Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

PubMed

Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

2015-05-01

Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

Genetic diversity of tyrosine hydroxylase (TH) and dopamine β-hydroxylase (DBH) genes in cattle breeds

PubMed Central

Lourenco-Jaramillo, Diana Lelidett; Sifuentes-Rincón, Ana María; Parra-Bracamonte, Gaspar Manuel; de la Rosa-Reyna, Xochitl Fabiola; Segura-Cabrera, Aldo; Arellano-Vera, Williams

2012-01-01

DNA from four cattle breeds was used to re-sequence all of the exons and 56% of the introns of the bovine tyrosine hydroxylase (TH) gene and 97% and 13% of the bovine dopamine β-hydroxylase (DBH) coding and non-coding sequences, respectively. Two novel single nucleotide polymorphisms (SNPs) and a microsatellite motif were found in the TH sequences. The DBH sequences contained 62 nucleotide changes, including eight non-synonymous SNPs (nsSNPs) that are of particular interest because they may alter protein function and therefore affect the phenotype. These DBH nsSNPs resulted in amino acid substitutions that were predicted to destabilize the protein structure. Six SNPs (one from TH and five from DBH non-synonymous SNPs) were genotyped in 140 animals; all of them were polymorphic and had a minor allele frequency of > 9%. There were significant differences in the intra- and inter-population haplotype distributions. The haplotype differences between Brahman cattle and the three B. t. taurus breeds (Charolais, Holstein and Lidia) were interesting from a behavioural point of view because of the differences in temperament between these breeds. PMID:22888292

Catalog of MicroRNA Seed Polymorphisms in Vertebrates

PubMed Central

Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

2012-01-01

MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content.

PubMed

Goszczynski, Daniel E; Papaleo-Mazzucco, Juliana; Ripoli, María V; Villarreal, Edgardo L; Rogberg-Muñoz, Andrés; Mezzadra, Carlos A; Melucci, Lilia M; Giovambattista, Guillermo

2017-07-03

FABP4 is a protein primarily expressed in adipocytes and macrophages that plays a key role in fatty acid trafficking and lipid hydrolysis. FABP4 gene polymorphisms have been associated with meat quality traits in cattle, mostly in Asian breeds under feedlot conditions. The objectives of this work were to characterize FABP4 genetic variation in several worldwide cattle breeds and evaluate possible genotype effects on fat content in a pasture-fed crossbred (Angus-Hereford-Limousin) population. We re-sequenced 43 unrelated animals from nine cattle breeds (Angus, Brahman, Creole, Hereford, Holstein, Limousin, Nelore, Shorthorn, and Wagyu) and obtained 22 single nucleotide polymorphisms (SNPs) over 3,164 bp, including four novel polymorphisms. Haplotypes and linkage disequilibrium analyses showed a high variability. Five SNPs were selected to perform validation and association studies in our crossbred population. Four SNPs showed well-balanced allele frequencies (minor frequency > 0.159), and three showed no significant deviations from Hardy-Weinberg proportions. SNPs showed significant effects on backfat thickness and fatty acid composition (P < 0.05). The protein structure of one of the missense SNPs was analyzed to elucidate its possible effect on fat content in our studied population. Our results revealed a possible blockage of the fatty acid binding site by the missense mutation.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

PubMed

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-07-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

PubMed Central

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-01-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

Common Polymorphisms in the PKP3-SIGIRR-TMEM16J Gene Region Are Associated With Susceptibility to Tuberculosis

PubMed Central

Randhawa, April K.; Chau, Tran T. H.; Bang, Nguyen D.; Yen, Nguyen T. B.; Farrar, Jeremy J.; Dunstan, Sarah J.; Hawn, Thomas R.

2012-01-01

(See the editorial commentary by Wilkinson, on pages 525–7.) Background. Tuberculosis has been associated with genetic variation in host immunity. We hypothesized that single-nucleotide polymorphisms (SNPs) in SIGIRR, a negative regulator of Toll-like receptor/IL-1R signaling, are associated with susceptibility to tuberculosis. Methods. We used a case-population study design in Vietnam with cases that had either tuberculous meningitis or pulmonary tuberculosis. We genotyped 6 SNPs in the SIGIRR gene region (including the adjacent genes PKP3 and TMEM16J) in a discovery cohort of 352 patients with tuberculosis and 382 controls. Significant associations were genotyped in a validation cohort (339 patients with tuberculosis, 376 controls). Results. Three SNPs (rs10902158, rs7105848, rs7111432) were associated with tuberculosis in discovery and validation cohorts. The polymorphisms were associated with both tuberculous meningitis and pulmonary tuberculosis and were strongest with a recessive genetic model (odds ratios, 1.5–1.6; P = .0006–.001). Coinheritance of these polymorphisms with previously identified risk alleles in Toll-like receptor 2 and TIRAP was associated with an additive risk of tuberculosis susceptibility. Conclusions. These results demonstrate a strong association of SNPs in the PKP3-SIGIRR-TMEM16J gene region and tuberculosis in discovery and validation cohorts. To our knowledge, these are the first associations of polymorphisms in this region with any disease. PMID:22223854

Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa.

PubMed

Acevedo, Summer F; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J

2015-08-30

Oxytocin is a peptide hormone important for social behavior and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether single nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Prospects for inferring pairwise relationships with single nucleotide polymorphisms

Treesearch

Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

2003-01-01

An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

PubMed Central

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766

Pharmacogenetics of human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1): gene resequencing, sequence variation, and functional genomics.

PubMed

Xu, Zhen-Hua; Thomae, Bianca A; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M

2003-06-01

3'-Phosphoadenosine 5'-phosphosulfate (PAPS) is the high-energy "sulfate donor" for reactions catalyzed by sulfotransferase (SULT) enzymes. The strict requirement of SULTs for PAPS suggests that PAPS synthesis might influence the rate of sulfate conjugation. In humans, PAPS is synthesized from ATP and SO(4)(2-) by two isoforms of PAPS synthetase (PAPSS): PAPSS1 and PAPSS2. As a step toward pharmacogenetic studies, we have resequenced the entire coding sequence of the human PAPSS1 gene, including exon-intron splice junctions, using DNA samples from 60 Caucasian-American and 58 African-American subjects. Twenty-one genetic polymorphisms were observed-1 insertion-deletion event and 20 single nucleotide polymorphisms (SNPs)-including two non-synonymous coding SNPs (cSNPs) that altered the following amino acids: Arg333Cys and Glu531Gln. Twelve pairs of these polymorphisms were tightly linked, and a total of twelve unequivocal haplotypes could be identified-two that were common to both ethnic groups and ten that were ethnic-specific. The Arg333Cys polymorphism, with an allele frequency of 2.5%, was observed only in DNA samples from Caucasian subjects. The Glu531Gln polymorphism was rare, with only a single copy of that allele in a DNA sample from an African-American subject. Transient expression in mammalian cells showed that neither of the non-synonymous cSNPs resulted in a change in the basal level of enzyme activity measured under optimal assay conditions. However, the Glu531Gln polymorphism altered the substrate kinetic properties of the enzyme. The Gln531 variant allozyme had a 5-fold higher K(m) value for SO(4)(2-) than did the wild-type allozyme and displayed monophasic kinetics for Na(2)SO(4). The wild-type allozyme (Glu531) showed biphasic kinetics for that substrate. These observations represent a step toward testing the hypothesis that genetic variation in PAPS synthesis catalyzed by PAPSS1 might alter in vivo sulfate conjugation.

Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

PubMed

Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

2018-04-19

ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

PubMed

Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

2015-08-01

The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

PubMed

Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

2012-07-01

Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (P<0.001). By alignment analysis and sequencing, we detected that the g.329C>T SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

Mitochondrial pathogenic mutations are population-specific.

PubMed

Breen, Michael S; Kondrashov, Fyodor A

2010-12-31

Surveying deleterious variation in human populations is crucial for our understanding, diagnosis and potential treatment of human genetic pathologies. A number of recent genome-wide analyses focused on the prevalence of segregating deleterious alleles in the nuclear genome. However, such studies have not been conducted for the mitochondrial genome. We present a systematic survey of polymorphisms in the human mitochondrial genome, including those predicted to be deleterious and those that correspond to known pathogenic mutations. Analyzing 4458 completely sequenced mitochondrial genomes we characterize the genetic diversity of different types of single nucleotide polymorphisms (SNPs) in African (L haplotypes) and non-African (M and N haplotypes) populations. We find that the overall level of polymorphism is higher in the mitochondrial compared to the nuclear genome, although the mitochondrial genome appears to be under stronger selection as indicated by proportionally fewer nonsynonymous than synonymous substitutions. The African mitochondrial genomes show higher heterozygosity, a greater number of polymorphic sites and higher frequencies of polymorphisms for synonymous, benign and damaging polymorphism than non-African genomes. However, African genomes carry significantly fewer SNPs that have been previously characterized as pathogenic compared to non-African genomes. Finding SNPs classified as pathogenic to be the only category of polymorphisms that are more abundant in non-African genomes is best explained by a systematic ascertainment bias that favours the discovery of pathogenic polymorphisms segregating in non-African populations. This further suggests that, contrary to the common disease-common variant hypothesis, pathogenic mutations are largely population-specific and different SNPs may be associated with the same disease in different populations. Therefore, to obtain a comprehensive picture of the deleterious variability in the human population, as well as to improve the diagnostics of individuals carrying African mitochondrial haplotypes, it is necessary to survey different populations independently. This article was reviewed by Dr Mikhail Gelfand, Dr Vasily Ramensky (nominated by Dr Eugene Koonin) and Dr David Rand (nominated by Dr Laurence Hurst).

Contributions of IKZF1, DDC, CDKN2A, CEBPE, and LMO1 Gene Polymorphisms to Acute Lymphoblastic Leukemia in a Yemeni Population.

PubMed

Al-Absi, Boshra; Razif, Muhammad F M; Noor, Suzita M; Saif-Ali, Riyadh; Aqlan, Mohammed; Salem, Sameer D; Ahmed, Radwan H; Muniandy, Sekaran

2017-10-01

Genome-wide and candidate gene association studies have previously revealed links between a predisposition to acute lymphoblastic leukemia (ALL) and genetic polymorphisms in the following genes: IKZF1 (7p12.2; ID: 10320), DDC (7p12.2; ID: 1644), CDKN2A (9p21.3; ID: 1029), CEBPE (14q11.2; ID: 1053), and LMO1 (11p15; ID: 4004). In this study, we aimed to conduct an investigation into the possible association between polymorphisms in these genes and ALL within a sample of Yemeni children of Arab-Asian descent. Seven single-nucleotide polymorphisms (SNPs) in IKZF1, three SNPs in DDC, two SNPs in CDKN2A, two SNPs in CEBPE, and three SNPs in LMO1 were genotyped in 289 Yemeni children (136 cases and 153 controls), using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Logistic regression analyses were used to estimate ALL risk, and the strength of association was expressed as odds ratios with 95% confidence intervals. We found that the IKZF1 SNP rs10235796 C allele (p = 0.002), the IKZF1 rs6964969 A>G polymorphism (p = 0.048, GG vs. AA), the CDKN2A rs3731246 G>C polymorphism (p = 0.047, GC+CC vs. GG), and the CDKN2A SNP rs3731246 C allele (p = 0.007) were significantly associated with ALL in Yemenis of Arab-Asian descent. In addition, a borderline association was found between IKZF1 rs4132601 T>G variant and ALL risk. No associations were found between the IKZF1 SNPs (rs11978267; rs7789635), DDC SNPs (rs3779084; rs880028; rs7809758), CDKN2A SNP (rs3731217), the CEBPE SNPs (rs2239633; rs12434881) and LMO1 SNPs (rs442264; rs3794012; rs4237770) with ALL in Yemeni children. The IKZF1 SNPs, rs10235796 and rs6964969, and the CDKN2A SNP rs3731246 (previously unreported) could serve as risk markers for ALL susceptibility in Yemeni children.

Dextromethorphan and debrisoquine metabolism and polymorphism of the gene for cytochrome P450 isozyme 2D50 in Thoroughbreds.

PubMed

Corado, Carley R; McKemie, Daniel S; Knych, Heather K

2016-09-01

OBJECTIVE To characterize polymorphisms of the gene for cytochrome P450 isozyme 2D50 (CYP2D50) and the disposition of 2 CYP2D50 probe drugs, dextromethorphan and debrisoquine, in horses. ANIMALS 23 healthy horses (22 Thoroughbreds and 1 Standardbred). PROCEDURES Single-nucleotide polymorphisms (SNPs) in CYP2D50 were identified. Disposition of dextromethorphan (2 mg/kg) and debrisoquine (0.2 mg/kg) were determined after oral (dextromethorphan) or nasogastric (debrisoquine) administration to the horses. Metabolic ratios of plasma dextromethorphan and total dextrorphan (dextrorphan plus dextrorphan-O-β-glucuronide) and 4-hydroxydebrisoquine concentrations were calculated on the basis of the area under the plasma concentration-versus-time curve extrapolated to infinity for the parent drug divided by that for the corresponding metabolite. Pharmacokinetic data were used to categorize horses into the phenotypic drug-metabolism categories poor, extensive, and ultrarapid. Disposition patterns were compared among categories, and relationships between SNPs and metabolism categories were explored. RESULTS Gene sequencing identified 51 SNPs, including 27 nonsynonymous SNPs. Debrisoquine was minimally detected after oral administration. Disposition of dextromethorphan varied markedly among horses. Metabolic ratios for dextromethorphan ranged from 0.03 to 0.46 (mean, 0.12). On the basis of these data, 1 horse was characterized as a poor metabolizer, 18 were characterized as extensive metabolizers, and 3 were characterized as ultrarapid metabolizers. CONCLUSIONS AND CLINICAL RELEVANCE Findings suggested that CYP2D50 is polymorphic and that the disposition of the probe drug varies markedly in horses. The polymorphisms may be related to rates of drug metabolism. Additional research involving more horses of various breeds is needed to fully explore the functional implication of polymorphisms in CYP2D50.

Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.

PubMed

Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of P450 Oxidoreductase Polymorphisms on the Metabolic Activities of Ten Cytochrome P450s Varied by Polymorphic CYP Genotypes in Human Liver Microsomes.

PubMed

Fang, Yan; Gao, Na; Tian, Xin; Zhou, Jun; Zhang, Hai-Feng; Gao, Jie; He, Xiao-Pei; Wen, Qiang; Jia, Lin-Jing; Jin, Han; Qiao, Hai-Ling

2018-06-27

Background/ Aims: Little is known about the effect of P450 oxidoreductase (POR) gene polymorphisms on the activities of CYPs with multiple genotypes. We genotyped 102 human livers for 18 known POR single nucleotide polymorphisms (SNPs) with allelic frequencies greater than 1% as well as for 27 known SNPs in 10 CYPs. CYP enzyme activities in microsomes prepared from these livers were determined by measuring probe substrate metabolism by high performance liquid chromatograph. We found that the effects of the 18 POR SNPs on 10 CYP activities were CYP genotype-dependent. The POR mutations were significantly associated with decreased overall Km for CYP2B6 and 2E1, and specific genotypes within CYP1A2, 2A6, 2B6, 2C8, 2D6 and 2E1 were identified as being affected by these POR SNPs. Notably, the effect of a specific POR mutation on the activity of a CYP genotype could not be predicted from other CYP genotypes of even the same CYP. When combining one POR SNP with other POR SNPs, a hitherto unrecognized effect of multiple-site POR gene polymorphisms (MSGP) on CYP activity was uncovered, which was not necessarily consistent with the effect of either single POR SNP. The effects of POR SNPs on CYP activities were not only CYP-dependent, but more importantly, CYP genotype-dependent. Moreover, the effect of a POR SNP alone and in combination with other POR SNPs (MSGP) was not always consistent, nor predictable. Understanding the impact of POR gene polymorphisms on drug metabolism necessitates knowing the complete SNP complement of POR and the genotype of the relevant CYPs. © 2018 The Author(s). Published by S. Karger AG, Basel.

[Association analysis between SNPs of the growth hormone receptor gene and growth traits in arctic fox].

PubMed

DU, Zhi-Heng; Liu, Zong-Yue; Bai, Xiu-Juan

2010-06-01

Using single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing, single nucleotide polymorphisms (SNPs) of growth hormone receptor (GHR) gene were detected in an arctic fox population. Correlation analysis between GHR polymorphisms and growth traits were carried out using the appropriate model. Four SNPs, G3A in the 5'UTR, C99T in the first exon, T59C and G65A in the fifth exon were identified on the arctic fox GHR gene. The G3A and C99T polymorphisms of GHR were associated with female fox body weight (Pamp;0.05) and the T59C and G65A polymorphisms of GHR were associated with male fox body weight (Pamp;0.05) and the skin length of the female fox (Pamp;0.01). Therefore, marker assistant selection on body weight and skin length of arctic foxes using these SNPs can be applied to get big and high quality arctic foxes.

Allele frequency and genotype distribution of polymorphisms within disease-related genes is influenced by ethnic population sub-structuring in Sudan.

PubMed

Bereir, R E H; Mohamed, H S; Seielstad, M; El Hassani, A M; Khalil, E A G; Peacock, C S; Blackwell, J M; Ibrahim, M E

2003-09-01

Four single nucleotide polymorphisms (SNPs) and a variable number of tandem repeats (VNTR) polymorphism located within disease associated/causing genes were typed in four populations of different tribal and ethnic affiliation from the Sudan. The genotype and allele frequencies were compared with those of other groups from published and unpublished data of world populations. The combined Sudanese sample conformed with Hardy-Weinberg equilibrium (HWE) expectation. However, population sub-structuring according to ethnic/linguistic group indicated at least two SNPs in departure from HWE. Differences in allele frequencies and genotype distribution between groups was also noted in three of the four SNPs. The other loci were distributed homogeneously within the populations studied with genotype frequencies in agreement with HWE expectation. These results highlight the importance of inter-population stratification for polymorphic markers, as well as the potential influence of evolutionary history and ethnic variation of loci, in the general distribution of SNPs and other polymorphisms.

Gene by Environment Investigation of Incident Lung Cancer Risk in African-Americans.

PubMed

David, Sean P; Wang, Ange; Kapphahn, Kristopher; Hedlin, Haley; Desai, Manisha; Henderson, Michael; Yang, Lingyao; Walsh, Kyle M; Schwartz, Ann G; Wiencke, John K; Spitz, Margaret R; Wenzlaff, Angela S; Wrensch, Margaret R; Eaton, Charles B; Furberg, Helena; Mark Brown, W; Goldstein, Benjamin A; Assimes, Themistocles; Tang, Hua; Kooperberg, Charles L; Quesenberry, Charles P; Tindle, Hilary; Patel, Manali I; Amos, Christopher I; Bergen, Andrew W; Swan, Gary E; Stefanick, Marcia L

2016-02-01

Genome-wide association studies have identified polymorphisms linked to both smoking exposure and risk of lung cancer. The degree to which lung cancer risk is driven by increased smoking, genetics, or gene-environment interactions is not well understood. We analyzed associations between 28 single nucleotide polymorphisms (SNPs) previously associated with smoking quantity and lung cancer in 7156 African-American females in the Women's Health Initiative (WHI), then analyzed main effects of top nominally significant SNPs and interactions between SNPs, cigarettes per day (CPD) and pack-years for lung cancer in an independent, multi-center case-control study of African-American females and males (1078 lung cancer cases and 822 controls). Nine nominally significant SNPs for CPD in WHI were associated with incident lung cancer (corrected p-values from 0.027 to 6.09 × 10(-5)). CPD was found to be a nominally significant effect modifier between SNP and lung cancer for six SNPs, including CHRNA5 rs2036527[A](betaSNP*CPD = - 0.017, p = 0.0061, corrected p = 0.054), which was associated with CPD in a previous genome-wide meta-analysis of African-Americans. These results suggest that chromosome 15q25.1 variants are robustly associated with CPD and lung cancer in African-Americans and that the allelic dose effect of these polymorphisms on lung cancer risk is most pronounced in lighter smokers.

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

Genetic polymorphism and prostate cancer aggressiveness: a case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans.

PubMed

Bensen, Jeannette T; Xu, Zongli; Smith, Gary J; Mohler, James L; Fontham, Elizabeth T H; Taylor, Jack A

2013-01-01

Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. Four GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and seven flanking SNPs were associated with CaP aggressiveness (P < 0.05) in three genomic regions: One at 3p12 (EA), seven at 8q24 (5 AA, 2 EA), and three at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (two AA, one AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (P < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. Copyright © 2012 Wiley Periodicals, Inc.

Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1536 GWAS and candidate SNPs in African Americans and European Americans

PubMed Central

Bensen, Jeannette T.; Xu, Zongli; Smith, Gary J.; Mohler, James L.; Fontham, Elizabeth T.H.; Taylor, Jack A.

2012-01-01

BACKGROUND Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. METHODS A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. RESULTS 4 GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and 7 flanking SNPs were associated with CaP aggressiveness (P<0.05) in 3 genomic regions: one at 3p12 (EA), 7 at 8q24 (5 AA, 2 EA), and 3 at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (2 AA, 1 AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (p < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. CONCLUSIONS Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. PMID:22549899

Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

PubMed

Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

2017-04-01

This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Development of a set of SNP markers present in expressed genes of the apple.

PubMed

Chagné, David; Gasic, Ksenija; Crowhurst, Ross N; Han, Yuepeng; Bassett, Heather C; Bowatte, Deepa R; Lawrence, Timothy J; Rikkerink, Erik H A; Gardiner, Susan E; Korban, Schuyler S

2008-11-01

Molecular markers associated with gene coding regions are useful tools for bridging functional and structural genomics. Due to their high abundance in plant genomes, single nucleotide polymorphisms (SNPs) are present within virtually all genomic regions, including most coding sequences. The objective of this study was to develop a set of SNPs for the apple by taking advantage of the wealth of genomics resources available for the apple, including a large collection of expressed sequenced tags (ESTs). Using bioinformatics tools, a search for SNPs within an EST database of approximately 350,000 sequences developed from a variety of apple accessions was conducted. This resulted in the identification of a total of 71,482 putative SNPs. As the apple genome is reported to be an ancient polyploid, attempts were made to verify whether those SNPs detected in silico were attributable either to allelic polymorphisms or to gene duplication or paralogous or homeologous sequence variations. To this end, a set of 464 PCR primer pairs was designed, PCR was amplified using two subsets of plants, and the PCR products were sequenced. The SNPs retrieved from these sequences were then mapped onto apple genetic maps, including a newly constructed map of a Royal Gala x A689-24 cross and a Malling 9 x Robusta 5, map using a bin mapping strategy. The SNP genotyping was performed using the high-resolution melting (HRM) technique. A total of 93 new markers containing 210 coding SNPs were successfully mapped. This new set of SNP markers for the apple offers new opportunities for understanding the genetic control of important horticultural traits using quantitative trait loci (QTL) or linkage disequilibrium analysis. These also serve as useful markers for aligning physical and genetic maps, and as potential transferable markers across the Rosaceae family.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Polymorphisms in inflammation pathway genes and endometrial cancer risk

PubMed Central

Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

2013-01-01

Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (P<0.05) indicated that the majority of associations could be linked to one of 24 distinct loci. One SNP from each of the 24 loci was then selected for follow-up genotyping. Of these, 21 SNPs were successfully designed and genotyped in stage 2, which consisted of ten additional studies including 6,604 endometrial cancer cases and 8,511 controls. Results Five of the 21 SNPs had significant allelic odds ratios and 95% confidence intervals as follows: FABP1, 0.92 (0.85-0.99); CXCL3, 1.16 (1.05-1.29); IL6, 1.08 (1.00-1.17); MSR1, 0.90 (0.82-0.98); and MMP9, 0.91 (0.87-0.97). Two of these polymorphisms were independently significant in the replication sample (rs352038 in CXCL3 and rs3918249 in MMP9). The association for the MMP9 polymorphism remained significant after Bonferroni correction and showed a significant association with endometrial cancer in both Asian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

RAN/RANBP2 polymorphisms and neuroblastoma risk in Chinese children: a three-center case-control study.

PubMed

Wang, Juxiang; Zhuo, Zhenjian; Chen, Min; Zhu, Jinhong; Zhao, Jie; Zhang, Jiao; Chen, Shanshan; He, Jing; Zhou, Haixia

2018-04-28

The genetic etiology of sporadic neuroblastoma remains largely obscure. RAN and RANBP2 genes encode Ras-related nuclear protein and Ran-binding protein 2, respectively. These two proteins form Ran-RanBP2 complex that regulate various cellular activities including nuclear transport. Aberrant functions of the two proteins are implicated in carcinogenesis. Given the unknown role of RAN/RANBP2 single nucleotide polymorphisms (SNPs) in neuroblastoma risk, we performed a multi-center case-control study in Chinese children to assess the association of the RAN/RANBP2 SNPs with neuroblastoma risk. We analyzed three potentially functional SNPs in RAN gene (rs56109543 C>T, rs7132224 A>G, rs14035 C>T) and one in RANBP2 (rs2462788 C>T) in 429 cases and 884 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to access the association between these four polymorphisms and neuroblastoma risk. No single variant was found to statistically significantly associate with neuroblastoma risk. However, individuals with 3 protective genotypes were less likely to develop neuroblastoma, in comparison to non-carriers (adjusted OR=0.33; 95% CI=0.12-0.96; P =0.042), as well as those with 0-2 protective genotypes (adjusted OR=0.33; 95% CI=0.11-0.94; P =0.038). Stratified analysis revealed no significant association for any of the four polymorphisms. Further studies are warranted to validate the weak impact of RAN/RANBP2 SNPs on neuroblastoma risk.

PXR polymorphisms and their impact on pharmacokinetics/pharmacodynamics of repaglinide in healthy Chinese volunteers.

PubMed

Du, Qing-qing; Wang, Zhi-jun; He, Lin; Jiang, Xue-hua; Wang, Ling

2013-11-01

CYP3A4 is the main isoform of cytochrome P450 oxidases involved in the metabolism of approximately 60 % drugs, and its expression level is highly variable in human subjects. CYP3A4 is regulated by many transcription factors, among which the pregnane X receptor/steroid and xenobiotic receptor (PXR/SXR, NR1I2) have been identified as the most critical. Genetic polymorphisms (such as SNPs) in PXR may affect the expression level of CYP3A4. Although numerous SNPs have been identified in PXR and have appeared to affect PXR function, their impact on the expression of CYP3A4 in human subjects has not been well studied. Thus, a clinical study in healthy Chinese subjects was conducted to investigate the impact of PXR polymorphisms on repaglinide (an endogenous marker for CYP3A4 activity) pharmacokinetics used alone or in combination with a PXR inducer, flucloxacillin. Two SNPs, -298A>G and 11193T>C, were identified as the tag SNPs to represent the overall genetic polymorphic profile of PXR. To evaluate the potential functional change of these two SNPs, 24 healthy subjects were recruited in a pharmacokinetics/pharmacodynamics study of repaglinide with or without flucloxacillin. The pharmacokinetic parameters including AUC and T1/2 were significantly different among the PXR genotype groups. The SNPs of -298G/G and 11193C/C were found to be associated with a lower PXR activity resulting in reduction of CYP3A4 activity in vivo. After administration of flucloxacillin, a significant drug-drug interaction was observed. The clearance of repagnilide was significantly increased by concomitant flucloxacillin in a genotype dependent manner. The subjects with SNPs of -298G/G and 11193C/C appeared to be less sensitive to flucloxacillin. Our study results demonstrated for the first time the impact of genetic polymorphisms of PXR on the PK and PD of repaglinide, and showed that subjects with genotype of -298G/G and 11193C/C in PXR has a decreased elimination rate of 3A4/2C8. Furthermore, flucloxacillin was able to induce 3A4/2C8 expression mediated by PXR in a genotype dependent manner.

Polymorphisms of the resistin gene and their association with obesity and resistin levels in Malaysian Malays.

PubMed

Apalasamy, Yamunah Devi; Rampal, Sanjay; Salim, Agus; Moy, Foong Ming; Su, Tin Tin; Majid, Hazreen Abdul; Bulgiba, Awang; Mohamed, Zahurin

2015-06-01

Single nucleotide polymorphisms (SNP) in the resistin gene (RETN) are linked to obesity and resistin levels in various populations. However, results have been inconsistent. This study aimed to investigate association between polymorphisms in the resistin gene with obesity in a homogenous Malaysian Malay population. This study is also aimed to determine association between resistin levels with certain SNPs and haplotypes of RETN. A total of 631 Malaysian Malay subjects were included in this study and genotyping was carried out using Sequenom MassARRAY. There was no significant difference found in both allelic and genotype frequencies of each of the RETN SNPs between the obese and non-obese groups after Bonferroni correction. RETN rs34861192 and rs3219175 SNPs were significantly associated with log-resistin levels. The GG genotype carriers are found to have higher levels of log-resistin compared to A allele carriers. The RETN haplotypes (CAG, CGA and GA) were significantly associated with resistin levels. However, the haplotypes of the RETN gene were not associated with obesity. Resistin levels were not correlated to metabolic parameters such as body weight, waist circumference, body mass index, and lipid parameters. RETN SNPs and haplotypes are of apparent functional importance in the regulation of resistin levels but are not correlated with obesity and related markers.

Development of genetic markers in abalone through construction of a SNP database.

PubMed

Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S

2011-06-01

In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis. © 2010 NFRDI, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

Ghrelin gene polymorphisms in rheumatoid arthritis.

PubMed

Ozgen, Metin; Koca, Suleyman Serdar; Etem, Ebru Onalan; Yuce, Huseyin; Aydin, Suleyman; Isik, Ahmet

2011-07-01

Ghrelin, an endogenous orexigenic peptide, has anti-inflammatory effects, down-regulates pro-inflammatory cytokines, and its altered levels are reported in various inflammatory diseases. The human preproghrelin (ghrelin/obestatin) gene shows several single nucleotide polymorphisms (SNPs) including Arg51Gln, Leu72Met, Gln90Leu, and A-501C. The aim of this study was to investigate the frequency, and clinical significance, of these four SNPs in a small cohort of Turkish patients with rheumatoid arthritis (RA). The study included 103 patients with RA and 103 healthy controls. In the RA group, disease activity and disease-related damage were assessed using the Disease Activity Score-28 (DAS-28), and the modified Larsen scoring (MLS) methods. In all the participants, genomic DNA was isolated and genotyped by polymerase chain reaction and restriction fragment length polymorphism analysis. The frequencies of ghrelin gene SNPs were 82.5 and 79.6% in the RA and control groups, respectively, and there were no significant differences in terms of genotype distributions and allele frequencies for these four SNPs between the groups. However, the A-501C SNP was found to be associated with early disease onset, and Gln90Leu SNP with less frequent rheumatoid factor positivity, in the RA group. A-501C SNP is associated with earlier onset of RA suggesting that genetic variations in the ghrelin gene may have an impact on RA. Copyright © 2010 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Sequence analysis of three canine adipokine genes revealed an association between TNF polymorphisms and obesity in Labrador dogs.

PubMed

Mankowska, M; Stachowiak, M; Graczyk, A; Ciazynska, P; Gogulski, M; Nizanski, W; Switonski, M

2016-04-01

Obesity is an emerging health problem in purebred dogs. Due to their crucial role in energy homeostasis control, genes encoding adipokines are considered candidate genes, and their variants may be associated with predisposition to obesity. Searching for polymorphism was carried out in three adipokine genes (TNF, RETN and IL6). The study was performed on 260 dogs, including lean (n = 109), overweight (n = 88) and obese (n = 63) dogs. The largest cohort was represented by Labrador Retrievers (n = 136). Altogether, 24 novel polymorphisms were identified: 12 in TNF (including one missense SNP), eight in RETN (including one missense SNP) and four in IL6. Distributions of five common SNPs (two in TNF, two in RETN and one in IL6) were further analyzed with regard to body condition score. Two SNPs in the non-coding parts of TNF (c.-40A>C and c.233+14G>A) were associated with obesity in Labrador dogs. The obtained results showed that the studied adipokine genes are highly polymorphic and two polymorphisms in the TNF gene may be considered as markers predisposing Labrador dogs to obesity. © 2015 Stichting International Foundation for Animal Genetics.

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Polygenic influences on dyslipidemias.

PubMed

Dron, Jacqueline S; Hegele, Robert A

2018-04-01

Rare large-effect genetic variants underlie monogenic dyslipidemias, whereas common small-effect genetic variants - single nucleotide polymorphisms (SNPs) - have modest influences on lipid traits. Over the past decade, these small-effect SNPs have been shown to cumulatively exert consistent effects on lipid phenotypes under a polygenic framework, which is the focus of this review. Several groups have reported polygenic risk scores assembled from lipid-associated SNPs, and have applied them to their respective phenotypes. For lipid traits in the normal population distribution, polygenic effects quantified by a score that integrates several common polymorphisms account for about 20-30% of genetic variation. Among individuals at the extremes of the distribution, that is, those with clinical dyslipidemia, the polygenic component includes both rare variants with large effects and common polymorphisms: depending on the trait, 20-50% of susceptibility can be accounted for by this assortment of genetic variants. Accounting for polygenic effects increases the numbers of dyslipidemic individuals who can be explained genetically, but a substantial proportion of susceptibility remains unexplained. Whether documenting the polygenic basis of dyslipidemia will affect outcomes in clinical trials or prospective observational studies remains to be determined.

SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis.

PubMed

Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P

2016-06-01

Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel of molecular tools for whole genome analysis, allowing integrating and better exploring the common bean breeding practices.

SNPServer: a real-time SNP discovery tool.

PubMed

Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

2005-07-01

SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

Association of ITPA polymorphisms rs6051702/rs1127354 instead of rs7270101/rs1127354 as predictor of ribavirin-associated anemia in chronic hepatitis C treated patients.

PubMed

D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni

2013-10-01

Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.

Genotype imputation for African Americans using data from HapMap phase II versus 1000 genomes projects.

PubMed

Sung, Yun J; Gu, C Charles; Tiwari, Hemant K; Arnett, Donna K; Broeckel, Ulrich; Rao, Dabeeru C

2012-07-01

Genotype imputation provides imputation of untyped single nucleotide polymorphisms (SNPs) that are present on a reference panel such as those from the HapMap Project. It is popular for increasing statistical power and comparing results across studies using different platforms. Imputation for African American populations is challenging because their linkage disequilibrium blocks are shorter and also because no ideal reference panel is available due to admixture. In this paper, we evaluated three imputation strategies for African Americans. The intersection strategy used a combined panel consisting of SNPs polymorphic in both CEU and YRI. The union strategy used a panel consisting of SNPs polymorphic in either CEU or YRI. The merge strategy merged results from two separate imputations, one using CEU and the other using YRI. Because recent investigators are increasingly using the data from the 1000 Genomes (1KG) Project for genotype imputation, we evaluated both 1KG-based imputations and HapMap-based imputations. We used 23,707 SNPs from chromosomes 21 and 22 on Affymetrix SNP Array 6.0 genotyped for 1,075 HyperGEN African Americans. We found that 1KG-based imputations provided a substantially larger number of variants than HapMap-based imputations, about three times as many common variants and eight times as many rare and low-frequency variants. This higher yield is expected because the 1KG panel includes more SNPs. Accuracy rates using 1KG data were slightly lower than those using HapMap data before filtering, but slightly higher after filtering. The union strategy provided the highest imputation yield with next highest accuracy. The intersection strategy provided the lowest imputation yield but the highest accuracy. The merge strategy provided the lowest imputation accuracy. We observed that SNPs polymorphic only in CEU had much lower accuracy, reducing the accuracy of the union strategy. Our findings suggest that 1KG-based imputations can facilitate discovery of significant associations for SNPs across the whole MAF spectrum. Because the 1KG Project is still under way, we expect that later versions will provide better imputation performance. © 2012 Wiley Periodicals, Inc.

Genetic polymorphisms of cytokine genes in type 2 diabetes mellitus

PubMed Central

Banerjee, Monisha; Saxena, Madhukar

2014-01-01

Diabetes mellitus is a combined metabolic disorder which includes hyperglycemia, dyslipidemia, stroke and several other complications. Various groups all over the world are relentlessly working out the possible role of a vast number of genes associated with type 2 diabetes (T2DM). Inflammation is an important outcome of any kind of imbalance in the body and is therefore an indicator of several diseases, including T2DM. Various ethnic populations around the world show different levels of variations in single nucleotide polymorphisms (SNPs). The present review was undertaken to explore the association of cytokine gene polymorphisms with T2DM in populations of different ethnicities. This will lead to the understanding of the role of cytokine genes in T2DM risk and development. Association studies of genotypes of SNPs present in cytokine genes will help to identify risk haplotype(s) for disease susceptibility by developing prognostic markers and alter treatment strategies for T2DM and related complications. This will enable individuals at risk to take prior precautionary measures and avoid or delay the onset of the disease. Future challenges will be to understand the genotypic interactions between SNPs in one cytokine gene or several genes at different loci and study their association with T2DM. PMID:25126395

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

PubMed

Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

2010-10-01

Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

EPH Receptor B4 (EPHB4) Gene Polymorphisms and Risk of Intracranial Hemorrhage in Patients with Brain Arteriovenous Malformations

PubMed Central

Weinsheimer, Shantel; Kim, Helen; Pawlikowska, Ludmila; Chen, Yongmei; Lawton, Michael T.; Sidney, Stephen; Kwok, Pui-Yan; McCulloch, Charles E.; Young, William L.

2009-01-01

Background Brain arteriovenous malformations (BAVM) are a tangle of abnormal vessels directly shunting blood from the arterial to venous circulation and an important cause of intracranial hemorrhage (ICH). EphB4 is involved in arterial-venous determination during embryogenesis; altered signaling could lead to vascular instability resulting in ICH. We investigated the association of single-nucleotide polymorphisms (SNPs) and haplotypes in EPHB4 with risk of ICH at clinical presentation in BAVM patients. Methods and Results Eight haplotype-tagging SNPs spanning ∼29 kb were tested for association with ICH presentation in 146 Caucasian BAVM patients (phase I: 56 ICH, 90 non-ICH) using allelic, haplotypic, and principal components analysis. Associated SNPs were then genotyped in 102 additional cases (phase II: 37 ICH, 65 non-ICH) and data combined for multivariable logistic regression. Minor alleles of 2 SNPs were associated with reduced risk of ICH presentation (rs314313 C, P=0.005; rs314308 T, P=0.0004). Overall, haplotypes were also significantly associated with ICH presentation (χ2=17.24, 6 df, P=0.008); 2 haplotypes containing the rs314308 T allele (GCCTGGGT, P=0.003; GTCTGGGC, P=0.036) were associated with reduced risk. In principal components analysis, 2 components explained 91% of the variance, and complemented haplotype results by implicating 4 SNPs at the 5′ end, including rs314308 and rs314313. These 2 SNPs were replicated in the phase II cohort, and combined data resulted in greater significance (rs314313, P=0.0007; rs314308, P=0.00008). SNP association with ICH presentation persisted after adjusting for age, sex, BAVM size, and deep venous drainage. Conclusions EPHB4 polymorphisms are associated with risk of ICH presentation in BAVM patients, warranting further study. PMID:20031623

The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

PubMed

Yates, Christopher M; Sternberg, Michael J E

2013-11-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.

PubMed

Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A

2012-01-01

Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

PubMed Central

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

PubMed

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

PubMed

Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

2018-04-01

HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

Associations between incident ischemic stroke events and stroke and cardiovascular disease-related genome-wide association studies single nucleotide polymorphisms in the Population Architecture Using Genomics and Epidemiology study.

PubMed

Carty, Cara L; Buzková, Petra; Fornage, Myriam; Franceschini, Nora; Cole, Shelley; Heiss, Gerardo; Hindorff, Lucia A; Howard, Barbara V; Mann, Sue; Martin, Lisa W; Zhang, Ying; Matise, Tara C; Prentice, Ross; Reiner, Alexander P; Kooperberg, Charles

2012-04-01

Genome-wide association studies (GWAS) have identified loci associated with ischemic stroke (IS) and cardiovascular disease (CVD) in European-descent individuals, but their replication in different populations has been largely unexplored. Nine single nucleotide polymorphisms (SNPs) selected from GWAS and meta-analyses of stroke, and 86 SNPs previously associated with myocardial infarction and CVD risk factors, including blood lipids (high density lipoprotein [HDL], low density lipoprotein [LDL], and triglycerides), type 2 diabetes, and body mass index (BMI), were investigated for associations with incident IS in European Americans (EA) N=26 276, African-Americans (AA) N=8970, and American Indians (AI) N=3570 from the Population Architecture using Genomics and Epidemiology Study. Ancestry-specific fixed effects meta-analysis with inverse variance weighting was used to combine study-specific log hazard ratios from Cox proportional hazards models. Two of 9 stroke SNPs (rs783396 and rs1804689) were significantly associated with [corrected] IS hazard in AA; none were significant in this large EA cohort. Of 73 CVD risk factor SNPs tested in EA, 2 (HDL and triglycerides SNPs) were associated with IS. In AA, SNPs associated with LDL, HDL, and BMI were significantly associated with IS (3 of 86 SNPs tested). Out of 58 SNPs tested in AI, 1 LDL SNP was significantly associated with IS. Our analyses showing lack of replication in spite of reasonable power for many stroke SNPs and differing results by ancestry highlight the need to follow up on GWAS findings and conduct genetic association studies in diverse populations. We found modest IS associations with BMI and lipids SNPs, though these findings require confirmation.

Associations Between Polymorphisms in the Glucocorticoid-Receptor Gene and Cardiovascular Risk Factors in a Chinese Population

PubMed Central

Yan, Yu-Xiang; Dong, Jing; Wu, Li-Juan; Shao, Shuang; Zhang, Jie; Zhang, Ling; Wang, Wei; He, Yan; Liu, You-Qin

2013-01-01

Background Glucocorticoid is an important regulator of energy homeostasis. Glucocorticoid receptor (GR) gene polymorphisms that contribute to variability in glucocorticoid sensitivity have been identified. We explored the associations of single-nucleotide polymorphisms (SNPs) of the GR gene with traditional cardiovascular risk factors in the Chinese Han population. Methods We recruited 762 consecutive adults who underwent a regular physical examination at Beijing Xuanwu Hospital. Blood pressure, glucose, lipid levels (total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein [LDL] cholesterol and triglycerides), body mass index (BMI), and waist-to-hip ratio were measured. Fourteen tag SNPs and 5 functional SNPs were selected and genotyped using the high-throughput Sequenom genotyping platform. Differences between genotypes/alleles for each SNP were adjusted for sex and age and tested using a general linear model procedure. Various models of inheritance, including additive, dominant, and recessive, were tested. Results Among the 19 SNPs examined, 5 markers were associated with cardiovascular risk factors. The rs41423247 GG genotype and the rs7701443 AA genotype were associated with higher BMI and systolic blood pressure (P < 0.0004), and the rs17209251 GG genotype was associated with higher systolic blood pressure (P < 0.0004). Lower systolic blood pressure, total cholesterol, and LDL cholesterol were observed among rs10052957 A allele carriers (P < 0.0004), and lower plasma glucose and LDL-cholesterol concentrations were observed among rs2963156 TT carriers (P < 0.0004). Conclusions Polymorphism of the GR gene was associated with cardiovascular risk factors and may contribute to susceptibility to cardiovascular disease. PMID:23892712

Interaction between LRP5 and periostin gene polymorphisms on serum periostin levels and cortical bone microstructure.

PubMed

Pepe, J; Bonnet, N; Herrmann, F R; Biver, E; Rizzoli, R; Chevalley, T; Ferrari, S L

2018-02-01

We investigated the interaction between periostin SNPs and the SNPs of the genes assumed to modulate serum periostin levels and bone microstructure in a cohort of postmenopausal women. We identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels and on radial cortical porosity. The purpose of this study is to investigate the interaction between periostin gene polymorphisms (SNPs) and other genes potentially responsible for modulating serum periostin levels and bone microstructure in a cohort of postmenopausal women. In 648 postmenopausal women from the Geneva Retirees Cohort, we analyzed 6 periostin SNPs and another 149 SNPs in 14 genes, namely BMP2, CTNNB1, ESR1, ESR2, LRP5, LRP6, PTH, SPTBN1, SOST, TGFb1, TNFRSF11A, TNFSF11, TNFRSF11B and WNT16. Volumetric BMD and bone microstructure were measured by high-resolution peripheral quantitative computed tomography at the distal radius and tibia. Serum periostin levels were associated with radial cortical porosity, including after adjustment for age, BMI, and years since menopause (p = 0.036). Sixteen SNPs in the ESR1, LRP5, TNFRSF11A, SOST, SPTBN1, TNFRSF11B and TNFSF11 genes were associated with serum periostin levels (p range 0.03-0.001) whereas 26 SNPs in 9 genes were associated with cortical porosity at the radius and/or at the tibia. WNT 16 was the gene with the highest number of SNPs associated with both trabecular and cortical microstructure. The periostin SNP rs9547970 was also associated with cortical porosity (p = 0.04). In particular, SNPs in LRP5, ESR1 and near the TNFRSF11A gene were associated with both cortical porosity and serum periostin levels. Eventually, we identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels (interaction p = 0.01) and on radial cortical porosity (interaction p = 0.005). These results suggest that periostin expression is genetically modulated, particularly by polymorphisms in the Wnt pathway, and is thereby implicated in the genetic variation of bone microstructure.

MicroRNA Related Polymorphisms and Breast Cancer Risk

PubMed Central

Khan, Sofia; Greco, Dario; Michailidou, Kyriaki; Milne, Roger L.; Muranen, Taru A.; Heikkinen, Tuomas; Aaltonen, Kirsimari; Dennis, Joe; Bolla, Manjeet K.; Liu, Jianjun; Hall, Per; Irwanto, Astrid; Humphreys, Keith; Li, Jingmei; Czene, Kamila; Chang-Claude, Jenny; Hein, Rebecca; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Fletcher, Olivia; Peto, Julian; dos Santos Silva, Isabel; Johnson, Nichola; Gibson, Lorna; Aitken, Zoe; Hopper, John L.; Tsimiklis, Helen; Bui, Minh; Makalic, Enes; Schmidt, Daniel F.; Southey, Melissa C.; Apicella, Carmel; Stone, Jennifer; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A.; van der Luijt, Rob B.; Meindl, Alfons; Schmutzler, Rita K.; Müller-Myhsok, Bertram; Lichtner, Peter; Turnbull, Clare; Rahman, Nazneen; Chanock, Stephen J.; Hunter, David J.; Cox, Angela; Cross, Simon S.; Reed, Malcolm W. R.; Schmidt, Marjanka K.; Broeks, Annegien; Veer, Laura J. V. a. n't.; Hogervorst, Frans B.; Fasching, Peter A.; Schrauder, Michael G.; Ekici, Arif B.; Beckmann, Matthias W.; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Benitez, Javier; Zamora, Pilar M.; Perez, Jose I. A.; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Pharoah, Paul D. P.; Dunning, Alison M.; Shah, Mitul; Luben, Robert; Brown, Judith; Couch, Fergus J.; Wang, Xianshu; Vachon, Celine; Olson, Janet E.; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Mulot, Claire; Marme, Frederick; Burwinkel, Barbara; Schneeweiss, Andreas; Sohn, Christof; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Andrulis, Irene L.; Knight, Julia A.; Tchatchou, Sandrine; Mulligan, Anna Marie; Dörk, Thilo; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Anton-Culver, Hoda; Darabi, Hatef; Eriksson, Mikael; Garcia-Closas, Montserrat; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Devilee, Peter; Tollenaar, Robert A. E. M.; Seynaeve, Caroline; van Asperen, Christi J.; Kristensen, Vessela N.; Slager, Susan; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Lindblom, Annika; Margolin, Sara; Radice, Paolo; Peterlongo, Paolo; Barile, Monica; Mariani, Paolo; Hooning, Maartje J.; Martens, John W. M.; Collée, J. Margriet; Jager, Agnes; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Giles, Graham G.; McLean, Catriona; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Mannermaa, Arto; Hamann, Ute; Chenevix-Trench, Georgia; Blomqvist, Carl; Aittomäki, Kristiina; Easton, Douglas F.; Nevanlinna, Heli

2014-01-01

Genetic variations, such as single nucleotide polymorphisms (SNPs) in microRNAs (miRNA) or in the miRNA binding sites may affect the miRNA dependent gene expression regulation, which has been implicated in various cancers, including breast cancer, and may alter individual susceptibility to cancer. We investigated associations between miRNA related SNPs and breast cancer risk. First we evaluated 2,196 SNPs in a case-control study combining nine genome wide association studies (GWAS). Second, we further investigated 42 SNPs with suggestive evidence for association using 41,785 cases and 41,880 controls from 41 studies included in the Breast Cancer Association Consortium (BCAC). Combining the GWAS and BCAC data within a meta-analysis, we estimated main effects on breast cancer risk as well as risks for estrogen receptor (ER) and age defined subgroups. Five miRNA binding site SNPs associated significantly with breast cancer risk: rs1045494 (odds ratio (OR) 0.92; 95% confidence interval (CI): 0.88–0.96), rs1052532 (OR 0.97; 95% CI: 0.95–0.99), rs10719 (OR 0.97; 95% CI: 0.94–0.99), rs4687554 (OR 0.97; 95% CI: 0.95–0.99, and rs3134615 (OR 1.03; 95% CI: 1.01–1.05) located in the 3′ UTR of CASP8, HDDC3, DROSHA, MUSTN1, and MYCL1, respectively. DROSHA belongs to miRNA machinery genes and has a central role in initial miRNA processing. The remaining genes are involved in different molecular functions, including apoptosis and gene expression regulation. Further studies are warranted to elucidate whether the miRNA binding site SNPs are the causative variants for the observed risk effects. PMID:25390939

MicroRNA related polymorphisms and breast cancer risk.

PubMed

Khan, Sofia; Greco, Dario; Michailidou, Kyriaki; Milne, Roger L; Muranen, Taru A; Heikkinen, Tuomas; Aaltonen, Kirsimari; Dennis, Joe; Bolla, Manjeet K; Liu, Jianjun; Hall, Per; Irwanto, Astrid; Humphreys, Keith; Li, Jingmei; Czene, Kamila; Chang-Claude, Jenny; Hein, Rebecca; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Fletcher, Olivia; Peto, Julian; dos Santos Silva, Isabel; Johnson, Nichola; Gibson, Lorna; Aitken, Zoe; Hopper, John L; Tsimiklis, Helen; Bui, Minh; Makalic, Enes; Schmidt, Daniel F; Southey, Melissa C; Apicella, Carmel; Stone, Jennifer; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A; van der Luijt, Rob B; Meindl, Alfons; Schmutzler, Rita K; Müller-Myhsok, Bertram; Lichtner, Peter; Turnbull, Clare; Rahman, Nazneen; Chanock, Stephen J; Hunter, David J; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Schmidt, Marjanka K; Broeks, Annegien; Van't Veer, Laura J; Hogervorst, Frans B; Fasching, Peter A; Schrauder, Michael G; Ekici, Arif B; Beckmann, Matthias W; Bojesen, Stig E; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Benitez, Javier; Zamora, Pilar M; Perez, Jose I A; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Pharoah, Paul D P; Dunning, Alison M; Shah, Mitul; Luben, Robert; Brown, Judith; Couch, Fergus J; Wang, Xianshu; Vachon, Celine; Olson, Janet E; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Mulot, Claire; Marme, Frederick; Burwinkel, Barbara; Schneeweiss, Andreas; Sohn, Christof; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Andrulis, Irene L; Knight, Julia A; Tchatchou, Sandrine; Mulligan, Anna Marie; Dörk, Thilo; Bogdanova, Natalia V; Antonenkova, Natalia N; Anton-Culver, Hoda; Darabi, Hatef; Eriksson, Mikael; Garcia-Closas, Montserrat; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; van Asperen, Christi J; Kristensen, Vessela N; Slager, Susan; Toland, Amanda E; Ambrosone, Christine B; Yannoukakos, Drakoulis; Lindblom, Annika; Margolin, Sara; Radice, Paolo; Peterlongo, Paolo; Barile, Monica; Mariani, Paolo; Hooning, Maartje J; Martens, John W M; Collée, J Margriet; Jager, Agnes; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Giles, Graham G; McLean, Catriona; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Simard, Jacques; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Mannermaa, Arto; Hamann, Ute; Chenevix-Trench, Georgia; Blomqvist, Carl; Aittomäki, Kristiina; Easton, Douglas F; Nevanlinna, Heli

2014-01-01

Genetic variations, such as single nucleotide polymorphisms (SNPs) in microRNAs (miRNA) or in the miRNA binding sites may affect the miRNA dependent gene expression regulation, which has been implicated in various cancers, including breast cancer, and may alter individual susceptibility to cancer. We investigated associations between miRNA related SNPs and breast cancer risk. First we evaluated 2,196 SNPs in a case-control study combining nine genome wide association studies (GWAS). Second, we further investigated 42 SNPs with suggestive evidence for association using 41,785 cases and 41,880 controls from 41 studies included in the Breast Cancer Association Consortium (BCAC). Combining the GWAS and BCAC data within a meta-analysis, we estimated main effects on breast cancer risk as well as risks for estrogen receptor (ER) and age defined subgroups. Five miRNA binding site SNPs associated significantly with breast cancer risk: rs1045494 (odds ratio (OR) 0.92; 95% confidence interval (CI): 0.88-0.96), rs1052532 (OR 0.97; 95% CI: 0.95-0.99), rs10719 (OR 0.97; 95% CI: 0.94-0.99), rs4687554 (OR 0.97; 95% CI: 0.95-0.99, and rs3134615 (OR 1.03; 95% CI: 1.01-1.05) located in the 3' UTR of CASP8, HDDC3, DROSHA, MUSTN1, and MYCL1, respectively. DROSHA belongs to miRNA machinery genes and has a central role in initial miRNA processing. The remaining genes are involved in different molecular functions, including apoptosis and gene expression regulation. Further studies are warranted to elucidate whether the miRNA binding site SNPs are the causative variants for the observed risk effects.

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Integrating common and rare genetic variation in diverse human populations.

PubMed

Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Dermitzakis, Emmanouil; Schaffner, Stephen F; Yu, Fuli; Peltonen, Leena; Dermitzakis, Emmanouil; Bonnen, Penelope E; Altshuler, David M; Gibbs, Richard A; de Bakker, Paul I W; Deloukas, Panos; Gabriel, Stacey B; Gwilliam, Rhian; Hunt, Sarah; Inouye, Michael; Jia, Xiaoming; Palotie, Aarno; Parkin, Melissa; Whittaker, Pamela; Yu, Fuli; Chang, Kyle; Hawes, Alicia; Lewis, Lora R; Ren, Yanru; Wheeler, David; Gibbs, Richard A; Muzny, Donna Marie; Barnes, Chris; Darvishi, Katayoon; Hurles, Matthew; Korn, Joshua M; Kristiansson, Kati; Lee, Charles; McCarrol, Steven A; Nemesh, James; Dermitzakis, Emmanouil; Keinan, Alon; Montgomery, Stephen B; Pollack, Samuela; Price, Alkes L; Soranzo, Nicole; Bonnen, Penelope E; Gibbs, Richard A; Gonzaga-Jauregui, Claudia; Keinan, Alon; Price, Alkes L; Yu, Fuli; Anttila, Verneri; Brodeur, Wendy; Daly, Mark J; Leslie, Stephen; McVean, Gil; Moutsianas, Loukas; Nguyen, Huy; Schaffner, Stephen F; Zhang, Qingrun; Ghori, Mohammed J R; McGinnis, Ralph; McLaren, William; Pollack, Samuela; Price, Alkes L; Schaffner, Stephen F; Takeuchi, Fumihiko; Grossman, Sharon R; Shlyakhter, Ilya; Hostetter, Elizabeth B; Sabeti, Pardis C; Adebamowo, Clement A; Foster, Morris W; Gordon, Deborah R; Licinio, Julio; Manca, Maria Cristina; Marshall, Patricia A; Matsuda, Ichiro; Ngare, Duncan; Wang, Vivian Ota; Reddy, Deepa; Rotimi, Charles N; Royal, Charmaine D; Sharp, Richard R; Zeng, Changqing; Brooks, Lisa D; McEwen, Jean E

2010-09-02

Despite great progress in identifying genetic variants that influence human disease, most inherited risk remains unexplained. A more complete understanding requires genome-wide studies that fully examine less common alleles in populations with a wide range of ancestry. To inform the design and interpretation of such studies, we genotyped 1.6 million common single nucleotide polymorphisms (SNPs) in 1,184 reference individuals from 11 global populations, and sequenced ten 100-kilobase regions in 692 of these individuals. This integrated data set of common and rare alleles, called 'HapMap 3', includes both SNPs and copy number polymorphisms (CNPs). We characterized population-specific differences among low-frequency variants, measured the improvement in imputation accuracy afforded by the larger reference panel, especially in imputing SNPs with a minor allele frequency of

Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

PubMed

Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

2001-11-14

The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

PubMed

Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

2016-01-01

Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

Identification of Polymorphisms in the 3′-Untranslated Region of the Human Pregnane X Receptor (PXR) Gene Associated with Variability in Cytochrome P450 3A (CYP3A) Metabolism

PubMed Central

Oleson, Lauren; von Moltke, Lisa L.; Greenblatt, David J.; Court, Michael H.

2013-01-01

Single nucleotide polymorphisms (SNPs) in the 3′untranslated region (3′UTR) of human pregnane X receptor (PXR) gene may contribute to interindividual variability in cytochrome P450 3A (CYP3A) activity. Genotype-phenotype associations involving PXR-3′UTR SNPs were investigated through in vitro (53 human livers from primarily white donors) and in vivo (26 white or African-American volunteers) studies using midazolam 1′-hydroxylation and midazolam apparent oral clearance (CL/F), respectively, as CYP3A-specific probes. PXR-3′UTR resequencing identified 12 SNPs, including 2 that were novel. Although none of the SNPs evaluated were associated with altered midazolam 1′-hydroxylation in the liver bank, both rs3732359 homozygotes and rs3732360 carriers showed 80% higher (P<0.05) CL/F compared with homozygous reference individuals. These differences in CL/F were even larger (100 and 120% higher, respectively; P<0.01) when only African-American subjects (n=14) were considered. Five major haplotypes were identified containing the PXR-3′UTR SNPs and previously identified intron SNPs. Although CL/F differences were not statistically significant within the entire study cohort, African-American carriers of Haplotype-1 (which includes both rs3732359 and rs3732360 variants) exhibited 70% higher median CL/F compared with African-American non-carriers (P=0.036). Our results identify rs3732359 and rs3732360 as PXR-3′UTR SNPs associated with higher CYP3A activity in vivo in African-Americans. PMID:20082578

Association of TRPV4 gene polymorphisms with chronic obstructive pulmonary disease.

PubMed

Zhu, Guohua; Gulsvik, Amund; Bakke, Per; Ghatta, Srinivas; Anderson, Wayne; Lomas, David A; Silverman, Edwin K; Pillai, Sreekumar G

2009-06-01

Chronic obstructive pulmonary disease (COPD) is characterized by airway epithelial damage, bronchoconstriction, parenchymal destruction and mucus hypersecretion. Upon activation by a broad range of stimuli, transient receptor potential vanilloid 4 (TRPV4) functions to control airway epithelial cell volume and epithelial and endothelial permeability; it also triggers bronchial smooth muscle contraction and participates in autoregulation of mucociliary transport. These functions of TRPV4 may be important for the regulation of COPD pathogenesis, so TRPV4 is a candidate gene for COPD. We genotyped 20 single nucleotide polymorphisms (SNPs) in TRPV4, and tested qualitative COPD and quantitative FEV(1) and FEV(1)/(F)VC phenotypes in two independent large populations. The family population had 606 pedigrees including 1891 individuals, and the case-control sample included 953 COPD cases and 956 controls. Family-based association tests were performed in the family data. Logistic regression and linear models were used in the case-control data to replicate the association results. In the family data, seven out of 20 SNPs tested were associated with COPD (2.5 x 10(-4) < or = P < or = 0.04) and six SNPs were associated with FEV(1)/VC (0.02 < or = P < or = 0.03) from family-based association tests (PBAT) analysis. Four out of the seven SNPs associated with COPD demonstrated replicated associations with the same effect directions in the case-control population (0.02 < or = P < or = 0.03). Significant haplotype associations supported the results of single SNP analyses. Thus, polymorphisms in the TRPV4 gene are associated with COPD.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population.

PubMed

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application "Lekgen" that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population

PubMed Central

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application “Lekgen” that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy. PMID:27499796

Single nucleotide polymorphisms in long noncoding RNA, ANRIL, are not associated with severe periodontitis but with adverse cardiovascular events among patients with cardiovascular disease.

PubMed

Schulz, S; Seitter, L; Werdan, K; Hofmann, B; Schaller, H-G; Schlitt, A; Reichert, S

2018-05-06

Biological plausibility of an association between severe periodontitis and cardiovascular disease (CVD) has been proven. Genetic characteristics play an important role in both complex inflammatory diseases. Polymorphisms (single nucleotide polymorphisms [SNPs]) in the long noncoding RNA, antisense noncoding RNA in the INK4 locus (ANRIL), were shown to play a leading role in both diseases. The primary objectives of the study were to assess, among cardiovascular (CV angiographically proven ≥50% stenosis of a main coronary artery) patients, the impact of ANRIL SNPs rs133049 and rs3217992 on the severity of periodontitis and the previous history of coronary events, as well as on the occurrence of further adverse CV events. The prevalence of severe periodontitis was analyzed in 1002 CV patients. ANRIL SNPs rs133049 and rs3217992 were genotyped. The prognostic value of both ANRIL SNPs for combined CV endpoint (stroke/transient ischemic attack [TIA], myocardial infarction, death from a CV-related event, death from stroke) was evaluated after a 3-year follow-up period. Hazard ratios (HRs) were adjusted for established CV risk factors applying Cox regression. ANRIL SNPs rs133049 and rs3217992 were not associated with severe periodontitis or history of CVD in CV patients. In the Kaplan-Meier survival curve including the log rank-test (P = .036) and Cox regression (hazard ratio = 1.684, P = .009) the AA genotype of rs3217992 was shown to be an independent predictor for adverse CV events after 3 years of follow-up. SNPs in ANRIL are not risk modulators for severe periodontitis and history of CVD in CV patients. The AA genotype of ANRIL SNPs rs3217992 possesses prognostic power for further CV events within 3 years of follow-up. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Bovine GDF10 gene polymorphism analysis and its association with body measurement traits in Chinese indigenous cattle.

PubMed

Adoligbe, C; Zan, Linsen; Farougou, S; Wang, Hongbao; Ujjan, J A

2012-04-01

The objective of this research was to detect bovine GDF10 gene polymorphism and analyze its association with body measurement traits (BMT) of animals sampled from 6 different Chinese indigenous cattle populations. The populations included Xuelong (Xl), Luxi (Lx), Qinchuan (Qc), Jiaxian red (Jx), Xianang (Xn) and Nanyang (Ny). Blood samples were taken from a total of 417 female animals stratified into age categories of 12-36 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out GDF10 single polymorphism nucleotide (SNPs) and explore their possible association with BMT. Sequence analysis of GDF10 gene revealed 3 SNPs in total: 1 in exon1 (G142A) and 2 in exon3 (A11471G, and T12495C). G142A and T12495C SNPs are both synonymous mutation. They showed 2 genotypes namely respectively (GG, GA) and (PP and PB). A11471G SNP is a missense mutation leading to the change of Alanine to Threonine amino acid. It showed three genotypes namely AA, BB and AB. Analysis of association of polymorphism with body measurement traits at the three locus showed that there were significant effects on BMT in Qc, Jx and Ny cattle population. These results suggest that the GDF10 gene might have potential effects on body measurement traits in the above mentioned cattle populations and could be used for marker-assisted selection.

An SNP resource for rice genetics and breeding based on subspecies indica and japonica genome alignments.

PubMed

Feltus, F Alex; Wan, Jun; Schulze, Stefan R; Estill, James C; Jiang, Ning; Paterson, Andrew H

2004-09-01

Dense coverage of the rice genome with polymorphic DNA markers is an invaluable tool for DNA marker-assisted breeding, positional cloning, and a wide range of evolutionary studies. We have aligned drafts of two rice subspecies, indica and japonica, and analyzed levels and patterns of genetic diversity. After filtering multiple copy and low quality sequence, 408,898 candidate DNA polymorphisms (SNPs/INDELs) were discerned between the two subspecies. These filters have the consequence that our data set includes only a subset of the available SNPs (in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles) but increase the likelihood that this subset is useful: Direct sequencing suggests that 79.8% +/- 7.5% of the in silico SNPs are real. The SNP sample in our database is not randomly distributed across the genome. In fact, 566 rice genomic regions had unusually high (328 contigs/48.6 Mb/13.6% of genome) or low (237 contigs/64.7 Mb/18.1% of genome) polymorphism rates. Many SNP-poor regions were substantially longer than most SNP-rich regions, covering up to 4 Mb, and possibly reflecting introgression between the respective gene pools that may have occurred hundreds of years ago. Although 46.2% +/- 8.3% of the SNPs differentiate other pairs of japonica and indica genotypes, SNP rates in rice were not predictive of evolutionary rates for corresponding genes in another grass species, sorghum. The data set is freely available at http://www.plantgenome.uga.edu/snp.

An SNP Resource for Rice Genetics and Breeding Based on Subspecies Indica and Japonica Genome Alignments

PubMed Central

Feltus, F. Alex; Wan, Jun; Schulze, Stefan R.; Estill, James C.; Jiang, Ning; Paterson, Andrew H.

2004-01-01

Dense coverage of the rice genome with polymorphic DNA markers is an invaluable tool for DNA marker-assisted breeding, positional cloning, and a wide range of evolutionary studies. We have aligned drafts of two rice subspecies, indica and japonica, and analyzed levels and patterns of genetic diversity. After filtering multiple copy and low quality sequence, 408,898 candidate DNA polymorphisms (SNPs/INDELs) were discerned between the two subspecies. These filters have the consequence that our data set includes only a subset of the available SNPs (in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles) but increase the likelihood that this subset is useful: Direct sequencing suggests that 79.8% ± 7.5% of the in silico SNPs are real. The SNP sample in our database is not randomly distributed across the genome. In fact, 566 rice genomic regions had unusually high (328 contigs/48.6 Mb/13.6% of genome) or low (237 contigs/64.7 Mb/18.1% of genome) polymorphism rates. Many SNP-poor regions were substantially longer than most SNP-rich regions, covering up to 4 Mb, and possibly reflecting introgression between the respective gene pools that may have occurred hundreds of years ago. Although 46.2% ± 8.3% of the SNPs differentiate other pairs of japonica and indica genotypes, SNP rates in rice were not predictive of evolutionary rates for corresponding genes in another grass species, sorghum. The data set is freely available at http://www.plantgenome.uga.edu/snp. PMID:15342564

Polymorphisms and pharmacogenomics for the toxicity of methotrexate monotherapy in patients with rheumatoid arthritis

PubMed Central

Qiu, Qi; Huang, Jing; Lin, Yang; Shu, Xiaoming; Fan, Huizheng; Tu, Zhihua; Zhou, Youwen; Xiao, Cheng

2017-01-01

Abstract Background: Methotrexate (MTX) is widely used and considered a first-line disease modifying antirheumatic drug (DMARD) for the treatment of rheumatoid arthritis (RA). However, 10% to 30% of patients discontinue therapy within a year of starting the treatment, usually because of undesirable side effects. Many of the relevant genes have been investigated to estimate the association between gene polymorphisms and MTX toxicity in RA patients, although inconsistent results have been reported. Methods: We searched EMBASE and PubMed in February 2016 for polymorphisms and pharmacogenomics study of the toxicity of MTX monotherapy in RA patients. The meta-analysis was stratified by whether genetic variants associated with MTX toxicity. Results: A total of 42 publications that included 28 genes with 88 gene SNPs associated with the transporters, enzymes, and metabolites of MTX or the progression of RA were included in the SR, and 31 studies were included in 7 meta-analyses. The meta-analysis showed a significant association between the toxicity of MTX and the RFC-1 80G > A (rs1051266) polymorphism in the European RA patients. Conclusion: RFC-1 80G > A (rs1051266) polymorphism was associated with MTX toxicity, and larger and more stringent study designs may provide more accurate results for the effect of these SNPs on the MTX toxicity. PMID:28296761

Genetic polymorphisms associated with breast cancer in malaysian cohort.

PubMed

Chahil, Jagdish Kaur; Munretnam, Khamsigan; Samsudin, Nurulhafizah; Lye, Say Hean; Hashim, Nikman Adli Nor; Ramzi, Nurul Hanis; Velapasamy, Sharmila; Wee, Ler Lian; Alex, Livy

2015-04-01

Genome-wide association studies have discovered multiple single nucleotide polymorphisms (SNPs) associated with the risk of common diseases. The objective of this study was to demonstrate the replication of previously published SNPs that showed statistical significance for breast cancer in the Malaysian population. In this case-control study, 80 subjects for each group were recruited from various hospitals in Malaysia. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. A total of three SNPs were found to be associated with increased risk of breast cancer while six SNPs showed protective effect. All nine were statistically significant SNPs (p ≤ 0.01), five SNPs from previous studies were successfully replicated in our study. Significant modifiable (diet) and non-modifiable (family history of breast cancer in first degree relative) risk factors were also observed. We identified nine SNPs from this study to be either conferring susceptibility or protection to breast cancer which may serve as potential markers in risk prediction.

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

Genomic variation at the tips of the adaptive radiation of Darwin's finches.

PubMed

Chaves, Jaime A; Cooper, Elizabeth A; Hendry, Andrew P; Podos, Jeffrey; De León, Luis F; Raeymaekers, Joost A M; MacMillan, W Owen; Uy, J Albert C

2016-11-01

Adaptive radiation unfolds as selection acts on the genetic variation underlying functional traits. The nature of this variation can be revealed by studying the tips of an ongoing adaptive radiation. We studied genomic variation at the tips of the Darwin's finch radiation; specifically focusing on polymorphism within, and variation among, three sympatric species of the genus Geospiza. Using restriction site-associated DNA (RAD-seq), we characterized 32 569 single-nucleotide polymorphisms (SNPs), from which 11 outlier SNPs for beak and body size were uncovered by a genomewide association study (GWAS). Principal component analysis revealed that these 11 SNPs formed four statistically linked groups. Stepwise regression then revealed that the first PC score, which included 6 of the 11 top SNPs, explained over 80% of the variation in beak size, suggesting that selection on these traits influences multiple correlated loci. The two SNPs most strongly associated with beak size were near genes associated with beak morphology across deeper branches of the radiation: delta-like 1 homologue (DLK1) and high-mobility group AT-hook 2 (HMGA2). Our results suggest that (i) key adaptive traits are associated with a small fraction of the genome (11 of 32 569 SNPs), (ii) SNPs linked to the candidate genes are dispersed throughout the genome (on several chromosomes), and (iii) micro- and macro-evolutionary variation (roots and tips of the radiation) involve some shared and some unique genomic regions. © 2016 John Wiley & Sons Ltd.

Design of a 9K illumina BeadChip for polar bears (Ursus maritimus) from RAD and transcriptome sequencing.

PubMed

Malenfant, René M; Coltman, David W; Davis, Corey S

2015-05-01

Single-nucleotide polymorphisms (SNPs) offer numerous advantages over anonymous markers such as microsatellites, including improved estimation of population parameters, finer-scale resolution of population structure and more precise genomic dissection of quantitative traits. However, many SNPs are needed to equal the resolution of a single microsatellite, and reliable large-scale genotyping of SNPs remains a challenge in nonmodel species. Here, we document the creation of a 9K Illumina Infinium BeadChip for polar bears (Ursus maritimus), which will be used to investigate: (i) the fine-scale population structure among Canadian polar bears and (ii) the genomic architecture of phenotypic traits in the Western Hudson Bay subpopulation. To this end, we used restriction-site associated DNA (RAD) sequencing from 38 bears across their circumpolar range, as well as blood/fat transcriptome sequencing of 10 individuals from Western Hudson Bay. Six-thousand RAD SNPs and 3000 transcriptomic SNPs were selected for the chip, based primarily on genomic spacing and gene function respectively. Of the 9000 SNPs ordered from Illumina, 8042 were successfully printed, and - after genotyping 1450 polar bears - 5441 of these SNPs were found to be well clustered and polymorphic. Using this array, we show rapid linkage disequilibrium decay among polar bears, we demonstrate that in a subsample of 78 individuals, our SNPs detect known genetic structure more clearly than 24 microsatellites genotyped for the same individuals and that these results are not driven by the SNP ascertainment scheme. Here, we present one of the first large-scale genotyping resources designed for a threatened species. © 2014 John Wiley & Sons Ltd.

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

PubMed Central

Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

2013-01-01

Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

Apolipoprotein gene involved in lipid metabolism

DOEpatents

Rubin, Edward [Berkeley, CA; Pennacchio, Len A [Sebastopol, CA

2007-07-03

Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.

No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

PubMed Central

Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-01-01

Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

PubMed

Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-06-16

Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

Two novel polymorphisms of bovine SIRT2 gene are associated with higher body weight in Nanyang cattle.

PubMed

Sun, Xiaomei; Li, Mingxun; Hao, Dan; Hua, Liushuai; Lan, Xianyong; Lei, Chuzhao; Hu, Shenrong; Qi, Xinglei; Chen, Hong

2015-03-01

Identification of polymorphisms associated with economic traits is important for successful marker-assisted selection in cattle breeding. The family of mammalian sirtuin regulates many biological functions, such as life span extension and energy metabolism. SIRT2, a most abundant sirtuin in adipocytes, acts as a crucial regulator of adipogenic differentiation and plays a key role in controlling adipose tissue function and mass. Here we investigated single nucleotide polymorphisms (SNPs) of bovine SIRT2 in 1226 cattle from five breeds and further evaluated the effects of identified SNPs on economically important traits of Nanyang cattle. Our results revealed four novel SNPs in bovine SIRT2, one was located in intronic region and the other three were synonymous mutations. Linkage disequilibrium and haplotype analyses based on the identified SNPs showed obvious difference between crossbred breed and the other four beef breeds. Association analyses demonstrated that SNPs g.17333C > T and g.17578A > G have a significantly effect on 18-months-old body weight of Nanyang population. Animals with combined genotype TTGG at the above two loci exhibited especially higher body weight. Our data for the first time demonstrated that polymorphisms in bovine SIRT2 are associated with economic traits of Nanyang cattle, which will be helpful for future cattle selection practices.

Neuropeptide Y gene-by-psychosocial stress interaction effect is associated with obesity in a Korean population.

PubMed

Kim, Hyun-Jin; Min, Kyoung-Bok; Min, Jin-Young

2016-07-01

Chronic psychosocial stress is a crucial risk factor in the development of many diseases including obesity. Neuropeptide Y (NPY), distributed throughout the peripheral and central nervous system, is believed to pay a role in the pathophysiologic relationship between stress and obesity. Although several animal studies have investigated the impact on obesity of interactions between NPY single nucleotide polymorphisms (SNPs) and stress, the same remains to be analyzed in humans. To identify NPY gene-by-stress interaction effects on human obesity, we analyzed the interaction between four NPY SNPs and stress with obesity-related traits, including visceral adipose tissue (VAT). A total of 1468 adult subjects were included for this analysis. In a SNP-only model without interaction with stress, no significant SNPs were found (pSNP>0.05). However, NPY SNPs-by-stress interaction effects were significantly linked to body mass index (BMI), waist circumference, and VAT (pint<0.05), even though a significant interaction effect for rs16135 on BMI was not identified. These significant interaction effects were also detected in interaction results for the binary traits of obesity. Among the obesity traits, mean changes of VAT by increased stress levels in homozygous risk allele carriers were the greatest (range of mean increases for four SNPs (min-max)=12.57cm(2)-29.86cm(2)). This study suggests that common polymorphisms for NPY were associated with human obesity by interacting with psychosocial stress, emphasizing the need for stress management in obesity prevention. Copyright © 2016 Elsevier Ltd. All rights reserved.

Polymorphisms of clip domain serine proteinase and serine proteinase homolog in the swimming crab Portunus trituberculatus and their association with Vibrio alginolyticus

NASA Astrophysics Data System (ADS)

Liu, Meng; Liu, Yuan; Hui, Min; Song, Chengwen; Cui, Zhaoxia

2017-03-01

Clip domain serine proteases (cSPs) and their homologs (SPHs) play an important role in various biological processes that are essential components of extracellular signaling cascades, especially in the innate immune responses of invertebrates. Here, polymorphisms of PtcSP and PtSPH from the swimming crab Portunus trituberculatus were investigated to explore their association with resistance/susceptibility to Vibrio alginolyticus. Polymorphic loci were identified using Clustal X, and characterized with SPSS 16.0 software, and then the significance of genotype and allele frequencies between resistant and susceptible stocks was determined by a χ 2 test. A total of 109 and 77 single nucleotide polymorphisms (SNPs) were identified in the genomic fragments of PtcSP and PtSPH, respectively. Notably, nearly half of PtSPH polymorphisms were found in the non-coding exon 1. Fourteen SNPs investigated were significantly associated with susceptibility/resistance to V. alginolyticus ( P <0.05). Among them, eight SNPs were observed in introns, and one synonymous, four non-synonymous SNPs and one ins-del were found in coding exons. In addition, five simple sequence repeats (SSRs) were detected in intron 3 of PtcSP. Although there was no statistically significant difference of allele frequencies, the SSRs showed different polymorphic alleles on the basis of the repeat number between resistant and susceptible stocks. After further validation, polymorphisms investigated here might be applied to select potential molecular markers of P. trituberculatus with resistance to V. alginolyticus.

The Associations between RNA Splicing Complex Gene SF3A1 Polymorphisms and Colorectal Cancer Risk in a Chinese Population.

PubMed

Chen, Xiaohua; Du, Hua; Liu, Binjian; Zou, Li; Chen, Wei; Yang, Yang; Zhu, Ying; Gong, Yajie; Tian, Jianbo; Li, Feng; Zhong, Shan

2015-01-01

Aberrant alternative splicing included alterations in components of the mRNA splicing machinery often occurred in colon cancer. However, the role of SF3A1, one key component of the mRNA splicing machinery, on colorectal cancer (CRC) risk was still not elucidated. We performed a hospital-based case-control study containing 801 CRC patients and 817 cancer-free controls to examine the association between SF3A1 polymorphisms and CRC risk in a Chinese population. Four candidate SNPs (rs10376, rs5753073, rs2839998 and rs2074733) were selected based on bioinformatics analysis and previous findings. The results showed no significant associations between these SNPs and CRC risk (P > 0.05). Besides, the stratified analysis based on the smoking and alcohol use status obtained no statistically significant results. Our study was the first one to investigate the association between SF3A1 polymorphisms and CRC risk. The results suggested these four SNPs in SF3A1 were not associated with CRC risk in a Chinese population, however, further more studies are needed to confirm our findings.

Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

PubMed Central

Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

2009-01-01

Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

Genetic polymorphisms to predict gains in maximal O2 uptake and knee peak torque after a high intensity training program in humans.

PubMed

Yoo, Jinho; Kim, Bo-Hyung; Kim, Soo-Hwan; Kim, Yangseok; Yim, Sung-Vin

2016-05-01

The study aimed to identify single nucleotide polymorphisms (SNPs) that significantly influenced the level of improvement of two kinds of training responses, including maximal O2 uptake (V'O2max) and knee peak torque of healthy adults participating in the high intensity training (HIT) program. The study also aimed to use these SNPs to develop prediction models for individual training responses. 79 Healthy volunteers participated in the HIT program. A genome-wide association study, based on 2,391,739 SNPs, was performed to identify SNPs that were significantly associated with gains in V'O2max and knee peak torque, following 9 weeks of the HIT program. To predict two training responses, two independent SNPs sets were determined using linear regression and iterative binary logistic regression analysis. False discovery rate analysis and permutation tests were performed to avoid false-positive findings. To predict gains in V'O2max, 7 SNPs were identified. These SNPs accounted for 26.0 % of the variance in the increment of V'O2max, and discriminated the subjects into three subgroups, non-responders, medium responders, and high responders, with prediction accuracy of 86.1 %. For the knee peak torque, 6 SNPs were identified, and accounted for 27.5 % of the variance in the increment of knee peak torque. The prediction accuracy discriminating the subjects into the three subgroups was estimated as 77.2 %. Novel SNPs found in this study could explain, and predict inter-individual variability in gains of V'O2max, and knee peak torque. Furthermore, with these genetic markers, a methodology suggested in this study provides a sound approach for the personalized training program.

Relationship of the MTHFD1 (rs2236225), eNOS (rs1799983), CBS (rs2850144) and ACE (rs4343) gene polymorphisms in a population of Iranian pediatric patients with congenital heart defects.

PubMed

Khatami, Mehri; Ratki, Farzaneh Morteza; Tajfar, Saba; Akrami, Fatemeh

2017-09-01

Congenital heart defects are structural cardiovascular malformations that arise from abnormal formation of the heart or major blood vessels during the fetal period. To investigate the association of 4 single nucleotide polymorphisms (SNPs) in the MTHFD1, eNOS, CBS and ACE genes, we evaluated their relationship with CHD in Iranian patients. In this case-control study, a total of 102 children with CHD and 98 control children were enrolled. Four SNPs including MTHFD1 G1958A, eNOS G894T, CBS C-4673G and ACE A2350G were genotyped by PCR-SSCP, Multiplex ARMS PCR and PCR-RFLP methods and confirmed by direct sequencing. We genotyped 102 patients and 98 controls for four polymorphisms by statistically analysis. There were three SNPs including MTHFD1 G1958A, eNOS G894T and ACE A2350G which might increase the risk of CHD, but CBS C-4673G was not significantly different between patients and controls. (P = 0.017, P = 0.048, P = 0.025 and P = 0.081 respectively). The allele frequencies of three SNPs for MTHFD1 G1958A, eNOS G894T and ACE A2350G in CHD are higher than that in control. Our results show that there is a significant relationship between MTHFD1 G1958A, eNOS G894T and ACE A2350G polymorphisms with CHD. Therefore, The AA and GA genotypes of MTHFD1 G1958A, TT and GT genotypes of eNOS G894T and the AA and GA genotypes of ACE A2350G are susceptible factors for CHD and may increase the risk of CHD. Copyright © 2017. Published by Elsevier Taiwan.

Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

PubMed

Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

2015-11-14

Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.

High resolution melting analysis is a more sensitive and effective alternative to gel-based platforms in analysis of SSR--an example in citrus.

PubMed

Distefano, Gaetano; Caruso, Marco; La Malfa, Stefano; Gentile, Alessandra; Wu, Shu-Biao

2012-01-01

High resolution melting curve analysis (HRM) has been used as an efficient, accurate and cost-effective tool to detect single nucleotide polymorphisms (SNPs) or insertions or deletions (INDELs). However, its efficiency, accuracy and applicability to discriminate microsatellite polymorphism have not been extensively assessed. The traditional protocols used for SSR genotyping include PCR amplification of the DNA fragment and the separation of the fragments on electrophoresis-based platform. However, post-PCR handling processes are laborious and costly. Furthermore, SNPs present in the sequences flanking repeat motif cannot be detected by polyacrylamide-gel-electrophoresis based methods. In the present study, we compared the discriminating power of HRM with the traditional electrophoresis-based methods and provided a panel of primers for HRM genotyping in Citrus. The results showed that sixteen SSR markers produced distinct polymorphic melting curves among the Citrus spp investigated through HRM analysis. Among those, 10 showed more genotypes by HRM analysis than capillary electrophoresis owing to the presence of SNPs in the amplicons. For the SSR markers without SNPs present in the flanking region, HRM also gave distinct melting curves which detected same genotypes as were shown in capillary electrophoresis (CE) analysis. Moreover, HRM analysis allowed the discrimination of most of the 15 citrus genotypes and the resulting genetic distance analysis clustered them into three main branches. In conclusion, it has been approved that HRM is not only an efficient and cost-effective alternative of electrophoresis-based method for SSR markers, but also a method to uncover more polymorphisms contributed by SNPs present in SSRs. It was therefore suggested that the panel of SSR markers could be used in a variety of applications in the citrus biodiversity and breeding programs using HRM analysis. Furthermore, we speculate that the HRM analysis can be employed to analyse SSR markers in a wide range of applications in all other species.

Association of μ-Calpain and Calpastatin Polymorphisms with Meat Tenderness in a Brahman–Angus Population

PubMed Central

Leal-Gutiérrez, Joel D.; Elzo, Mauricio A.; Johnson, Dwain D.; Scheffler, Tracy L.; Scheffler, Jason M.; Mateescu, Raluca G.

2018-01-01

Autogenous proteolytic enzymes of the calpain family are implicated in myofibrillar protein degradation. As a result, the μ-calpain gene and its specific inhibitor, calpastatin, have been repeatedly investigated for their association with meat quality traits in cattle; however, no functional mutation has been identified for these two genes. The objectives of this study were: (1) to assess breed composition effect on tenderness; (2) to perform a linkage disequilibrium (LD) analysis in μ-calpain and calpastatin genes as well as an association analyses with tenderness; and (3) to analyze putative functional SNPs inside the significant LD block for an effect on tenderness. Tenderness measurements and genotypes for 16 SNPs in μ-calpain gene and 28 SNPs in calpastatin gene from 673 steers were analyzed. A bioinformatic analysis identified “putative functional SNPs” inside the associated LD block – polymorphisms able to produce a physical and/or chemical change in the DNA, mRNA, or translated protein in silico. Breed composition had a significant (P < 0.0001) effect on tenderness where animals with more than 80% Angus composition had the most tender meat. One 11-kb LD-block and three LD-blocks of 37, 17, and 14 kb in length were identified in the μ-calpain and calpastatin genes, respectively. Out of these, the LD-block 3 in calpastatin, tagged by SNPs located at 7-98566391 and 7-98581038, had a significant effect on tenderness with the TG-CG diplotype being approximately 1 kg more tender than the toughest diplotype, TG-CG. A total of 768 SNPs in the LD-block 3 of calpastatin were included in the bioinformatic analysis, and 28 markers were selected as putative functional SNPs inside the LD-block 3 of calpastatin; however, none of them were polymorphic in this population. Out of 15 initial polymorphisms segregating inside the LD-block 3 of calpastatin in this population, markers ARSUSMARC116, Cast5, rs730723459, and rs210861835 were found to be significantly associated with tenderness. PMID:29520298

Pharmacogenetic screening for polymorphisms in drug-metabolizing enzymes and drug transporters in a Dutch population.

PubMed

Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H

2006-01-01

A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.

Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle

PubMed Central

2013-01-01

Background Identification of single nucleotide polymorphisms (SNPs) for specific genes involved in reproduction might improve reliability of genomic estimates for these low-heritability traits. Semen from 550 Holstein bulls of high (≥ 1.7; n = 288) or low (≤ −2; n = 262) daughter pregnancy rate (DPR) was genotyped for 434 candidate SNPs using the Sequenom MassARRAY® system. Three types of SNPs were evaluated: SNPs previously reported to be associated with reproductive traits or physically close to genetic markers for reproduction, SNPs in genes that are well known to be involved in reproductive processes, and SNPs in genes that are differentially expressed between physiological conditions in a variety of tissues associated in reproductive function. Eleven reproduction and production traits were analyzed. Results A total of 40 SNPs were associated (P < 0.05) with DPR. Among these were genes involved in the endocrine system, cell signaling, immune function and inhibition of apoptosis. A total of 10 genes were regulated by estradiol. In addition, 22 SNPs were associated with heifer conception rate, 33 with cow conception rate, 36 with productive life, 34 with net merit, 23 with milk yield, 19 with fat yield, 13 with fat percent, 19 with protein yield, 22 with protein percent, and 13 with somatic cell score. The allele substitution effect for SNPs associated with heifer conception rate, cow conception rate, productive life and net merit were in the same direction as for DPR. Allele substitution effects for several SNPs associated with production traits were in the opposite direction as DPR. Nonetheless, there were 29 SNPs associated with DPR that were not negatively associated with production traits. Conclusion SNPs in a total of 40 genes associated with DPR were identified as well as SNPs for other traits. It might be feasible to include these SNPs into genomic tests of reproduction and other traits. The genes associated with DPR are likely to be important for understanding the physiology of reproduction. Given the large number of SNPs associated with DPR that were not negatively associated with production traits, it should be possible to select for DPR without compromising production. PMID:23759029

Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene.

PubMed

Piva, Francesco; Giulietti, Matteo; Baldelli, Luisa; Nardi, Bernardo; Bellantuono, Cesario; Armeni, Tatiana; Saccucci, Franca; Principato, Giovanni

2011-08-01

Single nucleotide polymorphisms (SNPs) in serotonin related genes influence mental disorders, responses to pharmacological and psychotherapeutic treatments. In planning association studies, researchers that want to investigate new SNPs have to select some among a large number of candidates. Our aim is to guide researchers in the selection of the most likely phenotype affecting polymorphisms. Here, we studied serotonin receptor 2C (HTR2C) SNPs because, till now, only relatively few of about 2000 are investigated. We used the most updated and assessed bioinformatic tools to predict which variations can give rise to biological effects among 2450 HTR2C SNPs. We suggest 48 SNPs that are worth considering in future association studies in the field of psychiatry, psychology and pharmacogenomics. Moreover, our analyses point out the biological level probably affected, such as transcription, splicing, miRNA regulation and protein structure, thus allowing to suggest future molecular investigations. Although few association studies are available in literature, their results are in agreement with our predictions, showing that our selection methods can help to guide future association studies. Copyright © 2011 John Wiley & Sons, Ltd.

Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar).

PubMed

Houston, Ross D; Taggart, John B; Cézard, Timothé; Bekaert, Michaël; Lowe, Natalie R; Downing, Alison; Talbot, Richard; Bishop, Stephen C; Archibald, Alan L; Bron, James E; Penman, David J; Davassi, Alessandro; Brew, Fiona; Tinch, Alan E; Gharbi, Karim; Hamilton, Alastair

2014-02-06

Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in salmonids and in aquaculture breeding programs via genomic selection.

Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar)

PubMed Central

2014-01-01

Background Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. Results SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. Conclusions This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in salmonids and in aquaculture breeding programs via genomic selection. PMID:24524230

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study.

PubMed

Orlow, Irene; Reiner, Anne S; Thomas, Nancy E; Roy, Pampa; Kanetsky, Peter A; Luo, Li; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B; Anton-Culver, Hoda; Gallagher, Richard P; Dwyer, Terence; Busam, Klaus; Begg, Colin B; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study

PubMed Central

Orlow, Irene; Reiner, Anne S.; Thomas, Nancy E.; Roy, Pampa; Kanetsky, Peter A.; Luo, Li; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B.; Anton-Culver, Hoda; Gallagher, Richard P.; Dwyer, Terence; Busam, Klaus; Begg, Colin B.; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. PMID:26521212

ErbB polymorphisms: insights and implications for response to targeted cancer therapeutics.

PubMed

Alaoui-Jamali, Moulay A; Morand, Grégoire B; da Silva, Sabrina Daniela

2015-01-01

Advances in high-throughput genomic-scanning have expanded the repertory of genetic variations in DNA sequences encoding ErbB tyrosine kinase receptors in humans, including single nucleotide polymorphisms (SNPs), polymorphic repetitive elements, microsatellite variations, small-scale insertions and deletions. The ErbB family members: EGFR, ErbB2, ErbB3, and ErbB4 receptors are established as drivers of many aspects of tumor initiation and progression to metastasis. This knowledge has provided rationales for the development of an arsenal of anti-ErbB therapeutics, ranging from small molecule kinase inhibitors to monoclonal antibodies. Anti-ErbB agents are becoming the cornerstone therapeutics for the management of cancers that overexpress hyperactive variants of ErbB receptors, in particular ErbB2-positive breast cancer and non-small cell lung carcinomas. However, their clinical benefit has been limited to a subset of patients due to a wide heterogeneity in drug response despite the expression of the ErbB targets, attributed to intrinsic (primary) and to acquired (secondary) resistance. Somatic mutations in ErbB tyrosine kinase domains have been extensively investigated in preclinical and clinical setting as determinants for either high sensitivity or resistance to anti-ErbB therapeutics. In contrast, only scant information is available on the impact of SNPs, which are widespread in genes encoding ErbB receptors, on receptor structure and activity, and their predictive values for drug susceptibility. This review aims to briefly update polymorphic variations in genes encoding ErbB receptors based on recent advances in deep sequencing technologies, and to address challenging issues for a better understanding of the functional impact of single versus combined SNPs in ErbB genes to receptor topology, receptor-drug interaction, and drug susceptibility. The potential of exploiting SNPs in the era of stratified targeted therapeutics is discussed.

GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

PubMed

Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

2012-05-01

We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.

PubMed

Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao

2017-02-07

Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.

Association of Toll-like receptor 3 and Toll-like receptor 9 single-nucleotide polymorphisms with hepatitis C virus persistence among Egyptians.

PubMed

Hamdy, Shaimaa; Osman, Ahmed M; Zakaria, Zainab A; Galal, Iman; Sobhy, Maha; Hashem, Mohamed; Allam, Walaa R; Abdel-Samiee, Mohamed; Rewisha, Eman; Waked, Imam; Abdelwahab, Sayed F

2018-06-02

Toll-like receptors (TLRs) give the innate immune system a considerable specificity for a large range of pathogens. TLR3 detects dsRNA of viruses while TLR9 recognizes bacterial and viral unmethylated CpG motifs. This study examined whether there is a potential association between single-nucleotide polymorphisms (SNPs) in the TLR3.rs3775290 (c.1377C/T), TLR9.rs5743836 (-1237T→C) and TLR9.rs352140 (G2848A) genes and HCV infection among Egyptian patients and healthcare workers (HCWs). We enrolled 546 subjects (409 HCWs and 137 patients) divided into four groups: group 1 included 265 seronegative, aviremic subjects; group 2 included 25 seronegative, viremic subjects; group 3 included 87 subjects with spontaneously resolved HCV infection; and group 4 included 169 chronic HCV patients. All subjects were genotyped for TLR3.rs3775290, TLR9.rs5743836 and TLR9.rs352140 SNPs by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis. TLR3.rs3775290 "CC" genotype was associated with chronic HCV infection, where there was a significantly greater frequency of this genotype among chronic patients when compared to subjects with spontaneously resolved infection (63.9% vs. 51.9%; p = 0.033; OR = 1.639 and 95% CI = 0.94-2.84). However, this SNP did not correlate with the HCV RNA load among the chronic subjects (p > 0.05). There was no significant difference in TLR9.rs5743836 and TLR9.rs352140 genotype distribution between groups (p > 0.05). Lack of association between the three SNPs was found, as the three SNPs are located on two different chromosomes. In conclusion, the TLR3.rs3775290 "CC" genotype was associated with HCV chronicity, while the TLR9 gene may not play a major role in HCV infection.

Genetic alterations within TLR genes in development of Toxoplasma gondii infection among Polish pregnant women.

PubMed

Wujcicka, Wioletta; Wilczyński, Jan; Nowakowska, Dorota

2017-09-01

The research was conducted to evaluate the role of genotypes, haplotypes and multiple-SNP variants in the range of TLR2, TLR4 and TLR9 single nucleotide polymorphisms (SNPs) in the development of Toxoplasma gondii infection among Polish pregnant women. The study was performed for 116 Polish pregnant women, including 51 patients infected with T. gondii, and 65 age-matched control pregnant individuals. Genotypes in TLR2 2258 G>A, TLR4 896 A>G, TLR4 1196 C>T and TLR9 2848 G>A SNPs were estimated by self-designed, nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in the studied polymorphisms, were confirmed by sequencing. All the genotypes were calculated for Hardy-Weinberg (H-W) equilibrium and TLR4 variants were tested for linkage disequilibrium. Relationships were assessed between alleles, genotypes, haplotypes or multiple-SNP variants in TLR polymorphisms and the occurrence of T. gondii infection in pregnant women, using a logistic regression model. All the analyzed genotypes preserved the H-W equilibrium among the studied groups of patients (P>0.050). Similar distribution of distinct alleles and individual genotypes in TLR SNPs, as well as of haplotypes in TLR4 polymorphisms, were observed in T. gondii infected and control uninfected pregnant women. However, the GACG multiple-SNP variant, within the range of all the four studied polymorphisms, was correlated with a decreased risk of the parasitic infection (OR 0.52, 95% CI 0.28-0.97; P≤0.050). The polymorphisms, located within TLR2, TLR4 and TLR9 genes, may be involved together in occurrence of T. gondii infection among Polish pregnant women. Copyright © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.

Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

PubMed Central

Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

2006-01-01

Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

PubMed

Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

2005-09-01

Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

PubMed

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-11-20

BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

PubMed Central

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-01-01

Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

SNPs of bovine HGF gene and their association with growth traits in Nanyang cattle.

PubMed

Cai, Hanfang; Lan, Xianyong; Li, Aimin; Zhou, Yang; Sun, Jiajie; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

2013-10-01

Hepatocyte growth factor (HGF) is one of the multifunctional cell factors that regulates cellular proliferation, motility and morphogenesis in mammalians. And its medical research has deep significance. In this paper, polymorphisms of HGF gene were investigated in 1433 health and irrelated Chinese cattle by PCR-RFLP and DNA sequencing approach. Ten novel Single nucleotide polymorphisms (SNPs) were identified, which included one missense mutation, g.72801G>A in the coding region, and the others in the intron. Association analysis between four of them, g.288T>C, g.72801G>A, g.77172G>T, and g.77408T>G, and growth traits in Nanyang, were performed. The results indicated that SNPs within bovine HGF gene were significantly associated with growth traits. Phylogenetic analysis showed that the genetic background of Caoyuan Red cattle was different from the others in the tested breeds. The findings will provide a background for application of bovine HGF gene in the selection program in Chinese cattle. Copyright © 2013 Elsevier Ltd. All rights reserved.

Type 2 diabetes (T2D) associated polymorphisms regulate expression of adjacent transcripts in transformed lymphocytes, adipose, and muscle from Caucasian and African-American subjects.

PubMed

Sharma, Neeraj K; Langberg, Kurt A; Mondal, Ashis K; Elbein, Steven C; Das, Swapan K

2011-02-01

Genome-wide association scans (GWAS) have identified novel single nucleotide polymorphisms (SNPs) that increase T2D susceptibility and indicated the role of nearby genes in T2D pathogenesis. We hypothesized that T2D-associated SNPs act as cis-regulators of nearby genes in human tissues and that expression of these transcripts may correlate with metabolic traits, including insulin sensitivity (S(I)). Association of SNPs with the expression of their nearest transcripts was tested in adipose and muscle from 168 healthy individuals who spanned a broad range of S(I) and body mass index (BMI) and in transformed lymphocytes (TLs). We tested correlations between the expression of these transcripts in adipose and muscle with metabolic traits. Utilizing allelic expression imbalance (AEI) analysis we examined the presence of other cis-regulators for those transcripts in TLs. SNP rs9472138 was significantly (P = 0.037) associated with the expression of VEGFA in TLs while rs6698181 was detected as a cis-regulator for the PKN2 in muscle (P = 0.00027) and adipose (P = 0.018). Significant association was also observed for rs17036101 (P = 0.001) with expression of SYN2 in adipose of Caucasians. Among 19 GWAS-implicated transcripts, expression of VEGFA in adipose was correlated with BMI (r = -0.305) and S(I) (r = 0.230). Although only a minority of the T2D-associated SNPs were validated as cis-eQTLs for nearby transcripts, AEI analysis indicated presence of other cis-regulatory polymorphisms in 54% of these transcripts. Our study suggests that a small subset of GWAS-identified SNPs may increase T2D susceptibility by modulating expression of nearby transcripts in adipose or muscle.

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Qijian; Jia, Gaofeng; Hyten, David L.

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE PAGES

Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean.

PubMed

Song, Qijian; Jia, Gaofeng; Hyten, David L; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G; Osorno, Juan M; Schmutz, Jeremy; Jackson, Scott A; McClean, Phillip E; Cregan, Perry B

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. Copyright © 2015 Song et al.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Polymorphisms in MicroRNA Genes And Genes Involving in NMDAR Signaling and Schizophrenia: A Case-Control Study in Chinese Han Population.

PubMed

Zhang, Yanxia; Fan, Mei; Wang, Qingzhong; He, Guang; Fu, Yingmei; Li, Huafang; Yu, Shunying

2015-08-10

Disturbances in glutamate signaling caused by disruption of N-methyl-D-aspartate-type glutamate receptor (NMDAR) have been implicated in schizophrenia. Findings suggested that miR-219, miR-132 and miR-107 could involve in NMDAR signaling by influencing the expression of pathway genes or the signaling transmission and single nucleotide polymorphisms (SNPs) within miRNA genes or miRNA target sites could result in their functional changes. Therefore, we hypothesized that SNPs in miRNAs and/or their target sites were associated with schizophrenia. 3 SNPs in hsa-pri-miR-219/132/107 and 6 SNPs in 3'UTRs of GRIN2A/2B/3A and CAMK2G were selected and genotyped in a case-control study of 1041 schizophrenia cases and 953 healthy controls in Chinese Han population. In the present study, GRIN2B rs890 showed significant associations with schizophrenia. Further functional analyses showed that the rs890 variant C allele led to significantly lower luciferase activity, compared with the A allele. MDR analysis showed that a 4-locus model including rs107822, rs2306327, rs890 and rs12342026 was the best model. These findings suggest that GRIN2B may be associated with schizophrenia and interaction effects of the polymorphisms in hsa-miR-219, CAKM2G, GRIN2B and GRIN3A may confer susceptibility to schizophrenia in the Chinese Han population.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.

PubMed

Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej

2005-06-15

The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.

A survey of genome-wide single nucleotide polymorphisms through genome resequencing in the Périgord black truffle (Tuber melanosporum Vittad.).

PubMed

Payen, Thibaut; Murat, Claude; Gigant, Anaïs; Morin, Emmanuelle; De Mita, Stéphane; Martin, Francis

2015-09-01

The Périgord black truffle (Tuber melanosporum Vittad.), considered a gastronomic delicacy worldwide, is an ectomycorrhizal filamentous fungus that is ecologically important in Mediterranean French, Italian and Spanish woodlands. In this study, we developed a novel resource of single nucleotide polymorphisms (SNPs) for T. melanosporum using Illumina high-throughput resequencing. The genome from six T. melanosporum geographical accessions was sequenced to a depth of approximately 20×. These geographical accessions were selected from different populations within the northern and southern regions of the geographical species distribution. Approximately 80% of the reads for each of the six resequenced geographical accessions mapped against the reference T. melanosporum genome assembly, estimating the core genome size of this organism to be approximately 110 Mbp. A total of 442 326 SNPs corresponding to 3540 SNPs/Mbps were identified as being included in all seven genomes. The SNPs occurred more frequently in repeated sequences (85%), although 4501 SNPs were also identified in the coding regions of 2587 genes. Using the ratio of nonsynonymous mutations per nonsynonymous site (pN) to synonymous mutations per synonymous site (pS) and Tajima's D index scanning the whole genome, we were able to identify genomic regions and genes potentially subjected to positive or purifying selection. The SNPs identified represent a valuable resource for future population genetics and genomics studies. © 2015 John Wiley & Sons Ltd.

Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

PubMed

Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

2014-07-01

The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

USDA-ARS?s Scientific Manuscript database

The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

PubMed

Hughes, Austin L

2013-02-15

The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

Association of twelve polymorphisms in three onco-lncRNA genes with hepatocellular cancer risk and prognosis: A case-control study

PubMed Central

Wang, Ben-Gang; Xu, Qian; Lv, Zhi; Fang, Xin-Xin; Ding, Han-Xi; Wen, Jing; Yuan, Yuan

2018-01-01

AIM To evaluate the association of 12 tag single nucleotide polymorphisms (tagSNPs) in three onco-long non-coding RNA (lncRNA) genes (HOTTIP, CCAT2, MALAT1) with the risk and prognosis of hepatocellular cancer (HCC). METHODS Twelve tagSNPs covering the three onco-lncRNAs were genotyped by the KASP method in a total of 1338 samples, including 521 HCC patients and frequency-matched 817 controls. The samples were obtained from an unrelated Chinese population at the First Hospital of China Medical University from 2012-2015. The expression quantitative trait loci (eQTL) analyses were conducted to explore further the potential function of the promising SNPs. RESULTS Three SNPs in HOTTIP, one promoter SNP in MALAT1, and one haplotype of HOTTIP were associated with HCC risk. The HOTTIP rs17501292, rs2067087, and rs17427960 SNPs were increased to 1.55-, 1.20-, and 1.18-fold HCC risk under allelic models (P = 0.012, 0.017 and 0.049, respectively). MALAT1 rs4102217 SNP was increased to a 1.32-fold HCC risk under dominant models (P = 0.028). In addition, the two-way interaction of HOTTIP rs17501292-MALAT1 rs619586 polymorphisms showed a decreased effect on HCC risk (Pinteraction = 0.028, OR = 0.30) and epistasis with each other. HOTTIP rs3807598 variant genotype showed significantly longer survival time in HBV negative subgroup (P = 0.049, HR = 0.12), and MALAT1 rs591291 showed significantly better prognosis in female and HBV negative subgroups (P = 0.022, HR = 0.37; P = 0.042, HR = 0.25, respectively). In the study, no significant effect was observed in eQTL analysis. CONCLUSION Specific lncRNA (HOTTIP and MALAT1) SNPs have potential to be biomarkers for HCC risk and prognosis. PMID:29930469

Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

PubMed

Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan

2013-01-01

The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Association of Interleukin-1 gene clusters polymorphisms with primary open-angle glaucoma: a meta-analysis.

PubMed

Li, Junhua; Feng, Yifan; Sung, Mi Sun; Lee, Tae Hee; Park, Sang Woo

2017-11-28

Previous studies have associated the Interleukin-1 (IL-1) gene clusters polymorphisms with the risk of primary open-angle glaucoma (POAG). However, the results were not consistent. Here, we performed a meta-analysis to evaluate the role of IL-1 gene clusters polymorphisms in POAG susceptibility. PubMed, EMBASE and Cochrane Library (up to July 15, 2017) were searched by two independent investigators. All case-control studies investigating the association between single-nucleotide polymorphisms (SNPs) of IL-1 gene clusters and POAG risk were included. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated for quantifying the strength of association that has been involved in at least two studies. Five studies on IL-1β rs16944 (c. -511C > T) (1053 cases and 986 controls), 4 studies on IL-1α rs1800587 (c. -889C > T) (822 cases and 714 controls), and 4 studies on IL-1β rs1143634 (c. +3953C > T) (798 cases and 730 controls) were included. The results suggest that all three SNPs were not associated with POAG risk. Stratification analyses indicated that the rs1143634 has a suggestive associated with high tension glaucoma (HTG) under dominant (P = 0.03), heterozygote (P = 0.04) and allelic models (P = 0.02), however, the weak association was nullified after Bonferroni adjustments for multiple tests. Based on current meta-analysis, we indicated that there is lack of association between the three SNPs of IL-1 and POAG. However, this conclusion should be interpreted with caution and further well designed studies with large sample-size are required to validate the conclusion as low statistical powers.

Significant SNPs have limited prediction ability for thyroid cancer

PubMed Central

Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun

2014-01-01

Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304

Physiological Study on Association between Nicotinamide N-Methyltransferase Gene Polymorphisms and Hyperlipidemia

PubMed Central

Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong

2016-01-01

Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813

Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

PubMed

Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

2006-08-01

Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

Activating Transcription Factor 6 (ATF6) Sequence Polymorphisms in Type 2 Diabetes and Pre-Diabetic Traits

PubMed Central

Chu, Winston S.; Das, Swapan Kumar; Wang, Hua; Chan, Juliana C.; Deloukas, Panos; Froguel, Philippe; Baier, Leslie J.; Jia, Weiping; McCarthy, Mark I.; Ng, Maggie C.Y.; Damcott, Coleen; Shuldiner, Alan R.; Zeggini, Eleftheria; Elbein, Steven C.

2009-01-01

Activating transcription factor 6 (ATF6) is located within the region of linkage to type 2 diabetes on chromosome 1q21-q23 and is a key activator of the endoplasmic reticulum stress response. We evaluated 78 single nucleotide polymorphisms (SNPs) spanning >213 kb in 95 people, from which we selected 64 SNPs for evaluation in 191 Caucasian case subjects from Utah and between 165 and 188 control subjects. Six SNPs showed nominal associations with type 2 diabetes (P = 0.001-0.04), including the nonsynonymous SNP rs1058405 (M67V) in exon 3 and rs11579627 in the 3′ flanking region. Only rs1159627 remained significant on permutation testing. The associations were not replicated in 353 African-American case subjects and 182 control subjects, nor were ATF6 SNPs associated with altered insulin secretion or insulin sensitivity in nondiabetic Caucasian individuals. No association with type 2 diabetes was found in a subset of 44 SNPs in Caucasian (n = 2,099), Pima Indian (n = 293), and Chinese (n = 287) samples. Allelic expression imbalance was found in transformed lymphocyte cDNA for 3′ untranslated region variants, thus suggesting cis-acting regulatory variants. ATF6 does not appear to play a major role in type 2 diabetes, but further work is required to identify the cause of the allelic expression imbalance. PMID:17327457

Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans

PubMed Central

Kwon, Ki-Sung; Cho, Hye-Young

2016-01-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2, rs887369 in CXorf21, rs9782955 in LYST, and rs3794060 in NADSYN1). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans. PMID:27729837

Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans.

PubMed

Kwon, Ki-Sung; Cho, Hye-Young; Chung, Yeun-Jun

2016-09-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2 , rs887369 in CXorf21 , rs9782955 in LYST , and rs3794060 in NADSYN1 ). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans.

ADIPOQ, ADIPOR1, and ADIPOR2 Polymorphisms in Relation to Serum Adiponectin Levels and Body Mass Index in Black and White Women

PubMed Central

Cohen, Sarah S.; Gammon, Marilie D.; North, Kari E.; Millikan, Robert C.; Lange, Ethan M.; Williams, Scott M.; Zheng, Wei; Cai, Qiuyin; Long, Jirong; Smith, Jeffrey R.; Signorello, Lisa B.; Blot, William J.; Matthews, Charles E.

2012-01-01

Adiponectin is an adipose-secreted protein with influence on several physiologic pathways including those related to insulin sensitivity, inflammation, and atherogenesis. Adiponectin levels are highly heritable and several single nucleotide polymorphisms (SNPs) in adiponectin-related genes (ADIPOQ, ADIPOR1, ADIPOR2) have been examined in relation to circulating adiponectin levels and obesity phenotypes, but despite differences in adiponectin levels and obesity prevalence by race, few studies have included black participants. Using cross-sectional interview data and blood samples collected from 990 black and 977 white women enrolled in the Southern Community Cohort Study from 2002 to 2006, we examined 25 SNPs in ADIPOQ, 19 in ADIPOR1, and 27 in ADIPOR2 in relation to serum adiponectin levels and body mass index (BMI) using race-stratified linear regression models adjusted for age and percentage African ancestry. SNP rs17366568 in ADIPOQ was significantly associated with serum adiponectin levels in white women only (adjusted mean adiponectin levels = 15.9 for G/G genotype, 13.7 for A/G, and 9.3 for A/A, p=0.00036). No other SNPs were associated with adiponectin or BMI among blacks or whites. Because adiponectin levels as well as obesity are highly heritable and vary by race but associations with polymorphisms in the ADIPOQ, ADIPOR1, and ADIPOR2 genes have been few in this and other studies, future work including large populations from diverse racial groups is needed to detect additional genetic variants that influence adiponectin and BMI. PMID:21273992

Genetic modifiers of menopausal hormone replacement therapy and breast cancer risk: A genome-wide interaction study

PubMed Central

Rudolph, Anja; Hein, Rebecca; Lindström, Sara; Beckmann, Lars; Behrens, Sabine; Liu, Jianjun; Aschard, Hugues; Bolla, Manjeet K.; Wang, Jean; Truong, Thérèse; Cordina-Duverger, Emilie; Menegaux, Florence; Brüning, Thomas; Harth, Volker; Severi, Gianluca; Baglietto, Laura; Southey, Melissa; Chanock, Stephen J.; Lissowska, Jolanta; Figueroa, Jonine D.; Eriksson, Mikael; Humpreys, Keith; Darabi, Hatef; Olson, Janet E.; Stevens, Kristen N.; Vachon, Celine M.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Ashworth, Alan; Orr, Nicholas; Schoemaker, Minouk; Webb, Penny M.; Guénel, Pascal; Brauch, Hiltrud; Giles, Graham; García-Closas, Montserrat; Czene, Kamila; Chenevix-Trench, Georgia; Couch, Fergus J.; Andrulis, Irene L.; Swerdlow, Anthony; Hunter, David J.; Flesch-Janys, Dieter; Easton, Douglas F.; Hall, Per; Nevanlinna, Heli; Kraft, Peter; Chang-Claude, Jenny

2013-01-01

Women using menopausal hormone therapy (MHT) are at increased risk to develop breast cancer (BC). To detect genetic modifiers of the association between current use of MHT and BC risk, we conducted a meta-analysis of four genome-wide case-only studies followed by replication in eleven case-control studies. We used a case-only design to assess interactions between single nucleotide polymorphisms (SNPs) and current MHT use on risk of overall and lobular BC. The discovery stage included 2,920 cases (541 lobular) from four genome-wide association studies. The top 1,391 SNPs showing P-values for interaction (Pint) <3.0×10−03 were selected for replication using pooled case-control data from eleven studies of the Breast Cancer Association Consortium, including 7,689 cases (676 lobular) and 9,266 controls. Fixed effects meta-analysis was used to derive combined Pint. No SNP reached genome-wide significance in either the discovery or combined stage. We observed effect modification of current MHT use on overall BC risk by two SNPs on chr13 near POMP (combined Pint≤8.9×10−06), two SNPs in SLC25A21 (combined Pint≤4.8×10−05), and three SNPs in PLCG2 (combined Pint≤4.5×10−05). The association between lobular BC risk was potentially modified by one SNP in TMEFF2 (combined Pint≤2.7×10−05), one SNP in CD80 (combined Pint≤8.2×10−06), three SNPs on chr17 near TMEM132E (combined Pint≤2.2×10−06), and two SNPs on chr18 near SLC25A52 (combined Pint≤4.6×10−05). In conclusion, polymorphisms in genes related to solute transportation in mitochondria, transmembrane signaling and immune cell activation are potentially modifying BC risk associated with current use of MHT. These findings warrant replication in independent studies. PMID:24080446

Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease

PubMed Central

Martin, Eden R.; Scott, William K.; Nance, Martha A.; Watts, Ray L.; Hubble, Jean P.; Koller, William C.; Lyons, Kelly; Pahwa, Rajesh; Stern, Matthew B.; Colcher, Amy; Hiner, Bradley C.; Jankovic, Joseph; Ondo, William G.; Allen, Fred H.; Goetz, Christopher G.; Small, Gary W.; Masterman, Donna; Mastaglia, Frank; Laing, Nigel G.; Stajich, Jeffrey M.; Ribble, Robert C.; Booze, Michael W.; Rogala, Allison; Hauser, Michael A.; Zhang, Fengyu; Gibson, Rachel A.; Middleton, Lefkos T.; Roses, Allen D.; Haines, Jonathan L.; Scott, Burton L.; Pericak-Vance, Margaret A.; Vance, Jeffery M.

2013-01-01

Context The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. Objective To investigate whether the tau gene is involved in idiopathic PD. Design, Setting, and Participants Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Main Outcome Measure Family-based tests of association, calculated using asymptotic distributions. Results Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P = .03; SNP 9i, P = .04; and SNP 11, P = .04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P = .11, and SNP 9iii, P = .87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P = .009) and a negative association with another haplotype (P = .007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3,9i, 9ii, and 11). Conclusions This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD. PMID:11710889

Genetic Diversity and Demographic History of Cajanus spp. Illustrated from Genome-Wide SNPs

PubMed Central

Saxena, Rachit K.; von Wettberg, Eric; Upadhyaya, Hari D.; Sanchez, Vanessa; Songok, Serah; Saxena, Kulbhushan; Kimurto, Paul; Varshney, Rajeev K.

2014-01-01

Understanding genetic structure of Cajanus spp. is essential for achieving genetic improvement by quantitative trait loci (QTL) mapping or association studies and use of selected markers through genomic assisted breeding and genomic selection. After developing a comprehensive set of 1,616 single nucleotide polymorphism (SNPs) and their conversion into cost effective KASPar assays for pigeonpea (Cajanus cajan), we studied levels of genetic variability both within and between diverse set of Cajanus lines including 56 breeding lines, 21 landraces and 107 accessions from 18 wild species. These results revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, 75.8% of successful SNP assays revealed polymorphism, and more than 95% of these assays could be successfully transferred to related wild species. To show regional patterns of variation, we used STRUCTURE and Analysis of Molecular Variance (AMOVA) to partition variance among hierarchical sets of landraces and wild species at either the continental scale or within India. STRUCTURE separated most of the domesticated germplasm from wild ecotypes, and separates Australian and Asian wild species as has been found previously. Among Indian regions and states within regions, we found 36% of the variation between regions, and 64% within landraces or wilds within states. The highest level of polymorphism in wild relatives and landraces was found in Madhya Pradesh and Andhra Pradesh provinces of India representing the centre of origin and domestication of pigeonpea respectively. PMID:24533111

Functional Characterization of Schizophrenia-Associated Variation in CACNA1C

PubMed Central

Eckart, Nicole; Song, Qifeng; Yang, Rebecca; Wang, Ruihua; Zhu, Heng; McCallion, Andrew S.; Avramopoulos, Dimitrios

2016-01-01

Calcium channel subunits, including CACNA1C, have been associated with multiple psychiatric disorders. Specifically, genome wide association studies (GWAS) have repeatedly identified the single nucleotide polymorphism (SNP) rs1006737 in intron 3 of CACNA1C to be strongly associated with schizophrenia and bipolar disorder. Here, we show that rs1006737 marks a quantitative trait locus for CACNA1C transcript levels. We test 16 SNPs in high linkage disequilibrium with rs1007637 and find one, rs4765905, consistently showing allele-dependent regulatory function in reporter assays. We find allele-specific protein binding for 13 SNPs including rs4765905. Using protein microarrays, we identify several proteins binding ≥3 SNPs, but not control sequences, suggesting possible functional interactions and combinatorial haplotype effects. Finally, using circular chromatin conformation capture, we show interaction of the disease-associated region including the 16 SNPs with the CACNA1C promoter and other potential regulatory regions. Our results elucidate the pathogenic relevance of one of the best-supported risk loci for schizophrenia and bipolar disorder. PMID:27276213

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

Comprehensive Search for Alzheimer Disease Susceptibility Loci in the APOE Region

PubMed Central

Jun, Gyungah; Vardarajan, Badri N.; Buros, Jacqueline; Yu, Chang-En; Hawk, Michele V.; Dombroski, Beth A.; Crane, Paul K.; Larson, Eric B.; Mayeux, Richard; Haines, Jonathan L.; Lunetta, Kathryn L.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Farrer, Lindsay A.

2013-01-01

Objective To evaluate the association of risk and age at onset (AAO) of Alzheimer disease (AD) with single-nucleotide polymorphisms (SNPs) in the chromosome 19 region including apolipoprotein E (APOE) and a repeat-length polymorphism in TOMM40 (poly-T, rs10524523). Design Conditional logistic regression models and survival analysis. Setting Fifteen genome-wide association study data sets assembled by the Alzheimer's Disease Genetics Consortium. Participants Eleven thousand eight hundred forty AD cases and 10 931 cognitively normal elderly controls. Main Outcome Measures Association of AD risk and AAO with genotyped and imputed SNPs located in an 800-Mb region including APOE in the entire Alzheimer's Disease Genetics Consortium data set and with the TOMM40 poly-T marker genotyped in a subset of 1256 cases and 1605 controls. Results In models adjusting for APOE ε4, no SNPs in the entire region were significantly associated with AAO at P<.001. Rs10524523 was not significantly associated with AD or AAO in models adjusting for APOE genotype or within the subset of ε3/ε3 subjects. Conclusions APOE alleles ε2, ε3, and ε4 account for essentially all the inherited risk of AD associated with this region. Other variants including a poly-T track in TOMM40 are not independent risk or AAO loci. PMID:22869155

Vitamin D receptor polymorphisms in patients with cutaneous melanoma.

PubMed

Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne

2012-01-15

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis. Copyright © 2011 UICC.

Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan

PubMed Central

Glatt, SJ; Faraone, SV; Lasky-Su, JA; Kanazawa, T; Hwu, H-G; Tsuang, MT

2009-01-01

The gene that codes for dopamine receptor D2 (DRD2 on chromosome 11q23) has long been a prime functional and positional candidate risk gene for schizophrenia. Collectively, prior case–control studies found a reliable effect of the Ser311Cys DRD2 polymorphism (rs1801028) on risk for schizophrenia, but few other polymorphisms in the gene had ever been evaluated and no adequately powered family-based association study has been performed to date. Our objective was to test 21 haplotype-tagging and all three known nonsynonymous single-nucleotide polymorphisms (SNPs) in DRD2 for association with schizophrenia in a family-based study of 2408 Han Chinese, including 1214 affected individuals from 616 families. We did not find a significant effect of rs1801028, but we did find significant evidence for association of schizophrenia with two multi-marker haplotypes spanning blocks of strong linkage disequilibrium (LD) and nine individual SNPs (Ps < 0.05). Importantly, two SNPs (rs1079727 and rs2283265) and both multi-marker haplotypes spanning entire LD blocks (including one that contained rs1801028) remained significant after correcting for multiple testing. These results further add to the body of data implicating DRD2 as a schizophrenia risk gene; however, a causal variant(s) in DRD2 remains to be elucidated by further fine mapping of the gene, with particular attention given to the area surrounding the third through fifth exons. PMID:18332877

African-specific variability in the acetylcholine muscarinic receptor M4: association with cocaine and heroin addiction.

PubMed

Levran, Orna; Randesi, Matthew; Peles, Einat; Correa da Rosa, Joel; Ott, Jurg; Rotrosen, John; Adelson, Miriam; Kreek, Mary Jeanne

2016-06-01

This study was designed to determine whether polymorphisms in acetylcholine receptors contribute to opioid dependence and/or cocaine dependence. The sample (n = 1860) was divided by drug and ancestry, and 55 polymorphisms (nine genes) were analyzed. Of the 20 SNPs that showed nominally significant associations, the association of the African-specific CHRM4 SNP rs2229163 (Asn417=) with cocaine dependence survived correction for multiple testing (Pcorrected = 0.047). CHRM4 is located in a region of strong linkage disequilibrium on chromosome 11 that includes genes associated with schizophrenia. CHRM4 SNP rs2229163 is in strong linkage disequilibrium with several African-specific SNPs in DGKZ and AMBRA1. Cholinergic receptors' variants may contribute to drug addiction and have a potential role as pharmacogenetic markers.

Polymorphisms of genes coding for ghrelin and its receptor in relation to colorectal cancer risk: a two-step gene-wide case-control study

PubMed Central

2010-01-01

Background Ghrelin, an endogenous ligand for the growth hormone secretagogue receptor (GHSR), has two major functions: the stimulation of the growth hormone production and the stimulation of food intake. Accumulating evidence also indicates a role of ghrelin in cancer development. Methods We conducted a case-control study to examine the association of common genetic variants in the genes coding for ghrelin (GHRL) and its receptor (GHSR) with colorectal cancer risk. Pairwise tagging was used to select the 11 polymorphisms included in the study. The selected polymorphisms were genotyped in 680 cases and 593 controls from the Czech Republic. Results We found two SNPs associated with lower risk of colorectal cancer, namely SNPs rs27647 and rs35683. We replicated the two hits, in additional 569 cases and 726 controls from Germany. Conclusion A joint analysis of the two populations indicated that the T allele of rs27647 SNP exerted a protective borderline effect (Ptrend = 0.004). PMID:20920174

Polymorphisms of genes coding for ghrelin and its receptor in relation to colorectal cancer risk: a two-step gene-wide case-control study.

PubMed

Campa, Daniele; Pardini, Barbara; Naccarati, Alessio; Vodickova, Ludmila; Novotny, Jan; Steinke, Verena; Rahner, Nils; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Kötting, Judith; Betz, Beate; Kloor, Matthias; Engel, Christoph; Büttner, Reinhard; Propping, Peter; Försti, Asta; Hemminki, Kari; Barale, Roberto; Vodicka, Pavel; Canzian, Federico

2010-09-28

Ghrelin, an endogenous ligand for the growth hormone secretagogue receptor (GHSR), has two major functions: the stimulation of the growth hormone production and the stimulation of food intake. Accumulating evidence also indicates a role of ghrelin in cancer development. We conducted a case-control study to examine the association of common genetic variants in the genes coding for ghrelin (GHRL) and its receptor (GHSR) with colorectal cancer risk. Pairwise tagging was used to select the 11 polymorphisms included in the study. The selected polymorphisms were genotyped in 680 cases and 593 controls from the Czech Republic. We found two SNPs associated with lower risk of colorectal cancer, namely SNPs rs27647 and rs35683. We replicated the two hits, in additional 569 cases and 726 controls from Germany. A joint analysis of the two populations indicated that the T allele of rs27647 SNP exerted a protective borderline effect (Ptrend = 0.004).

Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

PubMed

Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

2017-08-01

Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

In Vitro vs In Silico Detected SNPs for the Development of a Genotyping Array: What Can We Learn from a Non-Model Species?

PubMed Central

Lepoittevin, Camille; Frigerio, Jean-Marc; Garnier-Géré, Pauline; Salin, Franck; Cervera, María-Teresa; Vornam, Barbara; Harvengt, Luc; Plomion, Christophe

2010-01-01

Background There is considerable interest in the high-throughput discovery and genotyping of single nucleotide polymorphisms (SNPs) to accelerate genetic mapping and enable association studies. This study provides an assessment of EST-derived and resequencing-derived SNP quality in maritime pine (Pinus pinaster Ait.), a conifer characterized by a huge genome size (∼23.8 Gb/C). Methodology/Principal Findings A 384-SNPs GoldenGate genotyping array was built from i/ 184 SNPs originally detected in a set of 40 re-sequenced candidate genes (in vitro SNPs), chosen on the basis of functionality scores, presence of neighboring polymorphisms, minor allele frequencies and linkage disequilibrium and ii/ 200 SNPs screened from ESTs (in silico SNPs) selected based on the number of ESTs used for SNP detection, the SNP minor allele frequency and the quality of SNP flanking sequences. The global success rate of the assay was 66.9%, and a conversion rate (considering only polymorphic SNPs) of 51% was achieved. In vitro SNPs showed significantly higher genotyping-success and conversion rates than in silico SNPs (+11.5% and +18.5%, respectively). The reproducibility was 100%, and the genotyping error rate very low (0.54%, dropping down to 0.06% when removing four SNPs showing elevated error rates). Conclusions/Significance This study demonstrates that ESTs provide a resource for SNP identification in non-model species, which do not require any additional bench work and little bio-informatics analysis. However, the time and cost benefits of in silico SNPs are counterbalanced by a lower conversion rate than in vitro SNPs. This drawback is acceptable for population-based experiments, but could be dramatic in experiments involving samples from narrow genetic backgrounds. In addition, we showed that both the visual inspection of genotyping clusters and the estimation of a per SNP error rate should help identify markers that are not suitable to the GoldenGate technology in species characterized by a large and complex genome. PMID:20543950

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population

PubMed Central

Sigurdson, Alice J.; Brenner, Alina V.; Roach, James A.; Goudeva, Lilia; Müller, Jörg A.; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M.; Yeager, Meredith; Chanock, Stephen J.; Pfeiffer, Ruth M.; Abend, Michael; Port, Matthias

2016-01-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case–control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. PMID:27207655

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population.

PubMed

Sigurdson, Alice J; Brenner, Alina V; Roach, James A; Goudeva, Lilia; Müller, Jörg A; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M; Yeager, Meredith; Chanock, Stephen J; Pfeiffer, Ruth M; Abend, Michael; Port, Matthias

2016-07-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case-control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. Published by Oxford University Press 2016.

Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, Susan L., E-mail: sltucker@mdanderson.org; Li Minghuan; Xu Ting

2013-01-01

Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk ofmore » severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.« less

Developmental validation of the MiSeq FGx Forensic Genomics System for Targeted Next Generation Sequencing in Forensic DNA Casework and Database Laboratories.

PubMed

Jäger, Anne C; Alvarez, Michelle L; Davis, Carey P; Guzmán, Ernesto; Han, Yonmee; Way, Lisa; Walichiewicz, Paulina; Silva, David; Pham, Nguyen; Caves, Glorianna; Bruand, Jocelyne; Schlesinger, Felix; Pond, Stephanie J K; Varlaro, Joe; Stephens, Kathryn M; Holt, Cydne L

2017-05-01

Human DNA profiling using PCR at polymorphic short tandem repeat (STR) loci followed by capillary electrophoresis (CE) size separation and length-based allele typing has been the standard in the forensic community for over 20 years. Over the last decade, Next-Generation Sequencing (NGS) matured rapidly, bringing modern advantages to forensic DNA analysis. The MiSeq FGx™ Forensic Genomics System, comprised of the ForenSeq™ DNA Signature Prep Kit, MiSeq FGx™ Reagent Kit, MiSeq FGx™ instrument and ForenSeq™ Universal Analysis Software, uses PCR to simultaneously amplify up to 231 forensic loci in a single multiplex reaction. Targeted loci include Amelogenin, 27 common, forensic autosomal STRs, 24 Y-STRs, 7 X-STRs and three classes of single nucleotide polymorphisms (SNPs). The ForenSeq™ kit includes two primer sets: Amelogenin, 58 STRs and 94 identity informative SNPs (iiSNPs) are amplified using DNA Primer Set A (DPMA; 153 loci); if a laboratory chooses to generate investigative leads using DNA Primer Set B, amplification is targeted to the 153 loci in DPMA plus 22 phenotypic informative (piSNPs) and 56 biogeographical ancestry SNPs (aiSNPs). High-resolution genotypes, including detection of intra-STR sequence variants, are semi-automatically generated with the ForenSeq™ software. This system was subjected to developmental validation studies according to the 2012 Revised SWGDAM Validation Guidelines. A two-step PCR first amplifies the target forensic STR and SNP loci (PCR1); unique, sample-specific indexed adapters or "barcodes" are attached in PCR2. Approximately 1736 ForenSeq™ reactions were analyzed. Studies include DNA substrate testing (cotton swabs, FTA cards, filter paper), species studies from a range of nonhuman organisms, DNA input sensitivity studies from 1ng down to 7.8pg, two-person human DNA mixture testing with three genotype combinations, stability analysis of partially degraded DNA, and effects of five commonly encountered PCR inhibitors. Calculations from ForenSeq™ STR and SNP repeatability and reproducibility studies (1ng template) indicate 100.0% accuracy of the MiSeq FGx™ System in allele calling relative to CE for STRs (1260 samples), and >99.1% accuracy relative to bead array typing for SNPs (1260 samples for iiSNPs, 310 samples for aiSNPs and piSNPs), with >99.0% and >97.8% precision, respectively. Call rates of >99.0% were observed for all STRs and SNPs amplified with both ForenSeq™ primer mixes. Limitations of the MiSeq FGx™ System are discussed. Results described here demonstrate that the MiSeq FGx™ System meets forensic DNA quality assurance guidelines with robust, reliable, and reproducible performance on samples of various quantities and qualities. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Association study between monoamine oxidase A (MAOA) gene polymorphisms and schizophrenia: lack of association with schizophrenia and possible association with affective disturbances of schizophrenia.

PubMed

Kim, Su Kang; Park, Hae Jeong; Seok, Hosik; Jeon, Hye Sook; Chung, Joo-Ho; Kang, Won Sub; Kim, Jong Woo; Yu, Gyeong Im; Shin, Dong Hoon

2014-05-01

Monoamine oxidase A (MAOA) catalyzes monoamine neurotransmitters including dopamine, 5-hydroxytryptamine (5-HT, serotonin), and norepinephrine. MAOA also plays a key role in emotional regulation. The aim of this study was to investigate the associations between the exonic single nucleotide polymorphisms (SNPs) of the MAOA gene located on the X chromosome and schizophrenia. We also analyzed the relationships between these SNPs and the common clinical symptoms of schizophrenia such as persecutory delusion, auditory hallucinations, affective disturbances, and poor concentration. Two hundred seventy five Korean schizophrenia patients and 289 control subjects were recruited. Three SNPs [rs6323 (Arg294Arg), rs1137070 (Asp470Asp), and rs3027407 (3'-untranslated region)] of the MAOA gene were selected and genotyped by direct sequencing. The common clinical symptoms of schizophrenia according to the Operation Criteria Checklist were analyzed. Three examined SNPs showed no associations with male and female schizophrenia, respectively (p>0.05). In the analysis of the common clinical symptoms of schizophrenia patients, three examined SNPs were associated with affective disturbances, especially restricted affect and blunted affect in male schizophrenia, respectively (restricted affect, p=0.002, OR=2.71, 95% CI 1.45-5.00; blunted affect, p=0.009, OR 2.25, 95% CI 1.22-4.12). The SNPs were not associated with other clinical symptoms of schizophrenia (persecutory delusion, auditory hallucinations, and poor concentration). These results suggest that exonic SNPs (rs6323, rs1137070, and rs3027407) of the MAOA gene may be contributed to affective disturbances of Korean males schizophrenia, especially restricted affect and blunted affect.

A qualitative study on Singaporean women's views towards breast cancer screening and Single Nucleotide Polymorphisms (SNPs) gene testing to guide personalised screening strategies.

PubMed

Wong, Xin Yi; Chong, Kok Joon; van Til, Janine A; Wee, Hwee Lin

2017-11-21

Breast cancer is the top cancer by incidence and mortality in Singaporean women. Mammography is by far its best screening tool, but current recommended age and interval may not yield the most benefit. Recent studies have demonstrated the potential of single nucleotide polymorphisms (SNPs) to improve discriminatory accuracy of breast cancer risk assessment models. This study was conducted to understand Singaporean women's views towards breast cancer screening and SNPs gene testing to guide personalised screening strategies. Focus group discussions were conducted among English-speaking women (n = 27) between 40 to 65 years old, both current and lapsed mammogram users. Women were divided into four groups based on age and mammogram usage. Discussions about breast cancer and screening experience, as well as perception and attitude towards SNPs gene testing were conducted by an experienced moderator. Women were also asked for factors that will influence their uptake of the test. Transcripts were analysed using thematic analysis to captured similarities and differences in views expressed. Barriers to repeat mammogram attendance include laziness to make appointment and painful and uncomfortable screening process. However, the underlying reason may be low perceived susceptibility to breast cancer. Facilitators to repeat mammogram attendance include ease of making appointment and timely reminders. Women were generally receptive towards SNPs gene testing, but required information on accuracy, cost, invasiveness, and side effects before they decide whether to go for it. Other factors include waiting time for results and frequency interval. On average, women gave a rating of 7.5 (range 5 to 10) when asked how likely they will go for the test. Addressing concerns such as pain and discomfort during mammogram, providing timely reminders and debunking breast cancer myths can help to improve screening uptake. Women demonstrated a spectrum of responses towards a novel test like SNPs gene testing, but need more information to make an informed decision. Future public health education on predictive genetic testing should adequately address both benefits and risks. Findings from this study is used to inform a discrete choice experiment to empirically quantify women preferences and willingness-to-pay for SNPs gene testing.

Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

PubMed

Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

2016-08-01

The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

CsSNP: A Web-Based Tool for the Detecting of Comparative Segments SNPs.

PubMed

Wang, Yi; Wang, Shuangshuang; Zhou, Dongjie; Yang, Shuai; Xu, Yongchao; Yang, Chao; Yang, Long

2016-07-01

SNP (single nucleotide polymorphism) is a popular tool for the study of genetic diversity, evolution, and other areas. Therefore, it is necessary to develop a convenient, utility, robust, rapid, and open source detecting-SNP tool for all researchers. Since the detection of SNPs needs special software and series steps including alignment, detection, analysis and present, the study of SNPs is limited for nonprofessional users. CsSNP (Comparative segments SNP, http://biodb.sdau.edu.cn/cssnp/ ) is a freely available web tool based on the Blat, Blast, and Perl programs to detect comparative segments SNPs and to show the detail information of SNPs. The results are filtered and presented in the statistics figure and a Gbrowse map. This platform contains the reference genomic sequences and coding sequences of 60 plant species, and also provides new opportunities for the users to detect SNPs easily. CsSNP is provided a convenient tool for nonprofessional users to find comparative segments SNPs in their own sequences, and give the users the information and the analysis of SNPs, and display these data in a dynamic map. It provides a new method to detect SNPs and may accelerate related studies.

DNA repair variants and breast cancer risk.

PubMed

Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

2016-05-01

A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P < 0.05), although no associations were observed for other DNA repair SNPs. Interactions of six SNPs in multiple DNA repair pathways with physical activity were evident prior to correction for FDR, following which there was support for only one of the interaction terms (P < 0.05). No consistent associations between variants in DNA repair genes and breast cancer risk or their modification by breast cancer risk factors were observed. © 2016 Wiley Periodicals, Inc.

[Evaluation of association between 9 genetic polymorphism and myocardial infarction in the Siberian population].

PubMed

Maksimov, V N; Kulikov, I V; Orlov, P S; Gafarov, V V; Maliutina, S K; Romashchenko, A G; Voevoda, M I

2012-01-01

to evaluate association between genetic polymorphism (SNPs) and myocardial infarction (identified in recent GWAS) as markers of high risk of myocardial infarction (MI) in Siberian population. Patients were divided into 2 groups - MI patients and control group (ratio 1:2) and presented the sapmle of population of Novosibirsk (9400 patients, 45-69 years) within international project HAPIEE (Health, Alcohol and Psychosocial factors In Eastern Europe). 200 patients with MI (129 men, 71 women) were included. Control group - individuals without MI (420) matched for age and sex. Genomic DNA was extracted from venous blood by phenol-chloroform extraction. Gene polymorphism of genes tested by real-time PCR according to protocol (probes TaqMan, Applied Biosystems, USA) with the use of ABI 7900HT. The following SNPs were studied: rs28711149, rs499818, rs619203, rs10757278 and rs1333049 (hr. 9), rs1376251, rs2549513, rs4804611, rs17465637. The association of SNP and MI was confirmed for 4 of 9 studied SNPs: rs1333049 (hr. 9), rs10757278 (hr. 9), rs499818 (hr. 6), rs619203 gene ROS1. Heart rate was associated with rs1333049 and rs10757278. Glucose level was associated with rs619203, rs28711149 and rs1376251. Total cholesterol and atherogenic index was associated with rs28711149. For the first time in Russian population the associations of GWAS with myocardial infarction SNPs was detected for rs619203, rs499818, rs1333049 and rs10757278. These genetic markers can be used for assessing the risk of myocardial infarction in Russian population.

Single-Nucleotide Polymorphism Markers from De-Novo Assembly of the Pomegranate Transcriptome Reveal Germplasm Genetic Diversity

PubMed Central

Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

2014-01-01

Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature. PMID:24558460

Single-nucleotide polymorphism markers from de-novo assembly of the pomegranate transcriptome reveal germplasm genetic diversity.

PubMed

Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

2014-01-01

Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature.

Association of "ADAM10" and "CAMK2A" Polymorphisms with Conduct Disorder: Evidence from Family-Based Studies

ERIC Educational Resources Information Center

Jian, Xue-Qiu; Wang, Ke-Sheng; Wu, Tie-Jian; Hillhouse, Joel J.; Mullersman, Jerald E.

2011-01-01

Twin and family studies have shown that genetic factors play a role in the development of conduct disorder (CD). The purpose of this study was to identify genetic variants associated with CD using a family-based association study. We used 4,720 single nucleotide polymorphisms (SNPs) from the Illumina Panel and 11,120 SNPs from the Affymetrix 10K…

In silico screening of the chicken genome for overlaps between genomic regions: microRNA genes, coding and non-coding transcriptional units, QTL, and genetic variations.

PubMed

Zorc, Minja; Kunej, Tanja

2016-05-01

MicroRNAs (miRNAs) are a class of non-coding RNAs involved in posttranscriptional regulation of target genes. Regulation requires complementarity between target mRNA and the mature miRNA seed region, responsible for their recognition and binding. It has been estimated that each miRNA targets approximately 200 genes, and genetic variability of miRNA genes has been reported to affect phenotypic variability and disease susceptibility in humans, livestock species, and model organisms. Polymorphisms in miRNA genes could therefore represent biomarkers for phenotypic traits in livestock animals. In our previous study, we collected polymorphisms within miRNA genes in chicken. In the present study, we identified miRNA-related genomic overlaps to prioritize genomic regions of interest for further functional studies and biomarker discovery. Overlapping genomic regions in chicken were analyzed using the following bioinformatics tools and databases: miRNA SNiPer, Ensembl, miRBase, NCBI Blast, and QTLdb. Out of 740 known pre-miRNA genes, 263 (35.5 %) contain polymorphisms; among them, 35 contain more than three polymorphisms The most polymorphic miRNA genes in chicken are gga-miR-6662, containing 23 single nucleotide polymorphisms (SNPs) within the pre-miRNA region, including five consecutive SNPs, and gga-miR-6688, containing ten polymorphisms including three consecutive polymorphisms. Several miRNA-related genomic hotspots have been revealed in chicken genome; polymorphic miRNA genes are located within protein-coding and/or non-coding transcription units and quantitative trait loci (QTL) associated with production traits. The present study includes the first description of an exonic miRNA in a chicken genome, an overlap between the miRNA gene and the exon of the protein-coding gene (gga-miR-6578/HADHB), and the first report of a missense polymorphism located within a mature miRNA seed region. Identified miRNA-related genomic hotspots in chicken can serve researchers as a starting point for further functional studies and association studies with poultry production and health traits and the basis for systematic screening of exonic miRNAs and missense/miRNA seed polymorphisms in other genomes.

Association of Adenylate Cyclase 10 (ADCY10) Polymorphisms and Bone Mineral Density in Healthy Adults

PubMed Central

Ichikawa, Shoji; Koller, Daniel L.; Curry, Leah R.; Lai, Dongbing; Xuei, Xiaoling; Edenberg, Howard J.; Hui, Siu L.; Peacock, Munro; Foroud, Tatiana; Econs, Michael J.

2010-01-01

Phenotypic variation in bone mineral density (BMD) among healthy adults is influenced by both genetic and environmental factors. Genetic sequence variations in the adenylate cyclase 10 (ADCY10) gene, which is also called soluble adenylate cyclase, have previously been reported to be associated with low spinal BMD in hypercalciuric patients. Since ADCY10 is located in the region linked to spinal BMD in our previous linkage analysis, we tested whether polymorphisms in this gene are also associated with normal BMD variation in healthy adults. Sixteen single nucleotide polymorphisms (SNPs) distributed throughout ADCY10 were genotyped in two healthy groups of American whites: 1,692 premenopausal women and 715 men. Statistical analyses were performed in the two groups to test for association between these SNPs and femoral neck and lumbar spine areal BMD. We observed significant evidence of association (p<0.01) with one SNP each in men and women. Genotypes at these SNPs accounted for less than 1% of hip BMD variation in men, but 1.5% of spinal BMD in women. However, adjacent SNPs did not corroborate the association in either males or females. In conclusion, we found a modest association between an ADCY10 polymorphism and spinal areal BMD in premenopausal white women. PMID:19093065

Common polymorphisms influencing serum uric acid levels contribute to susceptibility to gout, but not to coronary artery disease.

PubMed

Stark, Klaus; Reinhard, Wibke; Grassl, Martina; Erdmann, Jeanette; Schunkert, Heribert; Illig, Thomas; Hengstenberg, Christian

2009-11-05

Recently, a large meta-analysis including over 28,000 participants identified nine different loci with association to serum uric acid (UA) levels. Since elevated serum UA levels potentially cause gout and are a possible risk factor for coronary artery disease (CAD) and myocardial infarction (MI), we performed two large case-control association analyses with participants from the German MI Family Study. In the first study, we assessed the association of the qualitative trait gout and ten single nucleotide polymorphisms (SNP) markers that showed association to UA serum levels. In the second study, the same genetic polymorphisms were analyzed for association with CAD. A total of 683 patients suffering from gout and 1,563 healthy controls from the German MI Family Study were genotyped. Nine SNPs were identified from a recently performed genome-wide meta-analysis on serum UA levels (rs12129861, rs780094, rs734553, rs2231142, rs742132, rs1183201, rs12356193, rs17300741 and rs505802). Additionally, the marker rs6855911 was included which has been associated with gout in our cohort in a previous study. SNPs rs734553 and rs6855911, located in SLC2A9, and SNP rs2231142, known to be a missense polymorphism in ABCG2, were associated with gout (p=5.6*10(-7), p=1.1*10(-7), and p=1.3*10(-3), respectively). Other SNPs in the genes PDZK1, GCKR, LRRC16A, SLC17A1-SLC17A3, SLC16A9, SLC22A11 and SLC22A12 failed the significance level. None of the ten markers were associated with risk to CAD in our study sample of 1,473 CAD cases and 1,241 CAD-free controls. SNP markers in SLC2A9 and ABCG2 genes were found to be strongly associated with the phenotype gout. However, not all SNP markers influencing serum UA levels were also directly associated with the clinical manifestation of gout in our study sample. In addition, none of these SNPs showed association with the risk to CAD in the German MI Family Study.

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

PubMed Central

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E.; Al Masaud, Abdulaziz; Shire, Abdirashid M.; Das, Nagalla; Gumaa, Khalid

2017-01-01

Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of ‘which SNPs in which populations.’ The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Methods Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. Results None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Conclusion Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. PMID:28956366

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population.

PubMed

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E; Al Masaud, Abdulaziz; Shire, Abdirashid M; Das, Nagalla; Gumaa, Khalid; Giha, Hayder A

2017-09-01

Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of 'which SNPs in which populations.' The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. Copyright © 2017 Korean Endocrine Society

Effects of GWAS-Associated Genetic Variants on lncRNAs within IBD and T1D Candidate Loci

PubMed Central

Brorsson, Caroline A.; Pociot, Flemming

2014-01-01

Long non-coding RNAs are a new class of non-coding RNAs that are at the crosshairs in many human diseases such as cancers, cardiovascular disorders, inflammatory and autoimmune disease like Inflammatory Bowel Disease (IBD) and Type 1 Diabetes (T1D). Nearly 90% of the phenotype-associated single-nucleotide polymorphisms (SNPs) identified by genome-wide association studies (GWAS) lie outside of the protein coding regions, and map to the non-coding intervals. However, the relationship between phenotype-associated loci and the non-coding regions including the long non-coding RNAs (lncRNAs) is poorly understood. Here, we systemically identified all annotated IBD and T1D loci-associated lncRNAs, and mapped nominally significant GWAS/ImmunoChip SNPs for IBD and T1D within these lncRNAs. Additionally, we identified tissue-specific cis-eQTLs, and strong linkage disequilibrium (LD) signals associated with these SNPs. We explored sequence and structure based attributes of these lncRNAs, and also predicted the structural effects of mapped SNPs within them. We also identified lncRNAs in IBD and T1D that are under recent positive selection. Our analysis identified putative lncRNA secondary structure-disruptive SNPs within and in close proximity (+/−5 kb flanking regions) of IBD and T1D loci-associated candidate genes, suggesting that these RNA conformation-altering polymorphisms might be associated with diseased-phenotype. Disruption of lncRNA secondary structure due to presence of GWAS SNPs provides valuable information that could be potentially useful for future structure-function studies on lncRNAs. PMID:25144376

Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China

PubMed Central

WANG, ZHANG-YANG; HONG, WEI-LONG; ZHU, ZHE-HUI; CHEN, YUN-HAO; YE, WEN-LE; CHU, GUANG-YU; LI, JIA-LIN; CHEN, BI-CHENG; XIA, PENG

2015-01-01

BK polyomavirus (BKV) is important pathogen for kidney transplant recipients, as it is frequently re-activated, leading to nephropathy. The aim of this study was to investigate the phylogenetic reconstruction and polymorphism of the VP2 gene in BKV isolated from Chinese kidney transplant recipients. Phylogenetic analysis was carried out in the VP2 region from 135 BKV-positive samples and 28 reference strains retrieved from GenBank. The unweighted pair-group method with arithmetic mean (UPGMA) grouped all strains into subtypes, but failed to subdivide strains into subgroups. Among the plasma and urine samples, all plasma (23/23) and 82 urine samples (82/95) were identified to contain subtype I; the other 10 urine samples contained subtype IV. A 86-bp fragment was identified as a highly conserved sequence. Following alignment with 36 published BKV sequences from China, 92 sites of polymorphism were identified, including 11 single nucleotide polymorphisms (SNPs) prevalent in Chinese individuals and 30 SNPs that were specific to the two predominant subtypes I and IV. The limitations of the VP2 gene segment in subgrouping were confirmed by phylogenetic analysis. The conserved sequence and polymorphism identified in this study may be helpful in the detection and genotyping of BKV. PMID:26640547

LAMB1 polymorphism is associated with autism symptom severity in Korean autism spectrum disorder patients.

PubMed

Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Park, Hae Jeong; Nam, Min; Kim, Jong Woo

2015-01-01

LAMB1 encodes laminin beta-1, which is expressed during early development of the human nervous system, and could be involved in the pathogenesis of neurodevelopmental disorders. In our study, we aimed to investigate whether single nucleotide polymorphisms (SNPs) in LAMB1 were associated with autism spectrum disorder (ASD) and with related clinical severities of ASD. Two coding SNPs (rs20556 and rs25659) and two intronic SNPs (rs2158836 and rs2237659) were compared between 180 patients with ASD and 147 healthy control subjects using direct sequencing. The Korean version of the Childhood Autism Rating Scale (K-CARS) was used to assess clinical severities. Multiple logistic regression models were employed to analyze genetic data, and associations with symptom severity were tested with the Kruskal-Wallis and the Mann-Whitney U tests. None of the four examined SNPs was associated with ASD risk. However, the GG genotype of rs2158836 was associated with more severe symptoms for the "object use" and "non-verbal communication" measures. The results of our study suggest the association between rs2158836 polymorphisms and symptom severity in ASD.

Genetic association between ghrelin polymorphisms and Alzheimer's disease in a Japanese population.

PubMed

Shibata, Nobuto; Ohnuma, Tohru; Kuerban, Bolati; Komatsu, Miwa; Arai, Heii

2011-01-01

Ghrelin has been reported to enter the hippocampus and to bind to the neurons of the hippocampal formation. This peptide also affects neuronal glucose uptake and decreases tau hyperphosphorylation. There is increasing evidence suggesting an association between ghrelin and Alzheimer's disease (AD) pathology. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) of the ghrelin gene are associated with AD. The SNPs were genotyped using TaqMan technology and were analyzed using a case-control study design. Our case-control dataset consisted of 182 AD patients and 143 age-matched controls. Hardy-Weinberg equilibrium and linkage disequilibrium analyses suggest that the region in and around the gene is highly polymorphic. One SNP, rs4684677 (Leu90Gln), showed a marginal association with age of AD onset. We did not detect any association between the other SNPs of the ghrelin gene and AD. There have been few genetic studies on the relationship between circulating ghrelin and functional SNPs. Further multifactorial studies are needed to clarify the relationship between ghrelin and AD. Copyright © 2011 S. Karger AG, Basel.

Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

PubMed

He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

2017-04-25

Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

Impact of SNPs on Protein Phosphorylation Status in Rice (Oryza sativa L.).

PubMed

Lin, Shoukai; Chen, Lijuan; Tao, Huan; Huang, Jian; Xu, Chaoqun; Li, Lin; Ma, Shiwei; Tian, Tian; Liu, Wei; Xue, Lichun; Ai, Yufang; He, Huaqin

2016-11-11

Single nucleotide polymorphisms (SNPs) are widely used in functional genomics and genetics research work. The high-quality sequence of rice genome has provided a genome-wide SNP and proteome resource. However, the impact of SNPs on protein phosphorylation status in rice is not fully understood. In this paper, we firstly updated rice SNP resource based on the new rice genome Ver. 7.0, then systematically analyzed the potential impact of Non-synonymous SNPs (nsSNPs) on the protein phosphorylation status. There were 3,897,312 SNPs in Ver. 7.0 rice genome, among which 9.9% was nsSNPs. Whilst, a total 2,508,261 phosphorylated sites were predicted in rice proteome. Interestingly, we observed that 150,197 (39.1%) nsSNPs could influence protein phosphorylation status, among which 52.2% might induce changes of protein kinase (PK) types for adjacent phosphorylation sites. We constructed a database, SNP_rice, to deposit the updated rice SNP resource and phosSNPs information. It was freely available to academic researchers at http://bioinformatics.fafu.edu.cn. As a case study, we detected five nsSNPs that potentially influenced heterotrimeric G proteins phosphorylation status in rice, indicating that genetic polymorphisms showed impact on the signal transduction by influencing the phosphorylation status of heterotrimeric G proteins. The results in this work could be a useful resource for future experimental identification and provide interesting information for better rice breeding.

Genetic variations in NADPH-CYP450 oxidoreductase in a Czech Slavic cohort

PubMed Central

Tomková, Mária; Panda, Satya Prakash; Šeda, Ondřej; Baxová, Alice; Hůlková, Martina; Masters, Bettie Sue Siler; Martásek, Pavel

2015-01-01

Background Gene polymorphisms encoding the enzyme NADPH–cytochrome P450 oxidoreductase (POR) contribute to inter-individual differences in drug response. Aim To estimate polymorphic allele frequencies of the POR gene in a Czech Slavic population. Materials & Methods The gene POR was analyzed in 322 Czech Slavic individuals from a control cohort by sequencing and HRM analysis. Results Twenty-five SNP genetic variations were identified. Of these variants, 7 were new, unreported SNPs, including two SNPs in the 5´flanking region (g.4965 C>T and g.4994 G>T), one intronic variant (c.1899 −20C>T), one synonymous SNP (p.20Ala=) and three nonsynonymous SNPs (p.Thr29Ser, p.Pro384Leu and p.Thr529Met). The p.Pro384Leu variant exhibited reduced enzymatic activities compared to wild type. Conclusion New POR variant identification indicates that the number of uncommon variants might be specific for each subpopulation being investigated, particularly germane to the singular role that POR plays in providing reducing equivalents to all CYPs in the endoplasmic reticulum. PMID:25712184

Influence of COX-2 and OXTR polymorphisms on treatment outcome in treatment resistant depression.

PubMed

Mendlewicz, Julien; Crisafulli, Concetta; Calati, Raffaella; Kocabas, Neslihan Aygun; Massat, Isabelle; Linotte, Sylvie; Kasper, Siegfried; Fink, Martin; Sidoti, Antonina; Scantamburlo, Gabrielle; Ansseau, Marc; Antonijevic, Irina; Forray, Carlos; Snyder, Lenore; Bollen, Joseph; Montgomery, Stuart; Zohar, Joseph; Souery, Daniel; Serretti, Alessandro

2012-05-10

Inflammatory pathways play a crucial role in the pathomechanisms of antidepressant efficacy. The aim of this study was to investigate whether a set of single nucleotide polymorphisms (SNPs) within cyclooxygenase-2 (COX-2, rs5275 and rs20417) and oxytocin receptor (OXTR, rs53576 and rs2254298) genes was associated with antidepressant treatment resistance, response or remission. Three hundred seventy-two patients were recruited in the context of a multicenter resistant depression study. They were genotyped for COX-2 and OXTR SNPs. Treatment resistance (according to two different definitions), response and remission were recorded. We did not observe any association between the genotypes or alleles of the selected SNPs within COX-2 and OXTR genes and treatment resistance, response and remission in the whole sample. Our results are consistent with those of some studies but not with those of other ones. Indeed, several factors could be involved in the discrepancy observed across studies. They include sample size, environmental factors, differences in ethnicity, different study designs, and different definitions of treatment resistance. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Genetic variations of DICKKOPF family genes might not be associated with gastric cancer susceptibility.

PubMed

Wu, Juan; Zhang, Junfeng; Zhan, Zhen; Cao, Qinhong; Li, Zhong

2016-07-26

Recent studies have implicated that members of the DICKKOPF (DKK) were causally involved in large number of human cancers. This study was designed to investigate the relationship between the genetic variations of DKK family genes and the risk of gastric cancer (GC). Six SNPs (single nucleotide polymorphisms) of DKK family genes, including rs2241529 in DKK1, rs3733635, rs17037102 and rs419764 in DKK2, rs3206824 in DKK3 and rs2073664 in DKK4, were selected and genotyped by restriction fragment length polymorphism (RFLP) and TaqMan SNP genotyping methods in 409 GC cases and 554 cancer-free controls in the Han population in eastern China. None of the six SNPs achieved significant association with the overall GC risk and stratified analysis by age, gender, smoking status, drinking status, tumor location and pathological classification confirmed these non-significant associations. Our study indicated that the studied six SNPs of DKKs would not be the risk factors for GC in this Han Chinese population. Studies of larger population for different ethnicities will be needed to warrant our findings.

Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

PubMed

Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

2013-12-01

The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

PubMed

Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

2010-01-01

Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

Genetic contributions to the association between adult height and testicular germ cell tumors.

PubMed

Cook, Michael B; Chia, Victoria M; Berndt, Sonja I; Graubard, Barry I; Chanock, Stephen J; Rubertone, Mark V; Erickson, Ralph L; Hayes, Richard B; McGlynn, Katherine A

2011-06-01

Previously, we have shown that increasing adult height is associated with increased risk of testicular germ-cell tumor (TGCT). Recently, a number of single nucleotide polymorphisms (SNPs) have been found to be related to height. We examined whether these SNPs were associated with TGCT and whether they explained the relationship between height and TGCT. We genotyped 15 height-related SNPs in the US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) case-control study. DNA was extracted from buccal cell samples and Taqman assays were used to type the selected SNPs. We used logistic regression models to estimate odds ratios (ORs) and 95% confidence intervals (95%CIs). There were 561 cases and 676 controls for analysis. Two SNPs were found to be associated with risk of TGCT, rs6060373 (CC vs TT, OR = 1.51, 95% CI: 1.06-2.15) and rs143384 (CC vs TT, OR = 1.53, 95% CI: 1.09-2.15). rs6060373 is an intronic polymorphism of ubiquinol-cytochrome c reductase complex chaperone (UQCC), and rs143384 is a 5'UTR polymorphism of growth differentiation factor 5 (GDF5). No individual SNP attenuated the association between height and TGCT. Adjustment for all SNPs previously associated with adult height reduced the associations between adult height and TGCT by ~8.5%, although the P-value indicated only weak evidence that this difference was important (P = 0.26). This novel analysis provides tentative evidence that SNPs which are associated with adult height may also share an association with risk of TGCT.

Genome-wide DNA polymorphisms in Kavuni, a traditional rice cultivar with nutritional and therapeutic properties.

PubMed

Rathinasabapathi, Pasupathi; Purushothaman, Natarajan; Parani, Madasamy

2016-05-01

Although rice genome was sequenced in the year 2002, efforts in resequencing the large number of available accessions, landraces, traditional cultivars, and improved varieties of this important food crop are limited. We have initiated resequencing of the traditional cultivars from India. Kavuni is an important traditional rice cultivar from South India that attracts premium price for its nutritional and therapeutic properties. Whole-genome sequencing of Kavuni using Illumina platform and SNPs analysis using Nipponbare reference genome identified 1 150 711 SNPs of which 377 381 SNPs were located in the genic regions. Non-synonymous SNPs (62 708) were distributed in 19 251 genes, and their number varied between 1 and 115 per gene. Large-effect DNA polymorphisms (7769) were present in 3475 genes. Pathway mapping of these polymorphisms revealed the involvement of genes related to carbohydrate metabolism, translation, protein-folding, and cell death. Analysis of the starch biosynthesis related genes revealed that the granule-bound starch synthase I gene had T/G SNPs at the first intron/exon junction and a two-nucleotide combination, which were reported to favour high amylose content and low glycemic index. The present study provided a valuable genomics resource to study the rice varieties with nutritional and medicinal properties.

Possible association of VISA gene polymorphisms with susceptibility to systemic lupus erythematosus in Chinese population.

PubMed

Liu, Xiaowen; Jiao, Yulian; Wen, Xin; Wang, Laicheng; Ma, Chunyan; Gao, Xuejun; Chen, Zi-Jiang; Zhao, Yueran

2011-10-01

Virus-induced signaling adapter (VISA), an important adaptor protein linking both RIG-I and MDA-5 to downstream signaling events, may mediates the activation of NF kappaB and IRFs and the induction of type I IFN. As the evidence has showed that Toll-like receptors (TLRs), I-IFN and IFN-inducible genes contribute to the pathogenesis of systemic lupus erythematosus (SLE), the aim of the current study was to investigate the possible associations between the VISA gene and SLE. Four single nucleotide polymorphisms (SNPs), rs17857295, rs2326369, rs7262903, and rs7269320, in VISA gene were genotyped in 123 SLE patients and 95 healthy controls. Genotyping was performed using direct sequencing the purified PCR products. Associations were analyzed by using the chi-square test and Fisher's exact test. Haplotype analysis was performed using haploview and PHASE2.1. None of the four SNPs was found to be associated with SLE. The four-SNPs haplotype analysis showed different effect between cases and controls. While the SNPs, rs17857295 and rs2326369, were found to be associated with the renal nephritis and arthritis of SLE patient, respectively. The SNPs rs7269320 showed associations with different manifestations. Our data reveal that polymorphisms in the VISA gene may be related to disease susceptibility and manifestations of SLE.

Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

PubMed Central

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-01-01

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs.

PubMed

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-12-23

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease.

Association of OPRD1 polymorphisms with heroin dependence in a large case-control series.

PubMed

Nelson, Elliot C; Lynskey, Michael T; Heath, Andrew C; Wray, Naomi; Agrawal, Arpana; Shand, Fiona L; Henders, Anjali K; Wallace, Leanne; Todorov, Alexandre A; Schrage, Andrew J; Madden, Pamela A F; Degenhardt, Louisa; Martin, Nicholas G; Montgomery, Grant W

2014-01-01

Genes encoding the opioid receptors (OPRM1, OPRD1 and OPRK1) are obvious candidates for involvement in risk for heroin dependence. Prior association studies commonly had samples of modest size, included limited single nucleotide polymorphism (SNP) coverage of these genes and yielded inconsistent results. Participants for the current investigation included 1459 heroin-dependent cases ascertained from maintenance clinics in New South Wales, Australia, 1495 unrelated individuals selected from an Australian sample of twins and siblings as not meeting DSM-IV criteria for lifetime alcohol or illicit drug dependence (non-dependent controls) and 531 controls ascertained from economically disadvantaged neighborhoods in proximity to the maintenance clinics. A total of 136 OPRM1, OPRD1 and OPRK1 SNPs were genotyped in this sample. After controlling for admixture with principal components analysis, our comparison of cases to non-dependent controls found four OPRD1 SNPs in fairly high linkage disequilibrium for which adjusted P values remained significant (e.g. rs2236857; OR 1.25; P=2.95×10(-4) ) replicating a previously reported association. A post hoc analysis revealed that the two SNP (rs2236857 and rs581111) GA haplotype in OPRD1 is associated with greater risk (OR 1.68; P=1.41×10(-5) ). No OPRM1 or OPRK1 SNPs reached more than nominal significance. Comparisons of cases to neighborhood controls reached only nominal significance. Our results replicate a prior report providing strong evidence implicating OPRD1 SNPs and, in particular, the two SNP (rs2236857 and rs581111) GA haplotype in liability for heroin dependence. Support was not found for similar association involving either OPRM1 or OPRK1 SNPs. © 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction.

The effects of noncoding aquaporin-4 single-nucleotide polymorphisms on cognition and functional progression of Alzheimer's disease.

PubMed

Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J

2017-09-01

The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.

Tumor Necrosis Factor-alpha Induced Protein 3 Interacting Protein 1 Gene Polymorphisms and Pustular Psoriasis in Chinese Han Population

PubMed Central

Han, Jian-Wen; Wang, Yong; Alateng, Chulu; Li, Hong-Bin; Bai, Yun-Hua; Lyu, Xin-Xiang; Wu, Rina

2016-01-01

Background: Psoriasis is a common immune-mediated inflammatory dermatosis. Generalized pustular psoriasis (GPP) is the severe and rare type of psoriasis. The association between tumor necrosis factor-alpha induced protein 3 interacting protein 1 (TNIP1) gene and psoriasis was confirmed in people with multiple ethnicities. This study was to investigate the association between TNIP1 gene polymorphisms and pustular psoriasis in Chinese Han population. Methods: Seventy-three patients with GPP, 67 patients with palmoplantar pustulosis (PPP), and 476 healthy controls were collected from Chinese Han population. Six single nucleotide polymorphisms (SNPs) of the TNIP1 gene, namely rs3805435, rs3792798, rs3792797, rs869976, rs17728338, and rs999011 were genotyped by using polymerase chain reaction-ligase detection reaction. Statistical analyses were performed using the PLINK 1.07 package. Allele frequencies and genotyping frequencies for six SNPs were compared by using Chi-square test, odd ratio (OR) (including 95% confidence interval) were calculated. The haplotype analysis was conducted by Haploview software. Results: The frequencies of alleles of five SNPs were significantly different between the GPP group and the control group (P ≤ 7.22 × 10−3), especially in the GPP patients without psoriasis vulgaris (PsV). In the haplotype analysis, the most significantly different haplotype was H4: ACGAAC, with 13.1% frequency in the GPP group but only 3.4% in the control group (OR = 4.16, P = 4.459 × 10−7). However, no significant difference in the allele frequencies was found between the PPP group and control group for each of the six SNPs (P > 0.05). Conclusions: Polymorphisms in TNIP1 are associated with GPP in Chinese Han population. However, no association with PPP was found. These findings suggest that TNIP1 might be a susceptibility gene for GPP. PMID:27364786

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

DTIC Science & Technology

2013-10-01

identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

Association of Symptoms and Severity of Rift Valley Fever with Genetic Polymorphisms in Human Innate Immune Pathways

PubMed Central

Hise, Amy G.; Traylor, Zachary; Hall, Noémi B.; Sutherland, Laura J.; Dahir, Saidi; Ermler, Megan E.; Muiruri, Samuel; Muchiri, Eric M.; Kazura, James W.; LaBeaud, A. Desirée; King, Charles H.; Stein, Catherine M.

2015-01-01

Background Multiple recent outbreaks of Rift Valley Fever (RVF) in Africa, Madagascar, and the Arabian Peninsula have resulted in significant morbidity, mortality, and financial loss due to related livestock epizootics. Presentation of human RVF varies from mild febrile illness to meningoencephalitis, hemorrhagic diathesis, and/or ophthalmitis with residual retinal scarring, but the determinants for severe disease are not understood. The aim of the present study was to identify human genes associated with RVF clinical disease in a high-risk population in Northeastern Province, Kenya. Methodology/Principal Findings We conducted a cross-sectional survey among residents (N = 1,080; 1–85 yrs) in 6 villages in the Sangailu Division of Ijara District. Participants completed questionnaires on past symptoms and exposures, physical exam, vision testing, and blood collection. Single nucleotide polymorphism (SNP) genotyping was performed on a subset of individuals who reported past clinical symptoms consistent with RVF and unrelated subjects. Four symptom clusters were defined: meningoencephalitis, hemorrhagic fever, eye disease, and RVF-not otherwise specified. SNPs in 46 viral sensing and response genes were investigated. Association was analyzed between SNP genotype, serology and RVF symptom clusters. The meningoencephalitis symptom phenotype cluster among seropositive patients was associated with polymorphisms in DDX58/RIG-I and TLR8. Having three or more RVF-related symptoms was significantly associated with polymorphisms in TICAM1/TRIF, MAVS, IFNAR1 and DDX58/RIG-I. SNPs significantly associated with eye disease included three different polymorphisms TLR8 and hemorrhagic fever symptoms associated with TLR3, TLR7, TLR8 and MyD88. Conclusions/Significance Of the 46 SNPs tested, TLR3, TLR7, TLR8, MyD88, TRIF, MAVS, and RIG-I were repeatedly associated with severe symptomatology, suggesting that these genes may have a robust association with RVFV-associated clinical outcomes. Studies of these and related genetic polymorphisms are warranted to advance understanding of RVF pathogenesis. PMID:25756647

The first report of prion-related protein gene (PRNT) polymorphisms in goat.

PubMed

Kim, Yong-Chan; Jeong, Byung-Hoon

2017-06-01

Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

Genome-wide DNA polymorphism in the indica rice varieties RGD-7S and Taifeng B as revealed by whole genome re-sequencing.

PubMed

Fu, Chong-Yun; Liu, Wu-Ge; Liu, Di-Lin; Li, Ji-Hua; Zhu, Man-Shan; Liao, Yi-Long; Liu, Zhen-Rong; Zeng, Xue-Qin; Wang, Feng

2016-03-01

Next-generation sequencing technologies provide opportunities to further understand genetic variation, even within closely related cultivars. We performed whole genome resequencing of two elite indica rice varieties, RGD-7S and Taifeng B, whose F1 progeny showed hybrid weakness and hybrid vigor when grown in the early- and late-cropping seasons, respectively. Approximately 150 million 100-bp pair-end reads were generated, which covered ∼86% of the rice (Oryza sativa L. japonica 'Nipponbare') reference genome. A total of 2,758,740 polymorphic sites including 2,408,845 SNPs and 349,895 InDels were detected in RGD-7S and Taifeng B, respectively. Applying stringent parameters, we identified 961,791 SNPs and 46,640 InDels between RGD-7S and Taifeng B (RGD-7S/Taifeng B). The density of DNA polymorphisms was 256.8 SNPs and 12.5 InDels per 100 kb for RGD-7S/Taifeng B. Copy number variations (CNVs) were also investigated. In RGD-7S, 1989 of 2727 CNVs were overlapped in 218 genes, and 1231 of 2010 CNVs were annotated in 175 genes in Taifeng B. In addition, we verified a subset of InDels in the interval of hybrid weakness genes, Hw3 and Hw4, and obtained some polymorphic InDel markers, which will provide a sound foundation for cloning hybrid weakness genes. Analysis of genomic variations will also contribute to understanding the genetic basis of hybrid weakness and heterosis.

Significance of neurexin and neuroligin polymorphisms in regulating risk of Hirschsprung's disease.

PubMed

Li, Yanhong; Liu, Hui; Dong, Yubin

2018-06-01

By performing a basic case-control study among a Chinese population, the aims of this study were to explore if single nucleotide polymorphisms (SNPs) within neurexin and neuroligin were associated with susceptibility to Hirschsprung's disease (HD). Eleven SNPs within neurexin and neuroligin were selected in this basic case-control study, and this study recruited 210 children with HD and 187 healthy children. The t-test and Χ 2 test were used to find the difference between case and control in their clinical variables. OR and 95% CI were used to assess the association between HD susceptibility and neurexin/neuroligin polymorphisms/haplotypes. Several SNPs were significantly associated with altered risk of HD in the Chinese Han population, including rs1421589 within NRXN1 , rs11795613 and rs4844285 within NLGN3, as well as rs5961397, rs7157669 and rs724373 within NLGX4X (all P<0.05). Further studies presented that the effects of rs1421589 within NRXN1 , rs4844285 and rs11795613 within NLGN3 , as well as rs5961397 within NLGX4X on HD phenotypes were also statistically significant (all P<0.05). Conclusively, the polymorphisms and haplotypes situated within neurexin and neuroligin were markedly associated with the onset of HD, implying that mutations of neurexin and neuroligin might serve as the treatment target for HD for the Chinese children. © American Federation for Medical Research (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

USDA-ARS?s Scientific Manuscript database

This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

Genome-wide scans of genetic variants for psychophysiological endophenotypes: a methodological overview.

PubMed

Iacono, William G; Malone, Stephen M; Vaidyanathan, Uma; Vrieze, Scott I

2014-12-01

This article provides an introductory overview of the investigative strategy employed to evaluate the genetic basis of 17 endophenotypes examined as part of a 20-year data collection effort from the Minnesota Center for Twin and Family Research. Included are characterization of the study samples, descriptive statistics for key properties of the psychophysiological measures, and rationale behind the steps taken in the molecular genetic study design. The statistical approach included (a) biometric analysis of twin and family data, (b) heritability analysis using 527,829 single nucleotide polymorphisms (SNPs), (c) genome-wide association analysis of these SNPs and 17,601 autosomal genes, (d) follow-up analyses of candidate SNPs and genes hypothesized to have an association with each endophenotype, (e) rare variant analysis of nonsynonymous SNPs in the exome, and (f) whole genome sequencing association analysis using 27 million genetic variants. These methods were used in the accompanying empirical articles comprising this special issue, Genome-Wide Scans of Genetic Variants for Psychophysiological Endophenotypes. Copyright © 2014 Society for Psychophysiological Research.

No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.

PubMed

Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

2008-10-01

A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.

Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

PubMed

Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

2017-02-01

The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

Lack of Association of the Polymorphisms IL-17A (−197G/A) and IL-17F (+7488A/G) with Multibacillary Leprosy in Mexican Patients

PubMed Central

Escamilla-Tilch, Mónica; Estrada-García, Iris; Granados, Julio; Arenas-Guzmán, Roberto; Ramos-Payan, Rosalio; Pérez-Suárez, Thalía Gabriela; Salazar, Ma. Isabel; Pérez-Lucas, Riky Luis; Estrada-Parra, Sergio; Torres-Carrillo, Nora Magdalena

2014-01-01

Background. Leprosy is a chronic infectious disease caused by the intracellular acid-fast bacilli Mycobacterium leprae; it has been determined that genetic factors of the host play an important role in the disease susceptibility. Thus, in this case-control study, we evaluated the possible association between the IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs and susceptibility to leprosy disease in Mexican population. Methods. Seventy-five leprosy patients and sixty-nine control subjects were included. Both SNPs were genotyped with the polymerase chain reaction-restriction fragment length polymorphism technique. Results. We found nonsignificant differences in genotype and allele frequencies related to IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs in MB as well as subclinical forms of leprosy disease versus healthy individuals. Conclusions. Since the sample size is not large enough, it is difficult to sustain an association of susceptibility to leprosy with genotypes or allele frequencies of IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780), suggesting that IL-17 polymorphisms have no significant role in the genetic susceptibility to development of this disease in the Mexican Mestizo population. PMID:25431761

SNP Discovery and Linkage Map Construction in Cultivated Tomato

PubMed Central

Shirasawa, Kenta; Isobe, Sachiko; Hirakawa, Hideki; Asamizu, Erika; Fukuoka, Hiroyuki; Just, Daniel; Rothan, Christophe; Sasamoto, Shigemi; Fujishiro, Tsunakazu; Kishida, Yoshie; Kohara, Mitsuyo; Tsuruoka, Hisano; Wada, Tsuyuko; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2010-01-01

Few intraspecific genetic linkage maps have been reported for cultivated tomato, mainly because genetic diversity within Solanum lycopersicum is much less than that between tomato species. Single nucleotide polymorphisms (SNPs), the most abundant source of genomic variation, are the most promising source of polymorphisms for the construction of linkage maps for closely related intraspecific lines. In this study, we developed SNP markers based on expressed sequence tags for the construction of intraspecific linkage maps in tomato. Out of the 5607 SNP positions detected through in silico analysis, 1536 were selected for high-throughput genotyping of two mapping populations derived from crosses between ‘Micro-Tom’ and either ‘Ailsa Craig’ or ‘M82’. A total of 1137 markers, including 793 out of the 1338 successfully genotyped SNPs, along with 344 simple sequence repeat and intronic polymorphism markers, were mapped onto two linkage maps, which covered 1467.8 and 1422.7 cM, respectively. The SNP markers developed were then screened against cultivated tomato lines in order to estimate the transferability of these SNPs to other breeding materials. The molecular markers and linkage maps represent a milestone in the genomics and genetics, and are the first step toward molecular breeding of cultivated tomato. Information on the DNA markers, linkage maps, and SNP genotypes for these tomato lines is available at http://www.kazusa.or.jp/tomato/. PMID:21044984

CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.

PubMed

Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C

2005-04-15

Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.

Developing a new nonbinary SNP fluorescent multiplex detection system for forensic application in China.

PubMed

Liu, Yanfang; Liao, Huidan; Liu, Ying; Guo, Juanjuan; Sun, Yi; Fu, Xiaoliang; Xiao, Ding; Cai, Jifeng; Lan, Lingmei; Xie, Pingli; Zha, Lagabaiyila

2017-04-01

Nonbinary single-nucleotide polymorphisms (SNPs) are potential forensic genetic markers because their discrimination power is greater than that of normal binary SNPs, and that they can detect highly degraded samples. We previously developed a nonbinary SNP multiplex typing assay. In this study, we selected additional 20 nonbinary SNPs from the NCBI SNP database and verified them through pyrosequencing. These 20 nonbinary SNPs were analyzed using the fluorescent-labeled SNaPshot multiplex SNP typing method. The allele frequencies and genetic parameters of these 20 nonbinary SNPs were determined among 314 unrelated individuals from Han populations from China. The total power of discrimination was 0.9999999999994, and the cumulative probability of exclusion was 0.9986. Moreover, the result of the combination of this 20 nonbinary SNP assay with the 20 nonbinary SNP assay we previously developed demonstrated that the cumulative probability of exclusion of the 40 nonbinary SNPs was 0.999991 and that no significant linkage disequilibrium was observed in all 40 nonbinary SNPs. Thus, we concluded that this new system consisting of new 20 nonbinary SNPs could provide highly informative polymorphic data which would be further used in forensic application and would serve as a potentially valuable supplement to forensic DNA analysis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Association of CASP9, CASP10 gene polymorphisms and tea drinking with colorectal cancer risk in the Han Chinese population.

PubMed

Liu, He; Jiang, Xia; Zhang, Ming-wu; Pan, Yi-feng; Yu, Yun-xian; Zhang, Shan-chun; Ma, Xin-yuan; Li, Qi-long; Chen, Kun

2013-01-01

The initiators caspase-9 (CASP9) and caspase-10 (CASP10) are two key controllers of apoptosis and play important roles in carcinogenesis. This study aims to explore the association between CASPs gene polymorphisms and colorectal cancer (CRC) susceptibility in a population-based study. A two-stage designed population-based case-control study was carried out, including a testing set with 300 cases and 296 controls and a validation set with 206 cases and 845 controls. A total of eight tag selected single nucleotide polymorphisms (SNPs) in CASP9 and CASP10 were chosen based on HapMap and the National Center of Biotechnology Information (NCBI) datasets and genotyped by restriction fragment length polymorphism (RFLP) assay. Multivariate logistic regression models were applied to evaluate the association of SNPs with CRC risk. In the first stage, from eight tag SNPs, three polymorphisms rs4646077 (odds ratio (OR)(AA+AG): 0.654, 95% confidence interval (CI): 0.406-1.055; P=0.082), rs4233532 (OR(CC): 1.667, 95% CI: 0.967-2.876; OR(CT): 1.435, 95% CI: 0.998-2.063; P=0.077), and rs2881930 (OR(CC): 0.263, 95% CI: 0.095-0.728, P=0.036) showed possible association with CRC risk. However, none of the three SNPs, rs4646077 (OR(AA+AG): 1.233, 95% CI: 0.903-1.683), rs4233532 (OR(CC): 0.892, 95% CI: 0.640-1.243; OR(CT): 1.134, 95% CI: 0.897-1.433), and rs2881930 (OR(CC): 1.096, 95% CI: 0.620-1.938; OR(CT): 1.009, 95% CI: 0.801-1.271), remained significant with CRC risk in the validation set, even after stratification for different tumor locations (colon or rectum). In addition, never tea drinking was associated with a significantly increased risk of CRC in testing set together with validation set (OR: 1.755, 95% CI: 1.319-2.334). Our results found that polymorphisms of CASP9 and CASP10 genes may not contribute to CRC risk in Chinese population and thereby the large-scale case-control studies might be in consideration. In addition, tea drinking was a protective factor for CRC.

Association of CASP9, CASP10 gene polymorphisms and tea drinking with colorectal cancer risk in the Han Chinese population*

PubMed Central

Liu, He; Jiang, Xia; Zhang, Ming-wu; Pan, Yi-feng; Yu, Yun-xian; Zhang, Shan-chun; Ma, Xin-yuan; Li, Qi-long; Chen, Kun

2013-01-01

The initiators caspase-9 (CASP9) and caspase-10 (CASP10) are two key controllers of apoptosis and play important roles in carcinogenesis. This study aims to explore the association between CASPs gene polymorphisms and colorectal cancer (CRC) susceptibility in a population-based study. A two-stage designed population-based case-control study was carried out, including a testing set with 300 cases and 296 controls and a validation set with 206 cases and 845 controls. A total of eight tag selected single nucleotide polymorphisms (SNPs) in CASP9 and CASP10 were chosen based on HapMap and the National Center of Biotechnology Information (NCBI) datasets and genotyped by restriction fragment length polymorphism (RFLP) assay. Multivariate logistic regression models were applied to evaluate the association of SNPs with CRC risk. In the first stage, from eight tag SNPs, three polymorphisms rs4646077 (odds ratio (OR)AA+AG: 0.654, 95% confidence interval (CI): 0.406–1.055; P=0.082), rs4233532 (ORCC: 1.667, 95% CI: 0.967–2.876; ORCT: 1.435, 95% CI: 0.998–2.063; P=0.077), and rs2881930 (ORCC: 0.263, 95% CI: 0.095–0.728, P=0.036) showed possible association with CRC risk. However, none of the three SNPs, rs4646077 (ORAA+AG: 1.233, 95% CI: 0.903–1.683), rs4233532 (ORCC: 0.892, 95% CI: 0.640–1.243; ORCT: 1.134, 95% CI: 0.897–1.433), and rs2881930 (ORCC: 1.096, 95% CI: 0.620–1.938; ORCT: 1.009, 95% CI: 0.801–1.271), remained significant with CRC risk in the validation set, even after stratification for different tumor locations (colon or rectum). In addition, never tea drinking was associated with a significantly increased risk of CRC in testing set together with validation set (OR: 1.755, 95% CI: 1.319–2.334). Our results found that polymorphisms of CASP9 and CASP10 genes may not contribute to CRC risk in Chinese population and thereby the large-scale case-control studies might be in consideration. In addition, tea drinking was a protective factor for CRC. PMID:23303631

Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

PubMed

Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

2018-01-01

Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In general, our results demonstrated the usefulness of Random Forest in combination to other reduction techniques to identify population informative SNPs.

Functional Genomics Analysis of Big Data Identifies Novel Peroxisome Proliferator-Activated Receptor γ Target Single Nucleotide Polymorphisms Showing Association With Cardiometabolic Outcomes.

PubMed

Richardson, Kris; Schnitzler, Gavin R; Lai, Chao-Qiang; Ordovas, Jose M

2015-12-01

Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator-activated receptor γ (PPARγ) that is involved in lipid and glucose metabolism and maintenance of metabolic homeostasis. We used a functional genomics methodology to interrogate human chromatin immunoprecipitation-sequencing, genome-wide association studies, and expression quantitative trait locus data to inform selection of candidate functional single nucleotide polymorphisms (SNPs) falling in PPARγ motifs. We derived 27 328 chromatin immunoprecipitation-sequencing peaks for PPARγ in human adipocytes through meta-analysis of 3 data sets. The PPARγ consensus motif showed greatest enrichment and mapped to 8637 peaks. We identified 146 SNPs in these motifs. This number was significantly less than would be expected by chance, and Inference of Natural Selection from Interspersed Genomically coHerent elemenTs analysis indicated that these motifs are under weak negative selection. A screen of these SNPs against genome-wide association studies for cardiometabolic traits revealed significant enrichment with 16 SNPs. A screen against the MuTHER expression quantitative trait locus data revealed 8 of these were significantly associated with altered gene expression in human adipose, more than would be expected by chance. Several SNPs fall close, or are linked by expression quantitative trait locus to lipid-metabolism loci including CYP26A1. We demonstrated the use of functional genomics to identify SNPs of potential function. Specifically, that SNPs within PPARγ motifs that bind PPARγ in adipocytes are significantly associated with cardiometabolic disease and with the regulation of transcription in adipose. This method may be used to uncover functional SNPs that do not reach significance thresholds in the agnostic approach of genome-wide association studies. © 2015 American Heart Association, Inc.

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

PubMed Central

Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

2009-01-01

The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

Identification of single nucleotide polymorphism in protein phosphatase 1 regulatory subunit 11 gene in Murrah bulls

PubMed Central

Jain, Varsha; Patel, Brijesh; Umar, Farhat Paul; Ajithakumar, H. M.; Gurjar, Suraj K.; Gupta, I. D.; Verma, Archana

2017-01-01

Aim: This study was conducted with the objective to identify single nucleotide polymorphism (SNP) in protein phosphatase 1 regulatory subunit 11 (PPP1R11) gene in Murrah bulls. Materials and Methods: Genomic DNA was isolated by phenol–chloroform extraction method from the frozen semen samples of 65 Murrah bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal. The quality and concentration of DNA was checked by spectrophotometer reading and agarose gel electrophoresis. The target region of PPP1R11 gene was amplified using four sets of primer designed based on Bos taurus reference sequence. The amplified products were sequenced and aligned using Clustal Omega for identification of SNPs. Animals were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using EcoNI restriction enzyme. Results: The sequences in the NCBI accession number NW_005785016.1 for Bubalus bubalis were compared and aligned with the edited sequences of Murrah bulls with Clustal Omega software. A total of 10 SNPs were found, out of which 1 at 5’UTR, 3 at intron 1, and 6 at intron 2 region. PCR-RFLP using restriction enzyme EcoNI revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study. Conclusion: A total of 10 SNPs were found. PCR-RFLP revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study, due to which association analysis with conception rate was not feasible. PMID:28344410

Association of interleukin 1 receptor-like 1 gene polymorphisms with eosinophilic phenotype in Japanese adults with asthma.

PubMed

Inoue, Hideki; Ito, Isao; Niimi, Akio; Matsumoto, Hisako; Oguma, Tsuyoshi; Tajiri, Tomoko; Iwata, Toshiyuki; Nagasaki, Tadao; Kanemitsu, Yoshihiro; Morishima, Toshitaka; Hirota, Tomomitsu; Tamari, Mayumi; Wenzel, Sally E; Mishima, Michiaki

2017-11-01

IL1RL1 (ST2) is involved in Th2 inflammation including eosinophil activation. Single nucleotide polymorphisms (SNPs) of the IL1RL1 gene are associated with asthma development and increased peripheral blood eosinophil counts. However, the association between IL1RL1 SNPs and eosinophilic phenotype among adults with asthma remains unexplored. In a primary cohort of 110 adult Japanese patients with stable asthma, we examined the associations between IL1RL1 SNPs and clinical measurements including forced expiratory volume (FEV 1 ), airway reversibility of FEV 1 , exhaled nitric oxide (FeNO), serum soluble-ST2 (sST2) levels, peripheral blood eosinophil differentials and serum total IgE level. The findings in the primary cohort were confirmed in a validation cohort of 126 adult Japanese patients with stable asthma. Patients with minor alleles in 3 SNPs (rs17026974, rs1420101, and rs1921622) had high FeNO, blood eosinophil differentials, and reversibility of FEV 1 , but low levels of serum sST2 and FEV 1 . Minor alleles of rs1041973 were associated with low serum sST2 levels alone. In the validation cohort, minor alleles of rs1420101 were associated with high FeNO and blood eosinophil differentials, whereas minor alleles of rs17026974 and rs1921622 were associated with high blood eosinophil differentials and FeNO, respectively. Multivariate analyses revealed that the minor allele of rs1420101 additively contributed to the FeNO, blood eosinophil differentials, and reversibility of FEV 1 . The minor alleles of IL1RL1 SNPs were associated with high FeNO and peripheral blood eosinophilia among adult Japanese patients with stable asthma. IL1RL1 SNPs may characterize the eosinophilic phenotype with greater eosinophilic inflammation in the Japanese asthma cohort. Copyright © 2017 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.

Tissue expression and predicted protein structures of the bovine ANGPTL3 and association of novel SNPs with growth and meat quality traits.

PubMed

Chen, N B; Ma, Y; Yang, T; Lin, F; Fu, W W; Xu, Y J; Li, F; Li, J Y; Gao, S X

2015-08-01

Angiopoietin-like protein 3 (ANGPTL3) is a secreted protein that regulates lipid, glucose and energy metabolism. This study was conducted to better understand the effect of ANGPTL3 on important economic traits in cattle. First, transcript profiles for ANGPTL3 were measured in nine different Jiaxian cattle tissues. Second, polymorphisms were identified in the complete coding region and promoter region of the bovine ANGPTL3 gene in 707 cattle samples. Finally, an association study was carried out utilizing these single nucleotide polymorphisms (SNPs) to determine the effect of these SNPs on the growth and meat quality traits. Quantitative real-time PCR analysis showed that ANGPTL3 was mainly expressed in the liver. The promoter of the bovine ANGPTL3 contained several putative transcription factor binding sites (SF1, HNF-1, LXRα, NFκβ, HNF-3 and C/EBP). In total, four SNPs of the bovine ANGPTL3 gene were identified by direct sequencing. SNP1 (rs469906272: g.-38T>C) was identified in the promoter, SNP2 (rs451104723:g.104A>T) and SNP3 (rs482516226: g.509A>G) were identified in exon 1, and SNP4 (rs477165942: g.8661T>C) was identified in exon 6. Changes in predicted protein structures due to non-synonymous SNPs were analyzed. Haplotype frequencies and linkage disequilibrium were also investigated. Analysis of four SNPs in cattle from different native Chinese breeds (Nanyang (NY) and Jiaxian (JX)) and commercial breeds (Angus (AG), Hereford (HF), Limousin (LM), Luxi (LX), Simmental (ST) and Jinnan (JN)) revealed a significant association with growth traits (including: BW and hipbone width) and meat quality traits (including: Warner-Bratzler shear force and ribeye area). Therefore, implementation of these four mutations in selection indices in the beef industry may be beneficial in selecting individuals with superior growth and meat quality traits.

Polymorphisms in genes of the renin-angiotensin-aldosterone system and renal cell cancer risk: interplay with hypertension and intakes of sodium, potassium and fluid.

PubMed

Deckers, Ivette A; van den Brandt, Piet A; van Engeland, Manon; van Schooten, Frederik-Jan; Godschalk, Roger W; Keszei, András P; Schouten, Leo J

2015-03-01

Hypertension is an established risk factor for renal cell cancer (RCC). The renin-angiotensin-aldosterone system (RAAS) regulates blood pressure and is closely linked to hypertension. RAAS additionally influences homeostasis of electrolytes (e.g. sodium and potassium) and fluid. We investigated single nucleotide polymorphisms (SNPs) in RAAS and their interactions with hypertension and intakes of sodium, potassium and fluid regarding RCC risk in the Netherlands Cohort Study (NLCS), which was initiated in 1986 and included 120,852 participants aged 55 to 69 years. Diet and lifestyle were assessed by questionnaires and toenail clippings were collected. Genotyping of toenail DNA was performed using the SEQUENOM® MassARRAY® platform for a literature-based selection of 13 candidate SNPs in seven key RAAS genes. After 20.3 years of follow-up, Cox regression analyses were conducted using a case-cohort approach including 3,583 subcohort members and 503 RCC cases. Two SNPs in AGTR1 were associated with RCC risk. AGTR1_rs1492078 (AA vs. GG) decreased RCC risk [hazard ratio (HR) (95% confidence interval (CI)): 0.70(0.49-1.00)], whereas AGTR1_rs5186 (CC vs. AA) increased RCC risk [HR(95%CI): 1.49(1.08-2.05)]. Associations were stronger in participants with hypertension. The RCC risk for AGT_rs3889728 (AG + AA vs. GG) was modified by hypertension (p interaction = 0.039). SNP-diet interactions were not significant, although HRs suggested interaction between SNPs in ACE and sodium intake. SNPs in AGTR1 and AGT influenced RCC susceptibility, and their effects were modified by hypertension. Sodium intake was differentially associated with RCC risk across genotypes of several SNPs, yet some analyses had probably inadequate power to show significant interaction. Results suggest that RAAS may be a candidate pathway in RCC etiology. © 2014 UICC.

Japanese population structure, based on SNP genotypes from 7003 individuals compared to other ethnic groups: effects on population-based association studies.

PubMed

Yamaguchi-Kabata, Yumi; Nakazono, Kazuyuki; Takahashi, Atsushi; Saito, Susumu; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki

2008-10-01

Because population stratification can cause spurious associations in case-control studies, understanding the population structure is important. Here, we examined Japanese population structure by "Eigenanalysis," using the genotypes for 140,387 SNPs in 7003 Japanese individuals, along with 60 European, 60 African, and 90 East-Asian individuals, in the HapMap project. Most Japanese individuals fell into two main clusters, Hondo and Ryukyu; the Hondo cluster includes most of the individuals from the main islands in Japan, and the Ryukyu cluster includes most of the individuals from Okinawa. The SNPs with the greatest frequency differences between the Hondo and Ryukyu clusters were found in the HLA region in chromosome 6. The nonsynonymous SNPs with the greatest frequency differences between the Hondo and Ryukyu clusters were the Val/Ala polymorphism (rs3827760) in the EDAR gene, associated with hair thickness, and the Gly/Ala polymorphism (rs17822931) in the ABCC11 gene, associated with ear-wax type. Genetic differentiation was observed, even among different regions in Honshu Island, the largest island of Japan. Simulation studies showed that the inclusion of different proportions of individuals from different regions of Japan in case and control groups can lead to an inflated rate of false-positive results when the sample sizes are large.

 PARK2 polymorphisms predict disease progression in patients infected with hepatitis C virus.

PubMed

Al-Qahtani, Ahmed A; Al-Anazi, Mashael R; Al-Zoghaibi, Fahad A; Abdo, Ayman A; Sanai, Faisal M; Al-Hamoudi, Waleed K; Alswat, Khalid A; Al-Ashgar, Hamad I; Khan, Mohammed Q; Albenmousa, Ali; Khalak, Hanif; Al-Ahdal, Mohammed N

 Background. The protein encoded by PARK2 gene is a component of the ubiquitin-proteasome system that mediates targeting of proteins for the degradation pathway. Genetic variations at PARK2 gene were linked to various diseases including leprosy, typhoid and cancer. The present study investigated the association of single nucleotide polymorphisms (SNPs) in the PARK2 gene with the development of hepatitis C virus (HCV) infection and its progression to severe liver diseases. A total of 800 subjects, including 400 normal healthy subjects and 400 HCV-infected patients, were analyzed in this study. The patients were classified as chronic HCV patients (group I), patients with cirrhosis (group II) and patients with hepatocellular carcinoma (HCC) in the context of cirrhosis (group III). DNA was extracted and was genotyped for the SNPs rs10945859, rs2803085, rs2276201 and rs1931223. Among these SNPs, CT genotype of rs10945859 was found to have a significant association towards the clinical progression of chronic HCV infection to cirrhosis alone (OR = 1.850; 95% C. I. 1.115-3.069; p = 0.016) or cirrhosis and HCC (OR = 1.768; 95% C. I. 1.090-2.867; p value = 0.020). SNP rs10945859 in the PARK2 gene could prove useful in predicting the clinical outcome in HCV-infected patients.

Investigating the association between polymorphisms in connective tissue growth factor and susceptibility to colon carcinoma.

PubMed

Ahmad, Abrar; Askari, Shlear; Befekadu, Rahel; Hahn-Strömberg, Victoria

2015-04-01

There have been numerous studies on the gene expression of connective tissue growth factor (CTGF) in colorectal cancer, however very few have investigated polymorphisms in this gene. The present study aimed to determine whether single nucleotide polymorphisms (SNPs) in the CTGF gene are associated with a higher susceptibility to colon cancer and/or an invasive tumor growth pattern. The CTGF gene was genotyped for seven SNPs (rs6918698, rs1931002, rs9493150, rs12526196, rs12527705, rs9399005 and rs12527379) by pyrosequencing. Formalin‑fixed paraffin‑embedded tissue samples (n=112) from patients diagnosed with colon carcinoma, and an equal number of blood samples from healthy controls, were selected for genomic DNA extraction. The complexity index was measured using images of tumor samples (n=64) stained for cytokeratin‑8. The images were analyzed and correlated with the identified CTGF SNPs and clinicopathological parameters of the patients, including age, gender, tumor penetration, lymph node metastasis, systemic metastasis, differentiation and localization of tumor. It was demonstrated that the frequency of the SNP rs6918698 GG genotype was significantly associated (P=0.05) with an increased risk of colon cancer, as compared with the GC and CC genotypes. The other six SNPs (rs1931002, rs9493150, rs12526196, rs12527705, rs9399005 and rs12527379) exhibited no significant difference in the genotype and allele frequencies between patients diagnosed with colon carcinoma and the normal healthy population. A trend was observed between genotype variation at rs6918698 and the complexity index (P=0.052). The complexity index and genotypes for any of the studied SNPs were not significantly correlated with clinical or pathological parameters of the patients. These results indicate that the rs6918698 GG genotype is associated with an increased risk of developing colon carcinoma, and genetic variations at the rs6918698 are associated with the growth pattern of the tumor. The present results may facilitate the identification of potential biomarkers of the disease in addition to drug targets.

The APOC3 T-455C and C-482T promoter region polymorphisms are not associated with the severity of liver damage independently of PNPLA3 I148M genotype in patients with nonalcoholic fatty liver.

PubMed

Valenti, Luca; Nobili, Valerio; Al-Serri, Ahmad; Rametta, Raffaela; Leathart, Julian B S; Zappa, Marco A; Dongiovanni, Paola; Fracanzani, Anna L; Alterio, Arianna; Roviaro, Giancarlo; Daly, Ann K; Fargion, Silvia; Day, Christopher P

2011-12-01

The T-455C and C-482T APOC3 promoter region polymorphisms (SNPs) have recently been reported to predispose to dyslipidemia, insulin resistance, and nonalcoholic fatty liver disease (NAFLD) in Indian subjects, but the association with liver damage has not been evaluated so far. The aim was to assess the association between APOC3 SNPs and liver damage in Caucasian patients. We considered 437 Italian patients with histological diagnosis of NAFLD (including 137 children, 120 morbid obese) and 316 healthy controls, 71 Italian family trios, and 321 patients from the UK. APOC3 SNPs were determined by sequencing, allele-specific oligonucleotide probes and PCR-restriction fragment length polymorphism analysis, hepatic APOC3 mRNA levels by real-time PCR. APOC3 SNPs were not associated with NAFLD in Italian subjects, although a borderline significance for the transmission of the -455T allele was observed in the family study. Homozygosity for the APOC3 wild-type genotype (APOC3 WT) was associated with a more favorable lipid profile in control subjects, and consistently with lower hepatic APOC3 mRNA levels in obese patients without diabetes. However, APOC3 SNPs, alone or in combination, were not associated with insulin resistance, altered lipid levels, liver enzymes, and with liver damage (severity of steatosis, nonalcoholic steatohepatitis, and moderate/severe fibrosis) in Italian as well as in UK patients, and in the whole cohort. Stratification for the I148M PNPLA3 mutation, associated with the susceptibility to NASH, did not alter the results. APOC3 genotype is not associated with progressive liver damage in Caucasian patients with NAFLD. Copyright © 2011 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

NASA Astrophysics Data System (ADS)

Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

2008-11-01

Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

2011-07-15

Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern Chinese population.« less

TERT rs2736098 polymorphism and cancer risk: results of a meta-analysis.

PubMed

Qi, Hao-Yu; Zou, Peng; Zhao, Lin; Zhu, Jue; Gu, Ai-Hua

2012-01-01

Several studies have demonstrated associations between the TERT rs2736098 single nucleotide polymorphisms (SNPs) and susceptibility to cancer development. However, there are conflicting results. A systematic meta-analysis was therefore performed to establish the cancer risk associated with the polymorphism. In this meta-analysis, a total of 6 case-control studies, including 5,567 cases and 6,191 controls, were included. Crude odds ratios with 95% confidence intervals were used to assess the strength of associations in several genetic models. Our results showed no association reaching the level of statistical significance for overall risk. Interestingly, in the stratified analyses (subdivided by ethnicity), significantly increased risks were found in the Asian subgroup which indicates the TERT rs2736098 polymorphism may have controversial involvement in cancer susceptibility. Overall, this meta-analysis indicates that the TERT rs2736098 polymorphism may have little involvement in cancer susceptibility.

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

PubMed Central

Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

2007-01-01

Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

Chromosome 17: association of a large inversion polymorphism with corticosteroid response in asthma.

PubMed

Tantisira, Kelan G; Lazarus, Ross; Litonjua, Augusto A; Klanderman, Barbara; Weiss, Scott T

2008-08-01

A 900-kb inversion exists within a large region of conserved linkage disequilibrium (LD) on chromosome 17. CRHR1 is located within the inversion region and associated with inhaled corticosteroid response in asthma. We hypothesized that CRHR1 variants are in LD with the inversion, supporting a potential role for natural selection in the genetic response to corticosteroids. We genotyped six single nucleotide polymorphisms (SNPs) spanning chromosome 17: 40,410,565-42,372,240, including four SNPs defining inversion status. Similar allele frequencies and strong LD were noted between the inversion and a CRHR1 SNP previously associated with lung function response to inhaled corticosteroids. Each inversion-defining SNP was strongly associated with inhaled corticosteroid response in adult asthma (P values 0.002-0.005). The CRHR1 response to inhaled corticosteroids may thus be explained by natural selection resulting from inversion status or by long-range LD with another gene. Additional pharmacogenetic investigations into regions of chromosomal diversity, including copy number variation and inversions, are warranted.

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

PubMed Central

Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard

2014-01-01

High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

PubMed

Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

2017-01-01

Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

Haplotype combination of the bovine CFL2 gene sequence variants and association with growth traits in Qinchuan cattle.

PubMed

Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

2015-06-01

The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.250.33). Association analysis indicated that SNP G 1500 A, T 1694 A and C 2213 G were significantly associated with growth traits in the QC population. The results of our study suggest that the CFL2 gene may be a strong candidate gene that affects growth traits in the QC cattle breeding program. Copyright © 2015 Elsevier B.V. All rights reserved.

Investigating the CFH Gene Polymorphisms as a Risk Factor for Age-related Macular Degeneration in an Iranian Population.

PubMed

Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein

2016-06-01

Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.

A tool for selecting SNPs for association studies based on observed linkage disequilibrium patterns.

PubMed

De La Vega, Francisco M; Isaac, Hadar I; Scafe, Charles R

2006-01-01

The design of genetic association studies using single-nucleotide polymorphisms (SNPs) requires the selection of subsets of the variants providing high statistical power at a reasonable cost. SNPs must be selected to maximize the probability that a causative mutation is in linkage disequilibrium (LD) with at least one marker genotyped in the study. The HapMap project performed a genome-wide survey of genetic variation with about a million SNPs typed in four populations, providing a rich resource to inform the design of association studies. A number of strategies have been proposed for the selection of SNPs based on observed LD, including construction of metric LD maps and the selection of haplotype tagging SNPs. Power calculations are important at the study design stage to ensure successful results. Integrating these methods and annotations can be challenging: the algorithms required to implement these methods are complex to deploy, and all the necessary data and annotations are deposited in disparate databases. Here, we present the SNPbrowser Software, a freely available tool to assist in the LD-based selection of markers for association studies. This stand-alone application provides fast query capabilities and swift visualization of SNPs, gene annotations, power, haplotype blocks, and LD map coordinates. Wizards implement several common SNP selection workflows including the selection of optimal subsets of SNPs (e.g. tagging SNPs). Selected SNPs are screened for their conversion potential to either TaqMan SNP Genotyping Assays or the SNPlex Genotyping System, two commercially available genotyping platforms, expediting the set-up of genetic studies with an increased probability of success.

Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

PubMed Central

Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

2011-01-01

Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

PubMed Central

Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

Lack of association between autonomously functioning thyroid nodules and germline polymorphisms of the thyrotropin receptor and Gαs genes in a mild to moderate iodine-deficient Caucasian population.

PubMed

Vicchio, Teresa Manuela; Giovinazzo, Salvatore; Certo, Rosaria; Cucinotta, Mariapaola; Micali, Carmelo; Baldari, Sergio; Benvenga, Salvatore; Trimarchi, Francesco; Campennì, Alfredo; Ruggeri, Rosaria Maddalena

2014-07-01

Mutations of the thyrotropin receptor (TSHR) and/or Gαs gene have been found in a number of, but not all, autonomously functioning thyroid nodules (AFTNs). Recently, in a 15-year-old girl with a hyperfunctioning papillary thyroid carcinoma, we found two somatic and germline single nucleotide polymorphisms (SNPs): a SNP of the TSHR gene (exon 7, codon 187) and a SNP of Gαs gene (exon 8, codon 185). The same silent SNP of the TSHR gene had been reported in patients with AFTN or familial non-autoimmune hyperthyroidism. No further data about the prevalence of the two SNPs in AFTNs as well as in the general population are available in the literature. To clarify the possible role of these SNPs in predisposing to AFTN. Germline DNA was extracted from blood leukocytes of 115 patients with AFTNs (43 males and 72 females, aged 31-85 years, mean ± SD = 64 ± 13) and 100 sex-matched healthy individuals from the same geographic area, which is marginally iodine deficient. The genotype distribution of the two SNPs was investigated by restriction fragment length polymorphism-polymerase chain reaction. The prevalence of the two SNPs in our study population was low and not different to that found in healthy individuals: 8 % of patients vs. 9 % of controls were heterozygous for the TSHR SNP and 4 % patients vs. 6 % controls were heterozygous for the Gαs SNP. One patient harbored both SNPs. These results suggest that these two SNPs do not confer susceptibility for the development of AFTN.

Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2010-08-01

This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

PubMed

Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

PubMed

Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

2017-12-01

Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (p<0.0083). Seven SNPs in the MTHFR gene were associated with homocysteine levels at an α-level of 0.05, but the associations did not persist after Bonferroni correction. These SNPs did not show interactions with lead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

Genome supranucleosomal organization and genetic susceptibility to diseases

NASA Astrophysics Data System (ADS)

Jablonski, K. P.; Fretter, C.; Carron, L.; Forné, T.; Hütt, M.-T.; Lesne, A.

2017-09-01

The notion of disease-associated single-nucleotide polymorphisms (da-SNP), as determined in genome-wide association studies (GWAS), is relevant for many complex pathologies, including cancers. It appeared that da-SNPs are not only markers of causal genetic variation but may contribute to the disease development through an influence on gene expression levels. We argue that understanding this possible functional role of da-SNPs requires to consider their embedding in the tridimensional (3D) multi-scale organization of the human genome. We then focus on the potential impact of da-SNPs on chromatin loops and recently observed topologically associating domains (TADs). We show that for some diseases and cancer types, da-SNPs are over-represented in the borders of these topological domains, in a way that cannot be explained by an increased exon density. This analysis of the distribution of da-SNPs within the 3D genome organization suggests candidate loci for further experimental investigation of the mechanisms underlying genetic susceptibility to diseases, in particular cancer.

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

PubMed

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation <92%. Control children were defined as non-snoring children with AHI <2/h TST (NOSA). Endothelial function was assessed using a modified post-occlusive hyperemic test. The time to peak reperfusion (Tmax) was considered as the indicator for normal endothelial function (NEF; Tmax<45 sec), or ED (Tmax ≥ 45 sec). Genomic DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular morbidity. Thus, analysis of genotype-phenotype interactions in children with OSA may assist in the formulation of categorical risk estimates.

A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

PubMed Central

Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

2017-01-01

Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

PubMed Central

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-01-01

AIM: To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. METHODS: A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. RESULTS: There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. CONCLUSION: In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis. PMID:24409064

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis.

PubMed

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-12-28

To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis.

Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerns, Sarah L.; Ostrer, Harry; Stock, Richard

2010-12-01

Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score {<=}7) and 52 control subjects (post-treatment SHIM score {>=}16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, locatedmore » in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10{sup -8}, Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value < 10{sup -6}. Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened. This study demonstrates the feasibility of a genome-wide approach to investigate genetic predisposition to radiation injury.« less

HLA variants rs9271366 and rs9275328 are associated with systemic lupus erythematosus susceptibility in Malays and Chinese.

PubMed

Chai, H C; Phipps, M E; Othman, I; Tan, L P; Chua, K H

2013-02-01

Human leukocyte antigen (HLA) antigens and genes have long been reported associated with systemic lupus erythematosus (SLE) susceptibility in many populations. With the advance in technologies such as genome-wide association studies, many newly discovered SLE-associated single-nucleotide polymorphisms (SNPs) have been reported in recent years. These include HLA-DRB1/HLA-DQA1 rs9271366 and HLA-DQB1/HLA-DQA2 rs9275328. Our aim was to investigate these SNPs in a Malaysian SLE cohort. SNPs rs9271366 and rs9275328 were screened across 790 Malaysian citizens from three ethnic groups (360 patients and 430 healthy volunteers) by Taqman SNP genotyping assays. Allele and genotyping frequencies, Hardy-Weinberg equilibrium, Fisher's exact test and odds ratio were calculated for each SNP and ethnic group. Linkage disequilibrium and interaction between the two SNPs were also evaluated. The minor allele G and its homozygous genotype GG of HLA-DRB1/HLA-DQA1 rs9271366 significantly increased the SLE susceptibility in Malaysian patients, including those of Malay and Chinese ethnicity (odds ratio (OR) > 1, p < 0.05). As for HLA-DQB1/HLA-DQA2 rs9275328, the minor allele T and the heterozygous genotype CT conferred protective effect to SLE in Malaysians, as well as in Malays and Chinese, by having OR < 1 and p value <0.05. Both SNPs did not show associations to SLE in Indians. D' and r (2) values for the two SNPs in LD analysis were 0.941 and 0.065, respectively, with haplotype GC and AT being significantly associated with SLE (p < 5.0 × 10(-4)) after 10,000 permutations were performed. The MDR test clustered the genotype combinations of GG and CC, and AG and CC of rs9271366 and rs9275328, accordingly, as high-risk group, and the two SNPs interacted redundantly by removing 1.96% of the entropy. Our findings suggest that in addition to some classical HLA variants, rs9271366 and rs9275328 are additional polymorphisms worth considering in the Malaysian and possibly in a larger Asian SLE scenario.

Genome-wide DNA polymorphisms in two cultivars of mei (Prunus mume sieb. et zucc.).

PubMed

Sun, Lidan; Zhang, Qixiang; Xu, Zongda; Yang, Weiru; Guo, Yu; Lu, Jiuxing; Pan, Huitang; Cheng, Tangren; Cai, Ming

2013-10-06

Mei (Prunus mume Sieb. et Zucc.) is a famous ornamental plant and fruit crop grown in East Asian countries. Limited genetic resources, especially molecular markers, have hindered the progress of mei breeding projects. Here, we performed low-depth whole-genome sequencing of Prunus mume 'Fenban' and Prunus mume 'Kouzi Yudie' to identify high-quality polymorphic markers between the two cultivars on a large scale. A total of 1464.1 Mb and 1422.1 Mb of 'Fenban' and 'Kouzi Yudie' sequencing data were uniquely mapped to the mei reference genome with about 6-fold coverage, respectively. We detected a large number of putative polymorphic markers from the 196.9 Mb of sequencing data shared by the two cultivars, which together contained 200,627 SNPs, 4,900 InDels, and 7,063 SSRs. Among these markers, 38,773 SNPs, 174 InDels, and 418 SSRs were distributed in the 22.4 Mb CDS region, and 63.0% of these marker-containing CDS sequences were assigned to GO terms. Subsequently, 670 selected SNPs were validated using an Agilent's SureSelect solution phase hybridization assay. A subset of 599 SNPs was used to assess the genetic similarity of a panel of mei germplasm samples and a plum (P. salicina) cultivar, producing a set of informative diversity data. We also analyzed the frequency and distribution of detected InDels and SSRs in mei genome and validated their usefulness as DNA markers. These markers were successfully amplified in the cultivars and in their segregating progeny. A large set of high-quality polymorphic SNPs, InDels, and SSRs were identified in parallel between 'Fenban' and 'Kouzi Yudie' using low-depth whole-genome sequencing. The study presents extensive data on these polymorphic markers, which can be useful for constructing high-resolution genetic maps, performing genome-wide association studies, and designing genomic selection strategies in mei.

Dopamine D2 receptor gene polymorphisms and externalizing behaviors in children and adolescents.

PubMed

Della Torre, Osmar Henrique; Paes, Lúcia Arisaka; Henriques, Taciane Barbosa; de Mello, Maricilda Palandi; Celeri, Eloisa Helena Rubello Valler; Dalgalarrondo, Paulo; Guerra-Júnior, Gil; Santos-Júnior, Amilton Dos

2018-05-02

Dopamine is involved in several cerebral physiological processes, and single nucleotide polymorphisms (SNP) in the dopamine D2 receptor gene (DRD2) have been associated with numerous neurological and mental disorders, including those involving alterations in cognitive and emotional processes. The aim of this study was to evaluate the association between the SNPs c.957C > T (rs6277) and c.-585A > G (rs1799978) in the DRD2 gene and behavioral characteristics of children and adolescents based on an inventory of the Child Behavior Checklist (CBCL). Children and adolescents between 8 and 20 years old who were clinically followed-up were genotyped for the SNPs c.957C > T and c.-585A > G, and related to data of the CBCL/6-18 scale assessment performed with the help of caregivers. The chi-squared test was used to assess the differences in the frequencies of the C and T alleles in the polymorphism c.957C > T and of the A and G alleles in the polymorphism c.-585A > G with respect to the grouped CBCL scores at a significance level of 5%. Multiple logistic regression models were performed, to control whether sex and/or ethnicity could influence the results. Eighty-five patients were assessed overall, and the presence of the T allele (C/T and T/T) of DRD2 c.957C > T polymorphism was found to be significantly associated with the occurrence of defiant and oppositional problems and with attention and hyperactivity problems. There were no associations detected with polymorphism DRD2 c.-585A > G polymorphism. Both SNPs were in Hardy-Weinberg-equilibrium. Although the findings of this study are preliminary, due to its small number of participants, the presence of T allele (C/T, T/T) in c.957C > T SNP was associated with difficulty in impulse control, self-control of emotions, and conduct adjustment, which can contribute to improving the identification of mental and behavioral phenotypes associated with gene expression.

SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

PubMed Central

2012-01-01

Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

SNPit: a federated data integration system for the purpose of functional SNP annotation.

PubMed

Shen, Terry H; Carlson, Christopher S; Tarczy-Hornoch, Peter

2009-08-01

Genome wide association studies can potentially identify the genetic causes behind the majority of human diseases. With the advent of more advanced genotyping techniques, there is now an explosion of data gathered on single nucleotide polymorphisms (SNPs). The need exists for an integrated system that can provide up-to-date functional annotation information on SNPs. We have developed the SNP Integration Tool (SNPit) system to address this need. Built upon a federated data integration system, SNPit provides current information on a comprehensive list of SNP data sources. Additional logical inference analysis was included through an inference engine plug in. The SNPit web servlet is available online for use. SNPit allows users to go to one source for up-to-date information on the functional annotation of SNPs. A tool that can help to integrate and analyze the potential functional significance of SNPs is important for understanding the results from genome wide association studies.

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

PubMed

Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

2012-01-01

PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

Vitamin D receptor polymorphisms in patients with cutaneous melanoma

PubMed Central

Orlow, Irene; Roy, Pampa; Reiner, Anne S.; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Millikan, Robert C.; Thomas, Nancy E.; Gruber, Stephen B.; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P.; Dwyer, Terence; Kanetsky, Peter A.; Busam, Klaus; From, Lynn; Begg, Colin B.; Berwick, Marianne

2011-01-01

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene SNPs in a large international multi-center population-based case-control study of melanoma. Buccal DNAs were obtained from 1207 people with incident multiple primary melanoma and 2469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, htSNPs with ≥10% MAF in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3’ gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25% to 33% for 6 polymorphisms: rs10875712 (OR 1.28; 95%CI, 1.01–1.62), rs4760674 (OR 1.33; 95% CI, 1.06–1.67), rs7139166 (OR 1.26; 95%CI, 1.02–1.56), rs4516035 (OR 1.25; 95%CI, 1.01–1.55), rs11168287 (OR 1.27; 95%CI, 1.03–1.57), rs1544410 (OR 1.30; 95%CI, 1.04–1.63); for 2 polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65–1.02), rs7965281 (OR, 0.78; 95%CI, 0.62–0.99). We recognize the potential false positive findings due to multiple comparisons; however the 8 significant SNPs in this study outnumbered the 2 significant tests expected to occur by chance. The vitamin D receptor may play a role in melanomagenesis. PMID:21365644

[Association of single nucleotide polymorphisms of susceptibility genes of type 2 diabetes mellitus with liability to gout among ethnic Han Chinese males from coastal region of Shandong].

PubMed

Han, Lin; Xin, Ruosai; Sun, Jian; Hou, Feng; Li, Changgui; Hu, Xinlin; Liu, Zhen; Wang, Yao; Li, Xinde; Ren, Wei; Wang, Xuefeng; Jia, Zhaotong

2015-10-01

OBJECTIVE To assess the association of single nucleotide polymorphisms (SNPs) of susceptibility genes of type 2 diabetes mellitus (T2DM) with liability to gout among ethnic Han Chinese males from coastal region of Shandong province. METHODS Seven SNPs within the susceptibility genes of T2DM, including rs10773971(G/C) and rs4766398(G/C) of WNT5B gene, rs10225163(G/C) of JAZF1 gene, rs2069590(T/A) of BDKRB2 gene, rs5745709(G/A) of HGF gene, rs1991914(C/A) of OTOP1 gene and rs2236479(G/A) of COL18A1 gene, were typed with a custom-made Illumina GoldenGate Genotyping assay in 480 male patients with gout and 480 male controls. Potential association was assessed with the chi-square test. RESULTS No significant difference was detected for the 7 selected SNPs in terms of genotypic and allelic frequencies (P > 0.05). When age and body mass index (BMI) were adjusted, the 7 genetic variants still showed no significant association with gout. CONCLUSION The genotypes of the 7 selected SNPs are not associated with gout in ethnic Han Chinese male patients from the coastal region of Shandong province. However, the results need to be replicated in larger sets of patients collected from other regions and populations.

Multiple thrombophilic single nucleotide polymorphisms lack a significant effect on outcomes in fresh IVF cycles: an analysis of 1717 patients.

PubMed

Patounakis, George; Bergh, Eric; Forman, Eric J; Tao, Xin; Lonczak, Agnieszka; Franasiak, Jason M; Treff, Nathan; Scott, Richard T

2016-01-01

The aim of the study is to determine if thrombophilic single nucleotide polymorphisms (SNPs) affect outcomes in fresh in vitro fertilization (IVF) cycles in a large general infertility population. A prospective cohort analysis was performed at a university-affiliated private IVF center of female patients undergoing fresh non-donor IVF cycles. The effect of the following thrombophilic SNPs on IVF outcomes were explored: factor V (Leiden and H1299R), prothrombin (G20210A), factor XIII (V34L), β-fibrinogen (-455G → A), plasminogen activator inhibitor-1 (4G/5G), human platelet antigen-1 (a/b9L33P), and methylenetetrahydrofolate reductase (C677T and A1298C). The main outcome measures included positive pregnancy test, clinical pregnancy, embryo implantation, live birth, and pregnancy loss. Patients (1717) were enrolled in the study, and a total of 4169 embryos were transferred. There were no statistically significant differences in positive pregnancy test, clinical pregnancy, embryo implantation, live birth, or pregnancy loss in the analysis of 1717 patients attempting their first cycle of IVF. Receiver operator characteristics and logistic regression analyses showed that outcomes cannot be predicted by the cumulative number of thrombophilic mutations present in the patient. Individual and cumulative thrombophilic SNPs do not affect IVF outcomes. Therefore, initial screening for these SNPs is not indicated.

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

PubMed

Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

2010-05-01

Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

PubMed

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

PubMed

Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

2010-05-01

Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

The combined effects of single-nucleotide polymorphisms, tobacco products, and ethanol on normal resting blood mononuclear cells.

PubMed

Cederblad, Lena; Thunberg, Ulf; Engström, Mats; Castro, Juan; Rutqvist, Lars Erik; Laytragoon-Lewin, Nongnit

2013-05-01

Tobacco and ethanol consumption are crucial factors in the development of various diseases including cancer. In this investigation, we evaluated the combined effects of a number of single nucleotide polymorphisms (SNPs), with ethanol and tobacco products on healthy individuals. Pure nicotine, cigarette smoke extract, and Swedish snuff (snus) extract were used. The effects were examined by means of in vitro cell cycle progression and cell death of peripheral blood mononuclear cells (PBMCs) obtained from healthy donors. After 3 days, in vitro, resting PBMCs entered the S and G2 stage in the presence of 100 µM nicotine. The PBMCs only proceeded to S stage, in the presence of 0.2% ethanol. The nicotine- and ethanol-induced normal cell cycle progression correlated to a number of SNPs in the IL12RB2, Rad 52, XRCC2, P53, CCND3, and ABCA1 genes. Certain SNPs in Caspases 8, IL12RB2, Rad 52, MMP2, and MDM2 genes appeared to significantly influence the effects of EtOH-, snus-, and snus + EtOH-induced cell death. Importantly, the highest degree of cell death was observed in the presence of smoke + EtOH. The amount of cell death under this treatment condition also correlated to specific SNPs, located in the MDM2, ABCA1, or GASC1 genes. Cigarette smoke in combination with ethanol strongly induced massive cell death. Long-term exposure to smoke and ethanol could provoke chronic inflammation, and this could be the initiation of disease including the development of cancer at various sites.

Automated SNP detection from a large collection of white spruce expressed sequences: contributing factors and approaches for the categorization of SNPs

PubMed Central

Pavy, Nathalie; Parsons, Lee S; Paule, Charles; MacKay, John; Bousquet, Jean

2006-01-01

Background High-throughput genotyping technologies represent a highly efficient way to accelerate genetic mapping and enable association studies. As a first step toward this goal, we aimed to develop a resource of candidate Single Nucleotide Polymorphisms (SNP) in white spruce (Picea glauca [Moench] Voss), a softwood tree of major economic importance. Results A white spruce SNP resource encompassing 12,264 SNPs was constructed from a set of 6,459 contigs derived from Expressed Sequence Tags (EST) and by using the bayesian-based statistical software PolyBayes. Several parameters influencing the SNP prediction were analysed including the a priori expected polymorphism, the probability score (PSNP), and the contig depth and length. SNP detection in 3' and 5' reads from the same clones revealed a level of inconsistency between overlapping sequences as low as 1%. A subset of 245 predicted SNPs were verified through the independent resequencing of genomic DNA of a genotype also used to prepare cDNA libraries. The validation rate reached a maximum of 85% for SNPs predicted with either PSNP ≥ 0.95 or ≥ 0.99. A total of 9,310 SNPs were detected by using PSNP ≥ 0.95 as a criterion. The SNPs were distributed among 3,590 contigs encompassing an array of broad functional categories, with an overall frequency of 1 SNP per 700 nucleotide sites. Experimental and statistical approaches were used to evaluate the proportion of paralogous SNPs, with estimates in the range of 8 to 12%. The 3,789 coding SNPs identified through coding region annotation and ORF prediction, were distributed into 39% nonsynonymous and 61% synonymous substitutions. Overall, there were 0.9 SNP per 1,000 nonsynonymous sites and 5.2 SNPs per 1,000 synonymous sites, for a genome-wide nonsynonymous to synonymous substitution rate ratio (Ka/Ks) of 0.17. Conclusion We integrated the SNP data in the ForestTreeDB database along with functional annotations to provide a tool facilitating the choice of candidate genes for mapping purposes or association studies. PMID:16824208

Interleukin 18 receptor 1 gene polymorphisms are associated with asthma.

PubMed

Zhu, Guohua; Whyte, Moira K B; Vestbo, Jorgen; Carlsen, Karin; Carlsen, Kai-Håkon; Lenney, Warren; Silverman, Michael; Helms, Peter; Pillai, Sreekumar G

2008-09-01

The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined by genotyping seven SNPs in 294, 342 and 100 families from Denmark, United Kingdom and Norway and conducting family-based association analyses for asthma, atopic asthma and bronchial hyper-reactivity (BHR) phenotypes. Three SNPs in IL18R1 were associated with asthma (0.01131 < or = P < or = 0.01377), five with atopic asthma (0.00066 < or = P < or = 0.00405) and two with BHR (0.01450 < or = P < or = 0.03203) in the Danish population; two SNPs were associated with atopic asthma (0.00397 < or = P < or = 0.01481) and four with BHR (0.00435 < or = P < or = 0.03544) in the UK population; four SNPs showed associations with asthma (0.00015 < or = P < or = 0.03062), two with atopic asthma (0.01269 < or = P < or = 0.04042) and three with BHR (0.00259 < or = P < or = 0.01401) in the Norwegian population; five SNPs showed associations with asthma (0.00005 < or = P < or = 0.03744), five with atopic asthma (0.00001 < or = P < or = 0.04491) and three with BHR (0.03568 < or = P < or = 0.04778) in the combined population. Three intronic SNPs (rs1420099, rs1362348 and rs1974675) showed replicated association for at least one asthma-related phenotype. These results demonstrate significant association between polymorphisms in IL18R1 and asthma.

Canonical single nucleotide polymorphisms (SNPs) for high-resolution subtyping of Shiga-toxin producing Escherichia coli (STEC) O157:H7

USDA-ARS?s Scientific Manuscript database

The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...

Association of calpain 10 gene polymorphisms with type 2 diabetes mellitus in Southern Indians.

PubMed

Bodhini, Dhanasekaran; Radha, Venkatesan; Ghosh, Saurabh; Sanapala, Krishna R; Majumder, Partha P; Rao, Manchanahalli Rangaswamy Satyanarayana; Mohan, Viswanathan

2011-05-01

The aim was to investigate the association between the CAPN10 gene single nucleotide polymorphisms (SNPs) -44 (rs2975760), -43 (rs3792267), -19 (rs3842570), and -63 (rs5030952) and type 2 diabetes mellitus in an Asian Indian population in Southern India. A total of 1443 subjects, 794 normal glucose tolerant (NGT) and 649 type 2 diabetes mellitus subjects, were randomly selected from the Chennai Urban Rural Epidemiology Study. These subjects were genotyped for the 4 CAPN10 SNPs using polymerase chain reaction-restriction fragment length polymorphism and validated by direct sequencing. None of the 4 SNPs showed any significant differences in the genotypic distribution among the NGT and type 2 diabetes mellitus subjects (P = .20, .86, .34, and .39 for SNPs -44, -43, -19, and -63, respectively). The NGT subjects with the 11 genotype of the SNP -63 had significantly higher 2-hour postload plasma glucose (mean ± SD, 5.66 ± 1.05 mmol/L) levels compared with the combined 12 and 22 genotype group (5.33 ± 1.11 mmol/L, P = .004). The P value remained significant even after adjusting for age, sex, body mass index, smoking, and alcohol consumption (nominal P = .008). No significant difference in the biochemical parameters was observed when the subjects were stratified according to the other SNPs. The 2111 haplotype corresponding to SNPs -44, -43, -19, and -63 showed a significant difference in the proportion among NGT (0.18) and type 2 diabetes mellitus subjects (0.22, nominal P = .014). Although the Bonferroni correction based on the asymptotic test does not preserve this significance, the test based on the empirical distribution remained significant. In conclusion, our study raises the possibility that the 2111 haplotype of SNPs -44, -43, -19, and -63 may be associated with type 2 diabetes mellitus, although none of these SNPs may be individually associated with diabetes. Copyright © 2011 Elsevier Inc. All rights reserved.

Sequence Polymorphisms and Structural Variations among Four Grapevine (Vitis vinifera L.) Cultivars Representing Sardinian Agriculture

PubMed Central

Mercenaro, Luca; Nieddu, Giovanni; Porceddu, Andrea; Pezzotti, Mario; Camiolo, Salvatore

2017-01-01

The genetic diversity among grapevine (Vitis vinifera L.) cultivars that underlies differences in agronomic performance and wine quality reflects the accumulation of single nucleotide polymorphisms (SNPs) and small indels as well as larger genomic variations. A combination of high throughput sequencing and mapping against the grapevine reference genome allows the creation of comprehensive sequence variation maps. We used next generation sequencing and bioinformatics to generate an inventory of SNPs and small indels in four widely cultivated Sardinian grape cultivars (Bovale sardo, Cannonau, Carignano and Vermentino). More than 3,200,000 SNPs were identified with high statistical confidence. Some of the SNPs caused the appearance of premature stop codons and thus identified putative pseudogenes. The analysis of SNP distribution along chromosomes led to the identification of large genomic regions with uninterrupted series of homozygous SNPs. We used a digital comparative genomic hybridization approach to identify 6526 genomic regions with significant differences in copy number among the four cultivars compared to the reference sequence, including 81 regions shared between all four cultivars and 4953 specific to single cultivars (representing 1.2 and 75.9% of total copy number variation, respectively). Reads mapping at a distance that was not compatible with the insert size were used to identify a dataset of putative large deletions with cultivar Cannonau revealing the highest number. The analysis of genes mapping to these regions provided a list of candidates that may explain some of the phenotypic differences among the Bovale sardo, Cannonau, Carignano and Vermentino cultivars. PMID:28775732

Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

PubMed Central

Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

2013-01-01

Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

Association of TUSC1 and DPF3 gene polymorphisms with male infertility.

PubMed

Sato, Youichi; Hasegawa, Chise; Tajima, Atsushi; Nozawa, Shiari; Yoshiike, Miki; Koh, Eitetsue; Kanaya, Jiro; Namiki, Mikio; Matsumiya, Kiyomi; Tsujimura, Akira; Komatsu, Kiyoshi; Itoh, Naoki; Eguchi, Jiro; Yamauchi, Aiko; Iwamoto, Teruaki

2018-02-01

Recently, genome-wide association studies of a Hutterite population in the USA revealed that five single nucleotide polymorphisms (SNPs) with a significant association with sperm quality and/or function in ethnically diverse men from Chicago were significantly correlated with family size. Of these, three SNPs (rs7867029, rs7174015, and rs12870438) were found to be significantly associated with the risk of azoospermia and/or oligozoospermia in a Japanese population. In this study, we investigated whether the rs10966811 (located in an intergenic region between the TUSC1 and IZUMO3 genes) and rs10129954 (located in the DPF3 gene) SNPs, previously related to family size, are associated with male infertility. In addition, we performed association analysis between rs12348 in TUSC1 and rs2772579 in IZUMO3 and male infertility. We genotyped 145 patients with infertility (including 83 patients with azoospermia and 62 with oligozoospermia) and 713 fertile controls by PCR-RFLP technique for polymorphism. Because rs10966811 has no restriction sites, the SNP rs12376894 with strong linkage disequilibrium was selected as an alternative to rs10966811. There was a statistically significant association between rs12376894 proxy SNP of rs10966811 and oligozoospermia. Also, a statistically significant association between rs10129954 and azoospermia, and oligozoospermia was observed. When we assessed the relationship between rs12348 in TUSC1 and rs2772579 in IZUMO3 and male infertility traits, we found that rs12348 in TUSC1 was significantly associated with azoospermia and oligozoospermia, but rs2772579 in IZUMO3 was not associated with male infertility. We found that the polymorphisms in TUSC1 and DPF3 displayed strong associations with male infertility.

Contribution of myostatin gene polymorphisms to normal variation in lean mass, fat mass and peak BMD in Chinese male offspring.

PubMed

Yue, Hua; He, Jin-wei; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Ke, Yao-hua; Fu, Wen-zhen; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Wu, Song-hua; Zhang, Zhen-lin

2012-05-01

Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth. Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women. The purpose of this study was to investigate whether myostatin played a role in the normal variation in peak BMD, lean mass (LM), and fat mass (FM) of Chinese men. Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited. Anthropometric measurements, including the peak BMD, body LM and FM were measured using dual-energy X-ray absorptiometry (DXA). The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing. Both rs2293284 and +2278GA were genotyped using TaqMan assay, and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis. The associations of the SNPs with anthropometric variations were analyzed using the quantitative transmission disequilibrium test (QTDT). Using QTDT to detect within-family associations, neither single SNP nor haplotype was found to be associated with peak BMD at any bone site. However, rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001). Moreover, for within-family associations, haplotypes AGG, AAA, and TGG were found to be significantly associated with the trunk fat mass (all P<0.001). Our results suggest that genetic variation within myostatin may play a role in regulating the variation in fat mass in Chinese males. Additionally, the myostatin gene may be a candidate that determines body fat mass in Chinese men.

Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

PubMed

Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

2007-10-15

Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

Epidermal growth factor receptor pathway polymorphisms and the prognosis of hepatocellular carcinoma

PubMed Central

Wang, Wenjia; Ma, Xiao-Pin; Shi, Zhuqing; Zhang, Pengyin; Ding, Dong-Lin; Huang, Hui-Xing; Saiyin, Hexi Ge; Chen, Tao-Yang; Lu, Pei-Xin; Wang, Neng-Jin; Yu, Hongjie; Sun, Jielin; Zheng, S Lilly; Yu, Long; Xu, Jianfeng; Jiang, De-Ke

2015-01-01

The EGFR signaling pathway is important in the control of vital processes in the carcinogenesis of hepatocellular carcinoma (HCC), including cell survival, cell cycle progression, tumor invasion and angiogenesis. In the current study, we aim to assess if genetic variants in the genes of the EGFR signaling pathway are associated with the prognosis of HCC. We genotyped 36 single nucleotide polymorphisms (SNP) in four core genes (EGF, EGFR, VEGF, and VEGFR2) by using DNA from blood samples of 363 HCC patients with surgical resection. The associations between genotypes and overall survival (OS) and disease-free survival (DFS) were estimated using the Kaplan-Meier method. Hazard ratios (HRs) and 95% confident intervals (CIs) were estimated for the multivariate survival analyses by Cox proportional hazards regression models, adjusting for age, gender, family history, HBsAg and AFP. We found that five SNPs in the VEGFR2 gene were significantly associated with clinical outcomes of HCC patients. Among them, four SNPs (rs7692791, rs2305948, rs13109660, rs6838752) were associated with OS (p=0.035, 0.038, 0.029 and 0.028, respectively), and two SNPs (rs7692791 and rs2034965) were associated with DFS (p=0.039 and 0.017, respectively). Particularly, rs7692791 TT genotype was associated with both reduced OS (p=0.037) and DFS (p=0.043). However, only one SNP rs2034965 with the AA genotype was shown to be an independent effect on DFS (p=0.009) in the multivariate analysis. None of the other 31 polymorphisms or 9 haplotypes attained from the four genes was significantly associated with OS or DFS. Our results illustrated the potential use of VEGFR2 polymorphisms as prognostic markers for HCC patients. PMID:25628948

Associations of polymorphisms in circadian genes with abdominal obesity in Chinese adult population.

PubMed

Ye, Ding; Cai, Shaofang; Jiang, Xiyi; Ding, Ye; Chen, Kun; Fan, Chunhong; Jin, Mingjuan

2016-09-01

Circadian rhythm, which is controlled by circadian genes, regulates metabolic balance including the circulating levels of glucose, fatty acids, triglycerides, various hormones and so on. The study aimed to investigate the impact of potential polymorphisms in circadian genes on abdominal obesity among Chinese Han adults. A total of 260 cases with abdominal obesity and 260 controls were recruited by individual matching. Demographic characteristics and lifestyle information were collected by a validated questionnaire, and anthropometric parameters was measured by physical examination. Twenty-three single nucleotide polymorphisms (SNPs) in three circadian genes, CLOCK, CRY1 and CRY2, were genotyped by MassArray technique. Five SNPs significantly deviated from Hardy-Weinberg equilibrium (HWE) among controls, so eighteen SNPs were taken into logistic regression analysis. Independently, CLOCK rs10002541 (CC genotype vs. TT genotype: OR: 0.45, 95% CI: 0.23-0.86), CLOCK rs6850524 (CC genotype vs. GG genotype: OR: 0.50, 95% CI: 0.25-0.99) and CRY1 rs10861688 (TT genotype vs. CC genotype: OR: 0.50, 95% CI: 0.25-0.97) were negatively associated with the risk of abdominal obesity. Haplotype analysis showed that the haplotypes of CG and TG for CLOCK rs10002541 and rs4864546 had significant associations with abdominal obesity. Compared with the carriers of TA, those of CG were observed to have a lower risk (OR: 0.74, 95% CI: 0.56-0.99) of abdominal obesity, and those of TG presented a higher risk (OR: 1.70, 95% CI: 1.03-2.81). Our findings suggest that CLOCK and CRY1 polymorphisms might be involved in individual susceptibility to abdominal obesity in Chinese Han population. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

Haplotype combination of the bovine INSIG1 gene sequence variants and association with growth traits in Nanyang cattle.

PubMed

Sun, Jiajie; Gao, Yuan; Liu, Dong; Ma, Wei; Xue, Jing; Zhang, Chunlei; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

2012-06-01

The insulin-induced gene 1 (INSIG1) gene encodes a protein that blocks proteolytic activation of sterol regulatory element binding proteins, which are transcription factors that activate genes that regulate cholesterol, fatty acid, and glucose metabolism. However, similar research for the bovine INSIG1 gene is lacking. Therefore, in this study, polymorphisms of the bovine INSIG1 gene were detected in 643 individuals from four cattle breeds by DNA pooling, forced PCR-RFLP, PCR-SSCP, and DNA sequencing methods. Only 10 novel SNPs were identified, which included four mutations in the coding region and the others in the introns. In Nanyang individuals, seven common haplotypes were identified based on four coding region SNPs. The haplotype GACT, with a frequency of 75.4%, was the most prevalent haplotypes and SNPs formed two linkage disequilibrium blocks with strong multi-allelic D' (D' = 1). Additionally, association analysis between mutations of the bovine INSIG1 gene and growth traits in Nanyang cattle at 6, 12, 18, and 24 months old was performed, and the results indicated that the polymorphisms were not significantly associated with body mass.

TPH2 gene polymorphisms in the regulatory region are associated with paranoid schizophrenia in Northern Han Chinese.

PubMed

Xu, X M; Ding, M; Pang, H; Wang, B J

2014-03-12

In the last years, serotonin (5-HT) has been related with the pathophysiology of several psychiatric disorders, including schizophrenia. Thus, genes related to the serotonergic (5-HTergic) system are good candidate genes for schizophrenia. The rate-limiting enzyme of 5-HT synthesis is tryptophan hydroxylase 2 (TPH2). Single nucleotide polymorphisms (SNPs) in the regulatory regions of TPH2 gene may affect gene expression and biosynthesis of 5-HT triggering to various neuropsychiatric disorders related to 5-HT dysfunction. The present study explored the association of SNPs within the TPH2 gene with paranoid schizophrenia in Han Chinese. A total of 164 patients with schizophrenia and 244 healthy controls were genotyped for six TPH2 SNPs (rs4570625, rs11178997, rs11178998, rs41317118, rs17110747, and rs41317114). Significant group differences were observed in the allele and genotype frequencies of rs4570625 and in the frequencies of GTA and TTA haplotypes corresponding to rs4570625-rs11178997-rs11178998. Our findings suggest that common genetic variations of TPH2 are likely to contribute to genetic susceptibility to paranoid schizophrenia in Han Chinese. Further studies in larger samples are needed to replicate this association.

Relationship between genetic polymorphisms in the DRD5 gene and paranoid schizophrenia in northern Han Chinese.

PubMed

Zhao, Y; Ding, M; Pang, H; Xu, X M; Wang, B J

2014-03-12

Dopamine (DA) has been implicated in the pathophysiol-ogy of several psychiatric disorders, including schizophrenia. Thus, genes related to the dopaminergic (DAergic) system are good candidate genes for schizophrenia. One of receptors of the DA receptor system is dopa-mine receptor 5 (DRD5). Single nucleotide polymorphisms (SNPs) in the regulatory regions of DRD5 gene may affect gene expression, influence biosynthesis of DA and underlie various neuropsychiatric disorders re-lated to DA dysfunction. The present study explored the association of SNPs within the DRD5 gene with paranoid schizophrenia in Han Chinese. A total of 176 patients with schizophrenia and 206 healthy controls were genotyped for four DRD5 SNPs (rs77434921, rs2076907, rs6283, and rs1800762). Significant group differences were observed in the allele and genotype frequencies of rs77434921 and rs1800762 and in the frequen-cies of GC haplotypes corresponding to rs77434921-rs1800762. Our find-ings suggest that common genetic variations of DRD5 are likely to con-tribute to genetic susceptibility to paranoid schizophrenia in Han Chinese. Further studies in larger samples are needed to replicate this association.

Elastic-net regularization approaches for genome-wide association studies of rheumatoid arthritis.

PubMed

Cho, Seoae; Kim, Haseong; Oh, Sohee; Kim, Kyunga; Park, Taesung

2009-12-15

The current trend in genome-wide association studies is to identify regions where the true disease-causing genes may lie by evaluating thousands of single-nucleotide polymorphisms (SNPs) across the whole genome. However, many challenges exist in detecting disease-causing genes among the thousands of SNPs. Examples include multicollinearity and multiple testing issues, especially when a large number of correlated SNPs are simultaneously tested. Multicollinearity can often occur when predictor variables in a multiple regression model are highly correlated, and can cause imprecise estimation of association. In this study, we propose a simple stepwise procedure that identifies disease-causing SNPs simultaneously by employing elastic-net regularization, a variable selection method that allows one to address multicollinearity. At Step 1, the single-marker association analysis was conducted to screen SNPs. At Step 2, the multiple-marker association was scanned based on the elastic-net regularization. The proposed approach was applied to the rheumatoid arthritis (RA) case-control data set of Genetic Analysis Workshop 16. While the selected SNPs at the screening step are located mostly on chromosome 6, the elastic-net approach identified putative RA-related SNPs on other chromosomes in an increased proportion. For some of those putative RA-related SNPs, we identified the interactions with sex, a well known factor affecting RA susceptibility.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

2014-05-01

This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P < 0.05) were identified by logistic regression analysis, but results were insignificant after Bonferroni correction. Six SNPs formed a linkage disequilibrium block, and three main haplotypes were found. Two of three haplotypes (AAAGAA and GGGAGG) distributed highly in the POF group, whereas the remaining haplotype (GGAAGG) distributed highly in the control group by logistic regression analysis (highest odds ratio, 2.515; 95% CI, 1.515-4.175; P = 0.00036). Our observations suggest that genetic variations in the FANCA gene may increase the risk for POF in Korean women.

Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

PubMed

Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

2018-02-01

The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

PubMed

Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

2009-07-01

Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

PubMed Central

Hein, David W.

2009-01-01

Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

PubMed

Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

2012-05-01

Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures.

PubMed

Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J

2006-01-01

The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.

Transposon Insertions, Structural Variations, and SNPs Contribute to the Evolution of the Melon Genome.

PubMed

Sanseverino, Walter; Hénaff, Elizabeth; Vives, Cristina; Pinosio, Sara; Burgos-Paz, William; Morgante, Michele; Ramos-Onsins, Sebastián E; Garcia-Mas, Jordi; Casacuberta, Josep Maria

2015-10-01

The availability of extensive databases of crop genome sequences should allow analysis of crop variability at an unprecedented scale, which should have an important impact in plant breeding. However, up to now the analysis of genetic variability at the whole-genome scale has been mainly restricted to single nucleotide polymorphisms (SNPs). This is a strong limitation as structural variation (SV) and transposon insertion polymorphisms are frequent in plant species and have had an important mutational role in crop domestication and breeding. Here, we present the first comprehensive analysis of melon genetic diversity, which includes a detailed analysis of SNPs, SV, and transposon insertion polymorphisms. The variability found among seven melon varieties representing the species diversity and including wild accessions and highly breed lines, is relatively high due in part to the marked divergence of some lineages. The diversity is distributed nonuniformly across the genome, being lower at the extremes of the chromosomes and higher in the pericentromeric regions, which is compatible with the effect of purifying selection and recombination forces over functional regions. Additionally, this variability is greatly reduced among elite varieties, probably due to selection during breeding. We have found some chromosomal regions showing a high differentiation of the elite varieties versus the rest, which could be considered as strongly selected candidate regions. Our data also suggest that transposons and SV may be at the origin of an important fraction of the variability in melon, which highlights the importance of analyzing all types of genetic variability to understand crop genome evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

PubMed

Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

2016-08-01

Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Copy number variants and genetic polymorphisms in TBX21, GATA3, Rorc, Foxp3 and susceptibility to Behcet's disease and Vogt-Koyanagi-Harada syndrome.

PubMed

Liao, Dan; Hou, Shengping; Zhang, Jun; Fang, Jing; Liu, Yunjia; Bai, Lin; Cao, Qingfeng; Kijlstra, Aize; Yang, Peizeng

2015-04-15

This study aimed to investigate the role of genetic variants including single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) of TBX21, GATA3, Rorc and Foxp3 genes in Behcet's disease (BD) and Vogt-Koyanagi-Harada (VKH) syndrome in a Chinese Han population. Genotyping of 25 SNPs was performed by iPLEX system (Sequenom) or polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). TaqMan real time PCR was used to assess CNVs. The expression of Rorc and Foxp3 were examined by real-time PCR and cytokine production was measured by ELISA. High Rorc CNV was associated with the susceptibility to BD (P = 8.99 × 10(-8), OR = 3.0), and low Foxp3 CNV predisposed to BD in female patients (P = 1.92 × 10(-5), OR = 3.1). CNVs for the investigated genes were not altered in VKH syndrome. Further functional studies demonstrated that the relative mRNA expression levels of Rorc were increased in individuals with high Rorc copy number, but not for Foxp3. Increased production of IL-1β and IL-6 was found in individuals carrying a high CNV of Rorc. Our study showed that high CNVs of Rorc and low CNVs of Foxp3 confer risk for BD but not for VKH syndrome. The tested 25 SNPs in TBX21, GATA3, Rorc and Foxp3 did not associate with BD and VKH syndrome.

Association of vascular endothelial growth factor (VEGF) gene polymorphism and increased serum VEGF concentration with pancreatic adenocarcinoma.

PubMed

Sivaprasad, Siddapuram; Govardhan, Bale; Harithakrishna, Ramanujam; Venkat Rao, Guduru; Pradeep, Rebala; Kunal, Bharadhwaj; Ramakrishna, Nalla; Anuradha, Shekaran; Reddy, Duvvuru Nageshwar

2013-01-01

BACKGROUND &AIM: Pancreatic cancer is related to high mortality rate. The vascular endothelial growth factor (VEGF) has a strong influence in tumor-related angiogenesis having association with the grade of angiogenesis and the prognosis of different solid tumors including pancreatic cancer. The present study was aimed to analyze the genotype and haplotype distribution of VEGF gene single nucleotide polymorphisms (SNPs), -460T/C, +405G/C, +936C/T, in patients with pancreatic adenocarcinoma from South India, and the effect of these SNPs on serum VEGF level. Total 80 patients with pancreatic adenocarcinoma and 87 controls were recruited. The genotype of VEGF gene polymorphisms was determined in both patients and controls using polymerase chain reaction-restriction fragment length polymorphism method. The serum VEGF protein was estimated by standard enzyme-linked immunosorbent assay. The genotype, +405G/G of VEGF gene showed a significant association with the patients with pancreatic adenocarcinoma (P = 0.012, Odds ratio: 2.133), whereas no significant difference was found in the genotype distribution of SNPs, -460C/T and +936C/T between patient and control groups (P > 0.05). Serum VEGF level was found to be significantly high in patients (1315.10 pg/Ml, SD ± 230.79) when compared to controls (591.35 pg/mL, SD ± 92.48) (P < 0.0001), which showed a strong genotype-phenotype correlation between genotype +405G/G and serum VEGF level. Further, the haplotype C-G-T showed a strong association with the disease, and no specific haplotype was associated with increased serum VEGF level. The polymorphism, +405G/C but not -460T/C and +936C/T, of VEGF gene is strongly associated with pancreatic adenocarcinoma, and this SNP has significant influence on serum VEGF level. Copyright © 2013 IAP and EPC. Published by Elsevier B.V. All rights reserved.

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

A brain-derived neurotrophic factor polymorphism Val66Met identifies fibromyalgia syndrome subgroup with higher body mass index and C-reactive protein.

PubMed

Xiao, Yangming; Russell, I Jon; Liu, Ya-Guang

2012-08-01

A common single nucleotide polymorphism (SNP) in the gene of brain-derived neurotrophic factor (BDNF) results from a substitution at position 66 from valine (Val) to methionine (Met) and may predispose to human neuropsychiatric disorders. We proposed to determine whether these BDNF gene SNPs were associated with fibromyalgia syndrome (FMS) and/or any of its typical phenotypes. Patients with FMS (N = 95) and healthy normal controls (HNC, N = 58) were studied. Serum high-sensitivity C-reactive protein (hsCRP) levels were measured using an enzyme-linked immunosorbent assay (ELISA). The BDNF SNPs were determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).The BDNF SNP distribution was 65 (68%) Val/Val, 28 (30%) Val/Met, and 2 (2%) Met/Met for FMS and 40 (69%), 17(29%), and 1 (2%) for HNC, respectively. The serum high-sensitivity C-reactive protein (hsCRP)and body mass index (BMI) in FMS were higher than in HNC. The FMS with BDNF Val66Val had significantly higher mean BMI (P = 0.0001) and hsCRP (P = 0.02) than did FMS carrying the Val66Met genotype. This pattern was not found in HNC. Phenotypic measures of subjective pain, pain threshold, depression, or insomnia did not relate to either of the BDNF SNPs in FMS. The relative distribution BDNF SNPs did not differ between FMS and HNC. The BDNF Val66Met polymorphism is not selective for FMS. The BDNF Val66Val SNP identifies a subgroup of FMS with elevated hsCRP and higher BMI. This is the first study to associate a BDNF polymorphism with a FMS subgroup phenotype.

Genome-wide association study of sporadic brain arteriovenous malformations.

PubMed

Weinsheimer, Shantel; Bendjilali, Nasrine; Nelson, Jeffrey; Guo, Diana E; Zaroff, Jonathan G; Sidney, Stephen; McCulloch, Charles E; Al-Shahi Salman, Rustam; Berg, Jonathan N; Koeleman, Bobby P C; Simon, Matthias; Bostroem, Azize; Fontanella, Marco; Sturiale, Carmelo L; Pola, Roberto; Puca, Alfredo; Lawton, Michael T; Young, William L; Pawlikowska, Ludmila; Klijn, Catharina J M; Kim, Helen

2016-09-01

The pathogenesis of sporadic brain arteriovenous malformations (BAVMs) remains unknown, but studies suggest a genetic component. We estimated the heritability of sporadic BAVM and performed a genome-wide association study (GWAS) to investigate association of common single nucleotide polymorphisms (SNPs) with risk of sporadic BAVM in the international, multicentre Genetics of Arteriovenous Malformation (GEN-AVM) consortium. The Caucasian discovery cohort included 515 BAVM cases and 1191 controls genotyped using Affymetrix genome-wide SNP arrays. Genotype data were imputed to 1000 Genomes Project data, and well-imputed SNPs (>0.01 minor allele frequency) were analysed for association with BAVM. 57 top BAVM-associated SNPs (51 SNPs with p<10(-05) or p<10(-04) in candidate pathway genes, and 6 candidate BAVM SNPs) were tested in a replication cohort including 608 BAVM cases and 744 controls. The estimated heritability of BAVM was 17.6% (SE 8.9%, age and sex-adjusted p=0.015). None of the SNPs were significantly associated with BAVM in the replication cohort after correction for multiple testing. 6 SNPs had a nominal p<0.1 in the replication cohort and map to introns in EGFEM1P, SP4 and CDKAL1 or near JAG1 and BNC2. Of the 6 candidate SNPs, 2 in ACVRL1 and MMP3 had a nominal p<0.05 in the replication cohort. We performed the first GWAS of sporadic BAVM in the largest BAVM cohort assembled to date. No GWAS SNPs were replicated, suggesting that common SNPs do not contribute strongly to BAVM susceptibility. However, heritability estimates suggest a modest but significant genetic contribution. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Genetic Variants in SDC3 Gene are Significantly Associated with Growth Traits in Two Chinese Beef Cattle Breeds.

PubMed

Huang, Yong-Zhen; Wang, Qin; Zhang, Chun-Lei; Fang, Xing-Tang; Song, En-Liang; Chen, Hong

2016-01-01

Identification of the genes and polymorphisms underlying quantitative traits, and understanding these genes and polymorphisms affect economic growth traits, are important for successful marker-assisted selection and more efficient management strategies in commercial cattle (Bos taurus) population. Syndecan-3 (SDC3), a member of the syndecan family of type I transmembrane heparan sulfate proteoglycans is a novel regulator of feeding behavior and body weight. The aim of this study is to examine the association of the SDC3 polymorphism with growth traits in Chinese Jiaxian and Qinchuan cattle breeds (). Four single nucleotide polymorphisms (SNPs: 1-4) were detected in 555 cows from three Chinese native cattle breeds by means of sequencing pooled DNA samples and polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP) methods. We found one SNP (g.28362A > G) in intron and three SNPs (g.30742T > G, g.30821C > T and 33418 A > G) in exons. The statistical analyses indicated that these SNPs of SDC3 gene were associated with bovine body height, body length, chest circumference, and circumference of cannon bone (P < 0.05). The mutant-type variant was superior for growth traits; the heterozygote was associated with higher growth traits compared to wild-type homozygote. Our result confirms the polymorphisms in the SDC3 gene are associated with growth traits that may be used for marker-assisted selection in beef cattle breeding programs.

Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

USDA-ARS?s Scientific Manuscript database

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

Genome-wide association study of alcohol dependence

PubMed Central

Treutlein, Jens; Cichon, Sven; Ridinger, Monika; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Moessner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Fehr, Christoph; Scherbaum, Norbert; Steffens, Michael; Ludwig, Kerstin U.; Frank, Josef; Wichmann, H.- Erich; Schreiber, Stefan; Dragano, Nico; Sommer, Wolfgang; Leonardi-Essmann, Fernando; Lourdusamy, Anbarasu; Gebicke-Haerter, Peter; Wienker, Thomas F.; Sullivan, Patrick F.; Nöthen, Markus M.; Kiefer, Falk; Spanagel, Rainer; Mann, Karl; Rietschel, Marcella

2014-01-01

Context Identification of genes contributing to alcohol dependence will improve our understanding of the mechanisms underlying this disorder. Objective To identify susceptibility genes for alcohol dependence through a genome-wide association study (GWAS) and follow-up study in a population of German male inpatients with an early age at onset. Design The GWAS included 487 male inpatients with DSM-IV alcohol dependence with an age at onset below 28 years and 1,358 population based control individuals. The follow-up study included 1,024 male inpatients and 996 age-matched male controls. All subjects were of German descent. The GWAS tested 524,396 single nucleotide polymorphisms (SNPs). All SNPs with p<10-4 were subjected to the follow-up study. In addition, nominally significant SNPs from those genes that had also shown expression changes in rat brains after chronic alcohol consumption were selected for the follow-up step. Results The GWAS produced 121 SNPs with nominal p<10-4. These, together with 19 additional SNPs from homologs of rat genes showing differential expression, were genotyped in the follow-up sample. Fifteen SNPs showed significant association with the same allele as in the GWAS. In the combined analysis, two closely linked intergenic SNPs met genome-wide significance (rs7590720 p=9.72×10-9; rs1344694 p=1.69×10-8). They are located on chromosome 2q35, a region which has been implicated in linkage studies for alcohol phenotypes. Nine SNPs were located in genes, including CDH13 and ADH1C genes which have been reported to be associated with alcohol dependence. Conclusion This is the first GWAS and follow-up study to identify a genome-wide significant association in alcohol dependence. Further independent studies are required to confirm these findings. PMID:19581569

Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients

PubMed Central

Li, Jingjie; Yan, Mengdan; Xie, Zhilan; Zhu, Yuanyuan; Chen, Chao; Jin, Tianbo

2016-01-01

Previous studies suggested that single nucleotide polymorphisms (SNPs) in epidermal growth factor receptor (EGFR) are associated with risk of glioma. However, the associations between these SNPs and glioma patient prognosis have not yet been fully investigated. Therefore, the present study was aimed to evaluate the effects of EGFR polymorphisms on the glioma patient prognosis. We retrospectively evaluated 269 glioma patients and investigated associations between EGFR SNPs and patient prognosis using Cox proportional hazard models and Kaplan-Meier curves. Univariate analysis revealed that age, gross-total resection and chemotherapy were associated with the prognosis of glioma patients (p < 0.05). In addition, four EGFR SNPs (rs11506105, rs3752651, rs1468727 and rs845552) correlated with overall survival (OS) (Log-rank p = 0.011, 0.020, 0.008, and 0.009, respectively) and progression-free survival PFS (Log-rank p = 0.026, 0.024, 0.019 and 0.009, respectively). Multivariate analysis indicated that the rs11506105 G/G genotype, the rs3752651 and rs1468727 C/C genotype and the rs845552 A/A genotype correlated inversely with OS and PFS. In addition, OS among patients with the rs730437 C/C genotype (p = 0.030) was significantly lower OS than among patients with A/A genotype. These data suggest that five EGFR SNPs (rs11506105, rs3752651, rs1468727, rs845552 and rs730437) correlated with glioma patient prognosis, and should be furthered validated in studies of ethnically diverse patients. PMID:27437777

A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

PubMed

Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

2005-02-01

A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

PubMed

Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

2015-11-05

Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

PubMed

Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

2017-07-01

The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Genetic Variation in the Transforming Growth Factor-β Signaling Pathway and Survival After Diagnosis With Colon and Rectal Cancer

PubMed Central

Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Wolff, Roger K.; Caan, Bette J.

2012-01-01

BACKGROUND The transforming growth factor-β (TGF-β) signaling pathway is involved in many aspects of tumori-genesis, including angiogenesis and metastasis. The authors evaluated this pathway in association with survival after a diagnosis of colon or rectal cancer. METHODS The study included 1553 patients with colon cancer and 754 patients with rectal cancer who had incident first primary disease and were followed for a minimum of 7 years after diagnosis. Genetic variations were evaluated in the genes TGF-β1 (2 single nucleotide polymorphisms [SNPs]), TGF-β receptor 1 (TGF-βR1) (3 SNPs), smooth muscle actin/mothers against decapentaplegic homolog 1 (Smad1) (5 SNPs), Smad2 (4 SNPs), Smad3 (37 SNPs), Smad4 (2 SNPs), Smad7 (11 SNPs), bone morphogenetic protein 1 (BMP1) (11 SNPs), BMP2 (5 SNPs), BMP4 (3 SNPs), bone morphogenetic protein receptor 1A (BMPR1A) (9 SNPs), BMPR1B (21 SNPs), BMPR2 (11 SNPs), growth differentiation factor 10 (GDF10) (7 SNPs), Runt-related transcription factor 1 (RUNX1) (40 SNPs), RUNX2 (19 SNPs), RUNX3 (9 SNPs), eukaryotic translation initiation factor 4E (eiF4E) (3 SNPs), eukaryotic translation initiation factor 4E-binding protein 3 (eiF4EBP2) (2 SNPs), eiF4EBP3 (2 SNPs), and mitogen-activated protein kinase 1 (MAPK1) (6 SNPs). RESULTS After adjusting for American Joint Committee on Cancer stage and tumor molecular phenotype, 12 genes and 18 SNPs were associated with survival in patients with colon cancer, and 7 genes and 15 tagSNPs were associated with survival after a diagnosis of rectal cancer. A summary score based on “at-risk” genotypes revealed a hazard rate ratio of 5.10 (95% confidence interval, 2.56-10.15) for the group with the greatest number of “at-risk” genotypes; for rectal cancer, the hazard rate ratio was 6.03 (95% confidence interval, 2.83-12.75). CONCLUSIONS The current findings suggest that the presence of several higher risk alleles in the TGF-β signaling pathway increase the likelihood of dying after a diagnosis of colon or rectal cancer. PMID:21365634

Capturing haplotypes in germplasm core collections

USDA-ARS?s Scientific Manuscript database

Genomewide data sets of single nucleotide polymorphisms (SNPs) offer great potential to improve ex situ conservation. Two factors impede their use for producing core collections. First, due to the large number of SNPs, the assembly of collections that maximize diversity may be intractable using ex...

Marker-assisted backcross approach for important agronomic traits of sorghum

USDA-ARS?s Scientific Manuscript database

Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

eQTL networks unveil enriched mRNA master integrators downstream of complex disease-associated SNPs.

PubMed

Li, Haiquan; Pouladi, Nima; Achour, Ikbel; Gardeux, Vincent; Li, Jianrong; Li, Qike; Zhang, Hao Helen; Martinez, Fernando D; 'Skip' Garcia, Joe G N; Lussier, Yves A

2015-12-01

The causal and interplay mechanisms of Single Nucleotide Polymorphisms (SNPs) associated with complex diseases (complex disease SNPs) investigated in genome-wide association studies (GWAS) at the transcriptional level (mRNA) are poorly understood despite recent advancements such as discoveries reported in the Encyclopedia of DNA Elements (ENCODE) and Genotype-Tissue Expression (GTex). Protein interaction network analyses have successfully improved our understanding of both single gene diseases (Mendelian diseases) and complex diseases. Whether the mRNAs downstream of complex disease genes are central or peripheral in the genetic information flow relating DNA to mRNA remains unclear and may be disease-specific. Using expression Quantitative Trait Loci (eQTL) that provide DNA to mRNA associations and network centrality metrics, we hypothesize that we can unveil the systems properties of information flow between SNPs and the transcriptomes of complex diseases. We compare different conditions such as naïve SNP assignments and stringent linkage disequilibrium (LD) free assignments for transcripts to remove confounders from LD. Additionally, we compare the results from eQTL networks between lymphoblastoid cell lines and liver tissue. Empirical permutation resampling (p<0.001) and theoretic Mann-Whitney U test (p<10(-30)) statistics indicate that mRNAs corresponding to complex disease SNPs via eQTL associations are likely to be regulated by a larger number of SNPs than expected. We name this novel property mRNA hubness in eQTL networks, and further term mRNAs with high hubness as master integrators. mRNA master integrators receive and coordinate the perturbation signals from large numbers of polymorphisms and respond to the personal genetic architecture integratively. This genetic signal integration contrasts with the mechanism underlying some Mendelian diseases, where a genetic polymorphism affecting a single protein hub produces a divergent signal that affects a large number of downstream proteins. Indeed, we verify that this property is independent of the hubness in protein networks for which these mRNAs are transcribed. Our findings provide novel insights into the pleiotropy of mRNAs targeted by complex disease polymorphisms and the architecture of the information flow between the genetic polymorphisms and transcriptomes of complex diseases. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

PubMed

Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

2018-01-01

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity within each population. We also provide functional annotation based on the genome position of each SNP and evaluate the use of clonal lines for filtering of PSVs and MSVs. These SNPs form a new database, which provides an important resource for a new high density SNP array design and for other SNP genotyping platforms used for genetic and genomics studies of this iconic salmonid fish species.

Using microarray analysis to evaluate genetic polymorphisms involved in the metabolism of environmental chemicals.

PubMed

Ban, Susumu; Kondo, Tomoko; Ishizuka, Mayumi; Sasaki, Seiko; Konishi, Kanae; Washino, Noriaki; Fujita, Syoichi; Kishi, Reiko

2007-05-01

The field of molecular biology currently faces the need for a comprehensive method of evaluating individual differences derived from genetic variation in the form of single nucleotide polymorphisms (SNPs). SNPs in human genes are generally considered to be very useful in determining inherited genetic disorders, susceptibility to certain diseases, and cancer predisposition. Quick and accurate discrimination of SNPs is the key characteristic of technology used in DNA diagnostics. For this study, we first developed a DNA microarray and then evaluated its efficacy by determining the detection ability and validity of this method. Using DNA obtained from 380 pregnant Japanese women, we examined 13 polymorphisms of 9 genes, which are associated with the metabolism of environmental chemical compounds found in high frequency among Japanese populations. The ability to detect CYP1A1 I462V, CYP1B1 L432V, GSTP1 I105V and AhR R554K gene polymorphisms was above 98%, and agreement rates when compared with real time PCR analysis methods (kappa values) showed high validity: 0.98 (0.96), 0.97 (0.93), 0.90 (0.81), 0.90 (0.91), respectively. While this DNA microarray analysis should prove important as a method for initial screening, it is still necessary that we find better methods for improving the detection of other gene polymorphisms not part of this study.

Genetic Diversity in the Prion Protein Gene (PRNP) of Domestic Cattle and Water Buffaloes in Vietnam, Indonesia and Thailand

PubMed Central

UCHIDA, Leo; HERIYANTO, Agus; THONGCHAI, Chalermchaikit; HANH, Tran Thi; HORIUCHI, Motohiro; ISHIHARA, Kanako; TAMURA, Yutaka; MURAMATSU, Yasukazu

2014-01-01

ABSTRACT There has been an accumulation of information on frequencies of insertion/deletion (indel) polymorphisms within the bovine prion protein gene (PRNP) and on the number of octapeptide repeats and single nucleotide polymorphisms (SNPs) in the coding region of bovine PRNP related to bovine spongiform encephalopathy (BSE) susceptibility. We investigated the frequencies of 23-bp indel polymorphism in the promoter region (23indel) and 12-bp indel polymorphism in intron 1 region (12indel), octapeptide repeat polymorphisms and SNPs in the bovine PRNP of cattle and water buffaloes in Vietnam, Indonesia and Thailand. The frequency of the deletion allele in the 23indel site was significantly low in cattle of Indonesia and Thailand and water buffaloes. The deletion allele frequency in the 12indel site was significantly low in all of the cattle and buffaloes categorized in each subgroup. In both indel sites, the deletion allele has been reported to be associated with susceptibility to classical BSE. In some Indonesian local cattle breeds, the frequency of the allele with 5 octapeptide repeats was significantly high despite the fact that the allele with 6 octapeptide repeats has been reported to be most frequent in many breeds of cattle. Four SNPs observed in Indonesian local cattle have not been reported for domestic cattle. This study provided information on PRNP of livestock in these Southeast Asian countries. PMID:24705506

Transcriptome characterization and polymorphism detection between subspecies of big sagebrush (Artemisia tridentata)

PubMed Central

2011-01-01

Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Polymorphisms in genes related to inflammation and obesity and colorectal adenoma risk.

PubMed

Huang, Brian Z; Tsilidis, Konstantinos K; Smith, Michael W; Hoffman-Bolton, Judith; Visvanathan, Kala; Platz, Elizabeth A; Joshu, Corinne E

2018-05-26

We previously investigated the association between single nucleotide polymorphisms (SNPs) in genes related to obesity and inflammation and colorectal cancer in the CLUE II cohort. However, the relationships between these SNPs and colorectal adenomas have not been well evaluated. In a nested case-control study of 135 incident adenoma cases and 269 matched controls in the CLUE II cohort (1989-2000), we genotyped 17 candidate SNPs in 12 genes (PPARG, TCF7L2, ADIPOQ, LEP, IL10, CRP, TLR4, IL6, IL1B, IL8, TNF, RNASEL) and 19 tagSNPs in three genes (IL10, CRP, and TLR4). Conditional logistic regression was used to calculate odds ratios (OR) for adenomas (overall and by size, histology, location, number). Polymorphisms in the inflammatory-related genes CRP, ADIPOQ, IL6, and TLR4 were observed to be associated with adenoma risk. At rs1205 in CRP, T (minor allele) carriers had a higher risk (OR 1.67, 95%CI 1.07-2.60; reference: CC) of adenomas overall and adenomas with aggressive characteristics. At rs1201299 in ADIPOQ, the AC genotype had a higher risk (OR 1.58, 95%CI 1.00-2.49) of adenomas, while the minor AA genotype had a borderline inverse association (OR 0.44, 95%CI 0.18-1.08; reference: CC). At rs1800797 in IL6, the AA genotype had a borderline inverse association (OR 0.53, 95%CI 0.27-1.05; reference: GG). Three TLR4 tagSNPs (rs10116253, rs1927911, rs7873784) were associated with adenomas among obese participants. None of these SNPs were associated with colorectal cancer in our prior study in CLUE II, possibly suggesting a different genetic etiology for early colorectal neoplasia. © 2018 Wiley Periodicals, Inc.

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies

PubMed Central

Gimode, Davis; Odeny, Damaris A.; de Villiers, Etienne P.; Wanyonyi, Solomon; Dida, Mathews M.; Mneney, Emmarold E.; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M.

2016-01-01

Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional breeding programs in order to efficiently optimize productivity. PMID:27454301

Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

PubMed

Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M

2016-01-01

Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional breeding programs in order to efficiently optimize productivity.

Replication of Caucasian Loci Associated with Osteoporosis-related Traits in East Asians

PubMed Central

Kim, Beom-Jun; Ahn, Seong Hee; Kim, Hyeon-Mok; Ikegawa, Shiro; Yang, Tie-Lin; Guo, Yan; Deng, Hong-Wen; Koh, Jung-Min

2016-01-01

Background Most reported genome-wide association studies (GWAS) seeking to identify the loci of osteoporosis-related traits have involved Caucasian populations. We aimed to identify the single nucleotide polymorphisms (SNPs) of osteoporosis-related traits among East Asian populations from the bone mineral density (BMD)-related loci of an earlier GWAS meta-analysis. Methods A total of 95 SNPs, identified at the discovery stage of the largest GWAS meta-analysis of BMD, were tested to determine associations with osteoporosis-related traits (BMD, osteoporosis, or fracture) in Korean subjects (n=1,269). The identified SNPs of osteoporosis-related traits in Korean subjects were included in the replication analysis using Chinese (n=2,327) and Japanese (n=768) cohorts. Results A total of 17 SNPs were associated with low BMD in Korean subjects. Specifically, 9, 6, 9, and 5 SNPs were associated with the presence of osteoporosis, non-vertebral fractures, vertebral fractures, and any fracture, respectively. Collectively, 35 of the 95 SNPs (36.8%) were associated with one or more osteoporosis-related trait in Korean subjects. Of the 35 SNPs, 19 SNPs (54.3%) were also associated with one or more osteoporosis-related traits in East Asian populations. Twelve SNPs were associated with low BMD in the Chinese and Japanese cohorts. Specifically, 3, 4, and 2 SNPs were associated with the presence of hip fractures, vertebral fractures, and any fracture, respectively. Conclusions Our results identified the common SNPs of osteoporosis-related traits in both Caucasian and East Asian populations. These SNPs should be further investigated to assess whether they are true genetic markers of osteoporosis. PMID:27965945

Rapid molecular pathotyping of major salmonella enterica serotypes based on single-nucleotide polymorphisms (SNPs) in the adenylate cyclase (cyaA) gene

USDA-ARS?s Scientific Manuscript database

Introduction: Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific...

Design of a bovine low-density SNP array optimized for imputation

USDA-ARS?s Scientific Manuscript database

The Illumina BovineLD BeadChip was designed to support imputation to higher density genotypes in dairy and beef breeds by including single-nucleotide polymorphisms (SNPs) that had a high minor allele frequency as well as uniform spacing across the genome except at the ends of the chromosome where de...

Transcriptome-wide single nucleotide polymorphisms (SNPs) for abalone (Haliotis midae): validation and application using GoldenGate medium-throughput genotyping assays.

PubMed

Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay

2013-09-23

Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

PubMed Central

Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

2015-01-01

Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

PubMed Central

Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

2016-01-01

Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

Patterns of linkage disequilibrium at PARK16 may explain variances in genetic association studies.

PubMed

Li, Huihua; Teo, Yik-Ying; Tan, Eng-King

2015-09-01

Reproducing genomewide association studies findings in different populations is challenging, because the reproducibility fundamentally relies on the similar patterns of linkage disequilibrium between the unknown causal variants and the genotyped single-nucleotide polymorphisms (SNPs). The PARK16 locus was reported to alter the risk of Parkinson's disease (PD) in genomewide association studies in Japanese and Caucasians. We evaluated the regional linkage disequilibrium pattern at PARK16 locus in Caucasians, Japanese, and Chinese from HapMap and Chinese, Malays, and Indians from the Singapore Genome Variation Project, using the traditional heatmaps and targeted analysis of PARK16 gene via Monte Carlo simulation through varLD scores of these ethnic groups. One hundred SNPs in Caucasians, 95 SNPs in Chinese, 78 SNPs in Japanese from HapMap, 86 SNPs in Chinese, 99 SNPs in Indians, and 97 SNPs in Malays from the Singapore Genome Variation Project were included. Our targeted analysis showed that the linkage disequilibrium pattern of SNPs close to rs947211 was similar in Caucasians and Asians, including Chinese, Japanese, and Malay (all P > 0.0001), whereas different linkage disequilibrium patterns around rs823128, rs823156, and rs708730 were found between Caucasians and these Asian groups (all P < 0.0001). Our study suggests a higher chance to detect the association between rs947211 and PD in Chinese, Malay, and other Caucasian groups because of the similar linkage disequilibrium pattern around rs947211. The associations between rs823128/rs823156/rs708730 and PD are more likely to be replicated in Chinese and Malay populations. © 2015 International Parkinson and Movement Disorder Society.

Genetic prediction of type 2 diabetes using deep neural network.

PubMed

Kim, J; Kim, J; Kwak, M J; Bajaj, M

2018-04-01

Type 2 diabetes (T2DM) has strong heritability but genetic models to explain heritability have been challenging. We tested deep neural network (DNN) to predict T2DM using the nested case-control study of Nurses' Health Study (3326 females, 45.6% T2DM) and Health Professionals Follow-up Study (2502 males, 46.5% T2DM). We selected 96, 214, 399, and 678 single-nucleotide polymorphism (SNPs) through Fisher's exact test and L1-penalized logistic regression. We split each dataset randomly in 4:1 to train prediction models and test their performance. DNN and logistic regressions showed better area under the curve (AUC) of ROC curves than the clinical model when 399 or more SNPs included. DNN was superior than logistic regressions in AUC with 399 or more SNPs in male and 678 SNPs in female. Addition of clinical factors consistently increased AUC of DNN but failed to improve logistic regressions with 214 or more SNPs. In conclusion, we show that DNN can be a versatile tool to predict T2DM incorporating large numbers of SNPs and clinical information. Limitations include a relatively small number of the subjects mostly of European ethnicity. Further studies are warranted to confirm and improve performance of genetic prediction models using DNN in different ethnic groups. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Using Y-Chromosomal Haplogroups in Genetic Association Studies and Suggested Implications.

PubMed

Erzurumluoglu, A Mesut; Baird, Denis; Richardson, Tom G; Timpson, Nicholas J; Rodriguez, Santiago

2018-01-22

Y-chromosomal (Y-DNA) haplogroups are more widely used in population genetics than in genetic epidemiology, although associations between Y-DNA haplogroups and several traits, including cardiometabolic traits, have been reported. In apparently homogeneous populations defined by principal component analyses, there is still Y-DNA haplogroup variation which will result from population history. Therefore, hidden stratification and/or differential phenotypic effects by Y-DNA haplogroups could exist. To test this, we hypothesised that stratifying individuals according to their Y-DNA haplogroups before testing for associations between autosomal single nucleotide polymorphisms (SNPs) and phenotypes will yield difference in association. For proof of concept, we derived Y-DNA haplogroups from 6537 males from two epidemiological cohorts, Avon Longitudinal Study of Parents and Children (ALSPAC) ( n = 5080; 816 Y-DNA SNPs) and the 1958 Birth Cohort ( n = 1457; 1849 Y-DNA SNPs), and studied the robust associations between 32 SNPs and body mass index (BMI), including SNPs in or near Fat Mass and Obesity-associated protein ( FTO ) which yield the strongest effects. Overall, no association was replicated in both cohorts when Y-DNA haplogroups were considered and this suggests that, for BMI at least, there is little evidence of differences in phenotype or SNP association by Y-DNA structure. Further studies using other traits, phenome-wide association studies (PheWAS), other haplogroups and/or autosomal SNPs are required to test the generalisability and utility of this approach.

Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics

PubMed Central

Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

2017-01-01

In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476–20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients. PMID:28404909

Lipid regulatory genes polymorphism in children with and without obesity and cardiometabolic risk factors: The CASPIAN-III study

PubMed Central

Hovsepian, Silva; Javanmard, Shaghayegh Haghjooy; Mansourian, Marjan; Hashemipour, Mahin; Tajadini, Mohamadhasan; Kelishadi, Roya

2018-01-01

Background: Genetically, predisposed children are considered as at-risk individuals for cardiovascular disease. In this study, we aimed to compare the frequency of four-lipid regulatory polymorphism in obese and normal-weight children with and without cardiometabolic risk factors. Materials and Methods: In this nested case–control study, 600 samples of four groups of participants consisted of those with normal weight with and without cardiometabolic risk factors and obese with and without cardiometabolic risk factors. Allelic and genotypic frequencies of GCKR (rs780094), GCKR (rs1260333), MLXIPL (rs3812316), and FADS (rs174547) polymorphisms were compared in the four studied groups. Results: Data of 528 samples were complete and included in this study. The mean (standard deviation) age of participants was 15.01 (2.21) years. Frequency of tt allele (minor allele) of GCKR (rs1260333) polymorphism was significantly lower in normal weight metabolically healthy participants than metabolically unhealthy normal weight (MUHNW) and obese children with and without cardiometabolic risk factor (P = 0.01). Frequency of ga allele of GCKR (rs780094) polymorphism was significantly higher in normal weight children with cardiometabolic risk factor than in their obese counterparts with cardiometabolic risk factor (P = 0.04). Frequency of cg and gg alleles (minor type) of MLXIPL (rs3812316) polymorphism in normal weight metabolically healthy participants was significantly higher than MUHNW (P = 0.04) and metabolically healthy obese children (P = 0.04). Conclusion: The findings of our study indicated that the minor allele of GCKR (rs1260333) single nucleotide polymorphisms (SNPs) could have pathogenic effect for obesity and cardiometabolic risk factors. Ga allele of GCKR (rs780094) SNPs had a protective effect on obesity. Minor alleles of MLXIPL (rs3812316) could have a protective effect for obesity and cardiometabolic risk factors. PMID:29531563

Impact of CCL4 gene polymorphisms and environmental factors on oral cancer development and clinical characteristics.

PubMed

Lien, Ming-Yu; Lin, Chiao-Wen; Tsai, Hsiao-Chi; Chen, Yng-Tay; Tsai, Ming-Hsui; Hua, Chun-Hung; Yang, Shun-Fa; Tang, Chih-Hsin

2017-05-09

In Taiwan, oral cancer has causally been associated with environmental carcinogens. CCL4 (C-C chemokine ligand 4), a macrophage inflammatory protein with a key role in inflammation and immune-regulation, was implicated in carcinogenesis by facilitating instability in the tumor environment. The purpose of this study was to identify gene polymorphisms of CCL4 specific to patients with oral squamous cell carcinoma (OSCC) susceptibility and clinicopathological characteristics. A total of 2,053 participants, including 1192 healthy people and 861 patients with oral cancer, were recruited for this study. Three single-nucleotide polymorphisms (SNPs) of the CCL4 gene were analyzed by a real-time PCR. We found that the T/T homozygotes of CCL4 rs1634507 G/T polymorphism and the GG haplotype of 2 CCL4 SNPs (rs1634507 and rs10491121) combined were associated with oral-cancer susceptibility. In addition, TA haplotype significantly decreased the risks for oral cancer by 0.118 fold. Among 1420 smokers, CCL4 polymorphisms carriers with the betel-nut chewing habit had a 15.476-20.247-fold greater risk of having oral cancer compared to CCL4 wild-type (WT) carriers without the betel-nut chewing habit. Finally, patients with oral cancer who had A/G heterozygotes of CCL4 rs10491121 A/G polymorphism showed a lower risk for an advanced tumor size (> T2) (p=0.046), compared to those patients with AA homozygotes. Our results suggest that the CCL4 rs1634507 SNP have potential predictive significance in oral carcinogenesis. Gene-environment interactions of CCL4 polymorphisms might influence oral-cancer susceptibility. CCL4 rs10491121 may be a factor to predict the tumor size in OSCC patients.

Large-scale enrichment and discovery of gene-associated SNPs

USDA-ARS?s Scientific Manuscript database

With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

Polymorphisms of Leptin-b Gene Associated with Growth Traits in Orange-Spotted Grouper (Epinephelus coioides)

PubMed Central

Huang, Hai; Wei, Yun; Meng, Zining; Zhang, Yong; Liu, Xiaochun; Guo, Liang; Luo, Jian; Chen, Guohua; Lin, Haoran

2014-01-01

In mammals, leptin has been demonstrated to perform important roles in many physiological activities and to influence development, growth, metabolism and reproduction. However, in fish, its function is still unclear. Duplicate leptin genes, leptin-a and leptin-b, have been identified in the orange-spotted grouper. In the present study, the polymorphisms in the leptin-b gene of the orange-spotted grouper were detected, and the relation between these polymorphisms and 12 growth traits were analyzed. Six polymorphisms (including 3 single nucleotide polymorphisms (c.14G>A, c.93A>G, c.149G>A) in exon 1, 2 SNPs (c.181A>G, c.193G>A) in intron 1, and 1 SNP (c.360C>T) in exon 2) were identified and genotyped from 200 different individuals. The results revealed that the SNP c.149G>A was significantly associated with growth traits, that the heterozygous mutation genotype GA having negative effects on growth traits. However, the other five SNPs (c.14G>A, c.93A>G, c.181A>G, c.193G>A, c.360C>T) did not show significant associations with all the growth traits. Compared with our findings in leptin-a gene, the results suggested that the leptin-a hormone has more important physiological effects in fish bodies than the leptin-b type. Moreover, leptin genes were supposed to be one class of major candidate genes of regulating growth traits in the orange-spotted grouper. PMID:25003640

Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

PubMed

García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

2013-12-01

Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

PubMed

Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

2010-07-06

The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects

PubMed Central

Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran

2016-01-01

Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Results Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. Conclusions DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects. PMID:27111895

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Al-Absi, Boshra; Muniandy, Sekaran

2016-01-01

Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects.

A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

PubMed

Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

2013-12-01

Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

In silico identification of genetic variants in glucocerebrosidase (GBA) gene involved in Gaucher's disease using multiple software tools.

PubMed

Manickam, Madhumathi; Ravanan, Palaniyandi; Singh, Pratibha; Talwar, Priti

2014-01-01

Gaucher's disease (GD) is an autosomal recessive disorder caused by the deficiency of glucocerebrosidase, a lysosomal enzyme that catalyses the hydrolysis of the glycolipid glucocerebroside to ceramide and glucose. Polymorphisms in GBA gene have been associated with the development of Gaucher disease. We hypothesize that prediction of SNPs using multiple state of the art software tools will help in increasing the confidence in identification of SNPs involved in GD. Enzyme replacement therapy is the only option for GD. Our goal is to use several state of art SNP algorithms to predict/address harmful SNPs using comparative studies. In this study seven different algorithms (SIFT, MutPred, nsSNP Analyzer, PANTHER, PMUT, PROVEAN, and SNPs&GO) were used to predict the harmful polymorphisms. Among the seven programs, SIFT found 47 nsSNPs as deleterious, MutPred found 46 nsSNPs as harmful. nsSNP Analyzer program found 43 out of 47 nsSNPs are disease causing SNPs whereas PANTHER found 32 out of 47 as highly deleterious, 22 out of 47 are classified as pathological mutations by PMUT, 44 out of 47 were predicted to be deleterious by PROVEAN server, all 47 shows the disease related mutations by SNPs&GO. Twenty two nsSNPs were commonly predicted by all the seven different algorithms. The common 22 targeted mutations are F251L, C342G, W312C, P415R, R463C, D127V, A309V, G46E, G202E, P391L, Y363C, Y205C, W378C, I402T, S366R, F397S, Y418C, P401L, G195E, W184R, R48W, and T43R.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

PubMed Central

Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

2015-01-01

Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

Association between Genetic Polymorphisms in Cav2.3 (R-type) Ca2+ Channels and Fentanyl Sensitivity in Patients Undergoing Painful Cosmetic Surgery

PubMed Central

Fukuda, Ken-ichi; Kasai, Shinya; Hasegawa, Junko; Hayashida, Masakazu; Minami, Masabumi; Ikeda, Kazutaka

2013-01-01

Individual differences in the sensitivity to fentanyl, a widely used opioid analgesic, lead to different proper doses of fentanyl, which can hamper effective pain treatment. Voltage-activated Ca2+ channels (VACCs) play a crucial role in the nervous system by controlling membrane excitability and calcium signaling. Cav2.3 (R-type) VACCs have been especially thought to play critical roles in pain pathways and the analgesic effects of opioids. However, unknown is whether single-nucleotide polymorphisms (SNPs) of the human CACNA1E (calcium channel, voltage-dependent, R type, alpha 1E subunit) gene that encodes Cav2.3 VACCs influence the analgesic effects of opioids. Thus, the present study examined associations between fentanyl sensitivity and SNPs in the human CACNA1E gene in 355 Japanese patients who underwent painful orofacial cosmetic surgery, including bone dissection. We first conducted linkage disequilibrium (LD) analyses of 223 SNPs in a region that contains the CACNA1E gene using genomic samples from 100 patients, and a total of 13 LD blocks with 42 Tag SNPs were observed within and around the CACNA1E gene region. In the preliminary study using the same 100 genomic samples, only the rs3845446 A/G SNP was significantly associated with perioperative fentanyl use among these 42 Tag SNPs. In a confirmatory study using the other 255 genomic samples, this SNP was also significantly associated with perioperative fentanyl use. Thus, we further analyzed associations between genotypes of this SNP and all of the clinical data using a total of 355 samples. The rs3845446 A/G SNP was associated with intraoperative fentanyl use, 24 h postoperative fentanyl requirements, and perioperative fentanyl use. Subjects who carried the minor G allele required significantly less fentanyl for pain control compared with subjects who did not carry this allele. Although further validation is needed, the present findings show the possibility of the involvement of CACNA1E gene polymorphisms in fentanyl sensitivity. PMID:23940630

Exome-wide association study identifies genetic polymorphisms of C12orf51, MYL2, and ALDH2 associated with blood lead levels in the general Korean population.

PubMed

Eom, Sang-Yong; Hwang, Myung Sil; Lim, Ji-Ae; Choi, Byung-Sun; Kwon, Ho-Jang; Park, Jung-Duck; Kim, Yong-Dae; Kim, Heon

2017-02-17

Lead (Pb) is a ubiquitous toxic metal present in the environment that poses adverse health effects to humans. Inter-individual variation in blood Pb levels is affected by various factors, including genetic makeup. However, limited data are available on the association between genetic variation and blood Pb levels. The purpose of this study was to identify the genetic markers associated with blood Pb levels in the Korean population. The study subjects consisted of 1,483 healthy adults with no history of occupational exposure to Pb. We measured blood Pb levels and calculated probable daily intake of Pb according to dietary data collected using 24-hour recall. We conducted exome-wide association screening using Illumina Human Exome-12v1.2 platform (n = 500) and a replication analysis using VeraCode Goldengate assay (n = 1,483). Among the 244,770 single nucleotide polymorphisms (SNPs) tested, 12 SNPs associated with blood Pb level were identified, with suggestive significance level (P < 1 × 10 -4 ). In the Goldengate assay for replication, three SNPs (C12orf51 rs11066280, MYL2 rs12229654, and ALDH2 rs671) were associated with statistically suggestively significant differences in blood Pb levels. When stratified by drinking status, a potential association of C12orf51 rs11066280, MYL2 rs12229654, and ALDH2 rs671 with blood Pb level was observed only in drinkers. A marginally significant gene-environment interaction between ALDH2 rs671 and alcohol consumption was observed in relation to blood Pb levels. The effects of the three suggestively significant SNPs on blood Pb levels was dependent on daily calcium intake amounts. This exome-wide association study indicated that C12orf51 rs11066280, MYL2 rs12229654, and ALDH2 rs671 polymorphisms are linked to blood Pb levels in the Korean population. Our results suggest that these three SNPs are involved in the determination of Pb levels in Koreans via the regulation of alcohol drinking behavior, and that their negative effects may be compensated by appropriate calcium intake.

Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

PubMed

Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

2014-05-09

ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

PubMed

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Association Study of Genes Controlling IL-12-dependent IFN-γ Immunity: STAT4 Alleles Increase Risk of Pulmonary Tuberculosis in Morocco

PubMed Central

Sabri, Ayoub; Grant, Audrey V.; Cosker, Kristel; El Azbaoui, Safa; Abid, Ahmed; Abderrahmani Rhorfi, Ismail; Souhi, Hicham; Janah, Hicham; Alaoui-Tahiri, Kebir; Gharbaoui, Yasser; Benkirane, Majid; Orlova, Marianna; Boland, Anne; Deswarte, Caroline; Migaud, Melanie; Bustamante, Jacinta; Schurr, Erwin; Boisson-Dupuis, Stephanie; Casanova, Jean-Laurent; Abel, Laurent; El Baghdadi, Jamila

2014-01-01

Background. Only a minority of individuals infected with Mycobacterium tuberculosis develop clinical tuberculosis. Genetic epidemiological evidence suggests that pulmonary tuberculosis has a strong human genetic component. Previous genetic findings in Mendelian predisposition to more severe mycobacterial infections, including by M. tuberculosis, underlined the importance of the interleukin 12 (IL-12)/interferon γ (IFN-γ) circuit in antimycobacterial immunity. Methods. We conducted an association study in Morocco between pulmonary tuberculosis and a panel of single-nucleotide polymorphisms (SNPs) covering 14 core IL-12/IFN-γ circuit genes. The analyses were performed in a discovery family-based sample followed by replication in a case-control population. Results. Out of 228 SNPs tested in the family-based sample, 6 STAT4 SNPs were associated with pulmonary tuberculosis (P = .0013–.01). We replicated the same direction of association for 1 cluster of 3 SNPs encompassing the promoter region of STAT4. In the combined sample, the association was stronger among younger subjects (pulmonary tuberculosis onset <25 years) with an odds ratio of developing pulmonary tuberculosis at rs897200 for GG vs AG/AA subjects of 1.47 (1.06–2.04). Previous functional experiments showed that the G allele of rs897200 was associated with lower STAT4 expression. Conclusions. Our present findings in a Moroccan population support an association of pulmonary tuberculosis with STAT4 promoter-region polymorphisms that may impact STAT4 expression. PMID:24610875

Association of RTEL1 gene polymorphisms with stroke risk in a Chinese Han population.

PubMed

Cai, Yi; Zeng, Chaosheng; Su, Qingjie; Zhou, Jingxia; Li, Pengxiang; Dai, Mingming; Wang, Desheng; Long, Faqing

2017-12-29

We investigated the associations between single nucleotide polymorphisms (SNPs) in the regulator of telomere elongation helicase 1 ( RTEL1 ) gene and stroke in the Chinese population. A total of 400 stroke patients and 395 healthy participants were included in this study. Five SNPs in RTEL1 were genotyped and the association with stroke risk was analyzed. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using unconditional logistic regression analysis. Multivariate logistic regression analysis was used to identify SNPs that correlated with stroke. Rs2297441 was associated with an increased risk of stroke in an allele model (odds ratio [OR] = 1.24, 95% confidence interval [95% CI] = 1.01-1.52, p = 0.043). Rs6089953 was associated with an increased risk of stroke under the genotype model ([OR] = 1.862, [CI] = 1.123-3.085, p = 0.016). Rs2297441 was associated with an increased risk of stroke in an additive model (OR = 1.234, 95% CI = 1.005, p = 0.045, Rs6089953, Rs6010620 and Rs6010621 were associated with an increased risk of stroke in the recessive model (Rs6089953:OR = 1.825, 95% CI = 1.121-2.969, p =0.01546; Rs6010620: OR = 1.64, 95% CI = 1.008-2.669, p =0.04656;Rs6010621:OR = 1.661, 95% CI = 1.014-2.722, p =0.04389). Our findings reveal a possible association between SNPs in the RTEL1 gene and stroke risk in Chinese population.

Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

PubMed Central

Lapitan Jr., Lorico D. S.; Guo, Yuan

2015-01-01

Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio)

PubMed Central

2014-01-01

Background A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. Results The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. Conclusions The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species. PMID:24762296

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).

PubMed

Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen

2014-04-24

A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.

Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

PubMed

Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

2014-06-01

It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

HERC1 polymorphisms: population-specific variations in haplotype composition.

PubMed

Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

2009-08-01

Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

Genetic variations in IDH gene as prognosis predictors in TACE-treated hepatocellular carcinoma patients.

PubMed

Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin

2014-11-01

Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Novel SNPs in the exon region of bovine DKK4 gene and their association with body measurement traits in Qinchuan cattle.

PubMed

Gao, J B; Li, Y K; Yang, N; Ma, X H; Adoligbe, C; Jiang, B J; Fu, C Z; Cheng, G; Zan, L S

2013-02-28

The aim of this study was to determine whether single nucleotide polymorphisms (SNPs) of bovine Dickkopf homolog 4 (DKK4) are associated with body measurement traits in Qinchuan cattle. By using PCR-SSCP technology and DNA sequencing, we discovered 5 DKK4 SNPs in Qingchuan cattle, including -65G>A and -77G>T in the 5'-untranslated region, 1532C>G and 1533T>C in exon 2, and 2088C>T in exon 3. The sequencing map showed that 1532C>G and 1533T>C were in close linkage disequilibrium and were treated as 1532C>G-1533T>C in this study. Allele frequencies were calculated and analyzed by the chi-square test, which showed that -65G>A and 1532C>G-1533T>C were in Hardy-Weinberg equilibrium (P > 0.05), whereas -77G>T and 2088C>T were not in all 633 tested Qinchuan cattle individuals (P < 0.01). Gene heterozygosity (HE), effective allele number (NE), and polymorphism information content (PIC) were 0.407, 1.686, and 0.324 at -65G>A; 0.472, 1.894, and 0.361 at -77G>T; 0.476, 1.908, and 0.363 at 1532C>G-1533T>C; and 0.218, 1.279, and 0.195 at 2088C>T. We also evaluated the potential association of these SNPs with body measurement traits in all 633 individuals; the results suggest that several SNPs in Qinchuan cattle DKK4 were significantly associated with body length, hip height, rump length, hip width, heart girth, and pin bone width (P < 0.05 and P < 0.01). These results suggest that bovine DKK4 could be used as candidate gene for Qinchuan cattle breeding.

Association of TMPRSS6 polymorphisms with ferritin, hemoglobin, and type 2 diabetes risk in a Chinese Han population.

PubMed

Gan, Wei; Guan, Yu; Wu, Qian; An, Peng; Zhu, Jingwen; Lu, Ling; Jing, Li; Yu, Yu; Ruan, Sheng; Xie, Dong; Makrides, Maria; Gibson, Robert A; Anderson, Gregory J; Li, Huaixing; Lin, Xu; Wang, Fudi

2012-03-01

Transmembrane protease serine 6 (TMPRSS6) regulates iron homeostasis by inhibiting the expression of hepcidin. Multiple common variants in TMPRSS6 were significantly associated with serum iron in recent genome-wide association studies, but their effects in the Chinese remain to be elucidated. The objective was to determine whether the TMPRSS6 single nucleotide polymorphisms (SNPs) rs855791(V736A) and rs4820268(D521D) were associated with blood hemoglobin and plasma ferritin concentrations and risk of type 2 diabetes in Chinese individuals. The SNPs rs855791(V736A) and rs4820268(D521D) in the TMPRSS6 gene were genotyped and tested for their associations with plasma iron and type 2 diabetes risk in 1574 unrelated Chinese Hans from Beijing. The 2 TMPRSS6 SNPs rs855791(V736A) and rs4820268(D521D) were both significantly associated with plasma ferritin (P ≤ 0.0058), hemoglobin (P ≤ 0.0013), iron overload risk (P ≤ 0.0068), and type 2 diabetes risk (P ≤ 0.0314). None of the associations with hemoglobin or plasma ferritin remained significant (P ≥ 0.1229) when the 2 variants were both included in one linear regression model. A haplotype carrying both iron-lowering alleles from the 2 TMPRSS SNPs showed significant associations with lower hemoglobin (P = 0.0014), lower plasma ferritin (P = 0.0027), and a reduced risk of iron overload (P = 0.0017) and of type 2 diabetes (P = 0.0277). These findings suggest that TMPRSS6 variants were significantly associated with plasma ferritin, hemoglobin, risk of iron overload, and type 2 diabetes in Chinese Hans. The type 2 diabetes risk conferred by the TMPRSS6 SNPs is possibly mediated by plasma ferritin.

Case-control study of eczema in relation to IL4Rα genetic polymorphisms in Japanese women: The Kyushu Okinawa Maternal and Child Health Study.

PubMed

Miyake, Y; Tanaka, K; Arakawa, M

2013-05-01

Epidemiological research on the relationship between single nucleotide polymorphisms (SNPs) in the IL4Rα gene and eczema is sparse. We investigated the associations between IL4Rα SNPs rs1805011, rs1805015 and rs1801275 and risk of eczema in young adult Japanese women. Included were 188 women who met the criteria of the International Study of Asthma and Allergies in Childhood (ISAAC) for eczema. Controls were 635 women without eczema according to the ISAAC criteria who also had not been diagnosed with asthma, atopic eczema and/or allergic rhinitis by a doctor. Adjustment was made for age, region of residence, number of children, smoking and education. Under the additive model, SNP rs1805011 was significantly related to eczema: the adjusted OR was 0.55 (95% CI: 0.31-0.99). SNP rs1805015 was significantly associated with eczema in the additive and dominant models: the adjusted ORs were 0.55 (95% CI: 0.30-0.98) and 0.55 (95% CI: 0.30-0.997), respectively. There was no significant association between SNP rs1801275 and eczema. None of the haplotypes were significantly related to eczema. Significant associations between SNPs rs1805011 and rs1805015 and eczema were reported in women who had never smoked, but not in those who had ever smoked; the multiplicative interactions, however, were not significant. This is the first study to demonstrate significant associations between IL4Rα SNPs rs1805011 and rs1805015 and eczema. We do not find evidence for interactions affecting eczema between IL4Rα SNPs and smoking. © 2013 The Authors. Scandinavian Journal of Immunology © 2013 Blackwell Publishing Ltd.

Case-control study of rhinoconjunctivitis associated with IL5RA polymorphisms in Japanese women: the Kyushu Okinawa Maternal and Child Health Study.

PubMed

Miyake, Yoshihiro; Tanaka, Keiko; Arakawa, Masashi

2014-02-01

Epidemiological research on the relationship between single nucleotide polymorphisms (SNPs) in the IL5RA gene and allergic disorders is limited. We examined the relationship between IL5RA SNPs and risk of rhinoconjunctivitis in young adult Japanese women. Included were 393 women who met the criteria of the International Study of Asthma and Allergies in Childhood (ISAAC) for rhinoconjunctivitis. Controls were 767 women without rhinoconjunctivitis according to the ISAAC criteria who had not been diagnosed with allergic rhinitis by a doctor. Adjustment was made for age, region of residence, presence of older siblings, smoking, and education. Compared with the CC genotype of SNP rs6771148, the CG genotype, but not the GG genotype, was significantly associated with a reduced risk of rhinoconjunctivitis: the adjusted OR for the CG genotype was 0.76 (95% CI: 0.58-0.99). No evident associations were found between SNPs rs17882210, rs3804797, rs334809, rs9831572, or rs17881144 and rhinoconjunctivitis. The ACTAGA haplotype of rs17882210, rs3804797, rs334809, rs9831572, rs6771148, and rs17881144 was significantly inversely associated with rhinoconjunctivitis (crude OR=0.58, 95% CI: 0.37-0.88) while the GTAGCA haplotype was significantly positively related to rhinoconjunctivitis (crude OR=1.74, 95% CI: 1.14-2.65). No significant interactions affecting rhinoconjunctivitis were observed between any of the six SNPs and smoking. This is the first study to show significant associations between IL5RA SNP rs6771148, the ACTAGA haplotype, and the GTAGCA haplotype and the risk of rhinoconjunctivitis. We did not find evidence for interactions affecting rhinoconjunctivitis between any of the IL5RA SNPs and smoking. Copyright © 2013 Elsevier Ltd. All rights reserved.

Novel associations of UDP-glucuronosyltransferase 2B gene variants with prostate cancer risk in a multiethnic study.

PubMed

Vidal, Adriana C; Tucker, Cocoa; Schildkraut, Joellen M; Richardson, Ricardo M; McPhail, Megan; Freedland, Stephen J; Hoyo, Cathrine; Grant, Delores J

2013-11-22

We have previously shown that a functional polymorphism of the UGT2B15 gene (rs1902023) was associated with increased risk of prostate cancer (PC). Novel functional polymorphisms of the UGT2B17 and UGT2B15 genes have been recently characterized by in vitro assays but have not been evaluated in epidemiologic studies. Fifteen functional SNPs of the UGT2B17 and UGT2B15 genes, including cis-acting UGT2B gene SNPs, were genotyped in African American and Caucasian men (233 PC cases and 342 controls). Regression models were used to analyze the association between SNPs and PC risk. After adjusting for race, age and BMI, we found that six UGT2B15 SNPs (rs4148269, rs3100, rs9994887, rs13112099, rs7686914 and rs7696472) were associated with an increased risk of PC in log-additive models (p < 0.05). A SNP cis-acting on UGT2B17 and UGT2B15 expression (rs17147338) was also associated with increased risk of prostate cancer (OR = 1.65, 95% CI = 1.00-2.70); while a stronger association among men with high Gleason sum was observed for SNPs rs4148269 and rs3100. Although small sample size limits inference, we report novel associations between UGT2B15 and UGT2B17 variants and PC risk. These associations with PC risk in men with high Gleason sum, more frequently found in African American men, support the relevance of genetic differences in the androgen metabolism pathway, which could explain, in part, the high incidence of PC among African American men. Larger studies are required.

Novel associations of UDP-glucuronosyltransferase 2B gene variants with prostate cancer risk in a multiethnic study

PubMed Central

2013-01-01

Background We have previously shown that a functional polymorphism of the UGT2B15 gene (rs1902023) was associated with increased risk of prostate cancer (PC). Novel functional polymorphisms of the UGT2B17 and UGT2B15 genes have been recently characterized by in vitro assays but have not been evaluated in epidemiologic studies. Methods Fifteen functional SNPs of the UGT2B17 and UGT2B15 genes, including cis-acting UGT2B gene SNPs, were genotyped in African American and Caucasian men (233 PC cases and 342 controls). Regression models were used to analyze the association between SNPs and PC risk. Results After adjusting for race, age and BMI, we found that six UGT2B15 SNPs (rs4148269, rs3100, rs9994887, rs13112099, rs7686914 and rs7696472) were associated with an increased risk of PC in log-additive models (p < 0.05). A SNP cis-acting on UGT2B17 and UGT2B15 expression (rs17147338) was also associated with increased risk of prostate cancer (OR = 1.65, 95% CI = 1.00-2.70); while a stronger association among men with high Gleason sum was observed for SNPs rs4148269 and rs3100. Conclusions Although small sample size limits inference, we report novel associations between UGT2B15 and UGT2B17 variants and PC risk. These associations with PC risk in men with high Gleason sum, more frequently found in African American men, support the relevance of genetic differences in the androgen metabolism pathway, which could explain, in part, the high incidence of PC among African American men. Larger studies are required. PMID:24267955

SNCA polymorphisms, smoking, and sporadic Parkinson's disease in Japanese.

PubMed

Miyake, Yoshihiro; Tanaka, Keiko; Fukushima, Wakaba; Kiyohara, Chikako; Sasaki, Satoshi; Tsuboi, Yoshio; Yamada, Tatsuo; Oeda, Tomoko; Shimada, Hiroyuki; Kawamura, Nobutoshi; Sakae, Nobutaka; Fukuyama, Hidenao; Hirota, Yoshio; Nagai, Masaki

2012-06-01

Several case-control studies and genome-wide association studies have examined the relationships between single nucleotide polymorphisms (SNPs) in the SNCA gene and Parkinson's disease (PD), and have provided inconsistent results. We investigated the relationships between SNPs rs356229, rs356219, rs356220, rs7684318, and rs2736990 and the risk of sporadic PD in Japan using data from a multicenter hospital-based case-control study. Included were 229 cases within 6 years of onset of PD as defined according to the UK PD Society Brain Bank clinical diagnostic criteria. Controls were 357 inpatients and outpatients without neurodegenerative disease. Adjustment was made for sex, age, region of residence, and smoking. Based on the recessive model, compared with subjects with the CC or CT genotype of SNP rs356220, those with the TT genotype had a significantly increased risk of sporadic PD: the adjusted OR was 1.42 (95% CI: 1.002-2.02). In the additive model, SNP rs2736990 was significantly related to the risk of sporadic PD: the adjusted OR was 1.30 (95% CI: 1.002-1.68). There were no significant relationships between SNP rs356229, rs356219, or rs7684318 and the risk of sporadic PD in any genetic model. The additive interactions between SNPs rs356219 and rs356220 and smoking with respect to sporadic PD were significant although the multiplicative interactions were not significant. This study suggests that SNCA SNPs rs356220 and rs2736990 are significantly associated with the risk of sporadic PD in Japanese. We also present new evidence for biological interactions between SNPs rs356219 and rs356220 and smoking that affect sporadic PD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Lack of association of two chromosome 10q24 SNPs with Alzheimer’s disease

PubMed Central

Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas

2006-01-01

Several groups have reported evidence of linkage on chromosome 10 to late-onset Alzheimer’s disease (LOAD). In a recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10, significant associations between the rs498055 and rs4417206 SNPs and risk of LOAD were observed. We examined the association of these two SNPs with LOAD risk in a large Caucasian American cohort comprising about 2,000 cases and controls. Neither SNP revealed significant association with LOAD risk or age-at-onset. PMID:17000046

Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

PubMed

Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

2017-08-31

This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

PubMed Central

2013-01-01

Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet-dependent associations between SNPs and feed efficiency suggest that further refinement of variant panels require the consideration of the breed and management practices. The unique genomic variants associated with the one- and two-step indicators suggest that both types of indicators offer complementary description of feed efficiency that can be exploited for genome-enabled selection purposes. PMID:24066663

SNPit: a federated data integration system for the purpose of functional SNP annotation

PubMed Central

Shen, Terry H; Carlson, Christopher S; Tarczy-Hornoch, Peter

2009-01-01

Genome wide association studies can potentially identify the genetic causes behind the majority of human diseases. With the advent of more advanced genotyping techniques, there is now an explosion of data gathered on single nucleotide polymorphisms (SNPs). The need exists for an integrated system that can provide up-to-date functional annotation information on SNPs. We have developed the SNP Integration Tool (SNPit) system to address this need. Built upon a federated data integration system, SNPit provides current information on a comprehensive list of SNP data sources. Additional logical inference analysis was included through an inference engine plug in. The SNPit web servlet is available online for use. SNPit allows users to go to one source for up-to-date information on the functional annotation of SNPs. A tool that can help to integrate and analyze the potential functional significance of SNPs is important for understanding the results from genome wide association studies. PMID:19327864

Whole genome sequencing in the search for genes associated with the control of SIV infection in the Mauritian macaque model.

PubMed

de Manuel, Marc; Shiina, Takashi; Suzuki, Shingo; Dereuddre-Bosquet, Nathalie; Garchon, Henri-Jean; Tanaka, Masayuki; Congy-Jolivet, Nicolas; Aarnink, Alice; Le Grand, Roger; Marques-Bonet, Tomas; Blancher, Antoine

2018-05-08

In the Mauritian macaque experimentally inoculated with SIV, gene polymorphisms potentially associated with the plasma virus load at a set point, approximately 100 days post inoculation, were investigated. Among the 42 animals inoculated with 50 AID 50 of the same strain of SIV, none of which received any preventive or curative treatment, nine individuals were selected: three with a plasma virus load (PVL) among the lowest, three with intermediate PVL values and three among the highest PVL values. The complete genomes of these nine animals were then analyzed. Initially, attention was focused on variants with a potential functional impact on protein encoding genes (non-synonymous SNPs (NS-SNPs) and splicing variants). Thus, 424 NS-SNPs possibly associated with PVL were detected. The 424 candidates SNPs were genotyped in these 42 SIV experimentally infected animals (including the nine animals subjected to whole genome sequencing). The genes containing variants most probably associated with PVL at a set time point are analyzed herein.

Genetic Association Study of KCNQ5 Polymorphisms with High Myopia.

PubMed

Liao, Xuan; Yap, Maurice K H; Leung, Kim Hung; Kao, Patrick Y P; Liu, Long Qian; Yip, Shea Ping

2017-01-01

Identification of genetic variations related to high myopia may advance our knowledge of the etiopathogenesis of refractive error. This study investigated the role of potassium channel gene (KCNQ5) polymorphisms in high myopia. We performed a case-control study of 1563 unrelated Han Chinese subjects (809 cases of high myopia and 754 emmetropic controls). Five tag single-nucleotide polymorphisms (SNPs) of KCNQ5 were genotyped, and association testing with high myopia was conducted using logistic regression analysis adjusted for sex and age to give P asym values, and multiple comparisons were corrected by permutation test to give P emp values. All five noncoding SNPs were associated with high myopia. The SNP rs7744813, previously shown to be associated with refractive error and myopia in two GWAS, showed an odds ratio of 0.75 (95% CI 0.63-0.90; P emp = 0.0058) for the minor allele. The top SNP rs9342979 showed an odds ratio of 0.75 (95% CI 0.64-0.89; P emp = 0.0045) for the minor allele. Both SNPs are located within enhancer histone marks and DNase-hypersensitive sites. Our data support the involvement of KCNQ5 gene polymorphisms in the genetic susceptibility to high myopia and further exploration of KCNQ5 as a risk factor for high myopia.

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

PubMed Central

Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang

2016-01-01

The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

PubMed

Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

2018-01-30

Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Associations of Polymorphisms in the Apolipoprotein APOA1-C3-A5 Gene Cluster with Acute Coronary Syndrome

PubMed Central

Ding, Yan; Zhu, Ming An; Wang, Zhi Xiao; Zhu, Jing; Feng, Jing Bo; Li, Dong Sheng

2012-01-01

Background. Acute coronary syndromes (ACSs) are clinically cardiovascular events associated with dyslipidemia in common. Single nucleotide polymorphisms (SNPs) and haplotypes in the APOA1/C3/A5 gene cluster are associated with diabetes and familial combined hyperlipidaemia (FCH). Little is known about whether the polymorphisms in these genes affect lipid homeostasis in patients with ACSs. The present paper aimed to examine these associations with 4 SNPs in the APOA1 −75G > A, the APOC3 −455T > C, and APOA5 −1131T > C, c.553G > T variant to ACSs in Chinese Han. Methods. Chinese Han of 229 patients with ACSs and 254 unrelated controls were analyzed. Four SNPs in APOA1/C3/A5 cluster were genotyped and lipid was determined. Results. Our data show that minor allelic frequencies of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms in patients with ACSs were significantly higher than control group (P < 0.05). Furthermore, the 3 polymorphic sites were strongly of linkage disequilibrium, and minor alleles of 3 SNP sites had higher TG level than wild alleles (P < 0.05), APOC3 −455C and APOA5 c.553T allele carriers also had lower level of HDL-C. Conclusions. The minor alleles of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms are closely associated with ACSs. PMID:22675253

Association of interleukin-6 gene polymorphisms with hand osteoarthritis and hand osteoporosis.

PubMed

Blumenfeld, Orit; Williams, Frances M K; Valdes, Ana; Hart, Deborah J; Malkin, Ida; Spector, Timothy D; Livshits, Gregory

2014-09-01

Several genes, including IL-6 encoding pro-inflammatory cytokines, are involved in development of osteoarthritis and osteoporosis. The association of radiographic hand osteoarthritis (RHOA) and osteoporosis related phenotypes (RHOP) with polymorphisms in IL-6 has been reported inconsistently. The aim of this study was to examine the association, between RHOA and RHOP and IL-6 polymorphisms in two independent samples. Two samples: UK females, including 1440 individuals assessed for RHOA and 3470 assessed for RHOP; Chuvash pedigree including 1499 females and males were assessed for RHOP and RHOA. SNPs were genotyped in the IL-6 genomic region, and used in association analysis with RHOA and RHOP phenotypes. RHOP phenotypes showed similar heritability estimates in both samples, ranging from 34.5 ± 5.5% to 61.0 ± 2.4%. RHOA in Chuvash had substantially lower heritability estimates compared to twins (e.g. OSP scores: 11.8 ± 2.3% vs. 39.2 ± 4.1%) with much higher prevalence and considerably stronger correlation with age (r = 0.811 vs. r = 0.505). RHOA in Chuvash sample may be traumatic in nature, caused by heavy and prolonged manual work related to their private farming. There were a number of statistically significant association results with both types of phenotypes. The most consistent result was obtained for JSN in both samples with SNP from the same haploblock. Their combined probability of no association was only p = 0.000003. Additionally, there were SNPs common for both RHOA and RHOP. We have shown polymorphisms in IL_6 are significantly associated with RHOA and hand RHOP in two samples having different ethnicity and lifestyle. Age × environment × genes interaction appears as an important factor of RHOA manifestation and progression. Copyright © 2014 Elsevier Ltd. All rights reserved.

Analysis of Over 10,000 Cases Finds No Association between Previously-Reported Candidate Polymorphisms and Ovarian Cancer Outcome

PubMed Central

White, Kristin L.; Vierkant, Robert A.; Fogarty, Zachary C.; Charbonneau, Bridget; Block, Matthew S.; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Rossing, Mary Anne; Cramer, Daniel W.; Pearce, C. Leigh; Schildkraut, Joellen M.; Menon, Usha; Kjaer, Susanne Kruger; Levine, Douglas A.; Gronwald, Jacek; Culver, Hoda Anton; Whittemore, Alice S.; Karlan, Beth Y.; Lambrechts, Diether; Wentzensen, Nicolas; Kupryjanczyk, Jolanta; Chang-Claude, Jenny; Bandera, Elisa V.; Hogdall, Estrid; Heitz, Florian; Kaye, Stanley B.; Fasching, Peter A.; Campbell, Ian; Goodman, Marc T.; Pejovic, Tanja; Bean, Yukie; Lurie, Galina; Eccles, Diana; Hein, Alexander; Beckmann, Matthias W.; Ekici, Arif B.; Paul, James; Brown, Robert; Flanagan, James; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Claus K.; Lundvall, Lene; Olson, Sara H.; Orlow, Irene; Paddock, Lisa E.; Rudolph, Anja; Eilber, Ursula; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K.; Ziolkowska-Seta, Izabela; Brinton, Louise; Yang, Hannah; Garcia-Closas, Montserrat; Despierre, Evelyn; Lambrechts, Sandrina; Vergote, Ignace; Walsh, Christine; Lester, Jenny; Sieh, Weiva; McGuire, Valerie; Rothstein, Joseph H.; Ziogas, Argyrios; Lubiński, Jan; Cybulski, Cezary; Menkiszak, Janusz; Jensen, Allan; Gayther, Simon A.; Ramus, Susan J.; Gentry-Maharaj, Aleksandra; Berchuck, Andrew; Wu, Anna H.; Pike, Malcolm C.; Van Den Berg, David; Terry, Kathryn L.; Vitonis, Allison F.; Doherty, Jennifer A.; Johnatty, Sharon; deFazio, Anna; Song, Honglin; Tyrer, Jonathan; Sellers, Thomas A.; Phelan, Catherine M.; Kalli, Kimberly R.; Cunningham, Julie M.; Fridley, Brooke L.; Goode, Ellen L.

2013-01-01

Background Ovarian cancer is a leading cause of cancer-related death among women. In an effort to understand contributors to disease outcome, we evaluated single-nucleotide polymorphisms (SNPs) previously associated with ovarian cancer recurrence or survival, specifically in angiogenesis, inflammation, mitosis, and drug disposition genes. Methods Twenty-seven SNPs in VHL, HGF, IL18, PRKACB, ABCB1, CYP2C8, ERCC2, and ERCC1 previously associated with ovarian cancer outcome were genotyped in 10,084 invasive cases from 28 studies from the Ovarian Cancer Association Consortium with over 37,000 observed person-years and 4,478 deaths. Cox proportional hazards models were used to examine the association between candidate SNPs and ovarian cancer recurrence or survival with and without adjustment for key covariates. Results We observed no association between genotype and ovarian cancer recurrence or survival for any of the SNPs examined. Conclusions These results refute prior associations between these SNPs and ovarian cancer outcome and underscore the importance of maximally powered genetic association studies. Impact These variants should not be used in prognostic models. Alternate approaches to uncovering inherited prognostic factors, if they exist, are needed. PMID:23513043

Modulation of C-reactive protein and plasma omega-6 fatty acid levels by phospholipase A2 gene polymorphisms following a 6-week supplementation with fish oil.

PubMed

Tremblay, B L; Rudkowska, I; Couture, P; Lemieux, S; Julien, P; Vohl, M C

2015-12-01

This clinical trial investigated the impact of a six-week supplementation with fish oil and single nucleotide polymorphisms (SNPs) in PLA2G4A and PLA2G6 genes on total omega-6 fatty acid (n-6 FA) levels in plasma phospholipids (PL) and plasma C-reactive protein (CRP) levels in 191 subjects. Interaction effects between SNPs and supplementation modulated total n-6 FAs and CRP levels in both men and women. Associations between SNPs and total n-6 FA levels and between SNPs and CRP levels were identified in men, independently of supplementation. Supplementation decreased total n-6 FAs without affecting plasma CRP levels. Changes in CRP levels correlated positively with changes in total n-6 FAs in men (r=0.25 p=0.01), but not in women. In conclusion, total n-6 FA levels in plasma PL and plasma CRP levels are modulated by SNPs within PLA2G4A and PLA2G6 genes alone or in combination with fish oil supplementation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans.

PubMed

Dlugos, Andrea M; Palmer, Abraham A; de Wit, Harriet

2009-10-01

Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression.

MCP1 SNPs and Pulmonary Tuberculosis in Cohorts from West Africa, the USA and Argentina: Lack of Association or Epistasis with IL12B Polymorphisms

PubMed Central

Velez Edwards, Digna R.; Tacconelli, Alessandra; Wejse, Christian; Hill, Philip C.; Morris, Gerard A. J.; Edwards, Todd L.; Gilbert, John R.; Myers, Jamie L.; Park, Yo Son; Stryjewski, Martin E.; Abbate, Eduardo; Estevan, Rosa; Rabna, Paulo; Novelli, Giuseppe; Hamilton, Carol D.; Adegbola, Richard; Østergaard, Lars; Williams, Scott M.; Scott, William K.; Sirugo, Giorgio

2012-01-01

The monocyte chemotactic protein-1 (MCP-1) is a chemokine that plays an important role in the recruitment of monocytes to M. tuberculosis infection sites, and previous studies have reported that genetic variants in MCP1 are associated with differential susceptibility to pulmonary tuberculosis (PTB). We examined eight MCP1 single nucleotide polymorphisms (SNPs) in a multi-ethnic, case-control design that included: 321 cases and 346 controls from Guinea-Bissau, 258 cases and 271 controls from The Gambia, 295 cases and 179 controls from the U.S. (African-Americans), and an additional set of 237 cases and 144 controls of European ancestry from the U.S. and Argentina. Two locus interactions were also examined for polymorphisms in MCP1 and interleukin 12B (IL12B), another gene implicated in PTB risk. Examination of previously associated MCP1 SNPs rs1024611 (−2581A/G), rs2857656 (−362G/C) and rs4586 (+900C/T) did not show evidence for association. One interaction between rs2857656 and IL12B SNP rs2288831 was observed among Africans but the effect was in the opposite direction in Guineans (OR = 1.90, p = 0.001) and Gambians (OR = 0.64, p = 0.024). Our data indicate that the effect of genetic variation within MCP1 is not clear cut and additional studies will be needed to elucidate its role in TB susceptibility. PMID:22384203

Association between FTO gene polymorphisms and type 2 diabetes mellitus, serum levels of apelin and androgen hormones among Iranian obese women.

PubMed

Ghafarian-Alipour, Farzaneh; Ziaee, Shayan; Ashoori, Mohamad Reza; Zakeri, Mir Saeid; Boroumand, Mohammad Ali; Aghamohammadzadeh, Naser; Abbasi-Majdi, Maryam; Shool, Fatemeh; Asbaghi, Navid Sarakhs; Mohammadi, Abolghasem; Zarghami, Nosratollah

2018-01-30

Recent studies show that FTO single nucleotide polymorphisms (SNPs) are associated with obesity and type 2 diabetes mellitus (T2DM). On the other hand, many animal models and clinical studies have demonstrated that apelin, an adipocytokine, is related to the obesity and T2DM. Additionally, obese women are at risk of Hyperandrogenemia. So, the aim of this study was to investigate the relationship between FTO variants (rs763967273, rs759031579, rs141115189, rs9926289, rs76804286 and rs9939609) with T2DM, serum apelin and androgenic hormones in Iranian obese women. 197 obese women (123 women with T2DM and 74 women as healthy control) were participated in this study. Anthropometrical and biochemical characteristics were measured. Serum apelin and androgen hormones levels were determined in 66 subjects consisting of 33 cases and 33 controls. PCR were carried out and subsequently, the PCR production was genotyped by Sanger sequencing assay. Our observations showed that all SNPs are related to T2DM. The rs9926289 FTO variant had a strong association with serum apelin and dehydroepiandrosterone-sulfate levels (P=0.04 and P=0.03, respectively) among SNPs. In addition, apelin and androgenic hormones were correlated with T2DM. Two polymorphisms including rs9939609 and rs9926289 had a strong Linkage disequilibrium (r 2 =1). FTO variants not only were associated with T2DM, but also some variants had a strong association with apelin and androgenic hormones profile. Copyright © 2017 Elsevier B.V. All rights reserved.

[Association between aryl hydrocarbon receptor gene polymorphisms and chromosomal damage in coke-oven workers].

PubMed

Bin, Ping; Leng, Shuguang; Liang, Xuemiao; Cheng, Juan

2007-11-01

To investigate the association of single nucleotide polymorphisms (SNPs) or haplotypes of aryl hydrocarbon receptor (AHR) gene and chromosomal damage in peripheral blood lymphocytes among coke-oven workers. Eighty-nine coke-oven workers exposed to a high level of polycyclic aromatic hydrocarbons (PAHs) and sixty non-exposed workers were selected as the study subjects. Urinary 1-hydroxypyrene (1-OHPyr) levels were measured as the internal dose of PAHs exposure. The chromosomal damage in peripheral lymphocyte was measured by the cytokinesis-block micronucleus (CBMN) assay. Two SNPs in AHR gene, including rs6960165, rs2282885 were detected by PCR-RFLP. The AHR haplotypes were estimated by Bayesian statistical method with the software of PHASE Version 2.1. The associations between SNPs or haplotypes pairs and CBMN were assessed by analysis of covariance in the coke-oven workers and non-exposed workers. The level of 1-OHPyr among coke-oven workers was significantly higher than that among non-exposed workers (P < 0.01). The CBMN among coke-oven workers was significantly higher than that among non-exposed workers (P < 0.01). After adjusting the age and the level of 1-OHPyr, the different SNPs of AHR gene rs6960165 in coke-oven workers were related to the CBMN frequencies (P = 0.014), but no association between the different SNPs of AHR gene rs2282885 and the rates of CBMN was observed in coke-oven workers (P = 0.586), either in the controls (P = 0.308 and P = 0.415, respectively), the haplotypes in coke-oven workers were significantly related to the rates of CBMN (P = 0.007), while there was no significant association in non-exposed workers (P = 0.768). Our results suggested that SNPs rs6960165 or haplotypes of AHR were associated with the CBMN frequencies in coke-oven workers.

Genetic association with low concentrations of high density lipoprotein-cholesterol in a pediatric population of the Middle East and North Africa: the CASPIAN-III study.

PubMed

Kelishadi, Roya; Haghjooy Javanmard, Shaghayegh; Tajadini, Mohammad Hasan; Mansourian, Marjan; Motlagh, Mohammad Esmaeil; Ardalan, Gelayol; Ban, Matthew

2014-11-01

Depressed high-density lipoprotein cholesterol (HDL-C) is prevalent the Middle East and North Africa. Some studies have documented associations between HDL-C and several single nucleotide polymorphisms (SNPs) in candidate gene polymorphisms. We investigated the associations between SNP genotypes and HDL-C levels in Iranian students, aged 10-18 years. Genotyping was performed in 750 randomly selected participants among those with low HDL-C levels (below 5th percentile), intermediate HDL-C levels (5-95th) and high HDL-C levels (above the 95th percentile). Minor allele frequencies (MAFs) of the SNPs of interest were compared between the three HDL-C groups. The vast majority of pairwise comparisons of MAFs between HDL-C groups were significant. Pairwise comparisons between low and high HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for APOC3 rs5128. Pairwise comparisons between low and intermediate HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for APOC3 rs5128 and APOA1 rs2893157. Pairwise comparisons between intermediate and high HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for ABCA1 APOC3 rs5128 and APOA1 rs2893157. After adjustment for confounding factors, including age, sex, body mass index, low physical activity, consumption of saturated fats, and socioeconomic status, ABCA1 r1587K and CETP A373P significantly increased the risk of depressed HDL-C, and CETP Taq1 had a protective role. This study replicated several associations between HDL-C levels and candidate gene SNPs from genome-wide associations with HDL-C in Iranians from the pediatric age group. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

A 2-Stage Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms Associated With Development of Erectile Dysfunction Following Radiation Therapy for Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerns, Sarah L.; Departments of Pathology and Genetics, Albert Einstein College of Medicine, Bronx, New York; Stock, Richard

2013-01-01

Purpose: To identify single nucleotide polymorphisms (SNPs) associated with development of erectile dysfunction (ED) among prostate cancer patients treated with radiation therapy. Methods and Materials: A 2-stage genome-wide association study was performed. Patients were split randomly into a stage I discovery cohort (132 cases, 103 controls) and a stage II replication cohort (128 cases, 102 controls). The discovery cohort was genotyped using Affymetrix 6.0 genome-wide arrays. The 940 top ranking SNPs selected from the discovery cohort were genotyped in the replication cohort using Illumina iSelect custom SNP arrays. Results: Twelve SNPs identified in the discovery cohort and validated in themore » replication cohort were associated with development of ED following radiation therapy (Fisher combined P values 2.1 Multiplication-Sign 10{sup -5} to 6.2 Multiplication-Sign 10{sup -4}). Notably, these 12 SNPs lie in or near genes involved in erectile function or other normal cellular functions (adhesion and signaling) rather than DNA damage repair. In a multivariable model including nongenetic risk factors, the odds ratios for these SNPs ranged from 1.6 to 5.6 in the pooled cohort. There was a striking relationship between the cumulative number of SNP risk alleles an individual possessed and ED status (Sommers' D P value = 1.7 Multiplication-Sign 10{sup -29}). A 1-allele increase in cumulative SNP score increased the odds for developing ED by a factor of 2.2 (P value = 2.1 Multiplication-Sign 10{sup -19}). The cumulative SNP score model had a sensitivity of 84% and specificity of 75% for prediction of developing ED at the radiation therapy planning stage. Conclusions: This genome-wide association study identified a set of SNPs that are associated with development of ED following radiation therapy. These candidate genetic predictors warrant more definitive validation in an independent cohort.« less

Direct sequencing and comprehensive screening of genetic polymorphisms on CYP2 family genes (CYP2A6, CYP2B6, CYP2C8, and CYP2E1) in five ethnic populations.

PubMed

Kim, Jeong-Hyun; Cheong, Hyun Sub; Park, Byung Lae; Kim, Lyoung Hyo; Shin, Hee Jung; Na, Han Sung; Chung, Myeon Woo; Shin, Hyoung Doo

2015-01-01

Recently, CYP2A6, CYP2B6, CYP2C8, and CYP2E1 have been reported to play a role in the metabolic effect of pharmacological and carcinogenic compounds. Moreover, genetic variations of drug metabolism genes have been implicated in the interindividual variation in drug disposition and pharmacological response. To define the distribution of single nucleotide polymorphisms (SNPs) in these four CYP2 family genes and to discover novel SNPs across ethnic groups, 288 DNAs composed of 48 African-Americans, 48 European-Americans, 48 Japanese, 48 Han Chinese, and 96 Koreans were resequenced. A total of 143 SNPs, 26 in CYP2A6, 45 in CYP2B6, 29 in CYP2C8, and 43 in CYP2E1, were identified, including 13 novel variants. Notably, two SNPs in the regulatory regions, a promoter SNP rs2054675 and a nonsynonymous rs3745274 (p.172Q>H) in CYP2B6, showed significantly different minor allele frequencies (MAFs) among ethnic groups (minimum P = 4.30 × 10(-12)). In addition, rs2031920 in the promoter region of CYP2E1 showed a wide range of MAF between different ethnic groups, and even among other various ethnic groups based on public reports. Among 13 newly discovered SNPs in this study, 5 SNPs were estimated to have potential functions in further in silico analyses. Some differences in genetic variations and haplotypes of CYP2A6, CYP2B6, CYP2C8, and CYP2E1 were observed among populations. Our findings could be useful in further researches, such as genetic associations with drug responses.

Association between arachidonate 5-lipoxygenase-activating protein (ALOX5AP) and lung function in a Korean population.

PubMed

Ro, M; Kim, S; Pyun, J-A; Shin, C; Cho, N H; Lee, J-Y; Koh, I; Kwack, K

2012-08-01

Arachidonate 5-lipoxygenase-activating protein (ALOX5AP) plays a role in the 5-lipoxygenase (LO) pathway, which includes the LTC(4), LTD(4), LTE(4) and LTB(4). These leukotrienes are known causative factors of asthma, allergy, atopy and cardiovascular diseases. ALOX5AP lacks enzyme activity and acts by helping 5-LO function. In this study, healthy and general subjects who live in rural and urban areas of Korea were tested for the association of ALOX5AP polymorphisms with lung function. Lung function was also estimated by calculating the predicted values for forced expiratory volume in one second (FEV(1) _%PRED) and the proportion of the forced vital capacity exhaled in the first second (FEV(1) /FVC_PRED). The linear regression was adjusted for residence area, gender, age, height and smoking status. The analysis revealed associations between FEV(1) and the single-nucleotide polymorphism (SNP) rs9506352 and the haplotype TCAC (permuted P-value < 0.05). The linkage disequilibrium block that included the significant SNPs overlapped with SNPs that were revealed previously to associate with myocardial infarction and asthma and to affect lung function. This study is the first to demonstrate the association between lung function and ALOX5AP polymorphisms in a healthy and general population. © 2012 The Authors. Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd.

Hypoxia Inducible Factor-2 Alpha and Prolinhydroxylase 2 Polymorphisms in Patients with Acute Respiratory Distress Syndrome (ARDS).

PubMed

Dötsch, Annika; Eisele, Lewin; Rabeling, Miriam; Rump, Katharina; Walstein, Kai; Bick, Alexandra; Cox, Linda; Engler, Andrea; Bachmann, Hagen S; Jöckel, Karl-Heinz; Adamzik, Michael; Peters, Jürgen; Schäfer, Simon T

2017-06-14

Hypoxia-inducible-factor-2α (HIF-2α) and HIF-2 degrading prolyl-hydroxylases (PHD) are key regulators of adaptive hypoxic responses i.e., in acute respiratory distress syndrome (ARDS). Specifically, functionally active genetic variants of HIF-2α (single nucleotide polymorphism (SNP) [ch2:46441523(hg18)]) and PHD2 (C/T; SNP rs516651 and T/C; SNP rs480902) are associated with improved adaptation to hypoxia i.e., in high-altitude residents. However, little is known about these SNPs' prevalence in Caucasians and impact on ARDS-outcome. Thus, we tested the hypotheses that in Caucasian ARDS patients SNPs in HIF-2α or PHD2 genes are (1) common, and (2) independent risk factors for 30-day mortality. After ethics-committee approval, 272 ARDS patients were prospectively included, genotyped for PHD2 (Taqman SNP Genotyping Assay) and HIF-2α -polymorphism (restriction digest + agarose-gel visualization), and genotype dependent 30-day mortality was analyzed using Kaplan-Meier-plots and multivariate Cox-regression analyses. Frequencies were 99.62% for homozygous HIF-2α CC-carriers (CG: 0.38%; GG: 0%), 2.3% for homozygous PHD2 SNP rs516651 TT-carriers (CT: 18.9%; CC: 78.8%), and 3.7% for homozygous PHD2 SNP rs480902 TT-carriers (CT: 43.9%; CC: 52.4%). PHD2 rs516651 TT-genotype in ARDS was independently associated with a 3.34 times greater mortality risk (OR 3.34, CI 1.09-10.22; p = 0.034) within 30-days, whereas the other SNPs had no significant impact ( p = ns). The homozygous HIF-2α GG-genotype was not present in our Caucasian ARDS cohort; however PHD2 SNPs exist in Caucasians, and PHD2 rs516651 TT-genotype was associated with an increased 30-day mortality suggesting a relevance for adaptive responses in ARDS.

ESR1 and ESR2 polymorphisms in the BIG 1-98 trial comparing adjuvant letrozole versus tamoxifen or their sequence for early breast cancer.

PubMed

Leyland-Jones, Brian; Gray, Kathryn P; Abramovitz, Mark; Bouzyk, Mark; Young, Brandon; Long, Bradley; Kammler, Roswitha; Dell'Orto, Patrizia; Biasi, Maria Olivia; Thürlimann, Beat; Harvey, Vernon; Neven, Patrick; Arnould, Laurent; Maibach, Rudolf; Price, Karen N; Coates, Alan S; Goldhirsch, Aron; Gelber, Richard D; Pagani, Olivia; Viale, Giuseppe; Rae, James M; Regan, Meredith M

2015-12-01

Estrogen receptor 1 (ESR1) and ESR2 gene polymorphisms have been associated with endocrine-mediated physiological mechanisms, and inconsistently with breast cancer risk and outcomes, bone mineral density changes, and hot flushes/night sweats. DNA was isolated and genotyped for six ESR1 and two ESR2 single-nucleotide polymorphisms (SNPs) from tumor specimens from 3691 postmenopausal women with hormone receptor-positive breast cancer enrolled in the BIG 1-98 trial to receive tamoxifen and/or letrozole for 5 years. Associations with recurrence and adverse events (AEs) were assessed using Cox proportional hazards models. 3401 samples were successfully genotyped for five SNPs. ESR1 rs9340799(XbaI) (T>C) variants CC or TC were associated with reduced breast cancer risk (HR = 0.82,95% CI = 0.67-1.0), and ESR1 rs2077647 (T>C) variants CC or TC was associated with reduced distant recurrence risk (HR = 0.69, 95% CI = 0.53-0.90), both regardless of the treatments. No differential treatment effects (letrozole vs. tamoxifen) were observed for the association of outcome with any of the SNPs. Letrozole-treated patients with rs2077647 (T>C) variants CC and TC had a reduced risk of bone AE (HR = 0.75, 95% CI = 0.58-0.98, P interaction = 0.08), whereas patients with rs4986938 (G>A) genotype variants AA and AG had an increased risk of bone AE (HR = 1.37, 95% CI = 1.01-1.84, P interaction = 0.07). We observed that (1) rare ESR1 homozygous polymorphisms were associated with lower recurrence, and (2) ESR1 and ESR2 SNPs were associated with bone AEs in letrozole-treated patients. Genes that are involved in estrogen signaling and synthesis have the potential to affect both breast cancer recurrence and side effects, suggesting that individual treatment strategies can incorporate not only oncogenic drivers but also SNPs related to estrogen activity.

Association of Androgen Metabolism Gene Polymorphisms with Prostate Cancer Risk and Androgen Concentrations: Results from the Prostate Cancer Prevention Trial

PubMed Central

Price, Douglas K.; Chau, Cindy H.; Till, Cathee; Goodman, Phyllis J.; Leach, Robin J.; Johnson-Pais, Teresa L.; Hsing, Ann W.; Hoque, Ashraful; Parnes, Howard L.; Schenk, Jeannette M.; Tangen, Catherine M.; Thompson, Ian M.; Reichardt, Juergen K.V.; Figg, William D.

2016-01-01

Background Prostate cancer is highly influenced by androgens and genes. We investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or risk of prostate cancer or high-grade disease from finasteride treatment. Methods A nested case-control study from the Prostate Cancer Prevention Trial using cases drawn from men with biopsy-proven prostate cancer and biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with total, low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. Results There were significant associations of genetic polymorphisms in SRD5A1 (rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with risk of high-grade prostate cancer in the placebo arm of the PCPT; two SNPs were significantly associated with increased risk (SRD5A1 rs472402 [OR, 1.70; 95% CI, 1.05-2.75, Ptrend=0.03]; SRD5A2 rs2300700 [OR, 1.94; 95% CI, 1.19-3.18, Ptrend=0.01]). Eleven SNPs in SRD5A1, SRD5A2, CYP1B1, and CYP3A4 were found to be associated with modifying mean serum androgen and sex hormone-binding globulin concentrations; two SNPs (SRD5A1 rs824811 and CYP1B1 rs10012, Ptrend<0.05) consistently and significantly altered all androgen concentrations. Several SNPs (rs3822430, rs2300700; CYP3A43 rs800672; CYP19 rs700519; Ptrend<0.05) were significantly associated with both circulating hormone levels and prostate cancer risk. Conclusion Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. PMID:27164191

Replication of Caucasian loci associated with bone mineral density in Koreans.

PubMed

Kim, Y A; Choi, H J; Lee, J Y; Han, B G; Shin, C S; Cho, N H

2013-10-01

Most bone mineral density (BMD) loci were reported in Caucasian genome-wide association studies (GWAS). This study investigated the association between 59 known BMD loci (+200 suggestive SNPs) and DXA-derived BMD in East Asian population with respect to sex and site specificity. We also identified four novel BMD candidate loci from the suggestive SNPs. Most GWAS have reported BMD-related variations in Caucasian populations. This study investigates whether the BMD loci discovered in Caucasian GWAS are also associated with BMD in East Asian ethnic samples. A total of 2,729 unrelated Korean individuals from a population-based cohort were analyzed. We selected 747 single-nucleotide polymorphisms (SNPs). These markers included 547 SNPs from 59 loci with genome-wide significance (GWS, p value less than 5 × 10(-8)) levels and 200 suggestive SNPs that showed weaker BMD association with p value less than 5 × 10(-5). After quality control, 535 GWS SNPs and 182 suggestive SNPs were included in the replication analysis. Of the 535 GWS SNPs, 276 from 25 loci were replicated (p < 0.05) in the Korean population with 51.6 % replication rate. Of the 182 suggestive variants, 16 were replicated (p < 0.05, 8.8 % of replication rate), and five reached a significant combined p value (less than 7.0 × 10(-5), 0.05/717 SNPs, corrected for multiple testing). Two markers (rs11711157, rs3732477) are for the same signal near the gene CPN2 (carboxypeptidase N, polypeptide 2). The other variants, rs6436440 and rs2291296, were located in the genes AP1S3 (adaptor-related protein complex 1, sigma 3 subunit) and RARB (retinoic acid receptor, beta). Our results illustrate ethnic differences in BMD susceptibility genes and underscore the need for further genetic studies in each ethnic group. We were also able to replicate some SNPs with suggestive associations. These SNPs may be BMD-related genetic markers and should be further investigated.

T cell cytokine gene polymorphisms in canine diabetes mellitus.

PubMed

Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R

2009-03-15

Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

PubMed

Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

2016-06-01

Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

Genetic polymorphisms in the cytokine and chemokine system: their possible importance in allogeneic stem cell transplantation.

PubMed

Loeffler, Juergen; Ok, Michael; Morton, Oliver C; Mezger, Markus; Einsele, Hermann

2010-01-01

Chemokines represent central players of the innate and adaptive immunity and are involved in the regulation of inflammatory events occurring during infectious complications or during graft vs. host disease (GvHD). Patients after allogeneic stem cell transplantation (alloSCT) are at a high risk for the development of acute GvHD or to suffer from fungal infections. Susceptibility to fungal infections and the course of GvHD can be genetically influenced by single nucleotide polymorphisms (SNPs), which regulate expression or biological activity of chemokines, and therefore have an impact on the outcome of invasive aspergillosis and GvHD. High lightened studies of abetting factors for GvHD revealed SNPs in TNFA, IL-6, IL-10, INF-γ, CCL2, CCL5 (RANTES), IL-1Ra, IL-23R, IL-7Ralpha, IL-10RB, and CCR9 genes as prevalent considerable. Furthermore, additional SNPs were described to be significantly associated with fungal infections (Aspergillus fumigatus, Candida albicans), including markers in CCL3, CCL4, CCL20, CXCL2, CXCL8, CXCL10, CCR1, and CCR2. This review summarizes the current knowledge about the growing number of genetic markers in chemokine genes and their relevance for patients after alloSCT.

Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

PubMed

El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

2017-03-01

Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle.

PubMed

Magee, David A; Sikora, Klaudia M; Berkowicz, Erik W; Berry, Donagh P; Howard, Dawn J; Mullen, Michael P; Evans, Ross D; Spillane, Charles; MacHugh, David E

2010-10-13

Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle

PubMed Central

2010-01-01

Background Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Results Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Conclusions Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations. PMID:20942903

Polymorphisms of vitamin K-related genes (EPHX1 and VKORC1L1) and stable warfarin doses.

PubMed

Chung, Jee-Eun; Lee, Kyung Eun; Chang, Byung Chul; Gwak, Hye Sun

2018-01-30

The aim of this study was to investigate the possible effects of EPHX1 and VKORC1L1 polymorphisms on variability of responses to warfarin. Sixteen single nucleotide polymorphisms (SNPs) in 201 patients with stable warfarin doses were analyzed including genes of VKORC1, CYP2C9, CYP4F2, GGCX, EPHX1 and VKORC1L1. Univariate analysis was conducted for the association of genotypes with stable warfarin doses. Multiple linear regression analysis was used to investigate factors that independently affected the inter-individual variability of warfarin dose requirements. The rs4072879 of VKORC1L1 (A>G) was significantly associated with stable warfarin doses; wild homozygote carriers (AA) required significantly lower stable warfarin doses than those with the variant G allele (5.02±1.56 vs. 5.96±2.01mg; p=0.001). Multivariate analysis showed that EPHX1 rs1877724 and VKORC1L1 rs4072879 accounted for 1.5% and 1.3% of the warfarin dose variability. Adding EPHX1 and VKORC1L1 SNPs to the base model including non-genetic variables (operation age, body weight and the therapy of ACEI or ARB) and genetic variables (VKORC1 rs9934438, CYP2C9 rs1057910, and CYP4F2 rs2108622) gave a number needed to genotype of 34. This study showed that polymorphisms of EPHX1 and VKORC1L1 could be determinants of stable warfarin doses. Copyright © 2017. Published by Elsevier B.V.

Lymphocyte Antigen 75 Polymorphisms Are Associated with Disease Susceptibility and Phenotype in Japanese Patients with Inflammatory Bowel Disease.

PubMed

Hirayama, Atsuhiro; Joshita, Satoru; Kitahara, Kei; Mukawa, Kenji; Suga, Tomoaki; Umemura, Takeji; Tanaka, Eiji; Ota, Masao

2016-01-01

Recent genome-wide association studies have rapidly improved our understanding of the molecular pathways leading to inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC). Although several reports have demonstrated that gene single nucleotide polymorphisms (SNPs) are associated with susceptibility to IBD, its precise genetic factors have not been fully clarified. Here, we performed an association analysis between lymphocyte antigen 75 ( LY75 ) genetic variations and IBD susceptibility or phenotype. SNPs were genotyped in 51 CD patients, 94 UC patients, and 269 healthy controls of Japanese ethnicity. We detected a significant relationship with CD susceptibility for the rs16822581 LY75 SNP ( P = 0.045). One haplotype (GT, P = 0.042) was also associated with CD susceptibility, while another carrying the opposite SNP (CA) was linked to an absence of surgical history for CD. Our findings confirm that LY75 is involved in CD susceptibility and may play a role in disease activity in the Japanese population.

The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs.

PubMed

Udagawa, Chihiro; Tada, Naomi; Asano, Junzo; Ishioka, Katsumi; Ochiai, Kazuhiko; Bonkobara, Makoto; Tsuchida, Shuichi; Omi, Toshinori

2014-12-11

The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family that play an important role in energy homeostasis. Genetic association studies have shown that human UCP2 and UCP3 variants (SNPs and indels) are associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome. The aim of this study was to examine the genetic association between polymorphisms in UCP2 and UCP3 and metabolic data in dogs. We identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2, and 13 SNPs (11 intronic and 2 exonic) and one indel (exonic) in UCP3, by DNA sequence analysis of 11 different dog breeds (n=119). An association study between these UCP2 and UCP3 variants and the biochemical parameters of glucose, total cholesterol, lactate dehydrogenase and triglyceride in Labrador Retrievers (n=50) showed that none of the UCP2 polymorphisms were significantly associated with the levels of these parameters. However, four UCP3 SNPs (intron 1) were significantly associated with total cholesterol levels. In addition, the allele frequencies of two of the four SNPs associated with higher total cholesterol levels in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs, n=30), compared with the control breed (Shiba, n=30). The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. The examination of larger sample sizes and further analysis will lead to increased precision of these results.

Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum).

PubMed

Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh

2014-02-01

Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.

IL28B polymorphisms of both recipient and donor cooperate to influence IFN treatment response in HCV recurrence after liver transplantation, but IL28B SNPs of the recipient play a major role in IFN-induced blocking of HCV replication.

PubMed

Barbera, Floriana; Russelli, Giovanna; Pipitone, Loredana; Pietrosi, Giada; Corsale, Sveva; Vizzini, Giovanni; Gridelli, Bruno; Conaldi, Pier Giulio

2015-04-01

Single nucleotide polymorphisms (SNPs) of the IL28B locus are associated with a positive response to pegylated interferon-alpha and ribavirin (pegIFN-alpha/RBV) treatment of HCV-infected patients. This study evaluated the association between SNPs rs12980275, rs12979860 and rs8099917 and treatment outcome of HCV recurrent infection in HCV-positive patients who underwent liver transplant. We aimed to assess to what extent recipient and/or graft donor IL28B polymorphisms contribute to HCV clearance after transplantation influencing the response to the antiviral treatment. We found that the allele frequencies in donors were in agreement with the pattern expected in the European population. The frequency of favourable genotypes was significantly lower in recipients than in donors, reasonably because the recipients represented a group of patients affected by chronic Hepatitis C. Our study demonstrated that the positive outcome of the pegIFN-alpha/RBV treatment of HCV recurrence is associated with the co-presence of favourable genotypes of both donors and recipients. However, IL28B SNPs of the recipient seem to play a major role in this clinical setting. In particular, homozygosis of rs12979860 favourable genotype in recipients was associated with sustained virological response independently from the donor's genotype. Thus, identification of these SNPs may be useful to predict the response to IFN-based therapy of HCV recurrent infection in liver-transplanted patients.

A web-based genome browser for 'SNP-aware' assay design

USDA-ARS?s Scientific Manuscript database

Human and animal genomes contain an abundance of single nucleotide polymorphisms (SNPs) that are useful for genetic testing. However, the relatively large number of SNPs present in diverse populations can pose serious problems when designing assays. It is important to “mask” some SNP positions so ...

Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

SNP identification, genetic mapping and tissue expression of the rainbow trout TLR9 gene

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) in Toll-like receptor (TLR) genes have been reported to be associated with disease resistance in human and livestock. A number of TLR genes have been identified in rainbow trout including TLR2, TLR3, TLR5, TLR20, TLR22 and TLR23. The rainbow trout (Oncorhynch...

[Distribution of variant alleles association with warfarin pharmacokinetics and pharmacodynamics in the Han population in China].

PubMed

Liu, Yuan; Zhong, Shi-long; Yang, Min; Tan, Hong-hong; Fei, Hong-wen; Chen, Ji-yan; Yu, Xi-yong; Lin, Shu-guang

2011-12-18

To investigate distribution of CYP2C9, CYP3A4, VKORC1 and GGCX gene polymorphisms in the Han population of Guangdong. The subjects included were 970 Chinese Han patients who received long-term warfarin anticoagulant therapy orally after valve replacement in Guangdong General Hospital between 2000 and 2008. By selecting and analyzing the 12 single nucleotide polymorphisms (SNPs) loci, rs12572351 G>A, rs9332146 G>A, rs4917639 G>T, rs1057910 A>C (CYP2C9*3), rs1934967 G>T, rs1934968 G>A, rs2242480 T>C, rs2246709 G>A, rs9923231 C>T (VKORC1-1639 G>A), rs2359612 G>A (VKORC1*2), rs10871454 C>T, and rs699664 T>C, in 4 genes including CYP2C9, CYP3A4, VKORC1 and GGCX that were possibly correlated with warfarin pharmacodynamics and pharmacokinetics through literature retrieval, the distribution of mutation frequencies of the 12 SNPs loci in Chinese Han population were obtained systematically. SNaPshot technique was used to detect gene SNPs, Hardy-Weinberg genetic equilibrium test was used to test population representativeness. The allelic mutation frequency at CYP2C9 gene rs12572351 G>A, rs9332146 G>A, rs4917639 C>A, rs1057910 A>C (*3), rs1934967 G>T and rs1934968 G>A loci was 32.53%, 2.16%, 8.25%, 3.61%, 19.18% and 37.37%, respectively; the allelic mutation frequency at CYP3A4 gene rs2242480 T>C and rs2246709 G>A loci was 29.07% and 40.41%, respectively; the allelic mutation frequency at VKORC1 gene rs9923231 C>T, rs2359612 G>A and rs10871454 C>T SNPs loci was 87.99%, 87.94% and 91.34%, respectively; the allelic mutation frequency at GGCX gene rs699664 T>C locus was 31.86%. It is of important clinical significance in individualized warfarin therapy to systematically study distribution of mutation frequencies at 12 polymorphisms loci in 4 genes including CYP2C9, CYP3A4 , VKORC1 and GGCX related to warfarin pharmacodynamics and pharmacokinetics in the Chinese Han population receiving valve replacement.

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

PubMed

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

PubMed Central

Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

2014-01-01

Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Development and evaluation of high-density Axiom® CicerSNP Array for high-resolution genetic mapping and breeding applications in chickpea.

PubMed

Roorkiwal, Manish; Jain, Ankit; Kale, Sandip M; Doddamani, Dadakhalandar; Chitikineni, Annapurna; Thudi, Mahendar; Varshney, Rajeev K

2018-04-01

To accelerate genomics research and molecular breeding applications in chickpea, a high-throughput SNP genotyping platform 'Axiom ® CicerSNP Array' has been designed, developed and validated. Screening of whole-genome resequencing data from 429 chickpea lines identified 4.9 million SNPs, from which a subset of 70 463 high-quality nonredundant SNPs was selected using different stringent filter criteria. This was further narrowed down to 61 174 SNPs based on p-convert score ≥0.3, of which 50 590 SNPs could be tiled on array. Among these tiled SNPs, a total of 11 245 SNPs (22.23%) were from the coding regions of 3673 different genes. The developed Axiom ® CicerSNP Array was used for genotyping two recombinant inbred line populations, namely ICCRIL03 (ICC 4958 × ICC 1882) and ICCRIL04 (ICC 283 × ICC 8261). Genotyping data reflected high success and polymorphic rate, with 15 140 (29.93%; ICCRIL03) and 20 018 (39.57%; ICCRIL04) polymorphic SNPs. High-density genetic maps comprising 13 679 SNPs spanning 1033.67 cM and 7769 SNPs spanning 1076.35 cM were developed for ICCRIL03 and ICCRIL04 populations, respectively. QTL analysis using multilocation, multiseason phenotyping data on these RILs identified 70 (ICCRIL03) and 120 (ICCRIL04) main-effect QTLs on genetic map. Higher precision and potential of this array is expected to advance chickpea genetics and breeding applications. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

PubMed Central

Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

2012-01-01

Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

Next generation sequencing of SNPs using the HID-Ion AmpliSeq™ Identity Panel on the Ion Torrent PGM™ platform.

PubMed

Guo, Fei; Zhou, Yishu; Song, He; Zhao, Jinling; Shen, Hongying; Zhao, Bin; Liu, Feng; Jiang, Xianhua

2016-11-01

The HID-Ion AmpliSeq™ Identity Panel (the HID Identity Panel) is designed to detect 124-plex single nucleotide polymorphisms (SNPs) with next generation sequencing (NGS) technology on the Ion Torrent PGM™ platform, including 90 individual identification SNPs (IISNPs) on autosomal chromosomes and 34 lineage informative SNPs (LISNPs) on Y chromosome. In this study, we evaluated performance for the HID Identity Panel to provide a reference for NGS-SNP application, focusing on locus strand balance, locus coverage balance, heterozygote balance, and background signals. Besides, several experiments were carried out to find out improvements and limitations of this panel, including studies of species specificity, repeatability and concordance, sensitivity, mixtures, case-type samples and degraded samples, population genetics and pedigrees following the Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines. In addition, Southern and Northern Chinese Han were investigated to assess applicability of this panel. Results showed this panel led to cross-reactivity with primates to some extent but rarely with non-primate animals. Repeatable and concordant genotypes could be obtained in triplicate with one exception at rs7520386. Full profiles could be obtained from 100pg input DNA, but the optimal input DNA would be 1ng-200pg with 21 initial PCR cycles. A sample with ≥20% minor contributor could be considered as a mixture by the number of homozygotes, and full profiles belonging to minor contributors could be detected between 9:1 and 1:9 mixtures with known reference profiles. Also, this assay could be used for case-type samples and degraded samples. For autosomal SNPs (A-SNPs), F ST across all 90loci was not significantly different between Southern and Northern Chinese Han or between male and female samples. All A-SNP loci were independent in Chinese Han population. Except for 18loci with H e <0.4, most of the A-SNPs in the HID Identity Panel presented high polymorphisms. Forensic parameters were calculated as >99.999% for combined discrimination power (CDP), 0.999999724 for combined power of exclusion (CPE), 1.390×10 11 for combined likelihood ratio (CLR) of trios, and 2.361×10 6 for CLR of motherless duos. For Y-SNPs, a total of 8 haplotypes were observed with the value of 0.684 for haplotype diversity. As a whole, the HID Identity Panel is a well-performed, robust, reliable and high informative NGS-SNP assay and it can fully meet requirements for individual identification and paternity testing in forensic science. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Genetic variation in polyunsaturated fatty acid metabolism and its potential relevance for human development and health.

PubMed

Glaser, Claudia; Lattka, Eva; Rzehak, Peter; Steer, Colin; Koletzko, Berthold

2011-04-01

Blood and tissue contents of polyunsaturated fatty acid (PUFA) and long-chain PUFA (LC-PUFA) are related to numerous health outcomes including cardiovascular health, allergies, mental health and cognitive development. Evidence has accumulated to show that in addition to diet, common polymorphisms in the fatty acid desaturase (FADS) gene cluster have very marked effects on human PUFA and LC-PUFA status. Recent results suggest that in addition to fatty acid desaturase 1 and fatty acid desaturase 2, the gene product of fatty acid desaturase 3 is associated with desaturating activity. New data have become available to show that FADS single nucleotide polymorphisms (SNPs) also modulate docosahexaenoic acid status in pregnancy as well as LC-PUFA levels in children and in human milk. There are indications that FADS SNPs modulate the risk for allergic disorders and eczema, and the effect of breastfeeding on later cognitive development. Mechanisms by which FADS SNPs modulate PUFA levels in blood, breast milk and tissues should be explored further. More studies are required to explore the effects of FADS gene variants in populations with different ethnic backgrounds, lifestyles and dietary habits, and to investigate in greater depth the interaction of gene variants, diet and clinical end points, including immune response and developmental outcomes. Analyses of FADS gene variants should be included into all sizeable cohort and intervention studies addressing biological effects of PUFA and LC-PUFA in order to consider these important confounders, and to enhance study sensitivity and precision. © 2011 Blackwell Publishing Ltd.

HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

PubMed

Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

2007-04-04

To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

Fatal Methadone Toxicity: Potential Role of CYP3A4 Genetic Polymorphism

PubMed Central

Richards-Waugh, Lauren L.; Primerano, Donald A.; Dementieva, Yulia; Kraner, James C.; Rankin, Gary O.

2014-01-01

Methadone is difficult to administer as a therapeutic agent because of a wide range of interindividual pharmacokinetics, likely due to genetic variability of the CYP450 enzymes responsible for metabolism to its principal metabolite 2-ethylidene-1,5-dimethyl-3,3-diphenylpyrrolidine (EDDP). CYP3A4 is one of the primary CYP450 isoforms responsible for the metabolism of methadone to EDDP in humans. The purpose of this study was to evaluate the role of CYP3A4 genetic polymorphisms in accidental methadone fatalities. A study cohort consisting of 136 methadone-only and 92 combined methadone/benzodiazepine fatalities was selected from cases investigated at the West Virginia and Kentucky Offices of the Chief Medical Examiner. Seven single nucleotide polymorphisms (SNPs) were genotyped within the CYP3A4 gene. Observed allelic and genotypic frequencies were compared with expected frequencies obtained from The National Center for Biotechnology Information dbSNP database. SNPs rs2242480 and rs2740574 demonstrated an apparent enrichment within the methadone-only overdose fatalities compared with the control group and the general population. This enrichment was not apparent in the methadone/benzodiazepine cases for these two SNPs. Our findings indicate that there may be two or more SNPs on the CYP3A4 gene that cause or contribute to the methadone poor metabolizer phenotype. PMID:25217544

EPHA2 Polymorphisms in Estonian Patients with Age-Related Cataract.

PubMed

Celojevic, Dragana; Abramsson, Alexandra; Seibt Palmér, Mona; Tasa, Gunnar; Juronen, Erkki; Zetterberg, Henrik; Zetterberg, Madeleine

2016-01-01

Ephrin receptors (Ephs) are tyrosine kinases that together with their ligands, ephrins, are considered important in cell-cell communication, especially during embryogenesis but also for epithelium homeostasis. Studies have demonstrated the involvement of mutations or common variants of the gene encoding Eph receptor A2 (EPHA2), in congenital cataract and in age-related cataract. This study investigated a number of disease-associated single nucleotide polymorphisms (SNPs) in EPHA2 in patients with age-related cataract. The study included 491 Estonian patients who had surgery for age-related cataract, classified as nuclear, cortical, posterior subcapsular and mixed lens opacities, and 185 controls of the same ethnical origin. Seven SNPs in EPHA2 (rs7543472, rs11260867, rs7548209, rs3768293, rs6603867, rs6678616, rs477558) were genotyped using TaqMan Allelic Discrimination. Statistical analyses for single factor associations used χ(2)-test and logistic regression was performed including relevant covariates (age, sex and smoking). In single-SNP allele analysis, only the rs7543472 showed a borderline significant association with risk of cataract (p = 0.048). Regression analysis with known risk factors for cataract showed no significant associations of the studied SNPs with cataract. Stratification by cataract subtype did not alter the results. Adjusted odds ratios were between 0.82 and 1.16 (95% confidence interval 0.61-1.60). The present study does not support a major role of EphA2 in cataractogenesis in an Estonian population.

Association of yield-related traits in founder genotypes and derivatives of common wheat (Triticum aestivum L.).

PubMed

Guo, Jie; Shi, Weiping; Zhang, Zheng; Cheng, Jingye; Sun, Daizhen; Yu, Jin; Li, Xinlei; Guo, Pingyi; Hao, Chenyang

2018-02-20

Yield improvement is an ever-important objective of wheat breeding. Studying and understanding the phenotypes and genotypes of yield-related traits has potential for genetic improvement of crops. The genotypes of 215 wheat cultivars including 11 founder parents and 106 derivatives were analyzed by the 9 K wheat SNP iSelect assay. A total of 4138 polymorphic single nucleotide polymorphism (SNP) loci were detected on 21 chromosomes, of which 3792 were mapped to single chromosome locations. All genotypes were phenotyped for six yield-related traits including plant height (PH), spike length (SL), spikelet number per spike (SNPS), kernel number per spike (KNPS), kernel weight per spike (KWPS), and thousand kernel weight (TKW) in six irrigated environments. Genome-wide association analysis detected 117 significant associations of 76 SNPs on 15 chromosomes with phenotypic explanation rates (R 2 ) ranging from 2.03 to 12.76%. In comparing allelic variation between founder parents and their derivatives (106) and other cultivars (98) using the 76 associated SNPs, we found that the region 116.0-133.2 cM on chromosome 5A in founder parents and derivatives carried alleles positively influencing kernel weight per spike (KWPS), rarely found in other cultivars. The identified favorable alleles could mark important chromosome regions in derivatives that were inherited from founder parents. Our results unravel the genetic of yield in founder genotypes, and provide tools for marker-assisted selection for yield improvement.

Genome Wide Association Study of Sepsis in Extremely Premature Infants

PubMed Central

Srinivasan, Lakshmi; Page, Grier; Kirpalani, Haresh; Murray, Jeffrey C.; Das, Abhik; Higgins, Rosemary D.; Carlo, Waldemar A.; Bell, Edward F.; Goldberg, Ronald N.; Schibler, Kurt; Sood, Beena G.; Stevenson, David K.; Stoll, Barbara J.; Van Meurs, Krisa P.; Johnson, Karen J.; Levy, Joshua; McDonald, Scott A.; Zaterka-Baxter, Kristin M.; Kennedy, Kathleen A.; Sánchez, Pablo J.; Duara, Shahnaz; Walsh, Michele C.; Shankaran, Seetha; Wynn, James L.; Cotten, C. Michael

2017-01-01

Objective To identify genetic variants associated with sepsis (early and late-onset) using a genome wide association (GWA) analysis in a cohort of extremely premature infants. Study Design Previously generated GWA data from the Neonatal Research Network’s anonymized genomic database biorepository of extremely premature infants were used for this study. Sepsis was defined as culture-positive early-onset or late-onset sepsis or culture-proven meningitis. Genomic and whole genome amplified DNA was genotyped for 1.2 million single nucleotide polymorphisms (SNPs); 91% of SNPs were successfully genotyped. We imputed 7.2 million additional SNPs. P values and false discovery rates were calculated from multivariate logistic regression analysis adjusting for gender, gestational age and ancestry. Target statistical value was p<10−5. Secondary analyses assessed associations of SNPs with pathogen type. Pathway analyses were also run on primary and secondary end points. Results Data from 757 extremely premature infants were included: 351 infants with sepsis and 406 infants without sepsis. No SNPs reached genome-wide significance levels (5×10−8); two SNPs in proximity to FOXC2 and FOXL1 genes achieved target levels of significance. In secondary analyses, SNPs for ELMO1, IRAK2 (Gram positive sepsis), RALA, IMMP2L (Gram negative sepsis) and PIEZO2 (fungal sepsis) met target significance levels. Pathways associated with sepsis and Gram negative sepsis included gap junctions, fibroblast growth factor receptors, regulators of cell division and Interleukin-1 associated receptor kinase 2 (p values<0.001 and FDR<20%). Conclusions No SNPs met genome-wide significance in this cohort of ELBW infants; however, areas of potential association and pathways meriting further study were identified. PMID:28283553

Genome Wide Analysis of Fertility and Production Traits in Italian Holstein Cattle

PubMed Central

Stella, Alessandra; Biffani, Stefano; Negrini, Riccardo; Lazzari, Barbara; Ajmone-Marsan, Paolo; Williams, John L .

2013-01-01

A genome wide scan was performed on a total of 2093 Italian Holstein proven bulls genotyped with 50K single nucleotide polymorphisms (SNPs), with the objective of identifying loci associated with fertility related traits and to test their effects on milk production traits. The analysis was carried out using estimated breeding values for the aggregate fertility index and for each trait contributing to the index: angularity, calving interval, non-return rate at 56 days, days to first service, and 305 day first parity lactation. In addition, two production traits not included in the aggregate fertility index were analysed: fat yield and protein yield. Analyses were carried out using all SNPs treated separately, further the most significant marker on BTA14 associated to milk quality located in the DGAT1 region was treated as fixed effect. Genome wide association analysis identified 61 significant SNPs and 75 significant marker-trait associations. Eight additional SNP associations were detected when SNP located near DGAT1 was included as a fixed effect. As there were no obvious common SNPs between the traits analyzed independently in this study, a network analysis was carried out to identify unforeseen relationships that may link production and fertility traits. PMID:24265800

The oxytocin receptor gene (OXTR) is associated with autism spectrum disorder: a meta-analysis.

PubMed

LoParo, D; Waldman, I D

2015-05-01

The oxytocin receptor gene (OXTR) has been studied as a risk factor for autism spectrum disorder (ASD) owing to converging evidence from multiple levels of analysis that oxytocin (OXT) has an important role in the regulation of affiliative behavior and social bonding in both nonhuman mammals and humans. Inconsistency in the effect sizes of the OXTR variants included in association studies render it unclear whether OXTR is truly associated with ASD, and, if so, which OXTR single-nucleotide polymorphisms (SNPs) are associated. Thus, a meta-analytic review of extant studies is needed to determine whether OXTR shows association with ASD, and to elucidate which specific SNPs have a significant effect on ASD. The current meta-analysis of 16 OXTR SNPs included 3941 individuals with ASD from 11 independent samples, although analyses of each individual SNP included a subset of this total. We found significant associations between ASD and the SNPs rs7632287, rs237887, rs2268491 and rs2254298. OXTR was also significantly associated with ASD in a gene-based test. The current meta-analysis is the largest and most comprehensive investigation of the association of OXTR with ASD and the findings suggest directions for future studies of the etiology of ASD.

HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population

PubMed Central

Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

2014-01-01

Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234

TLR9 Gene Region Polymorphisms and Susceptibility to Tuberculosis in Vietnam

PubMed Central

Graustein, AD; Horne, DJ; Arentz, M; Bang, ND; Chau, TTH; Thwaites, GE; Caws, M; Thuong, NTT; Dunstan, SJ; Hawn, TR

2015-01-01

Summary Humans exposed to Mycobacterium tuberculosis (Mtb) show variation in susceptibility to infection and differences in tuberculosis (TB) disease outcome. Toll-like receptor 9 (TLR9) is a pattern recognition receptor that mediates recognition of Mtb and modulates Mtb-specific T-cell responses. Using a case-population design, we evaluated whether single nucleotide polymorphisms (SNPs) in the TLR9 gene region are associated with susceptibility to pulmonary or meningeal TB as well as neurologic presentation and mortality in the meningeal TB group. In a discovery cohort (n = 352 cases, 382 controls), three SNPs were associated with TB (all forms, p<0.05) while three additional SNPs neared significance (0.05

Interactions between C-reactive protein genotypes with markers of nutritional status in relation to inflammation.

PubMed

Nienaber-Rousseau, Cornelie; Swanepoel, Bianca; Dolman, Robin C; Pieters, Marlien; Conradie, Karin R; Towers, G Wayne

2014-11-11

Inflammation, as indicated by C-reactive protein concentrations (CRP), is a risk factor for chronic diseases. Both genetic and environmental factors affect susceptibility to inflammation. As dietary interventions can influence inflammatory status, we hypothesized that dietary effects could be influenced by interactions with single nucleotide polymorphisms (SNPs) in the CRP gene. We determined 12 CRP SNPs, as well as various nutrition status markers in 2010 black South Africans and analyzed their effect on CRP. Interactions were observed for several genotypes with obesity in determining CRP. Lipid intake modulated the pro-inflammatory effects of some SNPs, i.e., an increase in both saturated fatty acid and monounsaturated fatty acid intake in those homozygous for the polymorphic allele at rs2808630 was associated with a larger increase in CRP. Those harboring the minor alleles at rs3093058 and rs3093062 presented with significantly higher CRP in the presence of increased triglyceride or cholesterol intake. When harboring the minor allele of these SNPs, a high omega-6 to -3 ratio was, however, found to be anti-inflammatory. Carbohydrate intake also modulated CRP SNPs, as HbA1C and fasting glucose levels interacted with some SNPs to influence the CRP. This investigation highlights the impact that nutritional status can have on reducing the inherent genetic susceptibility to a heightened systemic inflammatory state.

Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

PubMed

Ojeda, Diego A; Forero, Diego A

2014-10-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Worldwide Distribution of Four SNPs in X‐Ray and Repair and Cross‐Complementing Group 1 (XRCC1)

PubMed Central

Takeshita, Haruo; Yasuda, Toshihiro; Kimura‐Kataoka, Kaori

2014-01-01

Abstract Purpose X‐ray repair cross‐complementing group 1 (XRCC1) repairs single‐strand breaks in DNA. Several reports have shown the association of single nucleotide polymorphisms (SNPs) (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 to diseases. Limited population data are available regarding SNPs in XRCC1, especially in African populations. In this study, genotype distributions of four SNPs in worldwide populations were examined and compared with those reported previously. Materials and Methods Four SNPs (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 from genomic DNA samples of 10 populations were evaluated by using polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results The frequency of the minor allele corresponding to the Trp allele of XRCC1Arg194Trp was higher in Asian populations than in African and Caucasian populations. As for XRCC1Pro206Pro, Africans showed higher minor allele frequencies than did Asian populations, except for Tamils and Sinhalese. XRCC1 Arg280His frequencies were similar among Africans and Caucasians but differed among Asian populations. Similarly, lower mutant XRCC1 Arg399Gln frequencies were observed in Africans. Conclusions This study is the first to show the existence of a certain genetic heterogeneity in the worldwide distribution of four SNPs in XRCC1. PMID:25387884

Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

PubMed

Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

2016-07-01

A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

Evolutionary selective pressure on three mitochondrial SNPs is consistent with their influence on metabolic efficiency in Pima Indians.

PubMed

Chamala, Srikar; Beckstead, Wesley A; Rowe, Mark J; McClellan, David A

2007-01-01

We investigated whether the effect of evolutionary selection on three recent Single Nucleotide Polymorphisms (SNPs) in the mitochondrial sub-haplogroups of Pima Indians is consistent with their effects on metabolic efficiency. The mitochondrial SNPs impact metabolic rate and respiratory quotient, and may be adaptations to caloric restriction in a desert habitat. Using TreeSAAP software, we examined evolutionary selection in 107 mammalian species at these SNPs, characterising the biochemical shifts produced by the amino acid substitutions. Our results suggest that two SNPs were affected by selection during mammalian evolution in a manner consistent with their effects on metabolic efficiency in Pima Indians.

The linkage disequilibrium pattern of the angiotensin converting enzyme gene in Arabic and Asian population groups.

PubMed

Kharrat, Najla; Abdelmouleh, Wafa; Abdelhedi, Rania; Alfadhli, Suad; Rebai, Ahmed

2012-01-01

DNA variations within the Angiotensin-Converting Enzyme (ACE) gene have been shown to be involved in the aetiology of several common diseases and the therapeutic response. This study reports a comparison of haplotype analysis of five SNPs in the ACE gene region using a sample of 100 healthy subjects derived from five different populations (Tunisian, Iranian, Kuwaiti, Bahraini and Indian). Strong linkage disequilibrium was found among all SNPs studied for all populations. Two SNPs (rs1800764 and rs4340) were identified as key SNPs for all populations. These SNPs will be valuable for future effective association studies of the ACE gene polymorphisms in Arab and Asian populations.

Association between UGT2B7 gene polymorphisms and fentanyl sensitivity in patients undergoing painful orthognathic surgery

PubMed Central

Muraoka, Wataru; Nishizawa, Daisuke; Fukuda, Kenichi; Kasai, Shinya; Hasegawa, Junko; Wajima, Koichi; Nakagawa, Taneaki

2016-01-01

Background Fentanyl is often used instead of morphine for the treatment of pain because it has fewer side effects. The metabolism of morphine by glucuronidation is known to be influenced by polymorphisms of the UGT2B7 gene. Some metabolic products of fentanyl are reportedly metabolized by glucuronate conjugation. The genes that are involved in the metabolic pathway of fentanyl may also influence fentanyl sensitivity. We analyzed associations between fentanyl sensitivity and polymorphisms of the UGT2B7 gene to clarify the hereditary determinants of individual differences in fentanyl sensitivity. Results This study examined whether single-nucleotide polymorphisms (SNPs) of the UGT2B7 gene affect cold pain sensitivity and the analgesic effects of fentanyl, evaluated by a standardized pain test and fentanyl requirements in healthy Japanese subjects who underwent uniform surgical procedures. The rs7439366 SNP of UGT2B7 is reportedly associated with the metabolism and analgesic effects of morphine. We found that this SNP is also associated with the analgesic effects of fentanyl in the cold pressor-induced pain test. It suggested that the C allele of the rs7439366 SNP may enhance analgesic efficacy. Two SNPs of UGT2B7, rs4587017 and rs1002849, were also found to be novel SNPs that may influence the analgesic effects of fentanyl in the cold pressor-induced pain test. Conclusions Fentanyl sensitivity for cold pressor-induced pain was associated with the rs7439366, rs4587017, and rs1002849 SNPs of the UGT2B7 gene. Our findings may provide valuable information for achieving satisfactory pain control and open to new avenues for personalized pain treatment. PMID:28256933

The evaluation of endothelin 1 (EDN1) and endothelin receptor type A (EDNRA) gene polymorphisms in Hashimoto's thyroiditis.

PubMed

Aydin, A Fatih; Vural, Pervin; Oruç, Çoşkun Umut; Doğru-Abbasoğlu, Semra; Özderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

2014-07-01

Endothelin1 (EDN1) is well established marker of inflammation. The functions of EDN1 are mediated mainly by endothelin receptors type A (EDNRA). The etiopathogenesis of Hashimoto's thyroiditis (HT) remains still elusive although the role of chronic inflammation and subsequent endothelial dysfunction has been established. This study examined firstly the possible association of EDN1 (G5665Tand T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of HT, and evaluates the relationship between genotypes and clinical/laboratory manifestation of HT. We analyzed genotype and allele distributions of above mentioned polymorphisms in 163 patients with HT and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between HT and variant alleles of EDN1 5665 and -1370, as well as EDNRA +70 and -231 SNPs were found. Haplotype analysis demonstrated that there was a strong (D'=0.76, r(2)=0.487) and weak (D'=0.403, r(2)=0.086) linkage disequilibrium (LD) between EDN1 -1370 and 5665, and between EDNRA -231 and +70 SNPs, respectively. However, haplotype frequencies in patients were similar to those in controls. In addition, it was observed that the EDNRA +70 G allele had protective effect against early (at age before 40 years) disease onset of HT (OR: 0.51, 95% CI=0.32-0.79, p=0.003). Although no significant associations between susceptibility to HT with EDN1 5665 and -1370, as well as with EDNRA+70 and -231 SNPs were found, EDNRA +70 polymorphism was related with decreased risk for early onset HT. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

A cis-phase interaction study of genetic variants within the MAOA gene in major depressive disorder.

PubMed

Zhang, JieXu; Chen, YanBo; Zhang, KeRang; Yang, Hong; Sun, Yan; Fang, Yue; Shen, Yan; Xu, Qi

2010-11-01

The genetic basis of major depressive disorder (MDD) has been explored extensively, but the mode of transmission of the disease has yet to be established. To better understand the mechanism by which the monoamine oxidase A (MAOA) gene may play a role in developing MDD, the present work examined the cis-phase interaction between genetic variants within the MAOA gene for the pathogenesis of MDD. A variable number tandem repeat (VNTR) and 19 single nucleotide polymorphisms (SNPs) within the gene were genotyped in 512 unrelated patients with MDD and 567 unrelated control subjects among a Chinese population. Quantitative real-time polymerase chain reaction analysis was applied to test the effect of genetic variants on expression of the MAOA gene in MDD. Neither the VNTR polymorphism nor seven informative SNPs showed allelic association with MDD, but the cis-acting interactions between the VNTR polymorphism and four individual SNPs were strongly associated with MDD risk, of which the VNTR-rs1465107 combination showed the strongest association (p = .000011). Quantitative real-time polymerase chain reaction analysis showed that overall relative quantity of MAOA messenger RNA was significantly higher in patients with MDD than in control subjects (fold change = 5.28, p = 1.7 × 10⁻⁷) and that in the male subjects carrying the VNTR-L, rs1465107-A, rs6323-G, rs2072743-A, or rs1137070-T alleles, expression of MAOA messenger RNA was significantly higher in the patient group than in the control group. The cis-phase interaction between the VNTR polymorphism and functional SNPs may contribute to the etiology of MDD. Copyright © 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Association between tumour necrosis-α gene polymorphisms and acne vulgaris in a Pakistani population.

PubMed

Aisha, N M; Haroon, J; Hussain, S; Tahir, C M; Ikramullah, M; Rahim, H; Kishwar, N; Younis, S; Hassan, M J; Javed, Q

2016-04-01

The cytokine tumour necrosis factor (TNF)-α is a well-studied potent candidate mediator that is systemically involved in a variety of inflammatory diseases. Several single nucleotide polymorphisms (SNPs) of the TNF-α gene have been studied with regard the pathogenesis of acne vulgaris, but the results have been inconclusive. This case-control study investigated the association of the TNF -308 G>A and -238 G>A SNPs with acne vulgaris in a high-risk Pakistani population. In total, 160 healthy controls and 140 patients with acne were enrolled in this study. Polymorphisms were determined by PCR and restriction fragment length polymorphism analysis. Our data showed that the TNF -308 G>A and TNF -238 G>A SNPs were present at a significantly higher rate in cases than in controls (P < 0.01 and P < 0.02; respectively). There was a significant difference between the G and A alleles from patients with acne and controls for -308 G>A (OR = 1.5, 95% CI = 1.07-2.19, P < 0.02) and -238 G>A (OR=1.6, 95% CI = 1.06-2.44, P = 0.02) genotype. Moreover, the severity of acne was significantly associated with TNF genotype (TNF -308 G>A: χ² = 34.6, P < 0.001; TNF -238 G>AL χ² = 12.9, P < 0.01). Our data suggest that the TNF -308 G>A and TNF -238 G>A SNPs may contribute to the pathogenesis of acne in the study population. Furthermore, patients with severe acne showed an increased frequency of mutant TNF genotypes at -308 and -238 compared with patients with less severe acne. © 2015 British Association of Dermatologists.

Association between polymorphisms in cancer-related genes and early onset of esophageal adenocarcinoma.

PubMed

Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C

2011-04-01

There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Oxytocin receptor gene variations predict neural and behavioral response to oxytocin in autism

PubMed Central

Watanabe, Takamitsu; Otowa, Takeshi; Abe, Osamu; Kuwabara, Hitoshi; Aoki, Yuta; Natsubori, Tatsunobu; Takao, Hidemasa; Kakiuchi, Chihiro; Kondo, Kenji; Ikeda, Masashi; Iwata, Nakao; Kasai, Kiyoto; Sasaki, Tsukasa

2017-01-01

Abstract Oxytocin appears beneficial for autism spectrum disorder (ASD), and more than 20 single-nucleotide polymorphisms (SNPs) in oxytocin receptor (OXTR) are relevant to ASD. However, neither biological functions of OXTR SNPs in ASD nor critical OXTR SNPs that determine oxytocin’s effects on ASD remains known. Here, using a machine-learning algorithm that was designed to evaluate collective effects of multiple SNPs and automatically identify most informative SNPs, we examined relationships between 27 representative OXTR SNPs and six types of behavioral/neural response to oxytocin in ASD individuals. The oxytocin effects were extracted from our previous placebo-controlled within-participant clinical trial administering single-dose intranasal oxytocin to 38 high-functioning adult Japanese ASD males. Consequently, we identified six different SNP sets that could accurately predict the six different oxytocin efficacies, and confirmed the robustness of these SNP selections against variations of the datasets and analysis parameters. Moreover, major alleles of several prominent OXTR SNPs—including rs53576 and rs2254298—were found to have dissociable effects on the oxytocin efficacies. These findings suggest biological functions of the OXTR SNP variants on autistic oxytocin responses, and implied that clinical oxytocin efficacy may be genetically predicted before its actual administration, which would contribute to establishment of future precision medicines for ASD. PMID:27798253

A Mismatch EndoNuclease Array-Based Methodology (MENA) for Identifying Known SNPs or Novel Point Mutations.

PubMed

Comeron, Josep M; Reed, Jordan; Christie, Matthew; Jacobs, Julia S; Dierdorff, Jason; Eberl, Daniel F; Manak, J Robert

2016-04-05

Accurate and rapid identification or confirmation of single nucleotide polymorphisms (SNPs), point mutations and other human genomic variation facilitates understanding the genetic basis of disease. We have developed a new methodology (called MENA (Mismatch EndoNuclease Array)) pairing DNA mismatch endonuclease enzymology with tiling microarray hybridization in order to genotype both known point mutations (such as SNPs) as well as identify previously undiscovered point mutations and small indels. We show that our assay can rapidly genotype known SNPs in a human genomic DNA sample with 99% accuracy, in addition to identifying novel point mutations and small indels with a false discovery rate as low as 10%. Our technology provides a platform for a variety of applications, including: (1) genotyping known SNPs as well as confirming newly discovered SNPs from whole genome sequencing analyses; (2) identifying novel point mutations and indels in any genomic region from any organism for which genome sequence information is available; and (3) screening panels of genes associated with particular diseases and disorders in patient samples to identify causative mutations. As a proof of principle for using MENA to discover novel mutations, we report identification of a novel allele of the beethoven (btv) gene in Drosophila, which encodes a ciliary cytoplasmic dynein motor protein important for auditory mechanosensation.

WS-SNPs&GO: a web server for predicting the deleterious effect of human protein variants using functional annotation

PubMed Central

2013-01-01

Background SNPs&GO is a method for the prediction of deleterious Single Amino acid Polymorphisms (SAPs) using protein functional annotation. In this work, we present the web server implementation of SNPs&GO (WS-SNPs&GO). The server is based on Support Vector Machines (SVM) and for a given protein, its input comprises: the sequence and/or its three-dimensional structure (when available), a set of target variations and its functional Gene Ontology (GO) terms. The output of the server provides, for each protein variation, the probabilities to be associated to human diseases. Results The server consists of two main components, including updated versions of the sequence-based SNPs&GO (recently scored as one of the best algorithms for predicting deleterious SAPs) and of the structure-based SNPs&GO3d programs. Sequence and structure based algorithms are extensively tested on a large set of annotated variations extracted from the SwissVar database. Selecting a balanced dataset with more than 38,000 SAPs, the sequence-based approach achieves 81% overall accuracy, 0.61 correlation coefficient and an Area Under the Curve (AUC) of the Receiver Operating Characteristic (ROC) curve of 0.88. For the subset of ~6,600 variations mapped on protein structures available at the Protein Data Bank (PDB), the structure-based method scores with 84% overall accuracy, 0.68 correlation coefficient, and 0.91 AUC. When tested on a new blind set of variations, the results of the server are 79% and 83% overall accuracy for the sequence-based and structure-based inputs, respectively. Conclusions WS-SNPs&GO is a valuable tool that includes in a unique framework information derived from protein sequence, structure, evolutionary profile, and protein function. WS-SNPs&GO is freely available at http://snps.biofold.org/snps-and-go. PMID:23819482

Association of glutathione S-transferase P1 (GSTP1) polymorphism with Tourette syndrome in Taiwanese patients.

PubMed

Shen, Che-Piao; Chou, I-Ching; Liu, Hsin-Ping; Lee, Cheng-Chun; Tsai, Yuhsin; Wu, Bor-Tsang; Hsu, Ban-Dar; Lin, Wei-Yong; Tsai, Fuu-Jen

2014-01-01

The etiology of Tourette syndrome (TS) is multifactorial. TS vulnerability may be associated with genetic and environmental factors. From the genetic point of view, TS is heterogeneous. Previous studies showed that some single-nucleotide polymorphisms (SNPs) of the glutathione-S-transferase P1 (GSTP1) gene can affect cellular proliferation and apoptotic activity and TS is a neurodevelopmental disorder. We guessed that there was a relationship between TS and genetic variants of the GSTP1 gene. Therefore, in this study, we aimed to test the hypothesis that GSTP1 SNPs were associated with TS. We performed a case-control study. One hundred twenty-one TS children and 105 normal children were included in the study. Polymerase chain reaction was used to identify the GSTP1 gene polymorphism at position rs6591256 (A/G, promoter polymorphism) in TS patients and normal children. The polymorphism at position rs6591256 in the GSTP1 gene revealed significant differences in the allele (p=0.0135) and genotype (p=0.0159) distributions between the TS patients and the control group. The A allele was present at a higher frequency than the G allele in the TS patients compared with the control group (odds ratio [OR]=1.91, 95% confidence interval [CI]: 1.14-3.21). The AA genotype was associated with susceptibility to TS with an OR of 2.38 for the AA versus AG genotype (95% CI: 1.29-4.41). These findings suggest that variants in the GSTP1 gene may play a role in susceptibility to TS.

Identification of SNPs associated with muscle yield and quality traits using allelic-imbalance analyses of pooled RNA-Seq samples in rainbow trout.

PubMed

Al-Tobasei, Rafet; Ali, Ali; Leeds, Timothy D; Liu, Sixin; Palti, Yniv; Kenney, Brett; Salem, Mohamed

2017-08-07

Coding/functional SNPs change the biological function of a gene and, therefore, could serve as "large-effect" genetic markers. In this study, we used two bioinformatics pipelines, GATK and SAMtools, for discovering coding/functional SNPs with allelic-imbalances associated with total body weight, muscle yield, muscle fat content, shear force, and whiteness. Phenotypic data were collected for approximately 500 fish, representing 98 families (5 fish/family), from a growth-selected line, and the muscle transcriptome was sequenced from 22 families with divergent phenotypes (4 low- versus 4 high-ranked families per trait). GATK detected 59,112 putative SNPs; of these SNPs, 4798 showed allelic imbalances (>2.0 as an amplification and <0.5 as loss of heterozygosity). SAMtools detected 87,066 putative SNPs; and of them, 4962 had allelic imbalances between the low- and high-ranked families. Only 1829 SNPs with allelic imbalances were common between the two datasets, indicating significant differences in algorithms. The two datasets contained 7930 non-redundant SNPs of which 4439 mapped to 1498 protein-coding genes (with 6.4% non-synonymous SNPs) and 684 mapped to 295 lncRNAs. Validation of a subset of 92 SNPs revealed 1) 86.7-93.8% success rate in calling polymorphic SNPs and 2) 95.4% consistent matching between DNA and cDNA genotypes indicating a high rate of identifying SNPs with allelic imbalances. In addition, 4.64% SNPs revealed random monoallelic expression. Genome distribution of the SNPs with allelic imbalances exhibited high density for all five traits in several chromosomes, especially chromosome 9, 20 and 28. Most of the SNP-harboring genes were assigned to important growth-related metabolic pathways. These results demonstrate utility of RNA-Seq in assessing phenotype-associated allelic imbalances in pooled RNA-Seq samples. The SNPs identified in this study were included in a new SNP-Chip design (available from Affymetrix) for genomic and genetic analyses in rainbow trout.

Genetic polymorphisms of antioxidant enzymes CAT and SOD affect the outcome of clinical, biochemical, and anthropometric variables in people with obesity under a dietary intervention.

PubMed

Hernández-Guerrero, César; Parra-Carriedo, Alicia; Ruiz-de-Santiago, Diana; Galicia-Castillo, Oscar; Buenrostro-Jáuregui, Mario; Díaz-Gutiérrez, Carmen

2018-01-01

Genetic polymorphisms of antioxidant enzymes CAT, GPX, and SOD are involved in the etiology of obesity and its principal comorbidities. The aim of the present study was to analyze the effect of aforementioned SNPs over the output of several variables in people with obesity after a nutritional intervention. The study included 92 Mexican women, which received a dietary intervention by 3 months. Participants were genotyped and stratified into two groups: (1) carriers; mutated homozygous plus heterozygous (CR) and (2) homozygous wild type (WT). A comparison between CR and WT was done in clinical (CV), biochemical (BV), and anthropometric variables (AV), at the beginning and at the end of the intervention. Participants ( n  = 92) showed statistically significant differences ( p  < 0.05) at the end of the nutritional intervention in several CV, BV, and AV. However, two kinds of responses were observed after genotyping participants: (A) CR and WT showed statistically significant differences ( p  < 0.05) in several CV, BV, and AV for the SNPs 599C>T GPX1 (rs1050450), - 251A>G SOD1 (rs2070424), and - 262C>T CAT (rs1001179). (B) Only CR showed statistically changes ( p  < 0.05) in several CV, BV, and AV for the SNPs - 21A>T CAT (rs7943316) and 47C>T SOD2 (rs4880). The dietary intervention effect was statistically significantly between the polymorphisms of 47C>T SOD2 and BMI, SBP, TBARS, total cholesterol, and C-LCL ( p  < 0.05) and between the polymorphisms of - 21A>T CAT (rs7943316) and SBP, DBP, total cholesterol, and atherogenic index ( p  < 0.05). People with obesity display different response in several CV, BV, and AV after a nutritional intervention, depending on the antioxidant genetic background of SOD and CAT enzymes.

The Discovery of Single-Nucleotide Polymorphisms—and Inferences about Human Demographic History

PubMed Central

Wakeley, John; Nielsen, Rasmus; Liu-Cordero, Shau Neen; Ardlie, Kristin

2001-01-01

A method of historical inference that accounts for ascertainment bias is developed and applied to single-nucleotide polymorphism (SNP) data in humans. The data consist of 84 short fragments of the genome that were selected, from three recent SNP surveys, to contain at least two polymorphisms in their respective ascertainment samples and that were then fully resequenced in 47 globally distributed individuals. Ascertainment bias is the deviation, from what would be observed in a random sample, caused either by discovery of polymorphisms in small samples or by locus selection based on levels or patterns of polymorphism. The three SNP surveys from which the present data were derived differ both in their protocols for ascertainment and in the size of the samples used for discovery. We implemented a Monte Carlo maximum-likelihood method to fit a subdivided-population model that includes a possible change in effective size at some time in the past. Incorrectly assuming that ascertainment bias does not exist causes errors in inference, affecting both estimates of migration rates and historical changes in size. Migration rates are overestimated when ascertainment bias is ignored. However, the direction of error in inferences about changes in effective population size (whether the population is inferred to be shrinking or growing) depends on whether either the numbers of SNPs per fragment or the SNP-allele frequencies are analyzed. We use the abbreviation “SDL,” for “SNP-discovered locus,” in recognition of the genomic-discovery context of SNPs. When ascertainment bias is modeled fully, both the number of SNPs per SDL and their allele frequencies support a scenario of growth in effective size in the context of a subdivided population. If subdivision is ignored, however, the hypothesis of constant effective population size cannot be rejected. An important conclusion of this work is that, in demographic or other studies, SNP data are useful only to the extent that their ascertainment can be modeled. PMID:11704929

Single nucleotide polymorphisms in the Trx2/TXNIP and TrxR2 genes of the mitochondrial thioredoxin antioxidant system and the risk of diabetic retinopathy in patients with Type 2 diabetes mellitus.

PubMed

Ramus, Sara Mankoc; Cilensek, Ines; Petrovic, Mojca Globocnik; Soucek, Miroslav; Kruzliak, Peter; Petrovic, Daniel

2016-03-01

Oxidative stress plays an important role in the pathogenesis of diabetes and its complications. The aim of this study was to examine the possible association between seven single nucleotide polymorphisms (SNPs) of the Trx2/TXNIP and TrxR2 genes encoding proteins involved in the thioredoxin antioxidant defence system and the risk of diabetic retinopthy (DR). Cross-sectional case-control study. A total of 802 Slovenian patients with Type 2 diabetes mellitus; 277 patients with DR and 525 with no DR were enrolled. Patients genotypes of the SNPs; including rs8140110, rs7211, rs7212, rs4755, rs1548357, rs4485648 and rs5748469 were determined by the competitive allele specific PCR method. Each genotype of examined SNPs was regressed in a logistic model, assuming the co-dominant, dominant and the recessive models of inheritance with covariates of duration of diabetes, HbA1c, insulin therapy, total cholesterol and LDL cholesterol levels. In the present study, for the first time we identified an association between the rs4485648 polymorphism of the TrxR2 gene and DR in Caucasians with Type 2 DM. The estimated ORs of adjusted logistic regression models were found to be as follows: 4.4 for CT heterozygotes, 4.3 for TT homozygotes (co-dominant genetic model) and 4.4 for CT+TT genotypes (dominant genetic model). In our case-control study we were not able to demonstrate any association between rs8140110, rs7211, rs7212, rs4755, rs1548357, and rs5748469 and DR, however, our findings provide evidence that the rs4485648 polymorphism of the TrxR2 gene might exert an independent effect on the development of DR. Copyright © 2016 Elsevier Inc. All rights reserved.

Tests of linkage and/or association of the LEPR gene polymorphisms with obesity phenotypes in Caucasian nuclear families.

PubMed

Liu, Yong-Jun; Rocha-Sanchez, Sonia M S; Liu, Peng-Yuan; Long, Ji-Rong; Lu, Yan; Elze, Leo; Recker, Robert R; Deng, Hong-Wen

2004-04-13

Genetic variations in the leptin receptor (LEPR) gene have been conceived to affect body weight in general populations. In this study, using the tests implemented in the statistical package QTDT, we evaluated association and/or linkage of the LEPR gene with obesity phenotypes in a large sample comprising 1,873 subjects from 405 Caucasian nuclear families. Obesity phenotypes tested include body mass index (BMI), fat mass, percentage fat mass (PFM), and lean mass, with the latter three measured by dual-energy X-ray absorptiometry (DXA). Three single nucleotide polymorphisms (SNPs), namely Lys109Arg (A/G), Lys656Asn (G/C), Pro1019Pro (G/A), in the LEPR gene were analyzed. Significant linkage disequilibrium (0.394 < or = |D'| < or = 0.688, P < 0.001) was observed between pairs of the three SNPs. No significant population stratification was found for any SNP/phenotype. In single-locus analyses, evidence of association was observed for Lys656Asn with lean mass (P = 0.002) and fat mass (P = 0.015). The contribution of this polymorphism to the phenotypic variation of lean mass and fat mass was 2.63% and 1.15%, respectively. Subjects carrying allele G at the Lys656Asn site had, on average, 3.16% higher lean mass and 2.71% higher fat mass than those without it. In the analyses for haplotypes defined by the three SNPs, significant associations were detected between haplotype GCA (P = 0.005) and lean mass. In addition, marginally significant evidence of association was observed for this haplotype with fat mass (P = 0.012). No statistically significant linkage was found, largely due to the limited power of the linkage approach to detect small genetic effects in our data sets. Our results suggest that the LEPR gene polymorphisms contribute to variation in obesity phenotypes.

Mapping a Mutation in "Caenorhabditis elegans" Using a Polymerase Chain Reaction-Based Approach

ERIC Educational Resources Information Center

Myers, Edith M.

2014-01-01

Many single nucleotide polymorphisms (SNPs) have been identified within the "Caenorhabditis elegans" genome. SNPs present in the genomes of two isogenic "C. elegans" strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which…

Association between IL-10a SNPs and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Analysis of gene polymorphisms and disease association is essential for assessing putative candidate genes affecting susceptibility or resistance to disease. In this paper, we report the results of an association analysis between SNPs in common carp innate immune response genes and resistance to Cy...

Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

USDA-ARS?s Scientific Manuscript database

ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Polymorphisms in the FGF2 gene and risk of serous ovarian cancer: results from the Ovarian Cancer Association Consortium

PubMed Central

Johnatty, Sharon E.; Beesley, Jonathan; Chen, Xiaoqing; Spurdle, Amanda B.; deFazio, Anna; Webb, Penelope M; Goode, Ellen L.; Rider, David N.; Vierkant, Robert A.; Anderson, Stephanie; Wu, Anna H.; Pike, Malcolm; Van Den Berg, David; Moysich, Kirsten; Ness, Roberta; Doherty, Jennifer; Rossing, Mary-Anne; Pearce, Celeste Leigh; Chenevix-Trench, Georgia

2009-01-01

Fibroblast growth factor (FGF)-2 (basic) is a potent angiogenic molecule involved in tumour progression, and is one of several growth factors with a central role in ovarian carcinogenesis. We hypothesised that common single nucleotide polymorphisms (SNPs) in the FGF2 gene may alter angiogenic potential and thereby susceptibility to ovarian cancer. We analysed 25 FGF2 tgSNPs using five independent study populations from the United States and Australia. Analysis was restricted to non-Hispanic White women with serous ovarian carcinoma (1269 cases and 2829 controls). There were no statistically significant associations between any FGF2 SNPs and ovarian cancer risk. There were two nominally statistically significant associations between heterozygosity for two FGF2 SNPs (rs308379 and rs308447; p<0.05) and serous ovarian cancer risk in the combined dataset, but rare homozygous estimates did not achieve statistical significance, nor were they consistent with the log additive model of inheritance. Overall genetic variation in FGF2 does not appear to play a role in susceptibility to ovarian cancer. PMID:19456219

Association of CAT polymorphisms with catalase activity and exposure to environmental oxidative stimuli

PubMed Central

Nadif, Rachel; Mintz, Margaret; Jedlicka, Anne; Bertrand, Jean-Pierre; Kleeberger, Steven R.; Kauffmann, Francine

2005-01-01

We tested the hypotheses that catalase activity is modified by CAT single nucleotide polymorphisms (SNPs) (–262;–844), and by their interactions with oxidant exposures (coal dusts, smoking), lymphotoxin alpha (LTA, NcoI) and tumor necrosis factor (TNF, -308) in 196 miners. Erythrocyte catalase, superoxide dismutase, and glutathione peroxidase activities were measured. The CAT –262 SNP was related to lower catalase activity (104, 87 and 72 k/g hemoglobin for CC, CT and TT respectively, p<0.0001). Regardless of CAT SNPs, the LTA NcoI but not the TNF –308 SNP was associated with catalase activity (p=0.04 and p=0.8). CAT –262 T carriers were less frequent in highly exposed miners (OR=0.39 [0.20 – 0.78], p=0.007). In CAT –262 T carriers only, catalase activity decreased with high dust exposure (p=0.01). Haplotype analyses (combined CAT SNPs) confirm these results. Results show that CAT –262 and LTA NcoI SNPs, and interaction with coal dust exposure, influenced catalase activity. PMID:16298864

Toll-like receptors genes polymorphisms and the occurrence of HCMV infection among pregnant women.

PubMed

Wujcicka, Wioletta; Paradowska, Edyta; Studzińska, Mirosława; Wilczyński, Jan; Nowakowska, Dorota

2017-03-24

Human cytomegalovirus (HCMV) is the most common cause of intrauterine infections worldwide. The toll-like receptors (TLRs) have been reported as important factors in immune response against HCMV. Particularly, TLR2, TLR4 and TLR9 have been shown to be involved in antiviral immunity. Evaluation of the role of single nucleotide polymorphisms (SNPs), located within TLR2, TLR4 and TLR9 genes, in the development of human cytomegalovirus (HCMV) infection in pregnant women and their fetuses and neonates, was performed. The study was performed for 131 pregnant women, including 66 patients infected with HCMV during pregnancy, and 65 age-matched control pregnant individuals. The patients were selected to the study, based on serological status of anti-HCMV IgG and IgM antibodies and on the presence of viral DNA in their body fluids. Genotypes in TLR2 2258 A > G, TLR4 896 G > A and 1196 C > T and TLR9 2848 G > A SNPs were determined by self-designed nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in TLR SNPs, were confirmed by sequencing. A relationship between the genotypes, alleles, haplotypes and multiple variants in the studied polymorphisms, and the occurrence of HCMV infection in pregnant women and their offsprings, was determined, using a logistic regression model. Genotypes in all the analyzed polymorphisms preserved the Hardy-Weinberg equilibrium in pregnant women, both infected and uninfected with HCMV (P > 0.050). GG homozygotic and GA heterozygotic status in TLR9 2848 G > A SNP decreased significantly the occurrence of HCMV infection (OR 0.44 95% CI 0.21-0.94 in the dominant model, P ≤ 0.050). The G allele in TLR9 SNP was significantly more frequent among the uninfected pregnant women than among the infected ones (χ 2  = 4.14, P ≤ 0.050). Considering other polymorphisms, similar frequencies of distinct genotypes, haplotypes and multiple-SNP variants were observed between the studied groups of patients. TLR9 2848 G > A SNP may be associated with HCMV infection in pregnant women.

CCR5 gene polymorphism is a genetic risk factor for radiographic severity of rheumatoid arthritis.

PubMed

Han, S W; Sa, K H; Kim, S I; Lee, S I; Park, Y W; Lee, S S; Yoo, W H; Soe, J S; Nam, E J; Lee, J; Park, J Y; Kang, Y M

2012-11-01

The chemokine receptor [C-C chemokine receptor 5 (CCR5)] is expressed on diverse immune effecter cells and has been implicated in the pathogenesis of rheumatoid arthritis (RA). This study sought to determine whether single-nucleotide polymorphisms (SNPs) in the CCR5 gene and their haplotypes were associated with susceptibility to and severity of RA. Three hundred fifty-seven patients with RA and 383 healthy unrelated controls were recruited. Using a pyrosequencing assay, we examined four polymorphisms -1118 CTAT(ins) (/del) (rs10577983), 303 A>G (rs1799987), 927 C>T (rs1800024), and 4838 G>T (rs1800874) of the CCR5 gene, which were distributed over the promoter region as well as the 5' and 3' untranslated regions. No significant difference in the genotype, allele, and haplotype frequencies of the four selected SNPs was observed between RA patients and controls. CCR5 polymorphisms of -1118 CTAT(del) (P = 0.012; corrected P = 0.048) and 303 A>G (P = 0.012; corrected P = 0.048) showed a significant association with radiographic severity in a recessive model, and, as a result of multivariate logistic regression analysis, were found to be an independent predictor of radiographic severity. When we separated the erosion score from the total Sharp score, the statistical significance of CCR5 polymorphisms showed an increase; -1118 CTAT(ins) (/del) (P = 0.007; corrected P = 0.028) and 303 A>G (P = 0.007; corrected P = 0.028). Neither SNPs nor haplotypes of the CCR5 gene showed a significant association with joint space narrowing score. These results indicate that genetic polymorphisms of CCR5 are an independent risk factor for radiographic severity denoted by modified Sharp score, particularly joint erosion in RA. © 2012 John Wiley & Sons A/S.

Association study of genes controlling IL-12-dependent IFN-γ immunity: STAT4 alleles increase risk of pulmonary tuberculosis in Morocco.

PubMed

Sabri, Ayoub; Grant, Audrey V; Cosker, Kristel; El Azbaoui, Safa; Abid, Ahmed; Abderrahmani Rhorfi, Ismail; Souhi, Hicham; Janah, Hicham; Alaoui-Tahiri, Kebir; Gharbaoui, Yasser; Benkirane, Majid; Orlova, Marianna; Boland, Anne; Deswarte, Caroline; Migaud, Melanie; Bustamante, Jacinta; Schurr, Erwin; Boisson-Dupuis, Stephanie; Casanova, Jean-Laurent; Abel, Laurent; El Baghdadi, Jamila

2014-08-15

Only a minority of individuals infected with Mycobacterium tuberculosis develop clinical tuberculosis. Genetic epidemiological evidence suggests that pulmonary tuberculosis has a strong human genetic component. Previous genetic findings in Mendelian predisposition to more severe mycobacterial infections, including by M. tuberculosis, underlined the importance of the interleukin 12 (IL-12)/interferon γ (IFN-γ) circuit in antimycobacterial immunity. We conducted an association study in Morocco between pulmonary tuberculosis and a panel of single-nucleotide polymorphisms (SNPs) covering 14 core IL-12/IFN-γ circuit genes. The analyses were performed in a discovery family-based sample followed by replication in a case-control population. Out of 228 SNPs tested in the family-based sample, 6 STAT4 SNPs were associated with pulmonary tuberculosis (P = .0013-.01). We replicated the same direction of association for 1 cluster of 3 SNPs encompassing the promoter region of STAT4. In the combined sample, the association was stronger among younger subjects (pulmonary tuberculosis onset <25 years) with an odds ratio of developing pulmonary tuberculosis at rs897200 for GG vs AG/AA subjects of 1.47 (1.06-2.04). Previous functional experiments showed that the G allele of rs897200 was associated with lower STAT4 expression. Our present findings in a Moroccan population support an association of pulmonary tuberculosis with STAT4 promoter-region polymorphisms that may impact STAT4 expression. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

MMP-3 gene polymorphisms are associated with increased risk of osteoarthritis in Chinese men.

PubMed

Guo, Wen; Xu, Pengcheng; Jin, Tianbo; Wang, Jihong; Fan, Dongsheng; Hao, Zengtao; Ji, Yuntao; Jing, Shangfei; Han, Chaoqian; Du, Jieli; Jiang, Dong; Wen, Shuzheng; Wang, Jianzhong

2017-10-03

Osteoarthritis (OA) is the most common late-onset degenerative joint disease., It is characterized by progressive degradation of articular cartilage. We investigated the association between OA occurrence and single nucleotide polymorphisms (SNPs) in the matrix metalloproteinase-3 ( MMP-3 ) gene involved in the breakdown of extra-cellular matrix proteins. The study included 100 male OA patients and 197 healthy men from the north area of China. Eight MMP-3 SNPs were genotyped. Odds ratios (ORs) with 95% confidence intervals (95%CIs) and multivariate logistic regression analysis were used to assess the association. Multivariate logistic regression analysis was used to identify SNPs that correlated with OA susceptibility. We found that rs639752 (dominant, OR = 2.03, 95% CI: 1.03-4.01, P = 0.038; over-dominant, OR = 2.00, 95% CI: 1.03-3.88, P = 0.037); rs520540 (dominant, OR = 2.03, 95% CI: 1.03-4.01, P = 0.038; over-dominant, OR = 2.00, 95% CI: 1.03-3.88, P = 0.037); rs602128 (dominant, OR = 2.03, 95% CI: 1.03-4.01, P = 0.038; over-dominant, OR = 2.01, 95% CI: 1.03-3.89, P = 0.037); and rs679620 (dominant, OR = 2.03, 95% CI: 1.03-4.01, P = 0.038; over-dominant, OR = 2.04, 95% CI: 1.05-3.96, P = 0.033) were associated with the increased risk of OA. Our results suggest that these SNPs may contribute to OA development, and could serve as molecular markers of OA susceptibility.

Association of RTEL1 gene polymorphisms with stroke risk in a Chinese Han population

PubMed Central

Cai, Yi; Zeng, Chaosheng; Su, Qingjie; Zhou, Jingxia; Li, Pengxiang; Dai, Mingming; Wang, Desheng; Long, Faqing

2017-01-01

We investigated the associations between single nucleotide polymorphisms (SNPs) in the regulator of telomere elongation helicase 1 (RTEL1) gene and stroke in the Chinese population. A total of 400 stroke patients and 395 healthy participants were included in this study. Five SNPs in RTEL1 were genotyped and the association with stroke risk was analyzed. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using unconditional logistic regression analysis. Multivariate logistic regression analysis was used to identify SNPs that correlated with stroke. Rs2297441 was associated with an increased risk of stroke in an allele model (odds ratio [OR] = 1.24, 95% confidence interval [95% CI] = 1.01–1.52, p = 0.043). Rs6089953 was associated with an increased risk of stroke under the genotype model ([OR] = 1.862, [CI] = 1.123–3.085, p = 0.016). Rs2297441 was associated with an increased risk of stroke in an additive model (OR = 1.234, 95% CI = 1.005, p = 0.045, Rs6089953, Rs6010620 and Rs6010621 were associated with an increased risk of stroke in the recessive model (Rs6089953:OR = 1.825, 95% CI = 1.121–2.969, p =0.01546; Rs6010620: OR = 1.64, 95% CI = 1.008–2.669, p =0.04656;Rs6010621:OR = 1.661, 95% CI = 1.014–2.722, p =0.04389). Our findings reveal a possible association between SNPs in the RTEL1 gene and stroke risk in Chinese population. PMID:29383136

Genetic Modifiers of Patent Ductus Arteriosus in Term Infants.

PubMed

Patel, Priti M; Momany, Allison M; Schaa, Kendra L; Romitti, Paul A; Druschel, Charlotte; Cooper, Margaret E; Marazita, Mary L; Murray, Jeffrey C; Dagle, John M

2016-09-01

To identify single-nucleotide polymorphisms (SNPs) in specific candidate genes associated with patent ductus arteriosus in term infants. We conducted an initial family-based, candidate gene study to analyze genotype data from DNA samples obtained from 171 term infants and their parents enrolled in the National Birth Defects Prevention Study (NBDPS). We performed transmission disequilibrium testing (TDT) using a panel of 55 SNPs in 17 genes. Replication of SNPs with P < .1 in the NBDPS trios was performed with a case-control strategy in an independent population. TDT analysis of the NBDPS trios resulted in 6 SNPs reaching the predetermined cutoff (P < .1) to be included in the replication study. These 6 SNPs were genotyped in the independent case-control population. A SNP in TGFBR2 was found to be associated with term patent ductus arteriosus in both populations after we corrected for multiple comparisons. (rs934328, TDT P = 2 × 10(-4), case-control P = 6.6 × 10(-5)). These findings confirm the importance of the transforming growth factor-beta pathway in the closure of the term ductus arteriosus and may suggest new therapeutic targets. Published by Elsevier Inc.

Efficient SNP Discovery by Combining Microarray and Lab-on-a-Chip Data for Animal Breeding and Selection

PubMed Central

Huang, Chao-Wei; Lin, Yu-Tsung; Ding, Shih-Torng; Lo, Ling-Ling; Wang, Pei-Hwa; Lin, En-Chung; Liu, Fang-Wei; Lu, Yen-Wen

2015-01-01

The genetic markers associated with economic traits have been widely explored for animal breeding. Among these markers, single-nucleotide polymorphism (SNPs) are gradually becoming a prevalent and effective evaluation tool. Since SNPs only focus on the genetic sequences of interest, it thereby reduces the evaluation time and cost. Compared to traditional approaches, SNP genotyping techniques incorporate informative genetic background, improve the breeding prediction accuracy and acquiesce breeding quality on the farm. This article therefore reviews the typical procedures of animal breeding using SNPs and the current status of related techniques. The associated SNP information and genotyping techniques, including microarray and Lab-on-a-Chip based platforms, along with their potential are highlighted. Examples in pig and poultry with different SNP loci linked to high economic trait values are given. The recommendations for utilizing SNP genotyping in nimal breeding are summarized. PMID:27600241

Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements

PubMed Central

Hayes, James E.; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J.

2015-01-01

Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin’s lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well. PMID:26422229

SORL1 variants and risk of late-onset Alzheimer's disease.

PubMed

Li, Yonghong; Rowland, Charles; Catanese, Joseph; Morris, John; Lovestone, Simon; O'Donovan, Michael C; Goate, Alison; Owen, Michael; Williams, Julie; Grupe, Andrew

2008-02-01

A recent study reported significant association of late-onset Alzheimer's disease (LOAD) with multiple single nucleotide polymorphisms (SNPs) and haplotypes in SORL1, a neuronal sortilin-related receptor protein known to be involved in the trafficking and processing of amyloid precursor protein. Here we attempted to validate this finding in three large, well characterized case-control series. Approximately 2000 samples from the three series were individually genotyped for 12 SNPs, including the 10 reported significant SNPs and 2 that constitute the reported significant haplotypes. A total of 25 allelic and haplotypic association tests were performed. One SNP rs2070045 was marginally replicated in the three sample sets combined (nominal P=0.035); however, this result does not remain significant when accounting for multiple comparisons. Further validation in other sample sets will be required to assess the true effects of SORL1 variants in LOAD.

Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

PubMed

Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

2015-04-01

Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

ADAM33 polymorphisms are associated with asthma and a distinctive palm dermatoglyphic pattern

PubMed Central

XUE, WEILIN; HAN, WEI; ZHOU, ZHAO-SHAN

2013-01-01

A close correlation between asthma and palm dermatoglyphic patterns has been observed in previous studies, but the underlying genetic mechanisms have not been investigated. A disintegrin and metalloprotein-33 (ADAM33) polymorphisms are important in the development of asthma and other atopic diseases. To investigate the underlying mechanisms of the association between asthma and distinctive palm dermatoglyphic patterns, thirteen ADAM33 single-nucleotide polymorphisms (SNPs) were analyzed for the association between asthma and palm dermatoglyphic patterns in a population of 400 asthmatic patients and 200 healthy controls. Based on the results, five SNPs, rs44707 (codominant model, P=0.031; log-additive model, P=0.0084), rs2787094 (overdominant model, P=0.049), rs678881 (codominant model, P=0.028; overdominant model, P=0.0083), rs677044 (codominant model, P=0.013; log-additive model, P=0.0033) and rs512625 (dominant model, P=0.033), were associated with asthma in this population. Two SNPs, rs44707 (dominant model, P=0.042) and rs2787094 (codominant model, P=0.014; recessive model, P=0.0038), were observed in the asthma patients with the distinctive palm pattern. As rs44707 and rs2787094 are associated with asthma and a distinctive palm pattern, the data suggest that ADAM33 polymorphisms are correlated with asthma and may be the underlying genetic basis of the association between asthma and palm dermatoglyphic patterns. PMID:24141861

SNPHunter: a bioinformatic software for single nucleotide polymorphism data acquisition and management.

PubMed

Wang, Lin; Liu, Simin; Niu, Tianhua; Xu, Xin

2005-03-18

Single nucleotide polymorphisms (SNPs) provide an important tool in pinpointing susceptibility genes for complex diseases and in unveiling human molecular evolution. Selection and retrieval of an optimal SNP set from publicly available databases have emerged as the foremost bottlenecks in designing large-scale linkage disequilibrium studies, particularly in case-control settings. We describe the architectural structure and implementations of a novel software program, SNPHunter, which allows for both ad hoc-mode and batch-mode SNP search, automatic SNP filtering, and retrieval of SNP data, including physical position, function class, flanking sequences at user-defined lengths, and heterozygosity from NCBI dbSNP. The SNP data extracted from dbSNP via SNPHunter can be exported and saved in plain text format for further down-stream analyses. As an illustration, we applied SNPHunter for selecting SNPs for 10 major candidate genes for type 2 diabetes, including CAPN10, FABP4, IL6, NOS3, PPARG, TNF, UCP2, CRP, ESR1, and AR. SNPHunter constitutes an efficient and user-friendly tool for SNP screening, selection, and acquisition. The executable and user's manual are available at http://www.hsph.harvard.edu/ppg/software.htm

Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

PubMed Central

Jannink, Jean-Luc

2010-01-01

Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

Shared susceptibility loci at 2q33 region for lung and esophageal cancers in high-incidence areas of esophageal cancer in northern China

PubMed Central

Song, Xin; Hu, Shou Jia; Lv, Shuang; Cheng, Rang; Zhang, Tang Juan; Han, Xue Na; Ren, Jing Li; Qi, Yi Jun

2017-01-01

Background Cancers from lung and esophagus are the leading causes of cancer-related deaths in China and share many similarities in terms of histological type, risk factors and genetic variants. Recent genome-wide association studies (GWAS) in Chinese esophageal cancer patients have demonstrated six high-risk candidate single nucleotide polymorphisms (SNPs). Thus, the present study aimed to determine the risk of these SNPs predisposing to lung cancer in Chinese population. Methods A total of 1170 lung cancer patients and 1530 normal subjects were enrolled in this study from high-incidence areas for esophageal cancer in Henan, northern China. Five milliliters of blood were collected from all subjects for genotyping. Genotyping of 20 high-risk SNP loci identified from genome-wide association studies (GWAS) on esophageal, lung and gastric cancers was performed using TaqMan allelic discrimination assays. Polymorphisms were examined for deviation from Hardy-Weinberg equilibrium (HWE) using Х2 test. Bonferroni correction was performed to correct the statistical significance of 20 SNPs with the risk of lung cancer. The Pearson’s Х2 test was used to compare the distributions of gender, TNM stage, histopathological type, smoking and family history by lung susceptibility genotypes. Kaplan-Meier and Cox regression analyses were carried out to evaluate the associations between genetic variants and overall survival. Results Four of the 20 SNPs identified as high-risk SNPs in Chinese esophageal cancer showed increased risk for Chinese lung cancer, which included rs3769823 (OR = 1.26; 95% CI = 1.107–1.509; P = 0.02), rs10931936 (OR = 1.283; 95% CI = 1.100–1.495; P = 0.04), rs2244438 (OR = 1.294; 95% CI = 1.098–1.525; P = 0.04) and rs13016963 (OR = 1.268; 95% CI = 1.089–1.447; P = 0.04). All these SNPs were located at 2q33 region harboringgenes of CASP8, ALS2CR12 and TRAK2. However, none of these susceptibility SNPs was observed to be significantly associated with gender, TNM stage, histopathological type, smoking, family history and overall survival. Conclusions The present study identified four high-risk SNPs at 2q33 locus for Chinese lung cancer and demonstrated the shared susceptibility loci at 2q33 region for Chinese lung and esophageal cancers. PMID:28542283

Shared susceptibility loci at 2q33 region for lung and esophageal cancers in high-incidence areas of esophageal cancer in northern China.

PubMed

Zhao, Xue Ke; Mao, Yi Min; Meng, Hui; Song, Xin; Hu, Shou Jia; Lv, Shuang; Cheng, Rang; Zhang, Tang Juan; Han, Xue Na; Ren, Jing Li; Qi, Yi Jun; Wang, Li Dong

2017-01-01

Cancers from lung and esophagus are the leading causes of cancer-related deaths in China and share many similarities in terms of histological type, risk factors and genetic variants. Recent genome-wide association studies (GWAS) in Chinese esophageal cancer patients have demonstrated six high-risk candidate single nucleotide polymorphisms (SNPs). Thus, the present study aimed to determine the risk of these SNPs predisposing to lung cancer in Chinese population. A total of 1170 lung cancer patients and 1530 normal subjects were enrolled in this study from high-incidence areas for esophageal cancer in Henan, northern China. Five milliliters of blood were collected from all subjects for genotyping. Genotyping of 20 high-risk SNP loci identified from genome-wide association studies (GWAS) on esophageal, lung and gastric cancers was performed using TaqMan allelic discrimination assays. Polymorphisms were examined for deviation from Hardy-Weinberg equilibrium (HWE) using Х2 test. Bonferroni correction was performed to correct the statistical significance of 20 SNPs with the risk of lung cancer. The Pearson's Х2 test was used to compare the distributions of gender, TNM stage, histopathological type, smoking and family history by lung susceptibility genotypes. Kaplan-Meier and Cox regression analyses were carried out to evaluate the associations between genetic variants and overall survival. Four of the 20 SNPs identified as high-risk SNPs in Chinese esophageal cancer showed increased risk for Chinese lung cancer, which included rs3769823 (OR = 1.26; 95% CI = 1.107-1.509; P = 0.02), rs10931936 (OR = 1.283; 95% CI = 1.100-1.495; P = 0.04), rs2244438 (OR = 1.294; 95% CI = 1.098-1.525; P = 0.04) and rs13016963 (OR = 1.268; 95% CI = 1.089-1.447; P = 0.04). All these SNPs were located at 2q33 region harboringgenes of CASP8, ALS2CR12 and TRAK2. However, none of these susceptibility SNPs was observed to be significantly associated with gender, TNM stage, histopathological type, smoking, family history and overall survival. The present study identified four high-risk SNPs at 2q33 locus for Chinese lung cancer and demonstrated the shared susceptibility loci at 2q33 region for Chinese lung and esophageal cancers.

A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo.

PubMed

Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo

2017-01-01

A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

PubMed Central

McGue, Matt; Iacono, William G.

2017-01-01

In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

Genetic Determinants of Enterovirus Infections: Polymorphisms in Type 1 Diabetes and Innate Immune Genes in the MIDIA Study.

PubMed

Witsø, Elisabet; Cinek, Ondrej; Tapia, German; Brorsson, Caroline A; Stene, Lars C; Gjessing, Håkon K; Rasmussen, Trond; Bergholdt, Regine; Pociot, Flemming M; Rønningen, Kjersti S

2015-12-01

Enteroviruses have been suggested as triggers of type 1 diabetes (T1D). We aimed to assess whether established T1D susceptibility single nucleotide polymorphisms (SNPs) and candidate SNPs in innate immune genes were associated with the frequency of enterovirus infection in otherwise healthy children. Fifty-six established T1D SNPs and 97 other candidate immunity SNPs were typed in 419 children carrying the T1D high-risk genotype, HLA-DR4-DQ8/DR3-DQ2 genotype, and 373 children without this genotype. Enteroviral RNA was detected using real-time polymerase chain reaction, with primers detecting essentially all enterovirus serotypes, in 7,393 longitudinal stool samples collected monthly (age range 3-36 months). The most significant association was with two T1D SNPs, rs12150079 (ZPBP2/ORMDL3/GSDMB region) (enterovirus frequency: AA 7.3%, AG 8.7%, GG 9.7%, RR = 0.86, overall p = 1.87E-02) and rs229541 (C1QTNF6/SSTR3/RAC2) (enterovirus frequency: CC 7.8%, CT 9.7%, TT 9.4%, RR = 1.13, overall p = 3.6E-02), followed by TLR8 (rs2407992) (p = 3.8E-02), TLR3 (1914926) (p = 4.9E-02), and two other T1D SNPs (IFIH1 rs3747517, p = 4.9E-02 and PTPN22, rs2476601, p = 5.3E-02). However, the quantile-quantile plot of p-values with confidence intervals for all 153 SNPs did not reveal clear evidence for rejection of the complete null hypothesis. Among a number of SNPs in candidate genes, we found no evidence for strong associations with enterovirus presence in stool samples from Norwegian children.

Genome-wide association study of coronary and aortic calcification in lung cancer screening CT

NASA Astrophysics Data System (ADS)

de Vos, Bob D.; van Setten, Jessica; de Jong, Pim A.; Mali, Willem P.; Oudkerk, Matthijs; Viergever, Max A.; Išgum, Ivana

2016-03-01

Arterial calcification has been related to cardiovascular disease (CVD) and osteoporosis. However, little is known about the role of genetics and exact pathways leading to arterial calcification and its relation to bone density changes indicating osteoporosis. In this study, we conducted a genome-wide association study of arterial calcification burden, followed by a look-up of known single nucleotide polymorphisms (SNPs) for coronary artery disease (CAD) and myocardial infarction (MI), and bone mineral density (BMD) to test for a shared genetic basis between the traits. The study included a subcohort of the Dutch-Belgian lung cancer screening trial comprised of 2,561 participants. Participants underwent baseline CT screening in one of two hospitals participating in the trial. Low-dose chest CT images were acquired without contrast enhancement and without ECG-synchronization. In these images coronary and aortic calcifications were identified automatically. Subsequently, the detected calcifications were quantified using coronary artery calcium Agatston and volume scores. Genotype data was available for these participants. A genome-wide association study was conducted on 10,220,814 SNPs using a linear regression model. To reduce multiple testing burden, known CAD/MI and BMD SNPs were specifically tested (45 SNPs from the CARDIoGRAMplusC4D consortium and 60 SNPS from the GEFOS consortium). No novel significant SNPs were found. Significant enrichment for CAD/MI SNPs was observed in testing Agatston and coronary artery calcium volume scores. Moreover, a significant enrichment of BMD SNPs was shown in aortic calcium volume scores. This may indicate genetic relation of BMD SNPs and arterial calcification burden.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

PubMed

Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

2015-01-01

Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

PubMed

Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

2016-06-01

Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation

PubMed Central

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-01-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption. PMID:23886516

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation.

PubMed

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-10-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9-2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption.

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

PubMed

Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

2017-04-04

Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

Association of ARID5B gene variants with acute lymphoblastic leukemia in Yemeni children.

PubMed

Al-Absi, Boshra; Noor, Suzita M; Saif-Ali, Riyadh; Salem, Sameer D; Ahmed, Radwan H; Razif, Muhammad Fm; Muniandy, Sekaran

2017-04-01

Studies have shown an association between ARID5B gene polymorphisms and childhood acute lymphoblastic leukemia. However, the association between ARID5B variants and acute lymphoblastic leukemia among the Arab population still needs to be studied. The aim of this study was to investigate the association between ARID5B variants with acute lymphoblastic leukemia in Yemeni children. A total of 14 ARID5B gene single nucleotide polymorphisms (SNPs) were genotyped in 289 Yemeni children, of whom 136 had acute lymphoblastic leukemia and 153 were controls, using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Using logistic regression adjusted for age and gender, the risks of acute lymphoblastic leukemia were presented as odds ratios and 95% confidence intervals. We found that nine SNPs were associated with acute lymphoblastic leukemia under additive genetic models: rs7073837, rs10740055, rs7089424, rs10821936, rs4506592, rs10994982, rs7896246, rs10821938, and rs7923074. Furthermore, the recessive models revealed that six SNPs were risk factors for acute lymphoblastic leukemia: rs10740055, rs7089424, rs10994982, rs7896246, rs10821938, and rs7923074. The gender-specific impact of these SNPs under the recessive genetic model revealed that SNPs rs10740055, rs10994982, and rs6479779 in females, and rs10821938 and rs7923074 in males were significantly associated with acute lymphoblastic leukemia risk. Under the dominant model, SNPs rs7073837, rs10821936, rs7896246, and rs6479778 in males only showed striking association with acute lymphoblastic leukemia. The additive model revealed that SNPs with significant association with acute lymphoblastic leukemia were rs10821936 (both males and females); rs7073837, rs10740055, rs10994982, and rs4948487 (females only); and rs7089424, rs7896246, rs10821938, and rs7923074 (males only). In addition, the ARID5B haplotype block (CGAACACAA) showed a higher risk for acute lymphoblastic leukemia. The haplotype (CCCGACTGC) was associated with protection against acute lymphoblastic leukemia. In conclusion, our study has shown that ARID5B variants are associated with acute lymphoblastic leukemia in Yemeni children with several gender biases of ARID5B single nucleotide polymorphisms reported.

SNP-markers in Allium species to facilitate introgression breeding in onion.

PubMed

Scholten, Olga E; van Kaauwen, Martijn P W; Shahin, Arwa; Hendrickx, Patrick M; Keizer, L C Paul; Burger, Karin; van Heusden, Adriaan W; van der Linden, C Gerard; Vosman, Ben

2016-08-31

Within onion, Allium cepa L., the availability of disease resistance is limited. The identification of sources of resistance in related species, such as Allium roylei and Allium fistulosum, was a first step towards the improvement of onion cultivars by breeding. SNP markers linked to resistance and polymorphic between these related species and onion cultivars are a valuable tool to efficiently introgress disease resistance genes. In this paper we describe the identification and validation of SNP markers valuable for onion breeding. Transcriptome sequencing resulted in 192 million RNA seq reads from the interspecific F1 hybrid between A. roylei and A. fistulosum (RF) and nine onion cultivars. After assembly, reliable SNPs were discovered in about 36 % of the contigs. For genotyping of the interspecific three-way cross population, derived from a cross between an onion cultivar and the RF (CCxRF), 1100 SNPs that are polymorphic in RF and monomorphic in the onion cultivars (RF SNPs) were selected for the development of KASP assays. A molecular linkage map based on 667 RF-SNP markers was constructed for CCxRF. In addition, KASP assays were developed for 1600 onion-SNPs (SNPs polymorphic among onion cultivars). A second linkage map was constructed for an F2 of onion x A. roylei (F2(CxR)) that consisted of 182 onion-SNPs and 119 RF-SNPs, and 76 previously mapped markers. Markers co-segregating in both the F2(CxR) and the CCxRF population were used to assign the linkage groups of RF to onion chromosomes. To validate usefulness of these SNP markers, QTL mapping was applied in the CCxRF population that segregates for resistance to Botrytis squamosa and resulted in a QTL for resistance on chromosome 6 of A. roylei. Our research has more than doubled the publicly available marker sequences of expressed onion genes and two onion-related species. It resulted in a detailed genetic map for the interspecific CCxRF population. This is the first paper that reports the detection of a QTL for resistance to B. squamosa in A. roylei.

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

Cannabinoid Receptor 1 Gene Polymorphisms and Marijuana Misuse Interactions On White Matter and Cognitive Deficits in Schizophrenia

PubMed Central

Ho, Beng-Choon; Wassink, Thomas H.; Ziebell, Steven; Andreasen, Nancy C.

2011-01-01

Marijuana exposure during the critical period of adolescent brain maturation may disrupt neuro-modulatory influences of endocannabinoids and increase schizophrenia susceptibility. Cannabinoid receptor 1 (CB1/CNR1) is the principal brain receptor mediating marijuana effects. No study to-date has systematically investigated the impact of CNR1 on quantitative phenotypic features in schizophrenia and inter-relationships with marijuana misuse. We genotyped 235 schizophrenia patients using 12 tag single nucleotide polymorphisms (tSNPs) that account for most of CB1 coding region genetic variability. Patients underwent a high-resolution anatomic brain magnetic resonance scan and cognitive assessment. Almost a quarter of the sample met DSM marijuana abuse (14%) or dependence (8%) criteria. Effects of CNR1 tSNPs and marijuana abuse/dependence on brain volumes and neurocognition were assessed using ANCOVA, including co-morbid alcohol/non-marijuana illicit drug misuse as covariates. Significant main effects of CNR1 tSNPs (rs7766029, rs12720071, and rs9450898) were found in white matter (WM) volumes. Patients with marijuana abuse/dependence had smaller fronto-temporal WM volumes than patients without heavy marijuana use. More interestingly, there were significant rs12720071 genotype-by-marijuana use interaction effects on WM volumes and neurocognitive impairment; suggestive of gene-environment interactions for conferring phenotypic abnormalities in schizophrenia. In this comprehensive evaluation of genetic variants distributed across the CB1 locus, CNR1 genetic polymorphisms were associated with WM brain volume variation among schizophrenia patients. Our findings suggest that heavy cannabis use in the context of specific CNR1 genotypes may contribute to greater WM volume deficits and cognitive impairment, which could in turn increase schizophrenia risk. PMID:21420833

Genetic variation in ORM1-like 3 (ORMDL3) and gasdermin-like (GSDML) and childhood asthma.

PubMed

Wu, H; Romieu, I; Sienra-Monge, J-J; Li, H; del Rio-Navarro, B E; London, S J

2009-04-01

A genome-wide association study identified ORM1-like 3 (orosomucoid 1-like 3, ORMDL3) as an asthma candidate gene. Single nucleotide polymorphisms (SNPs) in the region including ORMDL3 on chromosome 17q21 were related to childhood asthma risk and ORMDL3 expression levels in Europeans. We examined whether polymorphisms in ORMDL3 and the adjacent gasdermin-like (GSDML) gene associated with asthma in the genome-wide association study are related to childhood asthma and atopy in a Mexico City population. We genotyped rs4378650 in ORMDL3 and rs7216389 in GSDML in 615 nuclear families consisting of asthmatic children aged 4-17 years and their parents. Atopy was determined by skin prick tests to 25 aeroallergens. Individuals carrying the C allele of rs4378650 or the T allele of rs7216389 had increased risk of asthma [relative risk (RR) = 1.73, 95% confidence interval (CI) 1.19-2.53, P = 0.003 for one or two copies of rs4378650 C, and RR = 1.64, 95% CI 1.12-2.38, P = 0.009 for one or two copies of rs7216389 T). Linkage disequilibrium between the two SNPs was high (r(2) = 0.92). Neither of the SNPs was associated with the degree of atopy. A meta-analysis of five published studies on rs7216389 in nine populations gave an odds ratio for asthma of 1.44 (95% CI, 1.35-1.54, P < 0.00001). Our results and the meta-analysis provide evidence to confirm the finding from a recent genome-wide association study that polymorphisms in ORMDL3 and the adjacent GSDML may contribute to childhood asthma.

Genetic variation in ORM1-like 3 (ORMDL3) and gasdermin-like (GSDML) and childhood asthma

PubMed Central

Wu, H.; Romieu, I.; Sienra-Monge, J.-J.; Li, H.; del Rio-Navarro, B. E.; London, S. J.

2009-01-01

Background A genome-wide association study identified ORM1-like 3 (orosomucoid 1-like 3, ORMDL3) as an asthma candidate gene. Single nucleotide polymorphisms (SNPs) in the region including ORMDL3 on chromosome 17q21 were related to childhood asthma risk and ORMDL3 expression levels in Europeans. Objective We examined whether polymorphisms in ORMDL3 and the adjacent gasdermin-like (GSDML) gene associated with asthma in the genome-wide association study are related to childhood asthma and atopy in a Mexico City population. Methods We genotyped rs4378650 in ORMDL3 and rs7216389 in GSDML in 615 nuclear families consisting of asthmatic children aged 4–17 years and their parents. Atopy was determined by skin prick tests to 25 aeroallergens. Results Individuals carrying the C allele of rs4378650 or the T allele of rs7216389 had increased risk of asthma [relative risk (RR) = 1.73, 95% con.- dence interval (CI) 1.19–2.53, P = 0.003 for one or two copies of rs4378650 C, and RR = 1.64, 95% CI 1.12–2.38, P = 0.009 for one or two copies of rs7216389 T). Linkage disequilibrium between the two SNPs was high (r2 = 0.92). Neither of the SNPs was associated with the degree of atopy. A meta-analysis of five published studies on rs7216389 in nine populations gave an odds ratio for asthma of 1.44 (95% CI, 1.35–1.54, P < 0.00001). Conclusions Our results and the meta-analysis provide evidence to confirm the finding from a recent genome-wide association study that polymorphisms in ORMDL3 and the adjacent GSDML may contribute to childhood asthma. PMID:19133921

Circadian CLOCK gene polymorphisms in relation to sleep patterns and obesity in African Americans: findings from the Jackson heart study.

PubMed

Riestra, Pia; Gebreab, Samson Y; Xu, Ruihua; Khan, Rumana J; Gaye, Amadou; Correa, Adolfo; Min, Nancy; Sims, Mario; Davis, Sharon K

2017-06-23

Circadian rhythms regulate key biological processes and the dysregulation of the intrinsic clock mechanism affects sleep patterns and obesity onset. The CLOCK (circadian locomotor output cycles protein kaput) gene encodes a core transcription factor of the molecular circadian clock influencing diverse metabolic pathways, including glucose and lipid homeostasis. The primary objective of this study was to evaluate the associations between CLOCK single nucleotide polymorphisms (SNPs) and body mass index (BMI). We also evaluated the association of SNPs with BMI related factors such as sleep duration and quality, adiponectin and leptin, in 2962 participants (1116 men and 1810 women) from the Jackson Heart Study. Genotype data for the selected 23 CLOCK gene SNPS was obtained by imputation with IMPUTE2 software and reference phase data from the 1000 genome project. Genetic analyses were conducted with PLINK RESULTS: We found a significant association between the CLOCK SNP rs2070062 and sleep duration, participants carriers of the T allele showed significantly shorter sleep duration compared to non-carriers after the adjustment for individual proportions of European ancestry (PEA), socio economic status (SES), body mass index (BMI), alcohol consumption and smoking status that reach the significance threshold after multiple testing correction. In addition, we found nominal associations of the CLOCK SNP rs6853192 with longer sleep duration and the rs6820823, rs3792603 and rs11726609 with BMI. However, these associations did not reach the significance threshold after correction for multiple testing. In this work, CLOCK gene variants were associated with sleep duration and BMI suggesting that the effects of these polymorphisms on circadian rhythmicity may affect sleep duration and body weight regulation in Africans Americans.

An Intronic Polymorphism in couch potato Is Not Distributed Clinally in European Drosophila melanogaster Populations nor Does It Affect Diapause Inducibility.

PubMed

Zonato, Valeria; Fedele, Giorgio; Kyriacou, Charalambos P

2016-01-01

couch potato (cpo) encodes an RNA binding protein that has been reported to be expressed in the peripheral and central nervous system of embryos, larvae and adults, including the major endocrine organ, the ring gland. A polymorphism in the D. melanogaster cpo gene coding region displays a latitudinal cline in frequency in North American populations, but as cpo lies within the inversion In(3R)Payne, which is at high frequencies and itself shows a strong cline on this continent, interpretation of the cpo cline is not straightforward. A second downstream SNP in strong linkage disequilibrium with the first has been claimed to be primarily responsible for the latitudinal cline in diapause incidence in USA populations.Here, we investigate the frequencies of these two cpo SNPs in populations of Drosophila throughout continental Europe. The advantage of studying cpo variation in Europe is the very low frequency of In(3R)Payne, which we reveal here, does not appear to be clinally distributed. We observe a very different geographical scenario for cpo variation from the one in North America, suggesting that the downstream SNP does not play a role in diapause. In an attempt to verify whether the SNPs influence diapause we subsequently generated lines with different combinations of the two cpo SNPs on known timeless (tim) genetic backgrounds, because polymorphism in the clock gene tim plays a significant role in diapause inducibility. Our results reveal that the downstream cpo SNP does not seem to play any role in diapause induction in European populations in contrast to the upstream coding cpo SNP. Consequently, all future diapause studies on strains of D. melanogaster should initially determine their tim and cpo status.

Identification of leptin gene polymorphisms associated with carcass traits and fatty acid composition in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Okura, Kazuki; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2017-03-01

Previous studies have indicated that some leptin gene polymorphisms were associated with economically important traits in cattle breeds. However, polymorphisms in the leptin gene have not been reported thus far in Japanese Black cattle. Here, we aimed to identify the leptin gene polymorphisms which are associated with carcass traits and fatty acid composition in Japanese Black cattle. We sequenced the full-length coding sequence of leptin gene for eight Japanese Black cattle. Sequence comparison revealed eight single nucleotide polymorphisms (SNPs). Three of these were predicted to cause amino acid substitutions: Y7F, R25C and A80V. Then, we genotyped these SNPs in two populations (JB1 with 560 animals and JB2 with 450 animals) and investigated the effects on the traits. Y7F in JB1 and A80V in JB2 were excluded from statistical analysis because the minor allele frequencies were low (< 0.1). Association analysis revealed that Y7F had a significant effect on the dressed carcass weight in JB2; R25C had a significant effect on C18:0 and C14:1 in JB1 and JB2, respectively; and A80V had a significant effect on C16:0, C16:1, C18:1, monounsaturated fatty acid and saturated fatty acid in JB1. The results suggested that these SNPs could be used as an effective marker for the improvement of Japanese Black cattle. © 2016 Japanese Society of Animal Science.

GESPA: classifying nsSNPs to predict disease association.

PubMed

Khurana, Jay K; Reeder, Jay E; Shrimpton, Antony E; Thakar, Juilee

2015-07-25

Non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common DNA sequence variation associated with disease in humans. Thus determining the clinical significance of each nsSNP is of great importance. Potential detrimental nsSNPs may be identified by genetic association studies or by functional analysis in the laboratory, both of which are expensive and time consuming. Existing computational methods lack accuracy and features to facilitate nsSNP classification for clinical use. We developed the GESPA (GEnomic Single nucleotide Polymorphism Analyzer) program to predict the pathogenicity and disease phenotype of nsSNPs. GESPA is a user-friendly software package for classifying disease association of nsSNPs. It allows flexibility in acceptable input formats and predicts the pathogenicity of a given nsSNP by assessing the conservation of amino acids in orthologs and paralogs and supplementing this information with data from medical literature. The development and testing of GESPA was performed using the humsavar, ClinVar and humvar datasets. Additionally, GESPA also predicts the disease phenotype associated with a nsSNP with high accuracy, a feature unavailable in existing software. GESPA's overall accuracy exceeds existing computational methods for predicting nsSNP pathogenicity. The usability of GESPA is enhanced by fast SQL-based cloud storage and retrieval of data. GESPA is a novel bioinformatics tool to determine the pathogenicity and phenotypes of nsSNPs. We anticipate that GESPA will become a useful clinical framework for predicting the disease association of nsSNPs. The program, executable jar file, source code, GPL 3.0 license, user guide, and test data with instructions are available at http://sourceforge.net/projects/gespa.

Genome-wide re-sequencing of multidrug-resistant Mycobacterium leprae Airaku-3.

PubMed

Singh, P; Benjak, A; Carat, S; Kai, M; Busso, P; Avanzi, C; Paniz-Mondolfi, A; Peter, C; Harshman, K; Rougemont, J; Matsuoka, M; Cole, S T

2014-10-01

Genotyping and molecular characterization of drug resistance mechanisms in Mycobacterium leprae enables disease transmission and drug resistance trends to be monitored. In the present study, we performed genome-wide analysis of Airaku-3, a multidrug-resistant strain with an unknown mechanism of resistance to rifampicin. We identified 12 unique non-synonymous single-nucleotide polymorphisms (SNPs) including two in the transporter-encoding ctpC and ctpI genes. In addition, two SNPs were found that improve the resolution of SNP-based genotyping, particularly for Venezuelan and South East Asian strains of M. leprae. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Association of androgen metabolism gene polymorphisms with prostate cancer risk and androgen concentrations: Results from the Prostate Cancer Prevention Trial.

PubMed

Price, Douglas K; Chau, Cindy H; Till, Cathee; Goodman, Phyllis J; Leach, Robin J; Johnson-Pais, Teresa L; Hsing, Ann W; Hoque, Ashraful; Parnes, Howard L; Schenk, Jeannette M; Tangen, Catherine M; Thompson, Ian M; Reichardt, Juergen K V; Figg, William D

2016-08-01

Prostate cancer is highly influenced by androgens and genes. The authors investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or with the risk of prostate cancer or high-grade disease from finasteride treatment. A nested case-control study from the Prostate Cancer Prevention Trial using data from men who had biopsy-proven prostate cancer (cases) and a group of biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with overall (total), low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. There were significant associations of genetic polymorphisms in steroid 5α-reductase 1 (SRD5A1) (reference SNPs: rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with the risk of high-grade prostate cancer in the placebo arm of the Prostate Cancer Prevention Trial; 2 SNPs were significantly associated with an increased risk (SRD5A1 rs472402 [odds ratio, 1.70; 95% confidence interval, 1.05-2.75; Ptrend = .03] and SRD5A2 rs2300700 [odds ratio, 1.94; 95% confidence interval, 1.19-3.18; Ptrend = .01]). Eleven SNPs in SRD5A1, SRD5A2, cytochrome P450 family 1, subfamily B, polypeptide 1 (CYP1B1), and CYP3A4 were associated with modifying the mean concentrations of serum androgen and sex hormone-binding globulin; and 2 SNPs (SRD5A1 rs824811 and CYP1B1 rs10012; Ptrend < .05) consistently and significantly altered all androgen concentrations. Several SNPs (SRD5A1 rs3822430, SRD5A2 rs2300700, CYP3A43 rs800672, and CYP19 rs700519; Ptrend < .05) were significantly associated with both circulating hormone levels and prostate cancer risk. Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and the risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. Cancer 2016;122:2332-2340. © 2016 American Cancer Society. © 2016 American Cancer Society.

A comparative analysis of MC4R gene sequence, polymorphism, and chromosomal localization in Chinese raccoon dog and Arctic fox.

PubMed

Skorczyk, Anna; Flisikowski, Krzysztof; Switonski, Marek

2012-05-01

Numerous mutations of the human melanocortin receptor type 4 (MC4R) gene are responsible for monogenic obesity, and some of them appear to be associated with predisposition or resistance to polygenic obesity. Thus, this gene is considered a functional candidate for fat tissue accumulation and body weight in domestic mammals. The aim of the study was comparative analysis of chromosome localization, nucleotide sequence, and polymorphism of the MC4R gene in two farmed species of the Canidae family, namely the Chinese raccoon dog (Nycterutes procyonoides procyonoides) and the arctic fox (Alopex lagopus). The whole coding sequence, including fragments of 3'UTR and 5'UTR, shows 89% similarity between the arctic fox (1276 bp) and Chinese raccoon dog (1213 bp). Altogether, 30 farmed Chinese raccoon dogs and 30 farmed arctic foxes were searched for polymorphisms. In the Chinese raccoon dog, only one silent substitution in the coding sequence was identified; whereas in the arctic fox, four InDels and two single-nucleotide polymorphisms (SNPs) in the 5'UTR and six silent SNPs in the exon were found. The studied gene was mapped by FISH to the Chinese raccoon dog chromosome 9 (NPP9q1.2) and arctic fox chromosome 24 (ALA24q1.2-1.3). The obtained results are discussed in terms of genome evolution of species belonging to the family Canidae and their potential use in animal breeding.

Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

PubMed Central

2011-01-01

Background Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. PMID:21569632

Genomic and Metabolomic Profile Associated to Microalbuminuria

PubMed Central

Marrachelli, Vannina G.; Monleon, Daniel; Rentero, Pilar; Mansego, María L.; Morales, Jose Manuel; Galan, Inma; Segura, Remedios; Martinez, Fernando; Martin-Escudero, Juan Carlos; Briongos, Laisa; Marin, Pablo; Lliso, Gloria; Chaves, Felipe Javier; Redon, Josep

2014-01-01

To identify factors related with the risk to develop microalbuminuria using combined genomic and metabolomic values from a general population study. One thousand five hundred and two subjects, Caucasian, more than 18 years, representative of the general population, were included. Blood pressure measurement and albumin/creatinine ratio were measured in a urine sample. Using SNPlex, 1251 SNPs potentially associated to urinary albumin excretion (UAE) were analyzed. Serum metabolomic profile was assessed by 1H NMR spectra using a Brucker Advance DRX 600 spectrometer. From the total population, 1217 (mean age 54±19, 50.6% men, ACR>30 mg/g in 81 subjects) with high genotyping call rate were analysed. A characteristic metabolomic profile, which included products from mitochondrial and extra mitochondrial metabolism as well as branched amino acids and their derivative signals, were observed in microalbuminuric as compare to normoalbuminuric subjects. The comparison of the metabolomic profile between subjects with different UAE status for each of the genotypes associated to microalbuminuria revealed two SNPs, the rs10492025_TT of RPH3A gene and the rs4359_CC of ACE gene, with minimal or no statistically significant differences. Subjects with and without microalbuminuria, who shared the same genotype and metabolomic profile, differed in age. Microalbuminurics with the CC genotype of the rs4359 polymorphism and with the TT genotype of the rs10492025 polymorphism were seven years older and seventeen years younger, respectively as compared to the whole microalbuminuric subjects. With the same metabolomic environment, characteristic of subjects with microalbuminuria, the TT genotype of the rs10492025 polymorphism seems to increase and the CC genotype of the rs4359 polymorphism seems to reduce risk to develop microalbuminuria. PMID:24918908

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Genotypic variants at 2q33 and risk of esophageal squamous cell carcinoma in China: a meta-analysis of genome-wide association studies

PubMed Central

Abnet, Christian C.; Wang, Zhaoming; Song, Xin; Hu, Nan; Zhou, Fu-You; Freedman, Neal D.; Li, Xue-Min; Yu, Kai; Shu, Xiao-Ou; Yuan, Jian-Min; Zheng, Wei; Dawsey, Sanford M.; Liao, Linda M.; Lee, Maxwell P.; Ding, Ti; Qiao, You-Lin; Gao, Yu-Tang; Koh, Woon-Puay; Xiang, Yong-Bing; Tang, Ze-Zhong; Fan, Jin-Hu; Chung, Charles C.; Wang, Chaoyu; Wheeler, William; Yeager, Meredith; Yuenger, Jeff; Hutchinson, Amy; Jacobs, Kevin B.; Giffen, Carol A.; Burdett, Laurie; Fraumeni, Joseph F.; Tucker, Margaret A.; Chow, Wong-Ho; Zhao, Xue-Ke; Li, Jiang-Man; Li, Ai-Li; Sun, Liang-Dan; Wei, Wu; Li, Ji-Lin; Zhang, Peng; Li, Hong-Lei; Cui, Wen-Yan; Wang, Wei-Peng; Liu, Zhi-Cai; Yang, Xia; Fu, Wen-Jing; Cui, Ji-Li; Lin, Hong-Li; Zhu, Wen-Liang; Liu, Min; Chen, Xi; Chen, Jie; Guo, Li; Han, Jing-Jing; Zhou, Sheng-Li; Huang, Jia; Wu, Yue; Yuan, Chao; Huang, Jing; Ji, Ai-Fang; Kul, Jian-Wei; Fan, Zhong-Min; Wang, Jian-Po; Zhang, Dong-Yun; Zhang, Lian-Qun; Zhang, Wei; Chen, Yuan-Fang; Ren, Jing-Li; Li, Xiu-Min; Dong, Jin-Cheng; Xing, Guo-Lan; Guo, Zhi-Gang; Yang, Jian-Xue; Mao, Yi-Ming; Yuan, Yuan; Guo, Er-Tao; Zhang, Wei; Hou, Zhi-Chao; Liu, Jing; Li, Yan; Tang, Sa; Chang, Jia; Peng, Xiu-Qin; Han, Min; Yin, Wan-Li; Liu, Ya-Li; Hu, Yan-Long; Liu, Yu; Yang, Liu-Qin; Zhu, Fu-Guo; Yang, Xiu-Feng; Feng, Xiao-Shan; Wang, Zhou; Li, Yin; Gao, She-Gan; Liu, Hai-Lin; Yuan, Ling; Jin, Yan; Zhang, Yan-Rui; Sheyhidin, Ilyar; Li, Feng; Chen, Bao-Ping; Ren, Shu-Wei; Liu, Bin; Li, Dan; Zhang, Gao-Fu; Yue, Wen-Bin; Feng, Chang-Wei; Qige, Qirenwang; Zhao, Jian-Ting; Yang, Wen-Jun; Lei, Guang-Yan; Chen, Long-Qi; Li, En-Min; Xu, Li-Yan; Wu, Zhi-Yong; Bao, Zhi-Qin; Chen, Ji-Li; Li, Xian-Chang; Zhuang, Xiang; Zhou, Ying-Fa; Zuo, Xian-Bo; Dong, Zi-Ming; Wang, Lu-Wen; Fan, Xue-Pin; Wang, Jin; Zhou, Qi; Ma, Guo-Shun; Zhang, Qin-Xian; Liu, Hai; Jian, Xin-Ying; Lian, Sin-Yong; Wang, Jin-Sheng; Chang, Fu-Bao; Lu, Chang-Dong; Miao, Jian-Jun; Chen, Zhi-Guo; Wang, Ran; Guo, Ming; Fan, Zeng-Lin; Tao, Ping; Liu, Tai-Jing; Wei, Jin-Chang; Kong, Qing-Peng; Fan, Lei; Wang, Xian-Zeng; Gao, Fu-Sheng; Wang, Tian-Yun; Xie, Dong; Wang, Li; Chen, Shu-Qing; Yang, Wan-Cai; Hong, Jun-Yan; Wang, Liang; Qiu, Song-Liang; Goldstein, Alisa M.; Yuan, Zhi-Qing; Chanock, Stephen J.; Zhang, Xue-Jun; Taylor, Philip R.; Wang, Li-Dong

2012-01-01

Genome-wide association studies have identified susceptibility loci for esophageal squamous cell carcinoma (ESCC). We conducted a meta-analysis of all single-nucleotide polymorphisms (SNPs) that showed nominally significant P-values in two previously published genome-wide scans that included a total of 2961 ESCC cases and 3400 controls. The meta-analysis revealed five SNPs at 2q33 with P< 5 × 10−8, and the strongest signal was rs13016963, with a combined odds ratio (95% confidence interval) of 1.29 (1.19–1.40) and P= 7.63 × 10−10. An imputation analysis of 4304 SNPs at 2q33 suggested a single association signal, and the strongest imputed SNP associations were similar to those from the genotyped SNPs. We conducted an ancestral recombination graph analysis with 53 SNPs to identify one or more haplotypes that harbor the variants directly responsible for the detected association signal. This showed that the five SNPs exist in a single haplotype along with 45 imputed SNPs in strong linkage disequilibrium, and the strongest candidate was rs10201587, one of the genotyped SNPs. Our meta-analysis found genome-wide significant SNPs at 2q33 that map to the CASP8/ALS2CR12/TRAK2 gene region. Variants in CASP8 have been extensively studied across a spectrum of cancers with mixed results. The locus we identified appears to be distinct from the widely studied rs3834129 and rs1045485 SNPs in CASP8. Future studies of esophageal and other cancers should focus on comprehensive sequencing of this 2q33 locus and functional analysis of rs13016963 and rs10201587 and other strongly correlated variants. PMID:22323360

Genotypic variants at 2q33 and risk of esophageal squamous cell carcinoma in China: a meta-analysis of genome-wide association studies.

PubMed

Abnet, Christian C; Wang, Zhaoming; Song, Xin; Hu, Nan; Zhou, Fu-You; Freedman, Neal D; Li, Xue-Min; Yu, Kai; Shu, Xiao-Ou; Yuan, Jian-Min; Zheng, Wei; Dawsey, Sanford M; Liao, Linda M; Lee, Maxwell P; Ding, Ti; Qiao, You-Lin; Gao, Yu-Tang; Koh, Woon-Puay; Xiang, Yong-Bing; Tang, Ze-Zhong; Fan, Jin-Hu; Chung, Charles C; Wang, Chaoyu; Wheeler, William; Yeager, Meredith; Yuenger, Jeff; Hutchinson, Amy; Jacobs, Kevin B; Giffen, Carol A; Burdett, Laurie; Fraumeni, Joseph F; Tucker, Margaret A; Chow, Wong-Ho; Zhao, Xue-Ke; Li, Jiang-Man; Li, Ai-Li; Sun, Liang-Dan; Wei, Wu; Li, Ji-Lin; Zhang, Peng; Li, Hong-Lei; Cui, Wen-Yan; Wang, Wei-Peng; Liu, Zhi-Cai; Yang, Xia; Fu, Wen-Jing; Cui, Ji-Li; Lin, Hong-Li; Zhu, Wen-Liang; Liu, Min; Chen, Xi; Chen, Jie; Guo, Li; Han, Jing-Jing; Zhou, Sheng-Li; Huang, Jia; Wu, Yue; Yuan, Chao; Huang, Jing; Ji, Ai-Fang; Kul, Jian-Wei; Fan, Zhong-Min; Wang, Jian-Po; Zhang, Dong-Yun; Zhang, Lian-Qun; Zhang, Wei; Chen, Yuan-Fang; Ren, Jing-Li; Li, Xiu-Min; Dong, Jin-Cheng; Xing, Guo-Lan; Guo, Zhi-Gang; Yang, Jian-Xue; Mao, Yi-Ming; Yuan, Yuan; Guo, Er-Tao; Zhang, Wei; Hou, Zhi-Chao; Liu, Jing; Li, Yan; Tang, Sa; Chang, Jia; Peng, Xiu-Qin; Han, Min; Yin, Wan-Li; Liu, Ya-Li; Hu, Yan-Long; Liu, Yu; Yang, Liu-Qin; Zhu, Fu-Guo; Yang, Xiu-Feng; Feng, Xiao-Shan; Wang, Zhou; Li, Yin; Gao, She-Gan; Liu, Hai-Lin; Yuan, Ling; Jin, Yan; Zhang, Yan-Rui; Sheyhidin, Ilyar; Li, Feng; Chen, Bao-Ping; Ren, Shu-Wei; Liu, Bin; Li, Dan; Zhang, Gao-Fu; Yue, Wen-Bin; Feng, Chang-Wei; Qige, Qirenwang; Zhao, Jian-Ting; Yang, Wen-Jun; Lei, Guang-Yan; Chen, Long-Qi; Li, En-Min; Xu, Li-Yan; Wu, Zhi-Yong; Bao, Zhi-Qin; Chen, Ji-Li; Li, Xian-Chang; Zhuang, Xiang; Zhou, Ying-Fa; Zuo, Xian-Bo; Dong, Zi-Ming; Wang, Lu-Wen; Fan, Xue-Pin; Wang, Jin; Zhou, Qi; Ma, Guo-Shun; Zhang, Qin-Xian; Liu, Hai; Jian, Xin-Ying; Lian, Sin-Yong; Wang, Jin-Sheng; Chang, Fu-Bao; Lu, Chang-Dong; Miao, Jian-Jun; Chen, Zhi-Guo; Wang, Ran; Guo, Ming; Fan, Zeng-Lin; Tao, Ping; Liu, Tai-Jing; Wei, Jin-Chang; Kong, Qing-Peng; Fan, Lei; Wang, Xian-Zeng; Gao, Fu-Sheng; Wang, Tian-Yun; Xie, Dong; Wang, Li; Chen, Shu-Qing; Yang, Wan-Cai; Hong, Jun-Yan; Wang, Liang; Qiu, Song-Liang; Goldstein, Alisa M; Yuan, Zhi-Qing; Chanock, Stephen J; Zhang, Xue-Jun; Taylor, Philip R; Wang, Li-Dong

2012-05-01

Genome-wide association studies have identified susceptibility loci for esophageal squamous cell carcinoma (ESCC). We conducted a meta-analysis of all single-nucleotide polymorphisms (SNPs) that showed nominally significant P-values in two previously published genome-wide scans that included a total of 2961 ESCC cases and 3400 controls. The meta-analysis revealed five SNPs at 2q33 with P< 5 × 10(-8), and the strongest signal was rs13016963, with a combined odds ratio (95% confidence interval) of 1.29 (1.19-1.40) and P= 7.63 × 10(-10). An imputation analysis of 4304 SNPs at 2q33 suggested a single association signal, and the strongest imputed SNP associations were similar to those from the genotyped SNPs. We conducted an ancestral recombination graph analysis with 53 SNPs to identify one or more haplotypes that harbor the variants directly responsible for the detected association signal. This showed that the five SNPs exist in a single haplotype along with 45 imputed SNPs in strong linkage disequilibrium, and the strongest candidate was rs10201587, one of the genotyped SNPs. Our meta-analysis found genome-wide significant SNPs at 2q33 that map to the CASP8/ALS2CR12/TRAK2 gene region. Variants in CASP8 have been extensively studied across a spectrum of cancers with mixed results. The locus we identified appears to be distinct from the widely studied rs3834129 and rs1045485 SNPs in CASP8. Future studies of esophageal and other cancers should focus on comprehensive sequencing of this 2q33 locus and functional analysis of rs13016963 and rs10201587 and other strongly correlated variants.