Sample records for polymorphisms snps identified

  1. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    PubMed

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  2. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    PubMed Central

    Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

    2007-01-01

    Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

  3. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  4. Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

    PubMed Central

    Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

    2012-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

  5. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  6. Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

    PubMed

    Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

    2014-11-01

    This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

    Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

  8. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  9. [Association analysis between SNPs of the growth hormone receptor gene and growth traits in arctic fox].

    PubMed

    DU, Zhi-Heng; Liu, Zong-Yue; Bai, Xiu-Juan

    2010-06-01

    Using single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing, single nucleotide polymorphisms (SNPs) of growth hormone receptor (GHR) gene were detected in an arctic fox population. Correlation analysis between GHR polymorphisms and growth traits were carried out using the appropriate model. Four SNPs, G3A in the 5'UTR, C99T in the first exon, T59C and G65A in the fifth exon were identified on the arctic fox GHR gene. The G3A and C99T polymorphisms of GHR were associated with female fox body weight (Pamp;0.05) and the T59C and G65A polymorphisms of GHR were associated with male fox body weight (Pamp;0.05) and the skin length of the female fox (Pamp;0.01). Therefore, marker assistant selection on body weight and skin length of arctic foxes using these SNPs can be applied to get big and high quality arctic foxes.

  10. Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

    PubMed Central

    Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

    2018-01-01

    Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

  11. Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

    PubMed

    Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

    2018-01-01

    Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

  12. Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

    DTIC Science & Technology

    2013-10-01

    identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

  13. Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

    PubMed Central

    Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

    2007-01-01

    Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

  14. Two novel polymorphisms of bovine SIRT2 gene are associated with higher body weight in Nanyang cattle.

    PubMed

    Sun, Xiaomei; Li, Mingxun; Hao, Dan; Hua, Liushuai; Lan, Xianyong; Lei, Chuzhao; Hu, Shenrong; Qi, Xinglei; Chen, Hong

    2015-03-01

    Identification of polymorphisms associated with economic traits is important for successful marker-assisted selection in cattle breeding. The family of mammalian sirtuin regulates many biological functions, such as life span extension and energy metabolism. SIRT2, a most abundant sirtuin in adipocytes, acts as a crucial regulator of adipogenic differentiation and plays a key role in controlling adipose tissue function and mass. Here we investigated single nucleotide polymorphisms (SNPs) of bovine SIRT2 in 1226 cattle from five breeds and further evaluated the effects of identified SNPs on economically important traits of Nanyang cattle. Our results revealed four novel SNPs in bovine SIRT2, one was located in intronic region and the other three were synonymous mutations. Linkage disequilibrium and haplotype analyses based on the identified SNPs showed obvious difference between crossbred breed and the other four beef breeds. Association analyses demonstrated that SNPs g.17333C > T and g.17578A > G have a significantly effect on 18-months-old body weight of Nanyang population. Animals with combined genotype TTGG at the above two loci exhibited especially higher body weight. Our data for the first time demonstrated that polymorphisms in bovine SIRT2 are associated with economic traits of Nanyang cattle, which will be helpful for future cattle selection practices.

  15. SNPServer: a real-time SNP discovery tool.

    PubMed

    Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

    2005-07-01

    SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

  16. Polymorphisms of clip domain serine proteinase and serine proteinase homolog in the swimming crab Portunus trituberculatus and their association with Vibrio alginolyticus

    NASA Astrophysics Data System (ADS)

    Liu, Meng; Liu, Yuan; Hui, Min; Song, Chengwen; Cui, Zhaoxia

    2017-03-01

    Clip domain serine proteases (cSPs) and their homologs (SPHs) play an important role in various biological processes that are essential components of extracellular signaling cascades, especially in the innate immune responses of invertebrates. Here, polymorphisms of PtcSP and PtSPH from the swimming crab Portunus trituberculatus were investigated to explore their association with resistance/susceptibility to Vibrio alginolyticus. Polymorphic loci were identified using Clustal X, and characterized with SPSS 16.0 software, and then the significance of genotype and allele frequencies between resistant and susceptible stocks was determined by a χ 2 test. A total of 109 and 77 single nucleotide polymorphisms (SNPs) were identified in the genomic fragments of PtcSP and PtSPH, respectively. Notably, nearly half of PtSPH polymorphisms were found in the non-coding exon 1. Fourteen SNPs investigated were significantly associated with susceptibility/resistance to V. alginolyticus ( P <0.05). Among them, eight SNPs were observed in introns, and one synonymous, four non-synonymous SNPs and one ins-del were found in coding exons. In addition, five simple sequence repeats (SSRs) were detected in intron 3 of PtcSP. Although there was no statistically significant difference of allele frequencies, the SSRs showed different polymorphic alleles on the basis of the repeat number between resistant and susceptible stocks. After further validation, polymorphisms investigated here might be applied to select potential molecular markers of P. trituberculatus with resistance to V. alginolyticus.

  17. Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

    PubMed Central

    Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

    2010-01-01

    Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

  18. Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs.

    PubMed

    Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

    2010-12-23

    Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease.

  19. Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

    PubMed Central

    Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

    2014-01-01

    Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

  20. Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

    PubMed

    Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

    2015-11-05

    Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

  1. Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

    PubMed

    Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

    2008-01-01

    Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

  2. Effect of P450 Oxidoreductase Polymorphisms on the Metabolic Activities of Ten Cytochrome P450s Varied by Polymorphic CYP Genotypes in Human Liver Microsomes.

    PubMed

    Fang, Yan; Gao, Na; Tian, Xin; Zhou, Jun; Zhang, Hai-Feng; Gao, Jie; He, Xiao-Pei; Wen, Qiang; Jia, Lin-Jing; Jin, Han; Qiao, Hai-Ling

    2018-06-27

    Background/ Aims: Little is known about the effect of P450 oxidoreductase (POR) gene polymorphisms on the activities of CYPs with multiple genotypes. We genotyped 102 human livers for 18 known POR single nucleotide polymorphisms (SNPs) with allelic frequencies greater than 1% as well as for 27 known SNPs in 10 CYPs. CYP enzyme activities in microsomes prepared from these livers were determined by measuring probe substrate metabolism by high performance liquid chromatograph. We found that the effects of the 18 POR SNPs on 10 CYP activities were CYP genotype-dependent. The POR mutations were significantly associated with decreased overall Km for CYP2B6 and 2E1, and specific genotypes within CYP1A2, 2A6, 2B6, 2C8, 2D6 and 2E1 were identified as being affected by these POR SNPs. Notably, the effect of a specific POR mutation on the activity of a CYP genotype could not be predicted from other CYP genotypes of even the same CYP. When combining one POR SNP with other POR SNPs, a hitherto unrecognized effect of multiple-site POR gene polymorphisms (MSGP) on CYP activity was uncovered, which was not necessarily consistent with the effect of either single POR SNP. The effects of POR SNPs on CYP activities were not only CYP-dependent, but more importantly, CYP genotype-dependent. Moreover, the effect of a POR SNP alone and in combination with other POR SNPs (MSGP) was not always consistent, nor predictable. Understanding the impact of POR gene polymorphisms on drug metabolism necessitates knowing the complete SNP complement of POR and the genotype of the relevant CYPs. © 2018 The Author(s). Published by S. Karger AG, Basel.

  3. Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

    PubMed

    An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

    2015-06-01

    Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    PubMed

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  5. Screening for polymorphisms in the PXR gene in a Dutch population.

    PubMed

    Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

    2006-05-01

    Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

  6. Association of "ADAM10" and "CAMK2A" Polymorphisms with Conduct Disorder: Evidence from Family-Based Studies

    ERIC Educational Resources Information Center

    Jian, Xue-Qiu; Wang, Ke-Sheng; Wu, Tie-Jian; Hillhouse, Joel J.; Mullersman, Jerald E.

    2011-01-01

    Twin and family studies have shown that genetic factors play a role in the development of conduct disorder (CD). The purpose of this study was to identify genetic variants associated with CD using a family-based association study. We used 4,720 single nucleotide polymorphisms (SNPs) from the Illumina Panel and 11,120 SNPs from the Affymetrix 10K…

  7. Genetic polymorphisms associated with breast cancer in malaysian cohort.

    PubMed

    Chahil, Jagdish Kaur; Munretnam, Khamsigan; Samsudin, Nurulhafizah; Lye, Say Hean; Hashim, Nikman Adli Nor; Ramzi, Nurul Hanis; Velapasamy, Sharmila; Wee, Ler Lian; Alex, Livy

    2015-04-01

    Genome-wide association studies have discovered multiple single nucleotide polymorphisms (SNPs) associated with the risk of common diseases. The objective of this study was to demonstrate the replication of previously published SNPs that showed statistical significance for breast cancer in the Malaysian population. In this case-control study, 80 subjects for each group were recruited from various hospitals in Malaysia. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. A total of three SNPs were found to be associated with increased risk of breast cancer while six SNPs showed protective effect. All nine were statistically significant SNPs (p ≤ 0.01), five SNPs from previous studies were successfully replicated in our study. Significant modifiable (diet) and non-modifiable (family history of breast cancer in first degree relative) risk factors were also observed. We identified nine SNPs from this study to be either conferring susceptibility or protection to breast cancer which may serve as potential markers in risk prediction.

  8. Genetics of osteoporosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

    Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

  9. Development and Evaluation of a 9K SNP Array for Peach by Internationally Coordinated SNP Detection and Validation in Breeding Germplasm

    PubMed Central

    Scalabrin, Simone; Gilmore, Barbara; Lawley, Cynthia T.; Gasic, Ksenija; Micheletti, Diego; Rosyara, Umesh R.; Cattonaro, Federica; Vendramin, Elisa; Main, Dorrie; Aramini, Valeria; Blas, Andrea L.; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Troggio, Michela; Sosinski, Bryon; Aranzana, Maria José; Arús, Pere; Iezzoni, Amy; Morgante, Michele; Peace, Cameron

    2012-01-01

    Although a large number of single nucleotide polymorphism (SNP) markers covering the entire genome are needed to enable molecular breeding efforts such as genome wide association studies, fine mapping, genomic selection and marker-assisted selection in peach [Prunus persica (L.) Batsch] and related Prunus species, only a limited number of genetic markers, including simple sequence repeats (SSRs), have been available to date. To address this need, an international consortium (The International Peach SNP Consortium; IPSC) has pursued a coordinated effort to perform genome-scale SNP discovery in peach using next generation sequencing platforms to develop and characterize a high-throughput Illumina Infinium® SNP genotyping array platform. We performed whole genome re-sequencing of 56 peach breeding accessions using the Illumina and Roche/454 sequencing technologies. Polymorphism detection algorithms identified a total of 1,022,354 SNPs. Validation with the Illumina GoldenGate® assay was performed on a subset of the predicted SNPs, verifying ∼75% of genic (exonic and intronic) SNPs, whereas only about a third of intergenic SNPs were verified. Conservative filtering was applied to arrive at a set of 8,144 SNPs that were included on the IPSC peach SNP array v1, distributed over all eight peach chromosomes with an average spacing of 26.7 kb between SNPs. Use of this platform to screen a total of 709 accessions of peach in two separate evaluation panels identified a total of 6,869 (84.3%) polymorphic SNPs. The almost 7,000 SNPs verified as polymorphic through extensive empirical evaluation represent an excellent source of markers for future studies in genetic relatedness, genetic mapping, and dissecting the genetic architecture of complex agricultural traits. The IPSC peach SNP array v1 is commercially available and we expect that it will be used worldwide for genetic studies in peach and related stone fruit and nut species. PMID:22536421

  10. Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

    PubMed Central

    Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

    2017-01-01

    Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

  11. Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.

    PubMed

    Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A

    2012-01-01

    Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

  12. Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.

    PubMed

    Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

    2014-05-01

    This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P < 0.05) were identified by logistic regression analysis, but results were insignificant after Bonferroni correction. Six SNPs formed a linkage disequilibrium block, and three main haplotypes were found. Two of three haplotypes (AAAGAA and GGGAGG) distributed highly in the POF group, whereas the remaining haplotype (GGAAGG) distributed highly in the control group by logistic regression analysis (highest odds ratio, 2.515; 95% CI, 1.515-4.175; P = 0.00036). Our observations suggest that genetic variations in the FANCA gene may increase the risk for POF in Korean women.

  13. PXR polymorphisms and their impact on pharmacokinetics/pharmacodynamics of repaglinide in healthy Chinese volunteers.

    PubMed

    Du, Qing-qing; Wang, Zhi-jun; He, Lin; Jiang, Xue-hua; Wang, Ling

    2013-11-01

    CYP3A4 is the main isoform of cytochrome P450 oxidases involved in the metabolism of approximately 60 % drugs, and its expression level is highly variable in human subjects. CYP3A4 is regulated by many transcription factors, among which the pregnane X receptor/steroid and xenobiotic receptor (PXR/SXR, NR1I2) have been identified as the most critical. Genetic polymorphisms (such as SNPs) in PXR may affect the expression level of CYP3A4. Although numerous SNPs have been identified in PXR and have appeared to affect PXR function, their impact on the expression of CYP3A4 in human subjects has not been well studied. Thus, a clinical study in healthy Chinese subjects was conducted to investigate the impact of PXR polymorphisms on repaglinide (an endogenous marker for CYP3A4 activity) pharmacokinetics used alone or in combination with a PXR inducer, flucloxacillin. Two SNPs, -298A>G and 11193T>C, were identified as the tag SNPs to represent the overall genetic polymorphic profile of PXR. To evaluate the potential functional change of these two SNPs, 24 healthy subjects were recruited in a pharmacokinetics/pharmacodynamics study of repaglinide with or without flucloxacillin. The pharmacokinetic parameters including AUC and T1/2 were significantly different among the PXR genotype groups. The SNPs of -298G/G and 11193C/C were found to be associated with a lower PXR activity resulting in reduction of CYP3A4 activity in vivo. After administration of flucloxacillin, a significant drug-drug interaction was observed. The clearance of repagnilide was significantly increased by concomitant flucloxacillin in a genotype dependent manner. The subjects with SNPs of -298G/G and 11193C/C appeared to be less sensitive to flucloxacillin. Our study results demonstrated for the first time the impact of genetic polymorphisms of PXR on the PK and PD of repaglinide, and showed that subjects with genotype of -298G/G and 11193C/C in PXR has a decreased elimination rate of 3A4/2C8. Furthermore, flucloxacillin was able to induce 3A4/2C8 expression mediated by PXR in a genotype dependent manner.

  14. A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

    PubMed Central

    Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

    2007-01-01

    Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

  15. Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

    PubMed Central

    Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

    2016-01-01

    Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

  16. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  17. Genetic polymorphisms to predict gains in maximal O2 uptake and knee peak torque after a high intensity training program in humans.

    PubMed

    Yoo, Jinho; Kim, Bo-Hyung; Kim, Soo-Hwan; Kim, Yangseok; Yim, Sung-Vin

    2016-05-01

    The study aimed to identify single nucleotide polymorphisms (SNPs) that significantly influenced the level of improvement of two kinds of training responses, including maximal O2 uptake (V'O2max) and knee peak torque of healthy adults participating in the high intensity training (HIT) program. The study also aimed to use these SNPs to develop prediction models for individual training responses. 79 Healthy volunteers participated in the HIT program. A genome-wide association study, based on 2,391,739 SNPs, was performed to identify SNPs that were significantly associated with gains in V'O2max and knee peak torque, following 9 weeks of the HIT program. To predict two training responses, two independent SNPs sets were determined using linear regression and iterative binary logistic regression analysis. False discovery rate analysis and permutation tests were performed to avoid false-positive findings. To predict gains in V'O2max, 7 SNPs were identified. These SNPs accounted for 26.0 % of the variance in the increment of V'O2max, and discriminated the subjects into three subgroups, non-responders, medium responders, and high responders, with prediction accuracy of 86.1 %. For the knee peak torque, 6 SNPs were identified, and accounted for 27.5 % of the variance in the increment of knee peak torque. The prediction accuracy discriminating the subjects into the three subgroups was estimated as 77.2 %. Novel SNPs found in this study could explain, and predict inter-individual variability in gains of V'O2max, and knee peak torque. Furthermore, with these genetic markers, a methodology suggested in this study provides a sound approach for the personalized training program.

  18. Canonical single nucleotide polymorphisms (SNPs) for high-resolution subtyping of Shiga-toxin producing Escherichia coli (STEC) O157:H7

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...

  19. Marker-assisted backcross approach for important agronomic traits of sorghum

    USDA-ARS?s Scientific Manuscript database

    Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

  20. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  1. Dextromethorphan and debrisoquine metabolism and polymorphism of the gene for cytochrome P450 isozyme 2D50 in Thoroughbreds.

    PubMed

    Corado, Carley R; McKemie, Daniel S; Knych, Heather K

    2016-09-01

    OBJECTIVE To characterize polymorphisms of the gene for cytochrome P450 isozyme 2D50 (CYP2D50) and the disposition of 2 CYP2D50 probe drugs, dextromethorphan and debrisoquine, in horses. ANIMALS 23 healthy horses (22 Thoroughbreds and 1 Standardbred). PROCEDURES Single-nucleotide polymorphisms (SNPs) in CYP2D50 were identified. Disposition of dextromethorphan (2 mg/kg) and debrisoquine (0.2 mg/kg) were determined after oral (dextromethorphan) or nasogastric (debrisoquine) administration to the horses. Metabolic ratios of plasma dextromethorphan and total dextrorphan (dextrorphan plus dextrorphan-O-β-glucuronide) and 4-hydroxydebrisoquine concentrations were calculated on the basis of the area under the plasma concentration-versus-time curve extrapolated to infinity for the parent drug divided by that for the corresponding metabolite. Pharmacokinetic data were used to categorize horses into the phenotypic drug-metabolism categories poor, extensive, and ultrarapid. Disposition patterns were compared among categories, and relationships between SNPs and metabolism categories were explored. RESULTS Gene sequencing identified 51 SNPs, including 27 nonsynonymous SNPs. Debrisoquine was minimally detected after oral administration. Disposition of dextromethorphan varied markedly among horses. Metabolic ratios for dextromethorphan ranged from 0.03 to 0.46 (mean, 0.12). On the basis of these data, 1 horse was characterized as a poor metabolizer, 18 were characterized as extensive metabolizers, and 3 were characterized as ultrarapid metabolizers. CONCLUSIONS AND CLINICAL RELEVANCE Findings suggested that CYP2D50 is polymorphic and that the disposition of the probe drug varies markedly in horses. The polymorphisms may be related to rates of drug metabolism. Additional research involving more horses of various breeds is needed to fully explore the functional implication of polymorphisms in CYP2D50.

  2. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

    PubMed

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-09-06

    Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation <92%. Control children were defined as non-snoring children with AHI <2/h TST (NOSA). Endothelial function was assessed using a modified post-occlusive hyperemic test. The time to peak reperfusion (Tmax) was considered as the indicator for normal endothelial function (NEF; Tmax<45 sec), or ED (Tmax ≥ 45 sec). Genomic DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular morbidity. Thus, analysis of genotype-phenotype interactions in children with OSA may assist in the formulation of categorical risk estimates.

  3. Large-scale enrichment and discovery of gene-associated SNPs

    USDA-ARS?s Scientific Manuscript database

    With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

  4. Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.

    PubMed

    Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David

    2013-01-01

    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

  5. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    PubMed Central

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  6. Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

    PubMed

    Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

    2003-06-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

  7. Physiological Study on Association between Nicotinamide N-Methyltransferase Gene Polymorphisms and Hyperlipidemia

    PubMed Central

    Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong

    2016-01-01

    Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813

  8. Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs.

    PubMed

    Hui, Y T; Yang, Y Q; Liu, R Y; Zhang, Y Y; Xiang, C J; Liu, Z Z; Ding, Y H; Zhang, Y L; Wang, B R

    2013-09-13

    Apolipoprotein A5 (APOA5) and C3 (APOC3) genes are involved in the PPAR lipid metabolism pathway and thus associated with elevated triglyceride levels. However, whether APOA5 and APOC3 genetic polymorphisms affect intramuscular fat deposition and other meat quality traits remains unknown in pigs. One hundred and seventy-one Kele pigs were sampled to investigate genetic variants in the APOA5 and APOC3 genes and their association with seven pork quality traits. We identified 5 single nucleotide polymorphisms (SNPs) in the promoter region of the APOA5 gene and 17 SNPs in the APOC3 gene. Linkage disequilibrium analysis revealed 5 complete linkage disequilibria among these 22 SNPs. We found that 10 SNPs were significantly correlated with meat quality traits, including the mutation A5/-769 in the APOA5 gene, which was significantly associated with cooked weight percentage, and 9 SNPs in the APOC3 gene that were significantly associated with drip loss rate, meat color value of longissimus dorsi muscle and shear force. Therefore, these SNP markers will be useful for marker-assisted selection for improved pork quality.

  9. A survey of genome-wide single nucleotide polymorphisms through genome resequencing in the Périgord black truffle (Tuber melanosporum Vittad.).

    PubMed

    Payen, Thibaut; Murat, Claude; Gigant, Anaïs; Morin, Emmanuelle; De Mita, Stéphane; Martin, Francis

    2015-09-01

    The Périgord black truffle (Tuber melanosporum Vittad.), considered a gastronomic delicacy worldwide, is an ectomycorrhizal filamentous fungus that is ecologically important in Mediterranean French, Italian and Spanish woodlands. In this study, we developed a novel resource of single nucleotide polymorphisms (SNPs) for T. melanosporum using Illumina high-throughput resequencing. The genome from six T. melanosporum geographical accessions was sequenced to a depth of approximately 20×. These geographical accessions were selected from different populations within the northern and southern regions of the geographical species distribution. Approximately 80% of the reads for each of the six resequenced geographical accessions mapped against the reference T. melanosporum genome assembly, estimating the core genome size of this organism to be approximately 110 Mbp. A total of 442 326 SNPs corresponding to 3540 SNPs/Mbps were identified as being included in all seven genomes. The SNPs occurred more frequently in repeated sequences (85%), although 4501 SNPs were also identified in the coding regions of 2587 genes. Using the ratio of nonsynonymous mutations per nonsynonymous site (pN) to synonymous mutations per synonymous site (pS) and Tajima's D index scanning the whole genome, we were able to identify genomic regions and genes potentially subjected to positive or purifying selection. The SNPs identified represent a valuable resource for future population genetics and genomics studies. © 2015 John Wiley & Sons Ltd.

  10. Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

    PubMed

    El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

    2017-04-03

    Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

  11. Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

    PubMed

    Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

    2015-03-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

  12. Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

    PubMed Central

    Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

    2015-01-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

  13. Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

    PubMed Central

    Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

    2013-01-01

    Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

  14. SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

    PubMed Central

    Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

    2000-01-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

  15. SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

    PubMed

    Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

    2000-08-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P

  16. Effects of GWAS-Associated Genetic Variants on lncRNAs within IBD and T1D Candidate Loci

    PubMed Central

    Brorsson, Caroline A.; Pociot, Flemming

    2014-01-01

    Long non-coding RNAs are a new class of non-coding RNAs that are at the crosshairs in many human diseases such as cancers, cardiovascular disorders, inflammatory and autoimmune disease like Inflammatory Bowel Disease (IBD) and Type 1 Diabetes (T1D). Nearly 90% of the phenotype-associated single-nucleotide polymorphisms (SNPs) identified by genome-wide association studies (GWAS) lie outside of the protein coding regions, and map to the non-coding intervals. However, the relationship between phenotype-associated loci and the non-coding regions including the long non-coding RNAs (lncRNAs) is poorly understood. Here, we systemically identified all annotated IBD and T1D loci-associated lncRNAs, and mapped nominally significant GWAS/ImmunoChip SNPs for IBD and T1D within these lncRNAs. Additionally, we identified tissue-specific cis-eQTLs, and strong linkage disequilibrium (LD) signals associated with these SNPs. We explored sequence and structure based attributes of these lncRNAs, and also predicted the structural effects of mapped SNPs within them. We also identified lncRNAs in IBD and T1D that are under recent positive selection. Our analysis identified putative lncRNA secondary structure-disruptive SNPs within and in close proximity (+/−5 kb flanking regions) of IBD and T1D loci-associated candidate genes, suggesting that these RNA conformation-altering polymorphisms might be associated with diseased-phenotype. Disruption of lncRNA secondary structure due to presence of GWAS SNPs provides valuable information that could be potentially useful for future structure-function studies on lncRNAs. PMID:25144376

  17. Pharmacogenetic screening for polymorphisms in drug-metabolizing enzymes and drug transporters in a Dutch population.

    PubMed

    Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H

    2006-01-01

    A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.

  18. Genome-wide DNA polymorphisms in two cultivars of mei (Prunus mume sieb. et zucc.).

    PubMed

    Sun, Lidan; Zhang, Qixiang; Xu, Zongda; Yang, Weiru; Guo, Yu; Lu, Jiuxing; Pan, Huitang; Cheng, Tangren; Cai, Ming

    2013-10-06

    Mei (Prunus mume Sieb. et Zucc.) is a famous ornamental plant and fruit crop grown in East Asian countries. Limited genetic resources, especially molecular markers, have hindered the progress of mei breeding projects. Here, we performed low-depth whole-genome sequencing of Prunus mume 'Fenban' and Prunus mume 'Kouzi Yudie' to identify high-quality polymorphic markers between the two cultivars on a large scale. A total of 1464.1 Mb and 1422.1 Mb of 'Fenban' and 'Kouzi Yudie' sequencing data were uniquely mapped to the mei reference genome with about 6-fold coverage, respectively. We detected a large number of putative polymorphic markers from the 196.9 Mb of sequencing data shared by the two cultivars, which together contained 200,627 SNPs, 4,900 InDels, and 7,063 SSRs. Among these markers, 38,773 SNPs, 174 InDels, and 418 SSRs were distributed in the 22.4 Mb CDS region, and 63.0% of these marker-containing CDS sequences were assigned to GO terms. Subsequently, 670 selected SNPs were validated using an Agilent's SureSelect solution phase hybridization assay. A subset of 599 SNPs was used to assess the genetic similarity of a panel of mei germplasm samples and a plum (P. salicina) cultivar, producing a set of informative diversity data. We also analyzed the frequency and distribution of detected InDels and SSRs in mei genome and validated their usefulness as DNA markers. These markers were successfully amplified in the cultivars and in their segregating progeny. A large set of high-quality polymorphic SNPs, InDels, and SSRs were identified in parallel between 'Fenban' and 'Kouzi Yudie' using low-depth whole-genome sequencing. The study presents extensive data on these polymorphic markers, which can be useful for constructing high-resolution genetic maps, performing genome-wide association studies, and designing genomic selection strategies in mei.

  19. Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

    PubMed

    Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

    2018-05-03

    Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

  20. Association of μ-Calpain and Calpastatin Polymorphisms with Meat Tenderness in a Brahman–Angus Population

    PubMed Central

    Leal-Gutiérrez, Joel D.; Elzo, Mauricio A.; Johnson, Dwain D.; Scheffler, Tracy L.; Scheffler, Jason M.; Mateescu, Raluca G.

    2018-01-01

    Autogenous proteolytic enzymes of the calpain family are implicated in myofibrillar protein degradation. As a result, the μ-calpain gene and its specific inhibitor, calpastatin, have been repeatedly investigated for their association with meat quality traits in cattle; however, no functional mutation has been identified for these two genes. The objectives of this study were: (1) to assess breed composition effect on tenderness; (2) to perform a linkage disequilibrium (LD) analysis in μ-calpain and calpastatin genes as well as an association analyses with tenderness; and (3) to analyze putative functional SNPs inside the significant LD block for an effect on tenderness. Tenderness measurements and genotypes for 16 SNPs in μ-calpain gene and 28 SNPs in calpastatin gene from 673 steers were analyzed. A bioinformatic analysis identified “putative functional SNPs” inside the associated LD block – polymorphisms able to produce a physical and/or chemical change in the DNA, mRNA, or translated protein in silico. Breed composition had a significant (P < 0.0001) effect on tenderness where animals with more than 80% Angus composition had the most tender meat. One 11-kb LD-block and three LD-blocks of 37, 17, and 14 kb in length were identified in the μ-calpain and calpastatin genes, respectively. Out of these, the LD-block 3 in calpastatin, tagged by SNPs located at 7-98566391 and 7-98581038, had a significant effect on tenderness with the TG-CG diplotype being approximately 1 kg more tender than the toughest diplotype, TG-CG. A total of 768 SNPs in the LD-block 3 of calpastatin were included in the bioinformatic analysis, and 28 markers were selected as putative functional SNPs inside the LD-block 3 of calpastatin; however, none of them were polymorphic in this population. Out of 15 initial polymorphisms segregating inside the LD-block 3 of calpastatin in this population, markers ARSUSMARC116, Cast5, rs730723459, and rs210861835 were found to be significantly associated with tenderness. PMID:29520298

  1. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

    PubMed

    Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

    2001-11-23

    Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

  2. Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

    PubMed Central

    Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E.; Crowhurst, Ross N.; Chagné, David

    2013-01-01

    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality. PMID:24155917

  3. A brain-derived neurotrophic factor polymorphism Val66Met identifies fibromyalgia syndrome subgroup with higher body mass index and C-reactive protein.

    PubMed

    Xiao, Yangming; Russell, I Jon; Liu, Ya-Guang

    2012-08-01

    A common single nucleotide polymorphism (SNP) in the gene of brain-derived neurotrophic factor (BDNF) results from a substitution at position 66 from valine (Val) to methionine (Met) and may predispose to human neuropsychiatric disorders. We proposed to determine whether these BDNF gene SNPs were associated with fibromyalgia syndrome (FMS) and/or any of its typical phenotypes. Patients with FMS (N = 95) and healthy normal controls (HNC, N = 58) were studied. Serum high-sensitivity C-reactive protein (hsCRP) levels were measured using an enzyme-linked immunosorbent assay (ELISA). The BDNF SNPs were determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).The BDNF SNP distribution was 65 (68%) Val/Val, 28 (30%) Val/Met, and 2 (2%) Met/Met for FMS and 40 (69%), 17(29%), and 1 (2%) for HNC, respectively. The serum high-sensitivity C-reactive protein (hsCRP)and body mass index (BMI) in FMS were higher than in HNC. The FMS with BDNF Val66Val had significantly higher mean BMI (P = 0.0001) and hsCRP (P = 0.02) than did FMS carrying the Val66Met genotype. This pattern was not found in HNC. Phenotypic measures of subjective pain, pain threshold, depression, or insomnia did not relate to either of the BDNF SNPs in FMS. The relative distribution BDNF SNPs did not differ between FMS and HNC. The BDNF Val66Met polymorphism is not selective for FMS. The BDNF Val66Val SNP identifies a subgroup of FMS with elevated hsCRP and higher BMI. This is the first study to associate a BDNF polymorphism with a FMS subgroup phenotype.

  4. Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

    PubMed

    Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

    2006-06-01

    Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

  5. Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

    PubMed

    Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

    2018-01-30

    Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  6. Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

    PubMed

    Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

    2012-01-01

    PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

  7. Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

    2008-11-01

    Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

  8. Identification of Polymorphisms in the 3′-Untranslated Region of the Human Pregnane X Receptor (PXR) Gene Associated with Variability in Cytochrome P450 3A (CYP3A) Metabolism

    PubMed Central

    Oleson, Lauren; von Moltke, Lisa L.; Greenblatt, David J.; Court, Michael H.

    2013-01-01

    Single nucleotide polymorphisms (SNPs) in the 3′untranslated region (3′UTR) of human pregnane X receptor (PXR) gene may contribute to interindividual variability in cytochrome P450 3A (CYP3A) activity. Genotype-phenotype associations involving PXR-3′UTR SNPs were investigated through in vitro (53 human livers from primarily white donors) and in vivo (26 white or African-American volunteers) studies using midazolam 1′-hydroxylation and midazolam apparent oral clearance (CL/F), respectively, as CYP3A-specific probes. PXR-3′UTR resequencing identified 12 SNPs, including 2 that were novel. Although none of the SNPs evaluated were associated with altered midazolam 1′-hydroxylation in the liver bank, both rs3732359 homozygotes and rs3732360 carriers showed 80% higher (P<0.05) CL/F compared with homozygous reference individuals. These differences in CL/F were even larger (100 and 120% higher, respectively; P<0.01) when only African-American subjects (n=14) were considered. Five major haplotypes were identified containing the PXR-3′UTR SNPs and previously identified intron SNPs. Although CL/F differences were not statistically significant within the entire study cohort, African-American carriers of Haplotype-1 (which includes both rs3732359 and rs3732360 variants) exhibited 70% higher median CL/F compared with African-American non-carriers (P=0.036). Our results identify rs3732359 and rs3732360 as PXR-3′UTR SNPs associated with higher CYP3A activity in vivo in African-Americans. PMID:20082578

  9. Whole Genome Re-Sequencing and Characterization of Powdery Mildew Disease-Associated Allelic Variation in Melon.

    PubMed

    Natarajan, Sathishkumar; Kim, Hoy-Taek; Thamilarasan, Senthil Kumar; Veerappan, Karpagam; Park, Jong-In; Nou, Ill-Sup

    2016-01-01

    Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L.) and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs), 1.9 million InDels, and 182,398 putative structural variations (SVs). Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.

  10. Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

    PubMed

    Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

    2018-01-01

    Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In general, our results demonstrated the usefulness of Random Forest in combination to other reduction techniques to identify population informative SNPs.

  11. Mapping a Mutation in "Caenorhabditis elegans" Using a Polymerase Chain Reaction-Based Approach

    ERIC Educational Resources Information Center

    Myers, Edith M.

    2014-01-01

    Many single nucleotide polymorphisms (SNPs) have been identified within the "Caenorhabditis elegans" genome. SNPs present in the genomes of two isogenic "C. elegans" strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which…

  12. Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

  13. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

    PubMed Central

    Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

  14. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

    PubMed

    Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

  15. Genetic effects of PDGFRB and MARCH1 identified in GWAS revealing strong associations with semen production traits in Chinese Holstein bulls.

    PubMed

    Liu, Shuli; Yin, Hongwei; Li, Cong; Qin, Chunhua; Cai, Wentao; Cao, Mingyue; Zhang, Shengli

    2017-07-03

    Using a genome-wide association study strategy, our previous study discovered 19 significant single-nucleotide polymorphisms (SNPs) related to semen production traits in Chinese Holstein bulls. Among them, three SNPs were within or close to the phosphodiesterase 3A (PDE3A), membrane associated ring-CH-type finger 1 (MARCH1) and platelet derived growth factor receptor beta (PDGFRB) genes. The present study was designed with the objectives of identifying genetic polymorphism of the PDE3A, PDGFRB and MARCH1 genes and their effects on semen production traits in a Holstein bull population. A total of 20 SNPs were detected and genotyped in 730 bulls. Association analyses using de-regressed estimated breeding values of each semen production trait revealed four statistically significant SNPs for one or more semen production traits (P < 0.05): one SNP was located downstream of PDGFRB and three SNPs were located in the promoter of MARCH1. Interestingly, for MARCH1, haplotype-based analysis revealed significant associations of haplotypes with semen volume per ejaculate. Furthermore, high expression of the MARCH1 gene was observed in sperm cells. One SNP (rs43445726) in the regulatory region of MARCH1 had a significant effect on gene expression. Our study demonstrated the significant associations of genetic variants of the PDGFRB and MARCH1 genes with semen production traits. The identified SNPs may serve as genetic markers to optimize breeding programs for semen production traits in Holstein bull populations.

  16. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    PubMed

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

    2017-01-01

    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments.

  17. Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China

    PubMed Central

    WANG, ZHANG-YANG; HONG, WEI-LONG; ZHU, ZHE-HUI; CHEN, YUN-HAO; YE, WEN-LE; CHU, GUANG-YU; LI, JIA-LIN; CHEN, BI-CHENG; XIA, PENG

    2015-01-01

    BK polyomavirus (BKV) is important pathogen for kidney transplant recipients, as it is frequently re-activated, leading to nephropathy. The aim of this study was to investigate the phylogenetic reconstruction and polymorphism of the VP2 gene in BKV isolated from Chinese kidney transplant recipients. Phylogenetic analysis was carried out in the VP2 region from 135 BKV-positive samples and 28 reference strains retrieved from GenBank. The unweighted pair-group method with arithmetic mean (UPGMA) grouped all strains into subtypes, but failed to subdivide strains into subgroups. Among the plasma and urine samples, all plasma (23/23) and 82 urine samples (82/95) were identified to contain subtype I; the other 10 urine samples contained subtype IV. A 86-bp fragment was identified as a highly conserved sequence. Following alignment with 36 published BKV sequences from China, 92 sites of polymorphism were identified, including 11 single nucleotide polymorphisms (SNPs) prevalent in Chinese individuals and 30 SNPs that were specific to the two predominant subtypes I and IV. The limitations of the VP2 gene segment in subgrouping were confirmed by phylogenetic analysis. The conserved sequence and polymorphism identified in this study may be helpful in the detection and genotyping of BKV. PMID:26640547

  18. Genome-wide DNA polymorphisms in Kavuni, a traditional rice cultivar with nutritional and therapeutic properties.

    PubMed

    Rathinasabapathi, Pasupathi; Purushothaman, Natarajan; Parani, Madasamy

    2016-05-01

    Although rice genome was sequenced in the year 2002, efforts in resequencing the large number of available accessions, landraces, traditional cultivars, and improved varieties of this important food crop are limited. We have initiated resequencing of the traditional cultivars from India. Kavuni is an important traditional rice cultivar from South India that attracts premium price for its nutritional and therapeutic properties. Whole-genome sequencing of Kavuni using Illumina platform and SNPs analysis using Nipponbare reference genome identified 1 150 711 SNPs of which 377 381 SNPs were located in the genic regions. Non-synonymous SNPs (62 708) were distributed in 19 251 genes, and their number varied between 1 and 115 per gene. Large-effect DNA polymorphisms (7769) were present in 3475 genes. Pathway mapping of these polymorphisms revealed the involvement of genes related to carbohydrate metabolism, translation, protein-folding, and cell death. Analysis of the starch biosynthesis related genes revealed that the granule-bound starch synthase I gene had T/G SNPs at the first intron/exon junction and a two-nucleotide combination, which were reported to favour high amylose content and low glycemic index. The present study provided a valuable genomics resource to study the rice varieties with nutritional and medicinal properties.

  19. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    PubMed Central

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

  20. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    PubMed

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

  1. Catalog of MicroRNA Seed Polymorphisms in Vertebrates

    PubMed Central

    Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

    2012-01-01

    MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

  2. Common Polymorphisms in the PKP3-SIGIRR-TMEM16J Gene Region Are Associated With Susceptibility to Tuberculosis

    PubMed Central

    Randhawa, April K.; Chau, Tran T. H.; Bang, Nguyen D.; Yen, Nguyen T. B.; Farrar, Jeremy J.; Dunstan, Sarah J.; Hawn, Thomas R.

    2012-01-01

    (See the editorial commentary by Wilkinson, on pages 525–7.) Background. Tuberculosis has been associated with genetic variation in host immunity. We hypothesized that single-nucleotide polymorphisms (SNPs) in SIGIRR, a negative regulator of Toll-like receptor/IL-1R signaling, are associated with susceptibility to tuberculosis. Methods. We used a case-population study design in Vietnam with cases that had either tuberculous meningitis or pulmonary tuberculosis. We genotyped 6 SNPs in the SIGIRR gene region (including the adjacent genes PKP3 and TMEM16J) in a discovery cohort of 352 patients with tuberculosis and 382 controls. Significant associations were genotyped in a validation cohort (339 patients with tuberculosis, 376 controls). Results. Three SNPs (rs10902158, rs7105848, rs7111432) were associated with tuberculosis in discovery and validation cohorts. The polymorphisms were associated with both tuberculous meningitis and pulmonary tuberculosis and were strongest with a recessive genetic model (odds ratios, 1.5–1.6; P = .0006–.001). Coinheritance of these polymorphisms with previously identified risk alleles in Toll-like receptor 2 and TIRAP was associated with an additive risk of tuberculosis susceptibility. Conclusions. These results demonstrate a strong association of SNPs in the PKP3-SIGIRR-TMEM16J gene region and tuberculosis in discovery and validation cohorts. To our knowledge, these are the first associations of polymorphisms in this region with any disease. PMID:22223854

  3. Interaction between LRP5 and periostin gene polymorphisms on serum periostin levels and cortical bone microstructure.

    PubMed

    Pepe, J; Bonnet, N; Herrmann, F R; Biver, E; Rizzoli, R; Chevalley, T; Ferrari, S L

    2018-02-01

    We investigated the interaction between periostin SNPs and the SNPs of the genes assumed to modulate serum periostin levels and bone microstructure in a cohort of postmenopausal women. We identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels and on radial cortical porosity. The purpose of this study is to investigate the interaction between periostin gene polymorphisms (SNPs) and other genes potentially responsible for modulating serum periostin levels and bone microstructure in a cohort of postmenopausal women. In 648 postmenopausal women from the Geneva Retirees Cohort, we analyzed 6 periostin SNPs and another 149 SNPs in 14 genes, namely BMP2, CTNNB1, ESR1, ESR2, LRP5, LRP6, PTH, SPTBN1, SOST, TGFb1, TNFRSF11A, TNFSF11, TNFRSF11B and WNT16. Volumetric BMD and bone microstructure were measured by high-resolution peripheral quantitative computed tomography at the distal radius and tibia. Serum periostin levels were associated with radial cortical porosity, including after adjustment for age, BMI, and years since menopause (p = 0.036). Sixteen SNPs in the ESR1, LRP5, TNFRSF11A, SOST, SPTBN1, TNFRSF11B and TNFSF11 genes were associated with serum periostin levels (p range 0.03-0.001) whereas 26 SNPs in 9 genes were associated with cortical porosity at the radius and/or at the tibia. WNT 16 was the gene with the highest number of SNPs associated with both trabecular and cortical microstructure. The periostin SNP rs9547970 was also associated with cortical porosity (p = 0.04). In particular, SNPs in LRP5, ESR1 and near the TNFRSF11A gene were associated with both cortical porosity and serum periostin levels. Eventually, we identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels (interaction p = 0.01) and on radial cortical porosity (interaction p = 0.005). These results suggest that periostin expression is genetically modulated, particularly by polymorphisms in the Wnt pathway, and is thereby implicated in the genetic variation of bone microstructure.

  4. Discovery of 20,000 RAD-SNPs and development of a 52-SNP array for monitoring river otters

    Treesearch

    Jeffrey B. Stetz; Seth Smith; Michael A. Sawaya; Alan B. Ramsey; Stephen J. Amish; Michael K. Schwartz; Gordon Luikart

    2016-01-01

    Many North American river otter (Lontra canadensis) populations are threatened or recovering but are difficult to study because they occur at low densities, it is difficult to visually identify individuals, and they inhabit aquatic environments that accelerate degradation of biological samples. Single nucleotide polymorphisms (SNPs) can improve our ability to...

  5. Association of variants in innate immune genes with asthma and eczema

    PubMed Central

    Sharma, Sunita; Poon, Audrey; Himes, Blanca E.; Lasky-Su, Jessica; Sordillo, Joanne E.; Belanger, Kathleen; Milton, Donald K.; Bracken, Michael B.; Triche, Elizabeth W.; Leaderer, Brian P.; Gold, Diane R.; Litonjua, Augusto A.

    2012-01-01

    Background The innate immune pathway is important in the pathogenesis of asthma and eczema. However, only a few variants in these genes have been associated with either disease. We investigate the association between polymorphisms of genes in the innate immune pathway with childhood asthma and eczema. In addition, we compare individual associations with those discovered using a multivariate approach. Methods Using a novel method, case control based association testing (C2BAT), 569 single nucleotide polymorphisms (SNPs) in 44 innate immune genes were tested for association with asthma and eczema in children from the Boston Home Allergens and Asthma Study and the Connecticut Childhood Asthma Study. The screening algorithm was used to identify the top SNPs associated with asthma and eczema. We next investigated the interaction of innate immune variants with asthma and eczema risk using Bayesian networks. Results After correction for multiple comparisons, 7 SNPs in 6 genes (CARD25, TGFB1, LY96, ACAA1, DEFB1, and IFNG) were associated with asthma (adjusted p-value<0.02), while 5 SNPs in 3 different genes (CD80, STAT4, and IRAKI) were significantly associated with eczema (adjusted p-value < 0.02). None of these SNPs were associated with both asthma and eczema. Bayesian network analysis identified 4 SNPs that were predictive of asthma and 10 SNPs that predicted eczema. Of the genes identified using Bayesian networks, only CD80 was associated with eczema in the single-SNP study. Using novel methodology that allows for screening and replication in the same population, we have identified associations of innate immune genes with asthma and eczema. Bayesian network analysis suggests that additional SNPs influence disease susceptibility via SNP interactions. Conclusion Our findings suggest that innate immune genes contribute to the pathogenesis of asthma and eczema, and that these diseases likely have different genetic determinants. PMID:22192168

  6. Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

    PubMed

    Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

    2009-07-01

    Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

  7. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    PubMed

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

  8. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    PubMed

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  9. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    PubMed

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

    PubMed Central

    2012-01-01

    Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

  11. Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

    PubMed Central

    Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

    2009-01-01

    Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

  12. Development and evaluation of high-density Axiom® CicerSNP Array for high-resolution genetic mapping and breeding applications in chickpea.

    PubMed

    Roorkiwal, Manish; Jain, Ankit; Kale, Sandip M; Doddamani, Dadakhalandar; Chitikineni, Annapurna; Thudi, Mahendar; Varshney, Rajeev K

    2018-04-01

    To accelerate genomics research and molecular breeding applications in chickpea, a high-throughput SNP genotyping platform 'Axiom ® CicerSNP Array' has been designed, developed and validated. Screening of whole-genome resequencing data from 429 chickpea lines identified 4.9 million SNPs, from which a subset of 70 463 high-quality nonredundant SNPs was selected using different stringent filter criteria. This was further narrowed down to 61 174 SNPs based on p-convert score ≥0.3, of which 50 590 SNPs could be tiled on array. Among these tiled SNPs, a total of 11 245 SNPs (22.23%) were from the coding regions of 3673 different genes. The developed Axiom ® CicerSNP Array was used for genotyping two recombinant inbred line populations, namely ICCRIL03 (ICC 4958 × ICC 1882) and ICCRIL04 (ICC 283 × ICC 8261). Genotyping data reflected high success and polymorphic rate, with 15 140 (29.93%; ICCRIL03) and 20 018 (39.57%; ICCRIL04) polymorphic SNPs. High-density genetic maps comprising 13 679 SNPs spanning 1033.67 cM and 7769 SNPs spanning 1076.35 cM were developed for ICCRIL03 and ICCRIL04 populations, respectively. QTL analysis using multilocation, multiseason phenotyping data on these RILs identified 70 (ICCRIL03) and 120 (ICCRIL04) main-effect QTLs on genetic map. Higher precision and potential of this array is expected to advance chickpea genetics and breeding applications. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Non-synonymous single nucleotide polymorphisms in the watermelon eIF4E gene are closely associated with resistance to zucchini yellow mosaic virus.

    PubMed

    Ling, Kai-Shu; Harris, Karen R; Meyer, Jenelle D F; Levi, Amnon; Guner, Nihat; Wehner, Todd C; Bendahmane, Abdelhafid; Havey, Michael J

    2009-12-01

    Zucchini yellow mosaic virus (ZYMV) is one of the most economically important potyviruses infecting cucurbit crops worldwide. Using a candidate gene approach, we cloned and sequenced eIF4E and eIF(iso)4E gene segments in watermelon. Analysis of the nucleotide sequences between the ZYMV-resistant watermelon plant introduction PI 595203 (Citrullus lanatus var. lanatus) and the ZYMV-susceptible watermelon cultivar 'New Hampshire Midget' ('NHM') showed the presence of single nucleotide polymorphisms (SNPs). Initial analysis of the identified SNPs in association studies indicated that SNPs in the eIF4E, but not eIF(iso)4E, were closely associated to the phenotype of ZYMV-resistance in 70 F(2) and 114 BC(1R) progenies. Subsequently, we focused our efforts in obtaining the entire genomic sequence of watermelon eIF4E. Three SNPs were identified between PI 595203 and NHM. One of the SNPs (A241C) was in exon 1 and the other two SNPs (C309A and T554G) were in the first intron of the gene. SNP241 which resulted in an amino acid substitution (proline to threonine) was shown to be located in the critical cap recognition and binding area, similar to that of several plant species resistance to potyviruses. Analysis of a cleaved amplified polymorphism sequence (CAPS) marker derived from this SNP in F(2) and BC(1R) populations demonstrated a cosegregation between the CAPS-2 marker and their ZYMV resistance or susceptibility phenotype. When we investigated whether such SNP mutation in the eIF4E was also conserved in several other PIs of C. lanatus var. citroides, we identified a different SNP (A171G) resulting in another amino acid substitution (D71G) from four ZYMV-resistant C. lanatus var. citroides (PI 244018, PI 482261, PI 482299, and PI 482322). Additional CAPS markers were also identified. Availability of all these CAPS markers will enable marker-aided breeding of watermelon for ZYMV resistance.

  14. Genetic polymorphisms associated with increased risk of developing chronic myelogenous leukemia

    PubMed Central

    Bruzzoni-Giovanelli, Heriberto; González, Juan R.; Sigaux, François; Villoutreix, Bruno O.; Cayuela, Jean Michel; Guilhot, Joëlle; Preudhomme, Claude; Guilhot, François; Poyet, Jean-Luc; Rousselot, Philippe

    2015-01-01

    Little is known about inherited factors associated with the risk of developing chronic myelogenous leukemia (CML). We used a dedicated DNA chip containing 16 561 single nucleotide polymorphisms (SNPs) covering 1 916 candidate genes to analyze 437 CML patients and 1 144 healthy control individuals. Single SNP association analysis identified 139 SNPs that passed multiple comparisons (1% false discovery rate). The HDAC9, AVEN, SEMA3C, IKBKB, GSTA3, RIPK1 and FGF2 genes were each represented by three SNPs, the PSM family by four SNPs and the SLC15A1 gene by six. Haplotype analysis showed that certain combinations of rare alleles of these genes increased the risk of developing CML by more than two or three-fold. A classification tree model identified five SNPs belonging to the genes PSMB10, TNFRSF10D, PSMB2, PPARD and CYP26B1, which were associated with CML predisposition. A CML-risk-allele score was created using these five SNPs. This score was accurate for discriminating CML status (AUC: 0.61, 95%CI: 0.58–0.64). Interestingly, the score was associated with age at diagnosis and the average number of risk alleles was significantly higher in younger patients. The risk-allele score showed the same distribution in the general population (HapMap CEU samples) as in our control individuals and was associated with differential gene expression patterns of two genes (VAPA and TDRKH). In conclusion, we describe haplotypes and a genetic score that are significantly associated with a predisposition to develop CML. The SNPs identified will also serve to drive fundamental research on the putative role of these genes in CML development. PMID:26474455

  15. Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children.

    PubMed

    Butte, Nancy F; Voruganti, V Saroja; Cole, Shelley A; Haack, Karin; Comuzzie, Anthony G; Muzny, Donna M; Wheeler, David A; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A

    2011-09-22

    Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3'-UTR, and 2 in the 5'-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001-0.009) were associated with obesity-related traits (P = 0.01-0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77-0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children.

  16. Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

    PubMed

    Hamilton, Natasha A; Tammen, Imke; Raadsma, Herman W

    2013-01-01

    Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

  17. Multi-Species Comparative Analysis of the Equine ACE Gene Identifies a Highly Conserved Potential Transcription Factor Binding Site in Intron 16

    PubMed Central

    Hamilton, Natasha A.; Tammen, Imke; Raadsma, Herman W.

    2013-01-01

    Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism. PMID:23408978

  18. Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

    PubMed Central

    2014-01-01

    Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

  19. In Vitro vs In Silico Detected SNPs for the Development of a Genotyping Array: What Can We Learn from a Non-Model Species?

    PubMed Central

    Lepoittevin, Camille; Frigerio, Jean-Marc; Garnier-Géré, Pauline; Salin, Franck; Cervera, María-Teresa; Vornam, Barbara; Harvengt, Luc; Plomion, Christophe

    2010-01-01

    Background There is considerable interest in the high-throughput discovery and genotyping of single nucleotide polymorphisms (SNPs) to accelerate genetic mapping and enable association studies. This study provides an assessment of EST-derived and resequencing-derived SNP quality in maritime pine (Pinus pinaster Ait.), a conifer characterized by a huge genome size (∼23.8 Gb/C). Methodology/Principal Findings A 384-SNPs GoldenGate genotyping array was built from i/ 184 SNPs originally detected in a set of 40 re-sequenced candidate genes (in vitro SNPs), chosen on the basis of functionality scores, presence of neighboring polymorphisms, minor allele frequencies and linkage disequilibrium and ii/ 200 SNPs screened from ESTs (in silico SNPs) selected based on the number of ESTs used for SNP detection, the SNP minor allele frequency and the quality of SNP flanking sequences. The global success rate of the assay was 66.9%, and a conversion rate (considering only polymorphic SNPs) of 51% was achieved. In vitro SNPs showed significantly higher genotyping-success and conversion rates than in silico SNPs (+11.5% and +18.5%, respectively). The reproducibility was 100%, and the genotyping error rate very low (0.54%, dropping down to 0.06% when removing four SNPs showing elevated error rates). Conclusions/Significance This study demonstrates that ESTs provide a resource for SNP identification in non-model species, which do not require any additional bench work and little bio-informatics analysis. However, the time and cost benefits of in silico SNPs are counterbalanced by a lower conversion rate than in vitro SNPs. This drawback is acceptable for population-based experiments, but could be dramatic in experiments involving samples from narrow genetic backgrounds. In addition, we showed that both the visual inspection of genotyping clusters and the estimation of a per SNP error rate should help identify markers that are not suitable to the GoldenGate technology in species characterized by a large and complex genome. PMID:20543950

  20. Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

    PubMed

    Multani, Shaleen; Saranath, Dhananjaya

    2016-11-01

    Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

  1. Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

    PubMed Central

    Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

    2006-01-01

    Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

  2. Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

    PubMed

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

    2011-05-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

  3. Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

    PubMed Central

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

    2011-01-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

  4. Gene by Environment Investigation of Incident Lung Cancer Risk in African-Americans.

    PubMed

    David, Sean P; Wang, Ange; Kapphahn, Kristopher; Hedlin, Haley; Desai, Manisha; Henderson, Michael; Yang, Lingyao; Walsh, Kyle M; Schwartz, Ann G; Wiencke, John K; Spitz, Margaret R; Wenzlaff, Angela S; Wrensch, Margaret R; Eaton, Charles B; Furberg, Helena; Mark Brown, W; Goldstein, Benjamin A; Assimes, Themistocles; Tang, Hua; Kooperberg, Charles L; Quesenberry, Charles P; Tindle, Hilary; Patel, Manali I; Amos, Christopher I; Bergen, Andrew W; Swan, Gary E; Stefanick, Marcia L

    2016-02-01

    Genome-wide association studies have identified polymorphisms linked to both smoking exposure and risk of lung cancer. The degree to which lung cancer risk is driven by increased smoking, genetics, or gene-environment interactions is not well understood. We analyzed associations between 28 single nucleotide polymorphisms (SNPs) previously associated with smoking quantity and lung cancer in 7156 African-American females in the Women's Health Initiative (WHI), then analyzed main effects of top nominally significant SNPs and interactions between SNPs, cigarettes per day (CPD) and pack-years for lung cancer in an independent, multi-center case-control study of African-American females and males (1078 lung cancer cases and 822 controls). Nine nominally significant SNPs for CPD in WHI were associated with incident lung cancer (corrected p-values from 0.027 to 6.09 × 10(-5)). CPD was found to be a nominally significant effect modifier between SNP and lung cancer for six SNPs, including CHRNA5 rs2036527[A](betaSNP*CPD = - 0.017, p = 0.0061, corrected p = 0.054), which was associated with CPD in a previous genome-wide meta-analysis of African-Americans. These results suggest that chromosome 15q25.1 variants are robustly associated with CPD and lung cancer in African-Americans and that the allelic dose effect of these polymorphisms on lung cancer risk is most pronounced in lighter smokers.

  5. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    PubMed Central

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. Conclusions This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments. PMID:28234981

  6. [Identification of single nucleotide polymorphisms related to frailty].

    PubMed

    Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José

    2018-04-07

    The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. Inferring Alcoholism SNPs and Regulatory Chemical Compounds Based on Ensemble Bayesian Network.

    PubMed

    Chen, Huan; Sun, Jiatong; Jiang, Hong; Wang, Xianyue; Wu, Lingxiang; Wu, Wei; Wang, Qh

    2017-01-01

    The disturbance of consciousness is one of the most common symptoms of those have alcoholism and may cause disability and mortality. Previous studies indicated that several single nucleotide polymorphisms (SNP) increase the susceptibility of alcoholism. In this study, we utilized the Ensemble Bayesian Network (EBN) method to identify causal SNPs of alcoholism based on the verified GAW14 data. We built a Bayesian network combining random process and greedy search by using Genetic Analysis Workshop 14 (GAW14) dataset to establish EBN of SNPs. Then we predicted the association between SNPs and alcoholism by determining Bayes' prior probability. Thirteen out of eighteen SNPs directly connected with alcoholism were found concordance with potential risk regions of alcoholism in OMIM database. As many SNPs were found contributing to alteration on gene expression, known as expression quantitative trait loci (eQTLs), we further sought to identify chemical compounds acting as regulators of alcoholism genes captured by causal SNPs. Chloroprene and valproic acid were identified as the expression regulators for genes C11orf66 and SALL3 which were captured by alcoholism SNPs, respectively. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  9. SNP identification in FBXO32 gene and their associations with growth traits in cattle.

    PubMed

    Wang, Ailan; Zhang, Ya; Li, Mijie; Lan, Xianyong; Wang, Juqiang; Chen, Hong

    2013-02-15

    The F-box protein 32 (FBXO32), also known as Atrogin-1, is one of the four subunits of the ubiquitin protein ligase complex. FBXO32 has been previously shown to be involved in regulation of initiation and development of muscle mass. In the present study, we investigated the polymorphism of FBXO32 gene in 1313 cattle from seven bovine breeds using DNA sequencing, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR-based amplification-created restriction site (PCR-ACRS) methods. Four novel single nucleotide polymorphisms (SNPs) were identified within bovine FBXO32, and were deposited in the GenBank database. The association studies between these four SNPs and growth traits were performed in NanYang cattle. Notably, the SNPs ss411628932 and ss411628936 were shown to be significantly associated with body length of 24-month-old NanYang cattle. Based on the above four SNPs, 16 haplotypes were identified. The main haplotype was AATA, which occurred at a frequency of more than 40%. Additionally, phylogenetic analysis showed that geographical distance was essential to gene flow among seven cattle breeds. Indigenous bovine breeds displayed genetic difference in comparison to hybrid bovine breeds that have foreign origins. We herein describe for the first time a comprehensive study on the variability of bovine FBXO32 gene that is predictive of genetic potential for body length phenotype. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

    PubMed

    Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

    2015-08-01

    The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

  11. Replication of Caucasian Loci Associated with Osteoporosis-related Traits in East Asians

    PubMed Central

    Kim, Beom-Jun; Ahn, Seong Hee; Kim, Hyeon-Mok; Ikegawa, Shiro; Yang, Tie-Lin; Guo, Yan; Deng, Hong-Wen; Koh, Jung-Min

    2016-01-01

    Background Most reported genome-wide association studies (GWAS) seeking to identify the loci of osteoporosis-related traits have involved Caucasian populations. We aimed to identify the single nucleotide polymorphisms (SNPs) of osteoporosis-related traits among East Asian populations from the bone mineral density (BMD)-related loci of an earlier GWAS meta-analysis. Methods A total of 95 SNPs, identified at the discovery stage of the largest GWAS meta-analysis of BMD, were tested to determine associations with osteoporosis-related traits (BMD, osteoporosis, or fracture) in Korean subjects (n=1,269). The identified SNPs of osteoporosis-related traits in Korean subjects were included in the replication analysis using Chinese (n=2,327) and Japanese (n=768) cohorts. Results A total of 17 SNPs were associated with low BMD in Korean subjects. Specifically, 9, 6, 9, and 5 SNPs were associated with the presence of osteoporosis, non-vertebral fractures, vertebral fractures, and any fracture, respectively. Collectively, 35 of the 95 SNPs (36.8%) were associated with one or more osteoporosis-related trait in Korean subjects. Of the 35 SNPs, 19 SNPs (54.3%) were also associated with one or more osteoporosis-related traits in East Asian populations. Twelve SNPs were associated with low BMD in the Chinese and Japanese cohorts. Specifically, 3, 4, and 2 SNPs were associated with the presence of hip fractures, vertebral fractures, and any fracture, respectively. Conclusions Our results identified the common SNPs of osteoporosis-related traits in both Caucasian and East Asian populations. These SNPs should be further investigated to assess whether they are true genetic markers of osteoporosis. PMID:27965945

  12. Sequence Polymorphisms and Structural Variations among Four Grapevine (Vitis vinifera L.) Cultivars Representing Sardinian Agriculture

    PubMed Central

    Mercenaro, Luca; Nieddu, Giovanni; Porceddu, Andrea; Pezzotti, Mario; Camiolo, Salvatore

    2017-01-01

    The genetic diversity among grapevine (Vitis vinifera L.) cultivars that underlies differences in agronomic performance and wine quality reflects the accumulation of single nucleotide polymorphisms (SNPs) and small indels as well as larger genomic variations. A combination of high throughput sequencing and mapping against the grapevine reference genome allows the creation of comprehensive sequence variation maps. We used next generation sequencing and bioinformatics to generate an inventory of SNPs and small indels in four widely cultivated Sardinian grape cultivars (Bovale sardo, Cannonau, Carignano and Vermentino). More than 3,200,000 SNPs were identified with high statistical confidence. Some of the SNPs caused the appearance of premature stop codons and thus identified putative pseudogenes. The analysis of SNP distribution along chromosomes led to the identification of large genomic regions with uninterrupted series of homozygous SNPs. We used a digital comparative genomic hybridization approach to identify 6526 genomic regions with significant differences in copy number among the four cultivars compared to the reference sequence, including 81 regions shared between all four cultivars and 4953 specific to single cultivars (representing 1.2 and 75.9% of total copy number variation, respectively). Reads mapping at a distance that was not compatible with the insert size were used to identify a dataset of putative large deletions with cultivar Cannonau revealing the highest number. The analysis of genes mapping to these regions provided a list of candidates that may explain some of the phenotypic differences among the Bovale sardo, Cannonau, Carignano and Vermentino cultivars. PMID:28775732

  13. The linkage disequilibrium pattern of the angiotensin converting enzyme gene in Arabic and Asian population groups.

    PubMed

    Kharrat, Najla; Abdelmouleh, Wafa; Abdelhedi, Rania; Alfadhli, Suad; Rebai, Ahmed

    2012-01-01

    DNA variations within the Angiotensin-Converting Enzyme (ACE) gene have been shown to be involved in the aetiology of several common diseases and the therapeutic response. This study reports a comparison of haplotype analysis of five SNPs in the ACE gene region using a sample of 100 healthy subjects derived from five different populations (Tunisian, Iranian, Kuwaiti, Bahraini and Indian). Strong linkage disequilibrium was found among all SNPs studied for all populations. Two SNPs (rs1800764 and rs4340) were identified as key SNPs for all populations. These SNPs will be valuable for future effective association studies of the ACE gene polymorphisms in Arab and Asian populations.

  14. Type 2 diabetes (T2D) associated polymorphisms regulate expression of adjacent transcripts in transformed lymphocytes, adipose, and muscle from Caucasian and African-American subjects.

    PubMed

    Sharma, Neeraj K; Langberg, Kurt A; Mondal, Ashis K; Elbein, Steven C; Das, Swapan K

    2011-02-01

    Genome-wide association scans (GWAS) have identified novel single nucleotide polymorphisms (SNPs) that increase T2D susceptibility and indicated the role of nearby genes in T2D pathogenesis. We hypothesized that T2D-associated SNPs act as cis-regulators of nearby genes in human tissues and that expression of these transcripts may correlate with metabolic traits, including insulin sensitivity (S(I)). Association of SNPs with the expression of their nearest transcripts was tested in adipose and muscle from 168 healthy individuals who spanned a broad range of S(I) and body mass index (BMI) and in transformed lymphocytes (TLs). We tested correlations between the expression of these transcripts in adipose and muscle with metabolic traits. Utilizing allelic expression imbalance (AEI) analysis we examined the presence of other cis-regulators for those transcripts in TLs. SNP rs9472138 was significantly (P = 0.037) associated with the expression of VEGFA in TLs while rs6698181 was detected as a cis-regulator for the PKN2 in muscle (P = 0.00027) and adipose (P = 0.018). Significant association was also observed for rs17036101 (P = 0.001) with expression of SYN2 in adipose of Caucasians. Among 19 GWAS-implicated transcripts, expression of VEGFA in adipose was correlated with BMI (r = -0.305) and S(I) (r = 0.230). Although only a minority of the T2D-associated SNPs were validated as cis-eQTLs for nearby transcripts, AEI analysis indicated presence of other cis-regulatory polymorphisms in 54% of these transcripts. Our study suggests that a small subset of GWAS-identified SNPs may increase T2D susceptibility by modulating expression of nearby transcripts in adipose or muscle.

  15. Elastic-net regularization approaches for genome-wide association studies of rheumatoid arthritis.

    PubMed

    Cho, Seoae; Kim, Haseong; Oh, Sohee; Kim, Kyunga; Park, Taesung

    2009-12-15

    The current trend in genome-wide association studies is to identify regions where the true disease-causing genes may lie by evaluating thousands of single-nucleotide polymorphisms (SNPs) across the whole genome. However, many challenges exist in detecting disease-causing genes among the thousands of SNPs. Examples include multicollinearity and multiple testing issues, especially when a large number of correlated SNPs are simultaneously tested. Multicollinearity can often occur when predictor variables in a multiple regression model are highly correlated, and can cause imprecise estimation of association. In this study, we propose a simple stepwise procedure that identifies disease-causing SNPs simultaneously by employing elastic-net regularization, a variable selection method that allows one to address multicollinearity. At Step 1, the single-marker association analysis was conducted to screen SNPs. At Step 2, the multiple-marker association was scanned based on the elastic-net regularization. The proposed approach was applied to the rheumatoid arthritis (RA) case-control data set of Genetic Analysis Workshop 16. While the selected SNPs at the screening step are located mostly on chromosome 6, the elastic-net approach identified putative RA-related SNPs on other chromosomes in an increased proportion. For some of those putative RA-related SNPs, we identified the interactions with sex, a well known factor affecting RA susceptibility.

  16. What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

    PubMed Central

    McGue, Matt; Iacono, William G.

    2017-01-01

    In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

  17. No association between polymorphisms and haplotypes of COL1A1 and COL1A2 genes and osteoporotic fracture in postmenopausal Chinese women

    PubMed Central

    Hu, Wei-wei; He, Jin-wei; Zhang, Hao; Wang, Chun; Gu, Jie-mei; Yue, Hua; Ke, Yao-hua; Hu, Yun-qiu; Fu, Wen-zhen; Li, Miao; Liu, Yu-juan; Zhang, Zhen-lin

    2011-01-01

    Aim: To study whether genetic polymorphisms of COL1A1 and COL1A2 genes affected the onset of fracture in postmenopausal Chinese women. Methods: SNPs in COL1A1 and COL1A2 genes were identified via direct sequencing in 32 unrelated postmenopausal Chinese women. Ten SNPs were genotyped in 1252 postmenopausal Chinese women. The associations were examined using both single-SNP and haplotype tests using logistic regression. Results: Twenty four (4 novel) and 28 (7 novel) SNPs were identified in COL1A1 and COL1A2 gene, respectively. The distribution frequencies of 2 SNPs in COL1A1 (rs2075554 and rs2586494) and 3 SNPs in COL1A2 (rs42517, rs1801182, and rs42524) were significantly different from those documented for the European Caucasian population. No significant difference was observed between fracture and control groups with respect to allele frequency or genotype distribution in 9 selected SNPs and haplotype. No significant association was found between fragility fracture and each SNP or haplotype. The results remained the same after additional corrections for other risk factors such as weight, height, and bone mineral density. Conclusion: Our results show no association between common genetic variations of COL1A1 and COL1A2 genes and fracture, suggesting the complex genetic background of osteoporotic fractures. PMID:21602843

  18. Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

    PubMed

    Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

    2018-04-19

    ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

    PubMed

    Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2010-08-01

    This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

  20. Functional Genomics Analysis of Big Data Identifies Novel Peroxisome Proliferator-Activated Receptor γ Target Single Nucleotide Polymorphisms Showing Association With Cardiometabolic Outcomes.

    PubMed

    Richardson, Kris; Schnitzler, Gavin R; Lai, Chao-Qiang; Ordovas, Jose M

    2015-12-01

    Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator-activated receptor γ (PPARγ) that is involved in lipid and glucose metabolism and maintenance of metabolic homeostasis. We used a functional genomics methodology to interrogate human chromatin immunoprecipitation-sequencing, genome-wide association studies, and expression quantitative trait locus data to inform selection of candidate functional single nucleotide polymorphisms (SNPs) falling in PPARγ motifs. We derived 27 328 chromatin immunoprecipitation-sequencing peaks for PPARγ in human adipocytes through meta-analysis of 3 data sets. The PPARγ consensus motif showed greatest enrichment and mapped to 8637 peaks. We identified 146 SNPs in these motifs. This number was significantly less than would be expected by chance, and Inference of Natural Selection from Interspersed Genomically coHerent elemenTs analysis indicated that these motifs are under weak negative selection. A screen of these SNPs against genome-wide association studies for cardiometabolic traits revealed significant enrichment with 16 SNPs. A screen against the MuTHER expression quantitative trait locus data revealed 8 of these were significantly associated with altered gene expression in human adipose, more than would be expected by chance. Several SNPs fall close, or are linked by expression quantitative trait locus to lipid-metabolism loci including CYP26A1. We demonstrated the use of functional genomics to identify SNPs of potential function. Specifically, that SNPs within PPARγ motifs that bind PPARγ in adipocytes are significantly associated with cardiometabolic disease and with the regulation of transcription in adipose. This method may be used to uncover functional SNPs that do not reach significance thresholds in the agnostic approach of genome-wide association studies. © 2015 American Heart Association, Inc.

  1. Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans

    PubMed Central

    Kwon, Ki-Sung; Cho, Hye-Young

    2016-01-01

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2, rs887369 in CXorf21, rs9782955 in LYST, and rs3794060 in NADSYN1). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans. PMID:27729837

  2. Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans.

    PubMed

    Kwon, Ki-Sung; Cho, Hye-Young; Chung, Yeun-Jun

    2016-09-01

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2 , rs887369 in CXorf21 , rs9782955 in LYST , and rs3794060 in NADSYN1 ). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans.

  3. Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerns, Sarah L.; Ostrer, Harry; Stock, Richard

    2010-12-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score {<=}7) and 52 control subjects (post-treatment SHIM score {>=}16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, locatedmore » in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10{sup -8}, Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value < 10{sup -6}. Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened. This study demonstrates the feasibility of a genome-wide approach to investigate genetic predisposition to radiation injury.« less

  4. Development of genetic markers in abalone through construction of a SNP database.

    PubMed

    Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S

    2011-06-01

    In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis. © 2010 NFRDI, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

  5. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  6. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  7. Tissue expression and predicted protein structures of the bovine ANGPTL3 and association of novel SNPs with growth and meat quality traits.

    PubMed

    Chen, N B; Ma, Y; Yang, T; Lin, F; Fu, W W; Xu, Y J; Li, F; Li, J Y; Gao, S X

    2015-08-01

    Angiopoietin-like protein 3 (ANGPTL3) is a secreted protein that regulates lipid, glucose and energy metabolism. This study was conducted to better understand the effect of ANGPTL3 on important economic traits in cattle. First, transcript profiles for ANGPTL3 were measured in nine different Jiaxian cattle tissues. Second, polymorphisms were identified in the complete coding region and promoter region of the bovine ANGPTL3 gene in 707 cattle samples. Finally, an association study was carried out utilizing these single nucleotide polymorphisms (SNPs) to determine the effect of these SNPs on the growth and meat quality traits. Quantitative real-time PCR analysis showed that ANGPTL3 was mainly expressed in the liver. The promoter of the bovine ANGPTL3 contained several putative transcription factor binding sites (SF1, HNF-1, LXRα, NFκβ, HNF-3 and C/EBP). In total, four SNPs of the bovine ANGPTL3 gene were identified by direct sequencing. SNP1 (rs469906272: g.-38T>C) was identified in the promoter, SNP2 (rs451104723:g.104A>T) and SNP3 (rs482516226: g.509A>G) were identified in exon 1, and SNP4 (rs477165942: g.8661T>C) was identified in exon 6. Changes in predicted protein structures due to non-synonymous SNPs were analyzed. Haplotype frequencies and linkage disequilibrium were also investigated. Analysis of four SNPs in cattle from different native Chinese breeds (Nanyang (NY) and Jiaxian (JX)) and commercial breeds (Angus (AG), Hereford (HF), Limousin (LM), Luxi (LX), Simmental (ST) and Jinnan (JN)) revealed a significant association with growth traits (including: BW and hipbone width) and meat quality traits (including: Warner-Bratzler shear force and ribeye area). Therefore, implementation of these four mutations in selection indices in the beef industry may be beneficial in selecting individuals with superior growth and meat quality traits.

  8. Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

    PubMed

    Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

    2018-01-01

    Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

  9. Polymorphisms in inflammation pathway genes and endometrial cancer risk

    PubMed Central

    Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

    2013-01-01

    Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (P<0.05) indicated that the majority of associations could be linked to one of 24 distinct loci. One SNP from each of the 24 loci was then selected for follow-up genotyping. Of these, 21 SNPs were successfully designed and genotyped in stage 2, which consisted of ten additional studies including 6,604 endometrial cancer cases and 8,511 controls. Results Five of the 21 SNPs had significant allelic odds ratios and 95% confidence intervals as follows: FABP1, 0.92 (0.85-0.99); CXCL3, 1.16 (1.05-1.29); IL6, 1.08 (1.00-1.17); MSR1, 0.90 (0.82-0.98); and MMP9, 0.91 (0.87-0.97). Two of these polymorphisms were independently significant in the replication sample (rs352038 in CXCL3 and rs3918249 in MMP9). The association for the MMP9 polymorphism remained significant after Bonferroni correction and showed a significant association with endometrial cancer in both Asian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

  10. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  11. Genome-wide association study on growth traits in Colombian creole breeds and crossbreeds with Zebu cattle.

    PubMed

    Martínez, R; Gómez, Y; Rocha, J F M

    2014-08-25

    Whole genome selection represents an important tool for improving parameters related to the production of livestock. In order to build genomic selection indexes within a particular breed, it is important to identify polymorphisms that have the most significant association with a desired trait. A genome-wide marker association approach based on the Illumina BovineSNP50 BeadChip(TM) was used to identify genomic regions affecting birth weight (BW), weaning weight (WW), and daily weight gain (DWG) in purebred and crossbred creole cattle populations. We genotyped 654 individuals of Blanco Orejinegro (BON), Romosinuano (ROMO) and Cebú breeds and the crossbreeds BON x Cebú and ROMO x Cebú, and tested 5 genetic control models. In total, 85 single nucleotide polymorphisms (SNPs) were related (P < 0.05) to the 3 evaluated traits; BW was associated with the highest number of SNPs. For statistical false-positive correction, Bonferroni correction was used. From the results, we identified 7, 6, and 4 SNPs with strong associations with BW, WW, and DWG, respectively. Many of these SNPs were located on important coding regions of the bovine genome; their ontology and interactions are discussed herein. The results could contribute to the identification of genes involved in the physiology of beef cattle growth and the development of new strategies for breeding management via genomic selection to improve the productivity of creole cattle herds.

  12. Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

    2011-07-15

    Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern Chinese population.« less

  13. Modulation of C-reactive protein and plasma omega-6 fatty acid levels by phospholipase A2 gene polymorphisms following a 6-week supplementation with fish oil.

    PubMed

    Tremblay, B L; Rudkowska, I; Couture, P; Lemieux, S; Julien, P; Vohl, M C

    2015-12-01

    This clinical trial investigated the impact of a six-week supplementation with fish oil and single nucleotide polymorphisms (SNPs) in PLA2G4A and PLA2G6 genes on total omega-6 fatty acid (n-6 FA) levels in plasma phospholipids (PL) and plasma C-reactive protein (CRP) levels in 191 subjects. Interaction effects between SNPs and supplementation modulated total n-6 FAs and CRP levels in both men and women. Associations between SNPs and total n-6 FA levels and between SNPs and CRP levels were identified in men, independently of supplementation. Supplementation decreased total n-6 FAs without affecting plasma CRP levels. Changes in CRP levels correlated positively with changes in total n-6 FAs in men (r=0.25 p=0.01), but not in women. In conclusion, total n-6 FA levels in plasma PL and plasma CRP levels are modulated by SNPs within PLA2G4A and PLA2G6 genes alone or in combination with fish oil supplementation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    PubMed

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  15. Choline intake and genetic polymorphisms influence choline metabolite concentrations in human breast milk and plasma123

    PubMed Central

    Fischer, Leslie M; da Costa, Kerry Ann; Galanko, Joseph; Sha, Wei; Stephenson, Brigitte; Vick, Julie; Zeisel, Steven H

    2010-01-01

    Background: Choline is essential for infant nutrition, and breast milk is a rich source of this nutrient. Common single nucleotide polymorphisms (SNPs) change dietary requirements for choline intake. Objective: The aim of this study was to determine whether total choline intake and/or SNPs influence concentrations of choline and its metabolites in human breast milk and plasma. Design: We gave a total of 103 pregnant women supplemental choline or a placebo from 18 wk gestation to 45 d postpartum and genotyped the women for 370 common SNPs. At 45 d postpartum, we measured choline metabolite concentrations in breast milk and plasma and assessed the dietary intake of choline by using a 3-d food record. Results: On average, lactating women in our study ate two-thirds of the recommended intake for choline (Adequate Intake = 550 mg choline/d). Dietary choline intake (no supplement) correlated with breast-milk phosphatidylcholine and plasma choline concentrations. A supplement further increased breast-milk choline, betaine, and phosphocholine concentrations and increased plasma choline and betaine concentrations. We identified 5 SNPs in MTHFR that altered the slope of the intake–metabolite concentration relations, and we identified 2 SNPs in PEMT that shifted these curves upward. Individuals who shared sets of common SNPs were outliers in plots of intake–metabolite concentration curves; we suggest that these SNPs should be further investigated to determine how they alter choline metabolism. Conclusion: Total intake of choline and genotype can influence the concentrations of choline and its metabolites in the breast milk and blood of lactating women and thereby affect the amount of choline available to the developing infant. This study was registered at clinicaltrials.gov as NCT00678925. PMID:20534746

  16. A Multi-Trait, Meta-analysis for Detecting Pleiotropic Polymorphisms for Stature, Fatness and Reproduction in Beef Cattle

    PubMed Central

    Bolormaa, Sunduimijid; Pryce, Jennie E.; Reverter, Antonio; Zhang, Yuandan; Barendse, William; Kemper, Kathryn; Tier, Bruce; Savin, Keith; Hayes, Ben J.; Goddard, Michael E.

    2014-01-01

    Polymorphisms that affect complex traits or quantitative trait loci (QTL) often affect multiple traits. We describe two novel methods (1) for finding single nucleotide polymorphisms (SNPs) significantly associated with one or more traits using a multi-trait, meta-analysis, and (2) for distinguishing between a single pleiotropic QTL and multiple linked QTL. The meta-analysis uses the effect of each SNP on each of n traits, estimated in single trait genome wide association studies (GWAS). These effects are expressed as a vector of signed t-values (t) and the error covariance matrix of these t values is approximated by the correlation matrix of t-values among the traits calculated across the SNP (V). Consequently, t'V−1t is approximately distributed as a chi-squared with n degrees of freedom. An attractive feature of the meta-analysis is that it uses estimated effects of SNPs from single trait GWAS, so it can be applied to published data where individual records are not available. We demonstrate that the multi-trait method can be used to increase the power (numbers of SNPs validated in an independent population) of GWAS in a beef cattle data set including 10,191 animals genotyped for 729,068 SNPs with 32 traits recorded, including growth and reproduction traits. We can distinguish between a single pleiotropic QTL and multiple linked QTL because multiple SNPs tagging the same QTL show the same pattern of effects across traits. We confirm this finding by demonstrating that when one SNP is included in the statistical model the other SNPs have a non-significant effect. In the beef cattle data set, cluster analysis yielded four groups of QTL with similar patterns of effects across traits within a group. A linear index was used to validate SNPs having effects on multiple traits and to identify additional SNPs belonging to these four groups. PMID:24675618

  17. Identification and prioritization of NUAK1 and PPP1CC as positional candidate loci for skeletal muscle strength phenotypes

    PubMed Central

    Windelinckx, An; De Mars, Gunther; Huygens, Wim; Peeters, Maarten W.; Vincent, Barbara; Wijmenga, Cisca; Lambrechts, Diether; Aerssens, Jeroen; Vlietinck, Robert; Beunen, Gaston

    2011-01-01

    Muscle strength is an important determinant in elite sports performance as well as in the activities of daily living. Muscle metabolism also plays a role in the genesis, and therefore prevention, of common pathological conditions and chronic diseases. Even though heritability estimates between 31 and 78% suggest a significant genetic component in muscle strength, only a limited number of genes influencing muscle strength have been identified. This study aimed to identify and prioritize positional candidate genes within a skeletal muscle strength quantitative trait locus on chromosome 12q22-23 for follow-up. A two-staged gene-centered fine-mapping approach using 122 single nucleotide polymorphisms (SNPs) in stage 1 identified a familybased association (n = 500) between several tagSNPs located in the ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2 (ATP2A2; rs3026468), the NUAK family, SNF1-like kinase, 1 (NUAK1; rs10861553 and rs3741886), and the protein phosphatase 1, catalytic subunit, gamma isoform (PPP1CC; rs1050587 and rs7901769) genes and knee torque production (P values up to 0.00092). In stage 2, family-based association tests on additional putatively functional SNPs (e.g., exonic SNPs, SNPs in transcription factor binding sites or in conserved regions) in an enlarged sample (n = 536; 464 individuals overlap with stage 1) did not identify additional associations with muscle strength characteristics. Further in-depth analyses will be necessary to elucidate the exact role of ATP2A2, PPP1CC, and NUAK1 in muscle strength and to find out which functional polymorphisms are at the base of the interindividual strength differences. PMID:21750233

  18. DNA repair variants and breast cancer risk.

    PubMed

    Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

    2016-05-01

    A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P < 0.05), although no associations were observed for other DNA repair SNPs. Interactions of six SNPs in multiple DNA repair pathways with physical activity were evident prior to correction for FDR, following which there was support for only one of the interaction terms (P < 0.05). No consistent associations between variants in DNA repair genes and breast cancer risk or their modification by breast cancer risk factors were observed. © 2016 Wiley Periodicals, Inc.

  19. Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

    PubMed Central

    Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

    2012-01-01

    Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

  20. SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis.

    PubMed

    Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P

    2016-06-01

    Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel of molecular tools for whole genome analysis, allowing integrating and better exploring the common bean breeding practices.

  1. Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data.

    PubMed

    Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H

    2013-05-01

    Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach.

  2. A Mismatch EndoNuclease Array-Based Methodology (MENA) for Identifying Known SNPs or Novel Point Mutations.

    PubMed

    Comeron, Josep M; Reed, Jordan; Christie, Matthew; Jacobs, Julia S; Dierdorff, Jason; Eberl, Daniel F; Manak, J Robert

    2016-04-05

    Accurate and rapid identification or confirmation of single nucleotide polymorphisms (SNPs), point mutations and other human genomic variation facilitates understanding the genetic basis of disease. We have developed a new methodology (called MENA (Mismatch EndoNuclease Array)) pairing DNA mismatch endonuclease enzymology with tiling microarray hybridization in order to genotype both known point mutations (such as SNPs) as well as identify previously undiscovered point mutations and small indels. We show that our assay can rapidly genotype known SNPs in a human genomic DNA sample with 99% accuracy, in addition to identifying novel point mutations and small indels with a false discovery rate as low as 10%. Our technology provides a platform for a variety of applications, including: (1) genotyping known SNPs as well as confirming newly discovered SNPs from whole genome sequencing analyses; (2) identifying novel point mutations and indels in any genomic region from any organism for which genome sequence information is available; and (3) screening panels of genes associated with particular diseases and disorders in patient samples to identify causative mutations. As a proof of principle for using MENA to discover novel mutations, we report identification of a novel allele of the beethoven (btv) gene in Drosophila, which encodes a ciliary cytoplasmic dynein motor protein important for auditory mechanosensation.

  3. Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children

    PubMed Central

    Voruganti, V. Saroja; Cole, Shelley A.; Haack, Karin; Comuzzie, Anthony G.; Muzny, Donna M.; Wheeler, David A.; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A.

    2011-01-01

    Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5′ and 3′ flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3′-UTR, and 2 in the 5′-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001–0.009) were associated with obesity-related traits (P = 0.01–0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77–0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children. PMID:21771880

  4. Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

    PubMed Central

    Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

    2015-01-01

    Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

  5. Contributions of IKZF1, DDC, CDKN2A, CEBPE, and LMO1 Gene Polymorphisms to Acute Lymphoblastic Leukemia in a Yemeni Population.

    PubMed

    Al-Absi, Boshra; Razif, Muhammad F M; Noor, Suzita M; Saif-Ali, Riyadh; Aqlan, Mohammed; Salem, Sameer D; Ahmed, Radwan H; Muniandy, Sekaran

    2017-10-01

    Genome-wide and candidate gene association studies have previously revealed links between a predisposition to acute lymphoblastic leukemia (ALL) and genetic polymorphisms in the following genes: IKZF1 (7p12.2; ID: 10320), DDC (7p12.2; ID: 1644), CDKN2A (9p21.3; ID: 1029), CEBPE (14q11.2; ID: 1053), and LMO1 (11p15; ID: 4004). In this study, we aimed to conduct an investigation into the possible association between polymorphisms in these genes and ALL within a sample of Yemeni children of Arab-Asian descent. Seven single-nucleotide polymorphisms (SNPs) in IKZF1, three SNPs in DDC, two SNPs in CDKN2A, two SNPs in CEBPE, and three SNPs in LMO1 were genotyped in 289 Yemeni children (136 cases and 153 controls), using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Logistic regression analyses were used to estimate ALL risk, and the strength of association was expressed as odds ratios with 95% confidence intervals. We found that the IKZF1 SNP rs10235796 C allele (p = 0.002), the IKZF1 rs6964969 A>G polymorphism (p = 0.048, GG vs. AA), the CDKN2A rs3731246 G>C polymorphism (p = 0.047, GC+CC vs. GG), and the CDKN2A SNP rs3731246 C allele (p = 0.007) were significantly associated with ALL in Yemenis of Arab-Asian descent. In addition, a borderline association was found between IKZF1 rs4132601 T>G variant and ALL risk. No associations were found between the IKZF1 SNPs (rs11978267; rs7789635), DDC SNPs (rs3779084; rs880028; rs7809758), CDKN2A SNP (rs3731217), the CEBPE SNPs (rs2239633; rs12434881) and LMO1 SNPs (rs442264; rs3794012; rs4237770) with ALL in Yemeni children. The IKZF1 SNPs, rs10235796 and rs6964969, and the CDKN2A SNP rs3731246 (previously unreported) could serve as risk markers for ALL susceptibility in Yemeni children.

  6. Integrating common and rare genetic variation in diverse human populations.

    PubMed

    Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Dermitzakis, Emmanouil; Schaffner, Stephen F; Yu, Fuli; Peltonen, Leena; Dermitzakis, Emmanouil; Bonnen, Penelope E; Altshuler, David M; Gibbs, Richard A; de Bakker, Paul I W; Deloukas, Panos; Gabriel, Stacey B; Gwilliam, Rhian; Hunt, Sarah; Inouye, Michael; Jia, Xiaoming; Palotie, Aarno; Parkin, Melissa; Whittaker, Pamela; Yu, Fuli; Chang, Kyle; Hawes, Alicia; Lewis, Lora R; Ren, Yanru; Wheeler, David; Gibbs, Richard A; Muzny, Donna Marie; Barnes, Chris; Darvishi, Katayoon; Hurles, Matthew; Korn, Joshua M; Kristiansson, Kati; Lee, Charles; McCarrol, Steven A; Nemesh, James; Dermitzakis, Emmanouil; Keinan, Alon; Montgomery, Stephen B; Pollack, Samuela; Price, Alkes L; Soranzo, Nicole; Bonnen, Penelope E; Gibbs, Richard A; Gonzaga-Jauregui, Claudia; Keinan, Alon; Price, Alkes L; Yu, Fuli; Anttila, Verneri; Brodeur, Wendy; Daly, Mark J; Leslie, Stephen; McVean, Gil; Moutsianas, Loukas; Nguyen, Huy; Schaffner, Stephen F; Zhang, Qingrun; Ghori, Mohammed J R; McGinnis, Ralph; McLaren, William; Pollack, Samuela; Price, Alkes L; Schaffner, Stephen F; Takeuchi, Fumihiko; Grossman, Sharon R; Shlyakhter, Ilya; Hostetter, Elizabeth B; Sabeti, Pardis C; Adebamowo, Clement A; Foster, Morris W; Gordon, Deborah R; Licinio, Julio; Manca, Maria Cristina; Marshall, Patricia A; Matsuda, Ichiro; Ngare, Duncan; Wang, Vivian Ota; Reddy, Deepa; Rotimi, Charles N; Royal, Charmaine D; Sharp, Richard R; Zeng, Changqing; Brooks, Lisa D; McEwen, Jean E

    2010-09-02

    Despite great progress in identifying genetic variants that influence human disease, most inherited risk remains unexplained. A more complete understanding requires genome-wide studies that fully examine less common alleles in populations with a wide range of ancestry. To inform the design and interpretation of such studies, we genotyped 1.6 million common single nucleotide polymorphisms (SNPs) in 1,184 reference individuals from 11 global populations, and sequenced ten 100-kilobase regions in 692 of these individuals. This integrated data set of common and rare alleles, called 'HapMap 3', includes both SNPs and copy number polymorphisms (CNPs). We characterized population-specific differences among low-frequency variants, measured the improvement in imputation accuracy afforded by the larger reference panel, especially in imputing SNPs with a minor allele frequency of

  7. A 2-Stage Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms Associated With Development of Erectile Dysfunction Following Radiation Therapy for Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerns, Sarah L.; Departments of Pathology and Genetics, Albert Einstein College of Medicine, Bronx, New York; Stock, Richard

    2013-01-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with development of erectile dysfunction (ED) among prostate cancer patients treated with radiation therapy. Methods and Materials: A 2-stage genome-wide association study was performed. Patients were split randomly into a stage I discovery cohort (132 cases, 103 controls) and a stage II replication cohort (128 cases, 102 controls). The discovery cohort was genotyped using Affymetrix 6.0 genome-wide arrays. The 940 top ranking SNPs selected from the discovery cohort were genotyped in the replication cohort using Illumina iSelect custom SNP arrays. Results: Twelve SNPs identified in the discovery cohort and validated in themore » replication cohort were associated with development of ED following radiation therapy (Fisher combined P values 2.1 Multiplication-Sign 10{sup -5} to 6.2 Multiplication-Sign 10{sup -4}). Notably, these 12 SNPs lie in or near genes involved in erectile function or other normal cellular functions (adhesion and signaling) rather than DNA damage repair. In a multivariable model including nongenetic risk factors, the odds ratios for these SNPs ranged from 1.6 to 5.6 in the pooled cohort. There was a striking relationship between the cumulative number of SNP risk alleles an individual possessed and ED status (Sommers' D P value = 1.7 Multiplication-Sign 10{sup -29}). A 1-allele increase in cumulative SNP score increased the odds for developing ED by a factor of 2.2 (P value = 2.1 Multiplication-Sign 10{sup -19}). The cumulative SNP score model had a sensitivity of 84% and specificity of 75% for prediction of developing ED at the radiation therapy planning stage. Conclusions: This genome-wide association study identified a set of SNPs that are associated with development of ED following radiation therapy. These candidate genetic predictors warrant more definitive validation in an independent cohort.« less

  8. Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

    PubMed Central

    Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

    2009-01-01

    Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

  9. Allele frequency and genotype distribution of polymorphisms within disease-related genes is influenced by ethnic population sub-structuring in Sudan.

    PubMed

    Bereir, R E H; Mohamed, H S; Seielstad, M; El Hassani, A M; Khalil, E A G; Peacock, C S; Blackwell, J M; Ibrahim, M E

    2003-09-01

    Four single nucleotide polymorphisms (SNPs) and a variable number of tandem repeats (VNTR) polymorphism located within disease associated/causing genes were typed in four populations of different tribal and ethnic affiliation from the Sudan. The genotype and allele frequencies were compared with those of other groups from published and unpublished data of world populations. The combined Sudanese sample conformed with Hardy-Weinberg equilibrium (HWE) expectation. However, population sub-structuring according to ethnic/linguistic group indicated at least two SNPs in departure from HWE. Differences in allele frequencies and genotype distribution between groups was also noted in three of the four SNPs. The other loci were distributed homogeneously within the populations studied with genotype frequencies in agreement with HWE expectation. These results highlight the importance of inter-population stratification for polymorphic markers, as well as the potential influence of evolutionary history and ethnic variation of loci, in the general distribution of SNPs and other polymorphisms.

  10. Apolipoprotein gene involved in lipid metabolism

    DOEpatents

    Rubin, Edward [Berkeley, CA; Pennacchio, Len A [Sebastopol, CA

    2007-07-03

    Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.

  11. Pharmacogenetics of human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1): gene resequencing, sequence variation, and functional genomics.

    PubMed

    Xu, Zhen-Hua; Thomae, Bianca A; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M

    2003-06-01

    3'-Phosphoadenosine 5'-phosphosulfate (PAPS) is the high-energy "sulfate donor" for reactions catalyzed by sulfotransferase (SULT) enzymes. The strict requirement of SULTs for PAPS suggests that PAPS synthesis might influence the rate of sulfate conjugation. In humans, PAPS is synthesized from ATP and SO(4)(2-) by two isoforms of PAPS synthetase (PAPSS): PAPSS1 and PAPSS2. As a step toward pharmacogenetic studies, we have resequenced the entire coding sequence of the human PAPSS1 gene, including exon-intron splice junctions, using DNA samples from 60 Caucasian-American and 58 African-American subjects. Twenty-one genetic polymorphisms were observed-1 insertion-deletion event and 20 single nucleotide polymorphisms (SNPs)-including two non-synonymous coding SNPs (cSNPs) that altered the following amino acids: Arg333Cys and Glu531Gln. Twelve pairs of these polymorphisms were tightly linked, and a total of twelve unequivocal haplotypes could be identified-two that were common to both ethnic groups and ten that were ethnic-specific. The Arg333Cys polymorphism, with an allele frequency of 2.5%, was observed only in DNA samples from Caucasian subjects. The Glu531Gln polymorphism was rare, with only a single copy of that allele in a DNA sample from an African-American subject. Transient expression in mammalian cells showed that neither of the non-synonymous cSNPs resulted in a change in the basal level of enzyme activity measured under optimal assay conditions. However, the Glu531Gln polymorphism altered the substrate kinetic properties of the enzyme. The Gln531 variant allozyme had a 5-fold higher K(m) value for SO(4)(2-) than did the wild-type allozyme and displayed monophasic kinetics for Na(2)SO(4). The wild-type allozyme (Glu531) showed biphasic kinetics for that substrate. These observations represent a step toward testing the hypothesis that genetic variation in PAPS synthesis catalyzed by PAPSS1 might alter in vivo sulfate conjugation.

  12. Associations between incident ischemic stroke events and stroke and cardiovascular disease-related genome-wide association studies single nucleotide polymorphisms in the Population Architecture Using Genomics and Epidemiology study.

    PubMed

    Carty, Cara L; Buzková, Petra; Fornage, Myriam; Franceschini, Nora; Cole, Shelley; Heiss, Gerardo; Hindorff, Lucia A; Howard, Barbara V; Mann, Sue; Martin, Lisa W; Zhang, Ying; Matise, Tara C; Prentice, Ross; Reiner, Alexander P; Kooperberg, Charles

    2012-04-01

    Genome-wide association studies (GWAS) have identified loci associated with ischemic stroke (IS) and cardiovascular disease (CVD) in European-descent individuals, but their replication in different populations has been largely unexplored. Nine single nucleotide polymorphisms (SNPs) selected from GWAS and meta-analyses of stroke, and 86 SNPs previously associated with myocardial infarction and CVD risk factors, including blood lipids (high density lipoprotein [HDL], low density lipoprotein [LDL], and triglycerides), type 2 diabetes, and body mass index (BMI), were investigated for associations with incident IS in European Americans (EA) N=26 276, African-Americans (AA) N=8970, and American Indians (AI) N=3570 from the Population Architecture using Genomics and Epidemiology Study. Ancestry-specific fixed effects meta-analysis with inverse variance weighting was used to combine study-specific log hazard ratios from Cox proportional hazards models. Two of 9 stroke SNPs (rs783396 and rs1804689) were significantly associated with [corrected] IS hazard in AA; none were significant in this large EA cohort. Of 73 CVD risk factor SNPs tested in EA, 2 (HDL and triglycerides SNPs) were associated with IS. In AA, SNPs associated with LDL, HDL, and BMI were significantly associated with IS (3 of 86 SNPs tested). Out of 58 SNPs tested in AI, 1 LDL SNP was significantly associated with IS. Our analyses showing lack of replication in spite of reasonable power for many stroke SNPs and differing results by ancestry highlight the need to follow up on GWAS findings and conduct genetic association studies in diverse populations. We found modest IS associations with BMI and lipids SNPs, though these findings require confirmation.

  13. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  14. Variants in the SMARCA4 gene was associated with coronary heart disease susceptibility in Chinese han population.

    PubMed

    Guo, Xuan; Wang, Xiaohong; Wang, Yuan; Zhang, Chunyan; Quan, Xiaohui; Zhang, Yan; Jia, Shan; Ma, Weidong; Fan, Yajie; Wang, Congxia

    2017-01-31

    Coronary heart disease (CHD) is the leading cause of death worldwide. Many single-nucleotide polymorphisms (SNPs) are found to be related to the risk of CHD in previous studies. This study investigated whether polymorphism of SMARCA4 gene is associated with CHD. Genotypes at five CHD-relevant SNPs were determined in 456 cases of incident CHD and 685 unaffected controls in Chinese Han population using χ2 test, genetic model analysis and haplotype analysis. We also analysis the differences in continuous variables among the subjects with three genotypes of related genes were assessed using the ANOVA. We identified two susceptibility SNPs in the SMARCA4 gene that were potentially associated with a decreased risk of CHD. We identified rs11879293 (OR, 0.74; 95% CI, 0.59-0.96; P = 0.012) and rs12232780 (OR, 0.70; 95% CI, 0.54-0.90; P = 0.005) were associated with a decreased risk of CHD risk under the log-additive model adjusted by gender and age. Meanwhile, we also found that significant differences in glucose concentrations with rs11879293 and rs1122608 different genotype. Serum LDL-C and HDL-C were seen among the 3 genotypes of rs12232780 exist differences. This study provides an evidence for polymorphism of SMARCA4 gene associated with CHD development in Chinese Han population.

  15. Associations Between Polymorphisms in the Glucocorticoid-Receptor Gene and Cardiovascular Risk Factors in a Chinese Population

    PubMed Central

    Yan, Yu-Xiang; Dong, Jing; Wu, Li-Juan; Shao, Shuang; Zhang, Jie; Zhang, Ling; Wang, Wei; He, Yan; Liu, You-Qin

    2013-01-01

    Background Glucocorticoid is an important regulator of energy homeostasis. Glucocorticoid receptor (GR) gene polymorphisms that contribute to variability in glucocorticoid sensitivity have been identified. We explored the associations of single-nucleotide polymorphisms (SNPs) of the GR gene with traditional cardiovascular risk factors in the Chinese Han population. Methods We recruited 762 consecutive adults who underwent a regular physical examination at Beijing Xuanwu Hospital. Blood pressure, glucose, lipid levels (total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein [LDL] cholesterol and triglycerides), body mass index (BMI), and waist-to-hip ratio were measured. Fourteen tag SNPs and 5 functional SNPs were selected and genotyped using the high-throughput Sequenom genotyping platform. Differences between genotypes/alleles for each SNP were adjusted for sex and age and tested using a general linear model procedure. Various models of inheritance, including additive, dominant, and recessive, were tested. Results Among the 19 SNPs examined, 5 markers were associated with cardiovascular risk factors. The rs41423247 GG genotype and the rs7701443 AA genotype were associated with higher BMI and systolic blood pressure (P < 0.0004), and the rs17209251 GG genotype was associated with higher systolic blood pressure (P < 0.0004). Lower systolic blood pressure, total cholesterol, and LDL cholesterol were observed among rs10052957 A allele carriers (P < 0.0004), and lower plasma glucose and LDL-cholesterol concentrations were observed among rs2963156 TT carriers (P < 0.0004). Conclusions Polymorphism of the GR gene was associated with cardiovascular risk factors and may contribute to susceptibility to cardiovascular disease. PMID:23892712

  16. Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

    PubMed

    Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

    2017-05-01

    Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

  17. The α‐synuclein gene in multiple system atrophy

    PubMed Central

    Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

    2006-01-01

    Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

  18. Identification of new genetic polymorphisms that alter the dietary requirement for choline and vary in their distribution across ethnic and racial groups

    PubMed Central

    da Costa, Kerry-Ann; Corbin, Karen D.; Niculescu, Mihai D.; Galanko, Joseph A.; Zeisel, Steven H.

    2014-01-01

    Effect alleles (alleles with a polymorphism that is associated with the effect being measured) in a small number of single-nucleotide polymorphisms (SNPs) are known to influence the dietary requirement for choline. In this study, we examined a much larger number of SNPs (n=200) in 10 genes related to choline metabolism for associations with development of organ dysfunction (liver or muscle) when 79 humans were fed a low-choline diet. We confirmed that effect alleles in SNPs such as the C allele of PEMT rs12325817 increase the risk of developing organ dysfunction in women when they consume a diet low in choline, and we identified novel effect alleles, such as the C allele of CHKA SNP rs7928739, that alter dietary choline requirements. When fed a low-choline diet, some people presented with muscle damage rather than liver damage; several effect alleles in SLC44A1 (rs7873937, G allele; rs2771040, G; rs6479313, G; rs16924529, A; and rs3199966, C) and one in CHKB (rs1557502, A) were more common in these individuals. This suggests that pathways related to choline metabolism are more important for normal muscle function than previously thought. In European, Mexican, and Asian Americans, and in individuals of African descent, we examined the prevalence of the effect alleles in SNPs that alter choline requirement and found that they are differentially distributed among people of different ethnic and racial backgrounds. Overall, our study has identified novel genetic variants that modulate choline requirements and suggests that the dietary requirement for choline may be different across racial and ethnic groups.—Da Costa, K.-A., Corbin, K. D., Niculescu, M. D., Galanko, J. A., Zeisel, S. H. Identification of new genetic polymorphisms that alter the dietary requirement for choline and vary in their distribution across ethnic and racial groups. PMID:24671709

  19. Genome-wide association study in discordant sibships identifies multiple inherited susceptibility alleles linked to lung cancer.

    PubMed

    Galvan, Antonella; Falvella, Felicia S; Frullanti, Elisa; Spinola, Monica; Incarbone, Matteo; Nosotti, Mario; Santambrogio, Luigi; Conti, Barbara; Pastorino, Ugo; Gonzalez-Neira, Anna; Dragani, Tommaso A

    2010-03-01

    We analyzed a series of young (median age = 52 years) non-smoker lung cancer patients and their unaffected siblings as controls, using a genome-wide 620 901 single-nucleotide polymorphism (SNP) array analysis and a case-control DNA pooling approach. We identified 82 putatively associated SNPs that were retested by individual genotyping followed by use of the sib transmission disequilibrium test, pointing to 36 SNPs associated with lung cancer risk in the discordant sibs series. Analysis of these 36 SNPs in a polygenic model characterized by additive and interchangeable effects of rare alleles revealed a highly statistically significant dosage-dependent association between risk allele carrier status and proportion of cancer cases. Replication of the same 36 SNPs in a population-based series confirmed the association with lung cancer for three SNPs, suggesting that phenocopies and genetic heterogeneity can play a major role in the complex genetics of lung cancer risk in the general population.

  20. Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

    PubMed

    Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

    2014-12-01

    Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

  1. The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs.

    PubMed

    Udagawa, Chihiro; Tada, Naomi; Asano, Junzo; Ishioka, Katsumi; Ochiai, Kazuhiko; Bonkobara, Makoto; Tsuchida, Shuichi; Omi, Toshinori

    2014-12-11

    The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family that play an important role in energy homeostasis. Genetic association studies have shown that human UCP2 and UCP3 variants (SNPs and indels) are associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome. The aim of this study was to examine the genetic association between polymorphisms in UCP2 and UCP3 and metabolic data in dogs. We identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2, and 13 SNPs (11 intronic and 2 exonic) and one indel (exonic) in UCP3, by DNA sequence analysis of 11 different dog breeds (n=119). An association study between these UCP2 and UCP3 variants and the biochemical parameters of glucose, total cholesterol, lactate dehydrogenase and triglyceride in Labrador Retrievers (n=50) showed that none of the UCP2 polymorphisms were significantly associated with the levels of these parameters. However, four UCP3 SNPs (intron 1) were significantly associated with total cholesterol levels. In addition, the allele frequencies of two of the four SNPs associated with higher total cholesterol levels in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs, n=30), compared with the control breed (Shiba, n=30). The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. The examination of larger sample sizes and further analysis will lead to increased precision of these results.

  2. Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum).

    PubMed

    Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh

    2014-02-01

    Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.

  3. Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

    PubMed Central

    2011-01-01

    Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

  4. Altools: a user friendly NGS data analyser.

    PubMed

    Camiolo, Salvatore; Sablok, Gaurav; Porceddu, Andrea

    2016-02-17

    Genotyping by re-sequencing has become a standard approach to estimate single nucleotide polymorphism (SNP) diversity, haplotype structure and the biodiversity and has been defined as an efficient approach to address geographical population genomics of several model species. To access core SNPs and insertion/deletion polymorphisms (indels), and to infer the phyletic patterns of speciation, most such approaches map short reads to the reference genome. Variant calling is important to establish patterns of genome-wide association studies (GWAS) for quantitative trait loci (QTLs), and to determine the population and haplotype structure based on SNPs, thus allowing content-dependent trait and evolutionary analysis. Several tools have been developed to investigate such polymorphisms as well as more complex genomic rearrangements such as copy number variations, presence/absence variations and large deletions. The programs available for this purpose have different strengths (e.g. accuracy, sensitivity and specificity) and weaknesses (e.g. low computation speed, complex installation procedure and absence of a user-friendly interface). Here we introduce Altools, a software package that is easy to install and use, which allows the precise detection of polymorphisms and structural variations. Altools uses the BWA/SAMtools/VarScan pipeline to call SNPs and indels, and the dnaCopy algorithm to achieve genome segmentation according to local coverage differences in order to identify copy number variations. It also uses insert size information from the alignment of paired-end reads and detects potential large deletions. A double mapping approach (BWA/BLASTn) identifies precise breakpoints while ensuring rapid elaboration. Finally, Altools implements several processes that yield deeper insight into the genes affected by the detected polymorphisms. Altools was used to analyse both simulated and real next-generation sequencing (NGS) data and performed satisfactorily in terms of positive predictive values, sensitivity, the identification of large deletion breakpoints and copy number detection. Altools is fast, reliable and easy to use for the mining of NGS data. The software package also attempts to link identified polymorphisms and structural variants to their biological functions thus providing more valuable information than similar tools.

  5. Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

    PubMed

    Ojeda, Diego A; Forero, Diego A

    2014-10-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

  6. Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

    PubMed

    Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

    2016-07-01

    A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

  7. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

    PubMed

    Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

    2015-12-01

    Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three thermotolerance traits. In conclusion, specific genetic markers responsible for genetic variation in thermoregulation during heat stress in Holsteins were identified. These markers may prove useful in genetic selection for heat tolerance in Holstein cattle. © 2015 Blackwell Verlag GmbH.

  8. Identification of gene-specific polymorphisms and association with capsaicin pathway metabolites in Capsicum annuum L. collections.

    PubMed

    Reddy, Umesh K; Almeida, Aldo; Abburi, Venkata L; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil; Nimmakayala, Padma

    2014-01-01

    Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1.

  9. Identification of Gene-Specific Polymorphisms and Association with Capsaicin Pathway Metabolites in Capsicum annuum L. Collections

    PubMed Central

    Abburi, Venkata L.; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil

    2014-01-01

    Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1. PMID:24475113

  10. Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

    PubMed

    Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

    2017-04-04

    Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

  11. Breast cancer risk-associated SNPs modulate the affinity of chromatin for FOXA1 and alter gene expression

    PubMed Central

    Cowper-Sal·lari, Richard; Zhang, Xiaoyang; Wright, Jason B.; Bailey, Swneke D.; Cole, Michael D.; Eeckhoute, Jerome; Moore, Jason H.; Lupien, Mathieu

    2012-01-01

    Genome-wide association studies (GWASs) have identified thousands of single nucleotide polymorphisms (SNPs) associated with human traits and diseases. But because the vast majority of these SNPs are located in the noncoding regions of the genome their risk promoting mechanisms are elusive. Employing a new methodology combining cistromics, epigenomics and genotype imputation we annotate the noncoding regions of the genome in breast cancer cells and systematically identify the functional nature of SNPs associated with breast cancer risk. Our results demonstrate that breast cancer risk-associated SNPs are enriched in the cistromes of FOXA1 and ESR1 and the epigenome of H3K4me1 in a cancer and cell-type-specific manner. Furthermore, the majority of these risk-associated SNPs modulate the affinity of chromatin for FOXA1 at distal regulatory elements, which results in allele-specific gene expression, exemplified by the effect of the rs4784227 SNP on the TOX3 gene found within the 16q12.1 risk locus. PMID:23001124

  12. Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio)

    PubMed Central

    2014-01-01

    Background A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. Results The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. Conclusions The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species. PMID:24762296

  13. Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).

    PubMed

    Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen

    2014-04-24

    A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.

  14. Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data

    PubMed Central

    Hu, Bo; Xu, Yaomin

    2013-01-01

    Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach. PMID:23710259

  15. Differences in candidate gene association between European ancestry and African American asthmatic children.

    PubMed

    Baye, Tesfaye M; Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M; Martin, Lisa J; Lindsey, Mark; Patterson, Tia L; He, Hua; Ericksen, Mark B; Gupta, Jayanta; Tsoras, Anna M; Lindsley, Andrew; Rothenberg, Marc E; Wills-Karp, Marsha; Eissa, N Tony; Borish, Larry; Khurana Hershey, Gurjit K

    2011-02-28

    Candidate gene case-control studies have identified several single nucleotide polymorphisms (SNPs) that are associated with asthma susceptibility. Most of these studies have been restricted to evaluations of specific SNPs within a single gene and within populations from European ancestry. Recently, there is increasing interest in understanding racial differences in genetic risk associated with childhood asthma. Our aim was to compare association patterns of asthma candidate genes between children of European and African ancestry. Using a custom-designed Illumina SNP array, we genotyped 1,485 children within the Greater Cincinnati Pediatric Clinic Repository and Cincinnati Genomic Control Cohort for 259 SNPs in 28 genes and evaluated their associations with asthma. We identified 14 SNPs located in 6 genes that were significantly associated (p-values <0.05) with childhood asthma in African Americans. Among Caucasians, 13 SNPs in 5 genes were associated with childhood asthma. Two SNPs in IL4 were associated with asthma in both races (p-values <0.05). Gene-gene interaction studies identified race specific sets of genes that best discriminate between asthmatic children and non-allergic controls. We identified IL4 as having a role in asthma susceptibility in both African American and Caucasian children. However, while IL4 SNPs were associated with asthma in asthmatic children with European and African ancestry, the relative contributions of the most replicated asthma-associated SNPs varied by ancestry. These data provides valuable insights into the pathways that may predispose to asthma in individuals with European vs. African ancestry.

  16. Identification of Novel Single Nucleotide Polymorphisms Associated with Acute Respiratory Distress Syndrome by Exome-Seq

    PubMed Central

    Shortt, Katherine; Chaudhary, Suman; Grigoryev, Dmitry; Heruth, Daniel P.; Venkitachalam, Lakshmi; Zhang, Li Q.; Ye, Shui Q.

    2014-01-01

    Acute respiratory distress syndrome (ARDS) is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP) which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719) in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T) occurs within a histone mark (intron 6) of the Arylsulfatase D gene. rs9605146 (G>A) causes a deleterious coding change (proline to leucine) in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A) is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted. PMID:25372662

  17. Haplotype combination of the bovine CFL2 gene sequence variants and association with growth traits in Qinchuan cattle.

    PubMed

    Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

    2015-06-01

    The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.250.33). Association analysis indicated that SNP G 1500 A, T 1694 A and C 2213 G were significantly associated with growth traits in the QC population. The results of our study suggest that the CFL2 gene may be a strong candidate gene that affects growth traits in the QC cattle breeding program. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

    PubMed

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-07-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

  19. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

    PubMed Central

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-01-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  20. Exome-wide association study identifies genetic polymorphisms of C12orf51, MYL2, and ALDH2 associated with blood lead levels in the general Korean population.

    PubMed

    Eom, Sang-Yong; Hwang, Myung Sil; Lim, Ji-Ae; Choi, Byung-Sun; Kwon, Ho-Jang; Park, Jung-Duck; Kim, Yong-Dae; Kim, Heon

    2017-02-17

    Lead (Pb) is a ubiquitous toxic metal present in the environment that poses adverse health effects to humans. Inter-individual variation in blood Pb levels is affected by various factors, including genetic makeup. However, limited data are available on the association between genetic variation and blood Pb levels. The purpose of this study was to identify the genetic markers associated with blood Pb levels in the Korean population. The study subjects consisted of 1,483 healthy adults with no history of occupational exposure to Pb. We measured blood Pb levels and calculated probable daily intake of Pb according to dietary data collected using 24-hour recall. We conducted exome-wide association screening using Illumina Human Exome-12v1.2 platform (n = 500) and a replication analysis using VeraCode Goldengate assay (n = 1,483). Among the 244,770 single nucleotide polymorphisms (SNPs) tested, 12 SNPs associated with blood Pb level were identified, with suggestive significance level (P < 1 × 10 -4 ). In the Goldengate assay for replication, three SNPs (C12orf51 rs11066280, MYL2 rs12229654, and ALDH2 rs671) were associated with statistically suggestively significant differences in blood Pb levels. When stratified by drinking status, a potential association of C12orf51 rs11066280, MYL2 rs12229654, and ALDH2 rs671 with blood Pb level was observed only in drinkers. A marginally significant gene-environment interaction between ALDH2 rs671 and alcohol consumption was observed in relation to blood Pb levels. The effects of the three suggestively significant SNPs on blood Pb levels was dependent on daily calcium intake amounts. This exome-wide association study indicated that C12orf51 rs11066280, MYL2 rs12229654, and ALDH2 rs671 polymorphisms are linked to blood Pb levels in the Korean population. Our results suggest that these three SNPs are involved in the determination of Pb levels in Koreans via the regulation of alcohol drinking behavior, and that their negative effects may be compensated by appropriate calcium intake.

  1. Characteristics of Japanese inflammatory bowel disease susceptibility loci.

    PubMed

    Arimura, Yoshiaki; Isshiki, Hiroyuki; Onodera, Kei; Nagaishi, Kanna; Yamashita, Kentaro; Sonoda, Tomoko; Matsumoto, Takayuki; Takahashi, Atsushi; Takazoe, Masakazu; Yamazaki, Keiko; Kubo, Michiaki; Fujimiya, Mineko; Imai, Kohzoh; Shinomura, Yasuhisa

    2014-08-01

    There are substantial differences in inflammatory bowel disease (IBD) genetics depending on the populations examined. We aimed to identify Japanese population-specific or true culprit susceptibility genes through a meta-analysis of past genetic studies of Japanese IBD. For this study, we reviewed 2,703 articles. The review process consisted of three screening stages: we initially searched for relevant studies and then relevant single nucleotide polymorphisms (SNPs). Finally, we adjusted them for the meta-analysis. To maximize our chances of analysis, we introduced proxy SNPs during the first stage. To minimize publication bias, no significant SNPs and solitary SNPs without pairs were combined to be reconsidered during the third stage. Additionally, two SNPs were newly genotyped. Finally, we conducted a meta-analysis of 37 published studies in 50 SNPs located at 22 loci corresponding to the total number of 4,853 Crohn's disease (CD), 5,612 ulcerative colitis (UC) patients, and 14,239 healthy controls. We confirmed that the NKX2-3 polymorphism is associated with common susceptibility to IBD and that HLA-DRB1*0450 alleles increase susceptibility to CD but reduce risk for UC while HLA-DRB1*1502 alleles increase susceptibility to UC but reduce CD risk. Moreover, we found individual disease risk loci: TNFSF15 and TNFα to CD and HLA-B*5201, and NFKBIL1 to UC. The genetic risk of HLA was substantially high (odds ratios ranged from 1.54 to 2.69) while that of common susceptibility loci to IBD was modest (odds ratio ranged from 1.13 to 1.24). Results indicate that Japanese IBD susceptibility loci identified by the meta-analysis are closely associated with the HLA regions.

  2. Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.

    PubMed

    Tashjian, Robert Z; Granger, Erin K; Farnham, James M; Cannon-Albright, Lisa A; Teerlink, Craig C

    2016-02-01

    The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Limited data exist identifying specific genes associated with rotator cuff tearing. The purpose of this study was to identify specific genes or genetic variants associated with rotator cuff tearing by a genome-wide association study with an independent set of rotator cuff tear cases. A set of 311 full-thickness rotator cuff tear cases genotyped on the Illumina 5M single-nucleotide polymorphism (SNP) platform were used in a genome-wide association study with 2641 genetically matched white population controls available from the Illumina iControls database. Tests of association were performed with GEMMA software at 257,558 SNPs that compose the intersection of Illumina SNP platforms and that passed general quality control metrics. SNPs were considered significant if P < 1.94 × 10(-7) (Bonferroni correction: 0.05/257,558). Tests of association revealed 2 significantly associated SNPs, one occurring in SAP30BP (rs820218; P = 3.8E-9) on chromosome 17q25 and another occurring in SASH1 (rs12527089; P = 1.9E-7) on chromosome 6q24. This study represents the first attempt to identify genetic factors influencing rotator cuff tearing by a genome-wide association study using a dense/complete set of SNPs. Two SNPs were significantly associated with rotator cuff tearing, residing in SAP30BP on chromosome 17 and SASH1 on chromosome 6. Both genes are associated with the cellular process of apoptosis. Identification of potential genes or genetic variants associated with rotator cuff tearing may help in identifying individuals at risk for the development of rotator cuff tearing. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  3. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

    PubMed

    Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

    2018-01-01

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity within each population. We also provide functional annotation based on the genome position of each SNP and evaluate the use of clonal lines for filtering of PSVs and MSVs. These SNPs form a new database, which provides an important resource for a new high density SNP array design and for other SNP genotyping platforms used for genetic and genomics studies of this iconic salmonid fish species.

  4. Identification of SNPs associated with variola virus virulence.

    PubMed

    Hoen, Anne Gatewood; Gardner, Shea N; Moore, Jason H

    2013-02-14

    Decades after the eradication of smallpox, its etiological agent, variola virus (VARV), remains a threat as a potential bioweapon. Outbreaks of smallpox around the time of the global eradication effort exhibited variable case fatality rates (CFRs), likely attributable in part to complex viral genetic determinants of smallpox virulence. We aimed to identify genome-wide single nucleotide polymorphisms associated with CFR. We evaluated unadjusted and outbreak geographic location-adjusted models of single SNPs and two- and three-way interactions between SNPs. Using the data mining approach multifactor dimensionality reduction (MDR), we identified five VARV SNPs in models significantly associated with CFR. The top performing unadjusted model and adjusted models both revealed the same two-way gene-gene interaction. We discuss the biological plausibility of the influence of the SNPs identified these and other significant models on the strain-specific virulence of VARV. We have identified genetic loci in the VARV genome that are statistically associated with VARV virulence as measured by CFR. While our ability to infer a causal relationship between the specific SNPs identified in our analysis and VARV virulence is limited, our results suggest that smallpox severity is in part associated with VARV strain variation and that VARV virulence may be determined by multiple genetic loci. This study represents the first application of MDR to the identification of pathogen gene-gene interactions for predicting infectious disease outbreak severity.

  5. Identification of SNPs associated with variola virus virulence

    PubMed Central

    2013-01-01

    Background Decades after the eradication of smallpox, its etiological agent, variola virus (VARV), remains a threat as a potential bioweapon. Outbreaks of smallpox around the time of the global eradication effort exhibited variable case fatality rates (CFRs), likely attributable in part to complex viral genetic determinants of smallpox virulence. We aimed to identify genome-wide single nucleotide polymorphisms associated with CFR. We evaluated unadjusted and outbreak geographic location-adjusted models of single SNPs and two- and three-way interactions between SNPs. Findings Using the data mining approach multifactor dimensionality reduction (MDR), we identified five VARV SNPs in models significantly associated with CFR. The top performing unadjusted model and adjusted models both revealed the same two-way gene-gene interaction. We discuss the biological plausibility of the influence of the SNPs identified these and other significant models on the strain-specific virulence of VARV. Conclusions We have identified genetic loci in the VARV genome that are statistically associated with VARV virulence as measured by CFR. While our ability to infer a causal relationship between the specific SNPs identified in our analysis and VARV virulence is limited, our results suggest that smallpox severity is in part associated with VARV strain variation and that VARV virulence may be determined by multiple genetic loci. This study represents the first application of MDR to the identification of pathogen gene-gene interactions for predicting infectious disease outbreak severity. PMID:23410064

  6. The Association of CD81 Polymorphisms with Alloimmunization in Sickle Cell Disease

    PubMed Central

    Tatari-Calderone, Zohreh; Tamouza, Ryad; Le Bouder, Gama P.; Dewan, Ramita; Luban, Naomi L. C.; Lasserre, Jacqueline; Maury, Jacqueline; Lionnet, François; Krishnamoorthy, Rajagopal; Girot, Robert

    2013-01-01

    The goal of the present work was to identify the candidate genetic markers predictive of alloimmunization in sickle cell disease (SCD). Red blood cell (RBC) transfusion is indicated for acute treatment, prevention, and abrogation of some complications of SCD. A well-known consequence of multiple RBC transfusions is alloimmunization. Given that a subset of SCD patients develop multiple RBC allo-/autoantibodies, while others do not in a similar multiple transfusional setting, we investigated a possible genetic basis for alloimmunization. Biomarker(s) which predicts (predict) susceptibility to alloimmunization could identify patients at risk before the onset of a transfusion program and thus may have important implications for clinical management. In addition, such markers could shed light on the mechanism(s) underlying alloimmunization. We genotyped 27 single nucleotide polymorphisms (SNPs) in the CD81, CHRNA10, and ARHG genes in two groups of SCD patients. One group (35) of patients developed alloantibodies, and another (40) had no alloantibodies despite having received multiple transfusions. Two SNPs in the CD81 gene, that encodes molecule involved in the signal modulation of B lymphocytes, show a strong association with alloimmunization. If confirmed in prospective studies with larger cohorts, the two SNPs identified in this retrospective study could serve as predictive biomarkers for alloimmunization. PMID:23762099

  7. Predicting adaptive phenotypes from multilocus genotypes in Sitka spruce (Picea sitchensis) using random forest.

    PubMed

    Holliday, Jason A; Wang, Tongli; Aitken, Sally

    2012-09-01

    Climate is the primary driver of the distribution of tree species worldwide, and the potential for adaptive evolution will be an important factor determining the response of forests to anthropogenic climate change. Although association mapping has the potential to improve our understanding of the genomic underpinnings of climatically relevant traits, the utility of adaptive polymorphisms uncovered by such studies would be greatly enhanced by the development of integrated models that account for the phenotypic effects of multiple single-nucleotide polymorphisms (SNPs) and their interactions simultaneously. We previously reported the results of association mapping in the widespread conifer Sitka spruce (Picea sitchensis). In the current study we used the recursive partitioning algorithm 'Random Forest' to identify optimized combinations of SNPs to predict adaptive phenotypes. After adjusting for population structure, we were able to explain 37% and 30% of the phenotypic variation, respectively, in two locally adaptive traits--autumn budset timing and cold hardiness. For each trait, the leading five SNPs captured much of the phenotypic variation. To determine the role of epistasis in shaping these phenotypes, we also used a novel approach to quantify the strength and direction of pairwise interactions between SNPs and found such interactions to be common. Our results demonstrate the power of Random Forest to identify subsets of markers that are most important to climatic adaptation, and suggest that interactions among these loci may be widespread.

  8. Evidence that multiple genetic variants of MC4R play a functional role in the regulation of energy expenditure and appetite in Hispanic children1234

    PubMed Central

    Cole, Shelley A; Voruganti, V Saroja; Cai, Guowen; Haack, Karin; Kent, Jack W; Blangero, John; Comuzzie, Anthony G; McPherson, John D; Gibbs, Richard A

    2010-01-01

    Background: Melanocortin-4-receptor (MC4R) haploinsufficiency is the most common form of monogenic obesity; however, the frequency of MC4R variants and their functional effects in general populations remain uncertain. Objective: The aim was to identify and characterize the effects of MC4R variants in Hispanic children. Design: MC4R was resequenced in 376 parents, and the identified single nucleotide polymorphisms (SNPs) were genotyped in 613 parents and 1016 children from the Viva la Familia cohort. Measured genotype analysis (MGA) tested associations between SNPs and phenotypes. Bayesian quantitative trait nucleotide (BQTN) analysis was used to infer the most likely functional polymorphisms influencing obesity-related traits. Results: Seven rare SNPs in coding and 18 SNPs in flanking regions of MC4R were identified. MGA showed suggestive associations between MC4R variants and body size, adiposity, glucose, insulin, leptin, ghrelin, energy expenditure, physical activity, and food intake. BQTN analysis identified SNP 1704 in a predicted micro-RNA target sequence in the downstream flanking region of MC4R as a strong, probable functional variant influencing total, sedentary, and moderate activities with posterior probabilities of 1.0. SNP 2132 was identified as a variant with a high probability (1.0) of exerting a functional effect on total energy expenditure and sleeping metabolic rate. SNP rs34114122 was selected as having likely functional effects on the appetite hormone ghrelin, with a posterior probability of 0.81. Conclusion: This comprehensive investigation provides strong evidence that MC4R genetic variants are likely to play a functional role in the regulation of weight, not only through energy intake but through energy expenditure. PMID:19889825

  9. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

    PubMed

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

    2015-11-14

    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.

  10. SNPs of bovine HGF gene and their association with growth traits in Nanyang cattle.

    PubMed

    Cai, Hanfang; Lan, Xianyong; Li, Aimin; Zhou, Yang; Sun, Jiajie; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

    2013-10-01

    Hepatocyte growth factor (HGF) is one of the multifunctional cell factors that regulates cellular proliferation, motility and morphogenesis in mammalians. And its medical research has deep significance. In this paper, polymorphisms of HGF gene were investigated in 1433 health and irrelated Chinese cattle by PCR-RFLP and DNA sequencing approach. Ten novel Single nucleotide polymorphisms (SNPs) were identified, which included one missense mutation, g.72801G>A in the coding region, and the others in the intron. Association analysis between four of them, g.288T>C, g.72801G>A, g.77172G>T, and g.77408T>G, and growth traits in Nanyang, were performed. The results indicated that SNPs within bovine HGF gene were significantly associated with growth traits. Phylogenetic analysis showed that the genetic background of Caoyuan Red cattle was different from the others in the tested breeds. The findings will provide a background for application of bovine HGF gene in the selection program in Chinese cattle. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    PubMed

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. New genetic variants associated with prostate cancer

    Cancer.gov

    Researchers have newly identified 23 common genetic variants -- one-letter changes in DNA known as single-nucleotide polymorphisms or SNPs -- that are associated with risk of prostate cancer. These results come from an analysis of more than 10 million SNP

  13. Haplotype combination of the bovine INSIG1 gene sequence variants and association with growth traits in Nanyang cattle.

    PubMed

    Sun, Jiajie; Gao, Yuan; Liu, Dong; Ma, Wei; Xue, Jing; Zhang, Chunlei; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2012-06-01

    The insulin-induced gene 1 (INSIG1) gene encodes a protein that blocks proteolytic activation of sterol regulatory element binding proteins, which are transcription factors that activate genes that regulate cholesterol, fatty acid, and glucose metabolism. However, similar research for the bovine INSIG1 gene is lacking. Therefore, in this study, polymorphisms of the bovine INSIG1 gene were detected in 643 individuals from four cattle breeds by DNA pooling, forced PCR-RFLP, PCR-SSCP, and DNA sequencing methods. Only 10 novel SNPs were identified, which included four mutations in the coding region and the others in the introns. In Nanyang individuals, seven common haplotypes were identified based on four coding region SNPs. The haplotype GACT, with a frequency of 75.4%, was the most prevalent haplotypes and SNPs formed two linkage disequilibrium blocks with strong multi-allelic D' (D' = 1). Additionally, association analysis between mutations of the bovine INSIG1 gene and growth traits in Nanyang cattle at 6, 12, 18, and 24 months old was performed, and the results indicated that the polymorphisms were not significantly associated with body mass.

  14. Physiogenomic analysis of localized FMRI brain activity in schizophrenia.

    PubMed

    Windemuth, Andreas; Calhoun, Vince D; Pearlson, Godfrey D; Kocherla, Mohan; Jagannathan, Kanchana; Ruaño, Gualberto

    2008-06-01

    The search for genetic factors associated with disease is complicated by the complexity of the biological pathways linking genotype and phenotype. This analytical complexity is particularly concerning in diseases historically lacking reliable diagnostic biological markers, such as schizophrenia and other mental disorders. We investigate the use of functional magnetic resonance imaging (fMRI) as an intermediate phenotype (endophenotype) to identify physiogenomic associations to schizophrenia. We screened 99 subjects, 30 subjects diagnosed with schizophrenia, 13 unaffected relatives of schizophrenia patients, and 56 unrelated controls, for gene polymorphisms associated with fMRI activation patterns at two locations in temporal and frontal lobes previously implied in schizophrenia. A total of 22 single nucleotide polymorphisms (SNPs) in 15 genes from the dopamine and serotonin neurotransmission pathways were genotyped in all subjects. We identified three SNPs in genes that are significantly associated with fMRI activity. SNPs of the dopamine beta-hydroxylase (DBH) gene and of the dopamine receptor D4 (DRD4) were associated with activity in the temporal and frontal lobes, respectively. One SNP of serotonin-3A receptor (HTR3A) was associated with temporal lobe activity. The results of this study support the physiogenomic analysis of neuroimaging data to discover associations between genotype and disease-related phenotypes.

  15. Genome Wide Gene by Environment Interaction Analysis Identifies Common SNPs at 17q21.2 that Are Associated with Increased Body Mass Index Only among Asthmatics

    DTIC Science & Technology

    2015-12-16

    polymorphisms (SNPs), a candidate gene association study was conducted to identify shared genetic variants between childhood asthma and obesity , but no SNP was...10):969– 76. doi: 10.1093/aje/kwh303 PMID: 15522853. 33. von Kries R, Hermann M, Grunert VP, von Mutius E. Is obesity a risk factor for childhood ...88PA, Case # 2014-4685, 7 Oct 2014. PLoS One. 2015; 10(12):e0144114. 14. ABSTRACT Asthmatics have an increased risk of being overweight/ obese

  16. Association between polymorphisms in cancer-related genes and early onset of esophageal adenocarcinoma.

    PubMed

    Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C

    2011-04-01

    There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.

  17. Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle

    PubMed Central

    2013-01-01

    Background Identification of single nucleotide polymorphisms (SNPs) for specific genes involved in reproduction might improve reliability of genomic estimates for these low-heritability traits. Semen from 550 Holstein bulls of high (≥ 1.7; n = 288) or low (≤ −2; n = 262) daughter pregnancy rate (DPR) was genotyped for 434 candidate SNPs using the Sequenom MassARRAY® system. Three types of SNPs were evaluated: SNPs previously reported to be associated with reproductive traits or physically close to genetic markers for reproduction, SNPs in genes that are well known to be involved in reproductive processes, and SNPs in genes that are differentially expressed between physiological conditions in a variety of tissues associated in reproductive function. Eleven reproduction and production traits were analyzed. Results A total of 40 SNPs were associated (P < 0.05) with DPR. Among these were genes involved in the endocrine system, cell signaling, immune function and inhibition of apoptosis. A total of 10 genes were regulated by estradiol. In addition, 22 SNPs were associated with heifer conception rate, 33 with cow conception rate, 36 with productive life, 34 with net merit, 23 with milk yield, 19 with fat yield, 13 with fat percent, 19 with protein yield, 22 with protein percent, and 13 with somatic cell score. The allele substitution effect for SNPs associated with heifer conception rate, cow conception rate, productive life and net merit were in the same direction as for DPR. Allele substitution effects for several SNPs associated with production traits were in the opposite direction as DPR. Nonetheless, there were 29 SNPs associated with DPR that were not negatively associated with production traits. Conclusion SNPs in a total of 40 genes associated with DPR were identified as well as SNPs for other traits. It might be feasible to include these SNPs into genomic tests of reproduction and other traits. The genes associated with DPR are likely to be important for understanding the physiology of reproduction. Given the large number of SNPs associated with DPR that were not negatively associated with production traits, it should be possible to select for DPR without compromising production. PMID:23759029

  18. Neuropeptide Y gene-by-psychosocial stress interaction effect is associated with obesity in a Korean population.

    PubMed

    Kim, Hyun-Jin; Min, Kyoung-Bok; Min, Jin-Young

    2016-07-01

    Chronic psychosocial stress is a crucial risk factor in the development of many diseases including obesity. Neuropeptide Y (NPY), distributed throughout the peripheral and central nervous system, is believed to pay a role in the pathophysiologic relationship between stress and obesity. Although several animal studies have investigated the impact on obesity of interactions between NPY single nucleotide polymorphisms (SNPs) and stress, the same remains to be analyzed in humans. To identify NPY gene-by-stress interaction effects on human obesity, we analyzed the interaction between four NPY SNPs and stress with obesity-related traits, including visceral adipose tissue (VAT). A total of 1468 adult subjects were included for this analysis. In a SNP-only model without interaction with stress, no significant SNPs were found (pSNP>0.05). However, NPY SNPs-by-stress interaction effects were significantly linked to body mass index (BMI), waist circumference, and VAT (pint<0.05), even though a significant interaction effect for rs16135 on BMI was not identified. These significant interaction effects were also detected in interaction results for the binary traits of obesity. Among the obesity traits, mean changes of VAT by increased stress levels in homozygous risk allele carriers were the greatest (range of mean increases for four SNPs (min-max)=12.57cm(2)-29.86cm(2)). This study suggests that common polymorphisms for NPY were associated with human obesity by interacting with psychosocial stress, emphasizing the need for stress management in obesity prevention. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

    PubMed Central

    Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

    2013-01-01

    Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

  20. Polymorphisms in the SIRT5 gene and their association with body measurement and ultrasound traits in Qinchuan cattle.

    PubMed

    Gui, L S; Wang, H C; Liu, G Y; Zan, L S

    2015-04-22

    Silent information regulator 5 (SIRT5), a member of the Sirtuin family class III nicotinamide adenine dinucleotide-dependent protein deacetylases, plays an important role in metabolic and aging processes in mammals. We identified 4 single-nucleotide polymorphisms (SNPs) (G22010A, G22052A, G22119T, and G22245C) in the 3' untranslated regions of the SIRT5 gene from 572 Qinchuan cattle by sequencing and investigating their association with growth and ultrasound traits. The frequencies of genotype GG and allele G were high at the 4 SNPs. Based on the X(2) test, the genotypic distributions of the 4 SNPs were not in Hardy-Weinberg equilibrium (P < 0.05 or P < 0.01). Association analysis of individual SNPs and haplotype combinations revealed that the 4 loci were significantly associated with some body measurement and ultrasound traits in Qinchuan cattle, and the H1H5 (AG-GA-GG-GG) diplotypes had better performance than other combinations in Qinchuan cattle. Our results demonstrate that SIRT5 may be a candidate for marker-assisted selection in future breeding programs for Qinchuan cattle.

  1. Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

    PubMed Central

    Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

    2006-01-01

    Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

  2. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    PubMed

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  3. Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

    PubMed Central

    Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

    2015-01-01

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

  4. LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.

    PubMed

    Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej

    2005-06-15

    The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.

  5. Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

    PubMed Central

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

    2013-01-01

    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

  6. Identification of single nucleotide polymorphism in ginger using expressed sequence tags

    PubMed Central

    Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

    2009-01-01

    Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

  7. Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

    PubMed

    Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

    2010-10-01

    Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

  8. Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.

    PubMed

    Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho

    2015-05-01

    Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  9. Identification of leptin gene polymorphisms associated with carcass traits and fatty acid composition in Japanese Black cattle.

    PubMed

    Kawaguchi, Fuki; Okura, Kazuki; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

    2017-03-01

    Previous studies have indicated that some leptin gene polymorphisms were associated with economically important traits in cattle breeds. However, polymorphisms in the leptin gene have not been reported thus far in Japanese Black cattle. Here, we aimed to identify the leptin gene polymorphisms which are associated with carcass traits and fatty acid composition in Japanese Black cattle. We sequenced the full-length coding sequence of leptin gene for eight Japanese Black cattle. Sequence comparison revealed eight single nucleotide polymorphisms (SNPs). Three of these were predicted to cause amino acid substitutions: Y7F, R25C and A80V. Then, we genotyped these SNPs in two populations (JB1 with 560 animals and JB2 with 450 animals) and investigated the effects on the traits. Y7F in JB1 and A80V in JB2 were excluded from statistical analysis because the minor allele frequencies were low (< 0.1). Association analysis revealed that Y7F had a significant effect on the dressed carcass weight in JB2; R25C had a significant effect on C18:0 and C14:1 in JB1 and JB2, respectively; and A80V had a significant effect on C16:0, C16:1, C18:1, monounsaturated fatty acid and saturated fatty acid in JB1. The results suggested that these SNPs could be used as an effective marker for the improvement of Japanese Black cattle. © 2016 Japanese Society of Animal Science.

  10. GESPA: classifying nsSNPs to predict disease association.

    PubMed

    Khurana, Jay K; Reeder, Jay E; Shrimpton, Antony E; Thakar, Juilee

    2015-07-25

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common DNA sequence variation associated with disease in humans. Thus determining the clinical significance of each nsSNP is of great importance. Potential detrimental nsSNPs may be identified by genetic association studies or by functional analysis in the laboratory, both of which are expensive and time consuming. Existing computational methods lack accuracy and features to facilitate nsSNP classification for clinical use. We developed the GESPA (GEnomic Single nucleotide Polymorphism Analyzer) program to predict the pathogenicity and disease phenotype of nsSNPs. GESPA is a user-friendly software package for classifying disease association of nsSNPs. It allows flexibility in acceptable input formats and predicts the pathogenicity of a given nsSNP by assessing the conservation of amino acids in orthologs and paralogs and supplementing this information with data from medical literature. The development and testing of GESPA was performed using the humsavar, ClinVar and humvar datasets. Additionally, GESPA also predicts the disease phenotype associated with a nsSNP with high accuracy, a feature unavailable in existing software. GESPA's overall accuracy exceeds existing computational methods for predicting nsSNP pathogenicity. The usability of GESPA is enhanced by fast SQL-based cloud storage and retrieval of data. GESPA is a novel bioinformatics tool to determine the pathogenicity and phenotypes of nsSNPs. We anticipate that GESPA will become a useful clinical framework for predicting the disease association of nsSNPs. The program, executable jar file, source code, GPL 3.0 license, user guide, and test data with instructions are available at http://sourceforge.net/projects/gespa.

  11. SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Qijian; Jia, Gaofeng; Hyten, David L.

    A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

  12. SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

    DOE PAGES

    Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...

    2015-08-28

    A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

  13. Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

    PubMed Central

    Jannink, Jean-Luc

    2010-01-01

    Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

  14. SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean.

    PubMed

    Song, Qijian; Jia, Gaofeng; Hyten, David L; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G; Osorno, Juan M; Schmutz, Jeremy; Jackson, Scott A; McClean, Phillip E; Cregan, Perry B

    2015-08-28

    A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. Copyright © 2015 Song et al.

  15. Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

    PubMed

    Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

    2013-03-01

    Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

    PubMed

    Yates, Christopher M; Sternberg, Michael J E

    2013-11-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  17. RNA-Seq identifies SNP markers for growth traits in rainbow trout.

    PubMed

    Salem, Mohamed; Vallejo, Roger L; Leeds, Timothy D; Palti, Yniv; Liu, Sixin; Sabbagh, Annas; Rexroad, Caird E; Yao, Jianbo

    2012-01-01

    Fast growth is an important and highly desired trait, which affects the profitability of food animal production, with feed costs accounting for the largest proportion of production costs. Traditional phenotype-based selection is typically used to select for growth traits; however, genetic improvement is slow over generations. Single nucleotide polymorphisms (SNPs) explain 90% of the genetic differences between individuals; therefore, they are most suitable for genetic evaluation and strategies that employ molecular genetics for selective breeding. SNPs found within or near a coding sequence are of particular interest because they are more likely to alter the biological function of a protein. We aimed to use SNPs to identify markers and genes associated with genetic variation in growth. RNA-Seq whole-transcriptome analysis of pooled cDNA samples from a population of rainbow trout selected for improved growth versus unselected genetic cohorts (10 fish from 1 full-sib family each) identified SNP markers associated with growth-rate. The allelic imbalances (the ratio between the allele frequencies of the fast growing sample and that of the slow growing sample) were considered at scores >5.0 as an amplification and <0.2 as loss of heterozygosity. A subset of SNPs (n = 54) were validated and evaluated for association with growth traits in 778 individuals of a three-generation parent/offspring panel representing 40 families. Twenty-two SNP markers and one mitochondrial haplotype were significantly associated with growth traits. Polymorphism of 48 of the markers was confirmed in other commercially important aquaculture stocks. Many markers were clustered into genes of metabolic energy production pathways and are suitable candidates for genetic selection. The study demonstrates that RNA-Seq at low sequence coverage of divergent populations is a fast and effective means of identifying SNPs, with allelic imbalances between phenotypes. This technique is suitable for marker development in non-model species lacking complete and well-annotated genome reference sequences.

  18. Genome-wide association study identifies novel breast cancer susceptibility loci

    PubMed Central

    Easton, Douglas F.; Pooley, Karen A.; Dunning, Alison M.; Pharoah, Paul D. P.; Thompson, Deborah; Ballinger, Dennis G.; Struewing, Jeffery P.; Morrison, Jonathan; Field, Helen; Luben, Robert; Wareham, Nicholas; Ahmed, Shahana; Healey, Catherine S.; Bowman, Richard; Meyer, Kerstin B.; Haiman, Christopher A.; Kolonel, Laurence K.; Henderson, Brian E.; Marchand, Loic Le; Brennan, Paul; Sangrajrang, Suleeporn; Gaborieau, Valerie; Odefrey, Fabrice; Shen, Chen-Yang; Wu, Pei-Ei; Wang, Hui-Chun; Eccles, Diana; Evans, D. Gareth; Peto, Julian; Fletcher, Olivia; Johnson, Nichola; Seal, Sheila; Stratton, Michael R.; Rahman, Nazneen; Chenevix-Trench, Georgia; Bojesen, Stig E.; Nordestgaard, Børge G.; Axelsson, Christen K.; Garcia-Closas, Montserrat; Brinton, Louise; Chanock, Stephen; Lissowska, Jolanta; Peplonska, Beata; Nevanlinna, Heli; Fagerholm, Rainer; Eerola, Hannaleena; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J.; Hankinson, Susan E.; Cox, David G.; Hall, Per; Wedren, Sara; Liu, Jianjun; Low, Yen-Ling; Bogdanova, Natalia; Schürmann, Peter; Dörk, Thilo; Tollenaar, Rob A. E. M.; Jacobi, Catharina E.; Devilee, Peter; Klijn, Jan G. M.; Sigurdson, Alice J.; Doody, Michele M.; Alexander, Bruce H.; Zhang, Jinghui; Cox, Angela; Brock, Ian W.; MacPherson, Gordon; Reed, Malcolm W. R.; Couch, Fergus J.; Goode, Ellen L.; Olson, Janet E.; Meijers-Heijboer, Hanne; van den Ouweland, Ans; Uitterlinden, André; Rivadeneira, Fernando; Milne, Roger L.; Ribas, Gloria; Gonzalez-Neira, Anna; Benitez, Javier; Hopper, John L.; McCredie, Margaret; Southey, Melissa; Giles, Graham G.; Schroen, Chris; Justenhoven, Christina; Brauch, Hiltrud; Hamann, Ute; Ko, Yon-Dschun; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Mannermaa, Arto; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana; Day, Nicholas E.; Cox, David R.; Ponder, Bruce A. J.; Luccarini, Craig; Conroy, Don; Shah, Mitul; Munday, Hannah; Jordan, Clare; Perkins, Barbara; West, Judy; Redman, Karen; Driver, Kristy; Aghmesheh, Morteza; Amor, David; Andrews, Lesley; Antill, Yoland; Armes, Jane; Armitage, Shane; Arnold, Leanne; Balleine, Rosemary; Begley, Glenn; Beilby, John; Bennett, Ian; Bennett, Barbara; Berry, Geoffrey; Blackburn, Anneke; Brennan, Meagan; Brown, Melissa; Buckley, Michael; Burke, Jo; Butow, Phyllis; Byron, Keith; Callen, David; Campbell, Ian; Chenevix-Trench, Georgia; Clarke, Christine; Colley, Alison; Cotton, Dick; Cui, Jisheng; Culling, Bronwyn; Cummings, Margaret; Dawson, Sarah-Jane; Dixon, Joanne; Dobrovic, Alexander; Dudding, Tracy; Edkins, Ted; Eisenbruch, Maurice; Farshid, Gelareh; Fawcett, Susan; Field, Michael; Firgaira, Frank; Fleming, Jean; Forbes, John; Friedlander, Michael; Gaff, Clara; Gardner, Mac; Gattas, Mike; George, Peter; Giles, Graham; Gill, Grantley; Goldblatt, Jack; Greening, Sian; Grist, Scott; Haan, Eric; Harris, Marion; Hart, Stewart; Hayward, Nick; Hopper, John; Humphrey, Evelyn; Jenkins, Mark; Jones, Alison; Kefford, Rick; Kirk, Judy; Kollias, James; Kovalenko, Sergey; Lakhani, Sunil; Leary, Jennifer; Lim, Jacqueline; Lindeman, Geoff; Lipton, Lara; Lobb, Liz; Maclurcan, Mariette; Mann, Graham; Marsh, Deborah; McCredie, Margaret; McKay, Michael; McLachlan, Sue Anne; Meiser, Bettina; Milne, Roger; Mitchell, Gillian; Newman, Beth; O'Loughlin, Imelda; Osborne, Richard; Peters, Lester; Phillips, Kelly; Price, Melanie; Reeve, Jeanne; Reeve, Tony; Richards, Robert; Rinehart, Gina; Robinson, Bridget; Rudzki, Barney; Salisbury, Elizabeth; Sambrook, Joe; Saunders, Christobel; Scott, Clare; Scott, Elizabeth; Scott, Rodney; Seshadri, Ram; Shelling, Andrew; Southey, Melissa; Spurdle, Amanda; Suthers, Graeme; Taylor, Donna; Tennant, Christopher; Thorne, Heather; Townshend, Sharron; Tucker, Kathy; Tyler, Janet; Venter, Deon; Visvader, Jane; Walpole, Ian; Ward, Robin; Waring, Paul; Warner, Bev; Warren, Graham; Watson, Elizabeth; Williams, Rachael; Wilson, Judy; Winship, Ingrid; Young, Mary Ann; Bowtell, David; Green, Adele; deFazio, Anna; Chenevix-Trench, Georgia; Gertig, Dorota; Webb, Penny

    2009-01-01

    Breast cancer exhibits familial aggregation, consistent with variation in genetic susceptibility to the disease. Known susceptibility genes account for less than 25% of the familial risk of breast cancer, and the residual genetic variance is likely to be due to variants conferring more moderate risks. To identify further susceptibility alleles, we conducted a two-stage genome-wide association study in 4,398 breast cancer cases and 4,316 controls, followed by a third stage in which 30 single nucleotide polymorphisms (SNPs) were tested for confirmation in 21,860 cases and 22,578 controls from 22 studies. We used 227,876 SNPs that were estimated to correlate with 77% of known common SNPs in Europeans at r2>0.5. SNPs in five novel independent loci exhibited strong and consistent evidence of association with breast cancer (P<10−7). Four of these contain plausible causative genes (FGFR2, TNRC9, MAP3K1 and LSP1). At the second stage, 1,792 SNPs were significant at the P<0.05 level compared with an estimated 1,343 that would be expected by chance, indicating that many additional common susceptibility alleles may be identifiable by this approach. PMID:17529967

  19. Analysis of genetic polymorphisms in skeletal Class I crowding.

    PubMed

    Ting, Tung Yuen; Wong, Ricky Wing Kit; Rabie, A Bakr M

    2011-07-01

    Dental crowding is a problem for both adolescents and adults in modern society. The purpose of this research was to identify single nucleotide polymorphisms (SNPs) responsible for crowding in subjects with skeletal Class I relationships. The case subjects consisted of healthy Chinese people living in Hong Kong with skeletal Class I relationships and at least 5 mm of crowding in either arch. The control subjects met the same requirements but lacked crowding or spacing. SNP genotyping was performed on the MassARRAY platform. The chi-square test was used to compare genotype and allele type distributions between the case and the control groups. Logistic regression was used to calculate odds ratios with 95% confidence intervals, and the effects of age and sex for each SNP. Analyses of linkage disequilibrium and haplotype associations between SNPs were performed with software. Five SNPs were found to be significantly different in genotype or allele type distributions. SNP rs372024 was significantly associated with crowding (P = 0.004). Two SNPs, rs3764746 and rs3795170, on the EDA gene were found to be associated marginally. SNPs rs1005464 and rs15705 also exhibited marginal association with crowding. The effects of associated SNPs remained significant after adjustments for age and sex factors. This study suggests an association for the genes EDA and XEDAR in dental crowding in the Hong Kong Chinese population. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  20. Nonsynonymous Polymorphism in Guanine Monophosphate Synthetase Is a Risk Factor for Unfavorable Thiopurine Metabolite Ratios in Patients With Inflammatory Bowel Disease.

    PubMed

    Roberts, Rebecca L; Wallace, Mary C; Seinen, Margien L; van Bodegraven, Adriaan A; Krishnaprasad, Krupa; Jones, Gregory T; van Rij, Andre M; Baird, Angela; Lawrance, Ian C; Prosser, Ruth; Bampton, Peter; Grafton, Rachel; Simms, Lisa A; Studd, Corrie; Bell, Sally J; Kennedy, Martin A; Halliwell, Jacob; Gearry, Richard B; Radford-Smith, Graham; Andrews, Jane M; McHugh, Patrick C; Barclay, Murray L

    2018-05-16

    Up to 20% of patients with inflammatory bowel disease (IBD) who are refractory to thiopurine therapy preferentially produce 6-methylmercaptopurine (6-MMP) at the expense of 6-thioguanine nucleotides (6-TGN), resulting in a high 6-MMP:6-TGN ratio (>20). The objective of this study was to evaluate whether genetic variability in guanine monophosphate synthetase (GMPS) contributes to preferential 6-MMP metabolizer phenotype. Exome sequencing was performed in a cohort of IBD patients with 6-MMP:6-TGN ratios of >100 to identify nonsynonymous single nucleotide polymorphisms (nsSNPs). In vitro assays were performed to measure GMPS activity associated with these nsSNPs. Frequency of the nsSNPs was measured in a cohort of 530 Caucasian IBD patients. Two nsSNPs in GMPS (rs747629729, rs61750370) were detected in 11 patients with very high 6-MMP:6-TGN ratios. The 2 nsSNPs were predicted to be damaging by in silico analysis. In vitro assays demonstrated that both nsSNPs resulted in a significant reduction in GMPS activity (P < 0.05). The SNP rs61750370 was significantly associated with 6-MMP:6-TGN ratios ≥100 (odds ratio, 5.64; 95% confidence interval, 1.01-25.12; P < 0.031) in a subset of 264 Caucasian IBD patients. The GMPS SNP rs61750370 may be a reliable risk factor for extreme 6MMP preferential metabolism.

  1. Association study of interleukin-4 polymorphisms with paranoid schizophrenia in the Polish population: a critical approach.

    PubMed

    Fila-Danilow, Anna; Kucia, Krzysztof; Kowalczyk, Malgorzata; Owczarek, Aleksander; Paul-Samojedny, Monika; Borkowska, Paulina; Suchanek, Renata; Kowalski, Jan

    2012-08-01

    Changes in immunological system are one of dysfunctions reported in schizophrenia. Some changes based on an imbalance between Th1 and Th2 cytokines results from cytokine gene polymorphisms. Interleukin-4 gene (IL4) is considered as a potential candidate gene in schizophrenia association studies. The aim of the current case-control study was to examine whether the -590C/T (rs2243250) and -33C/T (rs2070874) IL4 gene polymorphisms are implicated in paranoid schizophrenia development in the Polish population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. The genotypes and alleles distribution of both SNPs were analysed in patients (n = 182) and healthy individuals constituted the control group (n = 215). The connection between some clinical variables and studied polymorphisms has been examined as well. We did not revealed any association between the -590C/T and -33C/T polymorphisms and paranoid schizophrenia. In case of both SNPs the homozygous TT genotype was extremely rare. Both polymorphic sites of the IL4 gene were found to be in a very strong linkage disequilibrium. However we did not identify a haplotype predispose to paranoid schizophrenia. No associations were also observed between the clinical course and psychopathology of the disease and the genotypes of both analysed polymorphisms. Our results suggest that the polymorphisms -590C/T in IL4 gene promoter region and -33C/T in the 5'-UTR are not involved in the pathophysiology of paranoid schizophrenia in Polish residents.

  2. MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures.

    PubMed

    Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra

    2014-01-01

    Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR.

  3. MDR-1 and MRP2 Gene Polymorphisms in Mexican Epileptic Pediatric Patients with Complex Partial Seizures

    PubMed Central

    Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra

    2014-01-01

    Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR. PMID:25346718

  4. Diet-gene interactions underlie metabolic individuality and influence brain development: Implications for clinical practice

    PubMed Central

    Zeisel, Steven H.

    2014-01-01

    One of the underlying mechanisms for metabolic individuality is genetic variation. Single nucleotide polymorphisms (SNPs) in genes of metabolic pathways can create metabolic inefficiencies that alter the dietary requirement for, and responses to nutrients. These SNPS can be detected using genetic profiling and the metabolic inefficiencies they cause can be detected using metabolomic profiling. Studies on the human dietary requirement for choline illustrate how useful these new approaches can be, as this requirement is influenced by SNPs in genes of choline and folate metabolism. In adults, these SNPs determine whether people develop fatty liver, liver damage and muscle damage when eating diets low in choline. Because choline is very important for fetal development, these SNPs may identify women who need to eat more choline during pregnancy. Some of the actions of choline are mediated by epigenetic mechanisms that permit “retuning” of metabolic pathways during early life. PMID:22614815

  5. Genetic polymorphisms of cytokine genes in type 2 diabetes mellitus

    PubMed Central

    Banerjee, Monisha; Saxena, Madhukar

    2014-01-01

    Diabetes mellitus is a combined metabolic disorder which includes hyperglycemia, dyslipidemia, stroke and several other complications. Various groups all over the world are relentlessly working out the possible role of a vast number of genes associated with type 2 diabetes (T2DM). Inflammation is an important outcome of any kind of imbalance in the body and is therefore an indicator of several diseases, including T2DM. Various ethnic populations around the world show different levels of variations in single nucleotide polymorphisms (SNPs). The present review was undertaken to explore the association of cytokine gene polymorphisms with T2DM in populations of different ethnicities. This will lead to the understanding of the role of cytokine genes in T2DM risk and development. Association studies of genotypes of SNPs present in cytokine genes will help to identify risk haplotype(s) for disease susceptibility by developing prognostic markers and alter treatment strategies for T2DM and related complications. This will enable individuals at risk to take prior precautionary measures and avoid or delay the onset of the disease. Future challenges will be to understand the genotypic interactions between SNPs in one cytokine gene or several genes at different loci and study their association with T2DM. PMID:25126395

  6. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    PubMed

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  7. Multi-variant study of obesity risk genes in African Americans: The Jackson Heart Study.

    PubMed

    Liu, Shijian; Wilson, James G; Jiang, Fan; Griswold, Michael; Correa, Adolfo; Mei, Hao

    2016-11-30

    Genome-wide association study (GWAS) has been successful in identifying obesity risk genes by single-variant association analysis. For this study, we designed steps of analysis strategy and aimed to identify multi-variant effects on obesity risk among candidate genes. Our analyses were focused on 2137 African American participants with body mass index measured in the Jackson Heart Study and 657 common single nucleotide polymorphisms (SNPs) genotyped at 8 GWAS-identified obesity risk genes. Single-variant association test showed that no SNPs reached significance after multiple testing adjustment. The following gene-gene interaction analysis, which was focused on SNPs with unadjusted p-value<0.10, identified 6 significant multi-variant associations. Logistic regression showed that SNPs in these associations did not have significant linear interactions; examination of genetic risk score evidenced that 4 multi-variant associations had significant additive effects of risk SNPs; and haplotype association test presented that all multi-variant associations contained one or several combinations of particular alleles or haplotypes, associated with increased obesity risk. Our study evidenced that obesity risk genes generated multi-variant effects, which can be additive or non-linear interactions, and multi-variant study is an important supplement to existing GWAS for understanding genetic effects of obesity risk genes. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  9. Discovery of 100K SNP array and its utilization in sugarcane

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing (NGS) enable us to identify thousands of single nucleotide polymorphisms (SNPs) marker for genotyping and fingerprinting. However, the process requires very precise bioinformatics analysis and filtering process. High throughput SNP array with predefined genomic location co...

  10. A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo.

    PubMed

    Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo

    2017-01-01

    A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

  11. Association of MYF5 and KLF15 gene polymorphisms with carcass traits in domestic pigeons (Columba livia).

    PubMed

    Yin, Z Z; Dong, X Y; Dong, D J; Ma, Y Z

    2016-10-01

    Single nucleotide polymorphisms (SNPs) in the exons of the myogenic factor 5 (MYF5) and Kruppel-like factor 15 (KLF15) genes were identified and analysed by using DNA sequencing methods in 60 female domestic pigeons (Columba livia). Five SNPs (T5067A, C5084T, C5101T, T5127A and C5154G) were detected in exon 3 of MYF5 and 6 SNPs (C1398T, C1464T, G1542A, C1929T, G1965A and A2355G) were found in exon 2 of KLF15, respectively. The analysis revealed three genotypes, in which the AA genotype was dominant and the A allele showed a dominant advantage. For the MYF5 gene, the C5084T and T5127A SNP genotypes were significantly associated with carcass traits of pigeons. Within those two SNPs, the BB genotype showed relatively higher trait association values than those of AA or AB genotypes. No significant association was observed between the KLF15 SNP genotypes and carcass traits. These results indicated that the MYF5 gene is a potential major gene affecting carcass traits in domestic pigeons. The BB genotype of the C5084T and T5127A SNPs could be a potential candidate genetic marker for marker-assisted selection in pigeon.

  12. Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

    PubMed

    Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2011-06-01

    Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

  13. Activating Transcription Factor 6 (ATF6) Sequence Polymorphisms in Type 2 Diabetes and Pre-Diabetic Traits

    PubMed Central

    Chu, Winston S.; Das, Swapan Kumar; Wang, Hua; Chan, Juliana C.; Deloukas, Panos; Froguel, Philippe; Baier, Leslie J.; Jia, Weiping; McCarthy, Mark I.; Ng, Maggie C.Y.; Damcott, Coleen; Shuldiner, Alan R.; Zeggini, Eleftheria; Elbein, Steven C.

    2009-01-01

    Activating transcription factor 6 (ATF6) is located within the region of linkage to type 2 diabetes on chromosome 1q21-q23 and is a key activator of the endoplasmic reticulum stress response. We evaluated 78 single nucleotide polymorphisms (SNPs) spanning >213 kb in 95 people, from which we selected 64 SNPs for evaluation in 191 Caucasian case subjects from Utah and between 165 and 188 control subjects. Six SNPs showed nominal associations with type 2 diabetes (P = 0.001-0.04), including the nonsynonymous SNP rs1058405 (M67V) in exon 3 and rs11579627 in the 3′ flanking region. Only rs1159627 remained significant on permutation testing. The associations were not replicated in 353 African-American case subjects and 182 control subjects, nor were ATF6 SNPs associated with altered insulin secretion or insulin sensitivity in nondiabetic Caucasian individuals. No association with type 2 diabetes was found in a subset of 44 SNPs in Caucasian (n = 2,099), Pima Indian (n = 293), and Chinese (n = 287) samples. Allelic expression imbalance was found in transformed lymphocyte cDNA for 3′ untranslated region variants, thus suggesting cis-acting regulatory variants. ATF6 does not appear to play a major role in type 2 diabetes, but further work is required to identify the cause of the allelic expression imbalance. PMID:17327457

  14. MMP1 bimodal expression and differential response to inflammatory mediators is linked to promoter polymorphisms

    PubMed Central

    2011-01-01

    Background Identifying the functional importance of the millions of single nucleotide polymorphisms (SNPs) in the human genome is a difficult challenge. Therefore, a reverse strategy, which identifies functionally important SNPs by virtue of the bimodal abundance across the human population of the SNP-related mRNAs will be useful. Those mRNA transcripts that are expressed at two distinct abundances in proportion to SNP allele frequency may warrant further study. Matrix metalloproteinase 1 (MMP1) is important in both normal development and in numerous pathologies. Although much research has been conducted to investigate the expression of MMP1 in many different cell types and conditions, the regulation of its expression is still not fully understood. Results In this study, we used a novel but straightforward method based on agglomerative hierarchical clustering to identify bimodally expressed transcripts in human umbilical vein endothelial cell (HUVEC) microarray data from 15 individuals. We found that MMP1 mRNA abundance was bimodally distributed in un-treated HUVECs and showed a bimodal response to inflammatory mediator treatment. RT-PCR and MMP1 activity assays confirmed the bimodal regulation and DNA sequencing of 69 individuals identified an MMP1 gene promoter polymorphism that segregated precisely with the MMP1 bimodal expression. Chromatin immunoprecipation (ChIP) experiments indicated that the transcription factors (TFs) ETS1, ETS2 and GATA3, bind to the MMP1 promoter in the region of this polymorphism and may contribute to the bimodal expression. Conclusions We describe a simple method to identify putative bimodally expressed RNAs from transcriptome data that is effective yet easy for non-statisticans to understand and use. This method identified bimodal endothelial cell expression of MMP1, which appears to be biologically significant with implications for inflammatory disease. (271 Words) PMID:21244711

  15. Polymorphisms of Leptin-b Gene Associated with Growth Traits in Orange-Spotted Grouper (Epinephelus coioides)

    PubMed Central

    Huang, Hai; Wei, Yun; Meng, Zining; Zhang, Yong; Liu, Xiaochun; Guo, Liang; Luo, Jian; Chen, Guohua; Lin, Haoran

    2014-01-01

    In mammals, leptin has been demonstrated to perform important roles in many physiological activities and to influence development, growth, metabolism and reproduction. However, in fish, its function is still unclear. Duplicate leptin genes, leptin-a and leptin-b, have been identified in the orange-spotted grouper. In the present study, the polymorphisms in the leptin-b gene of the orange-spotted grouper were detected, and the relation between these polymorphisms and 12 growth traits were analyzed. Six polymorphisms (including 3 single nucleotide polymorphisms (c.14G>A, c.93A>G, c.149G>A) in exon 1, 2 SNPs (c.181A>G, c.193G>A) in intron 1, and 1 SNP (c.360C>T) in exon 2) were identified and genotyped from 200 different individuals. The results revealed that the SNP c.149G>A was significantly associated with growth traits, that the heterozygous mutation genotype GA having negative effects on growth traits. However, the other five SNPs (c.14G>A, c.93A>G, c.181A>G, c.193G>A, c.360C>T) did not show significant associations with all the growth traits. Compared with our findings in leptin-a gene, the results suggested that the leptin-a hormone has more important physiological effects in fish bodies than the leptin-b type. Moreover, leptin genes were supposed to be one class of major candidate genes of regulating growth traits in the orange-spotted grouper. PMID:25003640

  16. Rapid Identification and Differentiation of Trichophyton Species, Based on Sequence Polymorphisms of the Ribosomal Internal Transcribed Spacer Regions, by Rolling-Circle Amplification▿

    PubMed Central

    Kong, Fanrong; Tong, Zhongsheng; Chen, Xiaoyou; Sorrell, Tania; Wang, Bin; Wu, Qixuan; Ellis, David; Chen, Sharon

    2008-01-01

    DNA sequencing analyses have demonstrated relatively limited polymorphisms within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp. We sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense, T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and developed a novel padlock probe and rolling-circle amplification (RCA)-based method for identification of single nucleotide polymorphisms (SNPs) that could be exploited to differentiate between Trichophyton spp. Sequencing results demonstrated intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified. The RCA assay correctly identified five Trichophyton species. Although the use of two “group-specific” probes targeting both the ITS1 and the ITS2 regions were required to identify T. soudanense, the other species were identified by single ITS1- or ITS2-targeted species-specific probes. There was good agreement between ITS sequencing and the RCA assay. Despite limited genetic variation between Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed potential as a simple, reproducible method for the rapid (2-h) identification of Trichophyton spp. PMID:18234865

  17. Genome-wide association tests of inversions with application to psoriasis

    PubMed Central

    Ma, Jianzhong; Xiong, Momiao; You, Ming; Lozano, Guillermina; Amos, Christopher I.

    2014-01-01

    Although inversions have occasionally been found to be associated with disease susceptibility through interrupting a gene or its regulatory region, or by increasing the risk for deleterious secondary rearrangements, no association study has been specifically conducted for risks associated with inversions, mainly because existing approaches to detecting and genotyping inversions do not readily scale to a large number of samples. Based on our recently proposed approach to identifying and genotyping inversions using principal components analysis (PCA), we herein develop a method of detecting association between inversions and disease in a genome-wide fashion. Our method uses genotype data for single nucleotide polymorphisms (SNPs), and is thus cost-efficient and computationally fast. For an inversion polymorphism, local PCA around the inversion region is performed to infer the inversion genotypes of all samples. For many inversions, we found that some of the SNPs inside an inversion region are fixed in the two lineages of different orientations and thus can serve as surrogate markers. Our method can be applied to case-control and quantitative trait association studies to identify inversions that may interrupt a gene or the connection between a gene and its regulatory agents. Our method also offers a new venue to identify inversions that are responsible for disease-causing secondary rearrangements. We illustrated our proposed approach to case-control data for psoriasis and identified novel associations with a few inversion polymorphisms. PMID:24623382

  18. Genotype-phenotype association study via new multi-task learning model

    PubMed Central

    Huo, Zhouyuan; Shen, Dinggang

    2018-01-01

    Research on the associations between genetic variations and imaging phenotypes is developing with the advance in high-throughput genotype and brain image techniques. Regression analysis of single nucleotide polymorphisms (SNPs) and imaging measures as quantitative traits (QTs) has been proposed to identify the quantitative trait loci (QTL) via multi-task learning models. Recent studies consider the interlinked structures within SNPs and imaging QTs through group lasso, e.g. ℓ2,1-norm, leading to better predictive results and insights of SNPs. However, group sparsity is not enough for representing the correlation between multiple tasks and ℓ2,1-norm regularization is not robust either. In this paper, we propose a new multi-task learning model to analyze the associations between SNPs and QTs. We suppose that low-rank structure is also beneficial to uncover the correlation between genetic variations and imaging phenotypes. Finally, we conduct regression analysis of SNPs and QTs. Experimental results show that our model is more accurate in prediction than compared methods and presents new insights of SNPs. PMID:29218896

  19. Replicability and Robustness of GWAS for Behavioral Traits

    PubMed Central

    Rietveld, Cornelius A.; Conley, Dalton; Eriksson, Nicholas; Esko, Tõnu; Medland, Sarah E.; Vinkhuyzen, Anna A.E.; Yang, Jian; Boardman, Jason D.; Chabris, Christopher F.; Dawes, Christopher T.; Domingue, Benjamin W.; Hinds, David A.; Johannesson, Magnus; Kiefer, Amy K.; Laibson, David; Magnusson, Patrik K. E.; Mountain, Joanna L.; Oskarsson, Sven; Rostapshova, Olga; Teumer, Alexander; Tung, Joyce Y.; Visscher, Peter M.; Benjamin, Daniel J.; Cesarini, David; Koellinger, Philipp D.

    2015-01-01

    A recent genome-wide association study (GWAS) of educational attainment identified three single-nucleotide polymorphisms (SNPs) that, despite their small effect sizes (each R2 ≈ 0.02%), reached genome-wide significance (p < 5×10−8) in a large discovery sample and replicated in an independent sample (p < 0.05). The study also reported associations between educational attainment and indices of SNPs called “polygenic scores.” We evaluate the robustness of these findings. Study 1 finds that all three SNPs replicate in another large (N = 34,428) independent sample. We also find that the scores remain predictive (R2 ≈ 2%) with stringent controls for stratification (Study 2) and in new within-family analyses (Study 3). Our results show that large and therefore well-powered GWASs can identify replicable genetic associations with behavioral traits. The small effect sizes of individual SNPs are likely to be a major contributing explanation for the striking contrast between our results and the disappointing replication record of most candidate gene studies. PMID:25287667

  20. Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression

    PubMed Central

    Kote-Jarai, Zsofia; Saunders, Edward J.; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Jugurnauth-Little, Sarah; Ross-Adams, Helen; Al Olama, Ali Amin; Benlloch, Sara; Halim, Silvia; Russel, Roslin; Dunning, Alison M.; Luccarini, Craig; Dennis, Joe; Neal, David E.; Hamdy, Freddie C.; Donovan, Jenny L.; Muir, Ken; Giles, Graham G.; Severi, Gianluca; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Lindstrom, Sara; Kraft, Peter; Hunter, David J.; Gapstur, Susan; Chanock, Stephen; Berndt, Sonja I.; Albanes, Demetrius; Andriole, Gerald; Schleutker, Johanna; Weischer, Maren; Canzian, Federico; Riboli, Elio; Key, Tim J.; Travis, Ruth C.; Campa, Daniele; Ingles, Sue A.; John, Esther M.; Hayes, Richard B.; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Ostrander, Elaine A.; Signorello, Lisa B.; Thibodeau, Stephen N.; Schaid, Dan; Maier, Christiane; Vogel, Walther; Kibel, Adam S.; Cybulski, Cezary; Lubinski, Jan; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y.; Kaneva, Radka; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Dicks, Ed; Baynes, Caroline; Conroy, Don; Bojesen, Stig E.; Kaaks, Rudolf; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Easton, Douglas F.; Eeles, Rosalind A.

    2013-01-01

    Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that encodes TERT. To comprehensively evaluate the association between genetic variation across this region and PrCa, we performed a fine-mapping analysis by genotyping 134 SNPs using a custom Illumina iSelect array or Sequenom MassArray iPlex, followed by imputation of 1094 SNPs in 22 301 PrCa cases and 22 320 controls in The PRACTICAL consortium. Multiple stepwise logistic regression analysis identified four signals in the promoter or intronic regions of TERT that independently associated with PrCa risk. Gene expression analysis of normal prostate tissue showed evidence that SNPs within one of these regions also associated with TERT expression, providing a potential mechanism for predisposition to disease. PMID:23535824

  1. Functional Characterization of Schizophrenia-Associated Variation in CACNA1C

    PubMed Central

    Eckart, Nicole; Song, Qifeng; Yang, Rebecca; Wang, Ruihua; Zhu, Heng; McCallion, Andrew S.; Avramopoulos, Dimitrios

    2016-01-01

    Calcium channel subunits, including CACNA1C, have been associated with multiple psychiatric disorders. Specifically, genome wide association studies (GWAS) have repeatedly identified the single nucleotide polymorphism (SNP) rs1006737 in intron 3 of CACNA1C to be strongly associated with schizophrenia and bipolar disorder. Here, we show that rs1006737 marks a quantitative trait locus for CACNA1C transcript levels. We test 16 SNPs in high linkage disequilibrium with rs1007637 and find one, rs4765905, consistently showing allele-dependent regulatory function in reporter assays. We find allele-specific protein binding for 13 SNPs including rs4765905. Using protein microarrays, we identify several proteins binding ≥3 SNPs, but not control sequences, suggesting possible functional interactions and combinatorial haplotype effects. Finally, using circular chromatin conformation capture, we show interaction of the disease-associated region including the 16 SNPs with the CACNA1C promoter and other potential regulatory regions. Our results elucidate the pathogenic relevance of one of the best-supported risk loci for schizophrenia and bipolar disorder. PMID:27276213

  2. Shared susceptibility loci at 2q33 region for lung and esophageal cancers in high-incidence areas of esophageal cancer in northern China

    PubMed Central

    Song, Xin; Hu, Shou Jia; Lv, Shuang; Cheng, Rang; Zhang, Tang Juan; Han, Xue Na; Ren, Jing Li; Qi, Yi Jun

    2017-01-01

    Background Cancers from lung and esophagus are the leading causes of cancer-related deaths in China and share many similarities in terms of histological type, risk factors and genetic variants. Recent genome-wide association studies (GWAS) in Chinese esophageal cancer patients have demonstrated six high-risk candidate single nucleotide polymorphisms (SNPs). Thus, the present study aimed to determine the risk of these SNPs predisposing to lung cancer in Chinese population. Methods A total of 1170 lung cancer patients and 1530 normal subjects were enrolled in this study from high-incidence areas for esophageal cancer in Henan, northern China. Five milliliters of blood were collected from all subjects for genotyping. Genotyping of 20 high-risk SNP loci identified from genome-wide association studies (GWAS) on esophageal, lung and gastric cancers was performed using TaqMan allelic discrimination assays. Polymorphisms were examined for deviation from Hardy-Weinberg equilibrium (HWE) using Х2 test. Bonferroni correction was performed to correct the statistical significance of 20 SNPs with the risk of lung cancer. The Pearson’s Х2 test was used to compare the distributions of gender, TNM stage, histopathological type, smoking and family history by lung susceptibility genotypes. Kaplan-Meier and Cox regression analyses were carried out to evaluate the associations between genetic variants and overall survival. Results Four of the 20 SNPs identified as high-risk SNPs in Chinese esophageal cancer showed increased risk for Chinese lung cancer, which included rs3769823 (OR = 1.26; 95% CI = 1.107–1.509; P = 0.02), rs10931936 (OR = 1.283; 95% CI = 1.100–1.495; P = 0.04), rs2244438 (OR = 1.294; 95% CI = 1.098–1.525; P = 0.04) and rs13016963 (OR = 1.268; 95% CI = 1.089–1.447; P = 0.04). All these SNPs were located at 2q33 region harboringgenes of CASP8, ALS2CR12 and TRAK2. However, none of these susceptibility SNPs was observed to be significantly associated with gender, TNM stage, histopathological type, smoking, family history and overall survival. Conclusions The present study identified four high-risk SNPs at 2q33 locus for Chinese lung cancer and demonstrated the shared susceptibility loci at 2q33 region for Chinese lung and esophageal cancers. PMID:28542283

  3. Shared susceptibility loci at 2q33 region for lung and esophageal cancers in high-incidence areas of esophageal cancer in northern China.

    PubMed

    Zhao, Xue Ke; Mao, Yi Min; Meng, Hui; Song, Xin; Hu, Shou Jia; Lv, Shuang; Cheng, Rang; Zhang, Tang Juan; Han, Xue Na; Ren, Jing Li; Qi, Yi Jun; Wang, Li Dong

    2017-01-01

    Cancers from lung and esophagus are the leading causes of cancer-related deaths in China and share many similarities in terms of histological type, risk factors and genetic variants. Recent genome-wide association studies (GWAS) in Chinese esophageal cancer patients have demonstrated six high-risk candidate single nucleotide polymorphisms (SNPs). Thus, the present study aimed to determine the risk of these SNPs predisposing to lung cancer in Chinese population. A total of 1170 lung cancer patients and 1530 normal subjects were enrolled in this study from high-incidence areas for esophageal cancer in Henan, northern China. Five milliliters of blood were collected from all subjects for genotyping. Genotyping of 20 high-risk SNP loci identified from genome-wide association studies (GWAS) on esophageal, lung and gastric cancers was performed using TaqMan allelic discrimination assays. Polymorphisms were examined for deviation from Hardy-Weinberg equilibrium (HWE) using Х2 test. Bonferroni correction was performed to correct the statistical significance of 20 SNPs with the risk of lung cancer. The Pearson's Х2 test was used to compare the distributions of gender, TNM stage, histopathological type, smoking and family history by lung susceptibility genotypes. Kaplan-Meier and Cox regression analyses were carried out to evaluate the associations between genetic variants and overall survival. Four of the 20 SNPs identified as high-risk SNPs in Chinese esophageal cancer showed increased risk for Chinese lung cancer, which included rs3769823 (OR = 1.26; 95% CI = 1.107-1.509; P = 0.02), rs10931936 (OR = 1.283; 95% CI = 1.100-1.495; P = 0.04), rs2244438 (OR = 1.294; 95% CI = 1.098-1.525; P = 0.04) and rs13016963 (OR = 1.268; 95% CI = 1.089-1.447; P = 0.04). All these SNPs were located at 2q33 region harboringgenes of CASP8, ALS2CR12 and TRAK2. However, none of these susceptibility SNPs was observed to be significantly associated with gender, TNM stage, histopathological type, smoking, family history and overall survival. The present study identified four high-risk SNPs at 2q33 locus for Chinese lung cancer and demonstrated the shared susceptibility loci at 2q33 region for Chinese lung and esophageal cancers.

  4. FABP4 is a leading candidate gene associated with residual feed intake in growing Holstein calves.

    PubMed

    Cohen-Zinder, Miri; Asher, Aviv; Lipkin, Ehud; Feingersch, Roi; Agmon, Rotem; Karasik, David; Brosh, Arieh; Shabtay, Ariel

    2016-05-01

    Ecological and economic concerns drive the need to improve feed utilization by domestic animals. Residual feed intake (RFI) is one of the most acceptable measures for feed efficiency (FE). However, phenotyping RFI-related traits is complex and expensive and requires special equipment. Advances in marker technology allow the development of various DNA-based selection tools. To assimilate these technologies for the benefit of RFI-based selection, reliable phenotypic measures are prerequisite. In the current study, we identified single nucleotide polymorphisms (SNPs) associated with RFI phenotypic consistency across different ages and diets (named RFI 1-3), using DNA samples of high or low RFI ranked Holstein calves. Using targeted sequencing of chromosomal regions associated with FE- and RFI-related traits, we identified 48 top SNPs significantly associated with at least one of three defined RFIs. Eleven of these SNPs were harbored by the fatty acid binding protein 4 (FABP4). While 10 significant SNPs found in FABP4 were common for RFI 1 and RFI 3, one SNP (FABP4_5; A

  5. Common polymorphisms influencing serum uric acid levels contribute to susceptibility to gout, but not to coronary artery disease.

    PubMed

    Stark, Klaus; Reinhard, Wibke; Grassl, Martina; Erdmann, Jeanette; Schunkert, Heribert; Illig, Thomas; Hengstenberg, Christian

    2009-11-05

    Recently, a large meta-analysis including over 28,000 participants identified nine different loci with association to serum uric acid (UA) levels. Since elevated serum UA levels potentially cause gout and are a possible risk factor for coronary artery disease (CAD) and myocardial infarction (MI), we performed two large case-control association analyses with participants from the German MI Family Study. In the first study, we assessed the association of the qualitative trait gout and ten single nucleotide polymorphisms (SNP) markers that showed association to UA serum levels. In the second study, the same genetic polymorphisms were analyzed for association with CAD. A total of 683 patients suffering from gout and 1,563 healthy controls from the German MI Family Study were genotyped. Nine SNPs were identified from a recently performed genome-wide meta-analysis on serum UA levels (rs12129861, rs780094, rs734553, rs2231142, rs742132, rs1183201, rs12356193, rs17300741 and rs505802). Additionally, the marker rs6855911 was included which has been associated with gout in our cohort in a previous study. SNPs rs734553 and rs6855911, located in SLC2A9, and SNP rs2231142, known to be a missense polymorphism in ABCG2, were associated with gout (p=5.6*10(-7), p=1.1*10(-7), and p=1.3*10(-3), respectively). Other SNPs in the genes PDZK1, GCKR, LRRC16A, SLC17A1-SLC17A3, SLC16A9, SLC22A11 and SLC22A12 failed the significance level. None of the ten markers were associated with risk to CAD in our study sample of 1,473 CAD cases and 1,241 CAD-free controls. SNP markers in SLC2A9 and ABCG2 genes were found to be strongly associated with the phenotype gout. However, not all SNP markers influencing serum UA levels were also directly associated with the clinical manifestation of gout in our study sample. In addition, none of these SNPs showed association with the risk to CAD in the German MI Family Study.

  6. Genotypic variants at 2q33 and risk of esophageal squamous cell carcinoma in China: a meta-analysis of genome-wide association studies

    PubMed Central

    Abnet, Christian C.; Wang, Zhaoming; Song, Xin; Hu, Nan; Zhou, Fu-You; Freedman, Neal D.; Li, Xue-Min; Yu, Kai; Shu, Xiao-Ou; Yuan, Jian-Min; Zheng, Wei; Dawsey, Sanford M.; Liao, Linda M.; Lee, Maxwell P.; Ding, Ti; Qiao, You-Lin; Gao, Yu-Tang; Koh, Woon-Puay; Xiang, Yong-Bing; Tang, Ze-Zhong; Fan, Jin-Hu; Chung, Charles C.; Wang, Chaoyu; Wheeler, William; Yeager, Meredith; Yuenger, Jeff; Hutchinson, Amy; Jacobs, Kevin B.; Giffen, Carol A.; Burdett, Laurie; Fraumeni, Joseph F.; Tucker, Margaret A.; Chow, Wong-Ho; Zhao, Xue-Ke; Li, Jiang-Man; Li, Ai-Li; Sun, Liang-Dan; Wei, Wu; Li, Ji-Lin; Zhang, Peng; Li, Hong-Lei; Cui, Wen-Yan; Wang, Wei-Peng; Liu, Zhi-Cai; Yang, Xia; Fu, Wen-Jing; Cui, Ji-Li; Lin, Hong-Li; Zhu, Wen-Liang; Liu, Min; Chen, Xi; Chen, Jie; Guo, Li; Han, Jing-Jing; Zhou, Sheng-Li; Huang, Jia; Wu, Yue; Yuan, Chao; Huang, Jing; Ji, Ai-Fang; Kul, Jian-Wei; Fan, Zhong-Min; Wang, Jian-Po; Zhang, Dong-Yun; Zhang, Lian-Qun; Zhang, Wei; Chen, Yuan-Fang; Ren, Jing-Li; Li, Xiu-Min; Dong, Jin-Cheng; Xing, Guo-Lan; Guo, Zhi-Gang; Yang, Jian-Xue; Mao, Yi-Ming; Yuan, Yuan; Guo, Er-Tao; Zhang, Wei; Hou, Zhi-Chao; Liu, Jing; Li, Yan; Tang, Sa; Chang, Jia; Peng, Xiu-Qin; Han, Min; Yin, Wan-Li; Liu, Ya-Li; Hu, Yan-Long; Liu, Yu; Yang, Liu-Qin; Zhu, Fu-Guo; Yang, Xiu-Feng; Feng, Xiao-Shan; Wang, Zhou; Li, Yin; Gao, She-Gan; Liu, Hai-Lin; Yuan, Ling; Jin, Yan; Zhang, Yan-Rui; Sheyhidin, Ilyar; Li, Feng; Chen, Bao-Ping; Ren, Shu-Wei; Liu, Bin; Li, Dan; Zhang, Gao-Fu; Yue, Wen-Bin; Feng, Chang-Wei; Qige, Qirenwang; Zhao, Jian-Ting; Yang, Wen-Jun; Lei, Guang-Yan; Chen, Long-Qi; Li, En-Min; Xu, Li-Yan; Wu, Zhi-Yong; Bao, Zhi-Qin; Chen, Ji-Li; Li, Xian-Chang; Zhuang, Xiang; Zhou, Ying-Fa; Zuo, Xian-Bo; Dong, Zi-Ming; Wang, Lu-Wen; Fan, Xue-Pin; Wang, Jin; Zhou, Qi; Ma, Guo-Shun; Zhang, Qin-Xian; Liu, Hai; Jian, Xin-Ying; Lian, Sin-Yong; Wang, Jin-Sheng; Chang, Fu-Bao; Lu, Chang-Dong; Miao, Jian-Jun; Chen, Zhi-Guo; Wang, Ran; Guo, Ming; Fan, Zeng-Lin; Tao, Ping; Liu, Tai-Jing; Wei, Jin-Chang; Kong, Qing-Peng; Fan, Lei; Wang, Xian-Zeng; Gao, Fu-Sheng; Wang, Tian-Yun; Xie, Dong; Wang, Li; Chen, Shu-Qing; Yang, Wan-Cai; Hong, Jun-Yan; Wang, Liang; Qiu, Song-Liang; Goldstein, Alisa M.; Yuan, Zhi-Qing; Chanock, Stephen J.; Zhang, Xue-Jun; Taylor, Philip R.; Wang, Li-Dong

    2012-01-01

    Genome-wide association studies have identified susceptibility loci for esophageal squamous cell carcinoma (ESCC). We conducted a meta-analysis of all single-nucleotide polymorphisms (SNPs) that showed nominally significant P-values in two previously published genome-wide scans that included a total of 2961 ESCC cases and 3400 controls. The meta-analysis revealed five SNPs at 2q33 with P< 5 × 10−8, and the strongest signal was rs13016963, with a combined odds ratio (95% confidence interval) of 1.29 (1.19–1.40) and P= 7.63 × 10−10. An imputation analysis of 4304 SNPs at 2q33 suggested a single association signal, and the strongest imputed SNP associations were similar to those from the genotyped SNPs. We conducted an ancestral recombination graph analysis with 53 SNPs to identify one or more haplotypes that harbor the variants directly responsible for the detected association signal. This showed that the five SNPs exist in a single haplotype along with 45 imputed SNPs in strong linkage disequilibrium, and the strongest candidate was rs10201587, one of the genotyped SNPs. Our meta-analysis found genome-wide significant SNPs at 2q33 that map to the CASP8/ALS2CR12/TRAK2 gene region. Variants in CASP8 have been extensively studied across a spectrum of cancers with mixed results. The locus we identified appears to be distinct from the widely studied rs3834129 and rs1045485 SNPs in CASP8. Future studies of esophageal and other cancers should focus on comprehensive sequencing of this 2q33 locus and functional analysis of rs13016963 and rs10201587 and other strongly correlated variants. PMID:22323360

  7. Genotypic variants at 2q33 and risk of esophageal squamous cell carcinoma in China: a meta-analysis of genome-wide association studies.

    PubMed

    Abnet, Christian C; Wang, Zhaoming; Song, Xin; Hu, Nan; Zhou, Fu-You; Freedman, Neal D; Li, Xue-Min; Yu, Kai; Shu, Xiao-Ou; Yuan, Jian-Min; Zheng, Wei; Dawsey, Sanford M; Liao, Linda M; Lee, Maxwell P; Ding, Ti; Qiao, You-Lin; Gao, Yu-Tang; Koh, Woon-Puay; Xiang, Yong-Bing; Tang, Ze-Zhong; Fan, Jin-Hu; Chung, Charles C; Wang, Chaoyu; Wheeler, William; Yeager, Meredith; Yuenger, Jeff; Hutchinson, Amy; Jacobs, Kevin B; Giffen, Carol A; Burdett, Laurie; Fraumeni, Joseph F; Tucker, Margaret A; Chow, Wong-Ho; Zhao, Xue-Ke; Li, Jiang-Man; Li, Ai-Li; Sun, Liang-Dan; Wei, Wu; Li, Ji-Lin; Zhang, Peng; Li, Hong-Lei; Cui, Wen-Yan; Wang, Wei-Peng; Liu, Zhi-Cai; Yang, Xia; Fu, Wen-Jing; Cui, Ji-Li; Lin, Hong-Li; Zhu, Wen-Liang; Liu, Min; Chen, Xi; Chen, Jie; Guo, Li; Han, Jing-Jing; Zhou, Sheng-Li; Huang, Jia; Wu, Yue; Yuan, Chao; Huang, Jing; Ji, Ai-Fang; Kul, Jian-Wei; Fan, Zhong-Min; Wang, Jian-Po; Zhang, Dong-Yun; Zhang, Lian-Qun; Zhang, Wei; Chen, Yuan-Fang; Ren, Jing-Li; Li, Xiu-Min; Dong, Jin-Cheng; Xing, Guo-Lan; Guo, Zhi-Gang; Yang, Jian-Xue; Mao, Yi-Ming; Yuan, Yuan; Guo, Er-Tao; Zhang, Wei; Hou, Zhi-Chao; Liu, Jing; Li, Yan; Tang, Sa; Chang, Jia; Peng, Xiu-Qin; Han, Min; Yin, Wan-Li; Liu, Ya-Li; Hu, Yan-Long; Liu, Yu; Yang, Liu-Qin; Zhu, Fu-Guo; Yang, Xiu-Feng; Feng, Xiao-Shan; Wang, Zhou; Li, Yin; Gao, She-Gan; Liu, Hai-Lin; Yuan, Ling; Jin, Yan; Zhang, Yan-Rui; Sheyhidin, Ilyar; Li, Feng; Chen, Bao-Ping; Ren, Shu-Wei; Liu, Bin; Li, Dan; Zhang, Gao-Fu; Yue, Wen-Bin; Feng, Chang-Wei; Qige, Qirenwang; Zhao, Jian-Ting; Yang, Wen-Jun; Lei, Guang-Yan; Chen, Long-Qi; Li, En-Min; Xu, Li-Yan; Wu, Zhi-Yong; Bao, Zhi-Qin; Chen, Ji-Li; Li, Xian-Chang; Zhuang, Xiang; Zhou, Ying-Fa; Zuo, Xian-Bo; Dong, Zi-Ming; Wang, Lu-Wen; Fan, Xue-Pin; Wang, Jin; Zhou, Qi; Ma, Guo-Shun; Zhang, Qin-Xian; Liu, Hai; Jian, Xin-Ying; Lian, Sin-Yong; Wang, Jin-Sheng; Chang, Fu-Bao; Lu, Chang-Dong; Miao, Jian-Jun; Chen, Zhi-Guo; Wang, Ran; Guo, Ming; Fan, Zeng-Lin; Tao, Ping; Liu, Tai-Jing; Wei, Jin-Chang; Kong, Qing-Peng; Fan, Lei; Wang, Xian-Zeng; Gao, Fu-Sheng; Wang, Tian-Yun; Xie, Dong; Wang, Li; Chen, Shu-Qing; Yang, Wan-Cai; Hong, Jun-Yan; Wang, Liang; Qiu, Song-Liang; Goldstein, Alisa M; Yuan, Zhi-Qing; Chanock, Stephen J; Zhang, Xue-Jun; Taylor, Philip R; Wang, Li-Dong

    2012-05-01

    Genome-wide association studies have identified susceptibility loci for esophageal squamous cell carcinoma (ESCC). We conducted a meta-analysis of all single-nucleotide polymorphisms (SNPs) that showed nominally significant P-values in two previously published genome-wide scans that included a total of 2961 ESCC cases and 3400 controls. The meta-analysis revealed five SNPs at 2q33 with P< 5 × 10(-8), and the strongest signal was rs13016963, with a combined odds ratio (95% confidence interval) of 1.29 (1.19-1.40) and P= 7.63 × 10(-10). An imputation analysis of 4304 SNPs at 2q33 suggested a single association signal, and the strongest imputed SNP associations were similar to those from the genotyped SNPs. We conducted an ancestral recombination graph analysis with 53 SNPs to identify one or more haplotypes that harbor the variants directly responsible for the detected association signal. This showed that the five SNPs exist in a single haplotype along with 45 imputed SNPs in strong linkage disequilibrium, and the strongest candidate was rs10201587, one of the genotyped SNPs. Our meta-analysis found genome-wide significant SNPs at 2q33 that map to the CASP8/ALS2CR12/TRAK2 gene region. Variants in CASP8 have been extensively studied across a spectrum of cancers with mixed results. The locus we identified appears to be distinct from the widely studied rs3834129 and rs1045485 SNPs in CASP8. Future studies of esophageal and other cancers should focus on comprehensive sequencing of this 2q33 locus and functional analysis of rs13016963 and rs10201587 and other strongly correlated variants.

  8. Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

    PubMed Central

    Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

    2000-01-01

    Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

  9. Evaluating the transferability of 15 European-derived fasting plasma glucose SNPs in Mexican children and adolescents

    PubMed Central

    Langlois, Christine; Abadi, Arkan; Peralta-Romero, Jesus; Alyass, Akram; Suarez, Fernando; Gomez-Zamudio, Jaime; Burguete-Garcia, Ana I.; Yazdi, Fereshteh T.; Cruz, Miguel; Meyre, David

    2016-01-01

    Genome wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with fasting plasma glucose (FPG) in adult European populations. The contribution of these SNPs to FPG in non-Europeans and children is unclear. We studied the association of 15 GWAS SNPs and a genotype score (GS) with FPG and 7 metabolic traits in 1,421 Mexican children and adolescents from Mexico City. Genotyping of the 15 SNPs was performed using TaqMan Open Array. We used multivariate linear regression models adjusted for age, sex, body mass index standard deviation score, and recruitment center. We identified significant associations between 3 SNPs (G6PC2 (rs560887), GCKR (rs1260326), MTNR1B (rs10830963)), the GS and FPG level. The FPG risk alleles of 11 out of the 15 SNPs (73.3%) displayed significant or non-significant beta values for FPG directionally consistent with those reported in adult European GWAS. The risk allele frequencies for 11 of 15 (73.3%) SNPs differed significantly in Mexican children and adolescents compared to European adults from the 1000G Project, but no significant enrichment in FPG risk alleles was observed in the Mexican population. Our data support a partial transferability of European GWAS FPG association signals in children and adolescents from the admixed Mexican population. PMID:27782183

  10. Genotyping of the Alzheimer's Disease Genome-Wide Association Study Index Single Nucleotide Polymorphisms in the Brains for Dementia Research Cohort.

    PubMed

    Brookes, Keeley J; McConnell, George; Williams, Kirsty; Chaudhury, Sultan; Madhan, Gaganjit; Patel, Tulsi; Turley, Christopher; Guetta-Baranes, Tamar; Bras, Jose; Guerreiro, Rita; Hardy, John; Francis, Paul T; Morgan, Kevin

    2018-06-08

    The Brains for Dementia Research project is a recently established longitudinal cohort which aims to provide brain tissue for research purposes from neuropathologically defined samples. Here we present the findings from our analysis on the 19 established GWAS index SNPs for Alzheimer's disease, in order to demonstrate if the BDR sample also displays association to these variants. A highly significant association of the APOEɛ4 allele was identified (p = 3.99×10-12). Association tests for the 19 GWAS SNPs found that although no SNPs survive multiple testing, nominal significant findings were detected and concordance with the Lambert et al. GWAS meta-analysis was observed.

  11. Use of single-nucleotide polymorphisms (SNPs) to distinguish gene expression subtypes of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME).

    PubMed

    Shimosako, Nana; Kerr, Jonathan R

    2014-12-01

    We have reported gene expression changes in patients with chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) and the fact that such gene expression data can be used to identify subtypes of CFS/ME with distinct clinical phenotypes. Due to the difficulties in using a comparative gene expression method as an aid to CFS/ME disease and subtype-specific diagnosis, we have attempted to develop such a method based on single-nucleotide polymorphism (SNP) analysis. To identify SNP allele associations with CFS/ME and CFS/ME subtypes, we tested genomic DNA of patients with CFS/ME (n=108), patients with endogenous depression (n=17) and normal blood donors (n=68) for 504 human SNP alleles located within 88 CFS-associated human genes using the SNP Genotyping GoldenGate Assay (Illumina, San Diego, California, USA). 360 ancestry informative markers (AIM) were also examined. 21 SNPs were significantly associated with CFS/ME compared with depression and normal groups. 148 SNP alleles had a significant association with one or more CFS/ME subtypes. For each subtype, associated SNPs tended to be grouped together within particular genes. AIM SNPs indicated that 4 subjects were of Asian origin while the remainder were Caucasian. Hierarchical clustering of AIM data revealed the relatedness between 2 couples of patients with CFS only and confirmed the overall heterogeneity of all subjects. This study provides evidence that human SNPs located within CFS/ME associated genes are associated with particular genomic subtypes of CFS/ME. Further work is required to develop this into a clinically useful subtype-specific diagnostic test. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  12. LPA and PLG sequence variation and kringle IV-2 copy number in two populations.

    PubMed

    Crawford, Dana C; Peng, Ze; Cheng, Jan-Fang; Boffelli, Dario; Ahearn, Magdalena; Nguyen, Dan; Shaffer, Tristan; Yi, Qian; Livingston, Robert J; Rieder, Mark J; Nickerson, Deborah A

    2008-01-01

    Lp(a) levels have long been recognized as a potential risk factor for coronary heart disease that is almost completely under genetic control. Much of the genetics impacting Lp(a) levels has been attributed to the highly polymorphic LPA kringle IV-2 copy number variant, and most of the variance in Lp(a) levels in populations of European-descent is inversely correlated with kringle IV copy number. However, less of the variance is explained in African-descent populations for the same structural variation. African-descent populations have, on average, higher levels of Lp(a), suggesting other genetic factors contribute to Lp(a) level variability across populations. To identify potential cis-acting factors, we re-sequenced the gene LPA for single nucleotide polymorphism (SNP) discovery in 23 European-Americans and 24 African-Americans. We also re- sequenced the neighboring gene plasminogen (PLG) and genotyped the kringle IV copy number variant in the same reference samples. These data are the most comprehensive description of sequence variation in LPA and its relationship with the kringle IV copy number variant. With these data, we demonstrate that only a fraction of LPA sequence diversity has been previously documented. Also, we identify several high frequency SNPs present in the African-American sample but absent in the European-American sample. Finally, we show that SNPs within PLG are not in linkage disequilibrium with SNPs in LPA, and we show that kringle IV copy number variation is not in linkage disequilibrium with either LPA or PLG SNPs. Together, these data suggest that LPA SNPs could independently contribute to Lp(a) levels in the general population. Copyright (c) 2008 S. Karger AG, Basel.

  13. Resistin polymorphisms are associated with muscle, bone, and fat phenotypes in white men and women.

    PubMed

    Pistilli, Emidio E; Gordish-Dressman, Heather; Seip, Richard L; Devaney, Joseph M; Thompson, Paul D; Price, Thomas B; Angelopoulos, Theodore J; Clarkson, Priscilla M; Moyna, Niall M; Pescatello, Linda S; Visich, Paul S; Zoeller, Robert F; Hoffman, Eric P; Gordon, Paul M

    2007-02-01

    The biological function of resistin (RST) is unknown, although it may have roles in obesity, diabetes, and insulin resistance. The objective of this study was to examine the effects of single nucleotide polymorphisms (SNPs) in the human RST gene on muscle, bone, and adipose tissue phenotypes and in response to resistance training (RT). Subjects were white and consisted of strength (n = 482) and size (n = 409) cohorts who had not performed RT in the previous year. Subjects completed 12 weeks of structured, unilateral upper arm RT aimed at increasing the size and strength of the non-dominant arm, using their dominant arm as an untrained control. Strength measurements were taken pre- and post-12-week RT and consisted of elbow flexor isometric strength and one-repetition maximum during a biceps curl using free weights. Whole muscle, subcutaneous fat, and cortical bone volumes were measured by magnetic resonance imaging. Six RST SNPs were identified. Analysis of covariance was used to test for effects of the SNPs on pre- and post-muscle strength and whole muscle, fat, and bone volumes independent of gender, age, and body weight. Five RST SNPs (-537 A>C, -420 C>G, 398 C>T, 540 G>A, 980 C>G) were associated with measured phenotypes among subjects when stratified by BMI (<25, >/ or = 25 kg/m(2)). Several gender-specific associations were observed between RST SNPs and phenotypes among individuals with a BMI > or = 25. Conversely, only two associations were observed among individuals with a BMI < 25. These data support previous identified associations of RST with adipose tissue and demonstrate additional associations with bone and skeletal muscle that warrant further investigation.

  14. Genomic profiling of thousands of candidate polymorphisms predicts risk of relapse in 778 Danish and German childhood acute lymphoblastic leukemia patients.

    PubMed

    Wesołowska-Andersen, A; Borst, L; Dalgaard, M D; Yadav, R; Rasmussen, K K; Wehner, P S; Rasmussen, M; Ørntoft, T F; Nordentoft, I; Koehler, R; Bartram, C R; Schrappe, M; Sicheritz-Ponten, T; Gautier, L; Marquart, H; Madsen, H O; Brunak, S; Stanulla, M; Gupta, R; Schmiegelow, K

    2015-02-01

    Childhood acute lymphoblastic leukemia survival approaches 90%. New strategies are needed to identify the 10-15% who evade cure. We applied targeted, sequencing-based genotyping of 25 000 to 34 000 preselected potentially clinically relevant single-nucleotide polymorphisms (SNPs) to identify host genome profiles associated with relapse risk in 352 patients from the Nordic ALL92/2000 protocols and 426 patients from the German Berlin-Frankfurt-Munster (BFM) ALL2000 protocol. Patients were enrolled between 1992 and 2008 (median follow-up: 7.6 years). Eleven cross-validated SNPs were significantly associated with risk of relapse across protocols. SNP and biologic pathway level analyses associated relapse risk with leukemia aggressiveness, glucocorticosteroid pharmacology/response and drug transport/metabolism pathways. Classification and regression tree analysis identified three distinct risk groups defined by end of induction residual leukemia, white blood cell count and variants in myeloperoxidase (MPO), estrogen receptor 1 (ESR1), lamin B1 (LMNB1) and matrix metalloproteinase-7 (MMP7) genes, ATP-binding cassette transporters and glucocorticosteroid transcription regulation pathways. Relapse rates ranged from 4% (95% confidence interval (CI): 1.6-6.3%) for the best group (72% of patients) to 76% (95% CI: 41-90%) for the worst group (5% of patients, P<0.001). Validation of these findings and similar approaches to identify SNPs associated with toxicities may allow future individualized relapse and toxicity risk-based treatments adaptation.

  15. First High-Density Linkage Map and Single Nucleotide Polymorphisms Significantly Associated With Traits of Economic Importance in Yellowtail Kingfish Seriola lalandi.

    PubMed

    Nguyen, Nguyen H; Rastas, Pasi M A; Premachandra, H K A; Knibb, Wayne

    2018-01-01

    The genetic resources available for the commercially important fish species Yellowtail kingfish (YTK) ( Seriola lalandi) are relative sparse. To overcome this, we aimed (1) to develop a linkage map for this species, and (2) to identify markers/variants associated with economically important traits in kingfish (with an emphasis on body weight). Genetic and genomic analyses were conducted using 13,898 single nucleotide polymorphisms (SNPs) generated from a new high-throughput genotyping by sequencing platform, Diversity Arrays Technology (DArTseq TM ) in a pedigreed population comprising 752 animals. The linkage analysis enabled to map about 4,000 markers to 24 linkage groups (LGs), with an average density of 3.4 SNPs per cM. The linkage map was integrated into a genome-wide association study (GWAS) and identified six variants/SNPs associated with body weight ( P < 5e -8 ) when a multi-locus mixed model was used. Two out of the six significant markers were mapped to LGs 17 and 23, and collectively they explained 5.8% of the total genetic variance. It is concluded that the newly developed linkage map and the significantly associated markers with body weight provide fundamental information to characterize genetic architecture of growth-related traits in this population of YTK S. lalandi .

  16. The Complete Chloroplast Genome of 17 Individuals of Pest Species Jacobaea vulgaris: SNPs, Microsatellites and Barcoding Markers for Population and Phylogenetic Studies

    PubMed Central

    Doorduin, Leonie; Gravendeel, Barbara; Lammers, Youri; Ariyurek, Yavuz; Chin-A-Woeng, Thomas; Vrieling, Klaas

    2011-01-01

    Invasive individuals from the pest species Jacobaea vulgaris show different allocation patterns in defence and growth compared with native individuals. To examine if these changes are caused by fast evolution, it is necessary to identify native source populations and compare these with invasive populations. For this purpose, we are in need of intraspecific polymorphic markers. We therefore sequenced the complete chloroplast genomes of 12 native and 5 invasive individuals of J. vulgaris with next generation sequencing and discovered single-nucleotide polymorphisms (SNPs) and microsatellites. This is the first study in which the chloroplast genome of that many individuals within a single species was sequenced. Thirty-two SNPs and 34 microsatellite regions were found. For none of the individuals, differences were found between the inverted repeats. Furthermore, being the first chloroplast genome sequenced in the Senecioneae clade, we compared it with four other members of the Asteraceae family to identify new regions for phylogentic inference within this clade and also within the Asteraceae family. Five markers (ndhC-trnV, ndhC-atpE, rps18-rpl20, clpP and psbM-trnD) contained parsimony-informative characters higher than 2%. Finally, we compared two procedures of preparing chloroplast DNA for next generation sequencing. PMID:21444340

  17. Physiogenomic Analysis of Localized fMRI Brain Activity in Schizophrenia

    PubMed Central

    Windemuth, Andreas; Calhoun, Vince D.; Pearlson, Godfrey D.; Kocherla, Mohan; Jagannathan, Kanchana; Ruaño, Gualberto

    2009-01-01

    The search for genetic factors associated with disease is complicated by the complexity of the biological pathways linking genotype and phenotype. This analytical complexity is particularly concerning in diseases historically lacking reliable diagnostic biological markers, such as schizophrenia and other mental disorders. We investigate the use of functional magnetic resonance imaging (fMRI) as an intermediate phenotype (endophenotype) to identify physiogenomic associations to schizophrenia. We screened 99 subjects, 30 subjects diagnosed with schizophrenia, 13 unaffected relatives of schizophrenia patients, and 56 unrelated controls, for gene polymorphisms associated with fMRI activation patterns at two locations in temporal and frontal lobes previously implied in schizophrenia. A total of 22 single nucleotide polymorphisms (SNPs) in 15 genes from the dopamine and serotonin neurotransmission pathways were genotyped in all subjects. We identified three SNPs in genes that are significantly associated with fMRI activity. SNPs of the dopamine beta-hydroxylase (DBH) gene and of the dopamine receptor D4 (DRD4) were associated with activity in the temporal and frontal lobes, respectively. One SNP of serotonin-3A receptor (HTR3A) was associated with temporal lobe activity. The results of this study support the physiogenomic analysis of neuroimaging data to discover associations between genotype and disease-related phenotypes. PMID:18330705

  18. Using RNA-Seq for gene identification, polymorphism detection and transcript profiling in two alfalfa genotypes with divergent cell wall composition in stems

    PubMed Central

    2011-01-01

    Background Alfalfa, [Medicago sativa (L.) sativa], a widely-grown perennial forage has potential for development as a cellulosic ethanol feedstock. However, the genomics of alfalfa, a non-model species, is still in its infancy. The recent advent of RNA-Seq, a massively parallel sequencing method for transcriptome analysis, provides an opportunity to expand the identification of alfalfa genes and polymorphisms, and conduct in-depth transcript profiling. Results Cell walls in stems of alfalfa genotype 708 have higher cellulose and lower lignin concentrations compared to cell walls in stems of genotype 773. Using the Illumina GA-II platform, a total of 198,861,304 expression sequence tags (ESTs, 76 bp in length) were generated from cDNA libraries derived from elongating stem (ES) and post-elongation stem (PES) internodes of 708 and 773. In addition, 341,984 ESTs were generated from ES and PES internodes of genotype 773 using the GS FLX Titanium platform. The first alfalfa (Medicago sativa) gene index (MSGI 1.0) was assembled using the Sanger ESTs available from GenBank, the GS FLX Titanium EST sequences, and the de novo assembled Illumina sequences. MSGI 1.0 contains 124,025 unique sequences including 22,729 tentative consensus sequences (TCs), 22,315 singletons and 78,981 pseudo-singletons. We identified a total of 1,294 simple sequence repeats (SSR) among the sequences in MSGI 1.0. In addition, a total of 10,826 single nucleotide polymorphisms (SNPs) were predicted between the two genotypes. Out of 55 SNPs randomly selected for experimental validation, 47 (85%) were polymorphic between the two genotypes. We also identified numerous allelic variations within each genotype. Digital gene expression analysis identified numerous candidate genes that may play a role in stem development as well as candidate genes that may contribute to the differences in cell wall composition in stems of the two genotypes. Conclusions Our results demonstrate that RNA-Seq can be successfully used for gene identification, polymorphism detection and transcript profiling in alfalfa, a non-model, allogamous, autotetraploid species. The alfalfa gene index assembled in this study, and the SNPs, SSRs and candidate genes identified can be used to improve alfalfa as a forage crop and cellulosic feedstock. PMID:21504589

  19. Association of SNPs in exon 2 of the MHC B-F gene with immune traits in two distinct chicken populations: Chinese Beijing-You and White Leghorn.

    PubMed

    Liu, L B; Wu, C M; Wen, J; Chen, J L; Zheng, M Q; Zhao, G P

    2009-03-01

    Antibody titers raised for vaccinations against avian influenza (AI) and Newcastle disease (ND) were higher in Chinese Beijing-You (BJY) than in White Leghorn (WL) ( P < 0.001), but there was no breed difference in titers for sheep red blood cells (SRBC). Genotyping by PCR-SSCP identified seven haplotypes in WL and 17 in BJY. After sequencing PCR products (35 and 85, respectively), 43 (WL) and 47 (BJY) single nucleotide polymorphisms (SNPs) were found in the 264 bp of exon 2. In WL chickens, significant associations were found with antibody responses to AI (two SNPs), ND (six SNPs), and SRBC (one SNP), while in BJY there was association with responses to ND (two SNPs) and SRBC (two SNPs), but none with AI. These results indicate that the genomic region bearing exon 2 of the major histocompatibility complex B-F gene has significant effects on antibody responses to SRBC and vaccination against AI and ND. Different SNPs affected antibody titers for each of the antigens and they differed between these very distinct breeds.

  20. Polymorphism discovery and allele frequency estimation using high-throughput DNA sequencing of target-enriched pooled DNA samples

    PubMed Central

    2012-01-01

    Background The central role of the somatotrophic axis in animal post-natal growth, development and fertility is well established. Therefore, the identification of genetic variants affecting quantitative traits within this axis is an attractive goal. However, large sample numbers are a pre-requisite for the identification of genetic variants underlying complex traits and although technologies are improving rapidly, high-throughput sequencing of large numbers of complete individual genomes remains prohibitively expensive. Therefore using a pooled DNA approach coupled with target enrichment and high-throughput sequencing, the aim of this study was to identify polymorphisms and estimate allele frequency differences across 83 candidate genes of the somatotrophic axis, in 150 Holstein-Friesian dairy bulls divided into two groups divergent for genetic merit for fertility. Results In total, 4,135 SNPs and 893 indels were identified during the resequencing of the 83 candidate genes. Nineteen percent (n = 952) of variants were located within 5' and 3' UTRs. Seventy-two percent (n = 3,612) were intronic and 9% (n = 464) were exonic, including 65 indels and 236 SNPs resulting in non-synonymous substitutions (NSS). Significant (P < 0.01) mean allele frequency differentials between the low and high fertility groups were observed for 720 SNPs (58 NSS). Allele frequencies for 43 of the SNPs were also determined by genotyping the 150 individual animals (Sequenom® MassARRAY). No significant differences (P > 0.1) were observed between the two methods for any of the 43 SNPs across both pools (i.e., 86 tests in total). Conclusions The results of the current study support previous findings of the use of DNA sample pooling and high-throughput sequencing as a viable strategy for polymorphism discovery and allele frequency estimation. Using this approach we have characterised the genetic variation within genes of the somatotrophic axis and related pathways, central to mammalian post-natal growth and development and subsequent lactogenesis and fertility. We have identified a large number of variants segregating at significantly different frequencies between cattle groups divergent for calving interval plausibly harbouring causative variants contributing to heritable variation. To our knowledge, this is the first report describing sequencing of targeted genomic regions in any livestock species using groups with divergent phenotypes for an economically important trait. PMID:22235840

  1. SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

    PubMed Central

    2012-01-01

    Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

  2. Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

    PubMed

    Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

    2016-01-01

    Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

  3. Variants for HDL-C, LDL-C, and triglycerides identified from admixture mapping and fine-mapping analysis in African American families.

    PubMed

    Shetty, Priya B; Tang, Hua; Feng, Tao; Tayo, Bamidele; Morrison, Alanna C; Kardia, Sharon L R; Hanis, Craig L; Arnett, Donna K; Hunt, Steven C; Boerwinkle, Eric; Rao, Dabeeru C; Cooper, Richard S; Risch, Neil; Zhu, Xiaofeng

    2015-02-01

    Admixture mapping of lipids was followed-up by family-based association analysis to identify variants for cardiovascular disease in African Americans. The present study conducted admixture mapping analysis for total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides. The analysis was performed in 1905 unrelated African American subjects from the National Heart, Lung and Blood Institute's Family Blood Pressure Program (FBPP). Regions showing admixture evidence were followed-up with family-based association analysis in 3556 African American subjects from the FBPP. The admixture mapping and family-based association analyses were adjusted for age, age(2), sex, body mass index, and genome-wide mean ancestry to minimize the confounding caused by population stratification. Regions that were suggestive of local ancestry association evidence were found on chromosomes 7 (low-density lipoprotein cholesterol), 8 (high-density lipoprotein cholesterol), 14 (triglycerides), and 19 (total cholesterol and triglycerides). In the fine-mapping analysis, 52 939 single-nucleotide polymorphisms (SNPs) were tested and 11 SNPs (8 independent SNPs) showed nominal significant association with high-density lipoprotein cholesterol (2 SNPs), low-density lipoprotein cholesterol (4 SNPs), and triglycerides (5 SNPs). The family data were used in the fine-mapping to identify SNPs that showed novel associations with lipids and regions, including genes with known associations for cardiovascular disease. This study identified regions on chromosomes 7, 8, 14, and 19 and 11 SNPs from the fine-mapping analysis that were associated with high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides for further studies of cardiovascular disease in African Americans. © 2014 American Heart Association, Inc.

  4. [Evaluation of association between 9 genetic polymorphism and myocardial infarction in the Siberian population].

    PubMed

    Maksimov, V N; Kulikov, I V; Orlov, P S; Gafarov, V V; Maliutina, S K; Romashchenko, A G; Voevoda, M I

    2012-01-01

    to evaluate association between genetic polymorphism (SNPs) and myocardial infarction (identified in recent GWAS) as markers of high risk of myocardial infarction (MI) in Siberian population. Patients were divided into 2 groups - MI patients and control group (ratio 1:2) and presented the sapmle of population of Novosibirsk (9400 patients, 45-69 years) within international project HAPIEE (Health, Alcohol and Psychosocial factors In Eastern Europe). 200 patients with MI (129 men, 71 women) were included. Control group - individuals without MI (420) matched for age and sex. Genomic DNA was extracted from venous blood by phenol-chloroform extraction. Gene polymorphism of genes tested by real-time PCR according to protocol (probes TaqMan, Applied Biosystems, USA) with the use of ABI 7900HT. The following SNPs were studied: rs28711149, rs499818, rs619203, rs10757278 and rs1333049 (hr. 9), rs1376251, rs2549513, rs4804611, rs17465637. The association of SNP and MI was confirmed for 4 of 9 studied SNPs: rs1333049 (hr. 9), rs10757278 (hr. 9), rs499818 (hr. 6), rs619203 gene ROS1. Heart rate was associated with rs1333049 and rs10757278. Glucose level was associated with rs619203, rs28711149 and rs1376251. Total cholesterol and atherogenic index was associated with rs28711149. For the first time in Russian population the associations of GWAS with myocardial infarction SNPs was detected for rs619203, rs499818, rs1333049 and rs10757278. These genetic markers can be used for assessing the risk of myocardial infarction in Russian population.

  5. Associations between polymorphisms in the NICD domain of bovine NOTCH1 gene and growth traits in Chinese Qinchuan cattle.

    PubMed

    Liu, Mei; Zhang, Chenge; Lai, Xinsheng; Xue, Jing; Lan, Xianyong; Lei, Chuzhao; Jia, Yutang; Chen, Hong

    2017-05-01

    NOTCH1 is one of the four mammalian Notch receptors, which is involved in the Notch signaling pathway. Specifically, NOTCH1 promotes the proliferation of myogenic precursor cells, and the NICD domain of NOTCH1 can impair regeneration of skeletal muscles. However, similar research on the bovine NOTCH1 gene is lacking. In this study, we detected the polymorphisms of the bovine NOTCH1 gene in a total of 448 individuals from Chinese Qinchuan cattle with DNA pooling, forced PCR-RFLP, and DNA sequencing methods. Five novel SNPs were identified within the NICD domain, and eight haplotypes comprising combinations of these five SNPs were studied as well. The association analysis of SNPs' effects with growth traits revealed that g.A48250G was significantly associated with body height, body weight, and height at hip cross, and that g.A49239C only showed significant associations with body height. This suggests that the NOTCH1 gene is a strong candidate gene that could be utilized as a promising marker in beef cattle breeding programs.

  6. Genetic variations in NADPH-CYP450 oxidoreductase in a Czech Slavic cohort

    PubMed Central

    Tomková, Mária; Panda, Satya Prakash; Šeda, Ondřej; Baxová, Alice; Hůlková, Martina; Masters, Bettie Sue Siler; Martásek, Pavel

    2015-01-01

    Background Gene polymorphisms encoding the enzyme NADPH–cytochrome P450 oxidoreductase (POR) contribute to inter-individual differences in drug response. Aim To estimate polymorphic allele frequencies of the POR gene in a Czech Slavic population. Materials & Methods The gene POR was analyzed in 322 Czech Slavic individuals from a control cohort by sequencing and HRM analysis. Results Twenty-five SNP genetic variations were identified. Of these variants, 7 were new, unreported SNPs, including two SNPs in the 5´flanking region (g.4965 C>T and g.4994 G>T), one intronic variant (c.1899 −20C>T), one synonymous SNP (p.20Ala=) and three nonsynonymous SNPs (p.Thr29Ser, p.Pro384Leu and p.Thr529Met). The p.Pro384Leu variant exhibited reduced enzymatic activities compared to wild type. Conclusion New POR variant identification indicates that the number of uncommon variants might be specific for each subpopulation being investigated, particularly germane to the singular role that POR plays in providing reducing equivalents to all CYPs in the endoplasmic reticulum. PMID:25712184

  7. Linkage disequilibrium and signatures of positive selection around LINE-1 retrotransposons in the human genome.

    PubMed

    Kuhn, Alexandre; Ong, Yao Min; Cheng, Ching-Yu; Wong, Tien Yin; Quake, Stephen R; Burkholder, William F

    2014-06-03

    Insertions of the human-specific subfamily of LINE-1 (L1) retrotransposon are highly polymorphic across individuals and can critically influence the human transcriptome. We hypothesized that L1 insertions could represent genetic variants determining important human phenotypic traits, and performed an integrated analysis of L1 elements and single nucleotide polymorphisms (SNPs) in several human populations. We found that a large fraction of L1s were in high linkage disequilibrium with their surrounding genomic regions and that they were well tagged by SNPs. However, L1 variants were only partially captured by SNPs on standard SNP arrays, so that their potential phenotypic impact would be frequently missed by SNP array-based genome-wide association studies. We next identified potential phenotypic effects of L1s by looking for signatures of natural selection linked to L1 insertions; significant extended haplotype homozygosity was detected around several L1 insertions. This finding suggests that some of these L1 insertions may have been the target of recent positive selection.

  8. A case-based evaluation of SRD5A1, SRD5A2, AR, and ADRA1A as candidate genes for severity of BPH.

    PubMed

    Klotsman, M; Weinberg, C R; Davis, K; Binnie, C G; Hartmann, K E

    2004-01-01

    In men with a clinical diagnosis of benign prostatic hyperplasia (BPH), polytomous logistic regression analysis was conducted to evaluate associations between two silent polymorphisms in SRD5A1 (codon positions 30 and 116), two polymorphisms in SRD5A2 (Val89Leu substitution and C to T transition in intron 1), a trinucleotide (CAG)n repeat in androgen receptor (AR), and an Arg492Cys substitution in ADRA1A and clinical parameters that characterize severity of BPH. Candidate gene selection was based on two mechanistic pathways targeted by pharmacotherapy for BPH: (1) androgen metabolic loci contributing to prostate growth (static obstruction); and (2) factors affecting smooth muscle tone (dynamic obstruction). Polymorphisms in SRD5A2 were not associated with severity of BPH; however, SRD5A1 polymorphisms were associated with severity of BPH. The process(es) in which these silent single-nucleotide polymorphisms (SNPs) influence BPH phenotypes is unknown and additional studies will be needed to assess whether these SNPs have direct functional consequences. The characterization of additional molecular factors that contribute to static and dynamic obstruction may help predict response to pharmacotherapy and serve to identify novel drug targets for the clinical management of BPH.

  9. Sequence analysis of three canine adipokine genes revealed an association between TNF polymorphisms and obesity in Labrador dogs.

    PubMed

    Mankowska, M; Stachowiak, M; Graczyk, A; Ciazynska, P; Gogulski, M; Nizanski, W; Switonski, M

    2016-04-01

    Obesity is an emerging health problem in purebred dogs. Due to their crucial role in energy homeostasis control, genes encoding adipokines are considered candidate genes, and their variants may be associated with predisposition to obesity. Searching for polymorphism was carried out in three adipokine genes (TNF, RETN and IL6). The study was performed on 260 dogs, including lean (n = 109), overweight (n = 88) and obese (n = 63) dogs. The largest cohort was represented by Labrador Retrievers (n = 136). Altogether, 24 novel polymorphisms were identified: 12 in TNF (including one missense SNP), eight in RETN (including one missense SNP) and four in IL6. Distributions of five common SNPs (two in TNF, two in RETN and one in IL6) were further analyzed with regard to body condition score. Two SNPs in the non-coding parts of TNF (c.-40A>C and c.233+14G>A) were associated with obesity in Labrador dogs. The obtained results showed that the studied adipokine genes are highly polymorphic and two polymorphisms in the TNF gene may be considered as markers predisposing Labrador dogs to obesity. © 2015 Stichting International Foundation for Animal Genetics.

  10. Development and Evaluation of a Genome-Wide 6K SNP Array for Diploid Sweet Cherry and Tetraploid Sour Cherry

    PubMed Central

    Peace, Cameron; Bassil, Nahla; Main, Dorrie; Ficklin, Stephen; Rosyara, Umesh R.; Stegmeir, Travis; Sebolt, Audrey; Gilmore, Barbara; Lawley, Cindy; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Iezzoni, Amy

    2012-01-01

    High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a community initiative to enable marker-assisted breeding for rosaceous crops. Next-generation sequencing in diverse breeding germplasm provided 25 billion basepairs (Gb) of cherry DNA sequence from which were identified genome-wide SNPs for sweet cherry and for the two sour cherry subgenomes derived from sweet cherry (avium subgenome) and P. fruticosa (fruticosa subgenome). Anchoring to the peach genome sequence, recently released by the International Peach Genome Initiative, predicted relative physical locations of the 1.9 million putative SNPs detected, preliminarily filtered to 368,943 SNPs. Further filtering was guided by results of a 144-SNP subset examined with the Illumina GoldenGate® assay on 160 accessions. A 6K Infinium® II array was designed with SNPs evenly spaced genetically across the sweet and sour cherry genomes. SNPs were developed for each sour cherry subgenome by using minor allele frequency in the sour cherry detection panel to enrich for subgenome-specific SNPs followed by targeting to either subgenome according to alleles observed in sweet cherry. The array was evaluated using panels of sweet (n = 269) and sour (n = 330) cherry breeding germplasm. Approximately one third of array SNPs were informative for each crop. A total of 1825 polymorphic SNPs were verified in sweet cherry, 13% of these originally developed for sour cherry. Allele dosage was resolved for 2058 polymorphic SNPs in sour cherry, one third of these being originally developed for sweet cherry. This publicly available genomics resource represents a significant advance in cherry genome-scanning capability that will accelerate marker-locus-trait association discovery, genome structure investigation, and genetic diversity assessment in this diploid-tetraploid crop group. PMID:23284615

  11. Searching for ancient balanced polymorphisms shared between Neanderthals and Modern Humans

    PubMed Central

    Viscardi, Lucas Henriques; Paixão-Côrtes, Vanessa Rodrigues; Comas, David; Salzano, Francisco Mauro; Rovaris, Diego; Bau, Claiton Dotto; Amorim, Carlos Eduardo G.; Bortolini, Maria Cátira

    2018-01-01

    Abstract Hominin evolution is characterized by adaptive solutions often rooted in behavioral and cognitive changes. If balancing selection had an important and long-lasting impact on the evolution of these traits, it can be hypothesized that genes associated with them should carry an excess of shared polymorphisms (trans- SNPs) across recent Homo species. In this study, we investigate the role of balancing selection in human evolution using available exomes from modern (Homo sapiens) and archaic humans (H. neanderthalensis and Denisovan) for an excess of trans-SNP in two gene sets: one associated with the immune system (IMMS) and another one with behavioral system (BEHS). We identified a significant excess of trans-SNPs in IMMS (N=547), of which six of these located within genes previously associated with schizophrenia. No excess of trans-SNPs was found in BEHS, but five genes in this system harbor potential signals for balancing selection and are associated with psychiatric or neurodevelopmental disorders. Our approach evidenced recent Homo trans-SNPs that have been previously implicated in psychiatric diseases such as schizophrenia, suggesting that a genetic repertoire common to the immune and behavioral systems could have been maintained by balancing selection starting before the split between archaic and modern humans. PMID:29658973

  12. Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene.

    PubMed

    Piva, Francesco; Giulietti, Matteo; Baldelli, Luisa; Nardi, Bernardo; Bellantuono, Cesario; Armeni, Tatiana; Saccucci, Franca; Principato, Giovanni

    2011-08-01

    Single nucleotide polymorphisms (SNPs) in serotonin related genes influence mental disorders, responses to pharmacological and psychotherapeutic treatments. In planning association studies, researchers that want to investigate new SNPs have to select some among a large number of candidates. Our aim is to guide researchers in the selection of the most likely phenotype affecting polymorphisms. Here, we studied serotonin receptor 2C (HTR2C) SNPs because, till now, only relatively few of about 2000 are investigated. We used the most updated and assessed bioinformatic tools to predict which variations can give rise to biological effects among 2450 HTR2C SNPs. We suggest 48 SNPs that are worth considering in future association studies in the field of psychiatry, psychology and pharmacogenomics. Moreover, our analyses point out the biological level probably affected, such as transcription, splicing, miRNA regulation and protein structure, thus allowing to suggest future molecular investigations. Although few association studies are available in literature, their results are in agreement with our predictions, showing that our selection methods can help to guide future association studies. Copyright © 2011 John Wiley & Sons, Ltd.

  13. A genetic variant in SLC28A3, rs56350726, is associated with progression to castration-resistant prostate cancer in a Korean population with metastatic prostate cancer.

    PubMed

    Jo, Jung Ku; Oh, Jong Jin; Kim, Yong Tae; Moon, Hong Sang; Choi, Hong Yong; Park, Seunghyun; Ho, Jin-Nyoung; Yoon, Sungroh; Park, Hae Young; Byun, Seok-Soo

    2017-11-14

    Genetic variation which related with progression to castration-resistant prostate cancer (CRPC) during androgen-deprivation therapy (ADT) has not been elucidated in patients with metastatic prostate cancer (mPCa). Therefore, we assessed the association between genetic variats in mPCa and progession to CRPC. Analysis of exome genotypes revealed that 42 SNPs were significantly associated with mPCa. The top five polymorphisms were statistically significantly associated with metastatic disease. In addition, one of these SNPs, rs56350726, was significantly associated with time to CRPC in Kaplan-Meier analysis (Log-rank test, p = 0.011). In multivariable Cox regression, rs56350726 was strongly associated with progression to CRPC (HR = 4.172 95% CI = 1.223-14.239, p = 0.023). We assessed genetic variation among 1000 patients with PCa with or without metastasis, using 242,221 single nucleotide polymorphisms (SNPs) on the custom HumanExome BeadChip v1.0 (Illuminam Inc.). We analyzed the time to CRPC in 110 of the 1000 patients who were treated with ADT. Genetic data were analyzed using unconditional logistic regression and odds ratios calculated as estimates of relative risk of metastasis. We identified SNPs associated with metastasis and analyzed the relationship between these SNPs and time to CRPC in mPCa. Based on a genetic variation, the five top SNPs were observed to associate with mPCa. And one (SLC28A3, rs56350726) of five SNP was found the association with the progression to CRPC in patients with mPCa.

  14. Replication of endometriosis-associated single-nucleotide polymorphisms from genome-wide association studies in a Caucasian population.

    PubMed

    Sundqvist, J; Xu, H; Vodolazkaia, A; Fassbender, A; Kyama, C; Bokor, A; Gemzell-Danielsson, K; D'Hooghe, T M; Falconer, H

    2013-03-01

    Is it possible to replicate the previously identified genetic association of four single-nucleotide polymorphisms (SNPs), rs12700667, rs7798431, rs1250248 and rs7521902, with endometriosis in a Caucasian population? A borderline association was observed for rs1250248 and endometriosis (P = 0.049). However, we could not replicate the other previously identified endometriosis-associated SNPs (rs12700667, rs7798431 and rs7521902) in the same population. Endometriosis is considered a complex disease, influenced by several genetic and environmental factors, as well as interactions between them. Previous studies have found genetic associations with endometriosis for SNPs at the 7p15 and 2q35 loci in a Caucasian population. Allele frequencies of SNPs were investigated in patients with endometriosis and controls. Blood samples and peritoneal biopsies were taken from a Caucasian female population consisting of 1129 patients with endometriosis and 831 controls. DNA was extracted for genotyping. The study was performed at a University hospital and research laboratories. A weak association with endometriosis (all stages) was observed for rs1250248 (P = 0.049). No significant associations were observed for the SNPs rs12700667, rs7798431 and rs7521902. A non-significant trend towards the association of rs1250248 with moderate/severe endometriosis was observed (odds ratio 1.18, 95% confidence interval 0.97-1.44). The inability to confirm all previous findings may result from differences between populations and type II errors. Our result demonstrates the difficulty of identifying common genetic variants in complex diseases. This study was supported by grants from the Karolinska Institutet and Stockholm City County/Karolinska Institutet (ALF), Stockholm, Sweden, Swedish Medical Research Council (K2007-54X-14212-06-3, K2010-54X-14212-09-3), Stockholm, Sweden, Leuven University Research Council (Onderzoeksraad KU Leuven), the Leuven University Hospitals Clinical Research Foundation (Klinisch onderzoeksfonds) and by the National Scientific Foundation (Fonds voor Wetenschappelijk Onderzoek, FWO). The authors have no conflict of interest.

  15. Whole mitochondrial and plastid genome SNP analysis of nine date palm cultivars reveals plastid heteroplasmy and close phylogenetic relationships among cultivars.

    PubMed

    Sabir, Jamal S M; Arasappan, Dhivya; Bahieldin, Ahmed; Abo-Aba, Salah; Bafeel, Sameera; Zari, Talal A; Edris, Sherif; Shokry, Ahmed M; Gadalla, Nour O; Ramadan, Ahmed M; Atef, Ahmed; Al-Kordy, Magdy A; El-Domyati, Fotoh M; Jansen, Robert K

    2014-01-01

    Date palm is a very important crop in western Asia and northern Africa, and it is the oldest domesticated fruit tree with archaeological records dating back 5000 years. The huge economic value of this crop has generated considerable interest in breeding programs to enhance production of dates. One of the major limitations of these efforts is the uncertainty regarding the number of date palm cultivars, which are currently based on fruit shape, size, color, and taste. Whole mitochondrial and plastid genome sequences were utilized to examine single nucleotide polymorphisms (SNPs) of date palms to evaluate the efficacy of this approach for molecular characterization of cultivars. Mitochondrial and plastid genomes of nine Saudi Arabian cultivars were sequenced. For each species about 60 million 100 bp paired-end reads were generated from total genomic DNA using the Illumina HiSeq 2000 platform. For each cultivar, sequences were aligned separately to the published date palm plastid and mitochondrial reference genomes, and SNPs were identified. The results identified cultivar-specific SNPs for eight of the nine cultivars. Two previous SNP analyses of mitochondrial and plastid genomes identified substantial intra-cultivar ( = intra-varietal) polymorphisms in organellar genomes but these studies did not properly take into account the fact that nearly half of the plastid genome has been integrated into the mitochondrial genome. Filtering all sequencing reads that mapped to both organellar genomes nearly eliminated mitochondrial heteroplasmy but all plastid SNPs remained heteroplasmic. This investigation provides valuable insights into how to deal with interorganellar DNA transfer in performing SNP analyses from total genomic DNA. The results confirm recent suggestions that plastid heteroplasmy is much more common than previously thought. Finally, low levels of sequence variation in plastid and mitochondrial genomes argue for using nuclear SNPs for molecular characterization of date palm cultivars.

  16. Marker-assisted selection for resistance to bacterial cold water disease in a commercial rainbow trout breeding population

    USDA-ARS?s Scientific Manuscript database

    Bacterial cold water disease (BCWD), caused by Flavobacterium psychrophilum, is an endemic and problematic disease in rainbow trout (Oncorhynchus mykiss) aquaculture. Previously, we have identified SNPs (single nucleotide polymorphisms) associated with BCWD resistance in rainbow trout. The objective...

  17. Epicuticular waxes and thrips resistance in onion

    USDA-ARS?s Scientific Manuscript database

    Next-generation sequencing of normalized cDNAs from two inbred lines of onion revealed over 3000 well supported single nucleotide polymorphisms (SNPs), of which over 800 have been mapped. This SNP-based map was used to identify quantitative trait loci (QTL) controlling the amounts and types of epicu...

  18. Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

    PubMed

    Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

    2015-03-15

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Genetic Diversity and Population Structure of F3:6 Nebraska Winter Wheat Genotypes Using Genotyping-By-Sequencing.

    PubMed

    Eltaher, Shamseldeen; Sallam, Ahmed; Belamkar, Vikas; Emara, Hamdy A; Nower, Ahmed A; Salem, Khaled F M; Poland, Jesse; Baenziger, Peter S

    2018-01-01

    The availability of information on the genetic diversity and population structure in wheat ( Triticum aestivum L.) breeding lines will help wheat breeders to better use their genetic resources and manage genetic variation in their breeding program. The recent advances in sequencing technology provide the opportunity to identify tens or hundreds of thousands of single nucleotide polymorphism (SNPs) in large genome species (e.g., wheat). These SNPs can be utilized for understanding genetic diversity and performing genome wide association studies (GWAS) for complex traits. In this study, the genetic diversity and population structure were investigated in a set of 230 genotypes (F 3:6 ) derived from various crosses as a prerequisite for GWAS and genomic selection. Genotyping-by-sequencing provided 25,566 high-quality SNPs. The polymorphism information content (PIC) across chromosomes ranged from 0.09 to 0.37 with an average of 0.23. The distribution of SNPs markers on the 21 chromosomes ranged from 319 on chromosome 3D to 2,370 on chromosome 3B. The analysis of population structure revealed three subpopulations (G1, G2, and G3). Analysis of molecular variance identified 8% variance among and 92% within subpopulations. Of the three subpopulations, G2 had the highest level of genetic diversity based on three genetic diversity indices: Shannon's information index ( I ) = 0.494, diversity index ( h ) = 0.328 and unbiased diversity index (uh) = 0.331, while G3 had lowest level of genetic diversity ( I = 0.348, h = 0.226 and uh = 0.236). This high genetic diversity identified among the subpopulations can be used to develop new wheat cultivars.

  20. XRCC1 Polymorphism Associated With Late Toxicity After Radiation Therapy in Breast Cancer Patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seibold, Petra; Behrens, Sabine; Schmezer, Peter

    Purpose: To identify single-nucleotide polymorphisms (SNPs) in oxidative stress–related genes associated with risk of late toxicities in breast cancer patients receiving radiation therapy. Methods and Materials: Using a 2-stage design, 305 SNPs in 59 candidate genes were investigated in the discovery phase in 753 breast cancer patients from 2 prospective cohorts from Germany. The 10 most promising SNPs in 4 genes were evaluated in the replication phase in up to 1883 breast cancer patients from 6 cohorts identified through the Radiogenomics Consortium. Outcomes of interest were late skin toxicity and fibrosis of the breast, as well as an overall toxicity score (Standardized Totalmore » Average Toxicity). Multivariable logistic and linear regression models were used to assess associations between SNPs and late toxicity. A meta-analysis approach was used to summarize evidence. Results: The association of a genetic variant in the base excision repair gene XRCC1, rs2682585, with normal tissue late radiation toxicity was replicated in all tested studies. In the combined analysis of discovery and replication cohorts, carrying the rare allele was associated with a significantly lower risk of skin toxicities (multivariate odds ratio 0.77, 95% confidence interval 0.61-0.96, P=.02) and a decrease in Standardized Total Average Toxicity scores (−0.08, 95% confidence interval −0.15 to −0.02, P=.016). Conclusions: Using a stage design with replication, we identified a variant allele in the base excision repair gene XRCC1 that could be used in combination with additional variants for developing a test to predict late toxicities after radiation therapy in breast cancer patients.« less

  1. Genetic Diversity and Population Structure of F3:6 Nebraska Winter Wheat Genotypes Using Genotyping-By-Sequencing

    PubMed Central

    Eltaher, Shamseldeen; Sallam, Ahmed; Belamkar, Vikas; Emara, Hamdy A.; Nower, Ahmed A.; Salem, Khaled F. M.; Poland, Jesse; Baenziger, Peter S.

    2018-01-01

    The availability of information on the genetic diversity and population structure in wheat (Triticum aestivum L.) breeding lines will help wheat breeders to better use their genetic resources and manage genetic variation in their breeding program. The recent advances in sequencing technology provide the opportunity to identify tens or hundreds of thousands of single nucleotide polymorphism (SNPs) in large genome species (e.g., wheat). These SNPs can be utilized for understanding genetic diversity and performing genome wide association studies (GWAS) for complex traits. In this study, the genetic diversity and population structure were investigated in a set of 230 genotypes (F3:6) derived from various crosses as a prerequisite for GWAS and genomic selection. Genotyping-by-sequencing provided 25,566 high-quality SNPs. The polymorphism information content (PIC) across chromosomes ranged from 0.09 to 0.37 with an average of 0.23. The distribution of SNPs markers on the 21 chromosomes ranged from 319 on chromosome 3D to 2,370 on chromosome 3B. The analysis of population structure revealed three subpopulations (G1, G2, and G3). Analysis of molecular variance identified 8% variance among and 92% within subpopulations. Of the three subpopulations, G2 had the highest level of genetic diversity based on three genetic diversity indices: Shannon’s information index (I) = 0.494, diversity index (h) = 0.328 and unbiased diversity index (uh) = 0.331, while G3 had lowest level of genetic diversity (I = 0.348, h = 0.226 and uh = 0.236). This high genetic diversity identified among the subpopulations can be used to develop new wheat cultivars. PMID:29593779

  2. Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.

    PubMed

    Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K

    2017-05-01

    The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.

  3. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    PubMed

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  4. Associations between RNA splicing regulatory variants of stemness-related genes and racial disparities in susceptibility to prostate cancer.

    PubMed

    Wang, Yanru; Freedman, Jennifer A; Liu, Hongliang; Moorman, Patricia G; Hyslop, Terry; George, Daniel J; Lee, Norman H; Patierno, Steven R; Wei, Qingyi

    2017-08-15

    Evidence suggests that cells with a stemness phenotype play a pivotal role in oncogenesis, and prostate cells exhibiting this phenotype have been identified. We used two genome-wide association study (GWAS) datasets of African descendants, from the Multiethnic/Minority Cohort Study of Diet and Cancer (MEC) and the Ghana Prostate Study, and two GWAS datasets of non-Hispanic whites, from the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial and the Breast and Prostate Cancer Cohort Consortium (BPC3), to analyze the associations between genetic variants of stemness-related genes and racial disparities in susceptibility to prostate cancer. We evaluated associations of single-nucleotide polymorphisms (SNPs) in 25 stemness-related genes with prostate cancer risk in 1,609 cases and 2,550 controls of non-Hispanic whites (4,934 SNPs) and 1,144 cases and 1,116 controls of African descendants (5,448 SNPs) with correction by false discovery rate ≤0.2. We identified 32 SNPs in five genes (TP63, ALDH1A1, WNT1, MET and EGFR) that were significantly associated with prostate cancer risk, of which six SNPs in three genes (TP63, ALDH1A1 and WNT1) and eight EGFR SNPs showed heterogeneity in susceptibility between these two racial groups. In addition, 13 SNPs in MET and one in ALDH1A1 were found only in African descendants. The in silico bioinformatics analyses revealed that EGFR rs2072454 and SNPs in linkage with the identified SNPs in MET and ALDH1A1 (r 2  > 0.6) were predicted to regulate RNA splicing. These variants may serve as novel biomarkers for racial disparities in prostate cancer risk. © 2017 UICC.

  5. GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

    PubMed

    Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

    2012-05-01

    We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

  6. Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.

    PubMed

    Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao

    2017-02-07

    Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.

  7. Combining Genome Wide Association Study and lung eQTL analysis provides evidence for novel genes associated with asthma

    PubMed Central

    Nieuwenhuis, Maartje A.; Siedlinski, Matteusz; van den Berge, Maarten; Granell, Raquel; Li, Xingnan; Niens, Marijke; van der Vlies, Pieter; Altmüller, Janine; Nürnberg, Peter; Kerkhof, Marjan; van Schayck, Onno C.; Riemersma, Ronald A.; van der Molen, Thys; de Monchy, Jan G.; Bossé, Yohan; Sandford, Andrew; Bruijnzeel-Koomen, Carla A.; van Wijk, Roy G.; ten Hacken, Nick H.; Timens, Wim; Boezen, H. Marike; Henderson, John; Kabesch, Michael; Vonk, Judith M.; Postma, Dirkje S.; Koppelman, Gerard H.

    2016-01-01

    Background Genome wide association studies (GWAS) of asthma have identified single nucleotide polymorphisms (SNPs) that modestly increase the risk for asthma. This could be due to phenotypic heterogeneity of asthma. Bronchial hyperresponsiveness (BHR) is a phenotypic hallmark of asthma. We aim to identify susceptibility genes for asthma combined with BHR and analyse the presence of cis-eQTLs among replicated SNPs. Secondly, we compare the genetic association of SNPs previously associated with (doctor diagnosed) asthma to our GWAS of asthma with BHR. Methods A GWAS was performed in 920 asthmatics with BHR and 980 controls. Top SNPs of our GWAS were analysed in four replication cohorts and lung cis-eQTL analysis was performed on replicated SNPs. We investigated association of SNPs previously associated with asthma in our data. Results 368 SNPs were followed up for replication. Six SNPs in genes encoding ABI3BP, NAF1, MICA and the 17q21 locus replicated in one or more cohorts, with one locus (17q21) achieving genome wide significance after meta-analysis. Five out of 6 replicated SNPs regulated 35 gene transcripts in whole lung. Eight of 20 asthma associated SNPs from previous GWAS were significantly associated with asthma and BHR. Three SNPs, in IL-33 and GSDMB, showed larger effect sizes in our data compared to published literature. Conclusions Combining GWAS with subsequent lung eQTL analysis revealed disease associated SNPs regulating lung mRNA expression levels of potential new asthma genes. Adding BHR to the asthma definition does not lead to an overall larger genetic effect size than analysing (doctor’s diagnosed) asthma. PMID:27439200

  8. Resequencing and Analysis of Variation in the TCF7L2 Gene in African Americans Suggests That SNP rs7903146 Is the Causal Diabetes Susceptibility Variant

    PubMed Central

    Palmer, Nicholette D.; Hester, Jessica M.; An, S. Sandy; Adeyemo, Adebowale; Rotimi, Charles; Langefeld, Carl D.; Freedman, Barry I.; Ng, Maggie C.Y.; Bowden, Donald W.

    2011-01-01

    OBJECTIVE Variation in the transcription factor 7-like 2 (TCF7L2) locus is associated with type 2 diabetes across multiple ethnicities. The aim of this study was to elucidate which variant in TCF7L2 confers diabetes susceptibility in African Americans. RESEARCH DESIGN AND METHODS Through the evaluation of tagging single nucleotide polymorphisms (SNPs), type 2 diabetes susceptibility was limited to a 4.3-kb interval, which contains the YRI (African) linkage disequilibrium (LD) block containing rs7903146. To better define the relationship between type 2 diabetes risk and genetic variation we resequenced this 4.3-kb region in 96 African American DNAs. Thirty-three novel and 13 known SNPs were identified: 20 with minor allele frequencies (MAF) >0.05 and 12 with MAF >0.10. These polymorphisms and the previously identified DG10S478 microsatellite were evaluated in African American type 2 diabetic cases (n = 1,033) and controls (n = 1,106). RESULTS Variants identified from direct sequencing and databases were genotyped or imputed. Fifteen SNPs showed association with type 2 diabetes (P < 0.05) with rs7903146 being the most significant (P = 6.32 × 10−6). Results of imputation, haplotype, and conditional analysis of SNPs were consistent with rs7903146 being the trait-defining SNP. Analysis of the DG10S478 microsatellite, which is outside the 4.3-kb LD block, revealed consistent association of risk allele 8 with type 2 diabetes (odds ratio [OR] = 1.33; P = 0.022) as reported in European populations; however, allele 16 (MAF = 0.016 cases and 0.032 controls) was strongly associated with reduced risk (OR = 0.39; P = 5.02 × 10−5) in contrast with previous studies. CONCLUSIONS In African Americans, these observations suggest that rs7903146 is the trait-defining polymorphism associated with type 2 diabetes risk. Collectively, these results support ethnic differences in type 2 diabetes associations. PMID:20980453

  9. Oxytocin receptor gene variations predict neural and behavioral response to oxytocin in autism

    PubMed Central

    Watanabe, Takamitsu; Otowa, Takeshi; Abe, Osamu; Kuwabara, Hitoshi; Aoki, Yuta; Natsubori, Tatsunobu; Takao, Hidemasa; Kakiuchi, Chihiro; Kondo, Kenji; Ikeda, Masashi; Iwata, Nakao; Kasai, Kiyoto; Sasaki, Tsukasa

    2017-01-01

    Abstract Oxytocin appears beneficial for autism spectrum disorder (ASD), and more than 20 single-nucleotide polymorphisms (SNPs) in oxytocin receptor (OXTR) are relevant to ASD. However, neither biological functions of OXTR SNPs in ASD nor critical OXTR SNPs that determine oxytocin’s effects on ASD remains known. Here, using a machine-learning algorithm that was designed to evaluate collective effects of multiple SNPs and automatically identify most informative SNPs, we examined relationships between 27 representative OXTR SNPs and six types of behavioral/neural response to oxytocin in ASD individuals. The oxytocin effects were extracted from our previous placebo-controlled within-participant clinical trial administering single-dose intranasal oxytocin to 38 high-functioning adult Japanese ASD males. Consequently, we identified six different SNP sets that could accurately predict the six different oxytocin efficacies, and confirmed the robustness of these SNP selections against variations of the datasets and analysis parameters. Moreover, major alleles of several prominent OXTR SNPs—including rs53576 and rs2254298—were found to have dissociable effects on the oxytocin efficacies. These findings suggest biological functions of the OXTR SNP variants on autistic oxytocin responses, and implied that clinical oxytocin efficacy may be genetically predicted before its actual administration, which would contribute to establishment of future precision medicines for ASD. PMID:27798253

  10. Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements

    PubMed Central

    Hayes, James E.; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J.

    2015-01-01

    Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin’s lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well. PMID:26422229

  11. OAS single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine

    PubMed Central

    Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2010-01-01

    Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393

  12. IL2RA/CD25 Gene Polymorphisms: Uneven Association with Multiple Sclerosis (MS) and Type 1 Diabetes (T1D)

    PubMed Central

    Alcina, Antonio; Fedetz, María; Ndagire, Dorothy; Fernández, Oscar; Leyva, Laura; Guerrero, Miguel; Abad-Grau, María M.; Arnal, Carmen; Delgado, Concepción; Lucas, Miguel; Izquierdo, Guillermo; Matesanz, Fuencisla

    2009-01-01

    Background IL-2 receptor (IL2R) alpha is the specific component of the high affinity IL2R system involved in the immune response and in the control of autoimmunity. Methods and Results Here we perform a replication and fine mapping of the IL2RA gene region analyzing 3 SNPs previously associated with multiple sclerosis (MS) and 5 SNPs associated with type 1 diabetes (T1D) in a collection of 798 MS patients and 927 matched Caucasian controls from the south of Spain. We observed association with MS in 6 of 8 SNPs. The rs1570538, at the 3′- UTR extreme of the gene, previously reported to have a weak association with MS, is replicated here (P = 0.032). The most associated T1D SNP (rs41295061) was not associated with MS in the present study. However, the rs35285258, belonging to another independent group of SNPs associated with T1D, showed the maximal association in this study but different risk allele. We replicated the association of only one (rs2104286) of the two IL2RA SNPs identified in the recently performed genome-wide association study of MS. Conclusions These findings confirm and extend the association of this gene with MS and reveal a genetic heterogeneity of the associated polymorphisms and risk alleles between MS and T1D suggesting different immunopathological roles of IL2RA in these two diseases. PMID:19125193

  13. Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

    PubMed Central

    Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

    2011-01-01

    DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

  14. Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

    PubMed Central

    Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan

    2015-01-01

    The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

  15. Impact of obesity-related genes in Spanish population

    PubMed Central

    2013-01-01

    Background The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis. Results Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%). Conclusion The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population. PMID:24267414

  16. Impact of obesity-related genes in Spanish population.

    PubMed

    Martínez-García, Fernando; Mansego, María L; Rojo-Martínez, Gemma; De Marco-Solar, Griselda; Morcillo, Sonsoles; Soriguer, Federico; Redón, Josep; Pineda Alonso, Monica; Martín-Escudero, Juan C; Cooper, Richard S; Chaves, Felipe J

    2013-11-23

    The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis. Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%). The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population.

  17. RNA-Seq identifies SNPs associated with muscle yield and quality in rainbow trout

    USDA-ARS?s Scientific Manuscript database

    Rainbow trout (Oncorhynchus mykiss) is one of the top five sport fish species in North America and the second most widely cultivated fish species for food. Quality attributes of fish flesh are important determinants of profitability for the food fish aquaculture industry. Single nucleotide polymorph...

  18. Genome wide association analysis for seedling response traits to thermal stress in sorghum germplasm

    USDA-ARS?s Scientific Manuscript database

    The sorghum association panel exhibited extensive variation for seedling traits under cold and heat stress. Genome-wide analyses identified thirty single nucleotide polymorphisms (SNPs) that were strongly associated with traits measured at seedling stage under cold stress and tagged genes that act a...

  19. Novel approach identifies SNPs in SLC2A10 and KCNK9 with evidence for parent-of-origin effect on body mass index.

    PubMed

    Hoggart, Clive J; Venturini, Giulia; Mangino, Massimo; Gomez, Felicia; Ascari, Giulia; Zhao, Jing Hua; Teumer, Alexander; Winkler, Thomas W; Tšernikova, Natalia; Luan, Jian'an; Mihailov, Evelin; Ehret, Georg B; Zhang, Weihua; Lamparter, David; Esko, Tõnu; Macé, Aurelien; Rüeger, Sina; Bochud, Pierre-Yves; Barcella, Matteo; Dauvilliers, Yves; Benyamin, Beben; Evans, David M; Hayward, Caroline; Lopez, Mary F; Franke, Lude; Russo, Alessia; Heid, Iris M; Salvi, Erika; Vendantam, Sailaja; Arking, Dan E; Boerwinkle, Eric; Chambers, John C; Fiorito, Giovanni; Grallert, Harald; Guarrera, Simonetta; Homuth, Georg; Huffman, Jennifer E; Porteous, David; Moradpour, Darius; Iranzo, Alex; Hebebrand, Johannes; Kemp, John P; Lammers, Gert J; Aubert, Vincent; Heim, Markus H; Martin, Nicholas G; Montgomery, Grant W; Peraita-Adrados, Rosa; Santamaria, Joan; Negro, Francesco; Schmidt, Carsten O; Scott, Robert A; Spector, Tim D; Strauch, Konstantin; Völzke, Henry; Wareham, Nicholas J; Yuan, Wei; Bell, Jordana T; Chakravarti, Aravinda; Kooner, Jaspal S; Peters, Annette; Matullo, Giuseppe; Wallaschofski, Henri; Whitfield, John B; Paccaud, Fred; Vollenweider, Peter; Bergmann, Sven; Beckmann, Jacques S; Tafti, Mehdi; Hastie, Nicholas D; Cusi, Daniele; Bochud, Murielle; Frayling, Timothy M; Metspalu, Andres; Jarvelin, Marjo-Riitta; Scherag, André; Smith, George Davey; Borecki, Ingrid B; Rousson, Valentin; Hirschhorn, Joel N; Rivolta, Carlo; Loos, Ruth J F; Kutalik, Zoltán

    2014-07-01

    The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity.

  20. Novel Approach Identifies SNPs in SLC2A10 and KCNK9 with Evidence for Parent-of-Origin Effect on Body Mass Index

    PubMed Central

    Hoggart, Clive J.; Venturini, Giulia; Mangino, Massimo; Gomez, Felicia; Ascari, Giulia; Zhao, Jing Hua; Teumer, Alexander; Winkler, Thomas W.; Tšernikova, Natalia; Luan, Jian'an; Mihailov, Evelin; Ehret, Georg B.; Zhang, Weihua; Lamparter, David; Esko, Tõnu; Macé, Aurelien; Rüeger, Sina; Bochud, Pierre-Yves; Barcella, Matteo; Dauvilliers, Yves; Benyamin, Beben; Evans, David M.; Hayward, Caroline; Lopez, Mary F.; Franke, Lude; Russo, Alessia; Heid, Iris M.; Salvi, Erika; Vendantam, Sailaja; Arking, Dan E.; Boerwinkle, Eric; Chambers, John C.; Fiorito, Giovanni; Grallert, Harald; Guarrera, Simonetta; Homuth, Georg; Huffman, Jennifer E.; Porteous, David; Moradpour, Darius; Iranzo, Alex; Hebebrand, Johannes; Kemp, John P.; Lammers, Gert J.; Aubert, Vincent; Heim, Markus H.; Martin, Nicholas G.; Montgomery, Grant W.; Peraita-Adrados, Rosa; Santamaria, Joan; Negro, Francesco; Schmidt, Carsten O.; Scott, Robert A.; Spector, Tim D.; Strauch, Konstantin; Völzke, Henry; Wareham, Nicholas J.; Yuan, Wei; Bell, Jordana T.; Chakravarti, Aravinda; Kooner, Jaspal S.; Peters, Annette; Matullo, Giuseppe; Wallaschofski, Henri; Whitfield, John B.; Paccaud, Fred; Vollenweider, Peter; Bergmann, Sven; Beckmann, Jacques S.; Tafti, Mehdi; Hastie, Nicholas D.; Cusi, Daniele; Bochud, Murielle; Frayling, Timothy M.; Metspalu, Andres; Jarvelin, Marjo-Riitta; Scherag, André; Smith, George Davey; Borecki, Ingrid B.; Rousson, Valentin; Hirschhorn, Joel N.; Rivolta, Carlo; Loos, Ruth J. F.; Kutalik, Zoltán

    2014-01-01

    The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity. PMID:25078964

  1. Genome-wide DNA polymorphism in the indica rice varieties RGD-7S and Taifeng B as revealed by whole genome re-sequencing.

    PubMed

    Fu, Chong-Yun; Liu, Wu-Ge; Liu, Di-Lin; Li, Ji-Hua; Zhu, Man-Shan; Liao, Yi-Long; Liu, Zhen-Rong; Zeng, Xue-Qin; Wang, Feng

    2016-03-01

    Next-generation sequencing technologies provide opportunities to further understand genetic variation, even within closely related cultivars. We performed whole genome resequencing of two elite indica rice varieties, RGD-7S and Taifeng B, whose F1 progeny showed hybrid weakness and hybrid vigor when grown in the early- and late-cropping seasons, respectively. Approximately 150 million 100-bp pair-end reads were generated, which covered ∼86% of the rice (Oryza sativa L. japonica 'Nipponbare') reference genome. A total of 2,758,740 polymorphic sites including 2,408,845 SNPs and 349,895 InDels were detected in RGD-7S and Taifeng B, respectively. Applying stringent parameters, we identified 961,791 SNPs and 46,640 InDels between RGD-7S and Taifeng B (RGD-7S/Taifeng B). The density of DNA polymorphisms was 256.8 SNPs and 12.5 InDels per 100 kb for RGD-7S/Taifeng B. Copy number variations (CNVs) were also investigated. In RGD-7S, 1989 of 2727 CNVs were overlapped in 218 genes, and 1231 of 2010 CNVs were annotated in 175 genes in Taifeng B. In addition, we verified a subset of InDels in the interval of hybrid weakness genes, Hw3 and Hw4, and obtained some polymorphic InDel markers, which will provide a sound foundation for cloning hybrid weakness genes. Analysis of genomic variations will also contribute to understanding the genetic basis of hybrid weakness and heterosis.

  2. Polymorphisms in the prostaglandin receptor EP2 gene confers susceptibility to tuberculosis.

    PubMed

    Liang, Li; Zhang, Qing; Luo, Liu-Lin; Yue, Jun; Zhao, Yan-Lin; Han, Min; Liu, Li-Rong; Xiao, He-Ping

    2016-12-01

    Prostaglandin E2 (PGE2) is an important lipid mediator of the inflammatory immune response during acute and chronic infections. PGE2 modulates a variety of immune functions via four receptors (EP1-EP4), which mediate distinct PGE2 effects. Mice lacking EP2 are more susceptible to infection by Mycobacterium tuberculosis (M.tb), have a higher bacterial load, and increase size and number of granulomatous lesions. Our aim was to assess whether single nucleotide polymorphisms (SNPs) in EP2 increase the risk of tuberculosis. DNA re-sequencing revealed five common EP2 variants in the Chinese Han population. We sequenced the EP2 gene from 600 patients and 572 healthy controls to measure SNP frequencies in association with tuberculosis infections (TB) within the population. The rs937337 polymorphism is associated with increased risk to tuberculosis (p=0.0044, odds ratio [OR], 1.67; 95% confidential interval,1.22-2.27). The rs937337 AA genotype and the rs1042618 CC genotype were significantly associated with TB. An estimation of the frequencies of haplotypes revealed a single protective haplotype GACGC for tuberculosis (p=0.00096, odds ratio [OR], 0.56; 95% confidential interval, 0.41-0.77). Furthermore, we determined that the remaining SNPs of EP2 were nominally associated with clinical patterns of disease. We identified genetic polymorphisms in EP2 associated with susceptibility to tuberculosis within a Chinese population. Our data support that EP2 SNPs are genetic predispositions of increased susceptibility to TB and to different clinical patterns of disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Association of Symptoms and Severity of Rift Valley Fever with Genetic Polymorphisms in Human Innate Immune Pathways

    PubMed Central

    Hise, Amy G.; Traylor, Zachary; Hall, Noémi B.; Sutherland, Laura J.; Dahir, Saidi; Ermler, Megan E.; Muiruri, Samuel; Muchiri, Eric M.; Kazura, James W.; LaBeaud, A. Desirée; King, Charles H.; Stein, Catherine M.

    2015-01-01

    Background Multiple recent outbreaks of Rift Valley Fever (RVF) in Africa, Madagascar, and the Arabian Peninsula have resulted in significant morbidity, mortality, and financial loss due to related livestock epizootics. Presentation of human RVF varies from mild febrile illness to meningoencephalitis, hemorrhagic diathesis, and/or ophthalmitis with residual retinal scarring, but the determinants for severe disease are not understood. The aim of the present study was to identify human genes associated with RVF clinical disease in a high-risk population in Northeastern Province, Kenya. Methodology/Principal Findings We conducted a cross-sectional survey among residents (N = 1,080; 1–85 yrs) in 6 villages in the Sangailu Division of Ijara District. Participants completed questionnaires on past symptoms and exposures, physical exam, vision testing, and blood collection. Single nucleotide polymorphism (SNP) genotyping was performed on a subset of individuals who reported past clinical symptoms consistent with RVF and unrelated subjects. Four symptom clusters were defined: meningoencephalitis, hemorrhagic fever, eye disease, and RVF-not otherwise specified. SNPs in 46 viral sensing and response genes were investigated. Association was analyzed between SNP genotype, serology and RVF symptom clusters. The meningoencephalitis symptom phenotype cluster among seropositive patients was associated with polymorphisms in DDX58/RIG-I and TLR8. Having three or more RVF-related symptoms was significantly associated with polymorphisms in TICAM1/TRIF, MAVS, IFNAR1 and DDX58/RIG-I. SNPs significantly associated with eye disease included three different polymorphisms TLR8 and hemorrhagic fever symptoms associated with TLR3, TLR7, TLR8 and MyD88. Conclusions/Significance Of the 46 SNPs tested, TLR3, TLR7, TLR8, MyD88, TRIF, MAVS, and RIG-I were repeatedly associated with severe symptomatology, suggesting that these genes may have a robust association with RVFV-associated clinical outcomes. Studies of these and related genetic polymorphisms are warranted to advance understanding of RVF pathogenesis. PMID:25756647

  4. RTEL1 tagging SNPs and haplotypes were associated with glioma development.

    PubMed

    Li, Gang; Jin, Tianbo; Liang, Hongjuan; Zhang, Zhiguo; He, Shiming; Tu, Yanyang; Yang, Haixia; Geng, Tingting; Cui, Guangbin; Chen, Chao; Gao, Guodong

    2013-05-17

    As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case-control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF)>5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P=0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P=0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype "GG" of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P=0.0002), while the genotype "CC" of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P=0.0003). Furthermore, haplotype "GCT" in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher's P=0.0005; Pearson's P=0.0005), and haplotype "ATT" was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher's P=0.0013; Pearson's P=0.0013). Two single variants, the genotypes of "GG" of rs6010620 and "CC" of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1993021136961998.

  5. Genome-wide association analysis for feed efficiency in Angus cattle.

    PubMed

    Rolf, M M; Taylor, J F; Schnabel, R D; McKay, S D; McClure, M C; Northcutt, S L; Kerley, M S; Weaber, R L

    2012-08-01

    Estimated breeding values for average daily feed intake (AFI; kg/day), residual feed intake (RFI; kg/day) and average daily gain (ADG; kg/day) were generated using a mixed linear model incorporating genomic relationships for 698 Angus steers genotyped with the Illumina BovineSNP50 assay. Association analyses of estimated breeding values (EBVs) were performed for 41,028 single nucleotide polymorphisms (SNPs), and permutation analysis was used to empirically establish the genome-wide significance threshold (P < 0.05) for each trait. SNPs significantly associated with each trait were used in a forward selection algorithm to identify genomic regions putatively harbouring genes with effects on each trait. A total of 53, 66 and 68 SNPs explained 54.12% (24.10%), 62.69% (29.85%) and 55.13% (26.54%) of the additive genetic variation (when accounting for the genomic relationships) in steer breeding values for AFI, RFI and ADG, respectively, within this population. Evaluation by pathway analysis revealed that many of these SNPs are in genomic regions that harbour genes with metabolic functions. The presence of genetic correlations between traits resulted in 13.2% of SNPs selected for AFI and 4.5% of SNPs selected for RFI also being selected for ADG in the analysis of breeding values. While our study identifies panels of SNPs significant for efficiency traits in our population, validation of all SNPs in independent populations will be necessary before commercialization. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

  6. Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

    PubMed

    Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

    2014-07-01

    The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

  7. Genetic Polymorphisms are Associated with Hair, Blood, and Urine Mercury Levels in the American Dental Association (ADA) Study Participants

    PubMed Central

    Parajuli, Rajendra Prasad; Goodrich, Jaclyn M.; Chou, Hwai-Nan; Gruninger, Stephen E.; Dolinoy, Dana C.; Franzblau, Alfred; Basu, Niladri

    2015-01-01

    Background/Aims Mercury (Hg) is a potent toxicant of concern to the general public. Recent studies suggest that several genes that mediate Hg metabolism are polymorphic. We hypothesize that single nucleotide polymorphisms (SNPs) in such genes may underline inter-individual differences in exposure biomarker concentrations. Methods Dental professionals were recruited during the American Dental Association (ADA) 2012 Annual Meeting. Samples of hair, blood, and urine were collected for quantifying Hg levels and genotyping (88 SNPs in classes relevant to Hg toxicokinetics including glutathione metabolism, selenoproteins, metallothioneins, and xenobiotic transporters). Questionnaires were administrated to obtain information on demographics and sources of Hg exposure (e.g., fish consumption and use of dental amalgam). Here, we report results for 380 participants with complete genotype and Hg biomarker datasets. ANOVA and linear regressions were used for statistical analysis. Results Mean (geometric) Hg levels in hair (hHg), blood (bHg), urine (uHg), and the average estimated Hg intake from fish were 0.62μg/g, 3.75μg/L, 1.32μg/L, and 0.12μg/kg body weight/day, respectively. Out of 88 SNPs successfully genotyped, Hg biomarker levels differed by genotype for 25 SNPs, one of which remained significant following Bonferroni correction in ANOVA. When the associations between sources of Hg exposure and SNPs were analyzed with respect to Hg biomarker concentrations, 38 SNPs had significant main effects and/or gene-Hg exposure source interactions. Twenty-five, 23, and four SNPs showed significant main effects and/or interactions for hHg, bHg, and uHg levels, respectively (p<0.05), and six SNPs (in GCLC, MT1M, MT4, ATP7B, and BDNF) remained significant following Bonferroni correction. Conclusion The findings suggest that polymorphisms in environmentally-responsive genes can influence Hg biomarker levels. Hence, consideration of such gene-environment factors may improve the ability to assess the health risks of Hg more precisely. PMID:26673400

  8. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  9. Detection of a single nucleotide polymorphism in the human alpha-lactalbumin gene: implications for human milk proteins.

    PubMed

    Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo

    2005-05-01

    Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their implications for protein bioactivity and infant nutrition need to be considered.

  10. Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

    PubMed

    Hughes, Austin L

    2013-02-15

    The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Diet-gene interactions underlie metabolic individuality and influence brain development: implications for clinical practice derived from studies on choline metabolism.

    PubMed

    Zeisel, Steven H

    2012-01-01

    One of the underlying mechanisms for metabolic individuality is genetic variation. Single nucleotide polymorphisms (SNPs) in genes of metabolic pathways can create metabolic inefficiencies that alter the dietary requirement for, and responses to, nutrients. These SNPs can be detected using genetic profiling and the metabolic inefficiencies they cause can be detected using metabolomic profiling. Studies on the human dietary requirement for choline illustrate how useful these new approaches can be, as this requirement is influenced by SNPs in genes of choline and folate metabolism. In adults, these SNPs determine whether people develop fatty liver, liver damage and muscle damage when eating diets low in choline. Because choline is very important for fetal development, these SNPs may identify women who need to eat more choline during pregnancy. Some of the actions of choline are mediated by epigenetic mechanisms that permit 'retuning' of metabolic pathways during early life. Copyright © 2012 S. Karger AG, Basel.

  12. No association between telomere length-related loci and number of cutaneous nevi.

    PubMed

    Li, Xin; Liang, Geyu; Du, Mengmeng; De Vivo, Immaculata; Nan, Hongmei

    2016-12-13

    Longer telomeres have been associated both with increased melanoma risk and increased nevus counts. Nevus count is one of the strongest risk factors for melanoma. Recent data showed that a genetic score derived by telomere length-related single nucleotide polymorphisms (SNPs) was strongly associated with melanoma risk; however, the relationships between these SNPs and number of cutaneous nevi have not been investigated. We evaluated the associations between telomere length-related SNPs reported by previous genome-wide association study (GWAS) and nevus counts among 15,955 participants of European Ancestry in the Nurses' Health Study and Health Professionals Follow-up Study. None of the SNPs was associated with nevus counts, nor was the genetic score combining the dosage of alleles related to increased telomere length. The telomere length-related SNPs identified by published GWAS do not appear to play an important role in nevus formation. Genetic determinants of telomere length reported by GWAS do not explain the observed epidemiologic association between telomere length and nevus counts.

  13. Association between long non-coding RNA polymorphisms and cancer risk: a meta-analysis.

    PubMed

    Huang, Xin; Zhang, Weiyue; Shao, Zengwu

    2018-05-25

    Several studies have suggested that long non-coding RNA (lncRNA) gene polymorphisms are associated with cancer risk. In the present study, we conducted a meta-analysis related to studies on the association between lncRNA single-nucleotide polymorphisms (SNPs) and the overall risk of cancer. A total 12 SNPs in five common lncRNA genes were finally included in the meta-analysis. In the lncRNA antisense noncoding RNA in the INK4 locus (ANRIL), the rs1333048 A/C, rs4977574 A/G, and rs10757278 A/G polymorphisms, but not rs1333045 C/T, were correlated with overall cancer risk. Our study also demonstrated that other SNPs were correlated with overall cancer risk, namely, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1, rs619586 A/G), HOXA distal transcript antisense RNA (HOTTIP, rs1859168 A/C) and highly up-regulated in liver cancer (HULC, rs7763881 A/C). Moreover, four prostate cancer‑associated non‑coding RNA 1 (PRNCR1, rs16901946 G/A, rs13252298 G/A, rs1016343 T/C, and rs1456315 G/A) SNPs were in association with cancer risk. No association was found between the PRNCR1 (rs7007694 C/T) SNP and the risk of cancer. In conclusion, our results suggest that several studied lncRNA SNPs are associated with overall cancer risk. Therefore, they might be potential predictive biomarkers for the risk of cancer. More studies based on larger sample sizes and more lncRNA SNPs are warranted to confirm these findings. ©2018 The Author(s).

  14. The First Genetic Map in Sweet Osmanthus (Osmanthus fragrans Lour.) Using Specific Locus Amplified Fragment Sequencing

    PubMed Central

    He, Yanxia; Yuan, Wangjun; Dong, Meifang; Han, Yuanji; Shang, Fude

    2017-01-01

    Osmanthus fragrans is an ornamental plant of substantial commercial value, and no genetic linkage maps of this species have previously been reported. Specific-locus amplified fragment sequencing (SLAF-seq) is a recently developed technology that allows massive single nucleotide polymorphisms (SNPs) to be identified and high-resolution genotyping. In our current research, we generated the first genetic map of O. fragrans using SLAF-seq, which is composed with 206.92 M paired-end reads and 173,537 SLAF markers. Among total 90,715 polymorphic SLAF markers, 15,317 polymorphic SLAFs could be used for genetic map construction. The integrated map contained 14,189 high quality SLAFs that were grouped in 23 genetic linkage groups, with a total length of 2962.46 cM and an average distance of 0.21 cM between two adjacent markers. In addition, 23,664 SNPs were identified from the mapped markers. As far as we know, this is the first of the genetic map of O. fragrans. Our results are further demonstrate that SLAF-seq is a very effective method for developing markers and constructing high-density linkage maps. The SNP markers and the genetic map reported in this study should be valuable resource in future research. PMID:29018460

  15. Comprehensive Survey of Genetic Diversity in Chloroplast Genomes and 45S nrDNAs within Panax ginseng Species

    PubMed Central

    Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Lee, Hyun Oh; Joh, Ho Jun; Kim, Nam-Hoon; Park, Hyun-Seung; Yang, Tae-Jin

    2015-01-01

    We report complete sequences of chloroplast (cp) genome and 45S nuclear ribosomal DNA (45S nrDNA) for 11 Panax ginseng cultivars. We have obtained complete sequences of cp and 45S nrDNA, the representative barcoding target sequences for cytoplasm and nuclear genome, respectively, based on low coverage NGS sequence of each cultivar. The cp genomes sizes ranged from 156,241 to 156,425 bp and the major size variation was derived from differences in copy number of tandem repeats in the ycf1 gene and in the intergenic regions of rps16-trnUUG and rpl32-trnUAG. The complete 45S nrDNA unit sequences were 11,091 bp, representing a consensus single transcriptional unit with an intergenic spacer region. Comparative analysis of these sequences as well as those previously reported for three Chinese accessions identified very rare but unique polymorphism in the cp genome within P. ginseng cultivars. There were 12 intra-species polymorphisms (six SNPs and six InDels) among 14 cultivars. We also identified five SNPs from 45S nrDNA of 11 Korean ginseng cultivars. From the 17 unique informative polymorphic sites, we developed six reliable markers for analysis of ginseng diversity and cultivar authentication. PMID:26061692

  16. Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Qian-fei; Liu, Xin; O'Connell, Jeff

    2003-09-15

    Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less

  17. Identification of SNPs associated with muscle yield and quality traits using allelic-imbalance analyses of pooled RNA-Seq samples in rainbow trout.

    PubMed

    Al-Tobasei, Rafet; Ali, Ali; Leeds, Timothy D; Liu, Sixin; Palti, Yniv; Kenney, Brett; Salem, Mohamed

    2017-08-07

    Coding/functional SNPs change the biological function of a gene and, therefore, could serve as "large-effect" genetic markers. In this study, we used two bioinformatics pipelines, GATK and SAMtools, for discovering coding/functional SNPs with allelic-imbalances associated with total body weight, muscle yield, muscle fat content, shear force, and whiteness. Phenotypic data were collected for approximately 500 fish, representing 98 families (5 fish/family), from a growth-selected line, and the muscle transcriptome was sequenced from 22 families with divergent phenotypes (4 low- versus 4 high-ranked families per trait). GATK detected 59,112 putative SNPs; of these SNPs, 4798 showed allelic imbalances (>2.0 as an amplification and <0.5 as loss of heterozygosity). SAMtools detected 87,066 putative SNPs; and of them, 4962 had allelic imbalances between the low- and high-ranked families. Only 1829 SNPs with allelic imbalances were common between the two datasets, indicating significant differences in algorithms. The two datasets contained 7930 non-redundant SNPs of which 4439 mapped to 1498 protein-coding genes (with 6.4% non-synonymous SNPs) and 684 mapped to 295 lncRNAs. Validation of a subset of 92 SNPs revealed 1) 86.7-93.8% success rate in calling polymorphic SNPs and 2) 95.4% consistent matching between DNA and cDNA genotypes indicating a high rate of identifying SNPs with allelic imbalances. In addition, 4.64% SNPs revealed random monoallelic expression. Genome distribution of the SNPs with allelic imbalances exhibited high density for all five traits in several chromosomes, especially chromosome 9, 20 and 28. Most of the SNP-harboring genes were assigned to important growth-related metabolic pathways. These results demonstrate utility of RNA-Seq in assessing phenotype-associated allelic imbalances in pooled RNA-Seq samples. The SNPs identified in this study were included in a new SNP-Chip design (available from Affymetrix) for genomic and genetic analyses in rainbow trout.

  18. Frequency and Distribution of Single-Nucleotide Polymorphisms within mprF in Methicillin-Resistant Staphylococcus aureus Clinical Isolates and Their Role in Cross-Resistance to Daptomycin and Host Defense Antimicrobial Peptides.

    PubMed

    Bayer, Arnold S; Mishra, Nagendra N; Chen, Liang; Kreiswirth, Barry N; Rubio, Aileen; Yang, Soo-Jin

    2015-08-01

    MprF is responsible for the lysinylation of phosphatidylglycerol (PG) to synthesize the positively charged phospholipid (PL) species, lysyl-PG (L-PG). It has been proposed that the single-nucleotide polymorphisms (SNPs) within the mprF open reading frame (ORF) are associated with a gain-in-function phenotype in terms of daptomycin resistance in Staphylococcus aureus. (Note that although the official term is daptomycin nonsusceptibility, we use the term daptomycin resistance in this paper for ease of presentation.) Using 22 daptomycin-susceptible (DAP(s))/daptomycin-resistant (DAP(r)) clinical methicillin-resistant S. aureus (MRSA) strain pairs, we assessed (i) the frequencies and distribution of putative mprF gain-in-function SNPs, (ii) the relationships of the SNPs to both daptomycin resistance and cross-resistance to the prototypical endovascular host defense peptide (HDP) thrombin-induced platelet microbicidal protein (tPMP), and (iii) the impact of mprF SNPs on positive surface charge phenotype and modifications of membrane PL profiles. Most of the mprF SNPs identified in our DAP(r) strains were clustered within the two MprF loci, (i) the central bifunctional domain and (ii) the C-terminal synthase domain. Moreover, we were able to correlate the presence and location of mprF SNPs in DAP(r) strains with HDP cross-resistance, positive surface charge, and L-PG profiles. Although DAP(r) strains with mprF SNPs in the bifunctional domain showed higher resistance to tPMPs than DAP(r) strains with SNPs in the synthase domain, this relationship was not observed in positive surface charge assays. These results demonstrated that both charge-mediated and -unrelated mechanisms are involved in DAP resistance and HDP cross-resistance in S. aureus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Determination of IL-1B (rs16944) and IL-6 (rs1800796) genetic polymorphisms in IgA nephropathy in a northwest Chinese Han population.

    PubMed

    Zhang, Daofa; Xie, Maowei; Yang, Xiaohong; Zhang, Yin; Su, Yan; Wang, Yanni; Huang, Haiyang; Han, Hui; Li, Wenning; Fu, Keying; Su, Huiluan; Xu, Wentan; Han, Yeguang; Wang, Ru; Zhang, Pei; Wu, Wei; Huang, Yun; Chen, Daojun; Jin, Tianbo; Wei, Jiali

    2017-09-22

    IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide, but etiology and pathogenesis continue to be poorly understood. Polymorphisms in the cytokine genes may play a role in the etiology and pathogenesis of IgAN. The incidence of different between diverse ethnic groups suggested important genetic influences on its pathogenesis. We genotype 10 single nucleotide polymorphisms (SNPs) in IL-1B and IL-6 gene using Sequenom Mass-ARRAY technology from 417 IgAN patients and 463 healthy controls of the Chinese Han population. We evaluated these SNPs associated with IgAN utilising the chi-square tests and genetic model analysis. We identified that the minor alleles of rs16944 ("A"), rs1800796 ("G") in IL-1B, IL-6 were involved in an increasingly risk of IgAN in allelic model analysis, respectively. The rs16944 in IL-1B and rs1800796 in IL-6 were associated with 1.23-fold (95% CI, 1.02-1.48, P = 0.031) and 1.33-fold (95% CI, 1.11-1.66, P = 0.003) increases in the risk of developing IgAN, respectively. There was only rs1800796 still correlated with IgAN in the allelic model after adjustment by age and gender and the Bonferroni correction. In addition, Haplotype G rs1800796 A rs2069837 G rs2069840 ( P = 0.037) and G rs1800796 A rs2069837 C rs2069840 ( P = 0.042) in IL-6 were considered to be associated with increased IgAN risk. This study verified the IL-6, IL-1B genetic variants polymorphisms contributed to IgAN susceptibility in a Chinese Han population. Although we identified SNPs susceptibility, however, replication studies and functional research are required to confirm the genetic contribution in IgAN.

  20. Determination of IL-1B (rs16944) and IL-6 (rs1800796) genetic polymorphisms in IgA nephropathy in a northwest Chinese Han population

    PubMed Central

    Zhang, Yin; Su, Yan; Wang, Yanni; Huang, Haiyang; Han, Hui; Li, Wenning; Fu, Keying; Su, Huiluan; Xu, Wentan; Han, Yeguang; Wang, Ru; Zhang, Pei; Wu, Wei; Huang, Yun; Chen, Daojun; Jin, Tianbo; Wei, Jiali

    2017-01-01

    IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide, but etiology and pathogenesis continue to be poorly understood. Polymorphisms in the cytokine genes may play a role in the etiology and pathogenesis of IgAN. The incidence of different between diverse ethnic groups suggested important genetic influences on its pathogenesis. We genotype 10 single nucleotide polymorphisms (SNPs) in IL-1B and IL-6 gene using Sequenom Mass-ARRAY technology from 417 IgAN patients and 463 healthy controls of the Chinese Han population. We evaluated these SNPs associated with IgAN utilising the chi-square tests and genetic model analysis. We identified that the minor alleles of rs16944 (“A”), rs1800796 (“G”) in IL-1B, IL-6 were involved in an increasingly risk of IgAN in allelic model analysis, respectively. The rs16944 in IL-1B and rs1800796 in IL-6 were associated with 1.23-fold (95% CI, 1.02-1.48, P = 0.031) and 1.33-fold (95% CI, 1.11-1.66, P = 0.003) increases in the risk of developing IgAN, respectively. There was only rs1800796 still correlated with IgAN in the allelic model after adjustment by age and gender and the Bonferroni correction. In addition, Haplotype Grs1800796A rs2069837G rs2069840 (P = 0.037) and G rs1800796A rs2069837C rs2069840 (P = 0.042) in IL-6were considered to be associated with increased IgAN risk. This study verified the IL-6, IL-1B genetic variants polymorphisms contributed to IgAN susceptibility in a Chinese Han population. Although we identified SNPs susceptibility, however, replication studies and functional research are required to confirm the genetic contribution in IgAN. PMID:29069743

  1. In silico screening of the chicken genome for overlaps between genomic regions: microRNA genes, coding and non-coding transcriptional units, QTL, and genetic variations.

    PubMed

    Zorc, Minja; Kunej, Tanja

    2016-05-01

    MicroRNAs (miRNAs) are a class of non-coding RNAs involved in posttranscriptional regulation of target genes. Regulation requires complementarity between target mRNA and the mature miRNA seed region, responsible for their recognition and binding. It has been estimated that each miRNA targets approximately 200 genes, and genetic variability of miRNA genes has been reported to affect phenotypic variability and disease susceptibility in humans, livestock species, and model organisms. Polymorphisms in miRNA genes could therefore represent biomarkers for phenotypic traits in livestock animals. In our previous study, we collected polymorphisms within miRNA genes in chicken. In the present study, we identified miRNA-related genomic overlaps to prioritize genomic regions of interest for further functional studies and biomarker discovery. Overlapping genomic regions in chicken were analyzed using the following bioinformatics tools and databases: miRNA SNiPer, Ensembl, miRBase, NCBI Blast, and QTLdb. Out of 740 known pre-miRNA genes, 263 (35.5 %) contain polymorphisms; among them, 35 contain more than three polymorphisms The most polymorphic miRNA genes in chicken are gga-miR-6662, containing 23 single nucleotide polymorphisms (SNPs) within the pre-miRNA region, including five consecutive SNPs, and gga-miR-6688, containing ten polymorphisms including three consecutive polymorphisms. Several miRNA-related genomic hotspots have been revealed in chicken genome; polymorphic miRNA genes are located within protein-coding and/or non-coding transcription units and quantitative trait loci (QTL) associated with production traits. The present study includes the first description of an exonic miRNA in a chicken genome, an overlap between the miRNA gene and the exon of the protein-coding gene (gga-miR-6578/HADHB), and the first report of a missense polymorphism located within a mature miRNA seed region. Identified miRNA-related genomic hotspots in chicken can serve researchers as a starting point for further functional studies and association studies with poultry production and health traits and the basis for systematic screening of exonic miRNAs and missense/miRNA seed polymorphisms in other genomes.

  2. An Alternative to the Search for Single Polymorphisms: Toward Molecular Personality Scales for the Five-Factor Model

    PubMed Central

    McCrae, Robert R.; Scally, Matthew; Terracciano, Antonio; Abecasis, Gonçalo R.; Costa, Paul T.

    2011-01-01

    There is growing evidence that personality traits are affected by many genes, all of which have very small effects. As an alternative to the largely-unsuccessful search for individual polymorphisms associated with personality traits, we identified large sets of potentially related single nucleotide polymorphisms (SNPs) and summed them to form molecular personality scales (MPSs) with from 4 to 2,497 SNPs. Scales were derived from two-thirds of a large (N = 3,972) sample of individuals from Sardinia who completed the Revised NEO Personality Inventory and were assessed in a genome-wide association scan. When MPSs were correlated with the phenotype in the remaining third of the sample, very small but significant associations were found for four of the five personality factors when the longest scales were examined. These data suggest that MPSs for Neuroticism, Openness to Experience, Agreeableness, and Conscientiousness (but not Extraversion) contain genetic information that can be refined in future studies, and the procedures described here should be applicable to other quantitative traits. PMID:21114353

  3. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    PubMed Central

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  4. Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

    PubMed

    Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

    2013-02-01

    Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Genome-wide association study of preeclampsia detects novel maternal single nucleotide polymorphisms and copy-number variants in subsets of the Hyperglycemia and Adverse Pregnancy Outcome (HAPO) study cohort

    PubMed Central

    Zhao, Linlu; Bracken, Michael B.; DeWan, Andrew T.

    2013-01-01

    Summary A genome-wide association study was undertaken to identify maternal single nucleotide polymorphisms (SNPs) and copy-number variants (CNVs) associated with preeclampsia. Case-control analysis was performed on 1070 Afro-Caribbean (n=21 cases and 1049 controls) and 723 Hispanic (n=62 cases and 661 controls) mothers and 1257 mothers of European ancestry (n=50 cases and 1207 controls) from the Hyperglycemia and Adverse Pregnancy Outcome (HAPO) study. European ancestry subjects were genotyped on Illumina Human610-Quad and Afro-Caribbean and Hispanic subjects were genotyped on Illumina Human1M-Duo BeadChip microarrays. Genome-wide SNP data were analyzed using PLINK. CNVs were called using three detection algorithms (GNOSIS, PennCNV, and QuantiSNP), merged using CNVision, and then screened using stringent criteria. SNP and CNV findings were compared to those of the Study of Pregnancy Hypertension in Iowa (SOPHIA), an independent preeclampsia case-control dataset of Caucasian mothers (n=177 cases and 116 controls). A list of top SNPs were identified for each of the HAPO ethnic groups, but none reached Bonferroni-corrected significance. Novel candidate CNVs showing enrichment among preeclampsia cases were also identified in each of the three ethnic groups. Several variants were suggestively replicated in SOPHIA. The discovered SNPs and copy-number variable regions present interesting candidate genetic variants for preeclampsia that warrant further replication and investigation. PMID:23551011

  6. Genome-wide association studies to identify rice salt-tolerance markers.

    PubMed

    Patishtan, Juan; Hartley, Tom N; Fonseca de Carvalho, Raquel; Maathuis, Frans J M

    2018-05-01

    Salinity is an ever increasing menace that affects agriculture worldwide. Crops such as rice are salt sensitive, but its degree of susceptibility varies widely between cultivars pointing to extensive genetic diversity that can be exploited to identify genes and proteins that are relevant in the response of rice to salt stress. We used a diversity panel of 306 rice accessions and collected phenotypic data after short (6 h), medium (7 d) and long (30 d) salinity treatment (50 mm NaCl). A genome-wide association study (GWAS) was subsequently performed, which identified around 1200 candidate genes from many functional categories, but this was treatment period dependent. Further analysis showed the presence of cation transporters and transcription factors with a known role in salinity tolerance and those that hitherto were not known to be involved in salt stress. Localization analysis of single nucleotide polymorphisms (SNPs) showed the presence of several hundred non-synonymous SNPs (nsSNPs) in coding regions and earmarked specific genomic regions with increased numbers of nsSNPs. It points to components of the ubiquitination pathway as important sources of genetic diversity that could underpin phenotypic variation in stress tolerance. © 2017 John Wiley & Sons Ltd.

  7. Genome Wide Analysis of Fertility and Production Traits in Italian Holstein Cattle

    PubMed Central

    Stella, Alessandra; Biffani, Stefano; Negrini, Riccardo; Lazzari, Barbara; Ajmone-Marsan, Paolo; Williams, John L .

    2013-01-01

    A genome wide scan was performed on a total of 2093 Italian Holstein proven bulls genotyped with 50K single nucleotide polymorphisms (SNPs), with the objective of identifying loci associated with fertility related traits and to test their effects on milk production traits. The analysis was carried out using estimated breeding values for the aggregate fertility index and for each trait contributing to the index: angularity, calving interval, non-return rate at 56 days, days to first service, and 305 day first parity lactation. In addition, two production traits not included in the aggregate fertility index were analysed: fat yield and protein yield. Analyses were carried out using all SNPs treated separately, further the most significant marker on BTA14 associated to milk quality located in the DGAT1 region was treated as fixed effect. Genome wide association analysis identified 61 significant SNPs and 75 significant marker-trait associations. Eight additional SNP associations were detected when SNP located near DGAT1 was included as a fixed effect. As there were no obvious common SNPs between the traits analyzed independently in this study, a network analysis was carried out to identify unforeseen relationships that may link production and fertility traits. PMID:24265800

  8. PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

    PubMed

    Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

    2016-10-06

    With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most efficient analysis of soybean data using thorough testing and validation. This research serves as an example of best practices for development of genomics data analysis workflows by integrating remote HPC resources and efficient data management with ease of use for biological users. PGen workflow can also be easily customized for analysis of data in other species.

  9. Multifaceted Genomic Risk for Brain Function in Schizophrenia

    PubMed Central

    Chen, Jiayu; Calhoun, Vince D.; Pearlson, Godfrey D.; Ehrlich, Stefan; Turner, Jessica A.; Ho, Beng-Choon; Wassink, Thomas H.; Michael, Andrew M; Liu, Jingyu

    2012-01-01

    Recently, deriving candidate endophenotypes from brain imaging data has become a valuable approach to study genetic influences on schizophrenia (SZ), whose pathophysiology remains unclear. In this work we utilized a multivariate approach, parallel independent component analysis, to identify genomic risk components associated with brain function abnormalities in SZ. 5157 candidate single nucleotide polymorphisms (SNPs) were derived from genome-wide array based on their possible connections with SZ and further investigated for their associations with brain activations captured with functional magnetic resonance imaging (fMRI) during a sensorimotor task. Using data from 92 SZ patients and 116 healthy controls, we detected a significant correlation (r= 0.29; p= 2.41×10−5) between one fMRI component and one SNP component, both of which significantly differentiated patients from controls. The fMRI component mainly consisted of precentral and postcentral gyri, the major activated regions in the motor task. On average, higher activation in these regions was observed in participants with higher loadings of the linked SNP component, predominantly contributed to by 253 SNPs. 138 identified SNPs were from known coding regions of 100 unique genes. 31 identified SNPs did not differ between groups, but moderately correlated with some other group-discriminating SNPs, indicating interactions among alleles contributing towards elevated SZ susceptibility. The genes associated with the identified SNPs participated in four neurotransmitter pathways: GABA receptor signaling, dopamine receptor signaling, neuregulin signaling and glutamate receptor signaling. In summary, our work provides further evidence for the complexity of genomic risk to the functional brain abnormality in SZ and suggests a pathological role of interactions between SNPs, genes and multiple neurotransmitter pathways. PMID:22440650

  10. A fast boosting-based screening method for large-scale association study in complex traits with genetic heterogeneity.

    PubMed

    Wang, Lu-Yong; Fasulo, D

    2006-01-01

    Genome-wide association study for complex diseases will generate massive amount of single nucleotide polymorphisms (SNPs) data. Univariate statistical test (i.e. Fisher exact test) was used to single out non-associated SNPs. However, the disease-susceptible SNPs may have little marginal effects in population and are unlikely to retain after the univariate tests. Also, model-based methods are impractical for large-scale dataset. Moreover, genetic heterogeneity makes the traditional methods harder to identify the genetic causes of diseases. A more recent random forest method provides a more robust method for screening the SNPs in thousands scale. However, for more large-scale data, i.e., Affymetrix Human Mapping 100K GeneChip data, a faster screening method is required to screening SNPs in whole-genome large scale association analysis with genetic heterogeneity. We propose a boosting-based method for rapid screening in large-scale analysis of complex traits in the presence of genetic heterogeneity. It provides a relatively fast and fairly good tool for screening and limiting the candidate SNPs for further more complex computational modeling task.

  11. SNPit: a federated data integration system for the purpose of functional SNP annotation.

    PubMed

    Shen, Terry H; Carlson, Christopher S; Tarczy-Hornoch, Peter

    2009-08-01

    Genome wide association studies can potentially identify the genetic causes behind the majority of human diseases. With the advent of more advanced genotyping techniques, there is now an explosion of data gathered on single nucleotide polymorphisms (SNPs). The need exists for an integrated system that can provide up-to-date functional annotation information on SNPs. We have developed the SNP Integration Tool (SNPit) system to address this need. Built upon a federated data integration system, SNPit provides current information on a comprehensive list of SNP data sources. Additional logical inference analysis was included through an inference engine plug in. The SNPit web servlet is available online for use. SNPit allows users to go to one source for up-to-date information on the functional annotation of SNPs. A tool that can help to integrate and analyze the potential functional significance of SNPs is important for understanding the results from genome wide association studies.

  12. Investigating the association between polymorphisms in connective tissue growth factor and susceptibility to colon carcinoma.

    PubMed

    Ahmad, Abrar; Askari, Shlear; Befekadu, Rahel; Hahn-Strömberg, Victoria

    2015-04-01

    There have been numerous studies on the gene expression of connective tissue growth factor (CTGF) in colorectal cancer, however very few have investigated polymorphisms in this gene. The present study aimed to determine whether single nucleotide polymorphisms (SNPs) in the CTGF gene are associated with a higher susceptibility to colon cancer and/or an invasive tumor growth pattern. The CTGF gene was genotyped for seven SNPs (rs6918698, rs1931002, rs9493150, rs12526196, rs12527705, rs9399005 and rs12527379) by pyrosequencing. Formalin‑fixed paraffin‑embedded tissue samples (n=112) from patients diagnosed with colon carcinoma, and an equal number of blood samples from healthy controls, were selected for genomic DNA extraction. The complexity index was measured using images of tumor samples (n=64) stained for cytokeratin‑8. The images were analyzed and correlated with the identified CTGF SNPs and clinicopathological parameters of the patients, including age, gender, tumor penetration, lymph node metastasis, systemic metastasis, differentiation and localization of tumor. It was demonstrated that the frequency of the SNP rs6918698 GG genotype was significantly associated (P=0.05) with an increased risk of colon cancer, as compared with the GC and CC genotypes. The other six SNPs (rs1931002, rs9493150, rs12526196, rs12527705, rs9399005 and rs12527379) exhibited no significant difference in the genotype and allele frequencies between patients diagnosed with colon carcinoma and the normal healthy population. A trend was observed between genotype variation at rs6918698 and the complexity index (P=0.052). The complexity index and genotypes for any of the studied SNPs were not significantly correlated with clinical or pathological parameters of the patients. These results indicate that the rs6918698 GG genotype is associated with an increased risk of developing colon carcinoma, and genetic variations at the rs6918698 are associated with the growth pattern of the tumor. The present results may facilitate the identification of potential biomarkers of the disease in addition to drug targets.

  13. CCDC26, CDKN2BAS, RTEL1 and TERT Polymorphisms in pediatric brain tumor susceptibility.

    PubMed

    Adel Fahmideh, Maral; Lavebratt, Catharina; Schüz, Joachim; Röösli, Martin; Tynes, Tore; Grotzer, Michael A; Johansen, Christoffer; Kuehni, Claudia E; Lannering, Birgitta; Prochazka, Michaela; Schmidt, Lisbeth S; Feychting, Maria

    2015-08-01

    The role of genetic polymorphisms in pediatric brain tumor (PBT) etiology is poorly understood. We hypothesized that single nucleotide polymorphisms (SNPs) identified in genome-wide association studies (GWAS) on adult glioma would also be associated with PBT risk. The study is based on the Cefalo study, a population-based multicenter case-control study. Saliva DNA from 245 cases and 489 controls, aged 7-19 years at diagnosis/reference date, was extracted and genotyped for 29 SNPs reported by GWAS to be significantly associated with risk of adult glioma. Data were analyzed using unconditional logistic regression. Stratified analyses were performed for two histological subtypes: astrocytoma alone and the other tumor types combined. The results indicated that four SNPs, CDKN2BAS rs4977756 (p = 0.036), rs1412829 (p = 0.037), rs2157719 (p = 0.018) and rs1063192 (p = 0.021), were associated with an increased susceptibility to PBTs, whereas the TERT rs2736100 was associated with a decreased risk (p = 0.018). Moreover, the stratified analyses showed a decreased risk of astrocytoma associated with RTEL1 rs6089953, rs6010620 and rs2297440 (p trend = 0.022, p trend = 0.042, p trend = 0.029, respectively) as well as an increased risk of this subtype associated with RTEL1 rs4809324 (p trend = 0.033). In addition, SNPs rs10464870 and rs891835 in CCDC26 were associated with an increased risk of non-astrocytoma tumor subtypes (p trend = 0.009, p trend = 0.007, respectively). Our findings indicate that SNPs in CDKN2BAS, TERT, RTEL1 and CCDC26 may be associated with the risk of PBTs. Therefore, we suggest that pediatric and adult brain tumors might share common genetic risk factors and similar etiological pathways. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Polymorphisms Near TBX5 and GDF7 Are Associated With Increased Risk for Barrett’s Esophagus

    PubMed Central

    Palles, Claire; Chegwidden, Laura; Li, Xinzhong; Findlay, John M.; Farnham, Garry; Castro Giner, Francesc; Peppelenbosch, Maikel P.; Kovac, Michal; Adams, Claire L.; Prenen, Hans; Briggs, Sarah; Harrison, Rebecca; Sanders, Scott; MacDonald, David; Haigh, Chris; Tucker, Art; Love, Sharon; Nanji, Manoj; deCaestecker, John; Ferry, David; Rathbone, Barrie; Hapeshi, Julie; Barr, Hugh; Moayyedi, Paul; Watson, Peter; Zietek, Barbara; Maroo, Neera; Gay, Laura; Underwood, Tim; Boulter, Lisa; McMurtry, Hugh; Monk, David; Patel, Praful; Ragunath, Krish; Al Dulaimi, David; Murray, Iain; Koss, Konrad; Veitch, Andrew; Trudgill, Nigel; Nwokolo, Chuka; Rembacken, Bjorn; Atherfold, Paul; Green, Elaine; Ang, Yeng; Kuipers, Ernst J.; Chow, Wu; Paterson, Stuart; Kadri, Sudarshan; Beales, Ian; Grimley, Charles; Mullins, Paul; Beckett, Conrad; Farrant, Mark; Dixon, Andrew; Kelly, Sean; Johnson, Matthew; Wajed, Shahjehan; Dhar, Anjan; Sawyer, Elinor; Roylance, Rebecca; Onstad, Lynn; Gammon, Marilie D.; Corley, Douglas A.; Shaheen, Nicholas J.; Bird, Nigel C.; Hardie, Laura J.; Reid, Brian J.; Ye, Weimin; Liu, Geoffrey; Romero, Yvonne; Bernstein, Leslie; Wu, Anna H.; Casson, Alan G.; Fitzgerald, Rebecca; Whiteman, David C.; Risch, Harvey A.; Levine, David M.; Vaughan, Tom L.; Verhaar, Auke P.; van den Brande, Jan; Toxopeus, Eelke L.; Spaander, Manon C.; Wijnhoven, Bas P.L.; van der Laan, Luc J.W.; Krishnadath, Kausilia; Wijmenga, Cisca; Trynka, Gosia; McManus, Ross; Reynolds, John V.; O’Sullivan, Jacintha; MacMathuna, Padraic; McGarrigle, Sarah A.; Kelleher, Dermot; Vermeire, Severine; Cleynen, Isabelle; Bisschops, Raf; Tomlinson, Ian; Jankowski, Janusz

    2015-01-01

    Background & Aims Barrett's esophagus (BE) increases the risk of esophageal adenocarcinoma (EAC). We found the risk to be BE has been associated with single nucleotide polymorphisms (SNPs) on chromosome 6p21 (within the HLA region) and on 16q23, where the closest protein-coding gene is FOXF1. Subsequently, the Barrett's and Esophageal Adenocarcinoma Consortium (BEACON) identified risk loci for BE and esophageal adenocarcinoma near CRTC1 and BARX1, and within 100 kb of FOXP1. We aimed to identify further SNPs that increased BE risk and to validate previously reported associations. Methods We performed a genome-wide association study (GWAS) to identify variants associated with BE and further analyzed promising variants identified by BEACON by genotyping 10,158 patients with BE and 21,062 controls. Results We identified 2 SNPs not previously associated with BE: rs3072 (2p24.1; odds ratio [OR] = 1.14; 95% CI: 1.09–1.18; P = 1.8 × 10−11) and rs2701108 (12q24.21; OR = 0.90; 95% CI: 0.86–0.93; P = 7.5 × 10−9). The closest protein-coding genes were respectively GDF7 (rs3072), which encodes a ligand in the bone morphogenetic protein pathway, and TBX5 (rs2701108), which encodes a transcription factor that regulates esophageal and cardiac development. Our data also supported in BE cases 3 risk SNPs identified by BEACON (rs2687201, rs11789015, and rs10423674). Meta-analysis of all data identified another SNP associated with BE and esophageal adenocarcinoma: rs3784262, within ALDH1A2 (OR = 0.90; 95% CI: 0.87–0.93; P = 3.72 × 10−9). Conclusions We identified 2 loci associated with risk of BE and provided data to support a further locus. The genes we found to be associated with risk for BE encode transcription factors involved in thoracic, diaphragmatic, and esophageal development or proteins involved in the inflammatory response. PMID:25447851

  15. No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

    PubMed

    Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

    2012-07-30

    This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. [Genetic diversity analysis of Andrographis paniculata in China based on SRAP and SNP].

    PubMed

    Chen, Rong; Wang, Xiao-Yun; Song, Yu-Ning; Zhu, Yun-feng; Wang, Peng-liang; Li, Min; Zhong, Guo-Yue

    2014-12-01

    In order to reveal genetic diversity of domestic Andrographis paniculata and its impact on quality, genetic backgrounds of 103 samples from 7 provinces in China were analyzed using SRAP marker and SNP marker. Genetic structures of the A. paniculata populations were estimated with Powermarker V 3.25 and Mega 6.0 software, and polymorphic SNPs were identified with CodonCode Aligner software. The results showed that the genetic distances of domestic A. paniculata germplasm ranged from 0. 01 to 0.09, and no polymorphic SNPs were discovered in coding sequence fragments of ent-copalyl diphosphate synthase. A. paniculata germplasm from various regions in China had poor genetic diversity. This phenomenon was closely related to strict self-fertilization and earlier introduction from the same origin. Therefore, genetic background had little impact on variable qualities of A. paniculata in domestic market. Mutation breeding, polyploid breeding and molecular breeding were proposed as promising strategies in germplasm innovation.

  17. ARG1 Is a Novel Bronchodilator Response Gene

    PubMed Central

    Litonjua, Augusto A.; Lasky-Su, Jessica; Schneiter, Kady; Tantisira, Kelan G.; Lazarus, Ross; Klanderman, Barbara; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Hanrahan, John P.; Liggett, Stephen B.; Hawkins, Gregory A.; Meyers, Deborah A.; Bleecker, Eugene R.; Lange, Christoph; Weiss, Scott T.

    2008-01-01

    Rationale: Inhaled β-agonists are one of the most widely used classes of drugs for the treatment of asthma. However, a substantial proportion of patients with asthma do not have a favorable response to these drugs, and identifying genetic determinants of drug response may aid in tailoring treatment for individual patients. Objectives: To screen variants in candidate genes in the steroid and β-adrenergic pathways for association with response to inhaled β-agonists. Methods: We genotyped 844 single nucleotide polymorphisms (SNPs) in 111 candidate genes in 209 children and their parents participating in the Childhood Asthma Management Program. We screened the association of these SNPs with acute response to inhaled β-agonists (bronchodilator response [BDR]) using a novel algorithm implemented in a family-based association test that ranked SNPs in order of statistical power. Genes that had SNPs with median power in the highest quartile were then taken for replication analyses in three other asthma cohorts. Measurements and Main Results: We identified 17 genes from the screening algorithm and genotyped 99 SNPs from these genes in a second population of patients with asthma. We then genotyped 63 SNPs from four genes with significant associations with BDR, for replication in a third and fourth population of patients with asthma. Evidence for association from the four asthma cohorts was combined, and SNPs from ARG1 were significantly associated with BDR. SNP rs2781659 survived Bonferroni correction for multiple testing (combined P value = 0.00048, adjusted P value = 0.047). Conclusions: These findings identify ARG1 as a novel gene for acute BDR in both children and adults with asthma. PMID:18617639

  18. Convergent evidence from systematic analysis of GWAS revealed genetic basis of esophageal cancer.

    PubMed

    Gao, Xue-Xin; Gao, Lei; Wang, Jiu-Qiang; Qu, Su-Su; Qu, Yue; Sun, Hong-Lei; Liu, Si-Dang; Shang, Ying-Li

    2016-07-12

    Recent genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) associated with risk of esophageal cancer (EC). However, investigation of genetic basis from the perspective of systematic biology and integrative genomics remains scarce.In this study, we explored genetic basis of EC based on GWAS data and implemented a series of bioinformatics methods including functional annotation, expression quantitative trait loci (eQTL) analysis, pathway enrichment analysis and pathway grouped network analysis.Two hundred and thirteen risk SNPs were identified, in which 44 SNPs were found to have significantly differential gene expression in esophageal tissues by eQTL analysis. By pathway enrichment analysis, 170 risk genes mapped by risk SNPs were enriched into 38 significant GO terms and 17 significant KEGG pathways, which were significantly grouped into 9 sub-networks by pathway grouped network analysis. The 9 groups of interconnected pathways were mainly involved with muscle cell proliferation, cellular response to interleukin-6, cell adhesion molecules, and ethanol oxidation, which might participate in the development of EC.Our findings provide genetic evidence and new insight for exploring the molecular mechanisms of EC.

  19. Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

    PubMed

    Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

    2015-05-01

    Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

  20. Significant SNPs have limited prediction ability for thyroid cancer

    PubMed Central

    Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun

    2014-01-01

    Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304

  1. Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

    PubMed

    Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

    2006-08-01

    Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

  2. HLA-DQA1 and PLA2R1 polymorphisms and risk of idiopathic membranous nephropathy.

    PubMed

    Bullich, Gemma; Ballarín, José; Oliver, Artur; Ayasreh, Nadia; Silva, Irene; Santín, Sheila; Díaz-Encarnación, Montserrat M; Torra, Roser; Ars, Elisabet

    2014-02-01

    Single nucleotide polymorphisms (SNPs) within HLA complex class II HLA-DQ α-chain 1 (HLA-DQA1) and M-type phospholipase A2 receptor (PLA2R1) genes were identified as strong risk factors for idiopathic membranous nephropathy (IMN) development in a recent genome-wide association study. Copy number variants (CNVs) within the Fc gamma receptor III (FCGR3) locus have been associated with several autoimmune diseases, but their role in IMN has not been studied. This study aimed to validate the association of HLA-DQA1 and PLA2R1 risk alleles with IMN in a Spanish cohort, test the putative association of FCGR3A and FCGR3B CNVs with IMN, and assess the use of these genetic factors to predict the clinical outcome of the disease. A Spanish cohort of 89 IMN patients and 286 matched controls without nephropathy was recruited between October of 2009 and July of 2012. Case-control studies for SNPs within HLA-DQA1 (rs2187668) and PLA2R1 (rs4664308) genes and CNVs for FCGR3A and FCGR3B genes were performed. The contribution of these polymorphisms to predict clinical outcome and renal function decline was analyzed. This study validated the association of these HLA-DQA1 and PLA2R1 SNPs with IMN in a Spanish cohort and its increased risk when combining both risk genotypes. No significant association was found between FCGR3 CNVs and IMN. These results revealed that HLA-DQA1 and PLA2R1 genotype combination adjusted for baseline proteinuria strongly predicted response to immunosuppressive therapy. HLA-DQA1 genotype adjusted for proteinuria was also linked with renal function decline. This study confirms that HLA-DQA1 and PLA2R1 genotypes are risk factors for IMN, whereas no association was identified for FCGR3 CNVs. This study provides, for the first time, evidence of the contribution of these HLA-DQA1 and PLA2R1 polymorphisms in predicting IMN response to immunosuppressors and disease progression. Future studies are needed to validate and identify prognostic markers.

  3. Prioritizing individual genetic variants after kernel machine testing using variable selection.

    PubMed

    He, Qianchuan; Cai, Tianxi; Liu, Yang; Zhao, Ni; Harmon, Quaker E; Almli, Lynn M; Binder, Elisabeth B; Engel, Stephanie M; Ressler, Kerry J; Conneely, Karen N; Lin, Xihong; Wu, Michael C

    2016-12-01

    Kernel machine learning methods, such as the SNP-set kernel association test (SKAT), have been widely used to test associations between traits and genetic polymorphisms. In contrast to traditional single-SNP analysis methods, these methods are designed to examine the joint effect of a set of related SNPs (such as a group of SNPs within a gene or a pathway) and are able to identify sets of SNPs that are associated with the trait of interest. However, as with many multi-SNP testing approaches, kernel machine testing can draw conclusion only at the SNP-set level, and does not directly inform on which one(s) of the identified SNP set is actually driving the associations. A recently proposed procedure, KerNel Iterative Feature Extraction (KNIFE), provides a general framework for incorporating variable selection into kernel machine methods. In this article, we focus on quantitative traits and relatively common SNPs, and adapt the KNIFE procedure to genetic association studies and propose an approach to identify driver SNPs after the application of SKAT to gene set analysis. Our approach accommodates several kernels that are widely used in SNP analysis, such as the linear kernel and the Identity by State (IBS) kernel. The proposed approach provides practically useful utilities to prioritize SNPs, and fills the gap between SNP set analysis and biological functional studies. Both simulation studies and real data application are used to demonstrate the proposed approach. © 2016 WILEY PERIODICALS, INC.

  4. Single-nucleotide polymorphism discovery in Leptographium longiclavatum, a mountain pine beetle-associated symbiotic fungus, using whole-genome resequencing.

    PubMed

    Ojeda, Dario I; Dhillon, Braham; Tsui, Clement K M; Hamelin, Richard C

    2014-03-01

    Single-nucleotide polymorphisms (SNPs) are rapidly becoming the standard markers in population genomics studies; however, their use in nonmodel organisms is limited due to the lack of cost-effective approaches to uncover genome-wide variation, and the large number of individuals needed in the screening process to reduce ascertainment bias. To discover SNPs for population genomics studies in the fungal symbionts of the mountain pine beetle (MPB), we developed a road map to discover SNPs and to produce a genotyping platform. We undertook a whole-genome sequencing approach of Leptographium longiclavatum in combination with available genomics resources of another MPB symbiont, Grosmannia clavigera. We sequenced 71 individuals pooled into four groups using the Illumina sequencing technology. We generated between 27 and 30 million reads of 75 bp that resulted in a total of 1, 181 contigs longer than 2 kb and an assembled genome size of 28.9 Mb (N50 = 48 kb, average depth = 125x). A total of 9052 proteins were annotated, and between 9531 and 17,266 SNPs were identified in the four pools. A subset of 206 genes (containing 574 SNPs, 11% false positives) was used to develop a genotyping platform for this species. Using this roadmap, we developed a genotyping assay with a total of 147 SNPs located in 121 genes using the Illumina(®) Sequenom iPLEX Gold. Our preliminary genotyping (success rate = 85%) of 304 individuals from 36 populations supports the utility of this approach for population genomics studies in other MPB fungal symbionts and other fungal nonmodel species. © 2013 John Wiley & Sons Ltd.

  5. Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

    PubMed Central

    Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

    2017-01-01

    Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

  6. CARD15 Gene Polymorphisms Are Associated with Tuberculosis Susceptibility in Chinese Holstein Cows

    PubMed Central

    Liu, Tong; Tu, Wenji; Li, Wengui; Dong, Guodong; Xu, Cong; Qin, Bo; Liu, Kaihua; Yang, Jie; Chai, Jun; Shi, Xianwei; Zhang, Yifang

    2015-01-01

    Bovine tuberculosis (BTB) is a significant veterinary and financial problem in many parts of the world. Associations between specific host genes and susceptibility to mycobacterial infections, such as tuberculosis, have been reported in several species. The objective of this study was to identify and evaluate the relationship of single-nucleotide polymorphisms (SNPs) in the CARD15 gene with susceptibility to BTB in Chinese Holstein cows. DNA samples from 201 Chinese Holstein cows (103 cases and 98 controls) were collected from Kunming City, Yuxi City, and Dali City in China. SNPs in the CARD15 gene were assessed using polymerase chain reaction (PCR) and restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR). Case-control association testing and statistical analysis identified six SNPs associated with susceptibility to BTB in Chinese Holstein cows. The frequency of genotypes C/T, A/G, A/G, A/G, C/T, and A/G in E4 (-37), 208, 1644, 1648, 1799, and E10 (+107), respectively, was significantly higher in cases than in controls, and also the alleles C, A, A, G, T, and A, respectively, were associated with a greater relative risk in cases than in controls. The distribution of two haplotypes, TGGACA and CAGACA, was significantly different between cases and controls. Overall, this case-control study suggested that E4 (-37)(C/T), 208(A/G), 1644(A/G), 1648(A/G), 1799(C/T), and E10 (+107)(A/G) in the CARD15 gene were significantly associated with susceptibility to BTB in Chinese Holstein cows and that haplotypes TGGACA and CAGACA could be used as genetic markers in marker-assisted breeding programs for breeding cows with high resistance to BTB. PMID:26244859

  7. Sequence polymorphism at the human apolipoprotein AII gene ( APOA2): unexpected deficit of variation in an African-American sample.

    PubMed

    Fullerton, Stephanie M; Clark, Andrew G; Weiss, Kenneth M; Taylor, Scott L; Stengård, Jari H; Salomaa, Veikko; Boerwinkle, Eric; Nickerson, Deborah A

    2002-07-01

    A 3.3-kb region, encompassing the APOA2 gene and 2 kb of 5' and 3' flanking DNA, was re-sequenced in a "core" sample of 24 individuals, sampled without regard to the health from each of three populations: African-Americans from Jackson (Miss., USA), Europeans from North Karelia (Finland), and non-Hispanic European-Americans from Rochester, (Minn., USA). Fifteen variable sites were identified (14 SNPs and one multi-allelic microsatellite, all silent), and these sites segregated as 18 sequence haplotypes (or nine, if SNPs only are considered). The haplotype distribution in the core African-American sample was unusual, with a deficit of particular haplotypes compared with those found in the other two samples, and a significantly (P<0.05) low level of nucleotide diversity relative to patterns of polymorphism and divergence at other human loci. Six of the 14 SNPs, whose variation captured the haplotype structure of the core data, were then genotyped by oligonucleotide ligation assay in an additional 2183 individuals from the same three populations (n=843, n=452, and n=888, respectively). All six sites varied in each of the larger "epidemiological" samples, and together, they defined 19 SNP haplotypes, seven with relative frequencies greater than 1% in the total sample; all of these common haplotypes had been identified earlier in the core re-sequencing survey. Here also, the African-American sample showed significantly lower SNP heterozygosity and haplotype diversity than the other two samples. The deficit of polymorphism is consistent with a population-specific non-neutral increase in the relative frequency of several haplotypes in Jackson.

  8. Development of a spreadsheet for SNPs typing using Microsoft EXCEL.

    PubMed

    Hashiyada, Masaki; Itakura, Yukio; Takahashi, Shirushi; Sakai, Jun; Funayama, Masato

    2009-04-01

    Single-nucleotide polymorphisms (SNPs) have some characteristics that make them very appropriate for forensic studies and applications. In our institute, SNPs typings were performed by the TaqMan SNP Genotyping Assays using the ABI PRISM 7500 FAST Real-Time PCR System (AppliedBiosystems) and Sequence Detection Software ver.1.4 (AppliedBiosystem). The TaqMan method was desired two positive control (Allele1 and 2) and one negative control to analyze each SNP locus. Therefore, it can be analyzed up to 24 loci of a person on a 96-well-plate at the same time. If SNPs analysis is expected to apply to biometrics authentication, 48 and over loci are required to identify a person. In this study, we designed a spreadsheet package using Microsoft EXCEL, and population data were used from our 120 SNPs population studies. On the spreadsheet, we defined SNP types using 'template files' instead of positive and negative controls. "Template files" consisted of the results of 94 unknown samples and two negative controls of each of 120 SNPs loci we had previously studied. By the use of the files, the spreadsheet could analyze 96 SNPs on a 96-wells-plate simultaneously.

  9. A novel method for in silico identification of regulatory SNPs in human genome.

    PubMed

    Li, Rong; Zhong, Dexing; Liu, Ruiling; Lv, Hongqiang; Zhang, Xinman; Liu, Jun; Han, Jiuqiang

    2017-02-21

    Regulatory single nucleotide polymorphisms (rSNPs), kind of functional noncoding genetic variants, can affect gene expression in a regulatory way, and they are thought to be associated with increased susceptibilities to complex diseases. Here a novel computational approach to identify potential rSNPs is presented. Different from most other rSNPs finding methods which based on hypothesis that SNPs causing large allele-specific changes in transcription factor binding affinities are more likely to play regulatory functions, we use a set of documented experimentally verified rSNPs and nonfunctional background SNPs to train classifiers, so the discriminating features are found. To characterize variants, an extensive range of characteristics, such as sequence context, DNA structure and evolutionary conservation etc. are analyzed. Support vector machine is adopted to build the classifier model together with an ensemble method to deal with unbalanced data. 10-fold cross-validation result shows that our method can achieve accuracy with sensitivity of ~78% and specificity of ~82%. Furthermore, our method performances better than some other algorithms based on aforementioned hypothesis in handling false positives. The original data and the source matlab codes involved are available at https://sourceforge.net/projects/rsnppredict/. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Estrogen Receptor 1 ( ESR1) Gene Polymorphisms and Obesity Phenotypes in a Population of Young Adults.

    PubMed

    Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca

    2017-06-01

    Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.

  11. A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

    PubMed Central

    Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

    2014-01-01

    SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

  12. Vitamin D receptor polymorphisms in patients with cutaneous melanoma.

    PubMed

    Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne

    2012-01-15

    The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis. Copyright © 2011 UICC.

  13. Population differences in platinum toxicity as a means to identify novel genetic susceptibility variants

    PubMed Central

    O'Donnell, Peter H.; Gamazon, Eric; Zhang, Wei; Stark, Amy L.; Kistner-Griffin, Emily O.; Huang, R. Stephanie; Dolan, M. Eileen

    2010-01-01

    Objectives Clinical studies show that Asians (ASN) are more susceptible to toxicities associated with platinum-containing regimens. We hypothesized that studying ASN as an `enriched phenotype' population could enable the discovery of novel genetic determinants of platinum susceptibility. Methods Using well-genotyped lymphoblastoid cell lines from the HapMap, we determined cisplatin and carboplatin cytotoxicity phenotypes (IC50s) for ASN, Caucasians (CEU), and Africans (YRI). IC50s were used in genome-wide association studies. Results ASN were most sensitive to platinums, corroborating clinical findings. ASN genome-wide association studies produced 479 single-nucleotide polymorphisms (SNPs) associating with cisplatin susceptibility and 199 with carboplatin susceptibility (P<10−4). Considering only the most significant variants (P< 9.99 × 10−6), backwards elimination was then used to identify reduced-model SNPs, which robustly described the drug phenotypes within ASN. These SNPs comprised highly descriptive genetic signatures of susceptibility, with 12 SNPs explaining more than 95% of the susceptibility phenotype variation for cisplatin, and eight SNPs approximately 75% for carboplatin. To determine the possible function of these variants in ASN, the SNPs were tested for association with differential expression of target genes. SNPs were highly associated with the expression of multiple target genes, and notably, the histone H3 family was implicated for both drugs, suggesting a platinum-class mechanism. Histone H3 has repeatedly been described as regulating the formation of platinum-DNA adducts, but this is the first evidence that specific genetic variants might mediate these interactions in a pharmacogenetic manner. Finally, to determine whether any ASN-identified SNPs might also be important in other human populations, we interrogated all 479/199 SNPs for association with platinum susceptibility in an independent combined CEU/YRI population. Three unique SNPs for cisplatin and 10 for carboplatin replicated in CEU/YRI. Conclusion Enriched `platinum susceptible' populations can be used to discover novel genetic determinants governing interindividual platinum chemotherapy susceptibility. PMID:20393316

  14. A candidate gene approach to study nematode resistance traits in naturally infected sheep.

    PubMed

    Wilkie, Hazel; Riggio, Valentina; Matika, Oswald; Nicol, Louise; Watt, Kathryn A; Sinclair, Rona; Sparks, Alexandra M; Nussey, Daniel H; Pemberton, Josephine M; Houston, Ross D; Hopkins, John

    2017-08-30

    Sheep naturally acquire a degree of resistant immunity to parasitic worm infection through repeated exposure. However, the immune response and clinical outcome vary greatly between animals. Genetic polymorphisms in genes integral to differential T helper cell polarization may contribute to variation in host response and disease outcome. A total of twelve single nucleotide polymorphisms (SNPs) were sequenced in IL23R, RORC2 and TBX21 from genomic DNA of Scottish Blackface lambs. Of the twelve SNPs, six were non-synonymous (missense), four were within the 3' UTRs and two were intronic. The association between nine of these SNPs and the traits of body weight, faecal egg count (FEC) and relative T. circumcincta L3-specific IgA antibody levels was assessed in a population of domestic Scottish Blackface ewe lambs and a population of free-living Soay ewe lambs both naturally infected with a mixture of nematodes. There were no significant associations identified between any of the SNPs and phenotypes recorded in either of the populations after adjustment for multiple testing (Bonferroni corrected P value≤0.002). In the Blackface lambs, there was a nominally significant association (P=0.007) between IL23R p.V324M and weight at 20 weeks. This association may be worthy of further investigation in a larger sample of sheep. Copyright © 2017. Published by Elsevier B.V.

  15. Whole-Genome Resequencing of Experimental Populations Reveals Polygenic Basis of Egg-Size Variation in Drosophila melanogaster

    PubMed Central

    Jha, Aashish R.; Miles, Cecelia M.; Lippert, Nodia R.; Brown, Christopher D.; White, Kevin P.; Kreitman, Martin

    2015-01-01

    Complete genome resequencing of populations holds great promise in deconstructing complex polygenic traits to elucidate molecular and developmental mechanisms of adaptation. Egg size is a classic adaptive trait in insects, birds, and other taxa, but its highly polygenic architecture has prevented high-resolution genetic analysis. We used replicated experimental evolution in Drosophila melanogaster and whole-genome sequencing to identify consistent signatures of polygenic egg-size adaptation. A generalized linear-mixed model revealed reproducible allele frequency differences between replicated experimental populations selected for large and small egg volumes at approximately 4,000 single nucleotide polymorphisms (SNPs). Several hundred distinct genomic regions contain clusters of these SNPs and have lower heterozygosity than the genomic background, consistent with selection acting on polymorphisms in these regions. These SNPs are also enriched among genes expressed in Drosophila ovaries and many of these genes have well-defined functions in Drosophila oogenesis. Additional genes regulating egg development, growth, and cell size show evidence of directional selection as genes regulating these biological processes are enriched for highly differentiated SNPs. Genetic crosses performed with a subset of candidate genes demonstrated that these genes influence egg size, at least in the large genetic background. These findings confirm the highly polygenic architecture of this adaptive trait, and suggest the involvement of many novel candidate genes in regulating egg size. PMID:26044351

  16. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    PubMed

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  17. Interleukin-2 and Interleukin-8 Gene Polymorphisms and Acquired Aplastic Anemia Risk in a Chinese Population.

    PubMed

    Zhang, Xuejie; Lin, Shengyun; Yang, Yan; Rong, Liucheng; He, Guangsheng; He, Hailong; Xue, Yao; Fang, Yongjun; Wang, Yaping

    2017-01-01

    Cytokines IL-2 and IL-8 both participate in immune regulation. However, the relationship between polymorphisms in these two cytokines and the risk of acquired aplastic anemia (acquired AA) has not been explored. We selected five SNPs including rs11575812, rs2069772 and rs2069762 of IL-2, rs2227306 and rs2227543 of IL-8. SNaPshot genotyping was used to test the genotypes of IL-2 and IL-8 polymorphisms in a population of 101 acquired AA patients and 165 healthy controls. The rs2069762 G allele appeared to be a protective mutation, but no significant differences were found in other four SNPs. We also found that rs2069762 had an impact on the transcriptional regulation. It could be assumed that the rs2069762 polymorphism might reduce the risk of acquired aplastic anemia, while the remaining four SNPs might not contribute to susceptibility to acquired AA in a Chinese population. © 2017 The Author(s)Published by S. Karger AG, Basel.

  18. Fine-Mapping of Common Genetic Variants Associated with Colorectal Tumor Risk Identified Potential Functional Variants

    PubMed Central

    Gala, Manish; Abecasis, Goncalo; Bezieau, Stephane; Brenner, Hermann; Butterbach, Katja; Caan, Bette J.; Carlson, Christopher S.; Casey, Graham; Chang-Claude, Jenny; Conti, David V.; Curtis, Keith R.; Duggan, David; Gallinger, Steven; Haile, Robert W.; Harrison, Tabitha A.; Hayes, Richard B.; Hoffmeister, Michael; Hopper, John L.; Hudson, Thomas J.; Jenkins, Mark A.; Küry, Sébastien; Le Marchand, Loic; Leal, Suzanne M.; Newcomb, Polly A.; Nickerson, Deborah A.; Potter, John D.; Schoen, Robert E.; Schumacher, Fredrick R.; Seminara, Daniela; Slattery, Martha L.; Hsu, Li; Chan, Andrew T.; White, Emily; Berndt, Sonja I.; Peters, Ulrike

    2016-01-01

    Genome-wide association studies (GWAS) have identified many common single nucleotide polymorphisms (SNPs) associated with colorectal cancer risk. These SNPs may tag correlated variants with biological importance. Fine-mapping around GWAS loci can facilitate detection of functional candidates and additional independent risk variants. We analyzed 11,900 cases and 14,311 controls in the Genetics and Epidemiology of Colorectal Cancer Consortium and the Colon Cancer Family Registry. To fine-map genomic regions containing all known common risk variants, we imputed high-density genetic data from the 1000 Genomes Project. We tested single-variant associations with colorectal tumor risk for all variants spanning genomic regions 250-kb upstream or downstream of 31 GWAS-identified SNPs (index SNPs). We queried the University of California, Santa Cruz Genome Browser to examine evidence for biological function. Index SNPs did not show the strongest association signals with colorectal tumor risk in their respective genomic regions. Bioinformatics analysis of SNPs showing smaller P-values in each region revealed 21 functional candidates in 12 loci (5q31.1, 8q24, 11q13.4, 11q23, 12p13.32, 12q24.21, 14q22.2, 15q13, 18q21, 19q13.1, 20p12.3, and 20q13.33). We did not observe evidence of additional independent association signals in GWAS-identified regions. Our results support the utility of integrating data from comprehensive fine-mapping with expanding publicly available genomic databases to help clarify GWAS associations and identify functional candidates that warrant more onerous laboratory follow-up. Such efforts may aid the eventual discovery of disease-causing variant(s). PMID:27379672

  19. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    PubMed

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Genome-Wide Association Study of Intelligence: Additive Effects of Novel Brain Expressed Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Shtir, Corina; Doyle, Alysa E.; Mick, Eric; McGough, James J.; McCracken, James; Biederman, Joseph; Smalley, Susan L.; Cantor, Rita M.; Faraone, Stephen V.; Nelson, Stanley F.

    2012-01-01

    Objective: The purpose of the present study was to identify common genetic variants that are associated with human intelligence or general cognitive ability. Method: We performed a genome-wide association analysis with a dense set of 1 million single-nucleotide polymorphisms (SNPs) and quantitative intelligence scores within an ancestrally…

  1. [Polymorphism of POU1F1 gene and PRL gene and their combined effects on milk performance traits in Chinese Holstein cattle].

    PubMed

    Jia, Xiang-Jie; Wang, Chang-Fa; Yang, Gui-Wen; Huang, Jin-Ming; Li, Qiu-Ling; Zhong, Ji-Feng

    2011-12-01

    Three novel SNPs were found by DNA sequencing, PCR-RFLP and CRS-PCR methods were used for genotyping in 979 Chinese Holstein cattle. One SNP, G1178C, was identified in exon 2 of POU1F1 gene. Two novel SNPs, A906G and A1134G, were identified in 5'-flanking regulatory region (5'-UTR) of PRL gene. The association between polymorphisms of the two genes and milk performance traits were analyzed with PROC GLM of SAS. The results showed that GC genotype at 1178 locus of POU1F1 gene was advantageous for milk yield, milk protein yield, and milk fat yield. AG genotype at 906 locus was advantageous for milk yield. There was no significant difference between 1134 locus and milk performance traits of 5'-UTR of PRL gene. Analysis of genotype combination effect on milk production traits showed that the effect of combined genotype was not simple sum of single genotypes and the effects of gene pyramiding seemed to be more important in molecular breeding.

  2. Molecular genetic studies in Saudi population; identified variants from GWAS and meta-analysis in stroke.

    PubMed

    Alharbi, Khalid Khalaf; Ali Khan, Imran; Alotaibi, Mohammad Abdullah; Saud Aloyaid, Abdullah; Al-Basheer, Haifa Abdulaziz; Alghamdi, Naelah Abdullah; Al-Baradie, Raid Saleem; Al-Sulaiman, A M

    2018-01-01

    Stroke is a multifactorial and heterogeneous disorder, correlates with heritability and considered as one of the major diseases. The prior reports performed the variable models such as genome-wide association studies (GWAS), replication, case-control, cross-sectional and meta-analysis studies and still, we lack diagnostic marker in the global world. There are limited studies were carried out in Saudi population, and we aim to investigate the molecular association of single nucleotide polymorphisms (SNPs) identified through GWAS and meta-analysis studies in stroke patients in the Saudi population. In this case-control study, we have opted gender equality of 207 cases and 207 controls from the capital city of Saudi Arabia in King Saud University Hospital. The peripheral blood (5 ml) sample will be collected in two different vacutainers, and three mL of the coagulated blood will be used for lipid analysis (biochemical tests) and two mL will be used for DNA analysis (molecular tests). Genomic DNA will be extracted with the collected blood samples, and specific primers will be designed for the opted SNPs ( SORT1 -rs646218 and OLR1 -rs11053646 polymorphisms) and PCR-RFLP will be performed and randomly DNA sequencing will be carried out to cross check the results. The rs646218 and rs11053646 polymorphisms were significantly associated with allele, genotype and dominant models with and without crude odds ratios (OR's) and Multiple logistic regression analysis (p < 0.05). Correlation between lipid profile and genotypes has confirmed the significant relation between triglycerides and rs646218 and rs1105364 6polymorphisms. However, rs11053646 polymorphism was correlated with HDLC (p = 0.04). Genotypes were examined in both males' vs. males and females' vs. females in cases and control and we concluded that in rs11053646 polymorphisms with male subjects compared between cases and controls found to be associated with dominant model heterozygote genotypes (p < 0.05). The results of the current study confirmed the SORT1 and OLR1  SNPs were associated in the Saudi population. The current results were in the association with the prior study results documented through GWAS and meta-analysis association. However, other ethnic population studies should be performed to rule out in the human hereditary diseases.

  3. Association of the FGA and SLC6A4 genes with autistic spectrum disorder in a Korean population.

    PubMed

    Ro, Myungja; Won, Seongsik; Kang, Hyunjun; Kim, Su-Yeon; Lee, Seung Ku; Nam, Min; Bang, Hee Jung; Yang, Jae Won; Choi, Kyung-Sik; Kim, Su Kang; Chung, Joo-Ho; Kwack, Kyubum

    2013-01-01

    Autism spectrum disorder (ASD) is a neurobiological disorder characterized by distinctive impairments in cognitive function, language, and behavior. Linkage and population studies suggest a genetic association between solute carrier family 6 member 4 (SLC6A4) variants and ASD. Logistic regression was used to identify associations between single-nucleotide polymorphisms (SNPs) and ASD with 3 alternative models (additive, dominant, and recessive). Linear regression analysis was performed to determine the influence of SNPs on Childhood Autism Rating Scale (CARS) scores as a quantitative phenotype. In the present study, we examined the associations of SNPs in the SLC6A4 gene and the fibrinogen alpha chain (FGA) gene. Logistic regression analysis showed a significant association between the risk of ASD and rs2070025 and rs2070011 in the FGA gene. The gene-gene interaction between SLC6A4 and FGA was not significantly associated with ASD susceptibility. However, polymorphisms in both SLC6A4 and the FGA gene significantly affected the symptoms of ASD. Our findings indicate that FGA and SLC6A4 gene interactions may contribute to the phenotypes of ASD rather than the incidence of ASD. © 2013 S. Karger AG, Basel.

  4. Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

    PubMed Central

    Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

    2007-01-01

    Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

  5. Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity.

    PubMed

    Ovsyannikova, Inna G; Haralambieva, Iana H; Vierkant, Robert A; O'Byrne, Megan M; Poland, Gregory A

    2013-06-01

    The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×10(5)PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r(2)≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic -2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses. Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  6. Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

    PubMed Central

    Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

    2016-01-01

    Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

  7. Fast and robust group-wise eQTL mapping using sparse graphical models.

    PubMed

    Cheng, Wei; Shi, Yu; Zhang, Xiang; Wang, Wei

    2015-01-16

    Genome-wide expression quantitative trait loci (eQTL) studies have emerged as a powerful tool to understand the genetic basis of gene expression and complex traits. The traditional eQTL methods focus on testing the associations between individual single-nucleotide polymorphisms (SNPs) and gene expression traits. A major drawback of this approach is that it cannot model the joint effect of a set of SNPs on a set of genes, which may correspond to hidden biological pathways. We introduce a new approach to identify novel group-wise associations between sets of SNPs and sets of genes. Such associations are captured by hidden variables connecting SNPs and genes. Our model is a linear-Gaussian model and uses two types of hidden variables. One captures the set associations between SNPs and genes, and the other captures confounders. We develop an efficient optimization procedure which makes this approach suitable for large scale studies. Extensive experimental evaluations on both simulated and real datasets demonstrate that the proposed methods can effectively capture both individual and group-wise signals that cannot be identified by the state-of-the-art eQTL mapping methods. Considering group-wise associations significantly improves the accuracy of eQTL mapping, and the successful multi-layer regression model opens a new approach to understand how multiple SNPs interact with each other to jointly affect the expression level of a group of genes.

  8. Putative Prostate Cancer Risk SNP in an Androgen Receptor‐Binding Site of the Melanophilin Gene Illustrates Enrichment of Risk SNPs in Androgen Receptor Target Sites

    PubMed Central

    Bu, Huajie; Narisu, Narisu; Schlick, Bettina; Rainer, Johannes; Manke, Thomas; Schäfer, Georg; Pasqualini, Lorenza; Chines, Peter; Schweiger, Michal R.; Fuchsberger, Christian

    2015-01-01

    ABSTRACT Genome‐wide association studies have identified genomic loci, whose single‐nucleotide polymorphisms (SNPs) predispose to prostate cancer (PCa). However, the mechanisms of most of these variants are largely unknown. We integrated chromatin‐immunoprecipitation‐coupled sequencing and microarray expression profiling in TMPRSS2‐ERG gene rearrangement positive DUCaP cells with the GWAS PCa risk SNPs catalog to identify disease susceptibility SNPs localized within functional androgen receptor‐binding sites (ARBSs). Among the 48 GWAS index risk SNPs and 3,917 linked SNPs, 80 were found located in ARBSs. Of these, rs11891426:T>G in an intron of the melanophilin gene (MLPH) was within a novel putative auxiliary AR‐binding motif, which is enriched in the neighborhood of canonical androgen‐responsive elements. T→G exchange attenuated the transcriptional activity of the ARBS in an AR reporter gene assay. The expression of MLPH in primary prostate tumors was significantly lower in those with the G compared with the T allele and correlated significantly with AR protein. Higher melanophilin level in prostate tissue of patients with a favorable PCa risk profile points out a tumor‐suppressive effect. These results unravel a hidden link between AR and a functional putative PCa risk SNP, whose allele alteration affects androgen regulation of its host gene MLPH. PMID:26411452

  9. Cumulative Genetic Risk Predicts Platinum/Taxane-Induced Neurotoxicity

    PubMed Central

    McWhinney-Glass, Sarah; Winham, Stacey J.; Hertz, Daniel L.; Revollo, Jane Yen; Paul, Jim; He, Yijing; Brown, Robert; Motsinger-Reif, Alison A.; McLeod, Howard L.

    2013-01-01

    Purpose The combination of a platinum and taxane are standard of care for many cancers, but the utility is often limited due to debilitating neurotoxicity. We examined whether single nucleotide polymorphisms (SNPs) from annotated candidate genes will identify genetic risk for chemotherapy-induced neurotoxicity. Patients and Methods A candidate-gene association study was conducted to validate the relevance of 1261 SNPs within 60 candidate genes in 404 ovarian cancer patients receiving platinum/taxane chemotherapy on the SCOTROC1 trial. Statistically significant variants were then assessed for replication in a separate 404 patient replication cohort from SCOTROC1. Results Significant associations with chemotherapy-induced neurotoxicity were identified and replicated for four SNPs in SOX10, BCL2, OPRM1, and TRPV1. The Population Attributable Risk for each of the four SNPs ranged from 5–35%, with a cumulative risk of 62%. According to the multiplicative model, the odds of developing neurotoxicity increase by a factor of 1.64 for every risk genotype. Patients possessing 3 risk variants have an estimated odds ratio of 4.49 (2.36–8.54) compared to individuals with 0 risk variants. Neither the four SNPs nor the risk score were associated with progression free survival or overall survival. Conclusions This study demonstrates that SNPs in four genes have a significant cumulative association with increased risk for the development of chemotherapy-induced neurotoxicity, independent of patient survival. PMID:23963862

  10. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.

    2015-01-01

    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

  11. Genome-wide association studies and epistasis analyses of candidate genes related to age at menarche and age at natural menopause in a Korean population.

    PubMed

    Pyun, Jung-A; Kim, Sunshin; Cho, Nam H; Koh, InSong; Lee, Jong-Young; Shin, Chol; Kwack, KyuBum

    2014-05-01

    The aim of this study was to identify polymorphisms and gene-gene interactions that are significantly associated with age at menarche and age at menopause in a Korean population. A total of 3,452 and 1,827 women participated in studies of age at menarche and age at natural menopause, respectively. Linear regression analyses adjusted for residence area were used to perform genome-wide association studies (GWAS), candidate gene association studies, and interactions between the candidate genes for age at menarche and age at natural menopause. In GWAS, four single nucleotide polymorphisms (SNPs; rs7528241, rs1324329, rs11597068, and rs6495785) were strongly associated with age at natural menopause (lowest P = 9.66 × 10). However, GWAS of age at menarche did not reveal any strong associations. In candidate gene association studies, SNPs with P < 0.01 were selected to test their synergistic interactions. For age at natural menopause, there was a significant interaction between intronic SNPs on ADAM metallopeptidase with thrombospondin type I motif 9 (ADAMTS9) and SMAD family member 3 (SMAD3) genes (P = 9.52 × 10). For age at menarche, there were three significant interactions between three intronic SNPs on follicle-stimulating hormone receptor (FSHR) gene and one SNP located at the 3' flanking region of insulin-like growth factor 2 receptor (IGF2R) gene (lowest P = 1.95 × 10). Novel SNPs and synergistic interactions between candidate genes are significantly associated with age at menarche and age at natural menopause in a Korean population.

  12. Genome-wide association study of vitamin D concentrations in Hispanic Americans: the IRAS family study.

    PubMed

    Engelman, Corinne D; Meyers, Kristin J; Ziegler, Julie T; Taylor, Kent D; Palmer, Nicholette D; Haffner, Steven M; Fingerlin, Tasha E; Wagenknecht, Lynne E; Rotter, Jerome I; Bowden, Donald W; Langefeld, Carl D; Norris, Jill M

    2010-10-01

    Vitamin D deficiency is associated with many adverse health outcomes. There are several well established environmental predictors of vitamin D concentrations, yet studies of the genetic determinants of vitamin D concentrations are in their infancy. Our objective was to conduct a pilot genome-wide association (GWA) study of 25-hydroxyvitamin D (25[OH]D) and 1,25-dihydroxyvitamin D (1,25[OH](2)D) concentrations in a subset of 229 Hispanic subjects, followed by replication genotyping of 50 single nucleotide polymorphisms (SNPs) in the entire sample of 1190 Hispanics from San Antonio, Texas and San Luis Valley, Colorado. Of the 309,200 SNPs that met all quality control criteria, three SNPs in high linkage disequilibrium (LD) with each other were significantly associated with 1,25[OH](2)D (rs6680429, rs9970802, and rs10889028) at a Bonferroni corrected P-value threshold of 1.62 × 10(-7), however none met the threshold for 25[OH]D. Of the 50 SNPs selected for replication genotyping, five for 25[OH]D (rs2806508, rs10141935, rs4778359, rs1507023, and rs9937918) and eight for 1,25[OH](2)D (rs6680429, rs1348864, rs4559029, rs12667374, rs7781309, rs10505337, rs2486443, and rs2154175) were replicated in the entire sample of Hispanics (P<0.01). In conclusion, we identified several SNPs that were associated with vitamin D metabolite concentrations in Hispanics. These candidate polymorphisms merit further investigation in independent populations and other ethnicities. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

    PubMed

    Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

    2016-01-01

    The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

  14. Association of vitamin D receptor gene polymorphisms with diabetic dyslipidemia in the elderly male population in North China.

    PubMed

    Xia, Zheng; Hu, Yazhuo; Han, Zhitao; Gao, Ya; Bai, Jie; He, Yao; Zhao, Hua; Zhang, Honghong

    2017-01-01

    The prevalence of dyslipidemia is rising alarmingly in elderly Han Chinese male patients with type 2 diabetes mellitus (T2DM). The genetic factors that contribute to the development of diabetic dyslipidemia remain incompletely identified. This study was conducted to assess the association between vitamin D receptor (VDR) polymorphisms and development of dyslipidemia in the Han elderly male population with T2DM in North China. A total of 242 T2DM patients with dyslipidemia (DH group, n=108) or without dyslipidemia (DO group, n=134) and 100 controls were genotyped for ApaI, TaqI and FokI single nucleotide polymorphisms (SNPs) of the VDR gene using polymerase chain reaction-restriction fragment length polymorphism and sequencing. The frequency and distribution of the SNPs were compared between cases and controls. The distribution of genotypes of VDR-FokI was significantly different between the control and DM group ( P =0.033), as well as between the control and DH subgroup ( P =0.011) but not DO subgroup ( P =0.111). The frequency of C allele and CC genotype of FokI was significantly higher in the DH patients than in the controls ( P =0.015 and P =0.003, respectively). Logistic regression analysis in a dominant model homozygous for the C allele of the FokI SNP showed that CC genotype was associated with DH patients (OR =1.797, 95% CI: 1.077-2.999, P =0.025). Significant associations of the ApaI and TaqI SNPs with either DO or DH subjects were not observed. These findings suggest that CC genotype of VDR-FokI is a risk factor for T2DM patients with dyslipidemia in elderly males in North China.

  15. Interactions of Cigarette Smoking with NAT2 Polymorphisms Impact Rheumatoid Arthritis Risk in African Americans

    PubMed Central

    Mikuls, Ted R.; LeVan, Tricia; Gould, Karen A.; Yu, Fang; Thiele, Geoffrey M.; Bynote, Kimberly K.; Conn, Doyt; Jonas, Beth L.; Callahan, Leigh F.; Smith, Edwin; Brasington, Richard; Moreland, Larry W.; Reynolds, Richard; Gaffo, Angelo; Bridges, S. Louis

    2011-01-01

    Objective To examine whether polymorphisms in genes coding for drug metabolizing enzymes (DMEs) impact rheumatoid arthritis (RA) risk due to cigarette smoking in African Americans. Methods Smoking status was evaluated in African American RA cases and non-RA controls categorized as heavy (≥ 10 pack-years) vs. other. Individuals were genotyped for a homozygous deletion polymorphism in glutathione S-transferase Mu-1 (GSTM1-null) in addition to tagging single nucleotide polymorphisms (SNPs) in N-acetyltransferase (NAT)1, NAT2, and epoxide hydrolase (EPXH1). Associations of genotypes with RA were examined using logistic regression and gene-smoking interactions were assessed. Results There were no significant associations of any DME genotype with RA. After adjustment for multiple comparisons, there were significant additive interactions between heavy smoking and NAT2 SNPs rs9987109 (Padd = 0.000003) and rs1208 (Padd = 0.00001); attributable proportions (APs) due to interaction ranged from 0.61 to 0.67. None of the multiplicative gene-smoking interactions examined remained significant after adjustment for multiple testing in overall disease risk. There was no evidence of significant gene-smoking interactions in analyses of GSTM1-null, NAT1, or EPXH1. DME gene-smoking interactions were similar when cases were limited to anti-citrullinated protein antibody (ACPA) positive individuals. Conclusion Among African Americans, RA risk imposed by heavy smoking appears to be mediated in part by genetic variation in NAT2. While further studies are needed to elucidate mechanisms underpinning these interactions, these SNPs appear to identify African American smokers at a much higher risk for RA with relative risks that are at least two-fold higher compared to non-smokers lacking these risk alleles. PMID:21989592

  16. Association studies on ghrelin and ghrelin receptor gene polymorphisms with obesity.

    PubMed

    Gueorguiev, Maria; Lecoeur, Cécile; Meyre, David; Benzinou, Michael; Mein, Charles A; Hinney, Anke; Vatin, Vincent; Weill, Jacques; Heude, Barbara; Hebebrand, Johannes; Grossman, Ashley B; Korbonits, Márta; Froguel, Philippe

    2009-04-01

    Ghrelin exerts a stimulatory effect on appetite and regulates energy homeostasis. Ghrelin gene variants have been shown to be associated with metabolic traits, although there is evidence suggesting linkage and association with obesity and the ghrelin receptor (GHSR). We hypothesized that these genes are good candidates for susceptibility to obesity. Direct sequencing identified 12 ghrelin single-nucleotide polymorphisms (SNPs) and 8 GHSR SNPs. The 10 common SNPs were genotyped in 1,275 obese subjects and in 1,059 subjects from a general population cohort of European origin. In the obesity case-control study, the GHSR SNP rs572169 was found to be associated with obesity (P = 0.007 in additive model, P = 0.001 in dominant model, odds ratio (OR) 1.73, 95% confidence interval (1.23-2.44)). The ghrelin variant, g.A265T (rs4684677), showed an association with obesity (P = 0.009, BMI adjusted for age and sex) in obese families. The ghrelin variant, g.A-604G (rs27647), showed an association with insulin levels at 2-h post-oral glucose tolerance test (OGTT) (P = 0.009) in obese families. We found an association between the eating behavior "overeating" and the GHSR SNP rs2232169 (P = 0.02) in obese subjects. However, none of these associations remained significant when corrected for multiple comparisons. Replication of the nominal associations with obesity could not be confirmed in a German genome-wide association (GWA) study for rs4684677 and rs572169 polymorphisms. Our data suggest that common polymorphisms in ghrelin and its receptor genes are not major contributors to the development of polygenic obesity, although common variants may alter body weight and eating behavior and contribute to insulin resistance, in particular in the context of early-onset obesity.

  17. Association between FASN gene polymorphisms ultrasound carcass traits and intramuscular fat in Qinchuan cattle.

    PubMed

    Raza, Sayed Haidar Abbas; Gui, Linsheng; Khan, Rajwali; Schreurs, Nicola M; Xiaoyu, Wang; Wu, Sen; Mei, Chugang; Wang, Li; Ma, Xueyao; Wei, Dawei; Guo, Hongfang; Zhang, Song; Wang, Xingping; Kaleri, Hubdar Ali; Zan, Linsen

    2018-03-01

    Fatty acid synthase (FASN) is an enzyme involved with fat deposition and fatty acid composition in cattle. This study was conducted to detect single nucleotide polymorphisms (SNPs) of the FASN gene and explore their relationships with ultrasound carcass traits in order to assess the potential use of the FASN gene for the breeding selection of Qinchuan cattle for desirable carcass traits. The frequencies of SNP g.12740C>T, g.13192T>C and g.13232C>T were identified in 525 individual Qinchuan cattle which were also assessed for backfat depth, eye muscle area and intramuscular fat by ultrasound. According to the PIC values, g.13192T>C possessed an intermediate polymorphism (0.25T, g.12740C>T possessed low polymorphism (PIC<0.25). Chi-square tests showed that g.13192T>C were in Hardy-Weinberg disequilibrium (c2C was associated with a greater eye muscle area and the TT genotype at g.13232C>T was associated with greater intramuscular fat. When these genotypes were combined there was no difference in eye muscle area and intramuscular fat between the diplotypes. The H 2 H 2 diplotype was associated with carcass traits that are likely to provide economic advantage in Qinchuan cattle. Variations in the FASN genes and their corresponding genotypes may be considered as molecular markers for economic traits in cattle breeding. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Automated SNP detection from a large collection of white spruce expressed sequences: contributing factors and approaches for the categorization of SNPs

    PubMed Central

    Pavy, Nathalie; Parsons, Lee S; Paule, Charles; MacKay, John; Bousquet, Jean

    2006-01-01

    Background High-throughput genotyping technologies represent a highly efficient way to accelerate genetic mapping and enable association studies. As a first step toward this goal, we aimed to develop a resource of candidate Single Nucleotide Polymorphisms (SNP) in white spruce (Picea glauca [Moench] Voss), a softwood tree of major economic importance. Results A white spruce SNP resource encompassing 12,264 SNPs was constructed from a set of 6,459 contigs derived from Expressed Sequence Tags (EST) and by using the bayesian-based statistical software PolyBayes. Several parameters influencing the SNP prediction were analysed including the a priori expected polymorphism, the probability score (PSNP), and the contig depth and length. SNP detection in 3' and 5' reads from the same clones revealed a level of inconsistency between overlapping sequences as low as 1%. A subset of 245 predicted SNPs were verified through the independent resequencing of genomic DNA of a genotype also used to prepare cDNA libraries. The validation rate reached a maximum of 85% for SNPs predicted with either PSNP ≥ 0.95 or ≥ 0.99. A total of 9,310 SNPs were detected by using PSNP ≥ 0.95 as a criterion. The SNPs were distributed among 3,590 contigs encompassing an array of broad functional categories, with an overall frequency of 1 SNP per 700 nucleotide sites. Experimental and statistical approaches were used to evaluate the proportion of paralogous SNPs, with estimates in the range of 8 to 12%. The 3,789 coding SNPs identified through coding region annotation and ORF prediction, were distributed into 39% nonsynonymous and 61% synonymous substitutions. Overall, there were 0.9 SNP per 1,000 nonsynonymous sites and 5.2 SNPs per 1,000 synonymous sites, for a genome-wide nonsynonymous to synonymous substitution rate ratio (Ka/Ks) of 0.17. Conclusion We integrated the SNP data in the ForestTreeDB database along with functional annotations to provide a tool facilitating the choice of candidate genes for mapping purposes or association studies. PMID:16824208

  19. Association of Adenylate Cyclase 10 (ADCY10) Polymorphisms and Bone Mineral Density in Healthy Adults

    PubMed Central

    Ichikawa, Shoji; Koller, Daniel L.; Curry, Leah R.; Lai, Dongbing; Xuei, Xiaoling; Edenberg, Howard J.; Hui, Siu L.; Peacock, Munro; Foroud, Tatiana; Econs, Michael J.

    2010-01-01

    Phenotypic variation in bone mineral density (BMD) among healthy adults is influenced by both genetic and environmental factors. Genetic sequence variations in the adenylate cyclase 10 (ADCY10) gene, which is also called soluble adenylate cyclase, have previously been reported to be associated with low spinal BMD in hypercalciuric patients. Since ADCY10 is located in the region linked to spinal BMD in our previous linkage analysis, we tested whether polymorphisms in this gene are also associated with normal BMD variation in healthy adults. Sixteen single nucleotide polymorphisms (SNPs) distributed throughout ADCY10 were genotyped in two healthy groups of American whites: 1,692 premenopausal women and 715 men. Statistical analyses were performed in the two groups to test for association between these SNPs and femoral neck and lumbar spine areal BMD. We observed significant evidence of association (p<0.01) with one SNP each in men and women. Genotypes at these SNPs accounted for less than 1% of hip BMD variation in men, but 1.5% of spinal BMD in women. However, adjacent SNPs did not corroborate the association in either males or females. In conclusion, we found a modest association between an ADCY10 polymorphism and spinal areal BMD in premenopausal white women. PMID:19093065

  20. Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

    PubMed Central

    Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E.; Al Masaud, Abdulaziz; Shire, Abdirashid M.; Das, Nagalla; Gumaa, Khalid

    2017-01-01

    Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of ‘which SNPs in which populations.’ The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Methods Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. Results None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Conclusion Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. PMID:28956366

  1. Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population.

    PubMed

    Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E; Al Masaud, Abdulaziz; Shire, Abdirashid M; Das, Nagalla; Gumaa, Khalid; Giha, Hayder A

    2017-09-01

    Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of 'which SNPs in which populations.' The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. Copyright © 2017 Korean Endocrine Society

  2. Joint Effects of Known Type 2 Diabetes Susceptibility Loci in Genome-Wide Association Study of Singapore Chinese: The Singapore Chinese Health Study

    PubMed Central

    Chen, Zhanghua; Pereira, Mark A.; Seielstad, Mark; Koh, Woon-Puay; Tai, E. Shyong; Teo, Yik-Ying; Liu, Jianjun; Hsu, Chris; Wang, Renwei; Odegaard, Andrew O.; Thyagarajan, Bharat; Koratkar, Revati; Yuan, Jian-Min; Gross, Myron D.; Stram, Daniel O.

    2014-01-01

    Background Genome-wide association studies (GWAS) have identified genetic factors in type 2 diabetes (T2D), mostly among individuals of European ancestry. We tested whether previously identified T2D-associated single nucleotide polymorphisms (SNPs) replicate and whether SNPs in regions near known T2D SNPs were associated with T2D within the Singapore Chinese Health Study. Methods 2338 cases and 2339 T2D controls from the Singapore Chinese Health Study were genotyped for 507,509 SNPs. Imputation extended the genotyped SNPs to 7,514,461 with high estimated certainty (r2>0.8). Replication of known index SNP associations in T2D was attempted. Risk scores were computed as the sum of index risk alleles. SNPs in regions ±100 kb around each index were tested for associations with T2D in conditional fine-mapping analysis. Results Of 69 index SNPs, 20 were genotyped directly and genotypes at 35 others were well imputed. Among the 55 SNPs with data, disease associations were replicated (at p<0.05) for 15 SNPs, while 32 more were directionally consistent with previous reports. Risk score was a significant predictor with a 2.03 fold higher risk CI (1.69–2.44) of T2D comparing the highest to lowest quintile of risk allele burden (p = 5.72×10−14). Two improved SNPs around index rs10923931 and 5 new candidate SNPs around indices rs10965250 and rs1111875 passed simple Bonferroni corrections for significance in conditional analysis. Nonetheless, only a small fraction (2.3% on the disease liability scale) of T2D burden in Singapore is explained by these SNPs. Conclusions While diabetes risk in Singapore Chinese involves genetic variants, most disease risk remains unexplained. Further genetic work is ongoing in the Singapore Chinese population to identify unique common variants not already seen in earlier studies. However rapid increases in T2D risk have occurred in recent decades in this population, indicating that dynamic environmental influences and possibly gene by environment interactions complicate the genetic architecture of this disease. PMID:24520337

  3. Joint effects of known type 2 diabetes susceptibility loci in genome-wide association study of Singapore Chinese: the Singapore Chinese health study.

    PubMed

    Chen, Zhanghua; Pereira, Mark A; Seielstad, Mark; Koh, Woon-Puay; Tai, E Shyong; Teo, Yik-Ying; Liu, Jianjun; Hsu, Chris; Wang, Renwei; Odegaard, Andrew O; Thyagarajan, Bharat; Koratkar, Revati; Yuan, Jian-Min; Gross, Myron D; Stram, Daniel O

    2014-01-01

    Genome-wide association studies (GWAS) have identified genetic factors in type 2 diabetes (T2D), mostly among individuals of European ancestry. We tested whether previously identified T2D-associated single nucleotide polymorphisms (SNPs) replicate and whether SNPs in regions near known T2D SNPs were associated with T2D within the Singapore Chinese Health Study. 2338 cases and 2339 T2D controls from the Singapore Chinese Health Study were genotyped for 507,509 SNPs. Imputation extended the genotyped SNPs to 7,514,461 with high estimated certainty (r(2)>0.8). Replication of known index SNP associations in T2D was attempted. Risk scores were computed as the sum of index risk alleles. SNPs in regions ± 100 kb around each index were tested for associations with T2D in conditional fine-mapping analysis. Of 69 index SNPs, 20 were genotyped directly and genotypes at 35 others were well imputed. Among the 55 SNPs with data, disease associations were replicated (at p<0.05) for 15 SNPs, while 32 more were directionally consistent with previous reports. Risk score was a significant predictor with a 2.03 fold higher risk CI (1.69-2.44) of T2D comparing the highest to lowest quintile of risk allele burden (p = 5.72 × 10(-14)). Two improved SNPs around index rs10923931 and 5 new candidate SNPs around indices rs10965250 and rs1111875 passed simple Bonferroni corrections for significance in conditional analysis. Nonetheless, only a small fraction (2.3% on the disease liability scale) of T2D burden in Singapore is explained by these SNPs. While diabetes risk in Singapore Chinese involves genetic variants, most disease risk remains unexplained. Further genetic work is ongoing in the Singapore Chinese population to identify unique common variants not already seen in earlier studies. However rapid increases in T2D risk have occurred in recent decades in this population, indicating that dynamic environmental influences and possibly gene by environment interactions complicate the genetic architecture of this disease.

  4. Association of LMX1A genetic polymorphisms with susceptibility to congenital scoliosis in Chinese Han population.

    PubMed

    Wu, Nan; Yuan, Suomao; Liu, Jiaqi; Chen, Jun; Fei, Qi; Liu, Sen; Su, Xinlin; Wang, Shengru; Zhang, Jianguo; Li, Shugang; Wang, Yipeng; Qiu, Guixing; Wu, Zhihong

    2014-10-01

    A genetic association study of single nucleotide polymorphisms (SNPs) for the LMX1A gene with congenital scoliosis (CS) in the Chinese Han population. To determine whether LMX1A genetic polymorphisms are associated with susceptibility to CS. CS is a lateral curvature of the spine due to congenital vertebral defects, whose exact genetic cause has not been well established. The LMX1A gene was suggested as a potential human candidate gene for CS. However, no genetic study of LMX1A in CS has ever been reported. We genotyped 13 SNPs of the LMX1A gene in 154 patients with CS and 144 controls with matched sex and age. After conducting the Hardy-Weinberg equilibrium test, the data of 13 SNPs were analyzed by the allelic and genotypic association with logistic regression analysis. Furthermore, the genotype-phenotype association and haplotype association analysis were also performed. The 13 SNPs of the LMX1A gene met Hardy-Weinberg equilibrium in the controls, which was not in the cases. None of the allelic and genotypic frequencies of these SNPs showed significant difference between case and control groups (P > 0.05). However, the genotypic frequencies of rs1354510 and rs16841013 in the LMX1A gene were associated with CS predisposition in the unconditional logistic regression analysis (P = 0.02 and 0.018, respectively). Genotypic frequencies of 3 SNPs at rs6671290, rs1354510, and rs16841013 were found to exhibit significant differences between patients with CS with failure of formation and the healthy controls (P = 0.019, 0.007, and 0.006, respectively). Besides, in the model analysis by using unconditional logistic regression analysis, the optimized model for the 3 genotypic positive SNPs with failure of formation were rs6671290 (codominant; P = 0.025, Akaike information value = 316.6, Bayesian information criterion = 333.9), rs1354510 (overdominant; P = 0.0017, Akaike information value = 312.1, Bayesian information criterion = 325.9), and rsl6841013 (overdominant; P = 0.0016, Akaike information value = 311.1, Bayesian information criterion = 325), respectively. However, the haplotype distributions in the case group were not significantly different from those of the control group in the 3 haplotype blocks. To our knowledge, this is the first study to identify that the SNPs of the LMX1A gene might be associated with the susceptibility to CS and different clinical phenotypes of CS in the Chinese Han population. 4.

  5. Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

    PubMed

    Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

    2018-04-01

    Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

  6. A polymorphism within the promoter of the TGFβ1 gene is associated with radiation sensitivity using an objective radiologic endpoint.

    PubMed

    Kelsey, Chris R; Jackson, Lauren; Langdon, Scott; Owzar, Kouros; Hubbs, Jessica; Vujaskovic, Zeljko; Das, Shiva; Marks, Lawrence B

    2012-02-01

    To evaluate whether single nucleotide polymorphisms (SNPs) in the transforming growth factor-β1 (TGFβ1) gene are associated with radiation sensitivity using an objective radiologic endpoint. Preradiation therapy and serial postradiation therapy single photon emission computed tomography (SPECT) lung perfusion scans were obtained in patients undergoing treatment for lung cancer. Serial blood samples were obtained to measure circulating levels of TGFβ1. Changes in regional perfusion were related to regional radiation dose yielding a patient-specific dose-response curve, reflecting the patient's inherent sensitivity to radiation therapy. Six TGFβ1 SNPs (-988, -800, -509, 869, 941, and 1655) were assessed using high-resolution melting assays and DNA sequencing. The association between genotype and slope of the dose-response curve, and genotype and TGFβ1 ratio (4-week/preradiation therapy), was analyzed using the Kruskal-Wallis test. 39 white patients with preradiation therapy and ≥ 6-month postradiation therapy SPECT scans and blood samples were identified. Increasing slope of the dose-response curve was associated with the C(-509)T SNP (p = 0.035), but not the other analyzed SNPs. This SNP was also associated with higher TGFβ1 ratios. This study suggests that a polymorphism within the promoter of the TGFβ1 gene is associated with increased radiation sensitivity (defined objectively by dose-dependent changes in SPECT lung perfusion). Copyright © 2012 Elsevier Inc. All rights reserved.

  7. A Polymorphism Within the Promoter of the TGF{beta}1 Gene Is Associated With Radiation Sensitivity Using an Objective Radiologic Endpoint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kelsey, Chris R., E-mail: kelse003@mc.duke.edu; Jackson, Lauren; Langdon, Scott

    2012-02-01

    Purpose: To evaluate whether single nucleotide polymorphisms (SNPs) in the transforming growth factor-{beta}1 (TGF{beta}1) gene are associated with radiation sensitivity using an objective radiologic endpoint. Methods and Materials: Preradiation therapy and serial postradiation therapy single photon emission computed tomography (SPECT) lung perfusion scans were obtained in patients undergoing treatment for lung cancer. Serial blood samples were obtained to measure circulating levels of TGF{beta}1. Changes in regional perfusion were related to regional radiation dose yielding a patient-specific dose-response curve, reflecting the patient's inherent sensitivity to radiation therapy. Six TGF{beta}1 SNPs (-988, -800, -509, 869, 941, and 1655) were assessed using high-resolutionmore » melting assays and DNA sequencing. The association between genotype and slope of the dose-response curve, and genotype and TGF{beta}1 ratio (4-week/preradiation therapy), was analyzed using the Kruskal-Wallis test. Results: 39 white patients with preradiation therapy and {>=}6-month postradiation therapy SPECT scans and blood samples were identified. Increasing slope of the dose-response curve was associated with the C(-509)T SNP (p = 0.035), but not the other analyzed SNPs. This SNP was also associated with higher TGF{beta}1 ratios. Conclusions: This study suggests that a polymorphism within the promoter of the TGF{beta}1 gene is associated with increased radiation sensitivity (defined objectively by dose-dependent changes in SPECT lung perfusion).« less

  8. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

    PubMed

    Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

    2010-11-26

    Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

  9. Genome-wide association study identifies phospholipase C zeta 1 (PLCz1) as a stallion fertility locus in Hanoverian warmblood horses.

    PubMed

    Schrimpf, Rahel; Dierks, Claudia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

    2014-01-01

    A consistently high level of stallion fertility plays an economically important role in modern horse breeding. We performed a genome-wide association study for estimated breeding values of the paternal component of the pregnancy rate per estrus cycle (EBV-PAT) in Hanoverian stallions. A total of 228 Hanoverian stallions were genotyped using the Equine SNP50 Beadchip. The most significant association was found on horse chromosome 6 for a single nucleotide polymorphism (SNP) within phospholipase C zeta 1 (PLCz1). In the close neighbourhood to PLCz1 is located CAPZA3 (capping protein (actin filament) muscle Z-line, alpha 3). The gene PLCz1 encodes a protein essential for spermatogenesis and oocyte activation through sperm induced Ca2+-oscillation during fertilization. We derived equine gene models for PLCz1 and CAPZA3 based on cDNA and genomic DNA sequences. The equine PLCz1 had four different transcripts of which two contained a premature termination codon. Sequencing all exons and their flanking sequences using genomic DNA samples from 19 Hanoverian stallions revealed 47 polymorphisms within PLCz1 and one SNP within CAPZA3. Validation of these 48 polymorphisms in 237 Hanoverian stallions identified three intronic SNPs within PLCz1 as significantly associated with EBV-PAT. Bioinformatic analysis suggested regulatory effects for these SNPs via transcription factor binding sites or microRNAs. In conclusion, non-coding polymorphisms within PLCz1 were identified as conferring stallion fertility and PLCz1 as candidate locus for male fertility in Hanoverian warmblood. CAPZA3 could be eliminated as candidate gene for fertility in Hanoverian stallions.

  10. Genome-Wide Association Study Identifies Phospholipase C zeta 1 (PLCz1) as a Stallion Fertility Locus in Hanoverian Warmblood Horses

    PubMed Central

    Schrimpf, Rahel; Dierks, Claudia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

    2014-01-01

    A consistently high level of stallion fertility plays an economically important role in modern horse breeding. We performed a genome-wide association study for estimated breeding values of the paternal component of the pregnancy rate per estrus cycle (EBV-PAT) in Hanoverian stallions. A total of 228 Hanoverian stallions were genotyped using the Equine SNP50 Beadchip. The most significant association was found on horse chromosome 6 for a single nucleotide polymorphism (SNP) within phospholipase C zeta 1 (PLCz1). In the close neighbourhood to PLCz1 is located CAPZA3 (capping protein (actin filament) muscle Z-line, alpha 3). The gene PLCz1 encodes a protein essential for spermatogenesis and oocyte activation through sperm induced Ca2+-oscillation during fertilization. We derived equine gene models for PLCz1 and CAPZA3 based on cDNA and genomic DNA sequences. The equine PLCz1 had four different transcripts of which two contained a premature termination codon. Sequencing all exons and their flanking sequences using genomic DNA samples from 19 Hanoverian stallions revealed 47 polymorphisms within PLCz1 and one SNP within CAPZA3. Validation of these 48 polymorphisms in 237 Hanoverian stallions identified three intronic SNPs within PLCz1 as significantly associated with EBV-PAT. Bioinformatic analysis suggested regulatory effects for these SNPs via transcription factor binding sites or microRNAs. In conclusion, non-coding polymorphisms within PLCz1 were identified as conferring stallion fertility and PLCz1 as candidate locus for male fertility in Hanoverian warmblood. CAPZA3 could be eliminated as candidate gene for fertility in Hanoverian stallions. PMID:25354211

  11. Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

    PubMed

    Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

    2017-08-01

    Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

  12. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

    PubMed Central

    2013-01-01

    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766

  13. Single nucleotide polymorphisms and genotypes of transient receptor potential ion channel and acetylcholine receptor genes from isolated B lymphocytes in myalgic encephalomyelitis/chronic fatigue syndrome patients.

    PubMed

    Marshall-Gradisnik, Sonya; Johnston, Samantha; Chacko, Anu; Nguyen, Thao; Smith, Peter; Staines, Donald

    2016-12-01

    Objective The pathomechanism of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) is unknown; however, a small subgroup of patients has shown muscarinic antibody positivity and reduced symptom presentation following anti-CD20 intervention. Given the important roles of calcium (Ca 2+ ) and acetylcholine (ACh) signalling in B cell activation and potential antibody development, we aimed to identify relevant single nucleotide polymorphisms (SNPs) and genotypes in isolated B cells from CFS/ME patients. Methods A total of 11 CFS/ME patients (aged 31.82 ± 5.50 years) and 11 non-fatigued controls (aged 33.91 ± 5.06 years) were included. Flow cytometric protocols were used to determine B cell purity, followed by SNP and genotype analysis for 21 mammalian TRP ion channel genes and nine mammalian ACh receptor genes. SNP association and genotyping analysis were performed using ANOVA and PLINK analysis software. Results Seventy-eight SNPs were identified in nicotinic and muscarinic acetylcholine receptor genes in the CFS/ME group, of which 35 were in mAChM3. The remaining SNPs were identified in nAChR delta (n = 12), nAChR alpha 9 (n = 5), TRPV2 (n = 7), TRPM3 (n = 4), TRPM4 (n = 1) mAChRM3 2 (n = 2), and mAChRM5 (n = 3) genes. Nine genotypes were identified from SNPs in TRPM3 (n = 1), TRPC6 (n = 1), mAChRM3 (n = 2), nAChR alpha 4 (n = 1), and nAChR beta 1 (n = 4) genes, and were located in introns and 3' untranslated regions. Odds ratios for these specific genotypes ranged between 7.11 and 26.67 for CFS/ME compared with the non-fatigued control group. Conclusion This preliminary investigation identified a number of SNPs and genotypes in genes encoding TRP ion channels and AChRs from B cells in patients with CFS/ME. These may be involved in B cell functional changes, and suggest a role for Ca 2+ dysregulation in AChR and TRP ion channel signalling in the pathomechanism of CFS/ME.

  14. The Impact of Polymorphic Variations in the 5p15, 6p12, 6p21 and 15q25 Loci on the Risk and Prognosis of Portuguese Patients with Non-Small Cell Lung Cancer

    PubMed Central

    de Mello, Ramon Andrade; Ferreira, Mónica; Soares-Pires, Filipa; Costa, Sandra; Cunha, João; Oliveira, Pedro; Hespanhol, Venceslau; Reis, Rui Manuel

    2013-01-01

    Introduction Polymorphic variants in the 5p15, 6p12, 6p21, and 15q25 loci were demonstrated to potentially contribute to lung cancer carcinogenesis. Therefore, this study was performed to assess the role of those variants in non-small cell lung cancer (NSCLC) risk and prognosis in a Portuguese population. Materials and Methods Blood from patients with NSCLC was prospectively collected. To perform an association study, DNA from these patients and healthy controls were genotyped for a panel of 19 SNPs using a Sequenom® MassARRAY platform. Kaplan-Meier curves were used to assess the overall survival (OS) and progression-free survival (PFS). Results One hundred and forty-four patients with NSCLC were successfully consecutively genotyped for the 19 SNPs. One SNP was associated with NSCLC risk: rs9295740 G/A. Two SNPs were associated with non-squamous histology: rs3024994 (VEGF intron 2) T/C and rs401681 C/T. Three SNPs were associated with response rate: rs3025035 (VEGF intron 7) C/T, rs833061 (VEGF –460) C/T and rs9295740 G/A. One SNP demonstrated an influence on PFS: rs401681 C/T at 5p15, p = 0.021. Four SNPs demonstrated an influence on OS: rs2010963 (VEGF +405 G/C), p = 0.042; rs3025010 (VEGF intron 5 C/T), p = 0.047; rs401681 C/T at 5p15, p = 0.046; and rs31489 C/A at 5p15, p = 0.029. Conclusions Our study suggests that SNPs in the 6p12, 6p21, and 5p15 loci may serve as risk, predictive and prognostic NSCLC biomarkers. In the future, SNPs identified in the genomes of patients may improve NSCLC screening strategies and therapeutic management as well. PMID:24039754

  15. High-resolution melting analysis of the single nucleotide polymorphism hot-spot region in the rpoB gene as an indicator of reduced susceptibility to rifaximin in Clostridium difficile.

    PubMed

    Pecavar, Verena; Blaschitz, Marion; Hufnagl, Peter; Zeinzinger, Josef; Fiedler, Anita; Allerberger, Franz; Maass, Matthias; Indra, Alexander

    2012-06-01

    Clostridium difficile, a Gram-positive, spore-forming, anaerobic bacterium, is the main causative agent of hospital-acquired diarrhoea worldwide. In addition to metronidazole and vancomycin, rifaximin, a rifamycin derivative, is a promising antibiotic for the treatment of recurring C. difficile infections (CDI). However, exposure of C. difficile to this antibiotic has led to the development of rifaximin-resistance due to point mutations in the β-subunit of the RNA polymerase (rpoB) gene. In the present study, 348 C. difficile strains with known PCR-ribotypes were investigated for respective single nucleotide polymorphisms (SNPs) within the proposed rpoB hot-spot region by using high-resolution melting (HRM) analysis. This method allows the detection of SNPs by comparing the altered melting behaviour of dsDNA with that of wild-type DNA. Discrimination between wild-type and mutant strains was enhanced by creating heteroduplexes by mixing sample DNA with wild-type DNA, leading to characteristic melting curve shapes from samples containing SNPs in the respective rpoB section. In the present study, we were able to identify 16 different rpoB sequence-types (ST) by sequencing analysis of a 325 bp fragment. The 16 PCR STs displayed a total of 24 different SNPs. Fifteen of these 24 SNPs were located within the proposed 151 bp SNP hot-spot region, resulting in 11 different HRM curve profiles (CP). Eleven SNPs (seven of which were within the proposed hot-spot region) led to amino acid substitutions associated with reduced susceptibility to rifaximin and 13 SNPs (eight of which were within the hot-spot region) were synonymous. This investigation clearly demonstrates that HRM analysis of the proposed SNP hot-spot region in the rpoB gene of C. difficile is a fast and cost-effective method for the identification of C. difficile samples with reduced susceptibility to rifaximin and even allows simultaneous SNP subtyping of the respective C. difficile isolates.

  16. Genotyping of 75 SNPs using arrays for individual identification in five population groups.

    PubMed

    Hwa, Hsiao-Lin; Wu, Lawrence Shih Hsin; Lin, Chun-Yen; Huang, Tsun-Ying; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

    2016-01-01

    Single nucleotide polymorphism (SNP) typing offers promise to forensic genetics. Various strategies and panels for analyzing SNP markers for individual identification have been published. However, the best panels with fewer identity SNPs for all major population groups are still under discussion. This study aimed to find more autosomal SNPs with high heterozygosity for individual identification among Asian populations. Ninety-six autosomal SNPs of 502 DNA samples from unrelated individuals of five population groups (208 Taiwanese Han, 83 Filipinos, 62 Thais, 69 Indonesians, and 80 individuals with European, Near Eastern, or South Asian ancestry) were analyzed using arrays in an initial screening, and 75 SNPs (group A, 46 newly selected SNPs; groups B, 29 SNPs based on a previous SNP panel) were selected for further statistical analyses. Some SNPs with high heterozygosity from Asian populations were identified. The combined random match probability of the best 40 and 45 SNPs was between 3.16 × 10(-17) and 7.75 × 10(-17) and between 2.33 × 10(-19) and 7.00 × 10(-19), respectively, in all five populations. These loci offer comparable power to short tandem repeats (STRs) for routine forensic profiling. In this study, we demonstrated the population genetic characteristics and forensic parameters of 75 SNPs with high heterozygosity from five population groups. This SNPs panel can provide valuable genotypic information and can be helpful in forensic casework for individual identification among these populations.

  17. How immunogenetically different are domestic pigs from wild boars: a perspective from single-nucleotide polymorphisms of 19 immunity-related candidate genes.

    PubMed

    Chen, Shanyuan; Gomes, Rui; Costa, Vânia; Santos, Pedro; Charneca, Rui; Zhang, Ya-ping; Liu, Xue-hong; Wang, Shao-qing; Bento, Pedro; Nunes, Jose-Luis; Buzgó, József; Varga, Gyula; Anton, István; Zsolnai, Attila; Beja-Pereira, Albano

    2013-10-01

    The coexistence of wild boars and domestic pigs across Eurasia makes it feasible to conduct comparative genetic or genomic analyses for addressing how genetically different a domestic species is from its wild ancestor. To test whether there are differences in patterns of genetic variability between wild and domestic pigs at immunity-related genes and to detect outlier loci putatively under selection that may underlie differences in immune responses, here we analyzed 54 single-nucleotide polymorphisms (SNPs) of 19 immunity-related candidate genes on 11 autosomes in three pairs of wild boar and domestic pig populations from China, Iberian Peninsula, and Hungary. Our results showed no statistically significant differences in allele frequency and heterozygosity across SNPs between three pairs of wild and domestic populations. This observation was more likely due to the widespread and long-lasting gene flow between wild boars and domestic pigs across Eurasia. In addition, we detected eight coding SNPs from six genes as outliers being under selection consistently by three outlier tests (BayeScan2.1, FDIST2, and Arlequin3.5). Among four non-synonymous outlier SNPs, one from TLR4 gene was identified as being subject to positive (diversifying) selection and three each from CD36, IFNW1, and IL1B genes were suggested as under balancing selection. All of these four non-synonymous variants were predicted as being benign by PolyPhen-2. Our results were supported by other independent lines of evidence for positive selection or balancing selection acting on these four immune genes (CD36, IFNW1, IL1B, and TLR4). Our study showed an example applying a candidate gene approach to identify functionally important mutations (i.e., outlier loci) in wild and domestic pigs for subsequent functional experiments.

  18. Use of a draft genome of coffee (Coffea arabica) to identify SNPs associated with caffeine content.

    PubMed

    Tran, Hue T M; Ramaraj, Thiruvarangan; Furtado, Agnelo; Lee, Leonard Slade; Henry, Robert J

    2018-03-07

    Arabica coffee (Coffea arabica) has a small gene pool limiting genetic improvement. Selection for caffeine content within this gene pool would be assisted by identification of the genes controlling this important trait. Sequencing of DNA bulks from 18 genotypes with extreme high- or low-caffeine content from a population of 232 genotypes was used to identify linked polymorphisms. To obtain a reference genome, a whole genome assembly of arabica coffee (variety K7) was achieved by sequencing using short read (Illumina) and long-read (PacBio) technology. Assembly was performed using a range of assembly tools resulting in 76 409 scaffolds with a scaffold N50 of 54 544 bp and a total scaffold length of 1448 Mb. Validation of the genome assembly using different tools showed high completeness of the genome. More than 99% of transcriptome sequences mapped to the C. arabica draft genome, and 89% of BUSCOs were present. The assembled genome annotated using AUGUSTUS yielded 99 829 gene models. Using the draft arabica genome as reference in mapping and variant calling allowed the detection of 1444 nonsynonymous single nucleotide polymorphisms (SNPs) associated with caffeine content. Based on Kyoto Encyclopaedia of Genes and Genomes pathway-based analysis, 65 caffeine-associated SNPs were discovered, among which 11 SNPs were associated with genes encoding enzymes involved in the conversion of substrates, which participate in the caffeine biosynthesis pathways. This analysis demonstrated the complex genetic control of this key trait in coffee. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    PubMed Central

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

    2015-01-01

    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  20. Most common single-nucleotide polymorphisms associated with rheumatoid arthritis in persons of European ancestry confer risk of rheumatoid arthritis in African Americans.

    PubMed

    Hughes, Laura B; Reynolds, Richard J; Brown, Elizabeth E; Kelley, James M; Thomson, Brian; Conn, Doyt L; Jonas, Beth L; Westfall, Andrew O; Padilla, Miguel A; Callahan, Leigh F; Smith, Edwin A; Brasington, Richard D; Edberg, Jeffrey C; Kimberly, Robert P; Moreland, Larry W; Plenge, Robert M; Bridges, S Louis

    2010-12-01

    Large-scale genetic association studies have identified >20 rheumatoid arthritis (RA) risk alleles among individuals of European ancestry. The influence of these risk alleles has not been comprehensively studied in African Americans. We therefore sought to examine whether these validated RA risk alleles are associated with RA risk in an African American population. Twenty-seven candidate single-nucleotide polymorphisms (SNPs) were genotyped in 556 autoantibody-positive African Americans with RA and 791 healthy African American control subjects. Odds ratios (ORs) and 95% confidence intervals (95% CIs) for each SNP were compared with previously published ORs for RA patients of European ancestry. We then calculated a composite genetic risk score (GRS) for each individual based on the sum of all risk alleles. Overlap of the ORs and 95% CIs between the European and African American populations was observed for 24 of the 27 candidate SNPs. Conversely, 3 of the 27 SNPs (CCR6 rs3093023, TAGAP rs394581, and TNFAIP3 rs6920220) demonstrated ORs in the opposite direction from those reported for RA patients of European ancestry. The GRS analysis indicated a small but highly significant probability that African American patients relative to control subjects were enriched for the risk alleles validated in European RA patients (P = 0.00005). The majority of RA risk alleles previously validated for RA patients of European ancestry showed similar ORs in our population of African Americans with RA. Furthermore, the aggregate GRS supports the hypothesis that these SNPs are risk alleles for RA in the African American population. Future large-scale genetic studies are needed to validate these risk alleles and identify novel RA risk alleles in African Americans. Copyright © 2010 by the American College of Rheumatology.

  1. Genome-wide association study reveals a QTL and strong candidate genes for umbilical hernia in pigs on SSC14.

    PubMed

    Grindflek, Eli; Hansen, Marianne H S; Lien, Sigbjørn; van Son, Maren

    2018-05-29

    Umbilical hernia is one of the most prevalent congenital defect in pigs, causing economic losses and substantial animal welfare problems. Identification and implementation of genomic regions controlling umbilical hernia in breeding is of great interest to reduce incidences of hernia in commercial pig production. The aim of this study was to identify such regions and possibly identify causative variation affecting umbilical hernia in pigs. A case/control material consisting of 739 Norwegian Landrace pigs was collected and applied in a GWAS study with a genome-wide distributed panel of 60 K SNPs. Additionally candidate genes were sequenced to detect additional polymorphisms that were used for single SNP and haplotype association analyses in 453 of the pigs. The GWAS in this report detected a highly significant region affecting umbilical hernia around 50 Mb on SSC14 (P < 0.0001) explaining up to 8.6% of the phenotypic variance of the trait. The region is rather broad and includes 62 significant SNPs in high linkage disequilibrium with each other. Targeted sequencing of candidate genes within the region revealed polymorphisms within the Leukemia inhibitory factor (LIF) and Oncostatin M (OSM) that were significantly associated with umbilical hernia (P < 0.001). A highly significant QTL for umbilical hernia in Norwegian Landrace pigs was detected around 50 Mb on SSC14. Resequencing of candidate genes within the region revealed SNPs within LIF and OSM highly associated with the trait. However, because of extended LD within the region, studies in other populations and functional studies are needed to determine whether these variants are causal or not. Still without this knowledge, SNPs within the region can be used as genetic markers to reduce incidences of umbilical hernia in Norwegian Landrace pigs.

  2. LAMB1 polymorphism is associated with autism symptom severity in Korean autism spectrum disorder patients.

    PubMed

    Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Park, Hae Jeong; Nam, Min; Kim, Jong Woo

    2015-01-01

    LAMB1 encodes laminin beta-1, which is expressed during early development of the human nervous system, and could be involved in the pathogenesis of neurodevelopmental disorders. In our study, we aimed to investigate whether single nucleotide polymorphisms (SNPs) in LAMB1 were associated with autism spectrum disorder (ASD) and with related clinical severities of ASD. Two coding SNPs (rs20556 and rs25659) and two intronic SNPs (rs2158836 and rs2237659) were compared between 180 patients with ASD and 147 healthy control subjects using direct sequencing. The Korean version of the Childhood Autism Rating Scale (K-CARS) was used to assess clinical severities. Multiple logistic regression models were employed to analyze genetic data, and associations with symptom severity were tested with the Kruskal-Wallis and the Mann-Whitney U tests. None of the four examined SNPs was associated with ASD risk. However, the GG genotype of rs2158836 was associated with more severe symptoms for the "object use" and "non-verbal communication" measures. The results of our study suggest the association between rs2158836 polymorphisms and symptom severity in ASD.

  3. Genetic association between ghrelin polymorphisms and Alzheimer's disease in a Japanese population.

    PubMed

    Shibata, Nobuto; Ohnuma, Tohru; Kuerban, Bolati; Komatsu, Miwa; Arai, Heii

    2011-01-01

    Ghrelin has been reported to enter the hippocampus and to bind to the neurons of the hippocampal formation. This peptide also affects neuronal glucose uptake and decreases tau hyperphosphorylation. There is increasing evidence suggesting an association between ghrelin and Alzheimer's disease (AD) pathology. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) of the ghrelin gene are associated with AD. The SNPs were genotyped using TaqMan technology and were analyzed using a case-control study design. Our case-control dataset consisted of 182 AD patients and 143 age-matched controls. Hardy-Weinberg equilibrium and linkage disequilibrium analyses suggest that the region in and around the gene is highly polymorphic. One SNP, rs4684677 (Leu90Gln), showed a marginal association with age of AD onset. We did not detect any association between the other SNPs of the ghrelin gene and AD. There have been few genetic studies on the relationship between circulating ghrelin and functional SNPs. Further multifactorial studies are needed to clarify the relationship between ghrelin and AD. Copyright © 2011 S. Karger AG, Basel.

  4. Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

    PubMed

    He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

    2017-04-25

    Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

  5. Impact of SNPs on Protein Phosphorylation Status in Rice (Oryza sativa L.).

    PubMed

    Lin, Shoukai; Chen, Lijuan; Tao, Huan; Huang, Jian; Xu, Chaoqun; Li, Lin; Ma, Shiwei; Tian, Tian; Liu, Wei; Xue, Lichun; Ai, Yufang; He, Huaqin

    2016-11-11

    Single nucleotide polymorphisms (SNPs) are widely used in functional genomics and genetics research work. The high-quality sequence of rice genome has provided a genome-wide SNP and proteome resource. However, the impact of SNPs on protein phosphorylation status in rice is not fully understood. In this paper, we firstly updated rice SNP resource based on the new rice genome Ver. 7.0, then systematically analyzed the potential impact of Non-synonymous SNPs (nsSNPs) on the protein phosphorylation status. There were 3,897,312 SNPs in Ver. 7.0 rice genome, among which 9.9% was nsSNPs. Whilst, a total 2,508,261 phosphorylated sites were predicted in rice proteome. Interestingly, we observed that 150,197 (39.1%) nsSNPs could influence protein phosphorylation status, among which 52.2% might induce changes of protein kinase (PK) types for adjacent phosphorylation sites. We constructed a database, SNP_rice, to deposit the updated rice SNP resource and phosSNPs information. It was freely available to academic researchers at http://bioinformatics.fafu.edu.cn. As a case study, we detected five nsSNPs that potentially influenced heterotrimeric G proteins phosphorylation status in rice, indicating that genetic polymorphisms showed impact on the signal transduction by influencing the phosphorylation status of heterotrimeric G proteins. The results in this work could be a useful resource for future experimental identification and provide interesting information for better rice breeding.

  6. Genome-wide analysis of central corneal thickness in primary open-angle glaucoma cases in the NEIGHBOR and GLAUGEN consortia.

    PubMed

    Ulmer, Megan; Li, Jun; Yaspan, Brian L; Ozel, Ayse Bilge; Richards, Julia E; Moroi, Sayoko E; Hawthorne, Felicia; Budenz, Donald L; Friedman, David S; Gaasterland, Douglas; Haines, Jonathan; Kang, Jae H; Lee, Richard; Lichter, Paul; Liu, Yutao; Pasquale, Louis R; Pericak-Vance, Margaret; Realini, Anthony; Schuman, Joel S; Singh, Kuldev; Vollrath, Douglas; Weinreb, Robert; Wollstein, Gadi; Zack, Donald J; Zhang, Kang; Young, Terri; Allingham, R Rand; Wiggs, Janey L; Ashley-Koch, Allison; Hauser, Michael A

    2012-07-03

    To investigate the effects of central corneal thickness (CCT)-associated variants on primary open-angle glaucoma (POAG) risk using single nucleotide polymorphisms (SNP) data from the Glaucoma Genes and Environment (GLAUGEN) and National Eye Institute (NEI) Glaucoma Human Genetics Collaboration (NEIGHBOR) consortia. A replication analysis of previously reported CCT SNPs was performed in a CCT dataset (n = 1117) and these SNPs were then tested for association with POAG using a larger POAG dataset (n = 6470). Then a CCT genome-wide association study (GWAS) was performed. Top SNPs from this analysis were selected and tested for association with POAG. cDNA libraries from fetal and adult brain and ocular tissue samples were generated and used for candidate gene expression analysis. Association with one of 20 previously published CCT SNPs was replicated: rs12447690, near the ZNF469 gene (P = 0.001; β = -5.08 μm/allele). None of these SNPs were significantly associated with POAG. In the CCT GWAS, no SNPs reached genome-wide significance. After testing 50 candidate SNPs for association with POAG, one SNP was identified, rs7481514 within the neurotrimin (NTM) gene, that was significantly associated with POAG in a low-tension subset (P = 0.00099; Odds Ratio [OR] = 1.28). Additionally, SNPs in the CNTNAP4 gene showed suggestive association with POAG (top SNP = rs1428758; P = 0.018; OR = 0.84). NTM and CNTNAP4 were shown to be expressed in ocular tissues. The results suggest previously reported CCT loci are not significantly associated with POAG susceptibility. By performing a quantitative analysis of CCT and a subsequent analysis of POAG, SNPs in two cell adhesion molecules, NTM and CNTNAP4, were identified and may increase POAG susceptibility in a subset of cases.

  7. Common Genetic Polymorphisms Influence Blood Biomarker Measurements in COPD.

    PubMed

    Sun, Wei; Kechris, Katerina; Jacobson, Sean; Drummond, M Bradley; Hawkins, Gregory A; Yang, Jenny; Chen, Ting-Huei; Quibrera, Pedro Miguel; Anderson, Wayne; Barr, R Graham; Basta, Patricia V; Bleecker, Eugene R; Beaty, Terri; Casaburi, Richard; Castaldi, Peter; Cho, Michael H; Comellas, Alejandro; Crapo, James D; Criner, Gerard; Demeo, Dawn; Christenson, Stephanie A; Couper, David J; Curtis, Jeffrey L; Doerschuk, Claire M; Freeman, Christine M; Gouskova, Natalia A; Han, MeiLan K; Hanania, Nicola A; Hansel, Nadia N; Hersh, Craig P; Hoffman, Eric A; Kaner, Robert J; Kanner, Richard E; Kleerup, Eric C; Lutz, Sharon; Martinez, Fernando J; Meyers, Deborah A; Peters, Stephen P; Regan, Elizabeth A; Rennard, Stephen I; Scholand, Mary Beth; Silverman, Edwin K; Woodruff, Prescott G; O'Neal, Wanda K; Bowler, Russell P

    2016-08-01

    Implementing precision medicine for complex diseases such as chronic obstructive lung disease (COPD) will require extensive use of biomarkers and an in-depth understanding of how genetic, epigenetic, and environmental variations contribute to phenotypic diversity and disease progression. A meta-analysis from two large cohorts of current and former smokers with and without COPD [SPIROMICS (N = 750); COPDGene (N = 590)] was used to identify single nucleotide polymorphisms (SNPs) associated with measurement of 88 blood proteins (protein quantitative trait loci; pQTLs). PQTLs consistently replicated between the two cohorts. Features of pQTLs were compared to previously reported expression QTLs (eQTLs). Inference of causal relations of pQTL genotypes, biomarker measurements, and four clinical COPD phenotypes (airflow obstruction, emphysema, exacerbation history, and chronic bronchitis) were explored using conditional independence tests. We identified 527 highly significant (p < 8 X 10-10) pQTLs in 38 (43%) of blood proteins tested. Most pQTL SNPs were novel with low overlap to eQTL SNPs. The pQTL SNPs explained >10% of measured variation in 13 protein biomarkers, with a single SNP (rs7041; p = 10-392) explaining 71%-75% of the measured variation in vitamin D binding protein (gene = GC). Some of these pQTLs [e.g., pQTLs for VDBP, sRAGE (gene = AGER), surfactant protein D (gene = SFTPD), and TNFRSF10C] have been previously associated with COPD phenotypes. Most pQTLs were local (cis), but distant (trans) pQTL SNPs in the ABO blood group locus were the top pQTL SNPs for five proteins. The inclusion of pQTL SNPs improved the clinical predictive value for the established association of sRAGE and emphysema, and the explanation of variance (R2) for emphysema improved from 0.3 to 0.4 when the pQTL SNP was included in the model along with clinical covariates. Causal modeling provided insight into specific pQTL-disease relationships for airflow obstruction and emphysema. In conclusion, given the frequency of highly significant local pQTLs, the large amount of variance potentially explained by pQTL, and the differences observed between pQTLs and eQTLs SNPs, we recommend that protein biomarker-disease association studies take into account the potential effect of common local SNPs and that pQTLs be integrated along with eQTLs to uncover disease mechanisms. Large-scale blood biomarker studies would also benefit from close attention to the ABO blood group.

  8. Common Genetic Polymorphisms Influence Blood Biomarker Measurements in COPD

    PubMed Central

    Drummond, M. Bradley; Hawkins, Gregory A.; Yang, Jenny; Chen, Ting-huei; Quibrera, Pedro Miguel; Anderson, Wayne; Barr, R. Graham; Bleecker, Eugene R.; Beaty, Terri; Casaburi, Richard; Castaldi, Peter; Cho, Michael H.; Comellas, Alejandro; Crapo, James D.; Criner, Gerard; Demeo, Dawn; Christenson, Stephanie A.; Couper, David J.; Doerschuk, Claire M.; Freeman, Christine M.; Gouskova, Natalia A.; Han, MeiLan K.; Hanania, Nicola A.; Hansel, Nadia N.; Hersh, Craig P.; Hoffman, Eric A.; Kaner, Robert J.; Kanner, Richard E.; Kleerup, Eric C.; Lutz, Sharon; Martinez, Fernando J.; Meyers, Deborah A.; Peters, Stephen P.; Regan, Elizabeth A.; Rennard, Stephen I.; Scholand, Mary Beth; Silverman, Edwin K.; Woodruff, Prescott G.; O’Neal, Wanda K.; Bowler, Russell P.

    2016-01-01

    Implementing precision medicine for complex diseases such as chronic obstructive lung disease (COPD) will require extensive use of biomarkers and an in-depth understanding of how genetic, epigenetic, and environmental variations contribute to phenotypic diversity and disease progression. A meta-analysis from two large cohorts of current and former smokers with and without COPD [SPIROMICS (N = 750); COPDGene (N = 590)] was used to identify single nucleotide polymorphisms (SNPs) associated with measurement of 88 blood proteins (protein quantitative trait loci; pQTLs). PQTLs consistently replicated between the two cohorts. Features of pQTLs were compared to previously reported expression QTLs (eQTLs). Inference of causal relations of pQTL genotypes, biomarker measurements, and four clinical COPD phenotypes (airflow obstruction, emphysema, exacerbation history, and chronic bronchitis) were explored using conditional independence tests. We identified 527 highly significant (p < 8 X 10−10) pQTLs in 38 (43%) of blood proteins tested. Most pQTL SNPs were novel with low overlap to eQTL SNPs. The pQTL SNPs explained >10% of measured variation in 13 protein biomarkers, with a single SNP (rs7041; p = 10−392) explaining 71%-75% of the measured variation in vitamin D binding protein (gene = GC). Some of these pQTLs [e.g., pQTLs for VDBP, sRAGE (gene = AGER), surfactant protein D (gene = SFTPD), and TNFRSF10C] have been previously associated with COPD phenotypes. Most pQTLs were local (cis), but distant (trans) pQTL SNPs in the ABO blood group locus were the top pQTL SNPs for five proteins. The inclusion of pQTL SNPs improved the clinical predictive value for the established association of sRAGE and emphysema, and the explanation of variance (R2) for emphysema improved from 0.3 to 0.4 when the pQTL SNP was included in the model along with clinical covariates. Causal modeling provided insight into specific pQTL-disease relationships for airflow obstruction and emphysema. In conclusion, given the frequency of highly significant local pQTLs, the large amount of variance potentially explained by pQTL, and the differences observed between pQTLs and eQTLs SNPs, we recommend that protein biomarker-disease association studies take into account the potential effect of common local SNPs and that pQTLs be integrated along with eQTLs to uncover disease mechanisms. Large-scale blood biomarker studies would also benefit from close attention to the ABO blood group. PMID:27532455

  9. Systematic identification of DNA variants associated with ultraviolet radiation using a novel Geographic-Wide Association Study (GeoWAS).

    PubMed

    Hsu, Irving; Chen, Rong; Ramesh, Aditya; Corona, Erik; Kang, Hyunseok Peter; Ruau, David; Butte, Atul J

    2013-06-20

    Long-term environmental variables are widely understood to play important roles in DNA variation. Previously, clinical studies examining the impacts of these variables on the human genome were localized to a single country, and used preselected DNA variants. Furthermore, clinical studies or surveys are either not available or difficult to carry out for developing countries. A systematic approach utilizing bioinformatics to identify associations among environmental variables, genetic variation, and diseases across various geographical locations is needed but has been lacking. Using a novel Geographic-Wide Association Study (GeoWAS) methodology, we identified Single Nucleotide Polymorphisms (SNPs) in the Human Genome Diversity Project (HGDP) with population allele frequencies associated geographical ultraviolet radiation exposure, and then assessed the diseases known to be assigned with these SNPs. 2,857 radiation SNPs were identified from over 650,000 SNPs in 52 indigenous populations across the world. Using a quantitative disease-SNP database curated from 5,065 human genetic papers, we identified disease associations with those radiation SNPs. The correlation of the rs16891982 SNP in the SLC45A2 gene with melanoma was used as a case study for analysis of disease risk, and the results were consistent with the incidence and mortality rates of melanoma in published scientific literature. Finally, by analyzing the ontology of genes in which the radiation SNPs were significantly enriched, potential associations between SNPs and neurological disorders such as Alzheimer's disease were hypothesized. A systematic approach using GeoWAS has enabled us to identify DNA variation associated with ultraviolet radiation and their connections to diseases such as skin cancers. Our analyses have led to a better understating at the genetic level of why certain diseases are more predominant in specific geographical locations, due to the interactions between environmental variables such as ultraviolet radiation and the population types in those regions. The hypotheses proposed in GeoWAS can lead to future testing and interdisciplinary research.

  10. Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

    PubMed

    Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

    2017-03-01

    It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

  11. Role of genetic & environment risk factors in the aetiology of colorectal cancer in Malaysia.

    PubMed

    Ramzi, Nurul Hanis; Chahil, Jagdish Kaur; Lye, Say Hean; Munretnam, Khamsigan; Sahadevappa, Kavitha Itagi; Velapasamy, Sharmila; Hashim, Nikman Adli Nor; Cheah, Soon Keat; Lim, Gerard Chin Chye; Hussein, Heselynn; Haron, Mohd Roslan; Alex, Livy; Ler, Lian Wee

    2014-06-01

    Colorectal cancer (CRC) is second only to breast cancer as the leading cause of cancer-related deaths in Malaysia. In the Asia-Pacific area, it is the highest emerging gastrointestinal cancer. The aim of this study was to identify single nucleotide polymorphisms (SNPs) and environmental factors associated with CRC risk in Malaysia from a panel of cancer associated SNPs. In this case-control study, 160 Malaysian subjects were recruited, including both with CRC and controls. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. Genotyping was carried out using Illumina's BeadArray platform. Information on blood group, occupation, medical history, family history of cancer, intake of red meat and vegetables, exposure to radiation, smoking and drinking habits, etc was collected. Odds ratio (OR), 95% confidence interval (CI) were calculated. A panel of 23 SNPs significantly associated with colorectal cancer risk was identified (P<0.01). Of these, 12 SNPs increased the risk of CRC and 11 reduced the risk. Among the environmental risk factors investigated, high intake of red meat (more than 50% daily proportion) was found to be significantly associated with increased risk of CRC (OR=6.52, 95% CI :1.93-2.04, P=0.003). Two SNPs including rs2069521 and rs10046 in genes of cytochrome P450 (CYP) superfamily were found significantly associated with CRC risk. For gene-environment analysis, the A allele of rs2069521 showed a significant association with CRC risk when stratified by red meat intake. In this preliminary study, a panel of SNPs found to be significantly associated with CRC in Malaysian population, was identified. Also, red meat consumption and lack of physical exercise were risk factors for CRC, while consumption of fruits and vegetables served as protective factor.

  12. Identification of susceptible genes for complex chronic diseases based on disease risk functional SNPs and interaction networks.

    PubMed

    Li, Wan; Zhu, Lina; Huang, Hao; He, Yuehan; Lv, Junjie; Li, Weimin; Chen, Lina; He, Weiming

    2017-10-01

    Complex chronic diseases are caused by the effects of genetic and environmental factors. Single nucleotide polymorphisms (SNPs), one common type of genetic variations, played vital roles in diseases. We hypothesized that disease risk functional SNPs in coding regions and protein interaction network modules were more likely to contribute to the identification of disease susceptible genes for complex chronic diseases. This could help to further reveal the pathogenesis of complex chronic diseases. Disease risk SNPs were first recognized from public SNP data for coronary heart disease (CHD), hypertension (HT) and type 2 diabetes (T2D). SNPs in coding regions that were classified into nonsense and missense by integrating several SNP functional annotation databases were treated as functional SNPs. Then, regions significantly associated with each disease were screened using random permutations for disease risk functional SNPs. Corresponding to these regions, 155, 169 and 173 potential disease susceptible genes were identified for CHD, HT and T2D, respectively. A disease-related gene product interaction network in environmental context was constructed for interacting gene products of both disease genes and potential disease susceptible genes for these diseases. After functional enrichment analysis for disease associated modules, 5 CHD susceptible genes, 7 HT susceptible genes and 3 T2D susceptible genes were finally identified, some of which had pleiotropic effects. Most of these genes were verified to be related to these diseases in literature. This was similar for disease genes identified from another method proposed by Lee et al. from a different aspect. This research could provide novel perspectives for diagnosis and treatment of complex chronic diseases and susceptible genes identification for other diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. snpTree--a web-server to identify and construct SNP trees from whole genome sequence data.

    PubMed

    Leekitcharoenphon, Pimlapas; Kaas, Rolf S; Thomsen, Martin Christen Frølund; Friis, Carsten; Rasmussen, Simon; Aarestrup, Frank M

    2012-01-01

    The advances and decreasing economical cost of whole genome sequencing (WGS), will soon make this technology available for routine infectious disease epidemiology. In epidemiological studies, outbreak isolates have very little diversity and require extensive genomic analysis to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed from concatenated SNPs using FastTree and a perl script. The online server was implemented by HTML, Java and python script.The server was evaluated using four published bacterial WGS data sets (V. cholerae, S. aureus CC398, S. Typhimurium and M. tuberculosis). The evaluation results for the first three cases was consistent and concordant for both raw reads and assembled genomes. In the latter case the original publication involved extensive filtering of SNPs, which could not be repeated using snpTree. The snpTree server is an easy to use option for rapid standardised and automatic SNP analysis in epidemiological studies also for users with limited bioinformatic experience. The web server is freely accessible at http://www.cbs.dtu.dk/services/snpTree-1.0/.

  14. Discovery of Pod Shatter-Resistant Associated SNPs by Deep Sequencing of a Representative Library Followed by Bulk Segregant Analysis in Rapeseed

    PubMed Central

    Huang, Shunmou; Yang, Hongli; Zhan, Gaomiao; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

    2012-01-01

    Background Single nucleotide polymorphisms (SNPs) are an important class of genetic marker for target gene mapping. As of yet, there is no rapid and effective method to identify SNPs linked with agronomic traits in rapeseed and other crop species. Methodology/Principal Findings We demonstrate a novel method for identifying SNP markers in rapeseed by deep sequencing a representative library and performing bulk segregant analysis. With this method, SNPs associated with rapeseed pod shatter-resistance were discovered. Firstly, a reduced representation of the rapeseed genome was used. Genomic fragments ranging from 450–550 bp were prepared from the susceptible bulk (ten F2 plants with the silique shattering resistance index, SSRI <0.10) and the resistance bulk (ten F2 plants with SSRI >0.90), and also Solexa sequencing-produced 90 bp reads. Approximately 50 million of these sequence reads were assembled into contigs to a depth of 20-fold coverage. Secondly, 60,396 ‘simple SNPs’ were identified, and the statistical significance was evaluated using Fisher's exact test. There were 70 associated SNPs whose –log10 p value over 16 were selected to be further analyzed. The distribution of these SNPs appeared a tight cluster, which consisted of 14 associated SNPs within a 396 kb region on chromosome A09. Our evidence indicates that this region contains a major quantitative trait locus (QTL). Finally, two associated SNPs from this region were mapped on a major QTL region. Conclusions/Significance 70 associated SNPs were discovered and a major QTL for rapeseed pod shatter-resistance was found on chromosome A09 using our novel method. The associated SNP markers were used for mapping of the QTL, and may be useful for improving pod shatter-resistance in rapeseed through marker-assisted selection and map-based cloning. This approach will accelerate the discovery of major QTLs and the cloning of functional genes for important agronomic traits in rapeseed and other crop species. PMID:22529909

  15. Mitochondrial pathogenic mutations are population-specific.

    PubMed

    Breen, Michael S; Kondrashov, Fyodor A

    2010-12-31

    Surveying deleterious variation in human populations is crucial for our understanding, diagnosis and potential treatment of human genetic pathologies. A number of recent genome-wide analyses focused on the prevalence of segregating deleterious alleles in the nuclear genome. However, such studies have not been conducted for the mitochondrial genome. We present a systematic survey of polymorphisms in the human mitochondrial genome, including those predicted to be deleterious and those that correspond to known pathogenic mutations. Analyzing 4458 completely sequenced mitochondrial genomes we characterize the genetic diversity of different types of single nucleotide polymorphisms (SNPs) in African (L haplotypes) and non-African (M and N haplotypes) populations. We find that the overall level of polymorphism is higher in the mitochondrial compared to the nuclear genome, although the mitochondrial genome appears to be under stronger selection as indicated by proportionally fewer nonsynonymous than synonymous substitutions. The African mitochondrial genomes show higher heterozygosity, a greater number of polymorphic sites and higher frequencies of polymorphisms for synonymous, benign and damaging polymorphism than non-African genomes. However, African genomes carry significantly fewer SNPs that have been previously characterized as pathogenic compared to non-African genomes. Finding SNPs classified as pathogenic to be the only category of polymorphisms that are more abundant in non-African genomes is best explained by a systematic ascertainment bias that favours the discovery of pathogenic polymorphisms segregating in non-African populations. This further suggests that, contrary to the common disease-common variant hypothesis, pathogenic mutations are largely population-specific and different SNPs may be associated with the same disease in different populations. Therefore, to obtain a comprehensive picture of the deleterious variability in the human population, as well as to improve the diagnostics of individuals carrying African mitochondrial haplotypes, it is necessary to survey different populations independently. This article was reviewed by Dr Mikhail Gelfand, Dr Vasily Ramensky (nominated by Dr Eugene Koonin) and Dr David Rand (nominated by Dr Laurence Hurst).

  16. Genetic polymorphisms and skin aging: the identification of population genotypic groups holds potential for personalized treatments.

    PubMed

    Naval, Jordi; Alonso, Vicente; Herranz, Miquel Angel

    2014-01-01

    Skin changes are among the most visible signs of aging. Skin properties such as hydration, elasticity, and antioxidant capacity play a key role in the skin aging process. Skin aging is a complex process influenced by heritable and environmental factors. Recent studies on twins have revealed that up to 60% of the skin aging variation between individuals can be attributed to genetic factors, while the remaining 40% is due to non-genetic factors. Recent advances in genomics and bioinformatics approaches have led to the association of certain single nucleotide polymorphisms (SNPs) to skin properties. Our aim was to classify individuals based on an ensemble of multiple polymorphisms associated with certain properties of the skin for providing personalized skin care and anti-aging therapies. We identified the key proteins and SNPs associated with certain properties of the skin that contribute to skin aging. We selected a set of 13 SNPs in gene coding for these proteins which are potentially associated with skin aging. Finally, we classified a sample of 120 female volunteers into ten clusters exhibiting different skin properties according to their genotypic signature. This is the first study that describes the actual frequency of genetic polymorphisms and their distribution in clusters involved in skin aging in a Caucasian population. Individuals can be divided into genetic clusters defined by genotypic variables. These genotypic variables are linked with polymorphisms in one or more genes associated with certain properties of the skin that contribute to a person's perceived age. Therefore, by using this classification, it is possible to characterize human skin care and anti-aging needs on the basis of an individual's genetic signature, thus opening the door to personalized treatments addressed at specific populations. This is part of an ongoing effort towards personalized anti-aging therapies combining genetic signatures with environmental and life style evaluations.

  17. Genetic polymorphisms and skin aging: the identification of population genotypic groups holds potential for personalized treatments

    PubMed Central

    Naval, Jordi; Alonso, Vicente; Herranz, Miquel Angel

    2014-01-01

    Introduction Skin changes are among the most visible signs of aging. Skin properties such as hydration, elasticity, and antioxidant capacity play a key role in the skin aging process. Skin aging is a complex process influenced by heritable and environmental factors. Recent studies on twins have revealed that up to 60% of the skin aging variation between individuals can be attributed to genetic factors, while the remaining 40% is due to non-genetic factors. Recent advances in genomics and bioinformatics approaches have led to the association of certain single nucleotide polymorphisms (SNPs) to skin properties. Our aim was to classify individuals based on an ensemble of multiple polymorphisms associated with certain properties of the skin for providing personalized skin care and anti-aging therapies. Methods and results We identified the key proteins and SNPs associated with certain properties of the skin that contribute to skin aging. We selected a set of 13 SNPs in gene coding for these proteins which are potentially associated with skin aging. Finally, we classified a sample of 120 female volunteers into ten clusters exhibiting different skin properties according to their genotypic signature. Conclusion This is the first study that describes the actual frequency of genetic polymorphisms and their distribution in clusters involved in skin aging in a Caucasian population. Individuals can be divided into genetic clusters defined by genotypic variables. These genotypic variables are linked with polymorphisms in one or more genes associated with certain properties of the skin that contribute to a person’s perceived age. Therefore, by using this classification, it is possible to characterize human skin care and anti-aging needs on the basis of an individual’s genetic signature, thus opening the door to personalized treatments addressed at specific populations. This is part of an ongoing effort towards personalized anti-aging therapies combining genetic signatures with environmental and life style evaluations. PMID:25061327

  18. Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

    PubMed

    Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

    2013-12-01

    The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

  19. Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

    PubMed

    Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

    2010-01-01

    Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

  20. Genetic contributions to the association between adult height and testicular germ cell tumors.

    PubMed

    Cook, Michael B; Chia, Victoria M; Berndt, Sonja I; Graubard, Barry I; Chanock, Stephen J; Rubertone, Mark V; Erickson, Ralph L; Hayes, Richard B; McGlynn, Katherine A

    2011-06-01

    Previously, we have shown that increasing adult height is associated with increased risk of testicular germ-cell tumor (TGCT). Recently, a number of single nucleotide polymorphisms (SNPs) have been found to be related to height. We examined whether these SNPs were associated with TGCT and whether they explained the relationship between height and TGCT. We genotyped 15 height-related SNPs in the US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) case-control study. DNA was extracted from buccal cell samples and Taqman assays were used to type the selected SNPs. We used logistic regression models to estimate odds ratios (ORs) and 95% confidence intervals (95%CIs). There were 561 cases and 676 controls for analysis. Two SNPs were found to be associated with risk of TGCT, rs6060373 (CC vs TT, OR = 1.51, 95% CI: 1.06-2.15) and rs143384 (CC vs TT, OR = 1.53, 95% CI: 1.09-2.15). rs6060373 is an intronic polymorphism of ubiquinol-cytochrome c reductase complex chaperone (UQCC), and rs143384 is a 5'UTR polymorphism of growth differentiation factor 5 (GDF5). No individual SNP attenuated the association between height and TGCT. Adjustment for all SNPs previously associated with adult height reduced the associations between adult height and TGCT by ~8.5%, although the P-value indicated only weak evidence that this difference was important (P = 0.26). This novel analysis provides tentative evidence that SNPs which are associated with adult height may also share an association with risk of TGCT.

  1. Possible association of VISA gene polymorphisms with susceptibility to systemic lupus erythematosus in Chinese population.

    PubMed

    Liu, Xiaowen; Jiao, Yulian; Wen, Xin; Wang, Laicheng; Ma, Chunyan; Gao, Xuejun; Chen, Zi-Jiang; Zhao, Yueran

    2011-10-01

    Virus-induced signaling adapter (VISA), an important adaptor protein linking both RIG-I and MDA-5 to downstream signaling events, may mediates the activation of NF kappaB and IRFs and the induction of type I IFN. As the evidence has showed that Toll-like receptors (TLRs), I-IFN and IFN-inducible genes contribute to the pathogenesis of systemic lupus erythematosus (SLE), the aim of the current study was to investigate the possible associations between the VISA gene and SLE. Four single nucleotide polymorphisms (SNPs), rs17857295, rs2326369, rs7262903, and rs7269320, in VISA gene were genotyped in 123 SLE patients and 95 healthy controls. Genotyping was performed using direct sequencing the purified PCR products. Associations were analyzed by using the chi-square test and Fisher's exact test. Haplotype analysis was performed using haploview and PHASE2.1. None of the four SNPs was found to be associated with SLE. The four-SNPs haplotype analysis showed different effect between cases and controls. While the SNPs, rs17857295 and rs2326369, were found to be associated with the renal nephritis and arthritis of SLE patient, respectively. The SNPs rs7269320 showed associations with different manifestations. Our data reveal that polymorphisms in the VISA gene may be related to disease susceptibility and manifestations of SLE.

  2. Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content.

    PubMed

    Goszczynski, Daniel E; Papaleo-Mazzucco, Juliana; Ripoli, María V; Villarreal, Edgardo L; Rogberg-Muñoz, Andrés; Mezzadra, Carlos A; Melucci, Lilia M; Giovambattista, Guillermo

    2017-07-03

    FABP4 is a protein primarily expressed in adipocytes and macrophages that plays a key role in fatty acid trafficking and lipid hydrolysis. FABP4 gene polymorphisms have been associated with meat quality traits in cattle, mostly in Asian breeds under feedlot conditions. The objectives of this work were to characterize FABP4 genetic variation in several worldwide cattle breeds and evaluate possible genotype effects on fat content in a pasture-fed crossbred (Angus-Hereford-Limousin) population. We re-sequenced 43 unrelated animals from nine cattle breeds (Angus, Brahman, Creole, Hereford, Holstein, Limousin, Nelore, Shorthorn, and Wagyu) and obtained 22 single nucleotide polymorphisms (SNPs) over 3,164 bp, including four novel polymorphisms. Haplotypes and linkage disequilibrium analyses showed a high variability. Five SNPs were selected to perform validation and association studies in our crossbred population. Four SNPs showed well-balanced allele frequencies (minor frequency > 0.159), and three showed no significant deviations from Hardy-Weinberg proportions. SNPs showed significant effects on backfat thickness and fatty acid composition (P < 0.05). The protein structure of one of the missense SNPs was analyzed to elucidate its possible effect on fat content in our studied population. Our results revealed a possible blockage of the fatty acid binding site by the missense mutation.

  3. Identification of an Interaction between VWF rs7965413 and Platelet Count as a Novel Risk Marker for Metabolic Syndrome: An Extensive Search of Candidate Polymorphisms in a Case-Control Study

    PubMed Central

    Nakatochi, Masahiro; Ushida, Yasunori; Yasuda, Yoshinari; Yoshida, Yasuko; Kawai, Shun; Kato, Ryuji; Nakashima, Toru; Iwata, Masamitsu; Kuwatsuka, Yachiyo; Ando, Masahiko; Hamajima, Nobuyuki; Kondo, Takaaki; Oda, Hiroaki; Hayashi, Mutsuharu; Kato, Sawako; Yamaguchi, Makoto; Maruyama, Shoichi; Matsuo, Seiichi; Honda, Hiroyuki

    2015-01-01

    Although many single nucleotide polymorphisms (SNPs) have been identified to be associated with metabolic syndrome (MetS), there was only a slight improvement in the ability to predict future MetS by the simply addition of SNPs to clinical risk markers. To improve the ability to predict future MetS, combinational effects, such as SNP—SNP interaction, SNP—environment interaction, and SNP—clinical parameter (SNP × CP) interaction should be also considered. We performed a case-control study to explore novel SNP × CP interactions as risk markers for MetS based on health check-up data of Japanese male employees. We selected 99 SNPs that were previously reported to be associated with MetS and components of MetS; subsequently, we genotyped these SNPs from 360 cases and 1983 control subjects. First, we performed logistic regression analyses to assess the association of each SNP with MetS. Of these SNPs, five SNPs were significantly associated with MetS (P < 0.05): LRP2 rs2544390, rs1800592 between UCP1 and TBC1D9, APOA5 rs662799, VWF rs7965413, and rs1411766 between MYO16 and IRS2. Furthermore, we performed multiple logistic regression analyses, including an SNP term, a CP term, and an SNP × CP interaction term for each CP and SNP that was significantly associated with MetS. We identified a novel SNP × CP interaction between rs7965413 and platelet count that was significantly associated with MetS [SNP term: odds ratio (OR) = 0.78, P = 0.004; SNP × CP interaction term: OR = 1.33, P = 0.001]. This association of the SNP × CP interaction with MetS remained nominally significant in multiple logistic regression analysis after adjustment for either the number of MetS components or MetS components excluding obesity. Our results reveal new insight into platelet count as a risk marker for MetS. PMID:25646961

  4. Identification of an interaction between VWF rs7965413 and platelet count as a novel risk marker for metabolic syndrome: an extensive search of candidate polymorphisms in a case-control study.

    PubMed

    Nakatochi, Masahiro; Ushida, Yasunori; Yasuda, Yoshinari; Yoshida, Yasuko; Kawai, Shun; Kato, Ryuji; Nakashima, Toru; Iwata, Masamitsu; Kuwatsuka, Yachiyo; Ando, Masahiko; Hamajima, Nobuyuki; Kondo, Takaaki; Oda, Hiroaki; Hayashi, Mutsuharu; Kato, Sawako; Yamaguchi, Makoto; Maruyama, Shoichi; Matsuo, Seiichi; Honda, Hiroyuki

    2015-01-01

    Although many single nucleotide polymorphisms (SNPs) have been identified to be associated with metabolic syndrome (MetS), there was only a slight improvement in the ability to predict future MetS by the simply addition of SNPs to clinical risk markers. To improve the ability to predict future MetS, combinational effects, such as SNP-SNP interaction, SNP-environment interaction, and SNP-clinical parameter (SNP × CP) interaction should be also considered. We performed a case-control study to explore novel SNP × CP interactions as risk markers for MetS based on health check-up data of Japanese male employees. We selected 99 SNPs that were previously reported to be associated with MetS and components of MetS; subsequently, we genotyped these SNPs from 360 cases and 1983 control subjects. First, we performed logistic regression analyses to assess the association of each SNP with MetS. Of these SNPs, five SNPs were significantly associated with MetS (P < 0.05): LRP2 rs2544390, rs1800592 between UCP1 and TBC1D9, APOA5 rs662799, VWF rs7965413, and rs1411766 between MYO16 and IRS2. Furthermore, we performed multiple logistic regression analyses, including an SNP term, a CP term, and an SNP × CP interaction term for each CP and SNP that was significantly associated with MetS. We identified a novel SNP × CP interaction between rs7965413 and platelet count that was significantly associated with MetS [SNP term: odds ratio (OR) = 0.78, P = 0.004; SNP × CP interaction term: OR = 1.33, P = 0.001]. This association of the SNP × CP interaction with MetS remained nominally significant in multiple logistic regression analysis after adjustment for either the number of MetS components or MetS components excluding obesity. Our results reveal new insight into platelet count as a risk marker for MetS.

  5. Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

    PubMed

    Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

    2015-06-01

    Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

  6. Correlates between Models of Virulence for Mycobacterium tuberculosis among Isolates of the Central Asian Lineage: a Case for Lysozyme Resistance Testing?

    PubMed Central

    Casali, Nicola; Clark, Simon O.; Hooper, Richard; Williams, Ann; Velji, Preya; Gonzalo, Ximena

    2015-01-01

    Virulence factors (VFs) contribute to the emergence of new human Mycobacterium tuberculosis strains, are lineage dependent, and are relevant to the development of M. tuberculosis drugs/vaccines. VFs were sought within M. tuberculosis lineage 3, which has the Central Asian (CAS) spoligotype. Three isolates were selected from clusters previously identified as dominant in London, United Kingdom. Strain-associated virulence was studied in guinea pig, monocyte-derived macrophage, and lysozyme resistance assays. Whole-genome sequencing, single nucleotide polymorphism (SNP) analysis, and a literature review contributed to the identification of SNPs of interest. The animal model revealed borderline differences in strain-associated pathogenicity. Ex vivo, isolate C72 exhibited statistically significant differences in intracellular growth relative to C6 and C14. SNP candidates inducing lower fitness levels included 123 unique nonsynonymous SNPs, including three located in genes (lysX, caeA, and ponA2) previously identified as VFs in the laboratory-adapted reference strain H37Rv and shown to confer lysozyme resistance. C72 growth was most affected by lysozyme in vitro. A BLAST search revealed that all three SNPs of interest (C35F, P76Q, and P780R) also occurred in Tiruvallur, India, and in Uganda. Unlike C72, however, no single isolate identified through BLAST carried all three SNPs simultaneously. CAS isolates representative of three medium-sized human clusters demonstrated differential outcomes in models commonly used to estimate strain-associated virulence, supporting the idea that virulence varies within, not just across, M. tuberculosis lineages. Three VF SNPs of interest were identified in two additional locations worldwide, which suggested independent selection and supported a role for these SNPs in virulence. The relevance of lysozyme resistance to strain virulence remains to be established. PMID:25776753

  7. SNP identification, genetic mapping and tissue expression of the rainbow trout TLR9 gene

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) in Toll-like receptor (TLR) genes have been reported to be associated with disease resistance in human and livestock. A number of TLR genes have been identified in rainbow trout including TLR2, TLR3, TLR5, TLR20, TLR22 and TLR23. The rainbow trout (Oncorhynch...

  8. Characterization of Heterobasidion occidentale transcriptomes reveals candidate genes and DNA polymorphisms for virulence variations.

    PubMed

    Liu, Jun-Jun; Shamoun, Simon Francis; Leal, Isabel; Kowbel, Robert; Sumampong, Grace; Zamany, Arezoo

    2018-05-01

    Characterization of genes involved in differentiation of pathogen species and isolates with variations of virulence traits provides valuable information to control tree diseases for meeting the challenges of sustainable forest health and phytosanitary trade issues. Lack of genetic knowledge and genomic resources hinders novel gene discovery, molecular mechanism studies and development of diagnostic tools in the management of forest pathogens. Here, we report on transcriptome profiling of Heterobasidion occidentale isolates with contrasting virulence levels. Comparative transcriptomic analysis identified orthologous groups exclusive to H. occidentale and its isolates, revealing biological processes involved in the differentiation of isolates. Further bioinformatics analyses identified an H. occidentale secretome, CYPome and other candidate effectors, from which genes with species- and isolate-specific expression were characterized. A large proportion of differentially expressed genes were revealed to have putative activities as cell wall modification enzymes and transcription factors, suggesting their potential roles in virulence and fungal pathogenesis. Next, large numbers of simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were detected, including more than 14 000 interisolate non-synonymous SNPs. These polymorphic loci and species/isolate-specific genes may contribute to virulence variations and provide ideal DNA markers for development of diagnostic tools and investigation of genetic diversity. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  9. Genome scan study of prostate cancer in Arabs: identification of three genomic regions with multiple prostate cancer susceptibility loci in Tunisians.

    PubMed

    Shan, Jingxuan; Al-Rumaihi, Khalid; Rabah, Danny; Al-Bozom, Issam; Kizhakayil, Dhanya; Farhat, Karim; Al-Said, Sami; Kfoury, Hala; Dsouza, Shoba P; Rowe, Jillian; Khalak, Hanif G; Jafri, Shahzad; Aigha, Idil I; Chouchane, Lotfi

    2013-05-13

    Large databases focused on genetic susceptibility to prostate cancer have been accumulated from population studies of different ancestries, including Europeans and African-Americans. Arab populations, however, have been only rarely studied. Using Affymetrix Genome-Wide Human SNP Array 6, we conducted a genome-wide association study (GWAS) in which 534,781 single nucleotide polymorphisms (SNPs) were genotyped in 221 Tunisians (90 prostate cancer patients and 131 age-matched healthy controls). TaqMan SNP Genotyping Assays on 11 prostate cancer associated SNPs were performed in a distinct cohort of 337 individuals from Arab ancestry living in Qatar and Saudi Arabia (155 prostate cancer patients and 182 age-matched controls). In-silico expression quantitative trait locus (eQTL) analysis along with mRNA quantification of nearby genes was performed to identify loci potentially cis-regulated by the identified SNPs. Three chromosomal regions, encompassing 14 SNPs, are significantly associated with prostate cancer risk in the Tunisian population (P = 1 × 10-4 to P = 1 × 10-5). In addition to SNPs located on chromosome 17q21, previously found associated with prostate cancer in Western populations, two novel chromosomal regions are revealed on chromosome 9p24 and 22q13. eQTL analysis and mRNA quantification indicate that the prostate cancer associated SNPs of chromosome 17 could enhance the expression of STAT5B gene. Our findings, identifying novel GWAS prostate cancer susceptibility loci, indicate that prostate cancer genetic risk factors could be ethnic specific.

  10. Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

    PubMed

    López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

    2017-12-01

    This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

  11. Going where traditional markers have not gone before: utility of and promise for RAD sequencing in marine invertebrate phylogeography and population genomics.

    PubMed

    Reitzel, A M; Herrera, S; Layden, M J; Martindale, M Q; Shank, T M

    2013-06-01

    Characterization of large numbers of single-nucleotide polymorphisms (SNPs) throughout a genome has the power to refine the understanding of population demographic history and to identify genomic regions under selection in natural populations. To this end, population genomic approaches that harness the power of next-generation sequencing to understand the ecology and evolution of marine invertebrates represent a boon to test long-standing questions in marine biology and conservation. We employed restriction-site-associated DNA sequencing (RAD-seq) to identify SNPs in natural populations of the sea anemone Nematostella vectensis, an emerging cnidarian model with a broad geographic range in estuarine habitats in North and South America, and portions of England. We identified hundreds of SNP-containing tags in thousands of RAD loci from 30 barcoded individuals inhabiting four locations from Nova Scotia to South Carolina. Population genomic analyses using high-confidence SNPs resulted in a highly-resolved phylogeography, a result not achieved in previous studies using traditional markers. Plots of locus-specific FST against heterozygosity suggest that a majority of polymorphic sites are neutral, with a smaller proportion suggesting evidence for balancing selection. Loci inferred to be under balancing selection were mapped to the genome, where 90% were located in gene bodies, indicating potential targets of selection. The results from analyses with and without a reference genome supported similar conclusions, further highlighting RAD-seq as a method that can be efficiently applied to species lacking existing genomic resources. We discuss the utility of RAD-seq approaches in burgeoning Nematostella research as well as in other cnidarian species, particularly corals and jellyfishes, to determine phylogeographic relationships of populations and identify regions of the genome undergoing selection. © 2013 John Wiley & Sons Ltd.

  12. Going where traditional markers have not gone before: utility of and promise for RAD sequencing in marine invertebrate phylogeography and population genomics

    PubMed Central

    Reitzel, A.M.; Herrera, S.; Layden, M.J.; Martindale, M.Q.; Shank, T.M.

    2013-01-01

    Characterization of large numbers of single nucleotide polymorphisms (SNPs) throughout a genome has the power to refine the understanding of population demographic history and to identify genomic regions under selection in natural populations. To this end, population genomic approaches that harness the power of next-generation sequencing to understand the ecology and evolution of marine invertebrates represent a boon to test long-standing questions in marine biology and conservation. We employed restriction-site-associated DNA sequencing (RAD-seq) to identify SNPs in natural populations of the sea anemone Nematostella vectensis, an emerging cnidarian model with a broad geographic range in estuarine habitats in North and South America, and portions of England. We identified hundreds of SNP-containing tags in thousands of RAD loci from 30 barcoded individuals inhabiting four locations from Nova Scotia to South Carolina. Population genomic analyses using high-confidence SNPs resulted in a highly-resolved phylogeography, a result not achieved in previous studies using traditional markers. Plots of locus-specific FST against heterozygosity suggest that a majority of polymorphic sites are neutral, with a smaller proportion suggesting evidence for balancing selection. Loci inferred to be under balancing selection were mapped to the genome, where 90% were located in gene bodies, indicating potential targets of selection. Results from analyses with and without a reference genome supported similar conclusions, further supporting RAD-seq as a method that can be efficiently applied to species lacking existing genomic resources. We discuss the utility of RAD-seq approaches in burgeoning Nematostella research as well as in other cnidarian species, particularly corals, to determine phylogeographic relationships of populations and identify regions of the genome undergoing selection. PMID:23473066

  13. Genome wide analysis reveals single nucleotide polymorphisms associated with fatness and putative novel copy number variants in three pig breeds

    PubMed Central

    2013-01-01

    Background Obesity, excess fat tissue in the body, can underlie a variety of medical complaints including heart disease, stroke and cancer. The pig is an excellent model organism for the study of various human disorders, including obesity, as well as being the foremost agricultural species. In order to identify genetic variants associated with fatness, we used a selective genomic approach sampling DNA from animals at the extreme ends of the fat and lean spectrum using estimated breeding values derived from a total population size of over 70,000 animals. DNA from 3 breeds (Sire Line Large White, Duroc and a white Pietrain composite line (Titan)) was used to interrogate the Illumina Porcine SNP60 Genotyping Beadchip in order to identify significant associations in terms of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs). Results By sampling animals at each end of the fat/lean EBV (estimate breeding value) spectrum the whole population could be assessed using less than 300 animals, without losing statistical power. Indeed, several significant SNPs (at the 5% genome wide significance level) were discovered, 4 of these linked to genes with ontologies that had previously been correlated with fatness (NTS, FABP6, SST and NR3C2). Quantitative analysis of the data identified putative CNV regions containing genes whose ontology suggested fatness related functions (MCHR1, PPARα, SLC5A1 and SLC5A4). Conclusions Selective genotyping of EBVs at either end of the phenotypic spectrum proved to be a cost effective means of identifying SNPs and CNVs associated with fatness and with estimated major effects in a large population of animals. PMID:24225222

  14. Genetic architecture of wild soybean (Glycine soja) response to soybean cyst nematode (Heterodera glycines).

    PubMed

    Zhang, Hengyou; Song, Qijian; Griffin, Joshua D; Song, Bao-Hua

    2017-12-01

    The soybean cyst nematode (SCN) is one of the most destructive pathogens of soybean plants worldwide. Host-plant resistance is an environmentally friendly method to mitigate SCN damage. To date, the resistant soybean cultivars harbor limited genetic variation, and some are losing resistance. Thus, a better understanding of the genetic mechanisms of the SCN resistance, as well as developing diverse resistant soybean cultivars, is urgently needed. In this study, a genome-wide association study (GWAS) was conducted using 1032 wild soybean (Glycine soja) accessions with over 42,000 single-nucleotide polymorphisms (SNPs) to understand the genetic architecture of G. soja resistance to SCN race 1. Ten SNPs were significantly associated with the response to race 1. Three SNPs on chromosome 18 were localized within the previously identified quantitative trait loci (QTLs), and two of which were localized within a strong linkage disequilibrium block encompassing a nucleotide-binding (NB)-ARC disease resistance gene (Glyma.18G102600). Genes encoding methyltransferases, the calcium-dependent signaling protein, the leucine-rich repeat kinase family protein, and the NB-ARC disease resistance protein, were identified as promising candidate genes. The identified SNPs and candidate genes can not only shed light on the molecular mechanisms underlying SCN resistance, but also can facilitate soybean improvement employing wild genetic resources.

  15. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  16. RTEL1 and TERT polymorphisms are associated with astrocytoma risk in the Chinese Han population.

    PubMed

    Jin, Tian-Bo; Zhang, Jia-Yi; Li, Gang; Du, Shu-Li; Geng, Ting-Ting; Gao, Jing; Liu, Qian-Ping; Gao, Guo-Dong; Kang, Long-Li; Chen, Chao; Li, Shan-Qu

    2013-12-01

    Common variants of multiple genes play a role in glioma onset. However, research related to astrocytoma, the most common primary brain neoplasm, is rare. In this study, we chose 21 tagging SNPs (tSNPs), previously reported to be associated with glioma risk in a Chinese case-control study from Xi'an, China, and identified their contributions to astrocytoma susceptibility. We found an association with astrocytoma susceptibility for two tSNPs (rs6010620 and rs2853676) in two different genes: regulator of telomere elongation helicase 1 (RTEL1) and telomerase reverse transcriptase (TERT), respectively. We confirmed our results using recessive, dominant, and additive models. In the recessive model, we found two tSNPs (rs2297440 and rs6010620) associated with increased astrocytoma risk. In the dominant model, we found that rs2853676 was associated with increased astrocytoma risk. In the additive model, all three tSNPs (rs2297440, rs2853676, and rs6010620) were associated with increased astrocytoma risk. Our results demonstrate, for the first time, the potential roles of RTEL1 and TERT in astrocytoma development.

  17. Genetic variations in MTHFR and esophageal squamous cell carcinoma susceptibility in Chinese Han population.

    PubMed

    Tang, Weifeng; Zhang, Sheng; Qiu, Hao; Wang, Lixin; Sun, Bin; Yin, Jun; Gu, Haiyong

    2014-05-01

    Esophageal cancer is the sixth most common cancer worldwide. Esophageal squamous cell carcinoma (ESCC) is a fatal malignancy associated with low 5-year survival rate. The aim of this study was to assess the association between methylenetetrahydrofolate reductase (MTHFR) tagging single nucleotide polymorphisms (SNPs) rs1801133 C>T, rs3753584 A>G, rs4845882 G>A, rs4846048 A>G and rs9651118 T>C genotypes and ESCC susceptibility in a hospital-based case-control study. We conducted genotyping analyses for these five SNPs with 629 ESCC cases and 686 controls in a Chinese Han population. Ligation detection reaction method was used to identify genotypes of these MTHFR SNPs. Our results demonstrated that MTHFR rs1801133 C>T was associated with the risk of ESCC; however, MTHFR rs4845882 G>A and rs4846048 A>G SNPs were associated with the decreased risk of ESCC, and MTHFR rs3753584 A>G and rs9651118 T>C SNPs were not associated with ESCC risk. Our findings suggests that MTHFR rs1801133 C>T, rs4845882 G>A and rs4846048 A>G SNPs may be genetic modifiers for developing ESCC in Chinese Han population.

  18. An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

    USDA-ARS?s Scientific Manuscript database

    This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

  19. Genetic diversity of tyrosine hydroxylase (TH) and dopamine β-hydroxylase (DBH) genes in cattle breeds

    PubMed Central

    Lourenco-Jaramillo, Diana Lelidett; Sifuentes-Rincón, Ana María; Parra-Bracamonte, Gaspar Manuel; de la Rosa-Reyna, Xochitl Fabiola; Segura-Cabrera, Aldo; Arellano-Vera, Williams

    2012-01-01

    DNA from four cattle breeds was used to re-sequence all of the exons and 56% of the introns of the bovine tyrosine hydroxylase (TH) gene and 97% and 13% of the bovine dopamine β-hydroxylase (DBH) coding and non-coding sequences, respectively. Two novel single nucleotide polymorphisms (SNPs) and a microsatellite motif were found in the TH sequences. The DBH sequences contained 62 nucleotide changes, including eight non-synonymous SNPs (nsSNPs) that are of particular interest because they may alter protein function and therefore affect the phenotype. These DBH nsSNPs resulted in amino acid substitutions that were predicted to destabilize the protein structure. Six SNPs (one from TH and five from DBH non-synonymous SNPs) were genotyped in 140 animals; all of them were polymorphic and had a minor allele frequency of > 9%. There were significant differences in the intra- and inter-population haplotype distributions. The haplotype differences between Brahman cattle and the three B. t. taurus breeds (Charolais, Holstein and Lidia) were interesting from a behavioural point of view because of the differences in temperament between these breeds. PMID:22888292

  20. No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.

    PubMed

    Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

    2008-10-01

    A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.

  1. Multicenter Prospective Study of Angiogenesis Polymorphism Validation in HCC Patients Treated with Sorafenib. An INNOVATE Study Protocol.

    PubMed

    Casadei Gardini, Andrea; Faloppi, Luca; Aprile, Giuseppe; Brunetti, Oronzo; Caparello, Chiara; Corbelli, Jody; Chessa, Luchino; Bruno, Daniele; Ercolani, Giorgio; Leonetti, Alessandro; de Stefano, Giorgio; Farella, Nunzia; Foschi, Francesco Giuseppe; Lanzi, Arianna; Dadduzio, Vincenzo; Marisi, Giorgia; Masi, Gianluca; Negri, Francesca V; Pagan, Flavia; Santini, Daniele; Scarpi, Emanuela; Silletta, Marianna; Silvestris, Nicola; Tamburini, Emiliano; Tassinari, Davide; Vivaldi, Caterina; Gentilucci, Umberto Vespasiani; Zagonel, Vittorina; Calvetti, Lorenzo; Cascinu, Stefano; Frassineti, Giovanni Luca; Scartozzi, Mario

    2017-12-01

    Introduction Although sorafenib is the upfront standard of care for advanced hepatocellular carcinoma (HCC), molecular predictors of efficacy have not been identified yet. In the ALICE-1 study, rs2010963 of VEGF-A and VEGF-C proved to be independent predictive factors for progression-free survival (PFS) and overall survival (OS) in multivariate analysis. The ALICE-1 study results were confirmed in the ALICE-2 study, in which VEGF and VEGFR SNPs were analyzed. In the ePHAS study we analyzed the SNPs of eNOS. In univariate analysis, patients homozygous for an eNOS haplotype (HT1: T-4b at eNOS-786/eNOS VNTR) had significantly shorter median PFS and OS than those with other haplotypes. These data were confirmed in the validation set. Methods This nonpharmacological, interventional, prospective multicenter study aims to determine whether eNOS, HIF-1, VEGF, Ang2 and VEGFR polymorphisms play a role in predicting the objective response rate, PFS, and OS of advanced HCC patients treated with sorafenib. The study will involve 160 advanced HCC patients with Child-Pugh class A disease. The primary aim is to validate the prognostic or predictive roles of eNOS, Ang2, HIF-1, VEGF and VEGFR polymorphisms in relation to the clinical outcome (PFS) of HCC patients treated with sorafenib. Conclusions Overall, our data may suggest that polymorphism analysis of the VEGF, VEGFR-2, HIF and eNOS genes can identify HCC patients who are more likely to benefit from sorafenib.

  2. Association analysis of the SOX10 polymorphism with Hirschsprung disease in the Han Chinese population.

    PubMed

    Pan, Zhi-Wen; Lou, Jintu; Luo, Chunfen; Yu, Linjun; Li, Ji-Cheng

    2011-10-01

    Hirschsprung disease (HSCR, Online Mendelian Inheritance in Man 142623) is a typical developmental disorder of the enteric nervous system in which ganglion cells fail to innervate the lower gastrointestinal tract during embryonic development. SOX10 gene is involved in the normal development of the enteric nervous system. Heterozygous SOX10 mutations have been identified in patients with syndromic HSCR. However, no mutations have been reported to date to be associated to isolated HSCR patient. We thus sought to investigate whether mutations in the SOX10 are associated with isolated HSCR in the Chinese population. Polymerase chain reaction amplification and direct sequencing were used to screen 4 exons of the SOX10 gene for mutations and polymorphisms in 104 patients with sporadic HSCR and 96 ethnically matched controls in Han Chinese populations. In this study, 4 single nucleotide polymorphisms (SNPs) were identified: SNP1: c.18C>T (GAC→GAT) in exon 2; SNP2: c.122G>T (GGC→GTC) in exon 2; SNP3: IVS2+10 (C→G) in intron 2; and SNP4: c.927T>C (CAT→CAC) in exon 4. SNP1 and SNP2 were novel described polymorphisms in the Chinese population. No SOX10 mutations were found in Han Chinese with isolated HSCR. Our results revealed that there was no association between the 4 SNPs of the SOX10 gene and HSCR. This study showed that the SOX10 gene is unlikely to be a major HSCR gene in the Chinese Han population. Copyright © 2011. Published by Elsevier Inc.

  3. Pool-based genome-wide association study identified novel candidate regions on BTA9 and 14 for oleic acid percentage in Japanese Black cattle.

    PubMed

    Kawaguchi, Fuki; Kigoshi, Hiroto; Nakajima, Ayaka; Matsumoto, Yuta; Uemoto, Yoshinobu; Fukushima, Moriyuki; Yoshida, Emi; Iwamoto, Eiji; Akiyama, Takayuki; Kohama, Namiko; Kobayashi, Eiji; Honda, Takeshi; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

    2018-05-17

    Fatty acid composition is an important indicator of beef quality. The objective of this study was to search the potential candidate region for fatty acid composition. We performed pool-based genome-wide association studies (GWAS) for oleic acid percentage (C18:1) in a Japanese Black cattle population from the Hyogo prefecture. GWAS analysis revealed two novel candidate regions on BTA9 and BTA14. The most significant single nucleotide polymorphisms (SNPs) in each region were genotyped in a population (n = 899) to verify their effect on C18:1. Statistical analysis revealed that both SNPs were significantly associated with C18:1 (p = .0080 and .0003), validating the quantitative trait loci (QTLs) detected in GWAS. We subsequently selected VNN1 and LYPLA1 genes as candidate genes from each region on BTA9 and BTA14, respectively. We sequenced full-length coding sequence (CDS) of these genes in eight individuals and identified a nonsynonymous SNP T66M on VNN1 gene as a putative candidate polymorphism. The polymorphism was also significantly associated with C18:1, but the p value (p = .0162) was higher than the most significant SNP on BTA9, suggesting that it would not be responsible for the QTL. Although further investigation will be needed to determine the responsible gene and polymorphism, our findings would contribute to development of selective markers for fatty acid composition in the Japanese Black cattle of Hyogo. © 2018 Japanese Society of Animal Science.

  4. CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.

    PubMed

    Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C

    2005-04-15

    Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.

  5. Developing a new nonbinary SNP fluorescent multiplex detection system for forensic application in China.

    PubMed

    Liu, Yanfang; Liao, Huidan; Liu, Ying; Guo, Juanjuan; Sun, Yi; Fu, Xiaoliang; Xiao, Ding; Cai, Jifeng; Lan, Lingmei; Xie, Pingli; Zha, Lagabaiyila

    2017-04-01

    Nonbinary single-nucleotide polymorphisms (SNPs) are potential forensic genetic markers because their discrimination power is greater than that of normal binary SNPs, and that they can detect highly degraded samples. We previously developed a nonbinary SNP multiplex typing assay. In this study, we selected additional 20 nonbinary SNPs from the NCBI SNP database and verified them through pyrosequencing. These 20 nonbinary SNPs were analyzed using the fluorescent-labeled SNaPshot multiplex SNP typing method. The allele frequencies and genetic parameters of these 20 nonbinary SNPs were determined among 314 unrelated individuals from Han populations from China. The total power of discrimination was 0.9999999999994, and the cumulative probability of exclusion was 0.9986. Moreover, the result of the combination of this 20 nonbinary SNP assay with the 20 nonbinary SNP assay we previously developed demonstrated that the cumulative probability of exclusion of the 40 nonbinary SNPs was 0.999991 and that no significant linkage disequilibrium was observed in all 40 nonbinary SNPs. Thus, we concluded that this new system consisting of new 20 nonbinary SNPs could provide highly informative polymorphic data which would be further used in forensic application and would serve as a potentially valuable supplement to forensic DNA analysis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

    PubMed

    Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

    2014-02-01

    Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

  7. An alternative to the search for single polymorphisms: toward molecular personality scales for the five-factor model.

    PubMed

    McCrae, Robert R; Scally, Matthew; Terracciano, Antonio; Abecasis, Gonçalo R; Costa, Paul T

    2010-12-01

    There is growing evidence that personality traits are affected by many genes, all of which have very small effects. As an alternative to the largely unsuccessful search for individual polymorphisms associated with personality traits, the authors identified large sets of potentially related single nucleotide polymorphisms (SNPs) and summed them to form molecular personality scales (MPSs) with from 4 to 2,497 SNPs. Scales were derived from two thirds of a large (N = 3,972) sample of individuals from Sardinia who completed the Revised NEO Personality Inventory (P. T. Costa, Jr., & R. R. McCrae, 1992) and were assessed in a genomewide association scan. When MPSs were correlated with the phenotype in the remaining one third of the sample, very small but significant associations were found for 4 of the 5e personality factors when the longest scales were examined. These data suggest that MPSs for Neuroticism, Openness to Experience, Agreeableness, and Conscientiousness (but not Extraversion) contain genetic information that can be refined in future studies, and the procedures described here should be applicable to other quantitative traits. PsycINFO Database Record (c) 2010 APA, all rights reserved.

  8. Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

    PubMed

    Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

    2002-03-01

    Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

  9. Novel Genetic Loci Associated with the Plasma Triglyceride Response to an Omega-3 Fatty Acid Supplementation.

    PubMed

    Vallée Marcotte, Bastien; Cormier, Hubert; Guénard, Frédéric; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2016-01-01

    A recent genome-wide association study (GWAS) by our group identified 13 loci associated with the plasma triglyceride (TG) response to omega-3 (n-3) fatty acid (FA) supplementation. This study aimed to test whether single-nucleotide polymorphisms (SNPs) within the IQCJ, NXPH1, PHF17 and MYB genes are associated with the plasma TG response to an n-3 FA supplementation. A total of 208 subjects followed a 6-week n-3 FA supplementation of 5 g/day of fish oil (1.9-2.2 g of eicosapentaenoic acid and 1.1 g of docosahexaenoic acid). Measurements of plasma lipids were made before and after the supplementation. Sixty-seven tagged SNPs were selected to increase the density of markers near GWAS hits. In a repeated model, independent effects of the genotype and the gene-supplementation interaction were associated with plasma TG. Genotype effects were observed with two SNPs of NXPH1, and gene-diet interactions were observed with ten SNPs of IQCJ, four SNPs of NXPH1 and three SNPs of MYB. Positive and negative responders showed different genotype frequencies with nine SNPs of IQCJ, two SNPs of NXPH1 and two SNPs of MYB. Fine mapping in GWAS-associated loci allowed the identification of SNPs partly explaining the large interindividual variability observed in plasma TG levels in response to an n-3 FA supplementation. © 2016 S. Karger AG, Basel.

  10. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  11. Discovering Single Nucleotide Polymorphisms Regulating Human Gene Expression Using Allele Specific Expression from RNA-seq Data

    PubMed Central

    Kang, Eun Yong; Martin, Lisa J.; Mangul, Serghei; Isvilanonda, Warin; Zou, Jennifer; Ben-David, Eyal; Han, Buhm; Lusis, Aldons J.; Shifman, Sagiv; Eskin, Eleazar

    2016-01-01

    The study of the genetics of gene expression is of considerable importance to understanding the nature of common, complex diseases. The most widely applied approach to identifying relationships between genetic variation and gene expression is the expression quantitative trait loci (eQTL) approach. Here, we increased the computational power of eQTL with an alternative and complementary approach based on analyzing allele specific expression (ASE). We designed a novel analytical method to identify cis-acting regulatory variants based on genome sequencing and measurements of ASE from RNA-sequencing (RNA-seq) data. We evaluated the power and resolution of our method using simulated data. We then applied the method to map regulatory variants affecting gene expression in lymphoblastoid cell lines (LCLs) from 77 unrelated northern and western European individuals (CEU), which were part of the HapMap project. A total of 2309 SNPs were identified as being associated with ASE patterns. The SNPs associated with ASE were enriched within promoter regions and were significantly more likely to signal strong evidence for a regulatory role. Finally, among the candidate regulatory SNPs, we identified 108 SNPs that were previously associated with human immune diseases. With further improvements in quantifying ASE from RNA-seq, the application of our method to other datasets is expected to accelerate our understanding of the biological basis of common diseases. PMID:27765809

  12. RTEL1 tagging SNPs and haplotypes were associated with glioma development

    PubMed Central

    2013-01-01

    Abstract As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case–control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF) > 5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P = 0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P = 0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype “GG” of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P = 0.0002), while the genotype “CC” of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P = 0.0003). Furthermore, haplotype “GCT” in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher’s P = 0.0005; Pearson’s P = 0.0005), and haplotype “ATT” was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher’s P = 0.0013; Pearson’s P = 0.0013). Two single variants, the genotypes of “GG” of rs6010620 and “CC” of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. Virtual slides The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1993021136961998 PMID:23683922

  13. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  14. SNPit: a federated data integration system for the purpose of functional SNP annotation

    PubMed Central

    Shen, Terry H; Carlson, Christopher S; Tarczy-Hornoch, Peter

    2009-01-01

    Genome wide association studies can potentially identify the genetic causes behind the majority of human diseases. With the advent of more advanced genotyping techniques, there is now an explosion of data gathered on single nucleotide polymorphisms (SNPs). The need exists for an integrated system that can provide up-to-date functional annotation information on SNPs. We have developed the SNP Integration Tool (SNPit) system to address this need. Built upon a federated data integration system, SNPit provides current information on a comprehensive list of SNP data sources. Additional logical inference analysis was included through an inference engine plug in. The SNPit web servlet is available online for use. SNPit allows users to go to one source for up-to-date information on the functional annotation of SNPs. A tool that can help to integrate and analyze the potential functional significance of SNPs is important for understanding the results from genome wide association studies. PMID:19327864

  15. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies

    PubMed Central

    Gimode, Davis; Odeny, Damaris A.; de Villiers, Etienne P.; Wanyonyi, Solomon; Dida, Mathews M.; Mneney, Emmarold E.; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M.

    2016-01-01

    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional breeding programs in order to efficiently optimize productivity. PMID:27454301

  16. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    PubMed

    Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M

    2016-01-01

    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional breeding programs in order to efficiently optimize productivity.

  17. Transcriptome characterization and polymorphism detection between subspecies of big sagebrush (Artemisia tridentata)

    PubMed Central

    2011-01-01

    Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398

  18. Germline polymorphisms in an enhancer of PSIP1 are associated with progression-free survival in epithelial ovarian cancer.

    PubMed

    French, Juliet D; Johnatty, Sharon E; Lu, Yi; Beesley, Jonathan; Gao, Bo; Kalimutho, Murugan; Henderson, Michelle J; Russell, Amanda J; Kar, Siddhartha; Chen, Xiaoqing; Hillman, Kristine M; Kaufmann, Susanne; Sivakumaran, Haran; O'Reilly, Martin; Wang, Chen; Korbie, Darren J; Lambrechts, Diether; Despierre, Evelyn; Van Nieuwenhuysen, Els; Lambrechts, Sandrina; Vergote, Ignace; Karlan, Beth; Lester, Jenny; Orsulic, Sandra; Walsh, Christine; Fasching, Peter A; Beckmann, Matthias W; Ekici, Arif B; Hein, Alexander; Matsuo, Keitaro; Hosono, Satoyo; Pisterer, Jacobus; Hillemanns, Peter; Nakanishi, Toru; Yatabe, Yasushi; Goodman, Marc T; Lurie, Galina; Matsuno, Rayna K; Thompson, Pamela J; Pejovic, Tanja; Bean, Yukie; Heitz, Florian; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Estrid; Kjaer, Susanne K; Jensen, Allan; Hogdall, Claus; Lundvall, Lene; Engelholm, Svend Aage; Brown, Bob; Flanagan, James M; Metcalf, Michelle D; Siddiqui, Nadeem; Sellers, Thomas; Fridley, Brooke; Cunningham, Julie; Schildkraut, Joellen M; Iversen, Ed; Weber, Rachel Palmieri; Brennan, Donal; Berchuck, Andrew; Pharoah, Paul; Harnett, Paul; Norris, Murray D; Haber, Michelle; Goode, Ellen L; Lee, Jason S; Khanna, Kum Kum; Meyer, Kerstin B; Chenevix-Trench, Georgia; deFazio, Anna; Edwards, Stacey L; MacGregor, Stuart

    2016-02-09

    Women with epithelial ovarian cancer (EOC) are usually treated with platinum/taxane therapy after cytoreductive surgery but there is considerable inter-individual variation in response. To identify germline single-nucleotide polymorphisms (SNPs) that contribute to variations in individual responses to chemotherapy, we carried out a multi-phase genome-wide association study (GWAS) in 1,244 women diagnosed with serous EOC who were treated with the same first-line chemotherapy, carboplatin and paclitaxel. We identified two SNPs (rs7874043 and rs72700653) in TTC39B (best P=7x10-5, HR=1.90, for rs7874043) associated with progression-free survival (PFS). Functional analyses show that both SNPs lie in a putative regulatory element (PRE) that physically interacts with the promoters of PSIP1, CCDC171 and an alternative promoter of TTC39B. The C allele of rs7874043 is associated with poor PFS and showed increased binding of the Sp1 transcription factor, which is critical for chromatin interactions with PSIP1. Silencing of PSIP1 significantly impaired DNA damage-induced Rad51 nuclear foci and reduced cell viability in ovarian cancer lines. PSIP1 (PC4 and SFRS1 Interacting Protein 1) is known to protect cells from stress-induced apoptosis, and high expression is associated with poor PFS in EOC patients. We therefore suggest that the minor allele of rs7874043 confers poor PFS by increasing PSIP1 expression.

  19. Germline polymorphisms in an enhancer of PSIP1 are associated with progression-free survival in epithelial ovarian cancer

    PubMed Central

    French, Juliet D.; Johnatty, Sharon E.; Lu, Yi; Beesley, Jonathan; Gao, Bo; Kalimutho, Murugan; Henderson, Michelle J.; Russell, Amanda J.; Kar, Siddhartha; Chen, Xiaoqing; Hillman, Kristine M.; Kaufmann, Susanne; Sivakumaran, Haran; O'Reilly, Martin; Wang, Chen; Korbie, Darren J.; Lambrechts, Diether; Despierre, Evelyn; Van Nieuwenhuysen, Els; Lambrechts, Sandrina; Vergote, Ignace; Karlan, Beth; Lester, Jenny; Orsulic, Sandra; Walsh, Christine; Fasching, Peter A.; Beckmann, Matthias W.; Ekici, Arif B.; Hein, Alexander; Matsuo, Keitaro; Hosono, Satoyo; Pisterer, Jacobus; Hillemanns, Peter; Nakanishi, Toru; Yatabe, Yasushi; Goodman, Marc T.; Lurie, Galina; Matsuno, Rayna K.; Thompson, Pamela J.; Pejovic, Tanja; Bean, Yukie; Heitz, Florian; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Estrid; Kjaer, Susanne K.; Jensen, Allan; Hogdall, Claus; Lundvall, Lene; Engelholm, Svend Aage; Brown, Bob; Flanagan, James M.; Metcalf, Michelle D.; Siddiqui, Nadeem; Sellers, Thomas; Fridley, Brooke; Cunningham, Julie; Schildkraut, Joellen M.; Iversen, Ed; Weber, Rachel Palmieri; Brennan, Donal; Berchuck, Andrew; Pharoah, Paul; Harnett, Paul; Norris, Murray D.; Haber, Michelle; Goode, Ellen L.; Lee, Jason S.; Khanna, Kum Kum; Meyer, Kerstin B.; Chenevix-Trench, Georgia; deFazio, Anna; Edwards, Stacey L.; MacGregor, Stuart

    2016-01-01

    Women with epithelial ovarian cancer (EOC) are usually treated with platinum/taxane therapy after cytoreductive surgery but there is considerable inter-individual variation in response. To identify germline single-nucleotide polymorphisms (SNPs) that contribute to variations in individual responses to chemotherapy, we carried out a multi-phase genome-wide association study (GWAS) in 1,244 women diagnosed with serous EOC who were treated with the same first-line chemotherapy, carboplatin and paclitaxel. We identified two SNPs (rs7874043 and rs72700653) in TTC39B (best P=7×10−5, HR=1.90, for rs7874043) associated with progression-free survival (PFS). Functional analyses show that both SNPs lie in a putative regulatory element (PRE) that physically interacts with the promoters of PSIP1, CCDC171 and an alternative promoter of TTC39B. The C allele of rs7874043 is associated with poor PFS and showed increased binding of the Sp1 transcription factor, which is critical for chromatin interactions with PSIP1. Silencing of PSIP1 significantly impaired DNA damage-induced Rad51 nuclear foci and reduced cell viability in ovarian cancer lines. PSIP1 (PC4 and SFRS1 Interacting Protein 1) is known to protect cells from stress-induced apoptosis, and high expression is associated with poor PFS in EOC patients. We therefore suggest that the minor allele of rs7874043 confers poor PFS by increasing PSIP1 expression. PMID:26840454

  20. Transcriptome-wide polymorphisms of red abalone (Haliotis rufescens) reveal patterns of gene flow and local adaptation.

    PubMed

    De Wit, Pierre; Palumbi, Stephen R

    2013-06-01

    Global climate change is projected to accelerate during the next century, altering oceanic patterns in temperature, pH and oxygen concentrations. Documenting patterns of genetic adaptation to these variables in locations that currently experience geographic variation in them is an important tool in understanding the potential for natural selection to allow populations to adapt as climate change proceeds. We sequenced the mantle transcriptome of 39 red abalone (Haliotis rufescens) individuals from three regions (Monterey Bay, Sonoma, north of Cape Mendocino) distinct in temperature, aragonite saturation, exposure to hypoxia and disease pressure along the California coast. Among 1.17 × 10(6) Single Nucleotide Polymorphisms (SNPs) identified in this study (1.37% of the transcriptome), 21 579 could be genotyped for all individuals. A principal components analysis concluded that the vast majority of SNPs show no population structure from Monterey, California to the Oregon border, in corroboration with several previous studies. In contrast, an FST outlier analysis indicated 691 SNPs as exhibiting significantly higher than expected differentiation (experiment-wide P < 0.05). From these, it was possible to identify 163 genes through BLAST annotation, 34 of which contained more than one outlier SNP. A large number of these genes are involved in biomineralization, energy metabolism, heat-, disease- or hypoxia-tolerance. These genes are candidate loci for spatial adaptation to geographic variation that is likely to increase in the future. © 2012 John Wiley & Sons Ltd.

  1. Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.

    PubMed

    Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole

    2017-08-01

    Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Indolethylamine-N-methyltransferase Polymorphisms: Genetic and Biochemical Approaches for Study of Endogenous N,N,-dimethyltryptamine.

    PubMed

    Dean, Jon G

    2018-01-01

    N,N -dimethyltryptamine (DMT) is a powerful serotonergic psychedelic whose exogenous administration elicits striking psychedelic effects in humans. Studies have identified DMT and analogous compounds (e.g., 5-hydroxy-DMT, 5-methoxy-DMT) alongside of an enzyme capable of synthesizing DMT endogenously from tryptamine, indolethylamine- N -methyltransferase (INMT), in human and several other mammalian tissues. Subsequently, multiple hypotheses for the physiological role of endogenous DMT have emerged, from proposed immunomodulatory functions to an emphasis on the overlap between the mental states generated by exogenous DMT and naturally occurring altered states of consciousness; e.g., schizophrenia. However, no clear relationship between endogenous DMT and naturally occurring altered states of consciousness has yet been established from in vivo assays of DMT in bodily fluids. The advent of genetic screening has afforded the capability to link alterations in the sequence of specific genes to behavioral and molecular phenotypes via expression of identified single nucleotide polymorphisms (SNPs) in cell and animal models. As SNPs in INMT may impact endogenous DMT synthesis and levels via changes in INMT expression and/or INMT structure and function, these combined genetic and biochemical approaches circumvent the limitations of assaying DMT in bodily fluids and may augment data from prior in vitro and in vivo work. Therefore, all reported SNPs in INMT were amassed from genetic and biochemical literature and genomic databases to consolidate a blueprint for future studies aimed at elucidating whether DMT plays a physiological role.

  3. Indolethylamine-N-methyltransferase Polymorphisms: Genetic and Biochemical Approaches for Study of Endogenous N,N,-dimethyltryptamine

    PubMed Central

    Dean, Jon G.

    2018-01-01

    N,N-dimethyltryptamine (DMT) is a powerful serotonergic psychedelic whose exogenous administration elicits striking psychedelic effects in humans. Studies have identified DMT and analogous compounds (e.g., 5-hydroxy-DMT, 5-methoxy-DMT) alongside of an enzyme capable of synthesizing DMT endogenously from tryptamine, indolethylamine-N-methyltransferase (INMT), in human and several other mammalian tissues. Subsequently, multiple hypotheses for the physiological role of endogenous DMT have emerged, from proposed immunomodulatory functions to an emphasis on the overlap between the mental states generated by exogenous DMT and naturally occurring altered states of consciousness; e.g., schizophrenia. However, no clear relationship between endogenous DMT and naturally occurring altered states of consciousness has yet been established from in vivo assays of DMT in bodily fluids. The advent of genetic screening has afforded the capability to link alterations in the sequence of specific genes to behavioral and molecular phenotypes via expression of identified single nucleotide polymorphisms (SNPs) in cell and animal models. As SNPs in INMT may impact endogenous DMT synthesis and levels via changes in INMT expression and/or INMT structure and function, these combined genetic and biochemical approaches circumvent the limitations of assaying DMT in bodily fluids and may augment data from prior in vitro and in vivo work. Therefore, all reported SNPs in INMT were amassed from genetic and biochemical literature and genomic databases to consolidate a blueprint for future studies aimed at elucidating whether DMT plays a physiological role. PMID:29740267

  4. Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics

    PubMed Central

    Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

    2017-01-01

    In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476–20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients. PMID:28404909

  5. Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics.

    PubMed

    Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

    2017-05-09

    In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476-20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients.

  6. Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation

    PubMed Central

    Thomas, Laurent F.; Sætrom, Pål

    2012-01-01

    Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

  7. Whole-Genome Resequencing of Experimental Populations Reveals Polygenic Basis of Egg-Size Variation in Drosophila melanogaster.

    PubMed

    Jha, Aashish R; Miles, Cecelia M; Lippert, Nodia R; Brown, Christopher D; White, Kevin P; Kreitman, Martin

    2015-10-01

    Complete genome resequencing of populations holds great promise in deconstructing complex polygenic traits to elucidate molecular and developmental mechanisms of adaptation. Egg size is a classic adaptive trait in insects, birds, and other taxa, but its highly polygenic architecture has prevented high-resolution genetic analysis. We used replicated experimental evolution in Drosophila melanogaster and whole-genome sequencing to identify consistent signatures of polygenic egg-size adaptation. A generalized linear-mixed model revealed reproducible allele frequency differences between replicated experimental populations selected for large and small egg volumes at approximately 4,000 single nucleotide polymorphisms (SNPs). Several hundred distinct genomic regions contain clusters of these SNPs and have lower heterozygosity than the genomic background, consistent with selection acting on polymorphisms in these regions. These SNPs are also enriched among genes expressed in Drosophila ovaries and many of these genes have well-defined functions in Drosophila oogenesis. Additional genes regulating egg development, growth, and cell size show evidence of directional selection as genes regulating these biological processes are enriched for highly differentiated SNPs. Genetic crosses performed with a subset of candidate genes demonstrated that these genes influence egg size, at least in the large genetic background. These findings confirm the highly polygenic architecture of this adaptive trait, and suggest the involvement of many novel candidate genes in regulating egg size. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

    PubMed Central

    Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

    2010-01-01

    Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

  9. Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

    PubMed Central

    Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

    2014-01-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

  10. Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

  11. Association of RTEL1 gene polymorphisms with stroke risk in a Chinese Han population.

    PubMed

    Cai, Yi; Zeng, Chaosheng; Su, Qingjie; Zhou, Jingxia; Li, Pengxiang; Dai, Mingming; Wang, Desheng; Long, Faqing

    2017-12-29

    We investigated the associations between single nucleotide polymorphisms (SNPs) in the regulator of telomere elongation helicase 1 ( RTEL1 ) gene and stroke in the Chinese population. A total of 400 stroke patients and 395 healthy participants were included in this study. Five SNPs in RTEL1 were genotyped and the association with stroke risk was analyzed. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using unconditional logistic regression analysis. Multivariate logistic regression analysis was used to identify SNPs that correlated with stroke. Rs2297441 was associated with an increased risk of stroke in an allele model (odds ratio [OR] = 1.24, 95% confidence interval [95% CI] = 1.01-1.52, p = 0.043). Rs6089953 was associated with an increased risk of stroke under the genotype model ([OR] = 1.862, [CI] = 1.123-3.085, p = 0.016). Rs2297441 was associated with an increased risk of stroke in an additive model (OR = 1.234, 95% CI = 1.005, p = 0.045, Rs6089953, Rs6010620 and Rs6010621 were associated with an increased risk of stroke in the recessive model (Rs6089953:OR = 1.825, 95% CI = 1.121-2.969, p =0.01546; Rs6010620: OR = 1.64, 95% CI = 1.008-2.669, p =0.04656;Rs6010621:OR = 1.661, 95% CI = 1.014-2.722, p =0.04389). Our findings reveal a possible association between SNPs in the RTEL1 gene and stroke risk in Chinese population.

  12. Resampling procedures to identify important SNPs using a consensus approach.

    PubMed

    Pardy, Christopher; Motyer, Allan; Wilson, Susan

    2011-11-29

    Our goal is to identify common single-nucleotide polymorphisms (SNPs) (minor allele frequency > 1%) that add predictive accuracy above that gained by knowledge of easily measured clinical variables. We take an algorithmic approach to predict each phenotypic variable using a combination of phenotypic and genotypic predictors. We perform our procedure on the first simulated replicate and then validate against the others. Our procedure performs well when predicting Q1 but is less successful for the other outcomes. We use resampling procedures where possible to guard against false positives and to improve generalizability. The approach is based on finding a consensus regarding important SNPs by applying random forests and the least absolute shrinkage and selection operator (LASSO) on multiple subsamples. Random forests are used first to discard unimportant predictors, narrowing our focus to roughly 100 important SNPs. A cross-validation LASSO is then used to further select variables. We combine these procedures to guarantee that cross-validation can be used to choose a shrinkage parameter for the LASSO. If the clinical variables were unavailable, this prefiltering step would be essential. We perform the SNP-based analyses simultaneously rather than one at a time to estimate SNP effects in the presence of other causal variants. We analyzed the first simulated replicate of Genetic Analysis Workshop 17 without knowledge of the true model. Post-conference knowledge of the simulation parameters allowed us to investigate the limitations of our approach. We found that many of the false positives we identified were substantially correlated with genuine causal SNPs.

  13. Genetic Diversity and Evolution of Salmonella enterica Serovar Enteritidis Strains with Different Phage Types

    PubMed Central

    Pettengill, James; Strain, Errol; Allard, Marc W.; Ahmed, Rafiq; Zhao, Shaohua; Brown, Eric W.

    2014-01-01

    Phage typing has been used for the epidemiological surveillance of Salmonella enterica serovar Enteritidis for over 2 decades. However, knowledge of the genetic and evolutionary relationships between phage types is very limited, making differences difficult to interpret. Here, single nucleotide polymorphisms (SNPs) identified from whole-genome comparisons were used to determine the relationships between some S. Enteritidis phage types (PTs) commonly associated with food-borne outbreaks in the United States. Emphasis was placed on the predominant phage types PT8, PT13a, and PT13 in North America. With >89,400 bp surveyed across 98 S. Enteritidis isolates representing 14 distinct phage types, 55 informative SNPs were discovered within 23 chromosomally anchored loci. To maximize the discriminatory and evolutionary partitioning of these highly homogeneous strains, sequences comprising informative SNPs were concatenated into a single combined data matrix and subjected to phylogenetic analysis. The resultant phylogeny allocated most S. Enteritidis isolates into two distinct clades (clades I and II) and four subclades. Synapomorphic (shared and derived) sets of SNPs capable of distinguishing individual clades/subclades were identified. However, individual phage types appeared to be evolutionarily disjunct when mapped to this phylogeny, suggesting that phage typing may not be valid for making phylogenetic inferences. Furthermore, the set of SNPs identified here represents useful genetic markers for strain differentiation of more clonal S. Enteritidis strains and provides core genotypic markers for future development of a SNP typing scheme with S. Enteritidis. PMID:24574287

  14. Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

    PubMed

    Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

    2017-01-01

    Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

  15. The search for loci under selection: trends, biases and progress.

    PubMed

    Ahrens, Collin W; Rymer, Paul D; Stow, Adam; Bragg, Jason; Dillon, Shannon; Umbers, Kate D L; Dudaniec, Rachael Y

    2018-03-01

    Detecting genetic variants under selection using F ST outlier analysis (OA) and environmental association analyses (EAAs) are popular approaches that provide insight into the genetic basis of local adaptation. Despite the frequent use of OA and EAA approaches and their increasing attractiveness for detecting signatures of selection, their application to field-based empirical data have not been synthesized. Here, we review 66 empirical studies that use Single Nucleotide Polymorphisms (SNPs) in OA and EAA. We report trends and biases across biological systems, sequencing methods, approaches, parameters, environmental variables and their influence on detecting signatures of selection. We found striking variability in both the use and reporting of environmental data and statistical parameters. For example, linkage disequilibrium among SNPs and numbers of unique SNP associations identified with EAA were rarely reported. The proportion of putatively adaptive SNPs detected varied widely among studies, and decreased with the number of SNPs analysed. We found that genomic sampling effort had a greater impact than biological sampling effort on the proportion of identified SNPs under selection. OA identified a higher proportion of outliers when more individuals were sampled, but this was not the case for EAA. To facilitate repeatability, interpretation and synthesis of studies detecting selection, we recommend that future studies consistently report geographical coordinates, environmental data, model parameters, linkage disequilibrium, and measures of genetic structure. Identifying standards for how OA and EAA studies are designed and reported will aid future transparency and comparability of SNP-based selection studies and help to progress landscape and evolutionary genomics. © 2018 John Wiley & Sons Ltd.

  16. Quantitative trait locus mapping of deep rooting by linkage and association analysis in rice

    PubMed Central

    Lou, Qiaojun; Chen, Liang; Mei, Hanwei; Wei, Haibin; Feng, Fangjun; Wang, Pei; Xia, Hui; Li, Tiemei; Luo, Lijun

    2015-01-01

    Deep rooting is a very important trait for plants’ drought avoidance, and it is usually represented by the ratio of deep rooting (RDR). Three sets of rice populations were used to determine the genetic base for RDR. A linkage mapping population with 180 recombinant inbred lines and an association mapping population containing 237 rice varieties were used to identify genes linked to RDR. Six quantitative trait loci (QTLs) of RDR were identified as being located on chromosomes 1, 2, 4, 7, and 10. Using 1 019 883 single-nucleotide polymorphisms (SNPs), a genome-wide association study of the RDR was performed. Forty-eight significant SNPs of the RDR were identified and formed a clear peak on the short arm of chromosome 1 in a Manhattan plot. Compared with the shallow-rooting group and the whole collection, the deep-rooting group had selective sweep regions on chromosomes 1 and 2, especially in the major QTL region on chromosome 2. Seven of the nine candidate SNPs identified by association mapping were verified in two RDR extreme groups. The findings from this study will be beneficial to rice drought-resistance research and breeding. PMID:26022253

  17. Exploiting Genome Structure in Association Analysis

    PubMed Central

    Kim, Seyoung

    2014-01-01

    Abstract A genome-wide association study involves examining a large number of single-nucleotide polymorphisms (SNPs) to identify SNPs that are significantly associated with the given phenotype, while trying to reduce the false positive rate. Although haplotype-based association methods have been proposed to accommodate correlation information across nearby SNPs that are in linkage disequilibrium, none of these methods directly incorporated the structural information such as recombination events along chromosome. In this paper, we propose a new approach called stochastic block lasso for association mapping that exploits prior knowledge on linkage disequilibrium structure in the genome such as recombination rates and distances between adjacent SNPs in order to increase the power of detecting true associations while reducing false positives. Following a typical linear regression framework with the genotypes as inputs and the phenotype as output, our proposed method employs a sparsity-enforcing Laplacian prior for the regression coefficients, augmented by a first-order Markov process along the sequence of SNPs that incorporates the prior information on the linkage disequilibrium structure. The Markov-chain prior models the structural dependencies between a pair of adjacent SNPs, and allows us to look for association SNPs in a coupled manner, combining strength from multiple nearby SNPs. Our results on HapMap-simulated datasets and mouse datasets show that there is a significant advantage in incorporating the prior knowledge on linkage disequilibrium structure for marker identification under whole-genome association. PMID:21548809

  18. Genetics of cortisol secretion and depressive symptoms: a candidate gene and genome wide association approach.

    PubMed

    Velders, Fleur P; Kuningas, Maris; Kumari, Meena; Dekker, Marieke J; Uitterlinden, Andre G; Kirschbaum, Clemens; Hek, Karin; Hofman, Albert; Verhulst, Frank C; Kivimaki, Mika; Van Duijn, Cornelia M; Walker, Brian R; Tiemeier, Henning

    2011-08-01

    Depressive patients often have altered cortisol secretion, but few studies have investigated genetic variants in relation to both cortisol secretion and depression. To identify genes related to both these conditions, we: (1) tested the association of single nucleotide polymorphisms (SNPs) in hypothalamic-pituitary-adrenal-axis (HPA-axis) candidate genes with a summary measure of total cortisol secretion during the day (cortisol(AUC)), (2) performed a genome wide association study (GWAS) of cortisol(AUC), and (3) tested the association of identified cortisol-related SNPs with depressive symptoms. We analyzed data on candidate SNPs for the HPA-axis, genome-wide scans, cortisol secretion (n=1711) and depressive symptoms (the Centre for Epidemiology Studies Depression Scale, CES-D) (n=2928) in elderly persons of the Rotterdam Study. We used data from the Whitehall II study (n=2836) to replicate the GWAS findings. Of the 1456 SNPs in 33 candidate genes, minor alleles of 4 SNPs (rs9470080, rs9394309, rs7748266 and rs1360780) in the FKBP5 gene were associated with a decreased cortisol(AUC) (p<1×10(-4) after correction for multiple testing using permutations). These SNPs were also associated with an increased risk of depressive symptoms (rs9470080: OR 1.19 (95%CI 1.0; 1.4)). The GWAS for cortisol yielded 2 SNPs with p-values of 1×10(-06) (rs8062512, rs2252459), but these associations could not be replicated. These results suggest that variation in the FKBP5 gene is associated with both cortisol(AUC) and the likelihood of depressive symptoms. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Genome Wide Association Study of Sepsis in Extremely Premature Infants

    PubMed Central

    Srinivasan, Lakshmi; Page, Grier; Kirpalani, Haresh; Murray, Jeffrey C.; Das, Abhik; Higgins, Rosemary D.; Carlo, Waldemar A.; Bell, Edward F.; Goldberg, Ronald N.; Schibler, Kurt; Sood, Beena G.; Stevenson, David K.; Stoll, Barbara J.; Van Meurs, Krisa P.; Johnson, Karen J.; Levy, Joshua; McDonald, Scott A.; Zaterka-Baxter, Kristin M.; Kennedy, Kathleen A.; Sánchez, Pablo J.; Duara, Shahnaz; Walsh, Michele C.; Shankaran, Seetha; Wynn, James L.; Cotten, C. Michael

    2017-01-01

    Objective To identify genetic variants associated with sepsis (early and late-onset) using a genome wide association (GWA) analysis in a cohort of extremely premature infants. Study Design Previously generated GWA data from the Neonatal Research Network’s anonymized genomic database biorepository of extremely premature infants were used for this study. Sepsis was defined as culture-positive early-onset or late-onset sepsis or culture-proven meningitis. Genomic and whole genome amplified DNA was genotyped for 1.2 million single nucleotide polymorphisms (SNPs); 91% of SNPs were successfully genotyped. We imputed 7.2 million additional SNPs. P values and false discovery rates were calculated from multivariate logistic regression analysis adjusting for gender, gestational age and ancestry. Target statistical value was p<10−5. Secondary analyses assessed associations of SNPs with pathogen type. Pathway analyses were also run on primary and secondary end points. Results Data from 757 extremely premature infants were included: 351 infants with sepsis and 406 infants without sepsis. No SNPs reached genome-wide significance levels (5×10−8); two SNPs in proximity to FOXC2 and FOXL1 genes achieved target levels of significance. In secondary analyses, SNPs for ELMO1, IRAK2 (Gram positive sepsis), RALA, IMMP2L (Gram negative sepsis) and PIEZO2 (fungal sepsis) met target significance levels. Pathways associated with sepsis and Gram negative sepsis included gap junctions, fibroblast growth factor receptors, regulators of cell division and Interleukin-1 associated receptor kinase 2 (p values<0.001 and FDR<20%). Conclusions No SNPs met genome-wide significance in this cohort of ELBW infants; however, areas of potential association and pathways meriting further study were identified. PMID:28283553

  20. Genome-wide association study of alcohol dependence

    PubMed Central

    Treutlein, Jens; Cichon, Sven; Ridinger, Monika; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Moessner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Fehr, Christoph; Scherbaum, Norbert; Steffens, Michael; Ludwig, Kerstin U.; Frank, Josef; Wichmann, H.- Erich; Schreiber, Stefan; Dragano, Nico; Sommer, Wolfgang; Leonardi-Essmann, Fernando; Lourdusamy, Anbarasu; Gebicke-Haerter, Peter; Wienker, Thomas F.; Sullivan, Patrick F.; Nöthen, Markus M.; Kiefer, Falk; Spanagel, Rainer; Mann, Karl; Rietschel, Marcella

    2014-01-01

    Context Identification of genes contributing to alcohol dependence will improve our understanding of the mechanisms underlying this disorder. Objective To identify susceptibility genes for alcohol dependence through a genome-wide association study (GWAS) and follow-up study in a population of German male inpatients with an early age at onset. Design The GWAS included 487 male inpatients with DSM-IV alcohol dependence with an age at onset below 28 years and 1,358 population based control individuals. The follow-up study included 1,024 male inpatients and 996 age-matched male controls. All subjects were of German descent. The GWAS tested 524,396 single nucleotide polymorphisms (SNPs). All SNPs with p<10-4 were subjected to the follow-up study. In addition, nominally significant SNPs from those genes that had also shown expression changes in rat brains after chronic alcohol consumption were selected for the follow-up step. Results The GWAS produced 121 SNPs with nominal p<10-4. These, together with 19 additional SNPs from homologs of rat genes showing differential expression, were genotyped in the follow-up sample. Fifteen SNPs showed significant association with the same allele as in the GWAS. In the combined analysis, two closely linked intergenic SNPs met genome-wide significance (rs7590720 p=9.72×10-9; rs1344694 p=1.69×10-8). They are located on chromosome 2q35, a region which has been implicated in linkage studies for alcohol phenotypes. Nine SNPs were located in genes, including CDH13 and ADH1C genes which have been reported to be associated with alcohol dependence. Conclusion This is the first GWAS and follow-up study to identify a genome-wide significant association in alcohol dependence. Further independent studies are required to confirm these findings. PMID:19581569

  1. Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma

    PubMed Central

    Yucesoy, Berran; Kaufman, Kenneth M.; Lummus, Zana L.; Weirauch, Matthew T.; Zhang, Ge; Cartier, André; Boulet, Louis-Philippe; Sastre, Joaquin; Quirce, Santiago; Tarlo, Susan M.; Cruz, Maria-Jesus; Munoz, Xavier; Harley, John B.; Bernstein, David I.

    2015-01-01

    Diisocyanates, reactive chemicals used to produce polyurethane products, are the most common causes of occupational asthma. The aim of this study is to identify susceptibility gene variants that could contribute to the pathogenesis of diisocyanate asthma (DA) using a Genome-Wide Association Study (GWAS) approach. Genome-wide single nucleotide polymorphism (SNP) genotyping was performed in 74 diisocyanate-exposed workers with DA and 824 healthy controls using Omni-2.5 and Omni-5 SNP microarrays. We identified 11 SNPs that exceeded genome-wide significance; the strongest association was for the rs12913832 SNP located on chromosome 15, which has been mapped to the HERC2 gene (p = 6.94 × 10−14). Strong associations were also found for SNPs near the ODZ3 and CDH17 genes on chromosomes 4 and 8 (rs908084, p = 8.59 × 10−9 and rs2514805, p = 1.22 × 10−8, respectively). We also prioritized 38 SNPs with suggestive genome-wide significance (p < 1 × 10−6). Among them, 17 SNPs map to the PITPNC1, ACMSD, ZBTB16, ODZ3, and CDH17 gene loci. Functional genomics data indicate that 2 of the suggestive SNPs (rs2446823 and rs2446824) are located within putative binding sites for the CCAAT/Enhancer Binding Protein (CEBP) and Hepatocyte Nuclear Factor 4, Alpha transcription factors (TFs), respectively. This study identified SNPs mapping to the HERC2, CDH17, and ODZ3 genes as potential susceptibility loci for DA. Pathway analysis indicated that these genes are associated with antigen processing and presentation, and other immune pathways. Overlap of 2 suggestive SNPs with likely TF binding sites suggests possible roles in disruption of gene regulation. These results provide new insights into the genetic architecture of DA and serve as a basis for future functional and mechanistic studies. PMID:25918132

  2. Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

    PubMed

    Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

    2015-09-01

    We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Association Between Genes Involved in Craniofacial Development and Nonsyndromic Cleft Lip and/or Palate in the Brazilian Population.

    PubMed

    Machado, Renato Assis; Messetti, Ana Camila; de Aquino, Sibele Nascimento; Martelli-Júnior, Hercílio; Swerts, Mário Sérgio Oliveira; de Almeida Reis, Silvia Regina; Moreira, Helenara Salvati Bertolossi; Persuhn, Darlene Camati; Coletta, Ricardo D

    2016-09-01

    To determine the association of single-nucleotide polymorphisms (SNPs) in genes related to craniofacial development, which were previously identified as susceptibility signals for nonsyndromic oral clefts, in Brazilians with nonsyndromic cleft lip and/or palate (NSCL/P). The SNPs rs748044 (TNP1), rs1106514 (MSX1), rs28372960, rs15251 and rs2569062 (TCOF1), rs7829058 (FGFR1), rs1793949 (COL2A1), rs11653738 (WNT3), and rs242082 (TIMP3) were assessed in a family-based transmission disequilibrium test (TDT) and a structured case-control analysis based on the individual ancestry proportions. The SNPs were initially analyzed by TDT, and polymorphisms showing a trend toward excess transmission were subsequently studied in an independent case-control sample. The study sample consisted of 189 case-parent trios of nonsyndromic cleft lip with or without cleft palate (NSCL±P), 107 case-parent trios of nonsyndromic cleft palate (NSCP), 318 isolated samples of NSCL±P, 189 isolated samples of NSCP, and 599 healthy controls. Association of alleles with NSCL/P pathogenesis. Preferential transmission of SNPs rs28372960 and rs7829058 in NSCL±P trios and rs11653738 in NSCP trios (P = .04) were observed, although the structured case-control analysis did not confirm these associations. The haplotype T-C-C formed by TCOF1 SNPs rs28372960, rs15251, and rs2569062 was more frequently transmitted from healthy parents to NSCL±P offspring, but the P value (P = .01) did not withstand Bonferroni correction for multiple tests. With the modest associations, our results do not support the hypothesis that TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3, and TIMP3 variants are risk factors for nonsyndromic oral clefts in the Brazilian population.

  4. A draft fur seal genome provides insights into factors affecting SNP validation and how to mitigate them.

    PubMed

    Humble, E; Martinez-Barrio, A; Forcada, J; Trathan, P N; Thorne, M A S; Hoffmann, M; Wolf, J B W; Hoffman, J I

    2016-07-01

    Custom genotyping arrays provide a flexible and accurate means of genotyping single nucleotide polymorphisms (SNPs) in a large number of individuals of essentially any organism. However, validation rates, defined as the proportion of putative SNPs that are verified to be polymorphic in a population, are often very low. A number of potential causes of assay failure have been identified, but none have been explored systematically. In particular, as SNPs are often developed from transcriptomes, parameters relating to the genomic context are rarely taken into account. Here, we assembled a draft Antarctic fur seal (Arctocephalus gazella) genome (assembly size: 2.41 Gb; scaffold/contig N50 : 3.1 Mb/27.5 kb). We then used this resource to map the probe sequences of 144 putative SNPs genotyped in 480 individuals. The number of probe-to-genome mappings and alignment length together explained almost a third of the variation in validation success, indicating that sequence uniqueness and proximity to intron-exon boundaries play an important role. The same pattern was found after mapping the probe sequences to the Walrus and Weddell seal genomes, suggesting that the genomes of species divergent by as much as 23 million years can hold information relevant to SNP validation outcomes. Additionally, reanalysis of genotyping data from seven previous studies found the same two variables to be significantly associated with SNP validation success across a variety of taxa. Finally, our study reveals considerable scope for validation rates to be improved, either by simply filtering for SNPs whose flanking sequences align uniquely and completely to a reference genome, or through predictive modelling. © 2015 John Wiley & Sons Ltd.

  5. Genetic Diversity and Population Structure of Whitebark Pine (Pinus albicaulis Engelm.) in Western North America

    PubMed Central

    Liu, Jun-Jun; Sniezko, Richard; Murray, Michael; Wang, Ning; Chen, Hao; Zamany, Arezoo; Sturrock, Rona N.; Savin, Douglas; Kegley, Angelia

    2016-01-01

    Whitebark pine (WBP, Pinus albicaulis Engelm.) is an endangered conifer species due to heavy mortality from white pine blister rust (WPBR, caused by Cronartium ribicola) and mountain pine beetle (Dendroctonus ponderosae). Information about genetic diversity and population structure is of fundamental importance for its conservation and restoration. However, current knowledge on the genetic constitution and genomic variation is still limited for WBP. In this study, an integrated genomics approach was applied to characterize seed collections from WBP breeding programs in western North America. RNA-seq analysis was used for de novo assembly of the WBP needle transcriptome, which contains 97,447 protein-coding transcripts. Within the transcriptome, single nucleotide polymorphisms (SNPs) were discovered, and more than 22,000 of them were non-synonymous SNPs (ns-SNPs). Following the annotation of genes with ns-SNPs, 216 ns-SNPs within candidate genes with putative functions in disease resistance and plant defense were selected to design SNP arrays for high-throughput genotyping. Among these SNP loci, 71 were highly polymorphic, with sufficient variation to identify a unique genotype for each of the 371 individuals originating from British Columbia (Canada), Oregon and Washington (USA). A clear genetic differentiation was evident among seed families. Analyses of genetic spatial patterns revealed varying degrees of diversity and the existence of several genetic subgroups in the WBP breeding populations. Genetic components were associated with geographic variables and phenotypic rating of WPBR disease severity across landscapes, which may facilitate further identification of WBP genotypes and gene alleles contributing to local adaptation and quantitative resistance to WPBR. The WBP genomic resources developed here provide an invaluable tool for further studies and for exploitation and utilization of the genetic diversity preserved within this endangered conifer and other five-needle pines. PMID:27992468

  6. Association analysis of genes involved in maize (Zea mays L.) root development with seedling and agronomic traits under contrasting nitrogen levels.

    PubMed

    Abdel-Ghani, Adel H; Kumar, Bharath; Pace, Jordon; Jansen, Constantin; Gonzalez-Portilla, Pedro J; Reyes-Matamoros, Jenaro; San Martin, Juan Pablo; Lee, Michael; Lübberstedt, Thomas

    2015-05-01

    A better understanding of the genetic control of root development might allow one to develop lines with root systems with the potential to adapt to soils with limited nutrient availability. For this purpose, an association study (AS) panel consisting of 74 diverse set of inbred maize lines were screened for seedling root traits and adult plant root traits under two contrasting nitrogen (N) levels (low and high N). Allele re-sequencing of RTCL, RTH3, RUM1, and RUL1 genes related to root development was carried out for AS panel lines. Association analysis was carried out between individual polymorphisms, and both seedling and adult plant traits, while controlling for spurious associations due to population structure and kinship relations. Based on the SNPs identified in RTCL, RTH3, RUM1, and RUL1, lines within the AS panel were grouped into 16, 9, 22, and 7 haplotypes, respectively. Association analysis revealed several polymorphisms within root genes putatively associated with the variability in seedling root and adult plant traits development under contrasting N levels. The highest number of significantly associated SNPs with seedling root traits were found in RTCL (19 SNPs) followed by RUM1 (4 SNPs) and in case of RTH3 and RUL1, two and three SNPs, respectively, were significantly associated with root traits. RTCL and RTH3 were also found to be associated with grain yield. Thus considerable allelic diversity is present within the candidate genes studied and can be utilized to develop functional markers that allow identification of maize lines with improved root architecture and yield under N stress conditions.

  7. Investigating the CFH Gene Polymorphisms as a Risk Factor for Age-related Macular Degeneration in an Iranian Population.

    PubMed

    Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein

    2016-06-01

    Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.

  8. Association between kidney function and genetic polymorphisms in atherosclerotic and chronic kidney diseases: A cross-sectional study in Japanese male workers

    PubMed Central

    Nakatochi, Masahiro; Yasuda, Yoshinari; Honda, Hiroyuki; Kuwatsuka, Yachiyo; Kato, Sawako; Kikuchi, Kyoko; Kondo, Takaaki; Iwata, Masamitsu; Nakashima, Toru; Yasui, Hiroshi; Takamatsu, Hideki; Okajima, Hiroshi; Yoshida, Yasuko; Maruyama, Shoichi

    2017-01-01

    Background Several single nucleotide polymorphisms (SNPs) have been implicated in the predisposition to chronic kidney disease (CKD). Atherosclerotic disease is deeply involved in the incidence of CKD; however, whether SNPs related to arteriosclerosis are involved in CKD remains unclear. This study aimed to identify SNPs associated with CKD and to examine whether risk allele accumulation is associated with CKD. Methods We conducted a cross-sectional study using data of 4814 male workers to examine the association between estimated glomerular filtration rate (eGFR) and 59 candidate polymorphisms (17 CKD, 42 atherosclerotic diseases). We defined the genetic risk score (GRS) as the total number of risk alleles that showed a significant association in this analysis and examined the relationship with CKD (eGFR < 60 ml/min/1.73m2). Multivariate logistic regression, discrimination by area under the receiver operating characteristic curve, integrated discrimination improvement (IDI), and category-free net reclassification improvement (cNRI) were evaluated. Results In total, 432 participants were categorized as having CKD. We found eight candidate SNPs with P value < 0.05 (CX3CR1 rs3732379, SHROOM3 rs17319721, MTP rs1800591, PIP5K1B rs4744712, APOA5 rs662799, BRAP rs3782886, SPATA5L1 rs2467853, and MCP1 rs1024611) in the multivariate linear regression adjusted for age, body mass index, systolic blood pressure, and fasting blood glucose. Among these eight SNPs, BRAP rs3782886 and SPATA5L1 rs2467853 were significantly associated with eGFR (false discovery rate < 0.05). GRS was significantly associated with CKD (odds ratio, 1.17; 95% confidence interval, 1.09–1.26). C-statisics improved from 0.775 to 0.780 but showed no statistical significance. However, adding GRS significantly improved IDI and cNRI (0.0057, P = 0.0028, and 0.212, P < 0.001, respectively). Conclusions After adjustment for clinical factors, kidney function was associated with BRAP rs3782886 and SPATA5L1 rs2467853 and the GRS for CKD that we developed was associated CKD. PMID:29016630

  9. Association between kidney function and genetic polymorphisms in atherosclerotic and chronic kidney diseases: A cross-sectional study in Japanese male workers.

    PubMed

    Kubo, Yoko; Imaizumi, Takahiro; Ando, Masahiko; Nakatochi, Masahiro; Yasuda, Yoshinari; Honda, Hiroyuki; Kuwatsuka, Yachiyo; Kato, Sawako; Kikuchi, Kyoko; Kondo, Takaaki; Iwata, Masamitsu; Nakashima, Toru; Yasui, Hiroshi; Takamatsu, Hideki; Okajima, Hiroshi; Yoshida, Yasuko; Maruyama, Shoichi

    2017-01-01

    Several single nucleotide polymorphisms (SNPs) have been implicated in the predisposition to chronic kidney disease (CKD). Atherosclerotic disease is deeply involved in the incidence of CKD; however, whether SNPs related to arteriosclerosis are involved in CKD remains unclear. This study aimed to identify SNPs associated with CKD and to examine whether risk allele accumulation is associated with CKD. We conducted a cross-sectional study using data of 4814 male workers to examine the association between estimated glomerular filtration rate (eGFR) and 59 candidate polymorphisms (17 CKD, 42 atherosclerotic diseases). We defined the genetic risk score (GRS) as the total number of risk alleles that showed a significant association in this analysis and examined the relationship with CKD (eGFR < 60 ml/min/1.73m2). Multivariate logistic regression, discrimination by area under the receiver operating characteristic curve, integrated discrimination improvement (IDI), and category-free net reclassification improvement (cNRI) were evaluated. In total, 432 participants were categorized as having CKD. We found eight candidate SNPs with P value < 0.05 (CX3CR1 rs3732379, SHROOM3 rs17319721, MTP rs1800591, PIP5K1B rs4744712, APOA5 rs662799, BRAP rs3782886, SPATA5L1 rs2467853, and MCP1 rs1024611) in the multivariate linear regression adjusted for age, body mass index, systolic blood pressure, and fasting blood glucose. Among these eight SNPs, BRAP rs3782886 and SPATA5L1 rs2467853 were significantly associated with eGFR (false discovery rate < 0.05). GRS was significantly associated with CKD (odds ratio, 1.17; 95% confidence interval, 1.09-1.26). C-statisics improved from 0.775 to 0.780 but showed no statistical significance. However, adding GRS significantly improved IDI and cNRI (0.0057, P = 0.0028, and 0.212, P < 0.001, respectively). After adjustment for clinical factors, kidney function was associated with BRAP rs3782886 and SPATA5L1 rs2467853 and the GRS for CKD that we developed was associated CKD.

  10. Lack of association between autonomously functioning thyroid nodules and germline polymorphisms of the thyrotropin receptor and Gαs genes in a mild to moderate iodine-deficient Caucasian population.

    PubMed

    Vicchio, Teresa Manuela; Giovinazzo, Salvatore; Certo, Rosaria; Cucinotta, Mariapaola; Micali, Carmelo; Baldari, Sergio; Benvenga, Salvatore; Trimarchi, Francesco; Campennì, Alfredo; Ruggeri, Rosaria Maddalena

    2014-07-01

    Mutations of the thyrotropin receptor (TSHR) and/or Gαs gene have been found in a number of, but not all, autonomously functioning thyroid nodules (AFTNs). Recently, in a 15-year-old girl with a hyperfunctioning papillary thyroid carcinoma, we found two somatic and germline single nucleotide polymorphisms (SNPs): a SNP of the TSHR gene (exon 7, codon 187) and a SNP of Gαs gene (exon 8, codon 185). The same silent SNP of the TSHR gene had been reported in patients with AFTN or familial non-autoimmune hyperthyroidism. No further data about the prevalence of the two SNPs in AFTNs as well as in the general population are available in the literature. To clarify the possible role of these SNPs in predisposing to AFTN. Germline DNA was extracted from blood leukocytes of 115 patients with AFTNs (43 males and 72 females, aged 31-85 years, mean ± SD = 64 ± 13) and 100 sex-matched healthy individuals from the same geographic area, which is marginally iodine deficient. The genotype distribution of the two SNPs was investigated by restriction fragment length polymorphism-polymerase chain reaction. The prevalence of the two SNPs in our study population was low and not different to that found in healthy individuals: 8 % of patients vs. 9 % of controls were heterozygous for the TSHR SNP and 4 % patients vs. 6 % controls were heterozygous for the Gαs SNP. One patient harbored both SNPs. These results suggest that these two SNPs do not confer susceptibility for the development of AFTN.

  11. Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

    PubMed

    Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

    2017-12-01

    Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (p<0.0083). Seven SNPs in the MTHFR gene were associated with homocysteine levels at an α-level of 0.05, but the associations did not persist after Bonferroni correction. These SNPs did not show interactions with lead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  12. Genetic polymorphism and prostate cancer aggressiveness: a case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans.

    PubMed

    Bensen, Jeannette T; Xu, Zongli; Smith, Gary J; Mohler, James L; Fontham, Elizabeth T H; Taylor, Jack A

    2013-01-01

    Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. Four GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and seven flanking SNPs were associated with CaP aggressiveness (P < 0.05) in three genomic regions: One at 3p12 (EA), seven at 8q24 (5 AA, 2 EA), and three at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (two AA, one AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (P < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. Copyright © 2012 Wiley Periodicals, Inc.

  13. Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1536 GWAS and candidate SNPs in African Americans and European Americans

    PubMed Central

    Bensen, Jeannette T.; Xu, Zongli; Smith, Gary J.; Mohler, James L.; Fontham, Elizabeth T.H.; Taylor, Jack A.

    2012-01-01

    BACKGROUND Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. METHODS A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. RESULTS 4 GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and 7 flanking SNPs were associated with CaP aggressiveness (P<0.05) in 3 genomic regions: one at 3p12 (EA), 7 at 8q24 (5 AA, 2 EA), and 3 at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (2 AA, 1 AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (p < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. CONCLUSIONS Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. PMID:22549899

  14. Significance of genetic variants in DLC1 and their association with hepatocellular carcinoma

    PubMed Central

    XIE, CHENG-RONG; SUN, HONG-GUANG; SUN, YU; ZHAO, WEN-XIU; ZHANG, SHENG; WANG, XIAO-MIN; YIN, ZHEN-YU

    2015-01-01

    DLC1 has been shown to be downregulated or absent in hepatocellular carcinoma (HCC) and is associated with tumorigenesis and development. However, only a small number of studies have focused on genetic variations of DLC1. The present study performed exon sequencing for the DLC1 gene in HCC tissue samples from 105 patients to identify functional genetic variation of DLC1 and its association with HCC susceptibility, clinicopathological features and prognosis. A novel missense mutation and four non-synonymous single nucleotide polymorphisms (SNPs; rs3816748, rs11203495, rs3816747 and rs532841) were identified. A significant correlation of rs3816747 polymorphisms with HCC susceptibility was identified. Compared to individuals with the GG genotype of rs3816747, those with the GA (odds ratio (OR)=0.486; P=0.037) or GA+AA genotype (OR=0.51; P=0.039) were associated with a significantly decreased HCC risk. Furthermore, patients with the GC+CC genotype of rs3816748, the TC+CC genotype of rs11203495 or the GA+AA genotype of rs3816747 had small-sized tumors compared with those carrying the wild-type genotype. No significant association of DLC1 SNPs with the patients' prognosis was found. These results indicated that genetic variations in the DLC1 gene may confer a risk for HCC. PMID:26095787

  15. Single nucleotide polymorphisms for feed efficiency and performance in crossbred beef cattle

    PubMed Central

    2014-01-01

    Background This study was conducted to: (1) identify new SNPs for residual feed intake (RFI) and performance traits within candidate genes identified in a genome wide association study (GWAS); (2) estimate the proportion of variation in RFI explained by the detected SNPs; (3) estimate the effects of detected SNPs on carcass traits to avoid undesirable correlated effects on these economically important traits when selecting for feed efficiency; and (4) map the genes to biological mechanisms and pathways. A total number of 339 SNPs corresponding to 180 genes were tested for association with phenotypes using a single locus regression (SLRM) and genotypic model on 726 and 990 crossbred animals for feed efficiency and carcass traits, respectively. Results Strong evidence of associations for RFI were located on chromosomes 8, 15, 16, 18, 19, 21, and 28. The strongest association with RFI (P = 0.0017) was found with a newly discovered SNP located on BTA 8 within the ELP3 gene. SNPs rs41820824 and rs41821600 on BTA 16 within the gene HMCN1 were strongly associated with RFI (P = 0.0064 and P = 0.0033, respectively). A SNP located on BTA 18 within the ZNF423 gene provided strong evidence for association with RFI (P = 0.0028). Genomic estimated breeding values (GEBV) from 98 significant SNPs were moderately correlated (0.47) to the estimated breeding values (EBVs) from a mixed animal model. The significant (P < 0.05) SNPs (98) explained 26% of the genetic variance for RFI. In silico functional analysis for the genes suggested 35 and 39 biological processes and pathways, respectively for feed efficiency traits. Conclusions This study identified several positional and functional candidate genes involved in important biological mechanisms associated with feed efficiency and performance. Significant SNPs should be validated in other populations to establish their potential utilization in genetic improvement programs. PMID:24476087

  16. Racial/ethnic variation in the association of lipid-related genetic variants with blood lipids in the US adult population.

    PubMed

    Chang, Man-huei; Ned, Renée M; Hong, Yuling; Yesupriya, Ajay; Yang, Quanhe; Liu, Tiebin; Janssens, A Cecile J W; Dowling, Nicole F

    2011-10-01

    Genome-wide association studies (GWAS) have identified a number of single-nucleotide polymorphisms (SNPs) associated with serum lipid level in populations of European descent. The individual and the cumulative effect of these SNPs on blood lipids are largely unclear for the US population. Using data from the second phase (1991-1994) of the Third National Health and Nutrition Examination Survey (NHANES III), a nationally representative survey of the US population, we examined associations of 57 GWAS-identified or well-established lipid-related genetic loci with plasma concentrations of high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol, total cholesterol, triglycerides, total cholesterol/HDL-C ratio, and non-HDL-C. We used multivariable linear regression to examine single SNP associations and the cumulative effect of multiple SNPs (using a genetic risk score [GRS]) on blood lipid levels. Analyses were conducted in adults from each of the 3 major racial/ethnic groups in the United States: non-Hispanic whites (n=2296), non-Hispanic blacks (n=1699), and Mexican Americans (n=1713). Allele frequencies for all SNPs varied significantly by race/ethnicity, except rs3764261 in CETP. Individual SNPs had very small effects on lipid levels, effects that were generally consistent in direction across racial/ethnic groups. More GWAS-validated SNPs were replicated in non-Hispanic whites (<67%) than in non-Hispanic blacks (<44%) or Mexican Americans (<44%). GRSs were strongly associated with increased lipid levels in each racial/ethnic group. The combination of all SNPs into a weighted GRS explained no more than 11% of the total variance in blood lipid levels. Our findings show that the combined association of SNPs, based on a GRS, was strongly associated with increased blood lipid measures in all major race/ethnic groups in the United States, which may help in identifying subgroups with a high risk for an unfavorable lipid profile.

  17. DNA repair gene polymorphisms and risk of cutaneous melanoma: a systematic review and meta-analysis.

    PubMed

    Mocellin, Simone; Verdi, Daunia; Nitti, Donato

    2009-10-01

    Polymorphisms of DNA repair-related genes might modulate cancer predisposition. We performed a systematic review and meta-analysis of the available evidence regarding the relationship between these polymorphisms and the risk of developing cutaneous melanoma. Relevant studies were searched using PubMed, Medline, Embase, Cancerlit, Cochrane and ISI Web of Knowledge databases. Data were gathered according to the Meta-analysis Of Observational Studies in Epidemiology (MOOSE) guidelines. The model-free approach was adopted to perform the meta-analysis of the retrieved data. We identified 20 original reports that describe the relationship between melanoma risk and the single-nucleotide polymorphisms (SNPs) of 16 genes (cases = 4195). For seven SNPs considered in at least two studies, the findings were heterogeneous. Data were suitable for meta-analysis only in the case of the XPD/ERCC2 SNP rs13181 (cases = 2308, controls = 3698) and demonstrated that the variant C allele is associated with increased melanoma risk (odds ratio = 1.12, 95% confidence interval = 1.03-1.21, P = 0.01; population attributable risk = 9.6%). This is the first meta-analysis suggesting that XPD/ERCC2 might represent a low-penetrance melanoma susceptibility gene. Much work is still to be done before definitive conclusions can be drawn on the role of DNA repair alterations in melanomagenesis since for the other genes involved in this highly complex process, the available information is scarce or null.

  18. Relationship between human LTA4H polymorphisms and extra-pulmonary tuberculosis in an ethnic Han Chinese population in Eastern China.

    PubMed

    Yang, Jinghui; Chen, Jin; Yue, Jun; Liu, Lirong; Han, Min; Wang, Hongxiu

    2014-12-01

    Two single nucleotide polymorphisms in Leukotriene A4 hydrolase (LTA4H) gene were reported to be associated with protection from pulmonary tuberculosis in Vietnamese population. But these associations were not found in the Russians. To investigate the association of LTA4H polymorphisms with tuberculosis in a Han Chinese population in Eastern China, we genotyped 5 SNPs of LTA4H gene in 743 of pulmonary tuberculosis patients, 372 of extra-pulmonary tuberculosis patients and 888 of healthy controls individuals. The CC and TT homozygotes of rs1978331 and rs2540474 were identified to have higher rates (P < 0.01) and be risk factors in the patients with extra-pulmonary tuberculosis (OR = 1.412; 95% CI = 1.104-1.804 and(OR = 1.380; 95% CI = 1.080-1.764). However, no significant association was found between any of the SNPs and pulmonary tuberculosis. In the extra-pulmonary tuberculosis subgroups. LTA4H gene were significantly associated with tuberculous meningitis, lymph node tuberculosis, bone tuberculosis and other extra-pulmonary tuberculosis except for pleural tuberculosis. The present findings suggest that polymorphisms in the LTA4H gene may affect susceptibility to extra-pulmonary tuberculosis and change the risk of developing the disease in the Han nationality in the East China. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Single nucleotide polymorphisms associated with nonsyndromic cryptorchidism in Mexican patients.

    PubMed

    Chávez-Saldaña, M; Vigueras-Villaseñor, R M; Yokoyama-Rebollar, E; Landero-Huerta, D A; Rojas-Castañeda, J C; Taja-Chayeb, L; Cuevas-Alpuche, J O; Zambrano, E

    2018-02-01

    Cryptorchidism is a frequent genitourinary malformation considered as an important risk factor for infertility and testicular malignancy. The aetiology of cryptorchidism is multifactorial in which certain SNPs, capable of inhibiting the development of the gubernaculum, are implicated. We analysed 16 SNPs by allelic discrimination and automated sequencing in 85 patients and 99 healthy people, with the objective to identify the association between these variants and isolated cryptorchidism. In two different patients with unilateral cryptorchidism, we found the variants rs121912556 and p.R105R of INSL3 gene in a heterozygous form associated with cryptorchidism, so we could considered them as risk factors for cryptorchidism. On the other hand, SNPs rs10421916 of INSL3 gene, as well as the variants rs1555633 and rs7325513 in the RXFP2 gene, and rs3779456 variant of the HOXA10 gene were statistically significant, when the patients and controls were compared and could be considered as protective factors since are predominantly present in controls. The genotype-phenotype correlation did not show statistical significance. With these results, we could conclude that these polymorphisms can be considered as important variants in our population and would contribute in the future knowledge of the aetiology and physiopathology of cryptorchidism. © 2017 Blackwell Verlag GmbH.

  20. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

    PubMed

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

    2012-11-10

    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

Top