Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

PubMed

Hamilton, Natasha A; Tammen, Imke; Raadsma, Herman W

2013-01-01

Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

Multi-Species Comparative Analysis of the Equine ACE Gene Identifies a Highly Conserved Potential Transcription Factor Binding Site in Intron 16

PubMed Central

Hamilton, Natasha A.; Tammen, Imke; Raadsma, Herman W.

2013-01-01

Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism. PMID:23408978

A global perspective on hepatitis B‐related single nucleotide polymorphisms and evolution during human migration

PubMed Central

Jeng, Wen‐Juei; Lin, Chun‐Yen

2017-01-01

Genome‐wide association studies have indicated that human leukocyte antigen (HLA)‐DP and HLA‐DQ play roles in persistent hepatitis B virus (HBV) infection in Asia. To understand the evolution of HBV‐related single nucleotide polymorphisms (SNPs) and to correlate these SNPs with chronic HBV infection among different populations, we conducted a global perspective study on hepatitis‐related SNPs. We selected 12 HBV‐related SNPs on the HLA locus and two HBV and three hepatitis C virus immune‐related SNPs for analysis. Five nasopharyngeal carcinoma‐related SNPs served as controls. All SNP data worldwide from 26 populations were downloaded from 1,000 genomes. We found a dramatic difference in the allele frequency in most of the HBV‐ and HLA‐related SNPs in East Asia compared to the other continents. A sharp change in allele frequency in 8 of 12 SNPs was found between Bengali populations in Bangladesh and Chinese Dai populations in Xishuangbanna, China (P < 0.001); these areas represent the junction of South and East Asia. For the immune‐related SNPs, significant changes were found after leaving Africa. Most of these genes shifted from higher expression genotypes in Africa to lower expression genotypes in either Europe or South Asia (P < 0.001). During this two‐stage adaptation, immunity adjusted toward a weak immune response, which could have been a survival strategy during human migration to East Asia. The prevalence of chronic HBV infection in Africa is as high as in Asia; however, the HBV‐related SNP genotypes are not present in Africa, and so the genetic mechanism of chronic HBV infection in Africa needs further exploration. Conclusion: Two stages of genetic changes toward a weak immune response occurred when humans migrated out of Africa. These changes could be a survival strategy for avoiding cytokine storms and surviving in new environments. (Hepatology Communications 2017;1:1005–1013) PMID:29404438

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

SNPServer: a real-time SNP discovery tool.

PubMed

Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

2005-07-01

SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

Profiling deleterious non-synonymous SNPs of smoker's gene CYP1A1.

PubMed

Ramesh, A Sai; Khan, Imran; Farhan, Md; Thiagarajan, Padma

2013-01-01

CYP1A1 gene belongs to the cytochrome P450 family and is known better as smokers' gene due to its hyperactivation as a consequence of long term smoking. The expression of CYP1A1 induces polycyclic aromatic hydrocarbon production in the lungs, which when over expressed, is known to cause smoking related diseases, such as cardiovascular pathologies, cancer, and diabetes. Single nucleotide polymorphisms (SNPs) are the simplest form of genetic variations that occur at a higher frequency, and are denoted as synonymous and non-synonymous SNPs on the basis of their effects on the amino acids. This study adopts a systematic in silico approach to predict the deleterious SNPs that are associated with disease conditions. It is inferred that four SNPs are highly deleterious, among which the SNP with rs17861094 is commonly predicted to be harmful by all tools. Hydrophobic (isoleucine) to hydrophilic (serine) amino acid variation was observed in the candidate gene. Hence, this investigation aims to characterize a candidate gene from 159 SNPs of CYP1A1.

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

PubMed

Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

2010-10-01

Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

PubMed

Yates, Christopher M; Sternberg, Michael J E

2013-11-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.

PubMed

Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A

2012-01-01

Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

SNP-VISTA: An Interactive SNPs Visualization Tool

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shah, Nameeta; Teplitsky, Michael V.; Pennacchio, Len A.

2005-07-05

Recent advances in sequencing technologies promise better diagnostics for many diseases as well as better understanding of evolution of microbial populations. Single Nucleotide Polymorphisms(SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it is possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease and then screen for causative mutations.In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmentalmore » samples makes possible more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at http://genome.lbl.gov/vista/snpvista.« less

Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

PubMed

Sattler, Ursula; Khosravi, Mojtaba; Avila, Mislay; Pilo, Paola; Langedijk, Johannes P; Ader-Ebert, Nadine; Alves, Lisa A; Plattet, Philippe; Origgi, Francesco C

2014-07-01

The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the attachment protein, which is pivotal for infection. Our results show that few SNPs have a relevant detrimental impact and they generally appear in specific combinations (molecular signatures). These drastic negative changes are neutralized by compensatory mutations, which contribute to maintenance of an overall constant bioactivity of the attachment protein. This compensational mechanism might reflect the reaction of the CDV machinery to the changes occurring in the virus following antigenic variations critical for virulence. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.

PubMed

Tashjian, Robert Z; Granger, Erin K; Farnham, James M; Cannon-Albright, Lisa A; Teerlink, Craig C

2016-02-01

The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Limited data exist identifying specific genes associated with rotator cuff tearing. The purpose of this study was to identify specific genes or genetic variants associated with rotator cuff tearing by a genome-wide association study with an independent set of rotator cuff tear cases. A set of 311 full-thickness rotator cuff tear cases genotyped on the Illumina 5M single-nucleotide polymorphism (SNP) platform were used in a genome-wide association study with 2641 genetically matched white population controls available from the Illumina iControls database. Tests of association were performed with GEMMA software at 257,558 SNPs that compose the intersection of Illumina SNP platforms and that passed general quality control metrics. SNPs were considered significant if P < 1.94 × 10(-7) (Bonferroni correction: 0.05/257,558). Tests of association revealed 2 significantly associated SNPs, one occurring in SAP30BP (rs820218; P = 3.8E-9) on chromosome 17q25 and another occurring in SASH1 (rs12527089; P = 1.9E-7) on chromosome 6q24. This study represents the first attempt to identify genetic factors influencing rotator cuff tearing by a genome-wide association study using a dense/complete set of SNPs. Two SNPs were significantly associated with rotator cuff tearing, residing in SAP30BP on chromosome 17 and SASH1 on chromosome 6. Both genes are associated with the cellular process of apoptosis. Identification of potential genes or genetic variants associated with rotator cuff tearing may help in identifying individuals at risk for the development of rotator cuff tearing. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

PubMed

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

Elastic-net regularization approaches for genome-wide association studies of rheumatoid arthritis.

PubMed

Cho, Seoae; Kim, Haseong; Oh, Sohee; Kim, Kyunga; Park, Taesung

2009-12-15

The current trend in genome-wide association studies is to identify regions where the true disease-causing genes may lie by evaluating thousands of single-nucleotide polymorphisms (SNPs) across the whole genome. However, many challenges exist in detecting disease-causing genes among the thousands of SNPs. Examples include multicollinearity and multiple testing issues, especially when a large number of correlated SNPs are simultaneously tested. Multicollinearity can often occur when predictor variables in a multiple regression model are highly correlated, and can cause imprecise estimation of association. In this study, we propose a simple stepwise procedure that identifies disease-causing SNPs simultaneously by employing elastic-net regularization, a variable selection method that allows one to address multicollinearity. At Step 1, the single-marker association analysis was conducted to screen SNPs. At Step 2, the multiple-marker association was scanned based on the elastic-net regularization. The proposed approach was applied to the rheumatoid arthritis (RA) case-control data set of Genetic Analysis Workshop 16. While the selected SNPs at the screening step are located mostly on chromosome 6, the elastic-net approach identified putative RA-related SNPs on other chromosomes in an increased proportion. For some of those putative RA-related SNPs, we identified the interactions with sex, a well known factor affecting RA susceptibility.

Genetic polymorphisms associated with breast cancer in malaysian cohort.

PubMed

Chahil, Jagdish Kaur; Munretnam, Khamsigan; Samsudin, Nurulhafizah; Lye, Say Hean; Hashim, Nikman Adli Nor; Ramzi, Nurul Hanis; Velapasamy, Sharmila; Wee, Ler Lian; Alex, Livy

2015-04-01

Genome-wide association studies have discovered multiple single nucleotide polymorphisms (SNPs) associated with the risk of common diseases. The objective of this study was to demonstrate the replication of previously published SNPs that showed statistical significance for breast cancer in the Malaysian population. In this case-control study, 80 subjects for each group were recruited from various hospitals in Malaysia. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. A total of three SNPs were found to be associated with increased risk of breast cancer while six SNPs showed protective effect. All nine were statistically significant SNPs (p ≤ 0.01), five SNPs from previous studies were successfully replicated in our study. Significant modifiable (diet) and non-modifiable (family history of breast cancer in first degree relative) risk factors were also observed. We identified nine SNPs from this study to be either conferring susceptibility or protection to breast cancer which may serve as potential markers in risk prediction.

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

Indolethylamine-N-methyltransferase Polymorphisms: Genetic and Biochemical Approaches for Study of Endogenous N,N,-dimethyltryptamine.

PubMed

Dean, Jon G

2018-01-01

N,N -dimethyltryptamine (DMT) is a powerful serotonergic psychedelic whose exogenous administration elicits striking psychedelic effects in humans. Studies have identified DMT and analogous compounds (e.g., 5-hydroxy-DMT, 5-methoxy-DMT) alongside of an enzyme capable of synthesizing DMT endogenously from tryptamine, indolethylamine- N -methyltransferase (INMT), in human and several other mammalian tissues. Subsequently, multiple hypotheses for the physiological role of endogenous DMT have emerged, from proposed immunomodulatory functions to an emphasis on the overlap between the mental states generated by exogenous DMT and naturally occurring altered states of consciousness; e.g., schizophrenia. However, no clear relationship between endogenous DMT and naturally occurring altered states of consciousness has yet been established from in vivo assays of DMT in bodily fluids. The advent of genetic screening has afforded the capability to link alterations in the sequence of specific genes to behavioral and molecular phenotypes via expression of identified single nucleotide polymorphisms (SNPs) in cell and animal models. As SNPs in INMT may impact endogenous DMT synthesis and levels via changes in INMT expression and/or INMT structure and function, these combined genetic and biochemical approaches circumvent the limitations of assaying DMT in bodily fluids and may augment data from prior in vitro and in vivo work. Therefore, all reported SNPs in INMT were amassed from genetic and biochemical literature and genomic databases to consolidate a blueprint for future studies aimed at elucidating whether DMT plays a physiological role.

Indolethylamine-N-methyltransferase Polymorphisms: Genetic and Biochemical Approaches for Study of Endogenous N,N,-dimethyltryptamine

PubMed Central

Dean, Jon G.

2018-01-01

N,N-dimethyltryptamine (DMT) is a powerful serotonergic psychedelic whose exogenous administration elicits striking psychedelic effects in humans. Studies have identified DMT and analogous compounds (e.g., 5-hydroxy-DMT, 5-methoxy-DMT) alongside of an enzyme capable of synthesizing DMT endogenously from tryptamine, indolethylamine-N-methyltransferase (INMT), in human and several other mammalian tissues. Subsequently, multiple hypotheses for the physiological role of endogenous DMT have emerged, from proposed immunomodulatory functions to an emphasis on the overlap between the mental states generated by exogenous DMT and naturally occurring altered states of consciousness; e.g., schizophrenia. However, no clear relationship between endogenous DMT and naturally occurring altered states of consciousness has yet been established from in vivo assays of DMT in bodily fluids. The advent of genetic screening has afforded the capability to link alterations in the sequence of specific genes to behavioral and molecular phenotypes via expression of identified single nucleotide polymorphisms (SNPs) in cell and animal models. As SNPs in INMT may impact endogenous DMT synthesis and levels via changes in INMT expression and/or INMT structure and function, these combined genetic and biochemical approaches circumvent the limitations of assaying DMT in bodily fluids and may augment data from prior in vitro and in vivo work. Therefore, all reported SNPs in INMT were amassed from genetic and biochemical literature and genomic databases to consolidate a blueprint for future studies aimed at elucidating whether DMT plays a physiological role. PMID:29740267

Two novel polymorphisms of bovine SIRT2 gene are associated with higher body weight in Nanyang cattle.

PubMed

Sun, Xiaomei; Li, Mingxun; Hao, Dan; Hua, Liushuai; Lan, Xianyong; Lei, Chuzhao; Hu, Shenrong; Qi, Xinglei; Chen, Hong

2015-03-01

Identification of polymorphisms associated with economic traits is important for successful marker-assisted selection in cattle breeding. The family of mammalian sirtuin regulates many biological functions, such as life span extension and energy metabolism. SIRT2, a most abundant sirtuin in adipocytes, acts as a crucial regulator of adipogenic differentiation and plays a key role in controlling adipose tissue function and mass. Here we investigated single nucleotide polymorphisms (SNPs) of bovine SIRT2 in 1226 cattle from five breeds and further evaluated the effects of identified SNPs on economically important traits of Nanyang cattle. Our results revealed four novel SNPs in bovine SIRT2, one was located in intronic region and the other three were synonymous mutations. Linkage disequilibrium and haplotype analyses based on the identified SNPs showed obvious difference between crossbred breed and the other four beef breeds. Association analyses demonstrated that SNPs g.17333C > T and g.17578A > G have a significantly effect on 18-months-old body weight of Nanyang population. Animals with combined genotype TTGG at the above two loci exhibited especially higher body weight. Our data for the first time demonstrated that polymorphisms in bovine SIRT2 are associated with economic traits of Nanyang cattle, which will be helpful for future cattle selection practices.

Polymorphisms of clip domain serine proteinase and serine proteinase homolog in the swimming crab Portunus trituberculatus and their association with Vibrio alginolyticus

NASA Astrophysics Data System (ADS)

Liu, Meng; Liu, Yuan; Hui, Min; Song, Chengwen; Cui, Zhaoxia

2017-03-01

Clip domain serine proteases (cSPs) and their homologs (SPHs) play an important role in various biological processes that are essential components of extracellular signaling cascades, especially in the innate immune responses of invertebrates. Here, polymorphisms of PtcSP and PtSPH from the swimming crab Portunus trituberculatus were investigated to explore their association with resistance/susceptibility to Vibrio alginolyticus. Polymorphic loci were identified using Clustal X, and characterized with SPSS 16.0 software, and then the significance of genotype and allele frequencies between resistant and susceptible stocks was determined by a χ 2 test. A total of 109 and 77 single nucleotide polymorphisms (SNPs) were identified in the genomic fragments of PtcSP and PtSPH, respectively. Notably, nearly half of PtSPH polymorphisms were found in the non-coding exon 1. Fourteen SNPs investigated were significantly associated with susceptibility/resistance to V. alginolyticus ( P <0.05). Among them, eight SNPs were observed in introns, and one synonymous, four non-synonymous SNPs and one ins-del were found in coding exons. In addition, five simple sequence repeats (SSRs) were detected in intron 3 of PtcSP. Although there was no statistically significant difference of allele frequencies, the SSRs showed different polymorphic alleles on the basis of the repeat number between resistant and susceptible stocks. After further validation, polymorphisms investigated here might be applied to select potential molecular markers of P. trituberculatus with resistance to V. alginolyticus.

Comparative Bioavailability and Utilization of Particular Forms of B12 Supplements With Potential to Mitigate B12-related Genetic Polymorphisms.

PubMed

Paul, Cristiana; Brady, David M

2017-02-01

Three natural forms of vitamin B 12 are commercially available: methylcobalamin (MeCbl), adenosylcobalamin (AdCbl), and hydroxycobalamin (OHCbl), all of which have been shown in clinical studies to improve vitamin B 12 status. They are bioidentical to the B 12 forms occurring in human physiology and animal foods. In contrast, cyanocobalamin (CNCbl), a synthetic B 12 compound used for food fortification and in some supplements, occurs only in trace amounts in human tissues as a result of cyanide intake from smoking or other sources. This study had 3 objectives: (1) To summarize and compare assimilation pathways for 4 B 12 forms; (2) to determine whether supplementation with a particular B 12 form (or combination of forms) presents any advantages for the general population or for individuals with single nucleotide polymorphisms (SNPs) in B 12 -related pathways; and (3) to address misconceptions regarding B 12 forms, methylation pathways, and various SNPs reported in commercially available tests. PubMed was systematically searched for articles published up to June 2016 using specific key words. Human, animal, and in vitro studies that were published in English, French, and German were included. Other studies considered were found by selecting in PubMed the suggested "related studies" and also some referenced studies. The study occurred in Los Angeles, CA, USA. The studies reviewed provide evidence that all supplemental or food-derived B 12 forms are reduced to a core cobalamin molecule, which converts to the intracellular active forms: MeCbl and AdCbl, in a ratio not influenced by the form of B 12 ingested. The methyl and adenosyl components of supplemental MeCbl and AdCbl are cleaved inside cells and are not used in the synthesis of intracellular MeCbl and AdCbl, respectively. However, the overall bioavailability of each form of supplemental B 12 may be influenced by many factors such as gastrointestinal pathologies, age, and genetics. Polymorphisms on B 12 -related pathways may affect the efficiency of absorption, blood transport, cellular uptake, and intracellular transformations. Supplementing with any of the nature bioidentical forms of B 12 (MeCbl, OHCbl, and/or AdCbl) is preferred instead of the use of CNCbl, owing to their superior bioavailability and safety. For the majority of the population, all B 12 forms may likely have similar bioavailabilities and physiological effects; thus, it makes sense to employ the least-expensive form of B 12 , such as MeCbl. Individuals with particular single nucleotide polymorphisms (SNPs) affecting B 12 assimilation may raise their B 12 status more efficiently with 1 or more particular forms of vitamin B 12 . However, because those types of SNPs are not currently reported in commercial tests, individuals may require either a trial-and-error approach by supplementing with 1 particular form of B 12 at a time, or they might simply use a supplement with a combination of all 3 naturally occurring forms of B 12 that are commercially available for a better chance of achieving faster clinical results. That approach may or may not offset genetic polymorphisms involving B 12 metabolism and related pathways.

SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

PubMed Central

Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

2000-01-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

PubMed

Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

2000-08-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P

Pharmacogenetic screening for polymorphisms in drug-metabolizing enzymes and drug transporters in a Dutch population.

PubMed

Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H

2006-01-01

A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.

Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.

PubMed

Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David

2013-01-01

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene.

PubMed

Piva, Francesco; Giulietti, Matteo; Baldelli, Luisa; Nardi, Bernardo; Bellantuono, Cesario; Armeni, Tatiana; Saccucci, Franca; Principato, Giovanni

2011-08-01

Single nucleotide polymorphisms (SNPs) in serotonin related genes influence mental disorders, responses to pharmacological and psychotherapeutic treatments. In planning association studies, researchers that want to investigate new SNPs have to select some among a large number of candidates. Our aim is to guide researchers in the selection of the most likely phenotype affecting polymorphisms. Here, we studied serotonin receptor 2C (HTR2C) SNPs because, till now, only relatively few of about 2000 are investigated. We used the most updated and assessed bioinformatic tools to predict which variations can give rise to biological effects among 2450 HTR2C SNPs. We suggest 48 SNPs that are worth considering in future association studies in the field of psychiatry, psychology and pharmacogenomics. Moreover, our analyses point out the biological level probably affected, such as transcription, splicing, miRNA regulation and protein structure, thus allowing to suggest future molecular investigations. Although few association studies are available in literature, their results are in agreement with our predictions, showing that our selection methods can help to guide future association studies. Copyright © 2011 John Wiley & Sons, Ltd.

GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

PubMed

Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

2012-05-01

We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.

PubMed

Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao

2017-02-07

Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.

Genetic Diversity of Sheep Breeds from Albania, Greece, and Italy Assessed by Mitochondrial DNA and Nuclear Polymorphisms (SNPs)

PubMed Central

Pariset, Lorraine; Mariotti, Marco; Gargani, Maria; Joost, Stephane; Negrini, Riccardo; Perez, Trinidad; Bruford, Michael; Ajmone Marsan, Paolo; Valentini, Alessio

2011-01-01

We employed mtDNA and nuclear SNPs to investigate the genetic diversity of sheep breeds of three countries of the Mediterranean basin: Albania, Greece, and Italy. In total, 154 unique mtDNA haplotypes were detected by means of D-loop sequence analysis. The major nucleotide diversity was observed in Albania. We identified haplogroups, A, B, and C in Albanian and Greek samples, while Italian individuals clustered in groups A and B. In general, the data show a pattern reflecting old migrations that occurred in postneolithic and historical times. PCA analysis on SNP data differentiated breeds with good correspondence to geographical locations. This could reflect geographical isolation, selection operated by local sheep farmers, and different flock management and breed admixture that occurred in the last centuries. PMID:22125424

Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

PubMed Central

Duellman, Tyler; Warren, Christopher; Yang, Jay

2014-01-01

Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation

PubMed Central

Thomas, Laurent F.; Sætrom, Pål

2012-01-01

Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

PubMed Central

Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

2010-01-01

Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

2014-01-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

PubMed

Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

2014-11-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

Development and Evaluation of a 9K SNP Array for Peach by Internationally Coordinated SNP Detection and Validation in Breeding Germplasm

PubMed Central

Scalabrin, Simone; Gilmore, Barbara; Lawley, Cynthia T.; Gasic, Ksenija; Micheletti, Diego; Rosyara, Umesh R.; Cattonaro, Federica; Vendramin, Elisa; Main, Dorrie; Aramini, Valeria; Blas, Andrea L.; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Troggio, Michela; Sosinski, Bryon; Aranzana, Maria José; Arús, Pere; Iezzoni, Amy; Morgante, Michele; Peace, Cameron

2012-01-01

Although a large number of single nucleotide polymorphism (SNP) markers covering the entire genome are needed to enable molecular breeding efforts such as genome wide association studies, fine mapping, genomic selection and marker-assisted selection in peach [Prunus persica (L.) Batsch] and related Prunus species, only a limited number of genetic markers, including simple sequence repeats (SSRs), have been available to date. To address this need, an international consortium (The International Peach SNP Consortium; IPSC) has pursued a coordinated effort to perform genome-scale SNP discovery in peach using next generation sequencing platforms to develop and characterize a high-throughput Illumina Infinium® SNP genotyping array platform. We performed whole genome re-sequencing of 56 peach breeding accessions using the Illumina and Roche/454 sequencing technologies. Polymorphism detection algorithms identified a total of 1,022,354 SNPs. Validation with the Illumina GoldenGate® assay was performed on a subset of the predicted SNPs, verifying ∼75% of genic (exonic and intronic) SNPs, whereas only about a third of intergenic SNPs were verified. Conservative filtering was applied to arrive at a set of 8,144 SNPs that were included on the IPSC peach SNP array v1, distributed over all eight peach chromosomes with an average spacing of 26.7 kb between SNPs. Use of this platform to screen a total of 709 accessions of peach in two separate evaluation panels identified a total of 6,869 (84.3%) polymorphic SNPs. The almost 7,000 SNPs verified as polymorphic through extensive empirical evaluation represent an excellent source of markers for future studies in genetic relatedness, genetic mapping, and dissecting the genetic architecture of complex agricultural traits. The IPSC peach SNP array v1 is commercially available and we expect that it will be used worldwide for genetic studies in peach and related stone fruit and nut species. PMID:22536421

Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

PubMed

Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

2014-07-01

The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

Genetic Polymorphisms are Associated with Hair, Blood, and Urine Mercury Levels in the American Dental Association (ADA) Study Participants

PubMed Central

Parajuli, Rajendra Prasad; Goodrich, Jaclyn M.; Chou, Hwai-Nan; Gruninger, Stephen E.; Dolinoy, Dana C.; Franzblau, Alfred; Basu, Niladri

2015-01-01

Background/Aims Mercury (Hg) is a potent toxicant of concern to the general public. Recent studies suggest that several genes that mediate Hg metabolism are polymorphic. We hypothesize that single nucleotide polymorphisms (SNPs) in such genes may underline inter-individual differences in exposure biomarker concentrations. Methods Dental professionals were recruited during the American Dental Association (ADA) 2012 Annual Meeting. Samples of hair, blood, and urine were collected for quantifying Hg levels and genotyping (88 SNPs in classes relevant to Hg toxicokinetics including glutathione metabolism, selenoproteins, metallothioneins, and xenobiotic transporters). Questionnaires were administrated to obtain information on demographics and sources of Hg exposure (e.g., fish consumption and use of dental amalgam). Here, we report results for 380 participants with complete genotype and Hg biomarker datasets. ANOVA and linear regressions were used for statistical analysis. Results Mean (geometric) Hg levels in hair (hHg), blood (bHg), urine (uHg), and the average estimated Hg intake from fish were 0.62μg/g, 3.75μg/L, 1.32μg/L, and 0.12μg/kg body weight/day, respectively. Out of 88 SNPs successfully genotyped, Hg biomarker levels differed by genotype for 25 SNPs, one of which remained significant following Bonferroni correction in ANOVA. When the associations between sources of Hg exposure and SNPs were analyzed with respect to Hg biomarker concentrations, 38 SNPs had significant main effects and/or gene-Hg exposure source interactions. Twenty-five, 23, and four SNPs showed significant main effects and/or interactions for hHg, bHg, and uHg levels, respectively (p<0.05), and six SNPs (in GCLC, MT1M, MT4, ATP7B, and BDNF) remained significant following Bonferroni correction. Conclusion The findings suggest that polymorphisms in environmentally-responsive genes can influence Hg biomarker levels. Hence, consideration of such gene-environment factors may improve the ability to assess the health risks of Hg more precisely. PMID:26673400

The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

USDA-ARS?s Scientific Manuscript database

The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

PubMed Central

Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

2004-01-01

Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

PubMed

Hughes, Austin L

2013-02-15

The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

Association between long non-coding RNA polymorphisms and cancer risk: a meta-analysis.

PubMed

Huang, Xin; Zhang, Weiyue; Shao, Zengwu

2018-05-25

Several studies have suggested that long non-coding RNA (lncRNA) gene polymorphisms are associated with cancer risk. In the present study, we conducted a meta-analysis related to studies on the association between lncRNA single-nucleotide polymorphisms (SNPs) and the overall risk of cancer. A total 12 SNPs in five common lncRNA genes were finally included in the meta-analysis. In the lncRNA antisense noncoding RNA in the INK4 locus (ANRIL), the rs1333048 A/C, rs4977574 A/G, and rs10757278 A/G polymorphisms, but not rs1333045 C/T, were correlated with overall cancer risk. Our study also demonstrated that other SNPs were correlated with overall cancer risk, namely, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1, rs619586 A/G), HOXA distal transcript antisense RNA (HOTTIP, rs1859168 A/C) and highly up-regulated in liver cancer (HULC, rs7763881 A/C). Moreover, four prostate cancer‑associated non‑coding RNA 1 (PRNCR1, rs16901946 G/A, rs13252298 G/A, rs1016343 T/C, and rs1456315 G/A) SNPs were in association with cancer risk. No association was found between the PRNCR1 (rs7007694 C/T) SNP and the risk of cancer. In conclusion, our results suggest that several studied lncRNA SNPs are associated with overall cancer risk. Therefore, they might be potential predictive biomarkers for the risk of cancer. More studies based on larger sample sizes and more lncRNA SNPs are warranted to confirm these findings. ©2018 The Author(s).

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

PubMed Central

Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E.; Crowhurst, Ross N.; Chagné, David

2013-01-01

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality. PMID:24155917

Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

PubMed

Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

2012-11-10

We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

Exploration of structural stability in deleterious nsSNPs of the XPA gene: A molecular dynamics approach.

PubMed

Nagasundaram, N; Priya Doss, C George

2011-01-01

Distinguishing the deleterious from the massive number of non-functional nsSNPs that occur within a single genome is a considerable challenge in mutation research. In this approach, we have used the existing in silico methods to explore the mutation-structure-function relationship in the XPAgene. We used the Sorting Intolerant From Tolerant (SIFT), Polymorphism Phenotyping (PolyPhen), I-Mutant 2.0, and the Protein Analysis THrough Evolutionary Relationships methods to predict the effects of deleterious nsSNPs on protein function and evaluated the impact of mutation on protein stability by Molecular Dynamics simulations. By comparing the scores of all the four in silico methods, nsSNP with an ID rs104894131 at position C108F was predicted to be highly deleterious. We extended our Molecular dynamics approach to gain insight into the impact of this non-synonymous polymorphism on structural changes that may affect the activity of the XPAgene. Based on the in silico methods score, potential energy, root-mean-square deviation, and root-mean-square fluctuation, we predict that deleterious nsSNP at position C108F would play a significant role in causing disease by the XPA gene. Our approach would present the application of in silicotools in understanding the functional variation from the perspective of structure, evolution, and phenotype.

Genetic polymorphisms in the cytokine and chemokine system: their possible importance in allogeneic stem cell transplantation.

PubMed

Loeffler, Juergen; Ok, Michael; Morton, Oliver C; Mezger, Markus; Einsele, Hermann

2010-01-01

Chemokines represent central players of the innate and adaptive immunity and are involved in the regulation of inflammatory events occurring during infectious complications or during graft vs. host disease (GvHD). Patients after allogeneic stem cell transplantation (alloSCT) are at a high risk for the development of acute GvHD or to suffer from fungal infections. Susceptibility to fungal infections and the course of GvHD can be genetically influenced by single nucleotide polymorphisms (SNPs), which regulate expression or biological activity of chemokines, and therefore have an impact on the outcome of invasive aspergillosis and GvHD. High lightened studies of abetting factors for GvHD revealed SNPs in TNFA, IL-6, IL-10, INF-γ, CCL2, CCL5 (RANTES), IL-1Ra, IL-23R, IL-7Ralpha, IL-10RB, and CCR9 genes as prevalent considerable. Furthermore, additional SNPs were described to be significantly associated with fungal infections (Aspergillus fumigatus, Candida albicans), including markers in CCL3, CCL4, CCL20, CXCL2, CXCL8, CXCL10, CCR1, and CCR2. This review summarizes the current knowledge about the growing number of genetic markers in chemokine genes and their relevance for patients after alloSCT.

Polymorphisms in Protein Tyrosine Phosphatase Non-receptor Type 2 and 22 (PTPN2/22) Are Linked to Hyper-Proliferative T-Cells and Susceptibility to Mycobacteria in Rheumatoid Arthritis

PubMed Central

Sharp, Robert C.; Beg, Shazia A.; Naser, Saleh A.

2018-01-01

A shared genetic pre-disposition, chronic inflammation, and treatment with similar biologics between Rheumatoid arthritis (RA) and Crohn's disease (CD) have intrigued us to investigate whether the two disorders share trigger association or possible causation. We hypothesized earlier that Single Nucleotide Polymorphisms (SNPs) in the negative regulators Protein Tyrosine Phosphatase Non-receptor type 2 and 22 (PTPN2/22) lead to a dysregulated immune response, susceptibility to environmental triggers, and continued apoptosis as seen in chronic inflammation in RA and CD. To test the hypothesis, peripheral leukocytes samples from 132 consented subjects were genotyped for 9 SNPs in PTPN2/22 using TaqMan™ genotyping. The effect of the SNPs on PTPN2/22 and IFN-γ expression was determined using real time PCR. T-cell proliferation and response to phytohematoagglutonin (PHA) mitogen and mycobacterial antigens were determined by BrdU proliferation assay. Blood samples were also analyzed for the Mycobacterium avium subspecies paratuberculosis (MAP) IS900 gene by nPCR. Out of 9 SNPs examined, heterozygous (TC) or minor (CC) alleles of PTPN2:rs478582 occurred in 79% RA compared to 60% healthy controls (p-values ≤ 0.05; OR = 2.28). Similarly, heterozygous (GA) or minor (AA) alleles of PTPN22:rs2476601 occurred in 29% RA compared to 6% healthy controls (p-values ≤ 0.05; OR = 5.90). PTPN2/22 expression in RA was decreased by 1.2-fold compared to healthy controls. PTPN2:rs478582 upregulated IFN-γ in RA by 1.5-fold. Combined PTPN2:rs478582 and PTPN22:rs2476601 increased T-cell proliferation by 2.7-fold when treated with PHA. Surprisingly, MAP DNA was detected in 34% of RA samples compared to 8% healthy controls, (p-values ≤ 0.05, OR = 5.74). RA samples with PTPN2:rs478582 and/or PTPN22:rs2476601 were more positive for MAP than samples without polymorphisms. Combined occurrence of PTPN2:rs478582 and PTPN22:rs2476601 in association with the presence of MAP has significantly increased T-cell response and elevated IFN-γ expression in RA samples. The data suggest that genetic polymorphisms may play vital role in T-cell regulation, susceptibility to mycobacteria and ultimately response to treatment. This is the first study to report the detection of MAP DNA in the blood of RA patients; further studies are needed using larger number of samples. PMID:29423382

The effects of noncoding aquaporin-4 single-nucleotide polymorphisms on cognition and functional progression of Alzheimer's disease.

PubMed

Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J

2017-09-01

The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.

Identification of Novel Single Nucleotide Polymorphisms Associated with Acute Respiratory Distress Syndrome by Exome-Seq

PubMed Central

Shortt, Katherine; Chaudhary, Suman; Grigoryev, Dmitry; Heruth, Daniel P.; Venkitachalam, Lakshmi; Zhang, Li Q.; Ye, Shui Q.

2014-01-01

Acute respiratory distress syndrome (ARDS) is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP) which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719) in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T) occurs within a histone mark (intron 6) of the Arylsulfatase D gene. rs9605146 (G>A) causes a deleterious coding change (proline to leucine) in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A) is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted. PMID:25372662

Genetic variation in Pythium myriotylum based on SNP typing and development of a PCR-RFLP detection of isolates recovered from Pythium soft rot ginger.

PubMed

Le, D P; Smith, M K; Aitken, E A B

2017-10-01

Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

PubMed

Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

2015-05-01

Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

Significant SNPs have limited prediction ability for thyroid cancer

PubMed Central

Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun

2014-01-01

Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304

Physiological Study on Association between Nicotinamide N-Methyltransferase Gene Polymorphisms and Hyperlipidemia

PubMed Central

Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong

2016-01-01

Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813

Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs.

PubMed

Hui, Y T; Yang, Y Q; Liu, R Y; Zhang, Y Y; Xiang, C J; Liu, Z Z; Ding, Y H; Zhang, Y L; Wang, B R

2013-09-13

Apolipoprotein A5 (APOA5) and C3 (APOC3) genes are involved in the PPAR lipid metabolism pathway and thus associated with elevated triglyceride levels. However, whether APOA5 and APOC3 genetic polymorphisms affect intramuscular fat deposition and other meat quality traits remains unknown in pigs. One hundred and seventy-one Kele pigs were sampled to investigate genetic variants in the APOA5 and APOC3 genes and their association with seven pork quality traits. We identified 5 single nucleotide polymorphisms (SNPs) in the promoter region of the APOA5 gene and 17 SNPs in the APOC3 gene. Linkage disequilibrium analysis revealed 5 complete linkage disequilibria among these 22 SNPs. We found that 10 SNPs were significantly correlated with meat quality traits, including the mutation A5/-769 in the APOA5 gene, which was significantly associated with cooked weight percentage, and 9 SNPs in the APOC3 gene that were significantly associated with drip loss rate, meat color value of longissimus dorsi muscle and shear force. Therefore, these SNP markers will be useful for marker-assisted selection for improved pork quality.

Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

PubMed

Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

2006-08-01

Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

Comparative Bioavailability and Utilization of Particular Forms of B12 Supplements With Potential to Mitigate B12-related Genetic Polymorphisms

PubMed Central

Paul, Cristiana; Brady, David M.

2017-01-01

Context Three natural forms of vitamin B12 are commercially available: methylcobalamin (MeCbl), adenosylcobalamin (AdCbl), and hydroxycobalamin (OHCbl), all of which have been shown in clinical studies to improve vitamin B12 status. They are bioidentical to the B12 forms occurring in human physiology and animal foods. In contrast, cyanocobalamin (CNCbl), a synthetic B12 compound used for food fortification and in some supplements, occurs only in trace amounts in human tissues as a result of cyanide intake from smoking or other sources. Objective This study had 3 objectives: (1) To summarize and compare assimilation pathways for 4 B12 forms; (2) to determine whether supplementation with a particular B12 form (or combination of forms) presents any advantages for the general population or for individuals with single nucleotide polymorphisms (SNPs) in B12-related pathways; and (3) to address misconceptions regarding B12 forms, methylation pathways, and various SNPs reported in commercially available tests. Design PubMed was systematically searched for articles published up to June 2016 using specific key words. Human, animal, and in vitro studies that were published in English, French, and German were included. Other studies considered were found by selecting in PubMed the suggested “related studies” and also some referenced studies. Setting The study occurred in Los Angeles, CA, USA. Results The studies reviewed provide evidence that all supplemental or food-derived B12 forms are reduced to a core cobalamin molecule, which converts to the intracellular active forms: MeCbl and AdCbl, in a ratio not influenced by the form of B12 ingested. The methyl and adenosyl components of supplemental MeCbl and AdCbl are cleaved inside cells and are not used in the synthesis of intracellular MeCbl and AdCbl, respectively. However, the overall bioavailability of each form of supplemental B12 may be influenced by many factors such as gastrointestinal pathologies, age, and genetics. Polymorphisms on B12-related pathways may affect the efficiency of absorption, blood transport, cellular uptake, and intracellular transformations. Conclusions Supplementing with any of the nature bioidentical forms of B12 (MeCbl, OHCbl, and/or AdCbl) is preferred instead of the use of CNCbl, owing to their superior bioavailability and safety. For the majority of the population, all B12 forms may likely have similar bioavailabilities and physiological effects; thus, it makes sense to employ the least-expensive form of B12, such as MeCbl. Individuals with particular single nucleotide polymorphisms (SNPs) affecting B12 assimilation may raise their B12 status more efficiently with 1 or more particular forms of vitamin B12. However, because those types of SNPs are not currently reported in commercial tests, individuals may require either a trial-and-error approach by supplementing with 1 particular form of B12 at a time, or they might simply use a supplement with a combination of all 3 naturally occurring forms of B12 that are commercially available for a better chance of achieving faster clinical results. That approach may or may not offset genetic polymorphisms involving B12 metabolism and related pathways. PMID:28223907

Interleukin-2 and Interleukin-8 Gene Polymorphisms and Acquired Aplastic Anemia Risk in a Chinese Population.

PubMed

Zhang, Xuejie; Lin, Shengyun; Yang, Yan; Rong, Liucheng; He, Guangsheng; He, Hailong; Xue, Yao; Fang, Yongjun; Wang, Yaping

2017-01-01

Cytokines IL-2 and IL-8 both participate in immune regulation. However, the relationship between polymorphisms in these two cytokines and the risk of acquired aplastic anemia (acquired AA) has not been explored. We selected five SNPs including rs11575812, rs2069772 and rs2069762 of IL-2, rs2227306 and rs2227543 of IL-8. SNaPshot genotyping was used to test the genotypes of IL-2 and IL-8 polymorphisms in a population of 101 acquired AA patients and 165 healthy controls. The rs2069762 G allele appeared to be a protective mutation, but no significant differences were found in other four SNPs. We also found that rs2069762 had an impact on the transcriptional regulation. It could be assumed that the rs2069762 polymorphism might reduce the risk of acquired aplastic anemia, while the remaining four SNPs might not contribute to susceptibility to acquired AA in a Chinese population. © 2017 The Author(s)Published by S. Karger AG, Basel.

Catalog of MicroRNA Seed Polymorphisms in Vertebrates

PubMed Central

Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

2012-01-01

MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

In Vitro vs In Silico Detected SNPs for the Development of a Genotyping Array: What Can We Learn from a Non-Model Species?

PubMed Central

Lepoittevin, Camille; Frigerio, Jean-Marc; Garnier-Géré, Pauline; Salin, Franck; Cervera, María-Teresa; Vornam, Barbara; Harvengt, Luc; Plomion, Christophe

2010-01-01

Background There is considerable interest in the high-throughput discovery and genotyping of single nucleotide polymorphisms (SNPs) to accelerate genetic mapping and enable association studies. This study provides an assessment of EST-derived and resequencing-derived SNP quality in maritime pine (Pinus pinaster Ait.), a conifer characterized by a huge genome size (∼23.8 Gb/C). Methodology/Principal Findings A 384-SNPs GoldenGate genotyping array was built from i/ 184 SNPs originally detected in a set of 40 re-sequenced candidate genes (in vitro SNPs), chosen on the basis of functionality scores, presence of neighboring polymorphisms, minor allele frequencies and linkage disequilibrium and ii/ 200 SNPs screened from ESTs (in silico SNPs) selected based on the number of ESTs used for SNP detection, the SNP minor allele frequency and the quality of SNP flanking sequences. The global success rate of the assay was 66.9%, and a conversion rate (considering only polymorphic SNPs) of 51% was achieved. In vitro SNPs showed significantly higher genotyping-success and conversion rates than in silico SNPs (+11.5% and +18.5%, respectively). The reproducibility was 100%, and the genotyping error rate very low (0.54%, dropping down to 0.06% when removing four SNPs showing elevated error rates). Conclusions/Significance This study demonstrates that ESTs provide a resource for SNP identification in non-model species, which do not require any additional bench work and little bio-informatics analysis. However, the time and cost benefits of in silico SNPs are counterbalanced by a lower conversion rate than in vitro SNPs. This drawback is acceptable for population-based experiments, but could be dramatic in experiments involving samples from narrow genetic backgrounds. In addition, we showed that both the visual inspection of genotyping clusters and the estimation of a per SNP error rate should help identify markers that are not suitable to the GoldenGate technology in species characterized by a large and complex genome. PMID:20543950

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

PubMed

Pang, Erli; Wu, Xiaomei; Lin, Kui

2016-06-01

Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

Association of "ADAM10" and "CAMK2A" Polymorphisms with Conduct Disorder: Evidence from Family-Based Studies

ERIC Educational Resources Information Center

Jian, Xue-Qiu; Wang, Ke-Sheng; Wu, Tie-Jian; Hillhouse, Joel J.; Mullersman, Jerald E.

2011-01-01

Twin and family studies have shown that genetic factors play a role in the development of conduct disorder (CD). The purpose of this study was to identify genetic variants associated with CD using a family-based association study. We used 4,720 single nucleotide polymorphisms (SNPs) from the Illumina Panel and 11,120 SNPs from the Affymetrix 10K…

Association of Adenylate Cyclase 10 (ADCY10) Polymorphisms and Bone Mineral Density in Healthy Adults

PubMed Central

Ichikawa, Shoji; Koller, Daniel L.; Curry, Leah R.; Lai, Dongbing; Xuei, Xiaoling; Edenberg, Howard J.; Hui, Siu L.; Peacock, Munro; Foroud, Tatiana; Econs, Michael J.

2010-01-01

Phenotypic variation in bone mineral density (BMD) among healthy adults is influenced by both genetic and environmental factors. Genetic sequence variations in the adenylate cyclase 10 (ADCY10) gene, which is also called soluble adenylate cyclase, have previously been reported to be associated with low spinal BMD in hypercalciuric patients. Since ADCY10 is located in the region linked to spinal BMD in our previous linkage analysis, we tested whether polymorphisms in this gene are also associated with normal BMD variation in healthy adults. Sixteen single nucleotide polymorphisms (SNPs) distributed throughout ADCY10 were genotyped in two healthy groups of American whites: 1,692 premenopausal women and 715 men. Statistical analyses were performed in the two groups to test for association between these SNPs and femoral neck and lumbar spine areal BMD. We observed significant evidence of association (p<0.01) with one SNP each in men and women. Genotypes at these SNPs accounted for less than 1% of hip BMD variation in men, but 1.5% of spinal BMD in women. However, adjacent SNPs did not corroborate the association in either males or females. In conclusion, we found a modest association between an ADCY10 polymorphism and spinal areal BMD in premenopausal white women. PMID:19093065

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

PubMed Central

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E.; Al Masaud, Abdulaziz; Shire, Abdirashid M.; Das, Nagalla; Gumaa, Khalid

2017-01-01

Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of ‘which SNPs in which populations.’ The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Methods Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. Results None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Conclusion Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. PMID:28956366

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population.

PubMed

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E; Al Masaud, Abdulaziz; Shire, Abdirashid M; Das, Nagalla; Gumaa, Khalid; Giha, Hayder A

2017-09-01

Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of 'which SNPs in which populations.' The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. Copyright © 2017 Korean Endocrine Society

The Population Genomics of Repeated Evolution in the Blind Cavefish Astyanax mexicanus

PubMed Central

Bradic, Martina; Teotónio, Henrique; Borowsky, Richard L.

2013-01-01

Distinct populations of Astyanax mexicanus cavefish offer striking examples of repeatable convergence or parallelism in their independent evolutions from surface to cave phenotypes. However, the extent to which the repeatability of evolution occurred at the genetic level remains poorly understood. To address this, we first characterized the genetic diversity of 518 single-nucleotide polymorphisms (SNPs), obtained through RAD tag sequencing and distributed throughout the genome, in seven cave and three groups of surface populations. The cave populations represented two distinct lineages (old and new). Thirty-one SNPs were significantly differentiated between surface and old cave populations, two SNPs were differentiated between surface and new cave populations, and 44 SNPs were significantly differentiated in both old and new cave populations. In addition, we determined whether these SNPs map to the same locations of previously described quantitative trait loci (QTL) between surface and cave populations. A total of 25 differentiated SNPs co-map with several QTL, such as one containing a fibroblast growth factor gene (Fgf8) involved in eye development and lens size. Further, the identity of many SNPs that co-mapped with QTL was the same in independently derived cave populations. These conclusions were further confirmed by haplotype analyses of SNPs within QTL regions. Our findings indicate that the repeatability of evolution at the genetic level is substantial, suggesting that ancestral standing genetic variation significantly contributed to the population genetic variability used in adaptation to the cave environment. PMID:23927992

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

PubMed Central

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766

LAMB1 polymorphism is associated with autism symptom severity in Korean autism spectrum disorder patients.

PubMed

Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Park, Hae Jeong; Nam, Min; Kim, Jong Woo

2015-01-01

LAMB1 encodes laminin beta-1, which is expressed during early development of the human nervous system, and could be involved in the pathogenesis of neurodevelopmental disorders. In our study, we aimed to investigate whether single nucleotide polymorphisms (SNPs) in LAMB1 were associated with autism spectrum disorder (ASD) and with related clinical severities of ASD. Two coding SNPs (rs20556 and rs25659) and two intronic SNPs (rs2158836 and rs2237659) were compared between 180 patients with ASD and 147 healthy control subjects using direct sequencing. The Korean version of the Childhood Autism Rating Scale (K-CARS) was used to assess clinical severities. Multiple logistic regression models were employed to analyze genetic data, and associations with symptom severity were tested with the Kruskal-Wallis and the Mann-Whitney U tests. None of the four examined SNPs was associated with ASD risk. However, the GG genotype of rs2158836 was associated with more severe symptoms for the "object use" and "non-verbal communication" measures. The results of our study suggest the association between rs2158836 polymorphisms and symptom severity in ASD.

Genetic association between ghrelin polymorphisms and Alzheimer's disease in a Japanese population.

PubMed

Shibata, Nobuto; Ohnuma, Tohru; Kuerban, Bolati; Komatsu, Miwa; Arai, Heii

2011-01-01

Ghrelin has been reported to enter the hippocampus and to bind to the neurons of the hippocampal formation. This peptide also affects neuronal glucose uptake and decreases tau hyperphosphorylation. There is increasing evidence suggesting an association between ghrelin and Alzheimer's disease (AD) pathology. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) of the ghrelin gene are associated with AD. The SNPs were genotyped using TaqMan technology and were analyzed using a case-control study design. Our case-control dataset consisted of 182 AD patients and 143 age-matched controls. Hardy-Weinberg equilibrium and linkage disequilibrium analyses suggest that the region in and around the gene is highly polymorphic. One SNP, rs4684677 (Leu90Gln), showed a marginal association with age of AD onset. We did not detect any association between the other SNPs of the ghrelin gene and AD. There have been few genetic studies on the relationship between circulating ghrelin and functional SNPs. Further multifactorial studies are needed to clarify the relationship between ghrelin and AD. Copyright © 2011 S. Karger AG, Basel.

Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

PubMed

He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

2017-04-25

Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

Common Polymorphisms in the PKP3-SIGIRR-TMEM16J Gene Region Are Associated With Susceptibility to Tuberculosis

PubMed Central

Randhawa, April K.; Chau, Tran T. H.; Bang, Nguyen D.; Yen, Nguyen T. B.; Farrar, Jeremy J.; Dunstan, Sarah J.; Hawn, Thomas R.

2012-01-01

(See the editorial commentary by Wilkinson, on pages 525–7.) Background. Tuberculosis has been associated with genetic variation in host immunity. We hypothesized that single-nucleotide polymorphisms (SNPs) in SIGIRR, a negative regulator of Toll-like receptor/IL-1R signaling, are associated with susceptibility to tuberculosis. Methods. We used a case-population study design in Vietnam with cases that had either tuberculous meningitis or pulmonary tuberculosis. We genotyped 6 SNPs in the SIGIRR gene region (including the adjacent genes PKP3 and TMEM16J) in a discovery cohort of 352 patients with tuberculosis and 382 controls. Significant associations were genotyped in a validation cohort (339 patients with tuberculosis, 376 controls). Results. Three SNPs (rs10902158, rs7105848, rs7111432) were associated with tuberculosis in discovery and validation cohorts. The polymorphisms were associated with both tuberculous meningitis and pulmonary tuberculosis and were strongest with a recessive genetic model (odds ratios, 1.5–1.6; P = .0006–.001). Coinheritance of these polymorphisms with previously identified risk alleles in Toll-like receptor 2 and TIRAP was associated with an additive risk of tuberculosis susceptibility. Conclusions. These results demonstrate a strong association of SNPs in the PKP3-SIGIRR-TMEM16J gene region and tuberculosis in discovery and validation cohorts. To our knowledge, these are the first associations of polymorphisms in this region with any disease. PMID:22223854

Impact of SNPs on Protein Phosphorylation Status in Rice (Oryza sativa L.).

PubMed

Lin, Shoukai; Chen, Lijuan; Tao, Huan; Huang, Jian; Xu, Chaoqun; Li, Lin; Ma, Shiwei; Tian, Tian; Liu, Wei; Xue, Lichun; Ai, Yufang; He, Huaqin

2016-11-11

Single nucleotide polymorphisms (SNPs) are widely used in functional genomics and genetics research work. The high-quality sequence of rice genome has provided a genome-wide SNP and proteome resource. However, the impact of SNPs on protein phosphorylation status in rice is not fully understood. In this paper, we firstly updated rice SNP resource based on the new rice genome Ver. 7.0, then systematically analyzed the potential impact of Non-synonymous SNPs (nsSNPs) on the protein phosphorylation status. There were 3,897,312 SNPs in Ver. 7.0 rice genome, among which 9.9% was nsSNPs. Whilst, a total 2,508,261 phosphorylated sites were predicted in rice proteome. Interestingly, we observed that 150,197 (39.1%) nsSNPs could influence protein phosphorylation status, among which 52.2% might induce changes of protein kinase (PK) types for adjacent phosphorylation sites. We constructed a database, SNP_rice, to deposit the updated rice SNP resource and phosSNPs information. It was freely available to academic researchers at http://bioinformatics.fafu.edu.cn. As a case study, we detected five nsSNPs that potentially influenced heterotrimeric G proteins phosphorylation status in rice, indicating that genetic polymorphisms showed impact on the signal transduction by influencing the phosphorylation status of heterotrimeric G proteins. The results in this work could be a useful resource for future experimental identification and provide interesting information for better rice breeding.

Mitochondrial pathogenic mutations are population-specific.

PubMed

Breen, Michael S; Kondrashov, Fyodor A

2010-12-31

Surveying deleterious variation in human populations is crucial for our understanding, diagnosis and potential treatment of human genetic pathologies. A number of recent genome-wide analyses focused on the prevalence of segregating deleterious alleles in the nuclear genome. However, such studies have not been conducted for the mitochondrial genome. We present a systematic survey of polymorphisms in the human mitochondrial genome, including those predicted to be deleterious and those that correspond to known pathogenic mutations. Analyzing 4458 completely sequenced mitochondrial genomes we characterize the genetic diversity of different types of single nucleotide polymorphisms (SNPs) in African (L haplotypes) and non-African (M and N haplotypes) populations. We find that the overall level of polymorphism is higher in the mitochondrial compared to the nuclear genome, although the mitochondrial genome appears to be under stronger selection as indicated by proportionally fewer nonsynonymous than synonymous substitutions. The African mitochondrial genomes show higher heterozygosity, a greater number of polymorphic sites and higher frequencies of polymorphisms for synonymous, benign and damaging polymorphism than non-African genomes. However, African genomes carry significantly fewer SNPs that have been previously characterized as pathogenic compared to non-African genomes. Finding SNPs classified as pathogenic to be the only category of polymorphisms that are more abundant in non-African genomes is best explained by a systematic ascertainment bias that favours the discovery of pathogenic polymorphisms segregating in non-African populations. This further suggests that, contrary to the common disease-common variant hypothesis, pathogenic mutations are largely population-specific and different SNPs may be associated with the same disease in different populations. Therefore, to obtain a comprehensive picture of the deleterious variability in the human population, as well as to improve the diagnostics of individuals carrying African mitochondrial haplotypes, it is necessary to survey different populations independently. This article was reviewed by Dr Mikhail Gelfand, Dr Vasily Ramensky (nominated by Dr Eugene Koonin) and Dr David Rand (nominated by Dr Laurence Hurst).

Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

PubMed

Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

2013-12-01

The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

PubMed

Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

2010-01-01

Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

Genetic contributions to the association between adult height and testicular germ cell tumors.

PubMed

Cook, Michael B; Chia, Victoria M; Berndt, Sonja I; Graubard, Barry I; Chanock, Stephen J; Rubertone, Mark V; Erickson, Ralph L; Hayes, Richard B; McGlynn, Katherine A

2011-06-01

Previously, we have shown that increasing adult height is associated with increased risk of testicular germ-cell tumor (TGCT). Recently, a number of single nucleotide polymorphisms (SNPs) have been found to be related to height. We examined whether these SNPs were associated with TGCT and whether they explained the relationship between height and TGCT. We genotyped 15 height-related SNPs in the US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) case-control study. DNA was extracted from buccal cell samples and Taqman assays were used to type the selected SNPs. We used logistic regression models to estimate odds ratios (ORs) and 95% confidence intervals (95%CIs). There were 561 cases and 676 controls for analysis. Two SNPs were found to be associated with risk of TGCT, rs6060373 (CC vs TT, OR = 1.51, 95% CI: 1.06-2.15) and rs143384 (CC vs TT, OR = 1.53, 95% CI: 1.09-2.15). rs6060373 is an intronic polymorphism of ubiquinol-cytochrome c reductase complex chaperone (UQCC), and rs143384 is a 5'UTR polymorphism of growth differentiation factor 5 (GDF5). No individual SNP attenuated the association between height and TGCT. Adjustment for all SNPs previously associated with adult height reduced the associations between adult height and TGCT by ~8.5%, although the P-value indicated only weak evidence that this difference was important (P = 0.26). This novel analysis provides tentative evidence that SNPs which are associated with adult height may also share an association with risk of TGCT.

Genome-wide DNA polymorphisms in Kavuni, a traditional rice cultivar with nutritional and therapeutic properties.

PubMed

Rathinasabapathi, Pasupathi; Purushothaman, Natarajan; Parani, Madasamy

2016-05-01

Although rice genome was sequenced in the year 2002, efforts in resequencing the large number of available accessions, landraces, traditional cultivars, and improved varieties of this important food crop are limited. We have initiated resequencing of the traditional cultivars from India. Kavuni is an important traditional rice cultivar from South India that attracts premium price for its nutritional and therapeutic properties. Whole-genome sequencing of Kavuni using Illumina platform and SNPs analysis using Nipponbare reference genome identified 1 150 711 SNPs of which 377 381 SNPs were located in the genic regions. Non-synonymous SNPs (62 708) were distributed in 19 251 genes, and their number varied between 1 and 115 per gene. Large-effect DNA polymorphisms (7769) were present in 3475 genes. Pathway mapping of these polymorphisms revealed the involvement of genes related to carbohydrate metabolism, translation, protein-folding, and cell death. Analysis of the starch biosynthesis related genes revealed that the granule-bound starch synthase I gene had T/G SNPs at the first intron/exon junction and a two-nucleotide combination, which were reported to favour high amylose content and low glycemic index. The present study provided a valuable genomics resource to study the rice varieties with nutritional and medicinal properties.

Possible association of VISA gene polymorphisms with susceptibility to systemic lupus erythematosus in Chinese population.

PubMed

Liu, Xiaowen; Jiao, Yulian; Wen, Xin; Wang, Laicheng; Ma, Chunyan; Gao, Xuejun; Chen, Zi-Jiang; Zhao, Yueran

2011-10-01

Virus-induced signaling adapter (VISA), an important adaptor protein linking both RIG-I and MDA-5 to downstream signaling events, may mediates the activation of NF kappaB and IRFs and the induction of type I IFN. As the evidence has showed that Toll-like receptors (TLRs), I-IFN and IFN-inducible genes contribute to the pathogenesis of systemic lupus erythematosus (SLE), the aim of the current study was to investigate the possible associations between the VISA gene and SLE. Four single nucleotide polymorphisms (SNPs), rs17857295, rs2326369, rs7262903, and rs7269320, in VISA gene were genotyped in 123 SLE patients and 95 healthy controls. Genotyping was performed using direct sequencing the purified PCR products. Associations were analyzed by using the chi-square test and Fisher's exact test. Haplotype analysis was performed using haploview and PHASE2.1. None of the four SNPs was found to be associated with SLE. The four-SNPs haplotype analysis showed different effect between cases and controls. While the SNPs, rs17857295 and rs2326369, were found to be associated with the renal nephritis and arthritis of SLE patient, respectively. The SNPs rs7269320 showed associations with different manifestations. Our data reveal that polymorphisms in the VISA gene may be related to disease susceptibility and manifestations of SLE.

Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content.

PubMed

Goszczynski, Daniel E; Papaleo-Mazzucco, Juliana; Ripoli, María V; Villarreal, Edgardo L; Rogberg-Muñoz, Andrés; Mezzadra, Carlos A; Melucci, Lilia M; Giovambattista, Guillermo

2017-07-03

FABP4 is a protein primarily expressed in adipocytes and macrophages that plays a key role in fatty acid trafficking and lipid hydrolysis. FABP4 gene polymorphisms have been associated with meat quality traits in cattle, mostly in Asian breeds under feedlot conditions. The objectives of this work were to characterize FABP4 genetic variation in several worldwide cattle breeds and evaluate possible genotype effects on fat content in a pasture-fed crossbred (Angus-Hereford-Limousin) population. We re-sequenced 43 unrelated animals from nine cattle breeds (Angus, Brahman, Creole, Hereford, Holstein, Limousin, Nelore, Shorthorn, and Wagyu) and obtained 22 single nucleotide polymorphisms (SNPs) over 3,164 bp, including four novel polymorphisms. Haplotypes and linkage disequilibrium analyses showed a high variability. Five SNPs were selected to perform validation and association studies in our crossbred population. Four SNPs showed well-balanced allele frequencies (minor frequency > 0.159), and three showed no significant deviations from Hardy-Weinberg proportions. SNPs showed significant effects on backfat thickness and fatty acid composition (P < 0.05). The protein structure of one of the missense SNPs was analyzed to elucidate its possible effect on fat content in our studied population. Our results revealed a possible blockage of the fatty acid binding site by the missense mutation.

Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

PubMed Central

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-01-01

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs.

PubMed

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-12-23

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease.

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

PubMed Central

2011-01-01

Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

Exploration of structural stability in deleterious nsSNPs of the XPA gene: A molecular dynamics approach

PubMed Central

NagaSundaram, N; Priya Doss, C George

2011-01-01

Background: Distinguishing the deleterious from the massive number of non-functional nsSNPs that occur within a single genome is a considerable challenge in mutation research. In this approach, we have used the existing in silico methods to explore the mutation-structure-function relationship in the XPAgene. Materials and Methods: We used the Sorting Intolerant From Tolerant (SIFT), Polymorphism Phenotyping (PolyPhen), I-Mutant 2.0, and the Protein Analysis THrough Evolutionary Relationships methods to predict the effects of deleterious nsSNPs on protein function and evaluated the impact of mutation on protein stability by Molecular Dynamics simulations. Results: By comparing the scores of all the four in silico methods, nsSNP with an ID rs104894131 at position C108F was predicted to be highly deleterious. We extended our Molecular dynamics approach to gain insight into the impact of this non-synonymous polymorphism on structural changes that may affect the activity of the XPAgene. Conclusion: Based on the in silico methods score, potential energy, root-mean-square deviation, and root-mean-square fluctuation, we predict that deleterious nsSNP at position C108F would play a significant role in causing disease by the XPA gene. Our approach would present the application of in silicotools in understanding the functional variation from the perspective of structure, evolution, and phenotype. PMID:22190868

Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

PubMed

Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

2007-08-01

Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

USDA-ARS?s Scientific Manuscript database

This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

Genetic diversity of tyrosine hydroxylase (TH) and dopamine β-hydroxylase (DBH) genes in cattle breeds

PubMed Central

Lourenco-Jaramillo, Diana Lelidett; Sifuentes-Rincón, Ana María; Parra-Bracamonte, Gaspar Manuel; de la Rosa-Reyna, Xochitl Fabiola; Segura-Cabrera, Aldo; Arellano-Vera, Williams

2012-01-01

DNA from four cattle breeds was used to re-sequence all of the exons and 56% of the introns of the bovine tyrosine hydroxylase (TH) gene and 97% and 13% of the bovine dopamine β-hydroxylase (DBH) coding and non-coding sequences, respectively. Two novel single nucleotide polymorphisms (SNPs) and a microsatellite motif were found in the TH sequences. The DBH sequences contained 62 nucleotide changes, including eight non-synonymous SNPs (nsSNPs) that are of particular interest because they may alter protein function and therefore affect the phenotype. These DBH nsSNPs resulted in amino acid substitutions that were predicted to destabilize the protein structure. Six SNPs (one from TH and five from DBH non-synonymous SNPs) were genotyped in 140 animals; all of them were polymorphic and had a minor allele frequency of > 9%. There were significant differences in the intra- and inter-population haplotype distributions. The haplotype differences between Brahman cattle and the three B. t. taurus breeds (Charolais, Holstein and Lidia) were interesting from a behavioural point of view because of the differences in temperament between these breeds. PMID:22888292

Association of polymorphism in adiponectin (+45 T/G) and leptin (–2548 G/A) genes with type 2 diabetes mellitus in male Egyptians

PubMed Central

Motawi, Tarek; Salman, Tarek; Shaker, Olfat

2015-01-01

Introduction Adiponectin is an adipose tissue-specific protein with insulin-sensitizing properties. Many investigators have explored the association between adiponectin single nucleotide polymorphisms (SNPs) and type 2 diabetes mellitus (T2DM) in different ethnic populations from different regions. Leptin is a protein hormone constituting an important signal in the regulation of adipose tissue mass and body weight. The aim of this study was to explore potential associations between SNP +45 T>G of the adiponectin gene and SNP 2548G/A of leptin with T2DM and the effect of SNPs on serum adiponectin and leptin levels. Material and methods From the Egyptian population, we enrolled 110 T2DM patients and 90 non-diabetic controls. Serum lipid profile, blood glucose, serum adiponectin, and leptin were measured. Genotyping for two common SNPs of the adiponectin and leptin genes was performed by polymerase chain reaction–restriction fragment length polymorphism. Results The G allele and TG/GG genotype of SNP 45 occurred more frequently than the T allele and TT genotype in T2DM patients compares to the controls. Subjects with the GG + TG genotype of SNP 45 were at increased risk for T2DM (OR = 6.476; 95% CI: 3.401–12.33) and associated with a low serum adiponectin level compared with the TT genotype. The serum leptin concentration of GA + AA genotype carriers was not significantly different from that of the GG genotype in the diabetic group. Conclusions The G allele carriers who have reduced plasma concentrations of adiponectin may have an association with T2DM, while leptin SNP 2548 G/A is not associated with the risk of development of T2DM in the Egyptian population. PMID:26528333

Dextromethorphan and debrisoquine metabolism and polymorphism of the gene for cytochrome P450 isozyme 2D50 in Thoroughbreds.

PubMed

Corado, Carley R; McKemie, Daniel S; Knych, Heather K

2016-09-01

OBJECTIVE To characterize polymorphisms of the gene for cytochrome P450 isozyme 2D50 (CYP2D50) and the disposition of 2 CYP2D50 probe drugs, dextromethorphan and debrisoquine, in horses. ANIMALS 23 healthy horses (22 Thoroughbreds and 1 Standardbred). PROCEDURES Single-nucleotide polymorphisms (SNPs) in CYP2D50 were identified. Disposition of dextromethorphan (2 mg/kg) and debrisoquine (0.2 mg/kg) were determined after oral (dextromethorphan) or nasogastric (debrisoquine) administration to the horses. Metabolic ratios of plasma dextromethorphan and total dextrorphan (dextrorphan plus dextrorphan-O-β-glucuronide) and 4-hydroxydebrisoquine concentrations were calculated on the basis of the area under the plasma concentration-versus-time curve extrapolated to infinity for the parent drug divided by that for the corresponding metabolite. Pharmacokinetic data were used to categorize horses into the phenotypic drug-metabolism categories poor, extensive, and ultrarapid. Disposition patterns were compared among categories, and relationships between SNPs and metabolism categories were explored. RESULTS Gene sequencing identified 51 SNPs, including 27 nonsynonymous SNPs. Debrisoquine was minimally detected after oral administration. Disposition of dextromethorphan varied markedly among horses. Metabolic ratios for dextromethorphan ranged from 0.03 to 0.46 (mean, 0.12). On the basis of these data, 1 horse was characterized as a poor metabolizer, 18 were characterized as extensive metabolizers, and 3 were characterized as ultrarapid metabolizers. CONCLUSIONS AND CLINICAL RELEVANCE Findings suggested that CYP2D50 is polymorphic and that the disposition of the probe drug varies markedly in horses. The polymorphisms may be related to rates of drug metabolism. Additional research involving more horses of various breeds is needed to fully explore the functional implication of polymorphisms in CYP2D50.

No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.

PubMed

Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

2008-10-01

A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.

CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.

PubMed

Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C

2005-04-15

Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.

Developing a new nonbinary SNP fluorescent multiplex detection system for forensic application in China.

PubMed

Liu, Yanfang; Liao, Huidan; Liu, Ying; Guo, Juanjuan; Sun, Yi; Fu, Xiaoliang; Xiao, Ding; Cai, Jifeng; Lan, Lingmei; Xie, Pingli; Zha, Lagabaiyila

2017-04-01

Nonbinary single-nucleotide polymorphisms (SNPs) are potential forensic genetic markers because their discrimination power is greater than that of normal binary SNPs, and that they can detect highly degraded samples. We previously developed a nonbinary SNP multiplex typing assay. In this study, we selected additional 20 nonbinary SNPs from the NCBI SNP database and verified them through pyrosequencing. These 20 nonbinary SNPs were analyzed using the fluorescent-labeled SNaPshot multiplex SNP typing method. The allele frequencies and genetic parameters of these 20 nonbinary SNPs were determined among 314 unrelated individuals from Han populations from China. The total power of discrimination was 0.9999999999994, and the cumulative probability of exclusion was 0.9986. Moreover, the result of the combination of this 20 nonbinary SNP assay with the 20 nonbinary SNP assay we previously developed demonstrated that the cumulative probability of exclusion of the 40 nonbinary SNPs was 0.999991 and that no significant linkage disequilibrium was observed in all 40 nonbinary SNPs. Thus, we concluded that this new system consisting of new 20 nonbinary SNPs could provide highly informative polymorphic data which would be further used in forensic application and would serve as a potentially valuable supplement to forensic DNA analysis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

NASA Astrophysics Data System (ADS)

Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

2008-11-01

Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

2011-07-15

Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern Chinese population.« less

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

PubMed Central

Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

2007-01-01

Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

PXR polymorphisms and their impact on pharmacokinetics/pharmacodynamics of repaglinide in healthy Chinese volunteers.

PubMed

Du, Qing-qing; Wang, Zhi-jun; He, Lin; Jiang, Xue-hua; Wang, Ling

2013-11-01

CYP3A4 is the main isoform of cytochrome P450 oxidases involved in the metabolism of approximately 60 % drugs, and its expression level is highly variable in human subjects. CYP3A4 is regulated by many transcription factors, among which the pregnane X receptor/steroid and xenobiotic receptor (PXR/SXR, NR1I2) have been identified as the most critical. Genetic polymorphisms (such as SNPs) in PXR may affect the expression level of CYP3A4. Although numerous SNPs have been identified in PXR and have appeared to affect PXR function, their impact on the expression of CYP3A4 in human subjects has not been well studied. Thus, a clinical study in healthy Chinese subjects was conducted to investigate the impact of PXR polymorphisms on repaglinide (an endogenous marker for CYP3A4 activity) pharmacokinetics used alone or in combination with a PXR inducer, flucloxacillin. Two SNPs, -298A>G and 11193T>C, were identified as the tag SNPs to represent the overall genetic polymorphic profile of PXR. To evaluate the potential functional change of these two SNPs, 24 healthy subjects were recruited in a pharmacokinetics/pharmacodynamics study of repaglinide with or without flucloxacillin. The pharmacokinetic parameters including AUC and T1/2 were significantly different among the PXR genotype groups. The SNPs of -298G/G and 11193C/C were found to be associated with a lower PXR activity resulting in reduction of CYP3A4 activity in vivo. After administration of flucloxacillin, a significant drug-drug interaction was observed. The clearance of repagnilide was significantly increased by concomitant flucloxacillin in a genotype dependent manner. The subjects with SNPs of -298G/G and 11193C/C appeared to be less sensitive to flucloxacillin. Our study results demonstrated for the first time the impact of genetic polymorphisms of PXR on the PK and PD of repaglinide, and showed that subjects with genotype of -298G/G and 11193C/C in PXR has a decreased elimination rate of 3A4/2C8. Furthermore, flucloxacillin was able to induce 3A4/2C8 expression mediated by PXR in a genotype dependent manner.

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

PubMed

Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

2017-01-01

Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

Investigating the CFH Gene Polymorphisms as a Risk Factor for Age-related Macular Degeneration in an Iranian Population.

PubMed

Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein

2016-06-01

Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.

Genetic findings and functional studies of human CYP3A5 single nucleotide polymorphisms in different ethnic groups.

PubMed

Lee, Su-Jun; Usmani, Khawja A; Chanas, Brian; Ghanayem, Burhan; Xi, Tina; Hodgson, Ernest; Mohrenweiser, Harvey W; Goldstein, Joyce A

2003-08-01

Genetic polymorphisms of cytochromes P450 (CYPs) are a principal reason for inter-individual variations in the metabolism of therapeutic drugs and environmental chemicals in humans. The present study identifies 34 single nucleotide polymorphisms (SNPs) of CYP3A5 including 27 previously unidentified SNPs by direct sequencing of the exons, intron-exon junctions and 5'-upstream region of CYP3A5 from 92 racially diverse individuals (24 Caucasians, 24 Africans, 24 Asians, and 20 individuals of unknown racial origin). Four new CYP3A5 SNPs produced coding changes: R28C, L82R, A337T, and F446S. CYP3A5 R28C occurred in African populations (allelic frequency of 4%). CYP3A5 A337T occurred in Asians (2% allelic frequency), CYP3A5 L82R (occurred in the racially unidentified group) and CYP3A5 F446S (identified in Caucasians with a 2% allelic frequency) were on an allele containing the splice change g.6986A>G known as CYP3A5*3. The newly identified allelic proteins were constructed by site-directed mutagenesis, expressed in Escherichia coli and purified. CYP3A5 L82R was expressed only as denatured CYP420, suggesting it may be unstable. CYP3A5*1 exhibited the highest maximal clearance for testosterone followed by CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5*1 exhibited a higher V(max) for nifedipine oxidation than CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5 A337T and CYP3A5 R28C exhibited a 42-64% lower V(max) for nifedipine oxidation than CYP3A5*1. CYP3A5 F446S exhibited a > 95% decrease in the intrinsic clearance for both 6beta-hydroxytestosterone and nifedipine oxidation. This study identifies four new potentially defective coding alleles. CYP3A5 F446S is predicted to be more catalytically defective than the splice change alone.

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

PubMed

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

PubMed Central

Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

Lack of association between autonomously functioning thyroid nodules and germline polymorphisms of the thyrotropin receptor and Gαs genes in a mild to moderate iodine-deficient Caucasian population.

PubMed

Vicchio, Teresa Manuela; Giovinazzo, Salvatore; Certo, Rosaria; Cucinotta, Mariapaola; Micali, Carmelo; Baldari, Sergio; Benvenga, Salvatore; Trimarchi, Francesco; Campennì, Alfredo; Ruggeri, Rosaria Maddalena

2014-07-01

Mutations of the thyrotropin receptor (TSHR) and/or Gαs gene have been found in a number of, but not all, autonomously functioning thyroid nodules (AFTNs). Recently, in a 15-year-old girl with a hyperfunctioning papillary thyroid carcinoma, we found two somatic and germline single nucleotide polymorphisms (SNPs): a SNP of the TSHR gene (exon 7, codon 187) and a SNP of Gαs gene (exon 8, codon 185). The same silent SNP of the TSHR gene had been reported in patients with AFTN or familial non-autoimmune hyperthyroidism. No further data about the prevalence of the two SNPs in AFTNs as well as in the general population are available in the literature. To clarify the possible role of these SNPs in predisposing to AFTN. Germline DNA was extracted from blood leukocytes of 115 patients with AFTNs (43 males and 72 females, aged 31-85 years, mean ± SD = 64 ± 13) and 100 sex-matched healthy individuals from the same geographic area, which is marginally iodine deficient. The genotype distribution of the two SNPs was investigated by restriction fragment length polymorphism-polymerase chain reaction. The prevalence of the two SNPs in our study population was low and not different to that found in healthy individuals: 8 % of patients vs. 9 % of controls were heterozygous for the TSHR SNP and 4 % patients vs. 6 % controls were heterozygous for the Gαs SNP. One patient harbored both SNPs. These results suggest that these two SNPs do not confer susceptibility for the development of AFTN.

Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2010-08-01

This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

PubMed

Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

PubMed

Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

2017-12-01

Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (p<0.0083). Seven SNPs in the MTHFR gene were associated with homocysteine levels at an α-level of 0.05, but the associations did not persist after Bonferroni correction. These SNPs did not show interactions with lead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

Genetic polymorphism and prostate cancer aggressiveness: a case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans.

PubMed

Bensen, Jeannette T; Xu, Zongli; Smith, Gary J; Mohler, James L; Fontham, Elizabeth T H; Taylor, Jack A

2013-01-01

Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. Four GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and seven flanking SNPs were associated with CaP aggressiveness (P < 0.05) in three genomic regions: One at 3p12 (EA), seven at 8q24 (5 AA, 2 EA), and three at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (two AA, one AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (P < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. Copyright © 2012 Wiley Periodicals, Inc.

Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1536 GWAS and candidate SNPs in African Americans and European Americans

PubMed Central

Bensen, Jeannette T.; Xu, Zongli; Smith, Gary J.; Mohler, James L.; Fontham, Elizabeth T.H.; Taylor, Jack A.

2012-01-01

BACKGROUND Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. METHODS A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. RESULTS 4 GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and 7 flanking SNPs were associated with CaP aggressiveness (P<0.05) in 3 genomic regions: one at 3p12 (EA), 7 at 8q24 (5 AA, 2 EA), and 3 at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (2 AA, 1 AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (p < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. CONCLUSIONS Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. PMID:22549899

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

PubMed

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation <92%. Control children were defined as non-snoring children with AHI <2/h TST (NOSA). Endothelial function was assessed using a modified post-occlusive hyperemic test. The time to peak reperfusion (Tmax) was considered as the indicator for normal endothelial function (NEF; Tmax<45 sec), or ED (Tmax ≥ 45 sec). Genomic DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular morbidity. Thus, analysis of genotype-phenotype interactions in children with OSA may assist in the formulation of categorical risk estimates.

Fast Screening Technology for Drug Emergency Management: Predicting Suspicious SNPs for ADR with Information Theory-based Models.

PubMed

Liang, Zhaohui; Liu, Jun; Huang, Jimmy X; Zeng, Xing

2018-01-01

The genetic polymorphism of Cytochrome P450 (CYP 450) is considered as one of the main causes for adverse drug reactions (ADRs). In order to explore the latent correlations between ADRs and potentially corresponding single-nucleotide polymorphism (SNPs) in CYP450, three algorithms based on information theory are used as the main method to predict the possible relation. The study uses a retrospective case-control study to explore the potential relation of ADRs to specific genomic locations and single-nucleotide polymorphism (SNP). The genomic data collected from 53 healthy volunteers are applied for the analysis, another group of genomic data collected from 30 healthy volunteers excluded from the study are used as the control group. The SNPs respective on five loci of CYP2D6*2,*10,*14 and CYP1A2*1C, *1F are detected by the Applied Biosystem 3130xl. The raw data is processed by ChromasPro to detect the specific alleles on the above loci from each sample. The secondary data are reorganized and processed by R combined with the reports of ADRs from clinical reports. Three information theory based algorithms are implemented for the screening task: JMI, CMIM, and mRMR. If a SNP is selected by more than two algorithms, we are confident to conclude that it is related to the corresponding ADR. The selection results are compared with the control decision tree + LASSO regression model. In the study group where ADRs occur, 10 SNPs are considered relevant to the occurrence of a specific ADR by the combined information theory model. In comparison, only 5 SNPs are considered relevant to a specific ADR by the decision tree + LASSO regression model. In addition, the new method detects more relevant pairs of SNP and ADR which are affected by both SNP and dosage. This implies that the new information theory based model is effective to discover correlations of ADRs and CYP 450 SNPs and is helpful in predicting the potential vulnerable genotype for some ADRs. The newly proposed information theory based model has superiority performance in detecting the relation between SNP and ADR compared to the decision tree + LASSO regression model. The new model is more sensitive to detect ADRs compared to the old method, while the old method is more reliable. Therefore, the selection criteria for selecting algorithms should depend on the pragmatic needs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Genome-wide DNA polymorphisms in two cultivars of mei (Prunus mume sieb. et zucc.).

PubMed

Sun, Lidan; Zhang, Qixiang; Xu, Zongda; Yang, Weiru; Guo, Yu; Lu, Jiuxing; Pan, Huitang; Cheng, Tangren; Cai, Ming

2013-10-06

Mei (Prunus mume Sieb. et Zucc.) is a famous ornamental plant and fruit crop grown in East Asian countries. Limited genetic resources, especially molecular markers, have hindered the progress of mei breeding projects. Here, we performed low-depth whole-genome sequencing of Prunus mume 'Fenban' and Prunus mume 'Kouzi Yudie' to identify high-quality polymorphic markers between the two cultivars on a large scale. A total of 1464.1 Mb and 1422.1 Mb of 'Fenban' and 'Kouzi Yudie' sequencing data were uniquely mapped to the mei reference genome with about 6-fold coverage, respectively. We detected a large number of putative polymorphic markers from the 196.9 Mb of sequencing data shared by the two cultivars, which together contained 200,627 SNPs, 4,900 InDels, and 7,063 SSRs. Among these markers, 38,773 SNPs, 174 InDels, and 418 SSRs were distributed in the 22.4 Mb CDS region, and 63.0% of these marker-containing CDS sequences were assigned to GO terms. Subsequently, 670 selected SNPs were validated using an Agilent's SureSelect solution phase hybridization assay. A subset of 599 SNPs was used to assess the genetic similarity of a panel of mei germplasm samples and a plum (P. salicina) cultivar, producing a set of informative diversity data. We also analyzed the frequency and distribution of detected InDels and SSRs in mei genome and validated their usefulness as DNA markers. These markers were successfully amplified in the cultivars and in their segregating progeny. A large set of high-quality polymorphic SNPs, InDels, and SSRs were identified in parallel between 'Fenban' and 'Kouzi Yudie' using low-depth whole-genome sequencing. The study presents extensive data on these polymorphic markers, which can be useful for constructing high-resolution genetic maps, performing genome-wide association studies, and designing genomic selection strategies in mei.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Polymorphisms in inflammation pathway genes and endometrial cancer risk

PubMed Central

Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

2013-01-01

Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (P<0.05) indicated that the majority of associations could be linked to one of 24 distinct loci. One SNP from each of the 24 loci was then selected for follow-up genotyping. Of these, 21 SNPs were successfully designed and genotyped in stage 2, which consisted of ten additional studies including 6,604 endometrial cancer cases and 8,511 controls. Results Five of the 21 SNPs had significant allelic odds ratios and 95% confidence intervals as follows: FABP1, 0.92 (0.85-0.99); CXCL3, 1.16 (1.05-1.29); IL6, 1.08 (1.00-1.17); MSR1, 0.90 (0.82-0.98); and MMP9, 0.91 (0.87-0.97). Two of these polymorphisms were independently significant in the replication sample (rs352038 in CXCL3 and rs3918249 in MMP9). The association for the MMP9 polymorphism remained significant after Bonferroni correction and showed a significant association with endometrial cancer in both Asian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

PubMed Central

2012-01-01

Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

Gene by Environment Investigation of Incident Lung Cancer Risk in African-Americans.

PubMed

David, Sean P; Wang, Ange; Kapphahn, Kristopher; Hedlin, Haley; Desai, Manisha; Henderson, Michael; Yang, Lingyao; Walsh, Kyle M; Schwartz, Ann G; Wiencke, John K; Spitz, Margaret R; Wenzlaff, Angela S; Wrensch, Margaret R; Eaton, Charles B; Furberg, Helena; Mark Brown, W; Goldstein, Benjamin A; Assimes, Themistocles; Tang, Hua; Kooperberg, Charles L; Quesenberry, Charles P; Tindle, Hilary; Patel, Manali I; Amos, Christopher I; Bergen, Andrew W; Swan, Gary E; Stefanick, Marcia L

2016-02-01

Genome-wide association studies have identified polymorphisms linked to both smoking exposure and risk of lung cancer. The degree to which lung cancer risk is driven by increased smoking, genetics, or gene-environment interactions is not well understood. We analyzed associations between 28 single nucleotide polymorphisms (SNPs) previously associated with smoking quantity and lung cancer in 7156 African-American females in the Women's Health Initiative (WHI), then analyzed main effects of top nominally significant SNPs and interactions between SNPs, cigarettes per day (CPD) and pack-years for lung cancer in an independent, multi-center case-control study of African-American females and males (1078 lung cancer cases and 822 controls). Nine nominally significant SNPs for CPD in WHI were associated with incident lung cancer (corrected p-values from 0.027 to 6.09 × 10(-5)). CPD was found to be a nominally significant effect modifier between SNP and lung cancer for six SNPs, including CHRNA5 rs2036527[A](betaSNP*CPD = - 0.017, p = 0.0061, corrected p = 0.054), which was associated with CPD in a previous genome-wide meta-analysis of African-Americans. These results suggest that chromosome 15q25.1 variants are robustly associated with CPD and lung cancer in African-Americans and that the allelic dose effect of these polymorphisms on lung cancer risk is most pronounced in lighter smokers.

Association between mitochondrial DNA variations and schizophrenia in the northern Chinese Han population.

PubMed

Xu, Feng-Ling; Ding, Mei; Yao, Jun; Shi, Zhang-Sen; Wu, Xue; Zhang, Jing-Jing; Pang, Hao; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

2017-01-01

To determine whether mitochondrial DNA (mtDNA) variations are associated with schizophrenia, 313 patients with schizophrenia and 326 unaffected participants of the northern Chinese Han population were included in a prospective study. Single-nucleotide polymorphisms (SNPs) including C5178A, A10398G, G13708A, and C13928G were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Hypervariable regions I and II (HVSI and HVSII) were analyzed by sequencing. The results showed that the 4 SNPs and 11 haplotypes, composed of the 4 SNPs, did not differ significantly between patient and control groups. No significant association between haplogroups and the risk of schizophrenia was ascertained after Bonferroni correction. Drawing a conclusion, there was no evidence of an association between mtDNA (the 4 SNPs and the control region) and schizophrenia in the northern Chinese Han population.

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

PubMed

Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

2012-01-01

PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis.

PubMed

Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P

2016-06-01

Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel of molecular tools for whole genome analysis, allowing integrating and better exploring the common bean breeding practices.

Optimum polygenic profile to resist exertional rhabdomyolysis during a marathon

PubMed Central

Valero, Marjorie; Salinero, Juan José; Lara, Beatriz; Gallo-Salazar, César; Areces, Francisco

2017-01-01

Purpose Exertional rhabdomyolysis can occur in individuals performing various types of exercise but it is unclear why some individuals develop this condition while others do not. Previous investigations have determined the role of several single nucleotide polymorphisms (SNPs) to explain inter-individual variability of serum creatine kinase (CK) concentrations after exertional muscle damage. However, there has been no research about the interrelationship among these SNPs. The purpose of this investigation was to analyze seven SNPs that are candidates for explaining individual variations of CK response after a marathon competition (ACE = 287bp Ins/Del, ACTN3 = p.R577X, CKMM = NcoI, IGF2 = C13790G, IL6 = 174G>C, MLCK = C37885A, TNFα = 308G>A). Methods Using Williams and Folland’s model, we determined the total genotype score from the accumulated combination of these seven SNPs for marathoners with a low CK response (n = 36; serum CK <400 U·L-1) vs. marathoners with a high CK response (n = 31; serum CK ≥400 U·L-1). Results At the end of the race, low CK responders had lower serum CK (290±65 vs. 733±405 U·L-1; P<0.01) and myoglobin concentrations (443±328 vs. 1009±971 ng·mL-1, P<0.01) than high CK responders. Although the groups were similar in age, anthropometric characteristics, running experience and training habits, total genotype score was higher in low CK responders than in high CK responders (5.2±1.4 vs. 4.4±1.7 point, P = 0.02). Conclusion Marathoners with a lower CK response after the race had a more favorable polygenic profile than runners with high serum CK concentrations. This might suggest a significant role of genetic polymorphisms in the levels of exertional muscle damage and rhabdomyolysis. Yet other SNPs, in addition to exercise training, might also play a role in the values of CK after damaging exercise. PMID:28257486

Breast cancer resistance protein (ABCG2) and drug disposition: intestinal expression, polymorphisms and sulfasalazine as an in vivo probe

PubMed Central

Urquhart, Bradley L.; Ware, Joseph A.; Tirona, Rommel G.; Ho, Richard H.; Leake, Brenda F.; Schwarz, Ute I.; Zaher, Hani; Palandra, Joe; Gregor, Jamie C.; Dresser, George K.; Kim, Richard B.

2014-01-01

Breast cancer resistance protein (BCRP) is an efflux transporter expressed in tissues that act as barriers to drug entry. Given that single nucleotide polymorphisms (SNPs) in the ABCG2 gene encoding BCRP are common, the possibility exists that these genetic variants may be a determinant of interindividual variability in drug response. The objective of this study is to confirm the human BCRP-mediated transport of sulfasalazine in vitro, evaluate interindividual variation in BCRP expression in human intestine and to determine the role of ABCG2 SNPs to drug disposition in healthy patients using sulfasalazine as a novel in vivo probe. To evaluate these objectives, pinch biopsies were obtained from 18 patients undergoing esophagogastro–duodenoscopy or colonoscopy for determination of BCRP expression in relation to genotype. Wild-type and variant BCRP were expressed in a heterologous expression system to evaluate the effect of SNPs on cell-surface trafficking. A total of 17 healthy individuals participated in a clinical investigation to determine the effect of BCRP SNPs on sulfasalazine pharmacokinetics. In vitro, the cell surface protein expression of the common BCRP 421 C>A variant was reduced in comparison with the wild-type control. Intestinal biopsy samples revealed that BCRP protein and mRNA expression did not significantly differ between patients with 34GG/421CC versus patients with 34GG/421CA genotypes. Remarkably, in subjects with 34GG/421CA genotype, sulfasalazine area under the concentration-time curve was 2.4-fold greater compared with 34GG/421CC subjects (P<0.05). This study links commonly occurring SNPs in BCRP with significantly increased oral sulfasalazine plasma exposure in humans. Accordingly, sulfasalazine may prove to have utility as in vivo probe for assessing the clinical impact of BCRP for the disposition and efficacy of drugs. PMID:18408567

Optimum polygenic profile to resist exertional rhabdomyolysis during a marathon.

PubMed

Del Coso, Juan; Valero, Marjorie; Salinero, Juan José; Lara, Beatriz; Gallo-Salazar, César; Areces, Francisco

2017-01-01

Exertional rhabdomyolysis can occur in individuals performing various types of exercise but it is unclear why some individuals develop this condition while others do not. Previous investigations have determined the role of several single nucleotide polymorphisms (SNPs) to explain inter-individual variability of serum creatine kinase (CK) concentrations after exertional muscle damage. However, there has been no research about the interrelationship among these SNPs. The purpose of this investigation was to analyze seven SNPs that are candidates for explaining individual variations of CK response after a marathon competition (ACE = 287bp Ins/Del, ACTN3 = p.R577X, CKMM = NcoI, IGF2 = C13790G, IL6 = 174G>C, MLCK = C37885A, TNFα = 308G>A). Using Williams and Folland's model, we determined the total genotype score from the accumulated combination of these seven SNPs for marathoners with a low CK response (n = 36; serum CK <400 U·L-1) vs. marathoners with a high CK response (n = 31; serum CK ≥400 U·L-1). At the end of the race, low CK responders had lower serum CK (290±65 vs. 733±405 U·L-1; P<0.01) and myoglobin concentrations (443±328 vs. 1009±971 ng·mL-1, P<0.01) than high CK responders. Although the groups were similar in age, anthropometric characteristics, running experience and training habits, total genotype score was higher in low CK responders than in high CK responders (5.2±1.4 vs. 4.4±1.7 point, P = 0.02). Marathoners with a lower CK response after the race had a more favorable polygenic profile than runners with high serum CK concentrations. This might suggest a significant role of genetic polymorphisms in the levels of exertional muscle damage and rhabdomyolysis. Yet other SNPs, in addition to exercise training, might also play a role in the values of CK after damaging exercise.

Genotype imputation for African Americans using data from HapMap phase II versus 1000 genomes projects.

PubMed

Sung, Yun J; Gu, C Charles; Tiwari, Hemant K; Arnett, Donna K; Broeckel, Ulrich; Rao, Dabeeru C

2012-07-01

Genotype imputation provides imputation of untyped single nucleotide polymorphisms (SNPs) that are present on a reference panel such as those from the HapMap Project. It is popular for increasing statistical power and comparing results across studies using different platforms. Imputation for African American populations is challenging because their linkage disequilibrium blocks are shorter and also because no ideal reference panel is available due to admixture. In this paper, we evaluated three imputation strategies for African Americans. The intersection strategy used a combined panel consisting of SNPs polymorphic in both CEU and YRI. The union strategy used a panel consisting of SNPs polymorphic in either CEU or YRI. The merge strategy merged results from two separate imputations, one using CEU and the other using YRI. Because recent investigators are increasingly using the data from the 1000 Genomes (1KG) Project for genotype imputation, we evaluated both 1KG-based imputations and HapMap-based imputations. We used 23,707 SNPs from chromosomes 21 and 22 on Affymetrix SNP Array 6.0 genotyped for 1,075 HyperGEN African Americans. We found that 1KG-based imputations provided a substantially larger number of variants than HapMap-based imputations, about three times as many common variants and eight times as many rare and low-frequency variants. This higher yield is expected because the 1KG panel includes more SNPs. Accuracy rates using 1KG data were slightly lower than those using HapMap data before filtering, but slightly higher after filtering. The union strategy provided the highest imputation yield with next highest accuracy. The intersection strategy provided the lowest imputation yield but the highest accuracy. The merge strategy provided the lowest imputation accuracy. We observed that SNPs polymorphic only in CEU had much lower accuracy, reducing the accuracy of the union strategy. Our findings suggest that 1KG-based imputations can facilitate discovery of significant associations for SNPs across the whole MAF spectrum. Because the 1KG Project is still under way, we expect that later versions will provide better imputation performance. © 2012 Wiley Periodicals, Inc.

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

PubMed

Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

2010-05-01

Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

PubMed

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

Functional polymorphisms of circadian negative feedback regulation genes are associated with clinical outcome in hepatocellular carcinoma patients receiving radical resection.

PubMed

Zhang, Zhaohui; Ma, Fei; Zhou, Feng; Chen, Yibing; Wang, Xiaoyan; Zhang, Hongxin; Zhu, Yong; Bi, Jianwei; Zhang, Yiguan

2014-12-01

Previous studies have demonstrated that circadian negative feedback loop genes play an important role in the development and progression of many cancers. However, the associations between single-nucleotide polymorphisms (SNPs) in these genes and the clinical outcomes of hepatocellular carcinoma (HCC) after surgical resection have not been studied so far. Thirteen functional SNPs in circadian genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 489 Chinese HCC patients who received radical resection. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. Cumulative effect analysis and survival tree analysis were used for the multiple SNPs analysis. Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). Moreover, we observed a cumulative effect of significant SNPs on OS and RFS (P for trend < 0.001 for both). Survival tree analysis indicated that wild genotype of rs228729 in PER3 was the primary risk factor contributing to HCC patients' RFS. Our study suggests that the polymorphisms in circadian negative feedback loop genes may serve as independent prognostic biomarkers in predicting clinical outcomes for HCC patients who received radical resection. Further studies with different ethnicities are needed to validate our findings and generalize its clinical utility.

Interleukin 18 receptor 1 gene polymorphisms are associated with asthma.

PubMed

Zhu, Guohua; Whyte, Moira K B; Vestbo, Jorgen; Carlsen, Karin; Carlsen, Kai-Håkon; Lenney, Warren; Silverman, Michael; Helms, Peter; Pillai, Sreekumar G

2008-09-01

The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined by genotyping seven SNPs in 294, 342 and 100 families from Denmark, United Kingdom and Norway and conducting family-based association analyses for asthma, atopic asthma and bronchial hyper-reactivity (BHR) phenotypes. Three SNPs in IL18R1 were associated with asthma (0.01131 < or = P < or = 0.01377), five with atopic asthma (0.00066 < or = P < or = 0.00405) and two with BHR (0.01450 < or = P < or = 0.03203) in the Danish population; two SNPs were associated with atopic asthma (0.00397 < or = P < or = 0.01481) and four with BHR (0.00435 < or = P < or = 0.03544) in the UK population; four SNPs showed associations with asthma (0.00015 < or = P < or = 0.03062), two with atopic asthma (0.01269 < or = P < or = 0.04042) and three with BHR (0.00259 < or = P < or = 0.01401) in the Norwegian population; five SNPs showed associations with asthma (0.00005 < or = P < or = 0.03744), five with atopic asthma (0.00001 < or = P < or = 0.04491) and three with BHR (0.03568 < or = P < or = 0.04778) in the combined population. Three intronic SNPs (rs1420099, rs1362348 and rs1974675) showed replicated association for at least one asthma-related phenotype. These results demonstrate significant association between polymorphisms in IL18R1 and asthma.

Canonical single nucleotide polymorphisms (SNPs) for high-resolution subtyping of Shiga-toxin producing Escherichia coli (STEC) O157:H7

USDA-ARS?s Scientific Manuscript database

The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...

Association of calpain 10 gene polymorphisms with type 2 diabetes mellitus in Southern Indians.

PubMed

Bodhini, Dhanasekaran; Radha, Venkatesan; Ghosh, Saurabh; Sanapala, Krishna R; Majumder, Partha P; Rao, Manchanahalli Rangaswamy Satyanarayana; Mohan, Viswanathan

2011-05-01

The aim was to investigate the association between the CAPN10 gene single nucleotide polymorphisms (SNPs) -44 (rs2975760), -43 (rs3792267), -19 (rs3842570), and -63 (rs5030952) and type 2 diabetes mellitus in an Asian Indian population in Southern India. A total of 1443 subjects, 794 normal glucose tolerant (NGT) and 649 type 2 diabetes mellitus subjects, were randomly selected from the Chennai Urban Rural Epidemiology Study. These subjects were genotyped for the 4 CAPN10 SNPs using polymerase chain reaction-restriction fragment length polymorphism and validated by direct sequencing. None of the 4 SNPs showed any significant differences in the genotypic distribution among the NGT and type 2 diabetes mellitus subjects (P = .20, .86, .34, and .39 for SNPs -44, -43, -19, and -63, respectively). The NGT subjects with the 11 genotype of the SNP -63 had significantly higher 2-hour postload plasma glucose (mean ± SD, 5.66 ± 1.05 mmol/L) levels compared with the combined 12 and 22 genotype group (5.33 ± 1.11 mmol/L, P = .004). The P value remained significant even after adjusting for age, sex, body mass index, smoking, and alcohol consumption (nominal P = .008). No significant difference in the biochemical parameters was observed when the subjects were stratified according to the other SNPs. The 2111 haplotype corresponding to SNPs -44, -43, -19, and -63 showed a significant difference in the proportion among NGT (0.18) and type 2 diabetes mellitus subjects (0.22, nominal P = .014). Although the Bonferroni correction based on the asymptotic test does not preserve this significance, the test based on the empirical distribution remained significant. In conclusion, our study raises the possibility that the 2111 haplotype of SNPs -44, -43, -19, and -63 may be associated with type 2 diabetes mellitus, although none of these SNPs may be individually associated with diabetes. Copyright © 2011 Elsevier Inc. All rights reserved.

A Multi-Trait, Meta-analysis for Detecting Pleiotropic Polymorphisms for Stature, Fatness and Reproduction in Beef Cattle

PubMed Central

Bolormaa, Sunduimijid; Pryce, Jennie E.; Reverter, Antonio; Zhang, Yuandan; Barendse, William; Kemper, Kathryn; Tier, Bruce; Savin, Keith; Hayes, Ben J.; Goddard, Michael E.

2014-01-01

Polymorphisms that affect complex traits or quantitative trait loci (QTL) often affect multiple traits. We describe two novel methods (1) for finding single nucleotide polymorphisms (SNPs) significantly associated with one or more traits using a multi-trait, meta-analysis, and (2) for distinguishing between a single pleiotropic QTL and multiple linked QTL. The meta-analysis uses the effect of each SNP on each of n traits, estimated in single trait genome wide association studies (GWAS). These effects are expressed as a vector of signed t-values (t) and the error covariance matrix of these t values is approximated by the correlation matrix of t-values among the traits calculated across the SNP (V). Consequently, t'V−1t is approximately distributed as a chi-squared with n degrees of freedom. An attractive feature of the meta-analysis is that it uses estimated effects of SNPs from single trait GWAS, so it can be applied to published data where individual records are not available. We demonstrate that the multi-trait method can be used to increase the power (numbers of SNPs validated in an independent population) of GWAS in a beef cattle data set including 10,191 animals genotyped for 729,068 SNPs with 32 traits recorded, including growth and reproduction traits. We can distinguish between a single pleiotropic QTL and multiple linked QTL because multiple SNPs tagging the same QTL show the same pattern of effects across traits. We confirm this finding by demonstrating that when one SNP is included in the statistical model the other SNPs have a non-significant effect. In the beef cattle data set, cluster analysis yielded four groups of QTL with similar patterns of effects across traits within a group. A linear index was used to validate SNPs having effects on multiple traits and to identify additional SNPs belonging to these four groups. PMID:24675618

Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

PubMed

Multani, Shaleen; Saranath, Dhananjaya

2016-11-01

Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

2014-05-01

This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P < 0.05) were identified by logistic regression analysis, but results were insignificant after Bonferroni correction. Six SNPs formed a linkage disequilibrium block, and three main haplotypes were found. Two of three haplotypes (AAAGAA and GGGAGG) distributed highly in the POF group, whereas the remaining haplotype (GGAAGG) distributed highly in the control group by logistic regression analysis (highest odds ratio, 2.515; 95% CI, 1.515-4.175; P = 0.00036). Our observations suggest that genetic variations in the FANCA gene may increase the risk for POF in Korean women.

Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

PubMed

Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

2018-02-01

The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

PubMed

Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

2012-07-01

Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (P<0.001). By alignment analysis and sequencing, we detected that the g.329C>T SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

PubMed

Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

2009-07-01

Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

The autoimmune regulator gene (AIRE) is strongly associated with vitiligo.

PubMed

Tazi-Ahnini, R; McDonagh, A J G; Wengraf, D A; Lovewell, T R J; Vasilopoulos, Y; Messenger, A G; Cork, M J; Gawkrodger, D J

2008-09-01

Vitiligo is an autoimmune disorder that occurs with greatly increased frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED) caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected an association between alopecia areata and single nucleotide polymorphisms (SNPs) in the AIRE gene. To report the findings of an extended study including haplotype analysis on six AIRE polymorphisms (AIRE C-103T, C4144G, T5238C, G6528A, T7215C and T11787C) in vitiligo, another APECED-associated disease. A case-control analysis was performed. Results showed a strong association between AIRE 7215C and vitiligo [P = 1.36 x 10(-5), odds ratio (OR) 3.12, 95% confidence interval (CI) 1.87-5.46]. We found no significant association with the other polymorphisms individually. However, haplotype analysis revealed that the AIRE haplotype CCTGCC showed a highly significant association with vitiligo (P = 4.14 x 10(-4), OR 3.00, 95% CI 1.70-5.28). To select the most informative minimal haplotypes, we tagged the polymorphisms using SNP tag software. Using AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, the haplotype AIRE CGCC was associated with vitiligo (P = 0.003, OR 2.49, 95% CI 1.45-4.26). The link between vitiligo and AIRE raises the possibility that defective skin peripheral antigen selection in the thymus is involved in the changes that result in melanocyte destruction in this disorder.

Mitochondrial haplotypes are not associated with mice selectively bred for high voluntary wheel running.

PubMed

Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore

2018-04-04

Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st  = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc  = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.

N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

PubMed Central

Hein, David W.

2009-01-01

Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

Interactive effect of STAT6 and IL13 gene polymorphisms on eczema status: results from a longitudinal and a cross-sectional study

PubMed Central

2013-01-01

Background Eczema is a prevalent skin disease that is mainly characterized by systemic deviation of immune response and defective epidermal barrier. Th2 cytokines, such as IL-13 and transcription factor STAT6 are key elements in the inflammatory response that characterize allergic disorders, including eczema. Previous genetic association studies showed inconsistent results for the association of single nucleotide polymorphisms (SNPs) with eczema. Our aim was to investigate whether SNPs in IL13 and STAT6 genes, which share a biological pathway, have an interactive effect on eczema risk. Methods Data from two independent population-based studies were analyzed, namely the Isle of Wight birth cohort study (IOW; n = 1,456) and for the purpose of replication the Swansea PAPA (Poblogaeth Asthma Prifysgol Abertawe; n = 1,445) cross-sectional study. Log-binomial regressions were applied to (i) account for the interaction between IL13 (rs20541) and STAT6 (rs1059513) polymorphisms and (ii) estimate the combined effect, in terms of risk ratios (RRs), of both risk factors on the risk of eczema. Results Under a dominant genetic model, the interaction term [IL13 (rs20541) × STAT6 (rs1059513)] was statistically significant in both studies (IOW: adjusted Pinteraction = 0.046; PAPA: Pinteraction = 0.037). The assessment of the combined effect associated with having risk genotypes in both SNPs yielded a 1.52-fold increased risk of eczema in the IOW study (95% confidence interval (CI): 1.05 – 2.20; P = 0.028) and a 2.01-fold higher risk of eczema (95% CI: 1.29 – 3.12; P = 0.002) in the PAPA study population. Conclusions Our study adds to the current knowledge of genetic susceptibility by demonstrating for the first time an interactive effect between SNPs in IL13 (rs20541) and STAT6 (rs1059513) on the occurrence of eczema in two independent samples. Findings of this report further support the emerging evidence that points toward the existence of genetic effects that occur via complex networks involving gene-gene interactions (epistasis). PMID:23815671

Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures.

PubMed

Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J

2006-01-01

The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.

Vkorc1 sequencing suggests anticoagulant resistance in rats in New Zealand.

PubMed

Cowan, Phil E; Gleeson, Dianne M; Howitt, Robyn Lj; Ramón-Laca, Ana; Esther, Alexandra; Pelz, Hans-Joachim

2017-01-01

Anticoagulant toxins are used globally to control rats. Resistance of Rattus species to these toxins now occurs in at least 18 countries in Europe, America and Asia. Resistance is often associated with single nucleotide polymorphisms (SNPs) in the Vkorc1 gene. This study gives a first overview of the distribution and frequency of Vkorc1 SNPs in rats in New Zealand. New Zealand is unusual in having no native rodents but three species of introduced Rattus - norvegicus Berk., rattus L. and exulans Peale. Sequence variants occurred in at least one species of rat at all 30 of the sites sampled. Three new SNPs were identified, one in kiore and two in ship rats. No SNPs previously associated with resistance were found in Norway rats or kiore, but seven ship rats were heterozygous and one homozygous for the A74T variant. Its resultant Tyr25Phe mutation has previously been associated with resistance to both first- and second-generation anticoagulants in ship rats in Spain. This is the first evidence of potential resistance to anticoagulant toxins in rats in New Zealand. Further testing using blood clotting response times in dosed rats is needed to confirm resistance potentially conferred by the Tyr25Phe mutation. Assessment is also needed of the potential of the other non-synonymous variants (Ala14Val, Ala26Val) recorded in this study to confer resistance to anticoagulant toxins. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

RAN/RANBP2 polymorphisms and neuroblastoma risk in Chinese children: a three-center case-control study.

PubMed

Wang, Juxiang; Zhuo, Zhenjian; Chen, Min; Zhu, Jinhong; Zhao, Jie; Zhang, Jiao; Chen, Shanshan; He, Jing; Zhou, Haixia

2018-04-28

The genetic etiology of sporadic neuroblastoma remains largely obscure. RAN and RANBP2 genes encode Ras-related nuclear protein and Ran-binding protein 2, respectively. These two proteins form Ran-RanBP2 complex that regulate various cellular activities including nuclear transport. Aberrant functions of the two proteins are implicated in carcinogenesis. Given the unknown role of RAN/RANBP2 single nucleotide polymorphisms (SNPs) in neuroblastoma risk, we performed a multi-center case-control study in Chinese children to assess the association of the RAN/RANBP2 SNPs with neuroblastoma risk. We analyzed three potentially functional SNPs in RAN gene (rs56109543 C>T, rs7132224 A>G, rs14035 C>T) and one in RANBP2 (rs2462788 C>T) in 429 cases and 884 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to access the association between these four polymorphisms and neuroblastoma risk. No single variant was found to statistically significantly associate with neuroblastoma risk. However, individuals with 3 protective genotypes were less likely to develop neuroblastoma, in comparison to non-carriers (adjusted OR=0.33; 95% CI=0.12-0.96; P =0.042), as well as those with 0-2 protective genotypes (adjusted OR=0.33; 95% CI=0.11-0.94; P =0.038). Stratified analysis revealed no significant association for any of the four polymorphisms. Further studies are warranted to validate the weak impact of RAN/RANBP2 SNPs on neuroblastoma risk.

The impact of single nucleotide polymorphisms on patterns of non-contact musculoskeletal soft tissue injuries in a football player population according to ethnicity.

PubMed

Pruna, Ricard; Ribas, Jordi; Montoro, Jose Bruno; Artells, Rosa

2015-02-02

The prevention, diagnosis, and management of non-contact musculoskeletal soft tissue injuries (NCMSTIs) related to participation in sports are key components of sport and exercise medicine. Epidemiological data have demonstrated the existence of interindividual differences in the severity of NCMSTIs, indicating that these injuries occur as a consequence of both extrinsic and intrinsic factors, including genetic variations. We have collected data on NCMSTIs suffered by 73 elite players of White, black African and Hispanic ethnicity of European football over the course of three consecutive seasons. We have also examined eight single nucleotide polymorphisms (SNPs) in genes related to tissue recovery and tissue repair in blood drawn from the players and correlated our findings with type and severity of injuries in each ethnic group. The frequency of the SNPs varied among the three ethnic sub-groups (p<0.0001). Among Whites, a significant relationship was observed between ligament injuries and ELN (p=0.001) and between tendinous injuries and ELN (p=0.05) and IGF2 (p=0.05). Among Hispanics, there was a significant relation between muscle injuries and ELN (p=0.032) and IGF2 (p=0.016). Interracial genotypic differences may be important in the study of NCMSTIs. A genetic profile based on SNPs may be useful tool to describe each individual's injuribility risk and provide specific treatment and preventive care for football players. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

The Association of the Immune Response Genes to Human Papillomavirus-Related Cervical Disease in a Brazilian Population

PubMed Central

Marangon, Amanda Vansan; Guelsin, Gláucia Andreia Soares; Visentainer, Jeane Eliete Laguila; Borelli, Sueli Donizete; Watanabe, Maria Angélica Ehara; Consolaro, Márcia Edilaine Lopes; Caleffi-Ferracioli, Katiany Rizzieri; Rudnick, Cristiane Conceição Chagas; Sell, Ana Maria

2013-01-01

The genetic variability of the host contributes to the risk of human papillomavirus (HPV)-related cervical disease. Immune response genes to HPV must be investigated to define patients with the highest risk of developing malignant disease. The aim of this study was to investigate the association of polymorphic immune response genes, namely KIR, HLA class I and II, and single-nucleotide polymorphisms (SNPs) of cytokines with HPV-related cervical disease. We selected 79 non-related, admixed Brazilian women from the state of Paraná, southern region of Brazil, who were infected with high carcinogenic risk HPV and present cervical intraepithelial neoplasia grade 3 (CIN3), and 150 HPV-negative women from the same region matched for ethnicity. KIR genes were genotyped using an in-house PCR-SSP. HLA alleles were typed using a reverse sequence-specific oligonucleotide technique. SNPs of TNF −308G>A, IL6 −174G>C, IFNG +874T>A, TGFB1 +869T>C +915G>C, and IL10 −592C>A −819C>T −1082G>A were evaluated using PCR-SSP. The KIR genes were not associated with HPV, although some pairs of i(inhibitory)KIR-ligands occurred more frequently in patients, supporting a role for NK in detrimental chronic inflammatory and carcinogenesis. Some HLA haplotypes were associated with HPV. The associations of INFG and IL10 SNPs potentially reflect impaired or invalid responses in advanced lesions. PMID:23936772

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

Association of ITPA polymorphisms rs6051702/rs1127354 instead of rs7270101/rs1127354 as predictor of ribavirin-associated anemia in chronic hepatitis C treated patients.

PubMed

D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni

2013-10-01

Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.

A brain-derived neurotrophic factor polymorphism Val66Met identifies fibromyalgia syndrome subgroup with higher body mass index and C-reactive protein.

PubMed

Xiao, Yangming; Russell, I Jon; Liu, Ya-Guang

2012-08-01

A common single nucleotide polymorphism (SNP) in the gene of brain-derived neurotrophic factor (BDNF) results from a substitution at position 66 from valine (Val) to methionine (Met) and may predispose to human neuropsychiatric disorders. We proposed to determine whether these BDNF gene SNPs were associated with fibromyalgia syndrome (FMS) and/or any of its typical phenotypes. Patients with FMS (N = 95) and healthy normal controls (HNC, N = 58) were studied. Serum high-sensitivity C-reactive protein (hsCRP) levels were measured using an enzyme-linked immunosorbent assay (ELISA). The BDNF SNPs were determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).The BDNF SNP distribution was 65 (68%) Val/Val, 28 (30%) Val/Met, and 2 (2%) Met/Met for FMS and 40 (69%), 17(29%), and 1 (2%) for HNC, respectively. The serum high-sensitivity C-reactive protein (hsCRP)and body mass index (BMI) in FMS were higher than in HNC. The FMS with BDNF Val66Val had significantly higher mean BMI (P = 0.0001) and hsCRP (P = 0.02) than did FMS carrying the Val66Met genotype. This pattern was not found in HNC. Phenotypic measures of subjective pain, pain threshold, depression, or insomnia did not relate to either of the BDNF SNPs in FMS. The relative distribution BDNF SNPs did not differ between FMS and HNC. The BDNF Val66Met polymorphism is not selective for FMS. The BDNF Val66Val SNP identifies a subgroup of FMS with elevated hsCRP and higher BMI. This is the first study to associate a BDNF polymorphism with a FMS subgroup phenotype.

Genetic Variants in SDC3 Gene are Significantly Associated with Growth Traits in Two Chinese Beef Cattle Breeds.

PubMed

Huang, Yong-Zhen; Wang, Qin; Zhang, Chun-Lei; Fang, Xing-Tang; Song, En-Liang; Chen, Hong

2016-01-01

Identification of the genes and polymorphisms underlying quantitative traits, and understanding these genes and polymorphisms affect economic growth traits, are important for successful marker-assisted selection and more efficient management strategies in commercial cattle (Bos taurus) population. Syndecan-3 (SDC3), a member of the syndecan family of type I transmembrane heparan sulfate proteoglycans is a novel regulator of feeding behavior and body weight. The aim of this study is to examine the association of the SDC3 polymorphism with growth traits in Chinese Jiaxian and Qinchuan cattle breeds (). Four single nucleotide polymorphisms (SNPs: 1-4) were detected in 555 cows from three Chinese native cattle breeds by means of sequencing pooled DNA samples and polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP) methods. We found one SNP (g.28362A > G) in intron and three SNPs (g.30742T > G, g.30821C > T and 33418 A > G) in exons. The statistical analyses indicated that these SNPs of SDC3 gene were associated with bovine body height, body length, chest circumference, and circumference of cannon bone (P < 0.05). The mutant-type variant was superior for growth traits; the heterozygote was associated with higher growth traits compared to wild-type homozygote. Our result confirms the polymorphisms in the SDC3 gene are associated with growth traits that may be used for marker-assisted selection in beef cattle breeding programs.

Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

USDA-ARS?s Scientific Manuscript database

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

Interaction between LRP5 and periostin gene polymorphisms on serum periostin levels and cortical bone microstructure.

PubMed

Pepe, J; Bonnet, N; Herrmann, F R; Biver, E; Rizzoli, R; Chevalley, T; Ferrari, S L

2018-02-01

We investigated the interaction between periostin SNPs and the SNPs of the genes assumed to modulate serum periostin levels and bone microstructure in a cohort of postmenopausal women. We identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels and on radial cortical porosity. The purpose of this study is to investigate the interaction between periostin gene polymorphisms (SNPs) and other genes potentially responsible for modulating serum periostin levels and bone microstructure in a cohort of postmenopausal women. In 648 postmenopausal women from the Geneva Retirees Cohort, we analyzed 6 periostin SNPs and another 149 SNPs in 14 genes, namely BMP2, CTNNB1, ESR1, ESR2, LRP5, LRP6, PTH, SPTBN1, SOST, TGFb1, TNFRSF11A, TNFSF11, TNFRSF11B and WNT16. Volumetric BMD and bone microstructure were measured by high-resolution peripheral quantitative computed tomography at the distal radius and tibia. Serum periostin levels were associated with radial cortical porosity, including after adjustment for age, BMI, and years since menopause (p = 0.036). Sixteen SNPs in the ESR1, LRP5, TNFRSF11A, SOST, SPTBN1, TNFRSF11B and TNFSF11 genes were associated with serum periostin levels (p range 0.03-0.001) whereas 26 SNPs in 9 genes were associated with cortical porosity at the radius and/or at the tibia. WNT 16 was the gene with the highest number of SNPs associated with both trabecular and cortical microstructure. The periostin SNP rs9547970 was also associated with cortical porosity (p = 0.04). In particular, SNPs in LRP5, ESR1 and near the TNFRSF11A gene were associated with both cortical porosity and serum periostin levels. Eventually, we identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels (interaction p = 0.01) and on radial cortical porosity (interaction p = 0.005). These results suggest that periostin expression is genetically modulated, particularly by polymorphisms in the Wnt pathway, and is thereby implicated in the genetic variation of bone microstructure.

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

PubMed Central

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

PubMed

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

Pharmacogenetics of human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1): gene resequencing, sequence variation, and functional genomics.

PubMed

Xu, Zhen-Hua; Thomae, Bianca A; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M

2003-06-01

3'-Phosphoadenosine 5'-phosphosulfate (PAPS) is the high-energy "sulfate donor" for reactions catalyzed by sulfotransferase (SULT) enzymes. The strict requirement of SULTs for PAPS suggests that PAPS synthesis might influence the rate of sulfate conjugation. In humans, PAPS is synthesized from ATP and SO(4)(2-) by two isoforms of PAPS synthetase (PAPSS): PAPSS1 and PAPSS2. As a step toward pharmacogenetic studies, we have resequenced the entire coding sequence of the human PAPSS1 gene, including exon-intron splice junctions, using DNA samples from 60 Caucasian-American and 58 African-American subjects. Twenty-one genetic polymorphisms were observed-1 insertion-deletion event and 20 single nucleotide polymorphisms (SNPs)-including two non-synonymous coding SNPs (cSNPs) that altered the following amino acids: Arg333Cys and Glu531Gln. Twelve pairs of these polymorphisms were tightly linked, and a total of twelve unequivocal haplotypes could be identified-two that were common to both ethnic groups and ten that were ethnic-specific. The Arg333Cys polymorphism, with an allele frequency of 2.5%, was observed only in DNA samples from Caucasian subjects. The Glu531Gln polymorphism was rare, with only a single copy of that allele in a DNA sample from an African-American subject. Transient expression in mammalian cells showed that neither of the non-synonymous cSNPs resulted in a change in the basal level of enzyme activity measured under optimal assay conditions. However, the Glu531Gln polymorphism altered the substrate kinetic properties of the enzyme. The Gln531 variant allozyme had a 5-fold higher K(m) value for SO(4)(2-) than did the wild-type allozyme and displayed monophasic kinetics for Na(2)SO(4). The wild-type allozyme (Glu531) showed biphasic kinetics for that substrate. These observations represent a step toward testing the hypothesis that genetic variation in PAPS synthesis catalyzed by PAPSS1 might alter in vivo sulfate conjugation.

Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients

PubMed Central

Li, Jingjie; Yan, Mengdan; Xie, Zhilan; Zhu, Yuanyuan; Chen, Chao; Jin, Tianbo

2016-01-01

Previous studies suggested that single nucleotide polymorphisms (SNPs) in epidermal growth factor receptor (EGFR) are associated with risk of glioma. However, the associations between these SNPs and glioma patient prognosis have not yet been fully investigated. Therefore, the present study was aimed to evaluate the effects of EGFR polymorphisms on the glioma patient prognosis. We retrospectively evaluated 269 glioma patients and investigated associations between EGFR SNPs and patient prognosis using Cox proportional hazard models and Kaplan-Meier curves. Univariate analysis revealed that age, gross-total resection and chemotherapy were associated with the prognosis of glioma patients (p < 0.05). In addition, four EGFR SNPs (rs11506105, rs3752651, rs1468727 and rs845552) correlated with overall survival (OS) (Log-rank p = 0.011, 0.020, 0.008, and 0.009, respectively) and progression-free survival PFS (Log-rank p = 0.026, 0.024, 0.019 and 0.009, respectively). Multivariate analysis indicated that the rs11506105 G/G genotype, the rs3752651 and rs1468727 C/C genotype and the rs845552 A/A genotype correlated inversely with OS and PFS. In addition, OS among patients with the rs730437 C/C genotype (p = 0.030) was significantly lower OS than among patients with A/A genotype. These data suggest that five EGFR SNPs (rs11506105, rs3752651, rs1468727, rs845552 and rs730437) correlated with glioma patient prognosis, and should be furthered validated in studies of ethnically diverse patients. PMID:27437777

A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

PubMed

Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

2005-02-01

A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

PubMed

Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

2015-11-05

Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

PubMed

Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

2017-07-01

The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Capturing haplotypes in germplasm core collections

USDA-ARS?s Scientific Manuscript database

Genomewide data sets of single nucleotide polymorphisms (SNPs) offer great potential to improve ex situ conservation. Two factors impede their use for producing core collections. First, due to the large number of SNPs, the assembly of collections that maximize diversity may be intractable using ex...

Marker-assisted backcross approach for important agronomic traits of sorghum

USDA-ARS?s Scientific Manuscript database

Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

eQTL networks unveil enriched mRNA master integrators downstream of complex disease-associated SNPs.

PubMed

Li, Haiquan; Pouladi, Nima; Achour, Ikbel; Gardeux, Vincent; Li, Jianrong; Li, Qike; Zhang, Hao Helen; Martinez, Fernando D; 'Skip' Garcia, Joe G N; Lussier, Yves A

2015-12-01

The causal and interplay mechanisms of Single Nucleotide Polymorphisms (SNPs) associated with complex diseases (complex disease SNPs) investigated in genome-wide association studies (GWAS) at the transcriptional level (mRNA) are poorly understood despite recent advancements such as discoveries reported in the Encyclopedia of DNA Elements (ENCODE) and Genotype-Tissue Expression (GTex). Protein interaction network analyses have successfully improved our understanding of both single gene diseases (Mendelian diseases) and complex diseases. Whether the mRNAs downstream of complex disease genes are central or peripheral in the genetic information flow relating DNA to mRNA remains unclear and may be disease-specific. Using expression Quantitative Trait Loci (eQTL) that provide DNA to mRNA associations and network centrality metrics, we hypothesize that we can unveil the systems properties of information flow between SNPs and the transcriptomes of complex diseases. We compare different conditions such as naïve SNP assignments and stringent linkage disequilibrium (LD) free assignments for transcripts to remove confounders from LD. Additionally, we compare the results from eQTL networks between lymphoblastoid cell lines and liver tissue. Empirical permutation resampling (p<0.001) and theoretic Mann-Whitney U test (p<10(-30)) statistics indicate that mRNAs corresponding to complex disease SNPs via eQTL associations are likely to be regulated by a larger number of SNPs than expected. We name this novel property mRNA hubness in eQTL networks, and further term mRNAs with high hubness as master integrators. mRNA master integrators receive and coordinate the perturbation signals from large numbers of polymorphisms and respond to the personal genetic architecture integratively. This genetic signal integration contrasts with the mechanism underlying some Mendelian diseases, where a genetic polymorphism affecting a single protein hub produces a divergent signal that affects a large number of downstream proteins. Indeed, we verify that this property is independent of the hubness in protein networks for which these mRNAs are transcribed. Our findings provide novel insights into the pleiotropy of mRNAs targeted by complex disease polymorphisms and the architecture of the information flow between the genetic polymorphisms and transcriptomes of complex diseases. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

PubMed

Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

2018-01-01

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity within each population. We also provide functional annotation based on the genome position of each SNP and evaluate the use of clonal lines for filtering of PSVs and MSVs. These SNPs form a new database, which provides an important resource for a new high density SNP array design and for other SNP genotyping platforms used for genetic and genomics studies of this iconic salmonid fish species.

Using microarray analysis to evaluate genetic polymorphisms involved in the metabolism of environmental chemicals.

PubMed

Ban, Susumu; Kondo, Tomoko; Ishizuka, Mayumi; Sasaki, Seiko; Konishi, Kanae; Washino, Noriaki; Fujita, Syoichi; Kishi, Reiko

2007-05-01

The field of molecular biology currently faces the need for a comprehensive method of evaluating individual differences derived from genetic variation in the form of single nucleotide polymorphisms (SNPs). SNPs in human genes are generally considered to be very useful in determining inherited genetic disorders, susceptibility to certain diseases, and cancer predisposition. Quick and accurate discrimination of SNPs is the key characteristic of technology used in DNA diagnostics. For this study, we first developed a DNA microarray and then evaluated its efficacy by determining the detection ability and validity of this method. Using DNA obtained from 380 pregnant Japanese women, we examined 13 polymorphisms of 9 genes, which are associated with the metabolism of environmental chemical compounds found in high frequency among Japanese populations. The ability to detect CYP1A1 I462V, CYP1B1 L432V, GSTP1 I105V and AhR R554K gene polymorphisms was above 98%, and agreement rates when compared with real time PCR analysis methods (kappa values) showed high validity: 0.98 (0.96), 0.97 (0.93), 0.90 (0.81), 0.90 (0.91), respectively. While this DNA microarray analysis should prove important as a method for initial screening, it is still necessary that we find better methods for improving the detection of other gene polymorphisms not part of this study.

Genetic Diversity in the Prion Protein Gene (PRNP) of Domestic Cattle and Water Buffaloes in Vietnam, Indonesia and Thailand

PubMed Central

UCHIDA, Leo; HERIYANTO, Agus; THONGCHAI, Chalermchaikit; HANH, Tran Thi; HORIUCHI, Motohiro; ISHIHARA, Kanako; TAMURA, Yutaka; MURAMATSU, Yasukazu

2014-01-01

ABSTRACT There has been an accumulation of information on frequencies of insertion/deletion (indel) polymorphisms within the bovine prion protein gene (PRNP) and on the number of octapeptide repeats and single nucleotide polymorphisms (SNPs) in the coding region of bovine PRNP related to bovine spongiform encephalopathy (BSE) susceptibility. We investigated the frequencies of 23-bp indel polymorphism in the promoter region (23indel) and 12-bp indel polymorphism in intron 1 region (12indel), octapeptide repeat polymorphisms and SNPs in the bovine PRNP of cattle and water buffaloes in Vietnam, Indonesia and Thailand. The frequency of the deletion allele in the 23indel site was significantly low in cattle of Indonesia and Thailand and water buffaloes. The deletion allele frequency in the 12indel site was significantly low in all of the cattle and buffaloes categorized in each subgroup. In both indel sites, the deletion allele has been reported to be associated with susceptibility to classical BSE. In some Indonesian local cattle breeds, the frequency of the allele with 5 octapeptide repeats was significantly high despite the fact that the allele with 6 octapeptide repeats has been reported to be most frequent in many breeds of cattle. Four SNPs observed in Indonesian local cattle have not been reported for domestic cattle. This study provided information on PRNP of livestock in these Southeast Asian countries. PMID:24705506

Polymorphisms of the resistin gene and their association with obesity and resistin levels in Malaysian Malays.

PubMed

Apalasamy, Yamunah Devi; Rampal, Sanjay; Salim, Agus; Moy, Foong Ming; Su, Tin Tin; Majid, Hazreen Abdul; Bulgiba, Awang; Mohamed, Zahurin

2015-06-01

Single nucleotide polymorphisms (SNP) in the resistin gene (RETN) are linked to obesity and resistin levels in various populations. However, results have been inconsistent. This study aimed to investigate association between polymorphisms in the resistin gene with obesity in a homogenous Malaysian Malay population. This study is also aimed to determine association between resistin levels with certain SNPs and haplotypes of RETN. A total of 631 Malaysian Malay subjects were included in this study and genotyping was carried out using Sequenom MassARRAY. There was no significant difference found in both allelic and genotype frequencies of each of the RETN SNPs between the obese and non-obese groups after Bonferroni correction. RETN rs34861192 and rs3219175 SNPs were significantly associated with log-resistin levels. The GG genotype carriers are found to have higher levels of log-resistin compared to A allele carriers. The RETN haplotypes (CAG, CGA and GA) were significantly associated with resistin levels. However, the haplotypes of the RETN gene were not associated with obesity. Resistin levels were not correlated to metabolic parameters such as body weight, waist circumference, body mass index, and lipid parameters. RETN SNPs and haplotypes are of apparent functional importance in the regulation of resistin levels but are not correlated with obesity and related markers.

Development of genetic markers in abalone through construction of a SNP database.

PubMed

Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S

2011-06-01

In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis. © 2010 NFRDI, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

EPH Receptor B4 (EPHB4) Gene Polymorphisms and Risk of Intracranial Hemorrhage in Patients with Brain Arteriovenous Malformations

PubMed Central

Weinsheimer, Shantel; Kim, Helen; Pawlikowska, Ludmila; Chen, Yongmei; Lawton, Michael T.; Sidney, Stephen; Kwok, Pui-Yan; McCulloch, Charles E.; Young, William L.

2009-01-01

Background Brain arteriovenous malformations (BAVM) are a tangle of abnormal vessels directly shunting blood from the arterial to venous circulation and an important cause of intracranial hemorrhage (ICH). EphB4 is involved in arterial-venous determination during embryogenesis; altered signaling could lead to vascular instability resulting in ICH. We investigated the association of single-nucleotide polymorphisms (SNPs) and haplotypes in EPHB4 with risk of ICH at clinical presentation in BAVM patients. Methods and Results Eight haplotype-tagging SNPs spanning ∼29 kb were tested for association with ICH presentation in 146 Caucasian BAVM patients (phase I: 56 ICH, 90 non-ICH) using allelic, haplotypic, and principal components analysis. Associated SNPs were then genotyped in 102 additional cases (phase II: 37 ICH, 65 non-ICH) and data combined for multivariable logistic regression. Minor alleles of 2 SNPs were associated with reduced risk of ICH presentation (rs314313 C, P=0.005; rs314308 T, P=0.0004). Overall, haplotypes were also significantly associated with ICH presentation (χ2=17.24, 6 df, P=0.008); 2 haplotypes containing the rs314308 T allele (GCCTGGGT, P=0.003; GTCTGGGC, P=0.036) were associated with reduced risk. In principal components analysis, 2 components explained 91% of the variance, and complemented haplotype results by implicating 4 SNPs at the 5′ end, including rs314308 and rs314313. These 2 SNPs were replicated in the phase II cohort, and combined data resulted in greater significance (rs314313, P=0.0007; rs314308, P=0.00008). SNP association with ICH presentation persisted after adjusting for age, sex, BAVM size, and deep venous drainage. Conclusions EPHB4 polymorphisms are associated with risk of ICH presentation in BAVM patients, warranting further study. PMID:20031623

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Polymorphisms in genes related to inflammation and obesity and colorectal adenoma risk.

PubMed

Huang, Brian Z; Tsilidis, Konstantinos K; Smith, Michael W; Hoffman-Bolton, Judith; Visvanathan, Kala; Platz, Elizabeth A; Joshu, Corinne E

2018-05-26

We previously investigated the association between single nucleotide polymorphisms (SNPs) in genes related to obesity and inflammation and colorectal cancer in the CLUE II cohort. However, the relationships between these SNPs and colorectal adenomas have not been well evaluated. In a nested case-control study of 135 incident adenoma cases and 269 matched controls in the CLUE II cohort (1989-2000), we genotyped 17 candidate SNPs in 12 genes (PPARG, TCF7L2, ADIPOQ, LEP, IL10, CRP, TLR4, IL6, IL1B, IL8, TNF, RNASEL) and 19 tagSNPs in three genes (IL10, CRP, and TLR4). Conditional logistic regression was used to calculate odds ratios (OR) for adenomas (overall and by size, histology, location, number). Polymorphisms in the inflammatory-related genes CRP, ADIPOQ, IL6, and TLR4 were observed to be associated with adenoma risk. At rs1205 in CRP, T (minor allele) carriers had a higher risk (OR 1.67, 95%CI 1.07-2.60; reference: CC) of adenomas overall and adenomas with aggressive characteristics. At rs1201299 in ADIPOQ, the AC genotype had a higher risk (OR 1.58, 95%CI 1.00-2.49) of adenomas, while the minor AA genotype had a borderline inverse association (OR 0.44, 95%CI 0.18-1.08; reference: CC). At rs1800797 in IL6, the AA genotype had a borderline inverse association (OR 0.53, 95%CI 0.27-1.05; reference: GG). Three TLR4 tagSNPs (rs10116253, rs1927911, rs7873784) were associated with adenomas among obese participants. None of these SNPs were associated with colorectal cancer in our prior study in CLUE II, possibly suggesting a different genetic etiology for early colorectal neoplasia. © 2018 Wiley Periodicals, Inc.

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Transcriptome-wide single nucleotide polymorphisms (SNPs) for abalone (Haliotis midae): validation and application using GoldenGate medium-throughput genotyping assays.

PubMed

Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay

2013-09-23

Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

PubMed Central

Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

2015-01-01

Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

PubMed Central

Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

2016-01-01

Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

Ovine Reference Materials and Assays for Prion Genetic Testing

USDA-ARS?s Scientific Manuscript database

Codon variants implicated in scrapie susceptibility or disease progression include those at amino acid positions 112, 136, 141, 154, and 171. Nine single nucleotide polymorphisms (SNPs) determine which residues are encoded by the five implicated codons and accurately scoring these SNPs is essential...

Large-scale enrichment and discovery of gene-associated SNPs

USDA-ARS?s Scientific Manuscript database

With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

PubMed

García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

2013-12-01

Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

PubMed

Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

2010-07-06

The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

PubMed Central

Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

2013-01-01

Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects

PubMed Central

Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran

2016-01-01

Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Results Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. Conclusions DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects. PMID:27111895

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Al-Absi, Boshra; Muniandy, Sekaran

2016-01-01

Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects.

A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

PubMed

Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

2013-12-01

Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

In silico identification of genetic variants in glucocerebrosidase (GBA) gene involved in Gaucher's disease using multiple software tools.

PubMed

Manickam, Madhumathi; Ravanan, Palaniyandi; Singh, Pratibha; Talwar, Priti

2014-01-01

Gaucher's disease (GD) is an autosomal recessive disorder caused by the deficiency of glucocerebrosidase, a lysosomal enzyme that catalyses the hydrolysis of the glycolipid glucocerebroside to ceramide and glucose. Polymorphisms in GBA gene have been associated with the development of Gaucher disease. We hypothesize that prediction of SNPs using multiple state of the art software tools will help in increasing the confidence in identification of SNPs involved in GD. Enzyme replacement therapy is the only option for GD. Our goal is to use several state of art SNP algorithms to predict/address harmful SNPs using comparative studies. In this study seven different algorithms (SIFT, MutPred, nsSNP Analyzer, PANTHER, PMUT, PROVEAN, and SNPs&GO) were used to predict the harmful polymorphisms. Among the seven programs, SIFT found 47 nsSNPs as deleterious, MutPred found 46 nsSNPs as harmful. nsSNP Analyzer program found 43 out of 47 nsSNPs are disease causing SNPs whereas PANTHER found 32 out of 47 as highly deleterious, 22 out of 47 are classified as pathological mutations by PMUT, 44 out of 47 were predicted to be deleterious by PROVEAN server, all 47 shows the disease related mutations by SNPs&GO. Twenty two nsSNPs were commonly predicted by all the seven different algorithms. The common 22 targeted mutations are F251L, C342G, W312C, P415R, R463C, D127V, A309V, G46E, G202E, P391L, Y363C, Y205C, W378C, I402T, S366R, F397S, Y418C, P401L, G195E, W184R, R48W, and T43R.

Associations between incident ischemic stroke events and stroke and cardiovascular disease-related genome-wide association studies single nucleotide polymorphisms in the Population Architecture Using Genomics and Epidemiology study.

PubMed

Carty, Cara L; Buzková, Petra; Fornage, Myriam; Franceschini, Nora; Cole, Shelley; Heiss, Gerardo; Hindorff, Lucia A; Howard, Barbara V; Mann, Sue; Martin, Lisa W; Zhang, Ying; Matise, Tara C; Prentice, Ross; Reiner, Alexander P; Kooperberg, Charles

2012-04-01

Genome-wide association studies (GWAS) have identified loci associated with ischemic stroke (IS) and cardiovascular disease (CVD) in European-descent individuals, but their replication in different populations has been largely unexplored. Nine single nucleotide polymorphisms (SNPs) selected from GWAS and meta-analyses of stroke, and 86 SNPs previously associated with myocardial infarction and CVD risk factors, including blood lipids (high density lipoprotein [HDL], low density lipoprotein [LDL], and triglycerides), type 2 diabetes, and body mass index (BMI), were investigated for associations with incident IS in European Americans (EA) N=26 276, African-Americans (AA) N=8970, and American Indians (AI) N=3570 from the Population Architecture using Genomics and Epidemiology Study. Ancestry-specific fixed effects meta-analysis with inverse variance weighting was used to combine study-specific log hazard ratios from Cox proportional hazards models. Two of 9 stroke SNPs (rs783396 and rs1804689) were significantly associated with [corrected] IS hazard in AA; none were significant in this large EA cohort. Of 73 CVD risk factor SNPs tested in EA, 2 (HDL and triglycerides SNPs) were associated with IS. In AA, SNPs associated with LDL, HDL, and BMI were significantly associated with IS (3 of 86 SNPs tested). Out of 58 SNPs tested in AI, 1 LDL SNP was significantly associated with IS. Our analyses showing lack of replication in spite of reasonable power for many stroke SNPs and differing results by ancestry highlight the need to follow up on GWAS findings and conduct genetic association studies in diverse populations. We found modest IS associations with BMI and lipids SNPs, though these findings require confirmation.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

Single nucleotide polymorphisms in long noncoding RNA, ANRIL, are not associated with severe periodontitis but with adverse cardiovascular events among patients with cardiovascular disease.

PubMed

Schulz, S; Seitter, L; Werdan, K; Hofmann, B; Schaller, H-G; Schlitt, A; Reichert, S

2018-05-06

Biological plausibility of an association between severe periodontitis and cardiovascular disease (CVD) has been proven. Genetic characteristics play an important role in both complex inflammatory diseases. Polymorphisms (single nucleotide polymorphisms [SNPs]) in the long noncoding RNA, antisense noncoding RNA in the INK4 locus (ANRIL), were shown to play a leading role in both diseases. The primary objectives of the study were to assess, among cardiovascular (CV angiographically proven ≥50% stenosis of a main coronary artery) patients, the impact of ANRIL SNPs rs133049 and rs3217992 on the severity of periodontitis and the previous history of coronary events, as well as on the occurrence of further adverse CV events. The prevalence of severe periodontitis was analyzed in 1002 CV patients. ANRIL SNPs rs133049 and rs3217992 were genotyped. The prognostic value of both ANRIL SNPs for combined CV endpoint (stroke/transient ischemic attack [TIA], myocardial infarction, death from a CV-related event, death from stroke) was evaluated after a 3-year follow-up period. Hazard ratios (HRs) were adjusted for established CV risk factors applying Cox regression. ANRIL SNPs rs133049 and rs3217992 were not associated with severe periodontitis or history of CVD in CV patients. In the Kaplan-Meier survival curve including the log rank-test (P = .036) and Cox regression (hazard ratio = 1.684, P = .009) the AA genotype of rs3217992 was shown to be an independent predictor for adverse CV events after 3 years of follow-up. SNPs in ANRIL are not risk modulators for severe periodontitis and history of CVD in CV patients. The AA genotype of ANRIL SNPs rs3217992 possesses prognostic power for further CV events within 3 years of follow-up. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio)

PubMed Central

2014-01-01

Background A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. Results The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. Conclusions The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species. PMID:24762296

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).

PubMed

Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen

2014-04-24

A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.

Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

PubMed

Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

2014-06-01

It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

PubMed

Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

2017-04-01

This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

HERC1 polymorphisms: population-specific variations in haplotype composition.

PubMed

Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

2009-08-01

Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

Associations Between Polymorphisms in the Glucocorticoid-Receptor Gene and Cardiovascular Risk Factors in a Chinese Population

PubMed Central

Yan, Yu-Xiang; Dong, Jing; Wu, Li-Juan; Shao, Shuang; Zhang, Jie; Zhang, Ling; Wang, Wei; He, Yan; Liu, You-Qin

2013-01-01

Background Glucocorticoid is an important regulator of energy homeostasis. Glucocorticoid receptor (GR) gene polymorphisms that contribute to variability in glucocorticoid sensitivity have been identified. We explored the associations of single-nucleotide polymorphisms (SNPs) of the GR gene with traditional cardiovascular risk factors in the Chinese Han population. Methods We recruited 762 consecutive adults who underwent a regular physical examination at Beijing Xuanwu Hospital. Blood pressure, glucose, lipid levels (total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein [LDL] cholesterol and triglycerides), body mass index (BMI), and waist-to-hip ratio were measured. Fourteen tag SNPs and 5 functional SNPs were selected and genotyped using the high-throughput Sequenom genotyping platform. Differences between genotypes/alleles for each SNP were adjusted for sex and age and tested using a general linear model procedure. Various models of inheritance, including additive, dominant, and recessive, were tested. Results Among the 19 SNPs examined, 5 markers were associated with cardiovascular risk factors. The rs41423247 GG genotype and the rs7701443 AA genotype were associated with higher BMI and systolic blood pressure (P < 0.0004), and the rs17209251 GG genotype was associated with higher systolic blood pressure (P < 0.0004). Lower systolic blood pressure, total cholesterol, and LDL cholesterol were observed among rs10052957 A allele carriers (P < 0.0004), and lower plasma glucose and LDL-cholesterol concentrations were observed among rs2963156 TT carriers (P < 0.0004). Conclusions Polymorphism of the GR gene was associated with cardiovascular risk factors and may contribute to susceptibility to cardiovascular disease. PMID:23892712

Lack of association of two chromosome 10q24 SNPs with Alzheimer’s disease

PubMed Central

Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas

2006-01-01

Several groups have reported evidence of linkage on chromosome 10 to late-onset Alzheimer’s disease (LOAD). In a recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10, significant associations between the rs498055 and rs4417206 SNPs and risk of LOAD were observed. We examined the association of these two SNPs with LOAD risk in a large Caucasian American cohort comprising about 2,000 cases and controls. Neither SNP revealed significant association with LOAD risk or age-at-onset. PMID:17000046

Association of μ-Calpain and Calpastatin Polymorphisms with Meat Tenderness in a Brahman–Angus Population

PubMed Central

Leal-Gutiérrez, Joel D.; Elzo, Mauricio A.; Johnson, Dwain D.; Scheffler, Tracy L.; Scheffler, Jason M.; Mateescu, Raluca G.

2018-01-01

Autogenous proteolytic enzymes of the calpain family are implicated in myofibrillar protein degradation. As a result, the μ-calpain gene and its specific inhibitor, calpastatin, have been repeatedly investigated for their association with meat quality traits in cattle; however, no functional mutation has been identified for these two genes. The objectives of this study were: (1) to assess breed composition effect on tenderness; (2) to perform a linkage disequilibrium (LD) analysis in μ-calpain and calpastatin genes as well as an association analyses with tenderness; and (3) to analyze putative functional SNPs inside the significant LD block for an effect on tenderness. Tenderness measurements and genotypes for 16 SNPs in μ-calpain gene and 28 SNPs in calpastatin gene from 673 steers were analyzed. A bioinformatic analysis identified “putative functional SNPs” inside the associated LD block – polymorphisms able to produce a physical and/or chemical change in the DNA, mRNA, or translated protein in silico. Breed composition had a significant (P < 0.0001) effect on tenderness where animals with more than 80% Angus composition had the most tender meat. One 11-kb LD-block and three LD-blocks of 37, 17, and 14 kb in length were identified in the μ-calpain and calpastatin genes, respectively. Out of these, the LD-block 3 in calpastatin, tagged by SNPs located at 7-98566391 and 7-98581038, had a significant effect on tenderness with the TG-CG diplotype being approximately 1 kg more tender than the toughest diplotype, TG-CG. A total of 768 SNPs in the LD-block 3 of calpastatin were included in the bioinformatic analysis, and 28 markers were selected as putative functional SNPs inside the LD-block 3 of calpastatin; however, none of them were polymorphic in this population. Out of 15 initial polymorphisms segregating inside the LD-block 3 of calpastatin in this population, markers ARSUSMARC116, Cast5, rs730723459, and rs210861835 were found to be significantly associated with tenderness. PMID:29520298

Genetic Association Study of KCNQ5 Polymorphisms with High Myopia.

PubMed

Liao, Xuan; Yap, Maurice K H; Leung, Kim Hung; Kao, Patrick Y P; Liu, Long Qian; Yip, Shea Ping

2017-01-01

Identification of genetic variations related to high myopia may advance our knowledge of the etiopathogenesis of refractive error. This study investigated the role of potassium channel gene (KCNQ5) polymorphisms in high myopia. We performed a case-control study of 1563 unrelated Han Chinese subjects (809 cases of high myopia and 754 emmetropic controls). Five tag single-nucleotide polymorphisms (SNPs) of KCNQ5 were genotyped, and association testing with high myopia was conducted using logistic regression analysis adjusted for sex and age to give P asym values, and multiple comparisons were corrected by permutation test to give P emp values. All five noncoding SNPs were associated with high myopia. The SNP rs7744813, previously shown to be associated with refractive error and myopia in two GWAS, showed an odds ratio of 0.75 (95% CI 0.63-0.90; P emp = 0.0058) for the minor allele. The top SNP rs9342979 showed an odds ratio of 0.75 (95% CI 0.64-0.89; P emp = 0.0045) for the minor allele. Both SNPs are located within enhancer histone marks and DNase-hypersensitive sites. Our data support the involvement of KCNQ5 gene polymorphisms in the genetic susceptibility to high myopia and further exploration of KCNQ5 as a risk factor for high myopia.

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

PubMed Central

Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang

2016-01-01

The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa.

PubMed

Acevedo, Summer F; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J

2015-08-30

Oxytocin is a peptide hormone important for social behavior and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether single nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

PubMed

Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

2018-01-30

Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Associations of Polymorphisms in the Apolipoprotein APOA1-C3-A5 Gene Cluster with Acute Coronary Syndrome

PubMed Central

Ding, Yan; Zhu, Ming An; Wang, Zhi Xiao; Zhu, Jing; Feng, Jing Bo; Li, Dong Sheng

2012-01-01

Background. Acute coronary syndromes (ACSs) are clinically cardiovascular events associated with dyslipidemia in common. Single nucleotide polymorphisms (SNPs) and haplotypes in the APOA1/C3/A5 gene cluster are associated with diabetes and familial combined hyperlipidaemia (FCH). Little is known about whether the polymorphisms in these genes affect lipid homeostasis in patients with ACSs. The present paper aimed to examine these associations with 4 SNPs in the APOA1 −75G > A, the APOC3 −455T > C, and APOA5 −1131T > C, c.553G > T variant to ACSs in Chinese Han. Methods. Chinese Han of 229 patients with ACSs and 254 unrelated controls were analyzed. Four SNPs in APOA1/C3/A5 cluster were genotyped and lipid was determined. Results. Our data show that minor allelic frequencies of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms in patients with ACSs were significantly higher than control group (P < 0.05). Furthermore, the 3 polymorphic sites were strongly of linkage disequilibrium, and minor alleles of 3 SNP sites had higher TG level than wild alleles (P < 0.05), APOC3 −455C and APOA5 c.553T allele carriers also had lower level of HDL-C. Conclusions. The minor alleles of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms are closely associated with ACSs. PMID:22675253

Polygenic influences on dyslipidemias.

PubMed

Dron, Jacqueline S; Hegele, Robert A

2018-04-01

Rare large-effect genetic variants underlie monogenic dyslipidemias, whereas common small-effect genetic variants - single nucleotide polymorphisms (SNPs) - have modest influences on lipid traits. Over the past decade, these small-effect SNPs have been shown to cumulatively exert consistent effects on lipid phenotypes under a polygenic framework, which is the focus of this review. Several groups have reported polygenic risk scores assembled from lipid-associated SNPs, and have applied them to their respective phenotypes. For lipid traits in the normal population distribution, polygenic effects quantified by a score that integrates several common polymorphisms account for about 20-30% of genetic variation. Among individuals at the extremes of the distribution, that is, those with clinical dyslipidemia, the polygenic component includes both rare variants with large effects and common polymorphisms: depending on the trait, 20-50% of susceptibility can be accounted for by this assortment of genetic variants. Accounting for polygenic effects increases the numbers of dyslipidemic individuals who can be explained genetically, but a substantial proportion of susceptibility remains unexplained. Whether documenting the polygenic basis of dyslipidemia will affect outcomes in clinical trials or prospective observational studies remains to be determined.

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle

PubMed Central

2013-01-01

Background Identification of single nucleotide polymorphisms (SNPs) for specific genes involved in reproduction might improve reliability of genomic estimates for these low-heritability traits. Semen from 550 Holstein bulls of high (≥ 1.7; n = 288) or low (≤ −2; n = 262) daughter pregnancy rate (DPR) was genotyped for 434 candidate SNPs using the Sequenom MassARRAY® system. Three types of SNPs were evaluated: SNPs previously reported to be associated with reproductive traits or physically close to genetic markers for reproduction, SNPs in genes that are well known to be involved in reproductive processes, and SNPs in genes that are differentially expressed between physiological conditions in a variety of tissues associated in reproductive function. Eleven reproduction and production traits were analyzed. Results A total of 40 SNPs were associated (P < 0.05) with DPR. Among these were genes involved in the endocrine system, cell signaling, immune function and inhibition of apoptosis. A total of 10 genes were regulated by estradiol. In addition, 22 SNPs were associated with heifer conception rate, 33 with cow conception rate, 36 with productive life, 34 with net merit, 23 with milk yield, 19 with fat yield, 13 with fat percent, 19 with protein yield, 22 with protein percent, and 13 with somatic cell score. The allele substitution effect for SNPs associated with heifer conception rate, cow conception rate, productive life and net merit were in the same direction as for DPR. Allele substitution effects for several SNPs associated with production traits were in the opposite direction as DPR. Nonetheless, there were 29 SNPs associated with DPR that were not negatively associated with production traits. Conclusion SNPs in a total of 40 genes associated with DPR were identified as well as SNPs for other traits. It might be feasible to include these SNPs into genomic tests of reproduction and other traits. The genes associated with DPR are likely to be important for understanding the physiology of reproduction. Given the large number of SNPs associated with DPR that were not negatively associated with production traits, it should be possible to select for DPR without compromising production. PMID:23759029

Analysis of Over 10,000 Cases Finds No Association between Previously-Reported Candidate Polymorphisms and Ovarian Cancer Outcome

PubMed Central

White, Kristin L.; Vierkant, Robert A.; Fogarty, Zachary C.; Charbonneau, Bridget; Block, Matthew S.; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Rossing, Mary Anne; Cramer, Daniel W.; Pearce, C. Leigh; Schildkraut, Joellen M.; Menon, Usha; Kjaer, Susanne Kruger; Levine, Douglas A.; Gronwald, Jacek; Culver, Hoda Anton; Whittemore, Alice S.; Karlan, Beth Y.; Lambrechts, Diether; Wentzensen, Nicolas; Kupryjanczyk, Jolanta; Chang-Claude, Jenny; Bandera, Elisa V.; Hogdall, Estrid; Heitz, Florian; Kaye, Stanley B.; Fasching, Peter A.; Campbell, Ian; Goodman, Marc T.; Pejovic, Tanja; Bean, Yukie; Lurie, Galina; Eccles, Diana; Hein, Alexander; Beckmann, Matthias W.; Ekici, Arif B.; Paul, James; Brown, Robert; Flanagan, James; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Claus K.; Lundvall, Lene; Olson, Sara H.; Orlow, Irene; Paddock, Lisa E.; Rudolph, Anja; Eilber, Ursula; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K.; Ziolkowska-Seta, Izabela; Brinton, Louise; Yang, Hannah; Garcia-Closas, Montserrat; Despierre, Evelyn; Lambrechts, Sandrina; Vergote, Ignace; Walsh, Christine; Lester, Jenny; Sieh, Weiva; McGuire, Valerie; Rothstein, Joseph H.; Ziogas, Argyrios; Lubiński, Jan; Cybulski, Cezary; Menkiszak, Janusz; Jensen, Allan; Gayther, Simon A.; Ramus, Susan J.; Gentry-Maharaj, Aleksandra; Berchuck, Andrew; Wu, Anna H.; Pike, Malcolm C.; Van Den Berg, David; Terry, Kathryn L.; Vitonis, Allison F.; Doherty, Jennifer A.; Johnatty, Sharon; deFazio, Anna; Song, Honglin; Tyrer, Jonathan; Sellers, Thomas A.; Phelan, Catherine M.; Kalli, Kimberly R.; Cunningham, Julie M.; Fridley, Brooke L.; Goode, Ellen L.

2013-01-01

Background Ovarian cancer is a leading cause of cancer-related death among women. In an effort to understand contributors to disease outcome, we evaluated single-nucleotide polymorphisms (SNPs) previously associated with ovarian cancer recurrence or survival, specifically in angiogenesis, inflammation, mitosis, and drug disposition genes. Methods Twenty-seven SNPs in VHL, HGF, IL18, PRKACB, ABCB1, CYP2C8, ERCC2, and ERCC1 previously associated with ovarian cancer outcome were genotyped in 10,084 invasive cases from 28 studies from the Ovarian Cancer Association Consortium with over 37,000 observed person-years and 4,478 deaths. Cox proportional hazards models were used to examine the association between candidate SNPs and ovarian cancer recurrence or survival with and without adjustment for key covariates. Results We observed no association between genotype and ovarian cancer recurrence or survival for any of the SNPs examined. Conclusions These results refute prior associations between these SNPs and ovarian cancer outcome and underscore the importance of maximally powered genetic association studies. Impact These variants should not be used in prognostic models. Alternate approaches to uncovering inherited prognostic factors, if they exist, are needed. PMID:23513043

Modulation of C-reactive protein and plasma omega-6 fatty acid levels by phospholipase A2 gene polymorphisms following a 6-week supplementation with fish oil.

PubMed

Tremblay, B L; Rudkowska, I; Couture, P; Lemieux, S; Julien, P; Vohl, M C

2015-12-01

This clinical trial investigated the impact of a six-week supplementation with fish oil and single nucleotide polymorphisms (SNPs) in PLA2G4A and PLA2G6 genes on total omega-6 fatty acid (n-6 FA) levels in plasma phospholipids (PL) and plasma C-reactive protein (CRP) levels in 191 subjects. Interaction effects between SNPs and supplementation modulated total n-6 FAs and CRP levels in both men and women. Associations between SNPs and total n-6 FA levels and between SNPs and CRP levels were identified in men, independently of supplementation. Supplementation decreased total n-6 FAs without affecting plasma CRP levels. Changes in CRP levels correlated positively with changes in total n-6 FAs in men (r=0.25 p=0.01), but not in women. In conclusion, total n-6 FA levels in plasma PL and plasma CRP levels are modulated by SNPs within PLA2G4A and PLA2G6 genes alone or in combination with fish oil supplementation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

PubMed

Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

2018-04-19

ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

ESR1 and ESR2 polymorphisms in the BIG 1-98 trial comparing adjuvant letrozole versus tamoxifen or their sequence for early breast cancer.

PubMed

Leyland-Jones, Brian; Gray, Kathryn P; Abramovitz, Mark; Bouzyk, Mark; Young, Brandon; Long, Bradley; Kammler, Roswitha; Dell'Orto, Patrizia; Biasi, Maria Olivia; Thürlimann, Beat; Harvey, Vernon; Neven, Patrick; Arnould, Laurent; Maibach, Rudolf; Price, Karen N; Coates, Alan S; Goldhirsch, Aron; Gelber, Richard D; Pagani, Olivia; Viale, Giuseppe; Rae, James M; Regan, Meredith M

2015-12-01

Estrogen receptor 1 (ESR1) and ESR2 gene polymorphisms have been associated with endocrine-mediated physiological mechanisms, and inconsistently with breast cancer risk and outcomes, bone mineral density changes, and hot flushes/night sweats. DNA was isolated and genotyped for six ESR1 and two ESR2 single-nucleotide polymorphisms (SNPs) from tumor specimens from 3691 postmenopausal women with hormone receptor-positive breast cancer enrolled in the BIG 1-98 trial to receive tamoxifen and/or letrozole for 5 years. Associations with recurrence and adverse events (AEs) were assessed using Cox proportional hazards models. 3401 samples were successfully genotyped for five SNPs. ESR1 rs9340799(XbaI) (T>C) variants CC or TC were associated with reduced breast cancer risk (HR = 0.82,95% CI = 0.67-1.0), and ESR1 rs2077647 (T>C) variants CC or TC was associated with reduced distant recurrence risk (HR = 0.69, 95% CI = 0.53-0.90), both regardless of the treatments. No differential treatment effects (letrozole vs. tamoxifen) were observed for the association of outcome with any of the SNPs. Letrozole-treated patients with rs2077647 (T>C) variants CC and TC had a reduced risk of bone AE (HR = 0.75, 95% CI = 0.58-0.98, P interaction = 0.08), whereas patients with rs4986938 (G>A) genotype variants AA and AG had an increased risk of bone AE (HR = 1.37, 95% CI = 1.01-1.84, P interaction = 0.07). We observed that (1) rare ESR1 homozygous polymorphisms were associated with lower recurrence, and (2) ESR1 and ESR2 SNPs were associated with bone AEs in letrozole-treated patients. Genes that are involved in estrogen signaling and synthesis have the potential to affect both breast cancer recurrence and side effects, suggesting that individual treatment strategies can incorporate not only oncogenic drivers but also SNPs related to estrogen activity.

Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

PubMed

Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

2015-11-14

Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.

Association of Androgen Metabolism Gene Polymorphisms with Prostate Cancer Risk and Androgen Concentrations: Results from the Prostate Cancer Prevention Trial

PubMed Central

Price, Douglas K.; Chau, Cindy H.; Till, Cathee; Goodman, Phyllis J.; Leach, Robin J.; Johnson-Pais, Teresa L.; Hsing, Ann W.; Hoque, Ashraful; Parnes, Howard L.; Schenk, Jeannette M.; Tangen, Catherine M.; Thompson, Ian M.; Reichardt, Juergen K.V.; Figg, William D.

2016-01-01

Background Prostate cancer is highly influenced by androgens and genes. We investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or risk of prostate cancer or high-grade disease from finasteride treatment. Methods A nested case-control study from the Prostate Cancer Prevention Trial using cases drawn from men with biopsy-proven prostate cancer and biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with total, low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. Results There were significant associations of genetic polymorphisms in SRD5A1 (rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with risk of high-grade prostate cancer in the placebo arm of the PCPT; two SNPs were significantly associated with increased risk (SRD5A1 rs472402 [OR, 1.70; 95% CI, 1.05-2.75, Ptrend=0.03]; SRD5A2 rs2300700 [OR, 1.94; 95% CI, 1.19-3.18, Ptrend=0.01]). Eleven SNPs in SRD5A1, SRD5A2, CYP1B1, and CYP3A4 were found to be associated with modifying mean serum androgen and sex hormone-binding globulin concentrations; two SNPs (SRD5A1 rs824811 and CYP1B1 rs10012, Ptrend<0.05) consistently and significantly altered all androgen concentrations. Several SNPs (rs3822430, rs2300700; CYP3A43 rs800672; CYP19 rs700519; Ptrend<0.05) were significantly associated with both circulating hormone levels and prostate cancer risk. Conclusion Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. PMID:27164191

High resolution melting analysis is a more sensitive and effective alternative to gel-based platforms in analysis of SSR--an example in citrus.

PubMed

Distefano, Gaetano; Caruso, Marco; La Malfa, Stefano; Gentile, Alessandra; Wu, Shu-Biao

2012-01-01

High resolution melting curve analysis (HRM) has been used as an efficient, accurate and cost-effective tool to detect single nucleotide polymorphisms (SNPs) or insertions or deletions (INDELs). However, its efficiency, accuracy and applicability to discriminate microsatellite polymorphism have not been extensively assessed. The traditional protocols used for SSR genotyping include PCR amplification of the DNA fragment and the separation of the fragments on electrophoresis-based platform. However, post-PCR handling processes are laborious and costly. Furthermore, SNPs present in the sequences flanking repeat motif cannot be detected by polyacrylamide-gel-electrophoresis based methods. In the present study, we compared the discriminating power of HRM with the traditional electrophoresis-based methods and provided a panel of primers for HRM genotyping in Citrus. The results showed that sixteen SSR markers produced distinct polymorphic melting curves among the Citrus spp investigated through HRM analysis. Among those, 10 showed more genotypes by HRM analysis than capillary electrophoresis owing to the presence of SNPs in the amplicons. For the SSR markers without SNPs present in the flanking region, HRM also gave distinct melting curves which detected same genotypes as were shown in capillary electrophoresis (CE) analysis. Moreover, HRM analysis allowed the discrimination of most of the 15 citrus genotypes and the resulting genetic distance analysis clustered them into three main branches. In conclusion, it has been approved that HRM is not only an efficient and cost-effective alternative of electrophoresis-based method for SSR markers, but also a method to uncover more polymorphisms contributed by SNPs present in SSRs. It was therefore suggested that the panel of SSR markers could be used in a variety of applications in the citrus biodiversity and breeding programs using HRM analysis. Furthermore, we speculate that the HRM analysis can be employed to analyse SSR markers in a wide range of applications in all other species.

Association of polymorphisms in microRNA machinery genes (DROSHA, DICER1, RAN, and XPO5) with risk of idiopathic primary ovarian insufficiency in Korean women.

PubMed

Rah, HyungChul; Jeon, Young Joo; Lee, Bo Eun; Kim, Jung O; Shim, Sung Han; Lee, Woo Sik; Choi, Dong Hee; Kim, Ji Hyang; Kim, Nam Keun

2013-10-01

The aim of our study was to investigate whether polymorphisms in microRNA machinery genes are associated with the risk of primary ovarian insufficiency (POI). We genotyped 136 POI patients and 236 controls among Korean women for nine single nucleotide polymorphisms (SNPs; DROSHA rs6877842 and rs10719; DICER1 rs13078 and rs3742330; RAN rs14035; and XPO5 rs34324334, rs2257082, rs11544382, and rs11077) by polymerase chain reaction-restriction fragment length polymorphism analysis. Differences in genotype frequencies between patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as measures of the strength of the association between genotype and POI. Of the nine SNPs, XPO5 rs34324334 and rs11544382 were monomorphic and were not analyzed further. The XPO5 rs2257082 CT and CT + TT variant genotypes were more frequent in patients (OR, 2.097; 95% CI, 1.207-3.645) than in controls (OR, 2.030; 95% CI, 1.196-3.445). The combined frequencies of XPO5 rs2257082 CT + TT and rs11077 AC + CC genotypes were higher in patients than in controls (OR, 2.526; 95% CI, 1.088-5.865). An association of POI risk with other polymorphisms was not found. A haplotype-based analysis of seven polymorphisms of the microRNA machinery genes for gene-gene interactions suggests that ***ACTA, ***GCCA, ***G*C*, *T*ATTA, and ***ACT* haplotypes (asterisk indicates SNP locus not included; DROSHA rs6877842 and rs10719, DICER1 rs13078 and rs3742330, RAN rs14035, and XPO5 rs2257082 and rs11077 polymorphisms) are associated with higher POI prevalence, and that ***GCTA, ***ACCA, *C*ATTA, and *C*ATT* haplotypes are associated with lower POI prevalence. Our data demonstrate that the XPO5 rs2257082 T variant allele occurs more frequently in POI patients than in controls, suggesting that this allele may be associated with increased POI risk.

The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs.

PubMed

Udagawa, Chihiro; Tada, Naomi; Asano, Junzo; Ishioka, Katsumi; Ochiai, Kazuhiko; Bonkobara, Makoto; Tsuchida, Shuichi; Omi, Toshinori

2014-12-11

The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family that play an important role in energy homeostasis. Genetic association studies have shown that human UCP2 and UCP3 variants (SNPs and indels) are associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome. The aim of this study was to examine the genetic association between polymorphisms in UCP2 and UCP3 and metabolic data in dogs. We identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2, and 13 SNPs (11 intronic and 2 exonic) and one indel (exonic) in UCP3, by DNA sequence analysis of 11 different dog breeds (n=119). An association study between these UCP2 and UCP3 variants and the biochemical parameters of glucose, total cholesterol, lactate dehydrogenase and triglyceride in Labrador Retrievers (n=50) showed that none of the UCP2 polymorphisms were significantly associated with the levels of these parameters. However, four UCP3 SNPs (intron 1) were significantly associated with total cholesterol levels. In addition, the allele frequencies of two of the four SNPs associated with higher total cholesterol levels in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs, n=30), compared with the control breed (Shiba, n=30). The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. The examination of larger sample sizes and further analysis will lead to increased precision of these results.

Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum).

PubMed

Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh

2014-02-01

Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.

IL28B polymorphisms of both recipient and donor cooperate to influence IFN treatment response in HCV recurrence after liver transplantation, but IL28B SNPs of the recipient play a major role in IFN-induced blocking of HCV replication.

PubMed

Barbera, Floriana; Russelli, Giovanna; Pipitone, Loredana; Pietrosi, Giada; Corsale, Sveva; Vizzini, Giovanni; Gridelli, Bruno; Conaldi, Pier Giulio

2015-04-01

Single nucleotide polymorphisms (SNPs) of the IL28B locus are associated with a positive response to pegylated interferon-alpha and ribavirin (pegIFN-alpha/RBV) treatment of HCV-infected patients. This study evaluated the association between SNPs rs12980275, rs12979860 and rs8099917 and treatment outcome of HCV recurrent infection in HCV-positive patients who underwent liver transplant. We aimed to assess to what extent recipient and/or graft donor IL28B polymorphisms contribute to HCV clearance after transplantation influencing the response to the antiviral treatment. We found that the allele frequencies in donors were in agreement with the pattern expected in the European population. The frequency of favourable genotypes was significantly lower in recipients than in donors, reasonably because the recipients represented a group of patients affected by chronic Hepatitis C. Our study demonstrated that the positive outcome of the pegIFN-alpha/RBV treatment of HCV recurrence is associated with the co-presence of favourable genotypes of both donors and recipients. However, IL28B SNPs of the recipient seem to play a major role in this clinical setting. In particular, homozygosis of rs12979860 favourable genotype in recipients was associated with sustained virological response independently from the donor's genotype. Thus, identification of these SNPs may be useful to predict the response to IFN-based therapy of HCV recurrent infection in liver-transplanted patients.

Joint Effects of Known Type 2 Diabetes Susceptibility Loci in Genome-Wide Association Study of Singapore Chinese: The Singapore Chinese Health Study

PubMed Central

Chen, Zhanghua; Pereira, Mark A.; Seielstad, Mark; Koh, Woon-Puay; Tai, E. Shyong; Teo, Yik-Ying; Liu, Jianjun; Hsu, Chris; Wang, Renwei; Odegaard, Andrew O.; Thyagarajan, Bharat; Koratkar, Revati; Yuan, Jian-Min; Gross, Myron D.; Stram, Daniel O.

2014-01-01

Background Genome-wide association studies (GWAS) have identified genetic factors in type 2 diabetes (T2D), mostly among individuals of European ancestry. We tested whether previously identified T2D-associated single nucleotide polymorphisms (SNPs) replicate and whether SNPs in regions near known T2D SNPs were associated with T2D within the Singapore Chinese Health Study. Methods 2338 cases and 2339 T2D controls from the Singapore Chinese Health Study were genotyped for 507,509 SNPs. Imputation extended the genotyped SNPs to 7,514,461 with high estimated certainty (r2>0.8). Replication of known index SNP associations in T2D was attempted. Risk scores were computed as the sum of index risk alleles. SNPs in regions ±100 kb around each index were tested for associations with T2D in conditional fine-mapping analysis. Results Of 69 index SNPs, 20 were genotyped directly and genotypes at 35 others were well imputed. Among the 55 SNPs with data, disease associations were replicated (at p<0.05) for 15 SNPs, while 32 more were directionally consistent with previous reports. Risk score was a significant predictor with a 2.03 fold higher risk CI (1.69–2.44) of T2D comparing the highest to lowest quintile of risk allele burden (p = 5.72×10−14). Two improved SNPs around index rs10923931 and 5 new candidate SNPs around indices rs10965250 and rs1111875 passed simple Bonferroni corrections for significance in conditional analysis. Nonetheless, only a small fraction (2.3% on the disease liability scale) of T2D burden in Singapore is explained by these SNPs. Conclusions While diabetes risk in Singapore Chinese involves genetic variants, most disease risk remains unexplained. Further genetic work is ongoing in the Singapore Chinese population to identify unique common variants not already seen in earlier studies. However rapid increases in T2D risk have occurred in recent decades in this population, indicating that dynamic environmental influences and possibly gene by environment interactions complicate the genetic architecture of this disease. PMID:24520337

Joint effects of known type 2 diabetes susceptibility loci in genome-wide association study of Singapore Chinese: the Singapore Chinese health study.

PubMed

Chen, Zhanghua; Pereira, Mark A; Seielstad, Mark; Koh, Woon-Puay; Tai, E Shyong; Teo, Yik-Ying; Liu, Jianjun; Hsu, Chris; Wang, Renwei; Odegaard, Andrew O; Thyagarajan, Bharat; Koratkar, Revati; Yuan, Jian-Min; Gross, Myron D; Stram, Daniel O

2014-01-01

Genome-wide association studies (GWAS) have identified genetic factors in type 2 diabetes (T2D), mostly among individuals of European ancestry. We tested whether previously identified T2D-associated single nucleotide polymorphisms (SNPs) replicate and whether SNPs in regions near known T2D SNPs were associated with T2D within the Singapore Chinese Health Study. 2338 cases and 2339 T2D controls from the Singapore Chinese Health Study were genotyped for 507,509 SNPs. Imputation extended the genotyped SNPs to 7,514,461 with high estimated certainty (r(2)>0.8). Replication of known index SNP associations in T2D was attempted. Risk scores were computed as the sum of index risk alleles. SNPs in regions ± 100 kb around each index were tested for associations with T2D in conditional fine-mapping analysis. Of 69 index SNPs, 20 were genotyped directly and genotypes at 35 others were well imputed. Among the 55 SNPs with data, disease associations were replicated (at p<0.05) for 15 SNPs, while 32 more were directionally consistent with previous reports. Risk score was a significant predictor with a 2.03 fold higher risk CI (1.69-2.44) of T2D comparing the highest to lowest quintile of risk allele burden (p = 5.72 × 10(-14)). Two improved SNPs around index rs10923931 and 5 new candidate SNPs around indices rs10965250 and rs1111875 passed simple Bonferroni corrections for significance in conditional analysis. Nonetheless, only a small fraction (2.3% on the disease liability scale) of T2D burden in Singapore is explained by these SNPs. While diabetes risk in Singapore Chinese involves genetic variants, most disease risk remains unexplained. Further genetic work is ongoing in the Singapore Chinese population to identify unique common variants not already seen in earlier studies. However rapid increases in T2D risk have occurred in recent decades in this population, indicating that dynamic environmental influences and possibly gene by environment interactions complicate the genetic architecture of this disease.

A web-based genome browser for 'SNP-aware' assay design

USDA-ARS?s Scientific Manuscript database

Human and animal genomes contain an abundance of single nucleotide polymorphisms (SNPs) that are useful for genetic testing. However, the relatively large number of SNPs present in diverse populations can pose serious problems when designing assays. It is important to “mask” some SNP positions so ...

Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

PubMed

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

PubMed Central

Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

2014-01-01

Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Design of a 9K illumina BeadChip for polar bears (Ursus maritimus) from RAD and transcriptome sequencing.

PubMed

Malenfant, René M; Coltman, David W; Davis, Corey S

2015-05-01

Single-nucleotide polymorphisms (SNPs) offer numerous advantages over anonymous markers such as microsatellites, including improved estimation of population parameters, finer-scale resolution of population structure and more precise genomic dissection of quantitative traits. However, many SNPs are needed to equal the resolution of a single microsatellite, and reliable large-scale genotyping of SNPs remains a challenge in nonmodel species. Here, we document the creation of a 9K Illumina Infinium BeadChip for polar bears (Ursus maritimus), which will be used to investigate: (i) the fine-scale population structure among Canadian polar bears and (ii) the genomic architecture of phenotypic traits in the Western Hudson Bay subpopulation. To this end, we used restriction-site associated DNA (RAD) sequencing from 38 bears across their circumpolar range, as well as blood/fat transcriptome sequencing of 10 individuals from Western Hudson Bay. Six-thousand RAD SNPs and 3000 transcriptomic SNPs were selected for the chip, based primarily on genomic spacing and gene function respectively. Of the 9000 SNPs ordered from Illumina, 8042 were successfully printed, and - after genotyping 1450 polar bears - 5441 of these SNPs were found to be well clustered and polymorphic. Using this array, we show rapid linkage disequilibrium decay among polar bears, we demonstrate that in a subsample of 78 individuals, our SNPs detect known genetic structure more clearly than 24 microsatellites genotyped for the same individuals and that these results are not driven by the SNP ascertainment scheme. Here, we present one of the first large-scale genotyping resources designed for a threatened species. © 2014 John Wiley & Sons Ltd.

Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

PubMed Central

Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

2009-01-01

Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

Genetic polymorphisms to predict gains in maximal O2 uptake and knee peak torque after a high intensity training program in humans.

PubMed

Yoo, Jinho; Kim, Bo-Hyung; Kim, Soo-Hwan; Kim, Yangseok; Yim, Sung-Vin

2016-05-01

The study aimed to identify single nucleotide polymorphisms (SNPs) that significantly influenced the level of improvement of two kinds of training responses, including maximal O2 uptake (V'O2max) and knee peak torque of healthy adults participating in the high intensity training (HIT) program. The study also aimed to use these SNPs to develop prediction models for individual training responses. 79 Healthy volunteers participated in the HIT program. A genome-wide association study, based on 2,391,739 SNPs, was performed to identify SNPs that were significantly associated with gains in V'O2max and knee peak torque, following 9 weeks of the HIT program. To predict two training responses, two independent SNPs sets were determined using linear regression and iterative binary logistic regression analysis. False discovery rate analysis and permutation tests were performed to avoid false-positive findings. To predict gains in V'O2max, 7 SNPs were identified. These SNPs accounted for 26.0 % of the variance in the increment of V'O2max, and discriminated the subjects into three subgroups, non-responders, medium responders, and high responders, with prediction accuracy of 86.1 %. For the knee peak torque, 6 SNPs were identified, and accounted for 27.5 % of the variance in the increment of knee peak torque. The prediction accuracy discriminating the subjects into the three subgroups was estimated as 77.2 %. Novel SNPs found in this study could explain, and predict inter-individual variability in gains of V'O2max, and knee peak torque. Furthermore, with these genetic markers, a methodology suggested in this study provides a sound approach for the personalized training program.

Development and evaluation of high-density Axiom® CicerSNP Array for high-resolution genetic mapping and breeding applications in chickpea.

PubMed

Roorkiwal, Manish; Jain, Ankit; Kale, Sandip M; Doddamani, Dadakhalandar; Chitikineni, Annapurna; Thudi, Mahendar; Varshney, Rajeev K

2018-04-01

To accelerate genomics research and molecular breeding applications in chickpea, a high-throughput SNP genotyping platform 'Axiom ® CicerSNP Array' has been designed, developed and validated. Screening of whole-genome resequencing data from 429 chickpea lines identified 4.9 million SNPs, from which a subset of 70 463 high-quality nonredundant SNPs was selected using different stringent filter criteria. This was further narrowed down to 61 174 SNPs based on p-convert score ≥0.3, of which 50 590 SNPs could be tiled on array. Among these tiled SNPs, a total of 11 245 SNPs (22.23%) were from the coding regions of 3673 different genes. The developed Axiom ® CicerSNP Array was used for genotyping two recombinant inbred line populations, namely ICCRIL03 (ICC 4958 × ICC 1882) and ICCRIL04 (ICC 283 × ICC 8261). Genotyping data reflected high success and polymorphic rate, with 15 140 (29.93%; ICCRIL03) and 20 018 (39.57%; ICCRIL04) polymorphic SNPs. High-density genetic maps comprising 13 679 SNPs spanning 1033.67 cM and 7769 SNPs spanning 1076.35 cM were developed for ICCRIL03 and ICCRIL04 populations, respectively. QTL analysis using multilocation, multiseason phenotyping data on these RILs identified 70 (ICCRIL03) and 120 (ICCRIL04) main-effect QTLs on genetic map. Higher precision and potential of this array is expected to advance chickpea genetics and breeding applications. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

PubMed

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

PubMed Central

Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

2012-01-01

Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

Bovine GDF10 gene polymorphism analysis and its association with body measurement traits in Chinese indigenous cattle.

PubMed

Adoligbe, C; Zan, Linsen; Farougou, S; Wang, Hongbao; Ujjan, J A

2012-04-01

The objective of this research was to detect bovine GDF10 gene polymorphism and analyze its association with body measurement traits (BMT) of animals sampled from 6 different Chinese indigenous cattle populations. The populations included Xuelong (Xl), Luxi (Lx), Qinchuan (Qc), Jiaxian red (Jx), Xianang (Xn) and Nanyang (Ny). Blood samples were taken from a total of 417 female animals stratified into age categories of 12-36 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out GDF10 single polymorphism nucleotide (SNPs) and explore their possible association with BMT. Sequence analysis of GDF10 gene revealed 3 SNPs in total: 1 in exon1 (G142A) and 2 in exon3 (A11471G, and T12495C). G142A and T12495C SNPs are both synonymous mutation. They showed 2 genotypes namely respectively (GG, GA) and (PP and PB). A11471G SNP is a missense mutation leading to the change of Alanine to Threonine amino acid. It showed three genotypes namely AA, BB and AB. Analysis of association of polymorphism with body measurement traits at the three locus showed that there were significant effects on BMT in Qc, Jx and Ny cattle population. These results suggest that the GDF10 gene might have potential effects on body measurement traits in the above mentioned cattle populations and could be used for marker-assisted selection.

Genomic variation at the tips of the adaptive radiation of Darwin's finches.

PubMed

Chaves, Jaime A; Cooper, Elizabeth A; Hendry, Andrew P; Podos, Jeffrey; De León, Luis F; Raeymaekers, Joost A M; MacMillan, W Owen; Uy, J Albert C

2016-11-01

Adaptive radiation unfolds as selection acts on the genetic variation underlying functional traits. The nature of this variation can be revealed by studying the tips of an ongoing adaptive radiation. We studied genomic variation at the tips of the Darwin's finch radiation; specifically focusing on polymorphism within, and variation among, three sympatric species of the genus Geospiza. Using restriction site-associated DNA (RAD-seq), we characterized 32 569 single-nucleotide polymorphisms (SNPs), from which 11 outlier SNPs for beak and body size were uncovered by a genomewide association study (GWAS). Principal component analysis revealed that these 11 SNPs formed four statistically linked groups. Stepwise regression then revealed that the first PC score, which included 6 of the 11 top SNPs, explained over 80% of the variation in beak size, suggesting that selection on these traits influences multiple correlated loci. The two SNPs most strongly associated with beak size were near genes associated with beak morphology across deeper branches of the radiation: delta-like 1 homologue (DLK1) and high-mobility group AT-hook 2 (HMGA2). Our results suggest that (i) key adaptive traits are associated with a small fraction of the genome (11 of 32 569 SNPs), (ii) SNPs linked to the candidate genes are dispersed throughout the genome (on several chromosomes), and (iii) micro- and macro-evolutionary variation (roots and tips of the radiation) involve some shared and some unique genomic regions. © 2016 John Wiley & Sons Ltd.

Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.

PubMed

Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.

HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

PubMed

Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

2007-04-04

To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

Fatal Methadone Toxicity: Potential Role of CYP3A4 Genetic Polymorphism

PubMed Central

Richards-Waugh, Lauren L.; Primerano, Donald A.; Dementieva, Yulia; Kraner, James C.; Rankin, Gary O.

2014-01-01

Methadone is difficult to administer as a therapeutic agent because of a wide range of interindividual pharmacokinetics, likely due to genetic variability of the CYP450 enzymes responsible for metabolism to its principal metabolite 2-ethylidene-1,5-dimethyl-3,3-diphenylpyrrolidine (EDDP). CYP3A4 is one of the primary CYP450 isoforms responsible for the metabolism of methadone to EDDP in humans. The purpose of this study was to evaluate the role of CYP3A4 genetic polymorphisms in accidental methadone fatalities. A study cohort consisting of 136 methadone-only and 92 combined methadone/benzodiazepine fatalities was selected from cases investigated at the West Virginia and Kentucky Offices of the Chief Medical Examiner. Seven single nucleotide polymorphisms (SNPs) were genotyped within the CYP3A4 gene. Observed allelic and genotypic frequencies were compared with expected frequencies obtained from The National Center for Biotechnology Information dbSNP database. SNPs rs2242480 and rs2740574 demonstrated an apparent enrichment within the methadone-only overdose fatalities compared with the control group and the general population. This enrichment was not apparent in the methadone/benzodiazepine cases for these two SNPs. Our findings indicate that there may be two or more SNPs on the CYP3A4 gene that cause or contribute to the methadone poor metabolizer phenotype. PMID:25217544

Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

PubMed

Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

2015-08-01

The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

PubMed

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-11-20

BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

PubMed Central

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-01-01

Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

Positive Association of D Allele of ACE Gene With High Altitude Pulmonary Edema in Indian Population.

PubMed

Bhagi, Shuchi; Srivastava, Swati; Tomar, Arvind; Bala Singh, Shashi; Sarkar, Soma

2015-06-01

High altitude pulmonary edema (HAPE) is a potentially fatal high altitude illness occurring as a result of hypobaric hypoxia with an unknown underlying genetic mechanism. Recent studies have shown a possible association between HAPE and polymorphisms in genes of the renin-angiotensin-aldosterone system (RAAS), which play a key role in sensitivity of an individual toward HAPE. For the present investigation, study groups consisted of HAPE patients (HAPE) and acclimatized control subjects (rCON). Four single-nucleotide polymorphisms (SNPs) were genotyped using restriction fragment length polymorphism (RFLP) analysis in genes of the RAAS pathway, specifically, renin (REN) C(-4063)T (rs41317140) and RENi8-83 (rs2368564), angiotensin (AGT) M(235)T (rs699), and angiotensin-converting enzyme (ACE) insertion/deletion (I/D) (rs1799752). Only the I/D polymorphism of the ACE gene showed a significant difference between the HAPE and rCON groups. The frequency of the D allele was found to be significantly higher in the HAPE group. Arterial oxygen saturation levels were significantly lower in the HAPE group compared with the rCON group and also decreased in the I/D and D/D genotypes compared with the I/I genotype in these groups. The other polymorphisms occurring in the REN and AGT genes were not significantly different between the 2 groups. These findings demonstrate a possible association of the I/D polymorphism of the ACE gene with the development of HAPE, with D/D being the at-risk genotype. Copyright © 2015 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population

PubMed Central

Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

2014-01-01

Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234

TLR9 Gene Region Polymorphisms and Susceptibility to Tuberculosis in Vietnam

PubMed Central

Graustein, AD; Horne, DJ; Arentz, M; Bang, ND; Chau, TTH; Thwaites, GE; Caws, M; Thuong, NTT; Dunstan, SJ; Hawn, TR

2015-01-01

Summary Humans exposed to Mycobacterium tuberculosis (Mtb) show variation in susceptibility to infection and differences in tuberculosis (TB) disease outcome. Toll-like receptor 9 (TLR9) is a pattern recognition receptor that mediates recognition of Mtb and modulates Mtb-specific T-cell responses. Using a case-population design, we evaluated whether single nucleotide polymorphisms (SNPs) in the TLR9 gene region are associated with susceptibility to pulmonary or meningeal TB as well as neurologic presentation and mortality in the meningeal TB group. In a discovery cohort (n = 352 cases, 382 controls), three SNPs were associated with TB (all forms, p<0.05) while three additional SNPs neared significance (0.05

Interactions between C-reactive protein genotypes with markers of nutritional status in relation to inflammation.

PubMed

Nienaber-Rousseau, Cornelie; Swanepoel, Bianca; Dolman, Robin C; Pieters, Marlien; Conradie, Karin R; Towers, G Wayne

2014-11-11

Inflammation, as indicated by C-reactive protein concentrations (CRP), is a risk factor for chronic diseases. Both genetic and environmental factors affect susceptibility to inflammation. As dietary interventions can influence inflammatory status, we hypothesized that dietary effects could be influenced by interactions with single nucleotide polymorphisms (SNPs) in the CRP gene. We determined 12 CRP SNPs, as well as various nutrition status markers in 2010 black South Africans and analyzed their effect on CRP. Interactions were observed for several genotypes with obesity in determining CRP. Lipid intake modulated the pro-inflammatory effects of some SNPs, i.e., an increase in both saturated fatty acid and monounsaturated fatty acid intake in those homozygous for the polymorphic allele at rs2808630 was associated with a larger increase in CRP. Those harboring the minor alleles at rs3093058 and rs3093062 presented with significantly higher CRP in the presence of increased triglyceride or cholesterol intake. When harboring the minor allele of these SNPs, a high omega-6 to -3 ratio was, however, found to be anti-inflammatory. Carbohydrate intake also modulated CRP SNPs, as HbA1C and fasting glucose levels interacted with some SNPs to influence the CRP. This investigation highlights the impact that nutritional status can have on reducing the inherent genetic susceptibility to a heightened systemic inflammatory state.

Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

PubMed

Ojeda, Diego A; Forero, Diego A

2014-10-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Worldwide Distribution of Four SNPs in X‐Ray and Repair and Cross‐Complementing Group 1 (XRCC1)

PubMed Central

Takeshita, Haruo; Yasuda, Toshihiro; Kimura‐Kataoka, Kaori

2014-01-01

Abstract Purpose X‐ray repair cross‐complementing group 1 (XRCC1) repairs single‐strand breaks in DNA. Several reports have shown the association of single nucleotide polymorphisms (SNPs) (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 to diseases. Limited population data are available regarding SNPs in XRCC1, especially in African populations. In this study, genotype distributions of four SNPs in worldwide populations were examined and compared with those reported previously. Materials and Methods Four SNPs (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 from genomic DNA samples of 10 populations were evaluated by using polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results The frequency of the minor allele corresponding to the Trp allele of XRCC1Arg194Trp was higher in Asian populations than in African and Caucasian populations. As for XRCC1Pro206Pro, Africans showed higher minor allele frequencies than did Asian populations, except for Tamils and Sinhalese. XRCC1 Arg280His frequencies were similar among Africans and Caucasians but differed among Asian populations. Similarly, lower mutant XRCC1 Arg399Gln frequencies were observed in Africans. Conclusions This study is the first to show the existence of a certain genetic heterogeneity in the worldwide distribution of four SNPs in XRCC1. PMID:25387884

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

PubMed

Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

2016-07-01

A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

Evolutionary selective pressure on three mitochondrial SNPs is consistent with their influence on metabolic efficiency in Pima Indians.

PubMed

Chamala, Srikar; Beckstead, Wesley A; Rowe, Mark J; McClellan, David A

2007-01-01

We investigated whether the effect of evolutionary selection on three recent Single Nucleotide Polymorphisms (SNPs) in the mitochondrial sub-haplogroups of Pima Indians is consistent with their effects on metabolic efficiency. The mitochondrial SNPs impact metabolic rate and respiratory quotient, and may be adaptations to caloric restriction in a desert habitat. Using TreeSAAP software, we examined evolutionary selection in 107 mammalian species at these SNPs, characterising the biochemical shifts produced by the amino acid substitutions. Our results suggest that two SNPs were affected by selection during mammalian evolution in a manner consistent with their effects on metabolic efficiency in Pima Indians.

The linkage disequilibrium pattern of the angiotensin converting enzyme gene in Arabic and Asian population groups.

PubMed

Kharrat, Najla; Abdelmouleh, Wafa; Abdelhedi, Rania; Alfadhli, Suad; Rebai, Ahmed

2012-01-01

DNA variations within the Angiotensin-Converting Enzyme (ACE) gene have been shown to be involved in the aetiology of several common diseases and the therapeutic response. This study reports a comparison of haplotype analysis of five SNPs in the ACE gene region using a sample of 100 healthy subjects derived from five different populations (Tunisian, Iranian, Kuwaiti, Bahraini and Indian). Strong linkage disequilibrium was found among all SNPs studied for all populations. Two SNPs (rs1800764 and rs4340) were identified as key SNPs for all populations. These SNPs will be valuable for future effective association studies of the ACE gene polymorphisms in Arab and Asian populations.

Association between UGT2B7 gene polymorphisms and fentanyl sensitivity in patients undergoing painful orthognathic surgery

PubMed Central

Muraoka, Wataru; Nishizawa, Daisuke; Fukuda, Kenichi; Kasai, Shinya; Hasegawa, Junko; Wajima, Koichi; Nakagawa, Taneaki

2016-01-01

Background Fentanyl is often used instead of morphine for the treatment of pain because it has fewer side effects. The metabolism of morphine by glucuronidation is known to be influenced by polymorphisms of the UGT2B7 gene. Some metabolic products of fentanyl are reportedly metabolized by glucuronate conjugation. The genes that are involved in the metabolic pathway of fentanyl may also influence fentanyl sensitivity. We analyzed associations between fentanyl sensitivity and polymorphisms of the UGT2B7 gene to clarify the hereditary determinants of individual differences in fentanyl sensitivity. Results This study examined whether single-nucleotide polymorphisms (SNPs) of the UGT2B7 gene affect cold pain sensitivity and the analgesic effects of fentanyl, evaluated by a standardized pain test and fentanyl requirements in healthy Japanese subjects who underwent uniform surgical procedures. The rs7439366 SNP of UGT2B7 is reportedly associated with the metabolism and analgesic effects of morphine. We found that this SNP is also associated with the analgesic effects of fentanyl in the cold pressor-induced pain test. It suggested that the C allele of the rs7439366 SNP may enhance analgesic efficacy. Two SNPs of UGT2B7, rs4587017 and rs1002849, were also found to be novel SNPs that may influence the analgesic effects of fentanyl in the cold pressor-induced pain test. Conclusions Fentanyl sensitivity for cold pressor-induced pain was associated with the rs7439366, rs4587017, and rs1002849 SNPs of the UGT2B7 gene. Our findings may provide valuable information for achieving satisfactory pain control and open to new avenues for personalized pain treatment. PMID:28256933

The evaluation of endothelin 1 (EDN1) and endothelin receptor type A (EDNRA) gene polymorphisms in Hashimoto's thyroiditis.

PubMed

Aydin, A Fatih; Vural, Pervin; Oruç, Çoşkun Umut; Doğru-Abbasoğlu, Semra; Özderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

2014-07-01

Endothelin1 (EDN1) is well established marker of inflammation. The functions of EDN1 are mediated mainly by endothelin receptors type A (EDNRA). The etiopathogenesis of Hashimoto's thyroiditis (HT) remains still elusive although the role of chronic inflammation and subsequent endothelial dysfunction has been established. This study examined firstly the possible association of EDN1 (G5665Tand T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of HT, and evaluates the relationship between genotypes and clinical/laboratory manifestation of HT. We analyzed genotype and allele distributions of above mentioned polymorphisms in 163 patients with HT and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between HT and variant alleles of EDN1 5665 and -1370, as well as EDNRA +70 and -231 SNPs were found. Haplotype analysis demonstrated that there was a strong (D'=0.76, r(2)=0.487) and weak (D'=0.403, r(2)=0.086) linkage disequilibrium (LD) between EDN1 -1370 and 5665, and between EDNRA -231 and +70 SNPs, respectively. However, haplotype frequencies in patients were similar to those in controls. In addition, it was observed that the EDNRA +70 G allele had protective effect against early (at age before 40 years) disease onset of HT (OR: 0.51, 95% CI=0.32-0.79, p=0.003). Although no significant associations between susceptibility to HT with EDN1 5665 and -1370, as well as with EDNRA+70 and -231 SNPs were found, EDNRA +70 polymorphism was related with decreased risk for early onset HT. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

A cis-phase interaction study of genetic variants within the MAOA gene in major depressive disorder.

PubMed

Zhang, JieXu; Chen, YanBo; Zhang, KeRang; Yang, Hong; Sun, Yan; Fang, Yue; Shen, Yan; Xu, Qi

2010-11-01

The genetic basis of major depressive disorder (MDD) has been explored extensively, but the mode of transmission of the disease has yet to be established. To better understand the mechanism by which the monoamine oxidase A (MAOA) gene may play a role in developing MDD, the present work examined the cis-phase interaction between genetic variants within the MAOA gene for the pathogenesis of MDD. A variable number tandem repeat (VNTR) and 19 single nucleotide polymorphisms (SNPs) within the gene were genotyped in 512 unrelated patients with MDD and 567 unrelated control subjects among a Chinese population. Quantitative real-time polymerase chain reaction analysis was applied to test the effect of genetic variants on expression of the MAOA gene in MDD. Neither the VNTR polymorphism nor seven informative SNPs showed allelic association with MDD, but the cis-acting interactions between the VNTR polymorphism and four individual SNPs were strongly associated with MDD risk, of which the VNTR-rs1465107 combination showed the strongest association (p = .000011). Quantitative real-time polymerase chain reaction analysis showed that overall relative quantity of MAOA messenger RNA was significantly higher in patients with MDD than in control subjects (fold change = 5.28, p = 1.7 × 10⁻⁷) and that in the male subjects carrying the VNTR-L, rs1465107-A, rs6323-G, rs2072743-A, or rs1137070-T alleles, expression of MAOA messenger RNA was significantly higher in the patient group than in the control group. The cis-phase interaction between the VNTR polymorphism and functional SNPs may contribute to the etiology of MDD. Copyright © 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Association between tumour necrosis-α gene polymorphisms and acne vulgaris in a Pakistani population.

PubMed

Aisha, N M; Haroon, J; Hussain, S; Tahir, C M; Ikramullah, M; Rahim, H; Kishwar, N; Younis, S; Hassan, M J; Javed, Q

2016-04-01

The cytokine tumour necrosis factor (TNF)-α is a well-studied potent candidate mediator that is systemically involved in a variety of inflammatory diseases. Several single nucleotide polymorphisms (SNPs) of the TNF-α gene have been studied with regard the pathogenesis of acne vulgaris, but the results have been inconclusive. This case-control study investigated the association of the TNF -308 G>A and -238 G>A SNPs with acne vulgaris in a high-risk Pakistani population. In total, 160 healthy controls and 140 patients with acne were enrolled in this study. Polymorphisms were determined by PCR and restriction fragment length polymorphism analysis. Our data showed that the TNF -308 G>A and TNF -238 G>A SNPs were present at a significantly higher rate in cases than in controls (P < 0.01 and P < 0.02; respectively). There was a significant difference between the G and A alleles from patients with acne and controls for -308 G>A (OR = 1.5, 95% CI = 1.07-2.19, P < 0.02) and -238 G>A (OR=1.6, 95% CI = 1.06-2.44, P = 0.02) genotype. Moreover, the severity of acne was significantly associated with TNF genotype (TNF -308 G>A: χ² = 34.6, P < 0.001; TNF -238 G>AL χ² = 12.9, P < 0.01). Our data suggest that the TNF -308 G>A and TNF -238 G>A SNPs may contribute to the pathogenesis of acne in the study population. Furthermore, patients with severe acne showed an increased frequency of mutant TNF genotypes at -308 and -238 compared with patients with less severe acne. © 2015 British Association of Dermatologists.

Association between polymorphisms in cancer-related genes and early onset of esophageal adenocarcinoma.

PubMed

Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C

2011-04-01

There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study.

PubMed

Orlow, Irene; Reiner, Anne S; Thomas, Nancy E; Roy, Pampa; Kanetsky, Peter A; Luo, Li; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B; Anton-Culver, Hoda; Gallagher, Richard P; Dwyer, Terence; Busam, Klaus; Begg, Colin B; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study

PubMed Central

Orlow, Irene; Reiner, Anne S.; Thomas, Nancy E.; Roy, Pampa; Kanetsky, Peter A.; Luo, Li; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B.; Anton-Culver, Hoda; Gallagher, Richard P.; Dwyer, Terence; Busam, Klaus; Begg, Colin B.; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. PMID:26521212

ErbB polymorphisms: insights and implications for response to targeted cancer therapeutics.

PubMed

Alaoui-Jamali, Moulay A; Morand, Grégoire B; da Silva, Sabrina Daniela

2015-01-01

Advances in high-throughput genomic-scanning have expanded the repertory of genetic variations in DNA sequences encoding ErbB tyrosine kinase receptors in humans, including single nucleotide polymorphisms (SNPs), polymorphic repetitive elements, microsatellite variations, small-scale insertions and deletions. The ErbB family members: EGFR, ErbB2, ErbB3, and ErbB4 receptors are established as drivers of many aspects of tumor initiation and progression to metastasis. This knowledge has provided rationales for the development of an arsenal of anti-ErbB therapeutics, ranging from small molecule kinase inhibitors to monoclonal antibodies. Anti-ErbB agents are becoming the cornerstone therapeutics for the management of cancers that overexpress hyperactive variants of ErbB receptors, in particular ErbB2-positive breast cancer and non-small cell lung carcinomas. However, their clinical benefit has been limited to a subset of patients due to a wide heterogeneity in drug response despite the expression of the ErbB targets, attributed to intrinsic (primary) and to acquired (secondary) resistance. Somatic mutations in ErbB tyrosine kinase domains have been extensively investigated in preclinical and clinical setting as determinants for either high sensitivity or resistance to anti-ErbB therapeutics. In contrast, only scant information is available on the impact of SNPs, which are widespread in genes encoding ErbB receptors, on receptor structure and activity, and their predictive values for drug susceptibility. This review aims to briefly update polymorphic variations in genes encoding ErbB receptors based on recent advances in deep sequencing technologies, and to address challenging issues for a better understanding of the functional impact of single versus combined SNPs in ErbB genes to receptor topology, receptor-drug interaction, and drug susceptibility. The potential of exploiting SNPs in the era of stratified targeted therapeutics is discussed.

Genome Analysis of the Domestic Dog (Korean Jindo) by Massively Parallel Sequencing

PubMed Central

Kim, Ryong Nam; Kim, Dae-Soo; Choi, Sang-Haeng; Yoon, Byoung-Ha; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dong-Wook; Kim, Jong-Joo; Ha, Ji-Hong; Toyoda, Atsushi; Fujiyama, Asao; Kim, Aeri; Kim, Min-Young; Park, Kun-Hyang; Lee, Kang Seon; Park, Hong-Seog

2012-01-01

Although pioneering sequencing projects have shed light on the boxer and poodle genomes, a number of challenges need to be met before the sequencing and annotation of the dog genome can be considered complete. Here, we present the DNA sequence of the Jindo dog genome, sequenced to 45-fold average coverage using Illumina massively parallel sequencing technology. A comparison of the sequence to the reference boxer genome led to the identification of 4 675 437 single nucleotide polymorphisms (SNPs, including 3 346 058 novel SNPs), 71 642 indels and 8131 structural variations. Of these, 339 non-synonymous SNPs and 3 indels are located within coding sequences (CDS). In particular, 3 non-synonymous SNPs and a 26-bp deletion occur in the TCOF1 locus, implying that the difference observed in cranial facial morphology between Jindo and boxer dogs might be influenced by those variations. Through the annotation of the Jindo olfactory receptor gene family, we found 2 unique olfactory receptor genes and 236 olfactory receptor genes harbouring non-synonymous homozygous SNPs that are likely to affect smelling capability. In addition, we determined the DNA sequence of the Jindo dog mitochondrial genome and identified Jindo dog-specific mtDNA genotypes. This Jindo genome data upgrade our understanding of dog genomic architecture and will be a very valuable resource for investigating not only dog genetics and genomics but also human and dog disease genetics and comparative genomics. PMID:22474061

HLA class I polymorphisms are associated with development of infectious mononucleosis upon primary EBV infection

PubMed Central

McAulay, Karen A.; Higgins, Craig D.; Macsween, Karen F.; Lake, Annette; Jarrett, Ruth F.; Robertson, Faye L.; Williams, Hilary; Crawford, Dorothy H.

2007-01-01

Infectious mononucleosis (IM) is an immunopathological disease caused by EBV that occurs in young adults and is a risk factor for Hodgkin lymphoma (HL). An association between EBV-positive HL and genetic markers in the HLA class I locus has been identified, indicating that genetic differences in the HLA class I locus may alter disease phenotypes associated with EBV infection. To further determine whether HLA class I alleles may affect development of EBV-associated diseases, we analyzed 2 microsatellite markers and 2 SNPs located near the HLA class I locus in patients with acute IM and in asymptomatic EBV-seropositive and -seronegative individuals. Alleles of both microsatellite markers were significantly associated with development of IM. Specific alleles of the 2 SNPs were also significantly more frequent in patients with IM than in EBV-seronegative individuals. IM patients possessing the associated microsatellite allele had fewer lymphocytes and increased neutrophils relative to IM patients lacking the allele. These patients also displayed higher EBV titers and milder IM symptoms. The results of this study indicate that HLA class I polymorphisms may predispose patients to development of IM upon primary EBV infection, suggesting that genetic variation in T cell responses can influence the nature of primary EBV infection and the level of viral persistence. PMID:17909631

HLA class I polymorphisms are associated with development of infectious mononucleosis upon primary EBV infection.

PubMed

McAulay, Karen A; Higgins, Craig D; Macsween, Karen F; Lake, Annette; Jarrett, Ruth F; Robertson, Faye L; Williams, Hilary; Crawford, Dorothy H

2007-10-01

Infectious mononucleosis (IM) is an immunopathological disease caused by EBV that occurs in young adults and is a risk factor for Hodgkin lymphoma (HL). An association between EBV-positive HL and genetic markers in the HLA class I locus has been identified, indicating that genetic differences in the HLA class I locus may alter disease phenotypes associated with EBV infection. To further determine whether HLA class I alleles may affect development of EBV-associated diseases, we analyzed 2 microsatellite markers and 2 SNPs located near the HLA class I locus in patients with acute IM and in asymptomatic EBV-seropositive and -seronegative individuals. Alleles of both microsatellite markers were significantly associated with development of IM. Specific alleles of the 2 SNPs were also significantly more frequent in patients with IM than in EBV-seronegative individuals. IM patients possessing the associated microsatellite allele had fewer lymphocytes and increased neutrophils relative to IM patients lacking the allele. These patients also displayed higher EBV titers and milder IM symptoms. The results of this study indicate that HLA class I polymorphisms may predispose patients to development of IM upon primary EBV infection, suggesting that genetic variation in T cell responses can influence the nature of primary EBV infection and the level of viral persistence.

Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

PubMed Central

Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

2004-01-01

The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394

Mapping a Mutation in "Caenorhabditis elegans" Using a Polymerase Chain Reaction-Based Approach

ERIC Educational Resources Information Center

Myers, Edith M.

2014-01-01

Many single nucleotide polymorphisms (SNPs) have been identified within the "Caenorhabditis elegans" genome. SNPs present in the genomes of two isogenic "C. elegans" strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which…

Association between IL-10a SNPs and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Analysis of gene polymorphisms and disease association is essential for assessing putative candidate genes affecting susceptibility or resistance to disease. In this paper, we report the results of an association analysis between SNPs in common carp innate immune response genes and resistance to Cy...

Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

USDA-ARS?s Scientific Manuscript database

ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Polymorphisms in the FGF2 gene and risk of serous ovarian cancer: results from the Ovarian Cancer Association Consortium

PubMed Central

Johnatty, Sharon E.; Beesley, Jonathan; Chen, Xiaoqing; Spurdle, Amanda B.; deFazio, Anna; Webb, Penelope M; Goode, Ellen L.; Rider, David N.; Vierkant, Robert A.; Anderson, Stephanie; Wu, Anna H.; Pike, Malcolm; Van Den Berg, David; Moysich, Kirsten; Ness, Roberta; Doherty, Jennifer; Rossing, Mary-Anne; Pearce, Celeste Leigh; Chenevix-Trench, Georgia

2009-01-01

Fibroblast growth factor (FGF)-2 (basic) is a potent angiogenic molecule involved in tumour progression, and is one of several growth factors with a central role in ovarian carcinogenesis. We hypothesised that common single nucleotide polymorphisms (SNPs) in the FGF2 gene may alter angiogenic potential and thereby susceptibility to ovarian cancer. We analysed 25 FGF2 tgSNPs using five independent study populations from the United States and Australia. Analysis was restricted to non-Hispanic White women with serous ovarian carcinoma (1269 cases and 2829 controls). There were no statistically significant associations between any FGF2 SNPs and ovarian cancer risk. There were two nominally statistically significant associations between heterozygosity for two FGF2 SNPs (rs308379 and rs308447; p<0.05) and serous ovarian cancer risk in the combined dataset, but rare homozygous estimates did not achieve statistical significance, nor were they consistent with the log additive model of inheritance. Overall genetic variation in FGF2 does not appear to play a role in susceptibility to ovarian cancer. PMID:19456219

Association of CAT polymorphisms with catalase activity and exposure to environmental oxidative stimuli

PubMed Central

Nadif, Rachel; Mintz, Margaret; Jedlicka, Anne; Bertrand, Jean-Pierre; Kleeberger, Steven R.; Kauffmann, Francine

2005-01-01

We tested the hypotheses that catalase activity is modified by CAT single nucleotide polymorphisms (SNPs) (–262;–844), and by their interactions with oxidant exposures (coal dusts, smoking), lymphotoxin alpha (LTA, NcoI) and tumor necrosis factor (TNF, -308) in 196 miners. Erythrocyte catalase, superoxide dismutase, and glutathione peroxidase activities were measured. The CAT –262 SNP was related to lower catalase activity (104, 87 and 72 k/g hemoglobin for CC, CT and TT respectively, p<0.0001). Regardless of CAT SNPs, the LTA NcoI but not the TNF –308 SNP was associated with catalase activity (p=0.04 and p=0.8). CAT –262 T carriers were less frequent in highly exposed miners (OR=0.39 [0.20 – 0.78], p=0.007). In CAT –262 T carriers only, catalase activity decreased with high dust exposure (p=0.01). Haplotype analyses (combined CAT SNPs) confirm these results. Results show that CAT –262 and LTA NcoI SNPs, and interaction with coal dust exposure, influenced catalase activity. PMID:16298864

Integrating common and rare genetic variation in diverse human populations.

PubMed

Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Dermitzakis, Emmanouil; Schaffner, Stephen F; Yu, Fuli; Peltonen, Leena; Dermitzakis, Emmanouil; Bonnen, Penelope E; Altshuler, David M; Gibbs, Richard A; de Bakker, Paul I W; Deloukas, Panos; Gabriel, Stacey B; Gwilliam, Rhian; Hunt, Sarah; Inouye, Michael; Jia, Xiaoming; Palotie, Aarno; Parkin, Melissa; Whittaker, Pamela; Yu, Fuli; Chang, Kyle; Hawes, Alicia; Lewis, Lora R; Ren, Yanru; Wheeler, David; Gibbs, Richard A; Muzny, Donna Marie; Barnes, Chris; Darvishi, Katayoon; Hurles, Matthew; Korn, Joshua M; Kristiansson, Kati; Lee, Charles; McCarrol, Steven A; Nemesh, James; Dermitzakis, Emmanouil; Keinan, Alon; Montgomery, Stephen B; Pollack, Samuela; Price, Alkes L; Soranzo, Nicole; Bonnen, Penelope E; Gibbs, Richard A; Gonzaga-Jauregui, Claudia; Keinan, Alon; Price, Alkes L; Yu, Fuli; Anttila, Verneri; Brodeur, Wendy; Daly, Mark J; Leslie, Stephen; McVean, Gil; Moutsianas, Loukas; Nguyen, Huy; Schaffner, Stephen F; Zhang, Qingrun; Ghori, Mohammed J R; McGinnis, Ralph; McLaren, William; Pollack, Samuela; Price, Alkes L; Schaffner, Stephen F; Takeuchi, Fumihiko; Grossman, Sharon R; Shlyakhter, Ilya; Hostetter, Elizabeth B; Sabeti, Pardis C; Adebamowo, Clement A; Foster, Morris W; Gordon, Deborah R; Licinio, Julio; Manca, Maria Cristina; Marshall, Patricia A; Matsuda, Ichiro; Ngare, Duncan; Wang, Vivian Ota; Reddy, Deepa; Rotimi, Charles N; Royal, Charmaine D; Sharp, Richard R; Zeng, Changqing; Brooks, Lisa D; McEwen, Jean E

2010-09-02

Despite great progress in identifying genetic variants that influence human disease, most inherited risk remains unexplained. A more complete understanding requires genome-wide studies that fully examine less common alleles in populations with a wide range of ancestry. To inform the design and interpretation of such studies, we genotyped 1.6 million common single nucleotide polymorphisms (SNPs) in 1,184 reference individuals from 11 global populations, and sequenced ten 100-kilobase regions in 692 of these individuals. This integrated data set of common and rare alleles, called 'HapMap 3', includes both SNPs and copy number polymorphisms (CNPs). We characterized population-specific differences among low-frequency variants, measured the improvement in imputation accuracy afforded by the larger reference panel, especially in imputing SNPs with a minor allele frequency of

Genetic alterations within TLR genes in development of Toxoplasma gondii infection among Polish pregnant women.

PubMed

Wujcicka, Wioletta; Wilczyński, Jan; Nowakowska, Dorota

2017-09-01

The research was conducted to evaluate the role of genotypes, haplotypes and multiple-SNP variants in the range of TLR2, TLR4 and TLR9 single nucleotide polymorphisms (SNPs) in the development of Toxoplasma gondii infection among Polish pregnant women. The study was performed for 116 Polish pregnant women, including 51 patients infected with T. gondii, and 65 age-matched control pregnant individuals. Genotypes in TLR2 2258 G>A, TLR4 896 A>G, TLR4 1196 C>T and TLR9 2848 G>A SNPs were estimated by self-designed, nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in the studied polymorphisms, were confirmed by sequencing. All the genotypes were calculated for Hardy-Weinberg (H-W) equilibrium and TLR4 variants were tested for linkage disequilibrium. Relationships were assessed between alleles, genotypes, haplotypes or multiple-SNP variants in TLR polymorphisms and the occurrence of T. gondii infection in pregnant women, using a logistic regression model. All the analyzed genotypes preserved the H-W equilibrium among the studied groups of patients (P>0.050). Similar distribution of distinct alleles and individual genotypes in TLR SNPs, as well as of haplotypes in TLR4 polymorphisms, were observed in T. gondii infected and control uninfected pregnant women. However, the GACG multiple-SNP variant, within the range of all the four studied polymorphisms, was correlated with a decreased risk of the parasitic infection (OR 0.52, 95% CI 0.28-0.97; P≤0.050). The polymorphisms, located within TLR2, TLR4 and TLR9 genes, may be involved together in occurrence of T. gondii infection among Polish pregnant women. Copyright © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.

CCR5 gene polymorphism is a genetic risk factor for radiographic severity of rheumatoid arthritis.

PubMed

Han, S W; Sa, K H; Kim, S I; Lee, S I; Park, Y W; Lee, S S; Yoo, W H; Soe, J S; Nam, E J; Lee, J; Park, J Y; Kang, Y M

2012-11-01

The chemokine receptor [C-C chemokine receptor 5 (CCR5)] is expressed on diverse immune effecter cells and has been implicated in the pathogenesis of rheumatoid arthritis (RA). This study sought to determine whether single-nucleotide polymorphisms (SNPs) in the CCR5 gene and their haplotypes were associated with susceptibility to and severity of RA. Three hundred fifty-seven patients with RA and 383 healthy unrelated controls were recruited. Using a pyrosequencing assay, we examined four polymorphisms -1118 CTAT(ins) (/del) (rs10577983), 303 A>G (rs1799987), 927 C>T (rs1800024), and 4838 G>T (rs1800874) of the CCR5 gene, which were distributed over the promoter region as well as the 5' and 3' untranslated regions. No significant difference in the genotype, allele, and haplotype frequencies of the four selected SNPs was observed between RA patients and controls. CCR5 polymorphisms of -1118 CTAT(del) (P = 0.012; corrected P = 0.048) and 303 A>G (P = 0.012; corrected P = 0.048) showed a significant association with radiographic severity in a recessive model, and, as a result of multivariate logistic regression analysis, were found to be an independent predictor of radiographic severity. When we separated the erosion score from the total Sharp score, the statistical significance of CCR5 polymorphisms showed an increase; -1118 CTAT(ins) (/del) (P = 0.007; corrected P = 0.028) and 303 A>G (P = 0.007; corrected P = 0.028). Neither SNPs nor haplotypes of the CCR5 gene showed a significant association with joint space narrowing score. These results indicate that genetic polymorphisms of CCR5 are an independent risk factor for radiographic severity denoted by modified Sharp score, particularly joint erosion in RA. © 2012 John Wiley & Sons A/S.

Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

PubMed Central

Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

2006-01-01

Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

PubMed

Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

2005-09-01

Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population.

PubMed

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application "Lekgen" that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population

PubMed Central

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application “Lekgen” that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy. PMID:27499796

Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

PubMed

Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

2015-04-01

Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

ADAM33 polymorphisms are associated with asthma and a distinctive palm dermatoglyphic pattern

PubMed Central

XUE, WEILIN; HAN, WEI; ZHOU, ZHAO-SHAN

2013-01-01

A close correlation between asthma and palm dermatoglyphic patterns has been observed in previous studies, but the underlying genetic mechanisms have not been investigated. A disintegrin and metalloprotein-33 (ADAM33) polymorphisms are important in the development of asthma and other atopic diseases. To investigate the underlying mechanisms of the association between asthma and distinctive palm dermatoglyphic patterns, thirteen ADAM33 single-nucleotide polymorphisms (SNPs) were analyzed for the association between asthma and palm dermatoglyphic patterns in a population of 400 asthmatic patients and 200 healthy controls. Based on the results, five SNPs, rs44707 (codominant model, P=0.031; log-additive model, P=0.0084), rs2787094 (overdominant model, P=0.049), rs678881 (codominant model, P=0.028; overdominant model, P=0.0083), rs677044 (codominant model, P=0.013; log-additive model, P=0.0033) and rs512625 (dominant model, P=0.033), were associated with asthma in this population. Two SNPs, rs44707 (dominant model, P=0.042) and rs2787094 (codominant model, P=0.014; recessive model, P=0.0038), were observed in the asthma patients with the distinctive palm pattern. As rs44707 and rs2787094 are associated with asthma and a distinctive palm pattern, the data suggest that ADAM33 polymorphisms are correlated with asthma and may be the underlying genetic basis of the association between asthma and palm dermatoglyphic patterns. PMID:24141861

Association of twelve polymorphisms in three onco-lncRNA genes with hepatocellular cancer risk and prognosis: A case-control study

PubMed Central

Wang, Ben-Gang; Xu, Qian; Lv, Zhi; Fang, Xin-Xin; Ding, Han-Xi; Wen, Jing; Yuan, Yuan

2018-01-01

AIM To evaluate the association of 12 tag single nucleotide polymorphisms (tagSNPs) in three onco-long non-coding RNA (lncRNA) genes (HOTTIP, CCAT2, MALAT1) with the risk and prognosis of hepatocellular cancer (HCC). METHODS Twelve tagSNPs covering the three onco-lncRNAs were genotyped by the KASP method in a total of 1338 samples, including 521 HCC patients and frequency-matched 817 controls. The samples were obtained from an unrelated Chinese population at the First Hospital of China Medical University from 2012-2015. The expression quantitative trait loci (eQTL) analyses were conducted to explore further the potential function of the promising SNPs. RESULTS Three SNPs in HOTTIP, one promoter SNP in MALAT1, and one haplotype of HOTTIP were associated with HCC risk. The HOTTIP rs17501292, rs2067087, and rs17427960 SNPs were increased to 1.55-, 1.20-, and 1.18-fold HCC risk under allelic models (P = 0.012, 0.017 and 0.049, respectively). MALAT1 rs4102217 SNP was increased to a 1.32-fold HCC risk under dominant models (P = 0.028). In addition, the two-way interaction of HOTTIP rs17501292-MALAT1 rs619586 polymorphisms showed a decreased effect on HCC risk (Pinteraction = 0.028, OR = 0.30) and epistasis with each other. HOTTIP rs3807598 variant genotype showed significantly longer survival time in HBV negative subgroup (P = 0.049, HR = 0.12), and MALAT1 rs591291 showed significantly better prognosis in female and HBV negative subgroups (P = 0.022, HR = 0.37; P = 0.042, HR = 0.25, respectively). In the study, no significant effect was observed in eQTL analysis. CONCLUSION Specific lncRNA (HOTTIP and MALAT1) SNPs have potential to be biomarkers for HCC risk and prognosis. PMID:29930469

Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

PubMed

Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan

2013-01-01

The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

Type 2 diabetes (T2D) associated polymorphisms regulate expression of adjacent transcripts in transformed lymphocytes, adipose, and muscle from Caucasian and African-American subjects.

PubMed

Sharma, Neeraj K; Langberg, Kurt A; Mondal, Ashis K; Elbein, Steven C; Das, Swapan K

2011-02-01

Genome-wide association scans (GWAS) have identified novel single nucleotide polymorphisms (SNPs) that increase T2D susceptibility and indicated the role of nearby genes in T2D pathogenesis. We hypothesized that T2D-associated SNPs act as cis-regulators of nearby genes in human tissues and that expression of these transcripts may correlate with metabolic traits, including insulin sensitivity (S(I)). Association of SNPs with the expression of their nearest transcripts was tested in adipose and muscle from 168 healthy individuals who spanned a broad range of S(I) and body mass index (BMI) and in transformed lymphocytes (TLs). We tested correlations between the expression of these transcripts in adipose and muscle with metabolic traits. Utilizing allelic expression imbalance (AEI) analysis we examined the presence of other cis-regulators for those transcripts in TLs. SNP rs9472138 was significantly (P = 0.037) associated with the expression of VEGFA in TLs while rs6698181 was detected as a cis-regulator for the PKN2 in muscle (P = 0.00027) and adipose (P = 0.018). Significant association was also observed for rs17036101 (P = 0.001) with expression of SYN2 in adipose of Caucasians. Among 19 GWAS-implicated transcripts, expression of VEGFA in adipose was correlated with BMI (r = -0.305) and S(I) (r = 0.230). Although only a minority of the T2D-associated SNPs were validated as cis-eQTLs for nearby transcripts, AEI analysis indicated presence of other cis-regulatory polymorphisms in 54% of these transcripts. Our study suggests that a small subset of GWAS-identified SNPs may increase T2D susceptibility by modulating expression of nearby transcripts in adipose or muscle.

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Qijian; Jia, Gaofeng; Hyten, David L.

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE PAGES

Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

PubMed Central

Jannink, Jean-Luc

2010-01-01

Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean.

PubMed

Song, Qijian; Jia, Gaofeng; Hyten, David L; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G; Osorno, Juan M; Schmutz, Jeremy; Jackson, Scott A; McClean, Phillip E; Cregan, Perry B

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. Copyright © 2015 Song et al.

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo.

PubMed

Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo

2017-01-01

A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

PubMed Central

McGue, Matt; Iacono, William G.

2017-01-01

In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

Genetic Determinants of Enterovirus Infections: Polymorphisms in Type 1 Diabetes and Innate Immune Genes in the MIDIA Study.

PubMed

Witsø, Elisabet; Cinek, Ondrej; Tapia, German; Brorsson, Caroline A; Stene, Lars C; Gjessing, Håkon K; Rasmussen, Trond; Bergholdt, Regine; Pociot, Flemming M; Rønningen, Kjersti S

2015-12-01

Enteroviruses have been suggested as triggers of type 1 diabetes (T1D). We aimed to assess whether established T1D susceptibility single nucleotide polymorphisms (SNPs) and candidate SNPs in innate immune genes were associated with the frequency of enterovirus infection in otherwise healthy children. Fifty-six established T1D SNPs and 97 other candidate immunity SNPs were typed in 419 children carrying the T1D high-risk genotype, HLA-DR4-DQ8/DR3-DQ2 genotype, and 373 children without this genotype. Enteroviral RNA was detected using real-time polymerase chain reaction, with primers detecting essentially all enterovirus serotypes, in 7,393 longitudinal stool samples collected monthly (age range 3-36 months). The most significant association was with two T1D SNPs, rs12150079 (ZPBP2/ORMDL3/GSDMB region) (enterovirus frequency: AA 7.3%, AG 8.7%, GG 9.7%, RR = 0.86, overall p = 1.87E-02) and rs229541 (C1QTNF6/SSTR3/RAC2) (enterovirus frequency: CC 7.8%, CT 9.7%, TT 9.4%, RR = 1.13, overall p = 3.6E-02), followed by TLR8 (rs2407992) (p = 3.8E-02), TLR3 (1914926) (p = 4.9E-02), and two other T1D SNPs (IFIH1 rs3747517, p = 4.9E-02 and PTPN22, rs2476601, p = 5.3E-02). However, the quantile-quantile plot of p-values with confidence intervals for all 153 SNPs did not reveal clear evidence for rejection of the complete null hypothesis. Among a number of SNPs in candidate genes, we found no evidence for strong associations with enterovirus presence in stool samples from Norwegian children.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

PubMed

Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

2015-01-01

Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

PubMed

Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

2016-06-01

Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation

PubMed Central

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-01-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption. PMID:23886516

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation.

PubMed

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-10-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9-2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

PubMed

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-07-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

PubMed Central

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-01-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

PubMed

Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

2017-04-04

Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

Association of ARID5B gene variants with acute lymphoblastic leukemia in Yemeni children.

PubMed

Al-Absi, Boshra; Noor, Suzita M; Saif-Ali, Riyadh; Salem, Sameer D; Ahmed, Radwan H; Razif, Muhammad Fm; Muniandy, Sekaran

2017-04-01

Studies have shown an association between ARID5B gene polymorphisms and childhood acute lymphoblastic leukemia. However, the association between ARID5B variants and acute lymphoblastic leukemia among the Arab population still needs to be studied. The aim of this study was to investigate the association between ARID5B variants with acute lymphoblastic leukemia in Yemeni children. A total of 14 ARID5B gene single nucleotide polymorphisms (SNPs) were genotyped in 289 Yemeni children, of whom 136 had acute lymphoblastic leukemia and 153 were controls, using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Using logistic regression adjusted for age and gender, the risks of acute lymphoblastic leukemia were presented as odds ratios and 95% confidence intervals. We found that nine SNPs were associated with acute lymphoblastic leukemia under additive genetic models: rs7073837, rs10740055, rs7089424, rs10821936, rs4506592, rs10994982, rs7896246, rs10821938, and rs7923074. Furthermore, the recessive models revealed that six SNPs were risk factors for acute lymphoblastic leukemia: rs10740055, rs7089424, rs10994982, rs7896246, rs10821938, and rs7923074. The gender-specific impact of these SNPs under the recessive genetic model revealed that SNPs rs10740055, rs10994982, and rs6479779 in females, and rs10821938 and rs7923074 in males were significantly associated with acute lymphoblastic leukemia risk. Under the dominant model, SNPs rs7073837, rs10821936, rs7896246, and rs6479778 in males only showed striking association with acute lymphoblastic leukemia. The additive model revealed that SNPs with significant association with acute lymphoblastic leukemia were rs10821936 (both males and females); rs7073837, rs10740055, rs10994982, and rs4948487 (females only); and rs7089424, rs7896246, rs10821938, and rs7923074 (males only). In addition, the ARID5B haplotype block (CGAACACAA) showed a higher risk for acute lymphoblastic leukemia. The haplotype (CCCGACTGC) was associated with protection against acute lymphoblastic leukemia. In conclusion, our study has shown that ARID5B variants are associated with acute lymphoblastic leukemia in Yemeni children with several gender biases of ARID5B single nucleotide polymorphisms reported.

SNP-markers in Allium species to facilitate introgression breeding in onion.

PubMed

Scholten, Olga E; van Kaauwen, Martijn P W; Shahin, Arwa; Hendrickx, Patrick M; Keizer, L C Paul; Burger, Karin; van Heusden, Adriaan W; van der Linden, C Gerard; Vosman, Ben

2016-08-31

Within onion, Allium cepa L., the availability of disease resistance is limited. The identification of sources of resistance in related species, such as Allium roylei and Allium fistulosum, was a first step towards the improvement of onion cultivars by breeding. SNP markers linked to resistance and polymorphic between these related species and onion cultivars are a valuable tool to efficiently introgress disease resistance genes. In this paper we describe the identification and validation of SNP markers valuable for onion breeding. Transcriptome sequencing resulted in 192 million RNA seq reads from the interspecific F1 hybrid between A. roylei and A. fistulosum (RF) and nine onion cultivars. After assembly, reliable SNPs were discovered in about 36 % of the contigs. For genotyping of the interspecific three-way cross population, derived from a cross between an onion cultivar and the RF (CCxRF), 1100 SNPs that are polymorphic in RF and monomorphic in the onion cultivars (RF SNPs) were selected for the development of KASP assays. A molecular linkage map based on 667 RF-SNP markers was constructed for CCxRF. In addition, KASP assays were developed for 1600 onion-SNPs (SNPs polymorphic among onion cultivars). A second linkage map was constructed for an F2 of onion x A. roylei (F2(CxR)) that consisted of 182 onion-SNPs and 119 RF-SNPs, and 76 previously mapped markers. Markers co-segregating in both the F2(CxR) and the CCxRF population were used to assign the linkage groups of RF to onion chromosomes. To validate usefulness of these SNP markers, QTL mapping was applied in the CCxRF population that segregates for resistance to Botrytis squamosa and resulted in a QTL for resistance on chromosome 6 of A. roylei. Our research has more than doubled the publicly available marker sequences of expressed onion genes and two onion-related species. It resulted in a detailed genetic map for the interspecific CCxRF population. This is the first paper that reports the detection of a QTL for resistance to B. squamosa in A. roylei.

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

Identification of leptin gene polymorphisms associated with carcass traits and fatty acid composition in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Okura, Kazuki; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2017-03-01

Previous studies have indicated that some leptin gene polymorphisms were associated with economically important traits in cattle breeds. However, polymorphisms in the leptin gene have not been reported thus far in Japanese Black cattle. Here, we aimed to identify the leptin gene polymorphisms which are associated with carcass traits and fatty acid composition in Japanese Black cattle. We sequenced the full-length coding sequence of leptin gene for eight Japanese Black cattle. Sequence comparison revealed eight single nucleotide polymorphisms (SNPs). Three of these were predicted to cause amino acid substitutions: Y7F, R25C and A80V. Then, we genotyped these SNPs in two populations (JB1 with 560 animals and JB2 with 450 animals) and investigated the effects on the traits. Y7F in JB1 and A80V in JB2 were excluded from statistical analysis because the minor allele frequencies were low (< 0.1). Association analysis revealed that Y7F had a significant effect on the dressed carcass weight in JB2; R25C had a significant effect on C18:0 and C14:1 in JB1 and JB2, respectively; and A80V had a significant effect on C16:0, C16:1, C18:1, monounsaturated fatty acid and saturated fatty acid in JB1. The results suggested that these SNPs could be used as an effective marker for the improvement of Japanese Black cattle. © 2016 Japanese Society of Animal Science.

GESPA: classifying nsSNPs to predict disease association.

PubMed

Khurana, Jay K; Reeder, Jay E; Shrimpton, Antony E; Thakar, Juilee

2015-07-25

Non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common DNA sequence variation associated with disease in humans. Thus determining the clinical significance of each nsSNP is of great importance. Potential detrimental nsSNPs may be identified by genetic association studies or by functional analysis in the laboratory, both of which are expensive and time consuming. Existing computational methods lack accuracy and features to facilitate nsSNP classification for clinical use. We developed the GESPA (GEnomic Single nucleotide Polymorphism Analyzer) program to predict the pathogenicity and disease phenotype of nsSNPs. GESPA is a user-friendly software package for classifying disease association of nsSNPs. It allows flexibility in acceptable input formats and predicts the pathogenicity of a given nsSNP by assessing the conservation of amino acids in orthologs and paralogs and supplementing this information with data from medical literature. The development and testing of GESPA was performed using the humsavar, ClinVar and humvar datasets. Additionally, GESPA also predicts the disease phenotype associated with a nsSNP with high accuracy, a feature unavailable in existing software. GESPA's overall accuracy exceeds existing computational methods for predicting nsSNP pathogenicity. The usability of GESPA is enhanced by fast SQL-based cloud storage and retrieval of data. GESPA is a novel bioinformatics tool to determine the pathogenicity and phenotypes of nsSNPs. We anticipate that GESPA will become a useful clinical framework for predicting the disease association of nsSNPs. The program, executable jar file, source code, GPL 3.0 license, user guide, and test data with instructions are available at http://sourceforge.net/projects/gespa.

Association of androgen metabolism gene polymorphisms with prostate cancer risk and androgen concentrations: Results from the Prostate Cancer Prevention Trial.

PubMed

Price, Douglas K; Chau, Cindy H; Till, Cathee; Goodman, Phyllis J; Leach, Robin J; Johnson-Pais, Teresa L; Hsing, Ann W; Hoque, Ashraful; Parnes, Howard L; Schenk, Jeannette M; Tangen, Catherine M; Thompson, Ian M; Reichardt, Juergen K V; Figg, William D

2016-08-01

Prostate cancer is highly influenced by androgens and genes. The authors investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or with the risk of prostate cancer or high-grade disease from finasteride treatment. A nested case-control study from the Prostate Cancer Prevention Trial using data from men who had biopsy-proven prostate cancer (cases) and a group of biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with overall (total), low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. There were significant associations of genetic polymorphisms in steroid 5α-reductase 1 (SRD5A1) (reference SNPs: rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with the risk of high-grade prostate cancer in the placebo arm of the Prostate Cancer Prevention Trial; 2 SNPs were significantly associated with an increased risk (SRD5A1 rs472402 [odds ratio, 1.70; 95% confidence interval, 1.05-2.75; Ptrend = .03] and SRD5A2 rs2300700 [odds ratio, 1.94; 95% confidence interval, 1.19-3.18; Ptrend = .01]). Eleven SNPs in SRD5A1, SRD5A2, cytochrome P450 family 1, subfamily B, polypeptide 1 (CYP1B1), and CYP3A4 were associated with modifying the mean concentrations of serum androgen and sex hormone-binding globulin; and 2 SNPs (SRD5A1 rs824811 and CYP1B1 rs10012; Ptrend < .05) consistently and significantly altered all androgen concentrations. Several SNPs (SRD5A1 rs3822430, SRD5A2 rs2300700, CYP3A43 rs800672, and CYP19 rs700519; Ptrend < .05) were significantly associated with both circulating hormone levels and prostate cancer risk. Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and the risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. Cancer 2016;122:2332-2340. © 2016 American Cancer Society. © 2016 American Cancer Society.

Genetic polymorphisms associated with fatty liver disease and fibrosis in HIV positive patients receiving combined antiretroviral therapy (cART)

PubMed Central

Luda, Carolin; Schwarze-Zander, Carolynne; Boesecke, Christoph; Hansel, Cordula; Nischalke, Hans-Dieter; Lutz, Philipp; Mohr, Raphael; Wasmuth, Jan-Christian; Strassburg, Christian P.; Trebicka, Jonel; Rockstroh, Jürgen Kurt; Spengler, Ulrich

2017-01-01

Hepatic steatosis can occur with any antiretroviral therapy (cART). Although single nucleotide polymorphisms (SNPs) have been identified to predispose to alcoholic and non-alcoholic fatty liver disease, their role for treatment-associated steatosis in HIV-positive patients remains unclear. We determined the frequency of PNPLA3 (rs738409), CSPG3/NCAN (rs2228603), GCKR (rs780094), PPP1R3B (rs4240624), TM6SF (rs8542926), LYPLAL1 (rs12137855) and MBOAT7 (rs626283) by RT-PCR in 117 HIV-positive patients on cART and stratified participants based on their “controlled attenuation parameter” (CAP) into probable (CAP: 215–300 dB/m) and definite (CAP >300 dB/m) hepatic steatosis. We analyzed CAP values and routine metabolic parameters according to the allele frequencies. Sixty-five (55.6%) and 13 (11.1%) patients were allocated to probable and definite steatosis. CAP values (p = 0.012) and serum triglycerides (p = 0.043) were increased in carriers of the GCKR (rs780094) A allele. Cox logistic regression identified triglycerides (p = 0.006), bilirubin (p = 0.021) and BMI (p = 0.068), but not the genetic parameters as risk factors for the occurrence of hepatic steatosis. Taken together, according to the limited sample size, this exploratory study generates the hypothesis that genetic polymorphisms seem to exert minor effects on the risk for fatty liver disease in HIV-positive patients on cART. Nevertheless, SNPs may modify metabolic complications once metabolic abnormalities have developed. Hence, subsequent analysis of a larger cohort is needed. PMID:28594920

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

USDA-ARS?s Scientific Manuscript database

The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Whole Genome Re-Sequencing and Characterization of Powdery Mildew Disease-Associated Allelic Variation in Melon.

PubMed

Natarajan, Sathishkumar; Kim, Hoy-Taek; Thamilarasan, Senthil Kumar; Veerappan, Karpagam; Park, Jong-In; Nou, Ill-Sup

2016-01-01

Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L.) and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs), 1.9 million InDels, and 182,398 putative structural variations (SVs). Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.

Lack of association between SREBF-1c gene polymorphisms and risk of non-alcoholic fatty liver disease in a Chinese Han population.

PubMed

Peng, Xian-E; Chen, Feng-Lin; Liu, Wenjuan; Hu, ZhiJian; Lin, Xu

2016-08-30

The transcription factor sterol regulatory element-binding protein-1c (SREBP-1c) is a key regulator of lipogenesis and insulin sensitivity, and is associated with non-alcoholic fatty liver disease (NAFLD). Here, we assessed the impact of common single nucleotide polymorphisms (SNPs) in SREBF-1c on NAFLD susceptibility and associated metabolic phenotypes in a Han Chinese population. Four common SNPs (rs62064119, rs2297508, rs11868035 and rs13306741) in the SREBP-1c gene were selected and genotyped in 593 patients with NAFLD and 593 healthy controls. Unconditional logistic regression was performed to assess the risk of NAFLD by determining odds ratios and 95% confidence intervals (CIs). No significant differences in genotype and allele frequencies of these four SNPs were found between the NAFLD population and the controls (all P > 0.05). In addition, we did not find any association between the SREBF-1c SNPs and the clinical and biochemical parameters, such as body mass index, total cholesterol, high density lipoprotein-and low density lipoprotein-cholesterol or systolic and diastolic blood pressure, except that the rs2297508 C-allele or rs11868035 G-allele showed significant associations with lower triglyceride levels in control subjects (P < 0.01). Our findings suggested that the four polymorphisms in SREBF-1c gene are not associated with risk of NAFLD in the Chinese Han population.

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

A genetic variant of miR-148a binding site in the SCRN1 3'-UTR is associated with susceptibility and prognosis of gastric cancer.

PubMed

Song, Peng; Zhu, Haixia; Zhang, Dong; Chu, Haiyan; Wu, Dongmei; Kang, Meiyun; Wang, Meilin; Gong, Weida; Zhou, Jianwei; Zhang, Zhengdong; Zhao, Qinghong

2014-11-17

Single nucleotide polymorphisms (SNPs) in the 3'-untranslated regions targeted by putative mircoRNA can change its binding strength, affecting the susceptibility and prognosis of cancer. We aimed to investigate the associations between SNPs within miR-148a binding sites and gastric cancer (GC) risk and prognosis. Using bioinformatics tools, we selected two SNPs (SCRN1 rs6976789 and PDYN rs2235749) located in miR-148a target sites. We genotyped the two SNPs in a case-control study comprising 753 GC patients and 949 cancer-free subjects. We found a significantly increased risk of GC associated with the SCRN1 rs6976789 C>T polymorphism [adjusted OR = 1.25, 95% confidence interval (CI) = 1.02-1.53; CT/TT vs. CC]. However, no significant association was found between the PDYN rs2235749 and GC risk in all genetic models. Furthermore, we evaluated whether SCRN1 rs6976789 affected the survival of GC patients. Results showed that individuals with SCRN1 rs6976789 TT genotype had poorer overall survival compared with those carried CC/CT genotypes in intestinal-type GC (adjusted HR = 2.47, 95% CI = 1.21-5.05). Luciferase report assay showed that the rs6976789 variant T allele influenced the binding ability of miR-148a. Our results suggested that the SCRN1 rs6976789 polymorphism may play an important role in the GC development and progression.

Polymorphisms in MicroRNA Genes And Genes Involving in NMDAR Signaling and Schizophrenia: A Case-Control Study in Chinese Han Population.

PubMed

Zhang, Yanxia; Fan, Mei; Wang, Qingzhong; He, Guang; Fu, Yingmei; Li, Huafang; Yu, Shunying

2015-08-10

Disturbances in glutamate signaling caused by disruption of N-methyl-D-aspartate-type glutamate receptor (NMDAR) have been implicated in schizophrenia. Findings suggested that miR-219, miR-132 and miR-107 could involve in NMDAR signaling by influencing the expression of pathway genes or the signaling transmission and single nucleotide polymorphisms (SNPs) within miRNA genes or miRNA target sites could result in their functional changes. Therefore, we hypothesized that SNPs in miRNAs and/or their target sites were associated with schizophrenia. 3 SNPs in hsa-pri-miR-219/132/107 and 6 SNPs in 3'UTRs of GRIN2A/2B/3A and CAMK2G were selected and genotyped in a case-control study of 1041 schizophrenia cases and 953 healthy controls in Chinese Han population. In the present study, GRIN2B rs890 showed significant associations with schizophrenia. Further functional analyses showed that the rs890 variant C allele led to significantly lower luciferase activity, compared with the A allele. MDR analysis showed that a 4-locus model including rs107822, rs2306327, rs890 and rs12342026 was the best model. These findings suggest that GRIN2B may be associated with schizophrenia and interaction effects of the polymorphisms in hsa-miR-219, CAKM2G, GRIN2B and GRIN3A may confer susceptibility to schizophrenia in the Chinese Han population.

Ghrelin gene polymorphisms in rheumatoid arthritis.

PubMed

Ozgen, Metin; Koca, Suleyman Serdar; Etem, Ebru Onalan; Yuce, Huseyin; Aydin, Suleyman; Isik, Ahmet

2011-07-01

Ghrelin, an endogenous orexigenic peptide, has anti-inflammatory effects, down-regulates pro-inflammatory cytokines, and its altered levels are reported in various inflammatory diseases. The human preproghrelin (ghrelin/obestatin) gene shows several single nucleotide polymorphisms (SNPs) including Arg51Gln, Leu72Met, Gln90Leu, and A-501C. The aim of this study was to investigate the frequency, and clinical significance, of these four SNPs in a small cohort of Turkish patients with rheumatoid arthritis (RA). The study included 103 patients with RA and 103 healthy controls. In the RA group, disease activity and disease-related damage were assessed using the Disease Activity Score-28 (DAS-28), and the modified Larsen scoring (MLS) methods. In all the participants, genomic DNA was isolated and genotyped by polymerase chain reaction and restriction fragment length polymorphism analysis. The frequencies of ghrelin gene SNPs were 82.5 and 79.6% in the RA and control groups, respectively, and there were no significant differences in terms of genotype distributions and allele frequencies for these four SNPs between the groups. However, the A-501C SNP was found to be associated with early disease onset, and Gln90Leu SNP with less frequent rheumatoid factor positivity, in the RA group. A-501C SNP is associated with earlier onset of RA suggesting that genetic variations in the ghrelin gene may have an impact on RA. Copyright © 2010 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

RNA Expression and Post-Transcriptional Editing Analyses of Cucumber Plastids Reveals Genetic Differences Associated with Chilling Tolerance

USDA-ARS?s Scientific Manuscript database

Tolerance to chilling injury in cucumber (Cucumis sativus L.) is associated with three plastomic single nucleotide polymorphisms (ptSNPs) at bp positions 4,813, 56,561, and 126,349 that are co-inherited. An understanding of the genetic expression of these ptSNPs as a response to chilling is critical...

Development and evaluation of a high density genotyping 'Axiom_Arachis' array with 58K SNPs for accelerating genetics and breeding in groundnut

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are the most abundant DNA sequence variation in the genomes which can be used to associate genotypic variation to the phenotype. Therefore, availability of a high-density SNP array with uniform genome coverage can advance genetic studies and breeding applicatio...

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

PubMed

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

2017-01-01

RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments.

Correlates between Models of Virulence for Mycobacterium tuberculosis among Isolates of the Central Asian Lineage: a Case for Lysozyme Resistance Testing?

PubMed Central

Casali, Nicola; Clark, Simon O.; Hooper, Richard; Williams, Ann; Velji, Preya; Gonzalo, Ximena

2015-01-01

Virulence factors (VFs) contribute to the emergence of new human Mycobacterium tuberculosis strains, are lineage dependent, and are relevant to the development of M. tuberculosis drugs/vaccines. VFs were sought within M. tuberculosis lineage 3, which has the Central Asian (CAS) spoligotype. Three isolates were selected from clusters previously identified as dominant in London, United Kingdom. Strain-associated virulence was studied in guinea pig, monocyte-derived macrophage, and lysozyme resistance assays. Whole-genome sequencing, single nucleotide polymorphism (SNP) analysis, and a literature review contributed to the identification of SNPs of interest. The animal model revealed borderline differences in strain-associated pathogenicity. Ex vivo, isolate C72 exhibited statistically significant differences in intracellular growth relative to C6 and C14. SNP candidates inducing lower fitness levels included 123 unique nonsynonymous SNPs, including three located in genes (lysX, caeA, and ponA2) previously identified as VFs in the laboratory-adapted reference strain H37Rv and shown to confer lysozyme resistance. C72 growth was most affected by lysozyme in vitro. A BLAST search revealed that all three SNPs of interest (C35F, P76Q, and P780R) also occurred in Tiruvallur, India, and in Uganda. Unlike C72, however, no single isolate identified through BLAST carried all three SNPs simultaneously. CAS isolates representative of three medium-sized human clusters demonstrated differential outcomes in models commonly used to estimate strain-associated virulence, supporting the idea that virulence varies within, not just across, M. tuberculosis lineages. Three VF SNPs of interest were identified in two additional locations worldwide, which suggested independent selection and supported a role for these SNPs in virulence. The relevance of lysozyme resistance to strain virulence remains to be established. PMID:25776753

Naturally Occurring Variations in the Human Cholinesterase Genes: Heritability and Association with Cardiovascular and Metabolic Traits

PubMed Central

Valle, Anne M.; Radić, Zoran; Rana, Brinda K.; Mahboubi, Vafa; Wessel, Jennifer; Shih, Pei-an Betty; Rao, Fangwen; O'Connor, Daniel T.

2011-01-01

Cholinergic neurotransmission in the central and autonomic nervous systems regulates immediate variations in and longer-term maintenance of cardiovascular function with acetylcholinesterase (AChE) activity that is critical to temporal responsiveness. Butyrylcholinesterase (BChE), largely confined to the liver and plasma, subserves metabolic functions. AChE and BChE are found in hematopoietic cells and plasma, enabling one to correlate enzyme levels in whole blood with hereditary traits in twins. Using both twin and unrelated subjects, we found certain single nucleotide polymorphisms (SNPs) in the ACHE gene correlated with catalytic properties and general cardiovascular functions. SNP discovery from ACHE resequencing identified 19 SNPs: 7 coding SNPs (cSNPs), of which 4 are nonsynonymous, and 12 SNPs in untranslated regions, of which 3 are in a conserved sequence of an upstream intron. Both AChE and BChE activity traits in blood were heritable: AChE at 48.8 ± 6.1% and BChE at 81.4 ± 2.8%. Allelic and haplotype variations in the ACHE and BCHE genes were associated with changes in blood AChE and BChE activities. AChE activity was associated with BP status and SBP, whereas BChE activity was associated with features of the metabolic syndrome (especially body weight and BMI). Gene products from cDNAs with nonsynonymous cSNPs were expressed and purified. Protein expression of ACHE nonsynonymous variant D134H (SNP6) is impaired: this variant shows compromised stability and altered rates of organophosphate inhibition and oxime-assisted reactivation. A substantial fraction of the D134H instability could be reversed in the D134H/R136Q mutant. Hence, common genetic variations at ACHE and BCHE loci were associated with changes in corresponding enzymatic activities in blood. PMID:21493754

VEGF-A and VEGFR1 SNPs associate with preeclampsia in a Philippine population.

PubMed

Amosco, Melissa D; Villar, Van Anthony M; Naniong, Justin Michael A; David-Bustamante, Lara Marie G; Jose, Pedro A; Palmes-Saloma, Cynthia P

The vascular endothelial growth factor (VEGF) family is important for establishing normal pregnancy, and related single nucleotide polymorphisms (SNPs) are implicated in abnormal placentation and preeclampsia. We evaluated the association between preeclampsia and several VEGF SNPs among Filipinos, an ethnically distinct group with high prevalence of preeclampsia. The genotypes and allelic variants were determined in a case-control study (191 controls and 165 preeclampsia patients) through SNP analysis of VEGF-A (rs2010963, rs3025039) and VEGF-C (rs7664413) and their corresponding receptors VEGFR1 (rs722503, rs12584067, rs7335588) and VEGFR3 (rs307826) from venous blood DNA. VEGF-A rs3025039 C allele has been shown to associate with preeclampsia (odds ratio of 1.648 (1.03-2.62)), while the T allele bestowed an additive effect for the maintenance of normal, uncomplicated pregnancy and against the development of preeclampsia (odds ratio of 0.62 (0.39-0.98)). VEGFR1 rs722503 is associated with preeclampsia occurring at or after the age of 40 years. The results showed that genetic variability of VEGF-A and VEGFR1 are important in the etiology of preeclampsia among Filipinos.

Local evolution of pyrethroid resistance offsets gene flow among Aedes aegypti collections in Yucatan State, Mexico.

PubMed

Saavedra-Rodriguez, Karla; Beaty, Meaghan; Lozano-Fuentes, Saul; Denham, Steven; Garcia-Rejon, Julian; Reyes-Solis, Guadalupe; Machain-Williams, Carlos; Loroño-Pino, Maria Alba; Flores-Suarez, Adriana; Ponce-Garcia, Gustavo; Beaty, Barry; Eisen, Lars; Black, William C

2015-01-01

The mosquito Aedes aegypti is the major vector of the four serotypes of dengue virus (DENV1-4). Previous studies have shown that Ae. aegypti in Mexico have a high effective migration rate and that gene flow occurs among populations that are up to 150 km apart. Since 2000, pyrethroids have been widely used for suppression of Ae. aegypti in cities in Mexico. In Yucatan State in particular, pyrethroids have been applied in and around dengue case households creating an opportunity for local selection and evolution of resistance. Herein, we test for evidence of local adaptation by comparing patterns of variation among 27 Ae. aegypti collections at 13 single nucleotide polymorphisms (SNPs): two in the voltage-gated sodium channel gene para known to confer knockdown resistance, three in detoxification genes previously associated with pyrethroid resistance, and eight in putatively neutral loci. The SNPs in para varied greatly in frequency among collections, whereas SNPs at the remaining 11 loci showed little variation supporting previous evidence for extensive local gene flow. Among Ae. aegypti in Yucatan State, Mexico, local adaptation to pyrethroids appears to offset the homogenizing effects of gene flow. © The American Society of Tropical Medicine and Hygiene.

Deletion of murine choline dehydrogenase results in diminished sperm motility.

PubMed

Johnson, Amy R; Craciunescu, Corneliu N; Guo, Zhong; Teng, Ya-Wen; Thresher, Randy J; Blusztajn, Jan K; Zeisel, Steven H

2010-08-01

Choline dehydrogenase (CHDH) catalyzes the conversion of choline to betaine, an important methyl donor and organic osmolyte. We have previously identified single nucleotide polymorphisms (SNPs) in the human CHDH gene that, when present, seem to alter the activity of the CHDH enzyme. These SNPs occur frequently in humans. We created a Chdh(-/-) mouse to determine the functional effects of mutations that result in decreased CHDH activity. Chdh deletion did not affect fetal viability or alter growth or survival of these mice. Only one of eleven Chdh(-/-) males was able to reproduce. Loss of CHDH activity resulted in decreased testicular betaine and increased choline and PCho concentrations. Chdh(+/+) and Chdh(-/-) mice produced comparable amounts of sperm; the impaired fertility was due to diminished sperm motility in the Chdh(-/-) males. Transmission electron microscopy revealed abnormal mitochondrial morphology in Chdh(-/-) sperm. ATP content, total mitochondrial dehydrogenase activity and inner mitochondrial membrane polarization were all significantly reduced in sperm from Chdh(-/-) animals. Mitochondrial changes were also detected in liver, kidney, heart, and testis tissues. We suggest that men who have SNPs in CHDH that decrease the activity of the CHDH enzyme could have decreased sperm motility and fertility.

Association of ADIPOQ gene with obesity and adiponectin levels in Malaysian Malays.

PubMed

Apalasamy, Yamunah Devi; Rampal, Sanjay; Salim, Agus; Moy, Foong Ming; Bulgiba, Awang; Mohamed, Zahurin

2014-05-01

Studies have shown that single-nucleotide polymorphisms (SNPs) on the ADIPOQ gene have been linked with obesity and with adiponectin levels in various populations. Here, we aimed to investigate the association of ADIPOQ rs17366568 and rs3774261 SNPs with obesity and with adiponectin levels in Malaysian Malays. Obesity parameters and adiponectin levels were measured in 574 subjects. Genotyping was performed using real-time polymerase chain reaction and Sequenom MassARRAY. A significant genotypic association was observed between ADIPOQ rs17366568 and obesity. The frequencies of AG and AA genotypes were significantly higher in the obese group (11%) than in the non-obese group (5%) (P=0.024). The odds of A alleles occurring among the obese group were twice those among the non-obese group (odds ratio 2.15; 95% confidence interval 1.13-4.09). However, no significant association was found between allelic frequencies of ADIPOQ rs17366568 and obesity after Bonferroni correction (P>0.025) or between ADIPOQ rs3774261 and obesity both at allelic and genotypic levels. ADIPOQ SNPs were not significantly associated with log-adiponectin levels. GA, GG, and AG haplotypes of the ADIPOQ gene were not associated with obesity. We confirmed the previously reported association of ADIPOQ rs17366568 with the risk of obesity. ADIPOQ SNPs are not important modulators of adiponectin levels in this population.

Studying the genetic basis of speciation in high gene flow marine invertebrates

PubMed Central

2016-01-01

A growing number of genes responsible for reproductive incompatibilities between species (barrier loci) exhibit the signals of positive selection. However, the possibility that genes experiencing positive selection diverge early in speciation and commonly cause reproductive incompatibilities has not been systematically investigated on a genome-wide scale. Here, I outline a research program for studying the genetic basis of speciation in broadcast spawning marine invertebrates that uses a priori genome-wide information on a large, unbiased sample of genes tested for positive selection. A targeted sequence capture approach is proposed that scores single-nucleotide polymorphisms (SNPs) in widely separated species populations at an early stage of allopatric divergence. The targeted capture of both coding and non-coding sequences enables SNPs to be characterized at known locations across the genome and at genes with known selective or neutral histories. The neutral coding and non-coding SNPs provide robust background distributions for identifying FST-outliers within genes that can, in principle, identify specific mutations experiencing diversifying selection. If natural hybridization occurs between species, the neutral coding and non-coding SNPs can provide a neutral admixture model for genomic clines analyses aimed at finding genes exhibiting strong blocks to introgression. Strongylocentrotid sea urchins are used as a model system to outline the approach but it can be used for any group that has a complete reference genome available. PMID:29491951

No association between polymorphisms and haplotypes of COL1A1 and COL1A2 genes and osteoporotic fracture in postmenopausal Chinese women

PubMed Central

Hu, Wei-wei; He, Jin-wei; Zhang, Hao; Wang, Chun; Gu, Jie-mei; Yue, Hua; Ke, Yao-hua; Hu, Yun-qiu; Fu, Wen-zhen; Li, Miao; Liu, Yu-juan; Zhang, Zhen-lin

2011-01-01

Aim: To study whether genetic polymorphisms of COL1A1 and COL1A2 genes affected the onset of fracture in postmenopausal Chinese women. Methods: SNPs in COL1A1 and COL1A2 genes were identified via direct sequencing in 32 unrelated postmenopausal Chinese women. Ten SNPs were genotyped in 1252 postmenopausal Chinese women. The associations were examined using both single-SNP and haplotype tests using logistic regression. Results: Twenty four (4 novel) and 28 (7 novel) SNPs were identified in COL1A1 and COL1A2 gene, respectively. The distribution frequencies of 2 SNPs in COL1A1 (rs2075554 and rs2586494) and 3 SNPs in COL1A2 (rs42517, rs1801182, and rs42524) were significantly different from those documented for the European Caucasian population. No significant difference was observed between fracture and control groups with respect to allele frequency or genotype distribution in 9 selected SNPs and haplotype. No significant association was found between fragility fracture and each SNP or haplotype. The results remained the same after additional corrections for other risk factors such as weight, height, and bone mineral density. Conclusion: Our results show no association between common genetic variations of COL1A1 and COL1A2 genes and fracture, suggesting the complex genetic background of osteoporotic fractures. PMID:21602843

Analysis of genetic polymorphisms in skeletal Class I crowding.

PubMed

Ting, Tung Yuen; Wong, Ricky Wing Kit; Rabie, A Bakr M

2011-07-01

Dental crowding is a problem for both adolescents and adults in modern society. The purpose of this research was to identify single nucleotide polymorphisms (SNPs) responsible for crowding in subjects with skeletal Class I relationships. The case subjects consisted of healthy Chinese people living in Hong Kong with skeletal Class I relationships and at least 5 mm of crowding in either arch. The control subjects met the same requirements but lacked crowding or spacing. SNP genotyping was performed on the MassARRAY platform. The chi-square test was used to compare genotype and allele type distributions between the case and the control groups. Logistic regression was used to calculate odds ratios with 95% confidence intervals, and the effects of age and sex for each SNP. Analyses of linkage disequilibrium and haplotype associations between SNPs were performed with software. Five SNPs were found to be significantly different in genotype or allele type distributions. SNP rs372024 was significantly associated with crowding (P = 0.004). Two SNPs, rs3764746 and rs3795170, on the EDA gene were found to be associated marginally. SNPs rs1005464 and rs15705 also exhibited marginal association with crowding. The effects of associated SNPs remained significant after adjustments for age and sex factors. This study suggests an association for the genes EDA and XEDAR in dental crowding in the Hong Kong Chinese population. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Genetic effects of PDGFRB and MARCH1 identified in GWAS revealing strong associations with semen production traits in Chinese Holstein bulls.

PubMed

Liu, Shuli; Yin, Hongwei; Li, Cong; Qin, Chunhua; Cai, Wentao; Cao, Mingyue; Zhang, Shengli

2017-07-03

Using a genome-wide association study strategy, our previous study discovered 19 significant single-nucleotide polymorphisms (SNPs) related to semen production traits in Chinese Holstein bulls. Among them, three SNPs were within or close to the phosphodiesterase 3A (PDE3A), membrane associated ring-CH-type finger 1 (MARCH1) and platelet derived growth factor receptor beta (PDGFRB) genes. The present study was designed with the objectives of identifying genetic polymorphism of the PDE3A, PDGFRB and MARCH1 genes and their effects on semen production traits in a Holstein bull population. A total of 20 SNPs were detected and genotyped in 730 bulls. Association analyses using de-regressed estimated breeding values of each semen production trait revealed four statistically significant SNPs for one or more semen production traits (P < 0.05): one SNP was located downstream of PDGFRB and three SNPs were located in the promoter of MARCH1. Interestingly, for MARCH1, haplotype-based analysis revealed significant associations of haplotypes with semen volume per ejaculate. Furthermore, high expression of the MARCH1 gene was observed in sperm cells. One SNP (rs43445726) in the regulatory region of MARCH1 had a significant effect on gene expression. Our study demonstrated the significant associations of genetic variants of the PDGFRB and MARCH1 genes with semen production traits. The identified SNPs may serve as genetic markers to optimize breeding programs for semen production traits in Holstein bull populations.

Nonsynonymous Polymorphism in Guanine Monophosphate Synthetase Is a Risk Factor for Unfavorable Thiopurine Metabolite Ratios in Patients With Inflammatory Bowel Disease.

PubMed

Roberts, Rebecca L; Wallace, Mary C; Seinen, Margien L; van Bodegraven, Adriaan A; Krishnaprasad, Krupa; Jones, Gregory T; van Rij, Andre M; Baird, Angela; Lawrance, Ian C; Prosser, Ruth; Bampton, Peter; Grafton, Rachel; Simms, Lisa A; Studd, Corrie; Bell, Sally J; Kennedy, Martin A; Halliwell, Jacob; Gearry, Richard B; Radford-Smith, Graham; Andrews, Jane M; McHugh, Patrick C; Barclay, Murray L

2018-05-16

Up to 20% of patients with inflammatory bowel disease (IBD) who are refractory to thiopurine therapy preferentially produce 6-methylmercaptopurine (6-MMP) at the expense of 6-thioguanine nucleotides (6-TGN), resulting in a high 6-MMP:6-TGN ratio (>20). The objective of this study was to evaluate whether genetic variability in guanine monophosphate synthetase (GMPS) contributes to preferential 6-MMP metabolizer phenotype. Exome sequencing was performed in a cohort of IBD patients with 6-MMP:6-TGN ratios of >100 to identify nonsynonymous single nucleotide polymorphisms (nsSNPs). In vitro assays were performed to measure GMPS activity associated with these nsSNPs. Frequency of the nsSNPs was measured in a cohort of 530 Caucasian IBD patients. Two nsSNPs in GMPS (rs747629729, rs61750370) were detected in 11 patients with very high 6-MMP:6-TGN ratios. The 2 nsSNPs were predicted to be damaging by in silico analysis. In vitro assays demonstrated that both nsSNPs resulted in a significant reduction in GMPS activity (P < 0.05). The SNP rs61750370 was significantly associated with 6-MMP:6-TGN ratios ≥100 (odds ratio, 5.64; 95% confidence interval, 1.01-25.12; P < 0.031) in a subset of 264 Caucasian IBD patients. The GMPS SNP rs61750370 may be a reliable risk factor for extreme 6MMP preferential metabolism.

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

The investigation of genetic polymorphisms in the carbonic anhydrase VI gene exon 2 and salivary parameters in type 2 diabetic patients and healthy adults.

PubMed

Koç Öztürk, Leyla; Ulucan, Korkut; Akyüz, Serap; Furuncuoğlu, Halit; Bayer, Hikmet; Yarat, Ayşen

2012-05-01

The aim of this study was to investigate carbonic anhydrase (CA) VI Exon 2 single nucleotide polymorphism (SNP) and its possible association with salivary parameters in type 2 diabetic patients compared to healthy adults. Caries status was measured by using the DMFT (number of decayed, missing, and filled teeth) index. Unstimulated whole saliva and blood samples were taken. SNPs of CA gene exon 2 were determined by PCR and DNA sequencing. Salivary CA activity and buffering capacity were determined by the method of Verpoorte and Ericson, respectively. Furthermore, salivary pH was measured with pH paper and salivary flow rate was calculated. Salivary buffering capacity and pH were significantly lower in diabetic patients than those of healthy subjects (P < 0.05). Salivary flow rate, CA activity and DMFT levels did not differ between groups (P > 0.05). Four SNPs were detected; their pubmed database number are rs2274327 (C/T), rs2274328 (A/C), rs2274329 (G/C) and rs2274330. While first three of those were responsible for amino acid changes, the last one was not. The frequencies of SNPs were not significant between groups (P > 0.05). Positive significant correlation was found between CA activity and the frequency of SNPs. There was no correlation between the SNPs frequencies and pH or buffering capacity. SNPs found in this study may be related to salivary CA activity in diabetics.

The cancer anorexia/weight loss syndrome: exploring associations with single nucleotide polymorphisms (SNPs) of inflammatory cytokines in patients with non-small cell lung cancer.

PubMed

Jatoi, Aminah; Qi, Yingwei; Kendall, Glenda; Jiang, Ruoxiang; McNallan, Sheila; Cunningham, Julie; Mandrekar, Sumithra; Yang, Ping

2010-10-01

The cancer anorexia/weight loss syndrome commonly occurs in patients with non-small cell lung cancer (NSCLC) and is characterized by loss of weight and appetite as well as diminished survival. The current study explored whether any of 22 single nucleotide polymorphisms (SNPs) of certain previously implicated inflammatory cytokines (interleukin-1 beta, interleukin-1RN, interleukin-6, and tumor necrosis factor) are associated with this syndrome. All NSCLC patients who had been enrolled in the Mayo Clinic Lung Cancer Cohort, had completed a health-related questionnaire approximately 6 months after enrollment, and had blood drawn were included in this study, thus yielding a sample size of 471 patients. Sixty-six (14%) patients manifested weight loss shortly after diagnosis, and 152 (32%) reported appetite loss. Only tumor necrosis factor alpha rs800629 was associated with anorexia (odds ratio: 0.46; 95% confidence interval: 0.29, 0.72; p < 0.001); patients who were heterozygous and minor homozygous were less likely to suffer anorexia. Otherwise, there were no statistically significant associations between any of the other 21 SNPs and weight loss and/or anorexia. In univariate analyses, weight loss, anorexia, more advanced cancer stage, and interleukin-1 beta rs1143627 were associated with a worse survival, and interleukin-6 rs2069835 was associated with better survival. However, in multivariate analyses, cancer stage and patient age were the only statistically significant predictors of worse survival. No specific SNP was associated with all aspects of the cancer anorexia/weight loss syndrome, but rs800629 may merit further study in cancer-associated anorexia.

The cancer anorexia/weight loss syndrome: exploring associations with single nucleotide polymorphisms (SNPs) of inflammatory cytokines in patients with non-small cell lung cancer

PubMed Central

Jatoi, Aminah; Qi, Yingwei; Kendall, Glenda; Jiang, Ruoxiang; McNallan, Sheila; Cunningham, Julie; Mandrekar, Sumithra; Yang, Ping

2010-01-01

Objective The cancer anorexia/weight loss syndrome commonly occurs in patients with non-small cell lung cancer (NSCLC) and is characterized by loss of weight and appetite as well as diminished survival. The current study explored whether any of 22 single nucleotide polymorphisms (SNPs) of certain previously implicated inflammatory cytokines (interleukin-1 beta, interleukin-1RN, interleukin-6, and tumor necrosis factor) are associated with this syndrome. Patients and Methods All NSCLC patients who had been enrolled in the Mayo Clinic Lung Cancer Cohort, had completed a health-related questionnaire approximately 6 months after enrollment, and had blood drawn were included in this study, thus yielding a sample size of 471 patients. Results Sixty-six (14%) patients manifested weight loss shortly after diagnosis, and 152 (32%) reported appetite loss. Only tumor necrosis factor alpha rs800629 was associated with anorexia (odds ratio: 0.46; 95% confidence interval: 0.29, 0.72; p<0.001); patients who were heterozygous and minor homozygous were less likely to suffer anorexia. Otherwise, there were no statistically significant associations between any of the other 21 SNPs and weight loss and/or anorexia. In univariate analyses, weight loss, anorexia, more advanced cancer stage, and interleukin-1 beta rs1143627 were associated with a worse survival, and interleukin-6 rs2069835 was associated with better survival. However, in multivariate analyses, cancer stage and patient age were the only statistically significant predictors of worse survival. Conclusion No specific SNP was associated with all aspects of the cancer anorexia/weight loss syndrome, but rs800629 may merit further study in cancer-associated anorexia. PMID:20012999

Nucleotide, cytogenetic and expression impact of the human chromosome 8p23.1 inversion polymorphism.

PubMed

Bosch, Nina; Morell, Marta; Ponsa, Immaculada; Mercader, Josep Maria; Armengol, Lluís; Estivill, Xavier

2009-12-14

The human chromosome 8p23.1 region contains a 3.8-4.5 Mb segment which can be found in different orientations (defined as genomic inversion) among individuals. The identification of single nucleotide polymorphisms (SNPs) tightly linked to the genomic orientation of a given region should be useful to indirectly evaluate the genotypes of large genomic orientations in the individuals. We have identified 16 SNPs, which are in linkage disequilibrium (LD) with the 8p23.1 inversion as detected by fluorescent in situ hybridization (FISH). The variability of the 8p23.1 orientation in 150 HapMap samples was predicted using this set of SNPs and was verified by FISH in a subset of samples. Four genes (NEIL2, MSRA, CTSB and BLK) were found differentially expressed (p<0.0005) according to the orientation of the 8p23.1 region. Finally, we have found variable levels of mosaicism for the orientation of the 8p23.1 as determined by FISH. By means of dense SNP genotyping of the region, haplotype-based computational analyses and FISH experiments we could infer and verify the orientation status of alleles in the 8p23.1 region by detecting two short haplotype stretches at both ends of the inverted region, which are likely the relic of the chromosome in which the original inversion occurred. Moreover, an impact of 8p23.1 inversion on gene expression levels cannot be ruled out, since four genes from this region have statistically significant different expression levels depending on the inversion status. FISH results in lymphoblastoid cell lines suggest the presence of mosaicism regarding the 8p23.1 inversion.

Interaction between arsenic exposure from drinking water and genetic polymorphisms on cardiovascular disease in Bangladesh: a prospective case-cohort study.

PubMed

Wu, Fen; Jasmine, Farzana; Kibriya, Muhammad G; Liu, Mengling; Cheng, Xin; Parvez, Faruque; Islam, Tariqul; Ahmed, Alauddin; Rakibuz-Zaman, Muhammad; Jiang, Jieying; Roy, Shantanu; Paul-Brutus, Rachelle; Slavkovich, Vesna; Islam, Tariqul; Levy, Diane; VanderWeele, Tyler J; Pierce, Brandon L; Graziano, Joseph H; Ahsan, Habibul; Chen, Yu

2015-05-01

Epidemiologic data on genetic susceptibility to cardiovascular effects of arsenic exposure from drinking water are limited. We investigated whether the association between well-water arsenic and cardiovascular disease (CVD) differed by 170 single nucleotide polymorphisms (SNPs) in 17 genes related to arsenic metabolism, oxidative stress, inflammation, and endothelial dysfunction. We conducted a prospective case-cohort study nested in the Health Effects of Arsenic Longitudinal Study, with a random subcohort of 1,375 subjects and 447 incident fatal and nonfatal cases of CVD. Well-water arsenic was measured in 2000 at baseline. The CVD cases, 56 of which occurred in the subcohort, included 238 coronary heart disease cases, 165 stroke cases, and 44 deaths due to other CVD identified during follow-up from 2000 to 2012. Of the 170 SNPs tested, multiplicative interactions between well-water arsenic and two SNPs, rs281432 in ICAM1 (padj = 0.0002) and rs3176867 in VCAM1 (padj = 0.035), were significant for CVD after adjustment for multiple testing. Compared with those with GC or CC genotype in rs281432 and lower well-water arsenic, the adjusted hazard ratio (aHR) for CVD was 1.82 (95% CI: 1.31, 2.54) for a 1-SD increase in well-water arsenic combined with the GG genotype, which was greater than expected given aHRs of 1.08 and 0.96 for separate effects of arsenic and the genotype alone, respectively. Similarly, the joint aHR for arsenic and the rs3176867 CC genotype was 1.34 (95% CI: 0.95, 1.87), greater than expected given aHRs for their separate effects of 1.02 and 0.84, respectively. Associations between CVD and arsenic exposure may be modified by genetic variants related to endothelial dysfunction.

Association study of interleukin-4 polymorphisms with paranoid schizophrenia in the Polish population: a critical approach.

PubMed

Fila-Danilow, Anna; Kucia, Krzysztof; Kowalczyk, Malgorzata; Owczarek, Aleksander; Paul-Samojedny, Monika; Borkowska, Paulina; Suchanek, Renata; Kowalski, Jan

2012-08-01

Changes in immunological system are one of dysfunctions reported in schizophrenia. Some changes based on an imbalance between Th1 and Th2 cytokines results from cytokine gene polymorphisms. Interleukin-4 gene (IL4) is considered as a potential candidate gene in schizophrenia association studies. The aim of the current case-control study was to examine whether the -590C/T (rs2243250) and -33C/T (rs2070874) IL4 gene polymorphisms are implicated in paranoid schizophrenia development in the Polish population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. The genotypes and alleles distribution of both SNPs were analysed in patients (n = 182) and healthy individuals constituted the control group (n = 215). The connection between some clinical variables and studied polymorphisms has been examined as well. We did not revealed any association between the -590C/T and -33C/T polymorphisms and paranoid schizophrenia. In case of both SNPs the homozygous TT genotype was extremely rare. Both polymorphic sites of the IL4 gene were found to be in a very strong linkage disequilibrium. However we did not identify a haplotype predispose to paranoid schizophrenia. No associations were also observed between the clinical course and psychopathology of the disease and the genotypes of both analysed polymorphisms. Our results suggest that the polymorphisms -590C/T in IL4 gene promoter region and -33C/T in the 5'-UTR are not involved in the pathophysiology of paranoid schizophrenia in Polish residents.

High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: assay success, polymorphism and transferability across species

PubMed Central

2011-01-01

Background High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity ≥2%. The development of a much larger array of informative SNPs across multiple Eucalyptus species is feasible, although strongly dependent on having a representative and sufficiently deep collection of sequences from many individuals of each target species. A higher density SNP platform will be instrumental to undertake genome-wide phylogenetic and population genomics studies and to implement molecular breeding by Genomic Selection in Eucalyptus. PMID:21492434

SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects.

PubMed

Dereeper, Alexis; Nicolas, Stéphane; Le Cunff, Loïc; Bacilieri, Roberto; Doligez, Agnès; Peros, Jean-Pierre; Ruiz, Manuel; This, Patrice

2011-05-05

High-throughput re-sequencing, new genotyping technologies and the availability of reference genomes allow the extensive characterization of Single Nucleotide Polymorphisms (SNPs) and insertion/deletion events (indels) in many plant species. The rapidly increasing amount of re-sequencing and genotyping data generated by large-scale genetic diversity projects requires the development of integrated bioinformatics tools able to efficiently manage, analyze, and combine these genetic data with genome structure and external data. In this context, we developed SNiPlay, a flexible, user-friendly and integrative web-based tool dedicated to polymorphism discovery and analysis. It integrates:1) a pipeline, freely accessible through the internet, combining existing softwares with new tools to detect SNPs and to compute different types of statistical indices and graphical layouts for SNP data. From standard sequence alignments, genotyping data or Sanger sequencing traces given as input, SNiPlay detects SNPs and indels events and outputs submission files for the design of Illumina's SNP chips. Subsequently, it sends sequences and genotyping data into a series of modules in charge of various processes: physical mapping to a reference genome, annotation (genomic position, intron/exon location, synonymous/non-synonymous substitutions), SNP frequency determination in user-defined groups, haplotype reconstruction and network, linkage disequilibrium evaluation, and diversity analysis (Pi, Watterson's Theta, Tajima's D).Furthermore, the pipeline allows the use of external data (such as phenotype, geographic origin, taxa, stratification) to define groups and compare statistical indices.2) a database storing polymorphisms, genotyping data and grapevine sequences released by public and private projects. It allows the user to retrieve SNPs using various filters (such as genomic position, missing data, polymorphism type, allele frequency), to compare SNP patterns between populations, and to export genotyping data or sequences in various formats. Our experiments on grapevine genetic projects showed that SNiPlay allows geneticists to rapidly obtain advanced results in several key research areas of plant genetic diversity. Both the management and treatment of large amounts of SNP data are rendered considerably easier for end-users through automation and integration. Current developments are taking into account new advances in high-throughput technologies.SNiPlay is available at: http://sniplay.cirad.fr/.

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population

PubMed Central

Sigurdson, Alice J.; Brenner, Alina V.; Roach, James A.; Goudeva, Lilia; Müller, Jörg A.; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M.; Yeager, Meredith; Chanock, Stephen J.; Pfeiffer, Ruth M.; Abend, Michael; Port, Matthias

2016-01-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case–control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. PMID:27207655

Development and Evaluation of a Genome-Wide 6K SNP Array for Diploid Sweet Cherry and Tetraploid Sour Cherry

PubMed Central

Peace, Cameron; Bassil, Nahla; Main, Dorrie; Ficklin, Stephen; Rosyara, Umesh R.; Stegmeir, Travis; Sebolt, Audrey; Gilmore, Barbara; Lawley, Cindy; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Iezzoni, Amy

2012-01-01

High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a community initiative to enable marker-assisted breeding for rosaceous crops. Next-generation sequencing in diverse breeding germplasm provided 25 billion basepairs (Gb) of cherry DNA sequence from which were identified genome-wide SNPs for sweet cherry and for the two sour cherry subgenomes derived from sweet cherry (avium subgenome) and P. fruticosa (fruticosa subgenome). Anchoring to the peach genome sequence, recently released by the International Peach Genome Initiative, predicted relative physical locations of the 1.9 million putative SNPs detected, preliminarily filtered to 368,943 SNPs. Further filtering was guided by results of a 144-SNP subset examined with the Illumina GoldenGate® assay on 160 accessions. A 6K Infinium® II array was designed with SNPs evenly spaced genetically across the sweet and sour cherry genomes. SNPs were developed for each sour cherry subgenome by using minor allele frequency in the sour cherry detection panel to enrich for subgenome-specific SNPs followed by targeting to either subgenome according to alleles observed in sweet cherry. The array was evaluated using panels of sweet (n = 269) and sour (n = 330) cherry breeding germplasm. Approximately one third of array SNPs were informative for each crop. A total of 1825 polymorphic SNPs were verified in sweet cherry, 13% of these originally developed for sour cherry. Allele dosage was resolved for 2058 polymorphic SNPs in sour cherry, one third of these being originally developed for sweet cherry. This publicly available genomics resource represents a significant advance in cherry genome-scanning capability that will accelerate marker-locus-trait association discovery, genome structure investigation, and genetic diversity assessment in this diploid-tetraploid crop group. PMID:23284615

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population.

PubMed

Sigurdson, Alice J; Brenner, Alina V; Roach, James A; Goudeva, Lilia; Müller, Jörg A; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M; Yeager, Meredith; Chanock, Stephen J; Pfeiffer, Ruth M; Abend, Michael; Port, Matthias

2016-07-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case-control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. Published by Oxford University Press 2016.

Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, Susan L., E-mail: sltucker@mdanderson.org; Li Minghuan; Xu Ting

2013-01-01

Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk ofmore » severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.« less

Genetic polymorphisms related to efficacy and overuse of triptans in chronic migraine.

PubMed

Gentile, Giovanna; Borro, Marina; Lala, Noemi; Missori, Serena; Simmaco, Maurizio; Martelletti, Paolo

2010-10-01

Migraine is a common type of headache and its most severe attacks are usually treated with triptans, the efficacy of which is extremely variable. Several SNPs in genes involved in metabolism and target mechanisms of triptans have been described. To define an association between genetic profile and triptan response, we classified a migrainous population on the basis of triptan response and characterized it for polymorphisms in the genes coding for monoamine oxidase A, G protein β3 and the cytochrome CYP1A2. Analysis of the association between genotypic and allelic frequencies of the analyzed SNPs and the grade of response to triptan administration showed a significant correlation for MAOA uVNTR polymorphism. Further stratification of patients in abuser and non-abuser groups revealed a significant association with triptan overuse and, within the abusers, with drug response to the CYP1A2*1F variant.

Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

PubMed

Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

2017-05-01

Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

The α‐synuclein gene in multiple system atrophy

PubMed Central

Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

2006-01-01

Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

PubMed Central

Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-01-01

Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

PubMed

Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-06-16

Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

NASA Astrophysics Data System (ADS)

Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

2013-09-01

Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

[Identification of single nucleotide polymorphisms related to frailty].

PubMed

Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José

2018-04-07

The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

PubMed Central

Galipeau, Jacques; Nooka, Ajay K.

2013-01-01

The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

Association study of IL10, IL1beta, and IL1RN and schizophrenia using tag SNPs from a comprehensive database: suggestive association with rs16944 at IL1beta.

PubMed

Shirts, Brian H; Wood, Joel; Yolken, Robert H; Nimgaonkar, Vishwajit L

2006-12-01

Genetic association studies of several candidate cytokine genes have been motivated by evidence of immune dysfunction among patients with schizophrenia. Intriguing but inconsistent associations have been reported with polymorphisms of three positional candidate genes, namely IL1beta, IL1RN, and IL10. We used comprehensive sequencing data from the Seattle SNPs database to select tag SNPs that represent all common polymorphisms in the Caucasian population at these loci. Associations with 28 tag SNPs were evaluated in 478 cases and 501 unscreened control individuals, while accounting for population sub-structure using the genomic control method. The samples were also stratified by gender, diagnostic category, and exposure to infectious agents. Significant association was not detected after correcting for multiple comparisons. However, meta-analysis of our data combined with previously published association studies of rs16944 (IL1beta -511) suggests that the C allele confers modest risk for schizophrenia among individuals reporting Caucasian ancestry, but not Asians (Caucasians, n=819 cases, 1292 controls; p=0.0013, OR=1.24, 95% CI 1.09, 1.41).

Polymorphisms in the SIRT5 gene and their association with body measurement and ultrasound traits in Qinchuan cattle.

PubMed

Gui, L S; Wang, H C; Liu, G Y; Zan, L S

2015-04-22

Silent information regulator 5 (SIRT5), a member of the Sirtuin family class III nicotinamide adenine dinucleotide-dependent protein deacetylases, plays an important role in metabolic and aging processes in mammals. We identified 4 single-nucleotide polymorphisms (SNPs) (G22010A, G22052A, G22119T, and G22245C) in the 3' untranslated regions of the SIRT5 gene from 572 Qinchuan cattle by sequencing and investigating their association with growth and ultrasound traits. The frequencies of genotype GG and allele G were high at the 4 SNPs. Based on the X(2) test, the genotypic distributions of the 4 SNPs were not in Hardy-Weinberg equilibrium (P < 0.05 or P < 0.01). Association analysis of individual SNPs and haplotype combinations revealed that the 4 loci were significantly associated with some body measurement and ultrasound traits in Qinchuan cattle, and the H1H5 (AG-GA-GG-GG) diplotypes had better performance than other combinations in Qinchuan cattle. Our results demonstrate that SIRT5 may be a candidate for marker-assisted selection in future breeding programs for Qinchuan cattle.

Impact of novel polymorphisms related to cytotoxicity of cytarabine in the induction treatment of acute myeloid leukemia.

PubMed

Megías-Vericat, Juan E; Montesinos, Pau; Herrero, María J; Moscardó, Federico; Bosó, Virginia; Martínez-Cuadrón, David; Poveda, José L; Sanz, Miguel Á; Aliño, Salvador F

2017-07-01

Several novel single nucleotide polymorphisms (SNPs) involved in cytarabine cytotoxicity and related to clinical outcomes have been reported recently in a series of 232 pediatric patients with acute myeloid leukemia (AML). We report the first adult AML cohort in which the influence of these SNPs in cytarabine efficacy and toxicity was analyzed. Six of polymorphisms with clinical significance in the previous study [rs12036333, rs10758713, rs9883101, rs6550826, IRX2: rs2897047, mutated in colorectal cancers (MCC): rs7729269] were analyzed in a cohort of 225 adult patients at initial diagnosis of AML treated with an induction scheme of idarubicin plus cytarabine. The variant alleles of rs12036333 and rs10758713 confirmed the previous associations with lower survival rates. The minor alleles of rs9883101 and rs6550826 were also related to lower survival, in concordance with higher cytarabine-induced cytotoxicity observed in pediatric patients. However, discordant findings between AML adult and pediatric population were observed with IRX2 rs2897047, showing higher survival in heterozygous genotype carriers. The heterozygous genotype of MCC rs7729269 was associated with higher cytarabine-induced toxicities (renal, hepatic, lung, skin toxicities), whereas lower time to thrombocytopenia recovery was associated with the MCC rs7729269 minor allele. This study confirms the influence in survival rates of these polymorphisms in an adult AML population. Novel associations between MCC SNPs and cytarabine toxicities were reported and should be validated in prospective studies involving larger groups of patients.

Association study of 21 circadian genes with bipolar I disorder, schizoaffective disorder, and schizophrenia

PubMed Central

Mansour, Hader A; Talkowski, Michael E; Wood, Joel; Chowdari, Kodavali V; McClain, Lora; Prasad, Konasale; Montrose, Debra; Fagiolini, Andrea; Friedman, Edward S; Allen, Michael H; Bowden, Charles L; Calabrese, Joseph; El-Mallakh, Rif S; Escamilla, Michael; Faraone, Stephen V; Fossey, Mark D; Gyulai, Laszlo; Loftis, Jennifer M; Hauser, Peter; Ketter, Terence A; Marangell, Lauren B; Miklowitz, David J; Nierenberg, Andrew A; Patel, Jayendra; Sachs, Gary S; Sklar, Pamela; Smoller, Jordan W; Laird, Nan; Keshavan, Matcheri; Thase, Michael E; Axelson, David; Birmaher, Boris; Lewis, David; Monk, Tim; Frank, Ellen; Kupfer, David J; Devlin, Bernie; Nimgaonkar, Vishwajit L

2012-01-01

Objective Published studies suggest associations between circadian gene polymorphisms and bipolar I disorder (BPI), as well as schizoaffective disorder (SZA) and schizophrenia (SZ). The results are plausible, based on prior studies of circadian abnormalities. As replications have not been attempted uniformly, we evaluated representative, common polymorphisms in all three disorders. Methods We assayed 276 publicly available ‘tag’ single nucleotide polymorphisms (SNPs) at 21 circadian genes among 523 patients with BPI, 527 patients with SZ/SZA, and 477 screened adult controls. Detected associations were evaluated in relation to two published genome-wide association studies (GWAS). Results Using gene-based tests, suggestive associations were noted between EGR3 and BPI (p = 0.017), and between NPAS2 and SZ/SZA (p = 0.034). Three SNPs were associated with both sets of disorders (NPAS2: rs13025524 and rs11123857; RORB: rs10491929; p < 0.05). None of the associations remained significant following corrections for multiple comparisons. Approximately 15% of the analyzed SNPs overlapped with an independent study that conducted GWAS for BPI; suggestive overlap between the GWAS analyses and ours was noted at ARNTL. Conclusions Several suggestive, novel associations were detected with circadian genes and BPI and SZ/SZA, but the present analyses do not support associations with common polymorphisms that confer risk with odds ratios greater than 1.5. Additional analyses using adequately powered samples are warranted to further evaluate these results. PMID:19839995

Genetic Diversity and Demographic History of Cajanus spp. Illustrated from Genome-Wide SNPs

PubMed Central

Saxena, Rachit K.; von Wettberg, Eric; Upadhyaya, Hari D.; Sanchez, Vanessa; Songok, Serah; Saxena, Kulbhushan; Kimurto, Paul; Varshney, Rajeev K.

2014-01-01

Understanding genetic structure of Cajanus spp. is essential for achieving genetic improvement by quantitative trait loci (QTL) mapping or association studies and use of selected markers through genomic assisted breeding and genomic selection. After developing a comprehensive set of 1,616 single nucleotide polymorphism (SNPs) and their conversion into cost effective KASPar assays for pigeonpea (Cajanus cajan), we studied levels of genetic variability both within and between diverse set of Cajanus lines including 56 breeding lines, 21 landraces and 107 accessions from 18 wild species. These results revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, 75.8% of successful SNP assays revealed polymorphism, and more than 95% of these assays could be successfully transferred to related wild species. To show regional patterns of variation, we used STRUCTURE and Analysis of Molecular Variance (AMOVA) to partition variance among hierarchical sets of landraces and wild species at either the continental scale or within India. STRUCTURE separated most of the domesticated germplasm from wild ecotypes, and separates Australian and Asian wild species as has been found previously. Among Indian regions and states within regions, we found 36% of the variation between regions, and 64% within landraces or wilds within states. The highest level of polymorphism in wild relatives and landraces was found in Madhya Pradesh and Andhra Pradesh provinces of India representing the centre of origin and domestication of pigeonpea respectively. PMID:24533111

Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

PubMed

Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

2013-11-01

Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

Investigation of -308G>A and -1031T>C polymorphisms in the TNFA promoter region in Polish peptic ulcer patients.

PubMed

Sałagacka, Aleksandra; Żebrowska, Marta; Jeleń, Agnieszka; Mirowski, Marek; Balcerczak, Ewa

2014-11-01

Tumor necrosis factor α (TNF-α) encoded by TNFA is a key mediator in inflammation, a precursor condition for peptic ulceration. Promoter polymorphisms of TNFA that influence its transcriptional activity and TNF-α production are known. TNFA-308G>A (rs1800629) and TNFA-1031T>C (rs1799964), which are responsible for increased TNFA transcription, could influence the risk of peptic ulceration. This study aimed to investigate these polymorphisms and to evaluate their association with peptic ulcer disease and Helicobacter pylori infection in the Polish population. Gastric mucosa specimens obtained from 177 Polish peptic ulcer patients were used to conduct rapid urease tests and to assess the investigated polymorphisms by polymerase chain reaction-restriction fragment length polymorphism. Genotyping data were compared with the results obtained from healthy individuals of Polish origin. There were no significant differences in genotype and allele frequency of the investigated polymorphisms between peptic ulcer patients and healthy individuals. No associations between the frequencies of particular genotypes and alleles for both single-nucleotide polymorphisms (SNPs) and the presence of H. pylori infection in peptic ulcer patients and in subgroups of men and women with peptic ulcer disease were found. The investigated SNPs are not risk factors for either peptic ulcer or H. pylori infection development in the Polish population. The results require verification in a larger cohort.

Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

PubMed

Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

2001-11-23

Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.

PubMed

Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej

2005-06-15

The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.

Polymorphisms rs12998 and rs5780218 in KiSS1 suppressor metastasis gene in Mexican patients with breast cancer.

PubMed

Quevedo, Edhit Guadalupe Cruz; Aguilar, Gabriela Monserrat Mimendi; Aguilar, Luis Anselmo Juárez; Rubio, Susan Andrea Gutierrez; Martínez, Silvia Esperanza Flores; Rodríguez, Ingrid Patricia Dávalos; Corona, José Sánchez; Morán, Martha Isabel Torres; Gómez, Roberto Carlos Rosales; Moguel, María Cristina Morán

2015-01-01

KiSS1 is a metastasis suppressor gene associated with inhibition of cellular chemotaxis and invasion attenuating the metastasis in melanoma and breast cancer cell lines. Along the KiSS-1 gene at least 294 SNPs have been described; however the association of these polymorphisms as genetic markers for metastasis in breast cancer studies has not been investigated. Here we describe two simple PCR-RFLPs protocols to identify the rs5780218 (9DelT) and the rs12998 (E20K) KiSS1 polymorphisms and the allelic, genotypic, and haplotypic frequencies in Mexican general population (GP) and patients with benign breast disease (BBD) or breast cancer (BC). The rs5780218 polymorphism was individually associated with breast cancer (P = 0.0332) and the rs12998 polymorphism shows statistically significant differences when GP versus case (BC and BBD) groups were compared (P < 0.0001). The H1 Haplotype (G/-) occurred more frequently in BC group (0.4256) whereas H2 haplotype (G/T) was the most prevalent in BBD group (0.4674). Our data indicated that the rs5780218 polymorphism individually confers susceptibility for development of breast cancer in Mexican population and a possible role as a genetic marker in breast cancer metastasis for H1 haplotype (Wt/variant) in KiSS1 gene must be analyzed in other populations.

Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.

PubMed

Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I

2016-12-22

Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.

Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

PubMed

Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

2018-06-01

Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

Single-Nucleotide Polymorphisms Within the Thrombomodulin Gene (THBD) Predict Mortality in Patients With Graft-Versus-Host Disease.

PubMed

Rachakonda, Sivaramakrishna P; Penack, Olaf; Dietrich, Sascha; Blau, Olga; Blau, Igor Wolfgang; Radujkovic, Aleksandar; Isermann, Berend; Ho, Anthony D; Uharek, Lutz; Dreger, Peter; Kumar, Rajiv; Luft, Thomas

2014-10-20

Steroid-refractory graft-versus-host disease (GVHD) is a major and often fatal complication after allogeneic stem-cell transplantation (alloSCT). Although the pathophysiology of steroid refractoriness is not fully understood, evidence is accumulating that endothelial cell stress is involved, and endothelial thrombomodulin (THBD) plays a role in this process. Here we assess whether single-nucleotide polymorphisms (SNPs) within the THBD gene predict outcome after alloSCT. Seven SNPs within the THBD gene were studied (rs1962, rs1042579, rs1042580, rs3176123, rs3176124, rs3176126, and rs3176134) in a training cohort of 306 patients. The relevant genotypes were then validated in an independent cohort (n = 321). In the training cohort, an increased risk of nonrelapse mortality (NRM) was associated with three of seven SNPs tested: rs1962, rs1042579 (in linkage disequilibrium with rs3176123), and rs1042580. When patients were divided into risk groups (one v no high-risk SNP), a strong correlation with NRM was observed (hazard ratio [HR], 2.31; 95% CI, 1.36 to 3.95; P = .002). More specifically, NRM was predicted by THBD SNPs in patients who later developed GVHD (HR, 3.03; 95% CI, 1.61 to 5.68; P < .001) but not in patients without GVHD. In contrast, THBD SNPs did not predict incidence of acute GVHD. Multivariable analyses adjusting for clinical variables confirmed the independent effect of THBD SNPs on NRM. All findings could be reproduced in the validation cohort. THBD SNPs predict mortality of manifest GVHD but not the risk of acquiring GVHD, supporting the hypothesis that endothelial vulnerability contributes to GVHD refractoriness. © 2014 by American Society of Clinical Oncology.

Genetic polymorphisms associated with increased risk of developing chronic myelogenous leukemia

PubMed Central

Bruzzoni-Giovanelli, Heriberto; González, Juan R.; Sigaux, François; Villoutreix, Bruno O.; Cayuela, Jean Michel; Guilhot, Joëlle; Preudhomme, Claude; Guilhot, François; Poyet, Jean-Luc; Rousselot, Philippe

2015-01-01

Little is known about inherited factors associated with the risk of developing chronic myelogenous leukemia (CML). We used a dedicated DNA chip containing 16 561 single nucleotide polymorphisms (SNPs) covering 1 916 candidate genes to analyze 437 CML patients and 1 144 healthy control individuals. Single SNP association analysis identified 139 SNPs that passed multiple comparisons (1% false discovery rate). The HDAC9, AVEN, SEMA3C, IKBKB, GSTA3, RIPK1 and FGF2 genes were each represented by three SNPs, the PSM family by four SNPs and the SLC15A1 gene by six. Haplotype analysis showed that certain combinations of rare alleles of these genes increased the risk of developing CML by more than two or three-fold. A classification tree model identified five SNPs belonging to the genes PSMB10, TNFRSF10D, PSMB2, PPARD and CYP26B1, which were associated with CML predisposition. A CML-risk-allele score was created using these five SNPs. This score was accurate for discriminating CML status (AUC: 0.61, 95%CI: 0.58–0.64). Interestingly, the score was associated with age at diagnosis and the average number of risk alleles was significantly higher in younger patients. The risk-allele score showed the same distribution in the general population (HapMap CEU samples) as in our control individuals and was associated with differential gene expression patterns of two genes (VAPA and TDRKH). In conclusion, we describe haplotypes and a genetic score that are significantly associated with a predisposition to develop CML. The SNPs identified will also serve to drive fundamental research on the putative role of these genes in CML development. PMID:26474455

SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

PubMed Central

2012-01-01

Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children.

PubMed

Butte, Nancy F; Voruganti, V Saroja; Cole, Shelley A; Haack, Karin; Comuzzie, Anthony G; Muzny, Donna M; Wheeler, David A; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A

2011-09-22

Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3'-UTR, and 2 in the 5'-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001-0.009) were associated with obesity-related traits (P = 0.01-0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77-0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children.

Association study between monoamine oxidase A (MAOA) gene polymorphisms and schizophrenia: lack of association with schizophrenia and possible association with affective disturbances of schizophrenia.

PubMed

Kim, Su Kang; Park, Hae Jeong; Seok, Hosik; Jeon, Hye Sook; Chung, Joo-Ho; Kang, Won Sub; Kim, Jong Woo; Yu, Gyeong Im; Shin, Dong Hoon

2014-05-01

Monoamine oxidase A (MAOA) catalyzes monoamine neurotransmitters including dopamine, 5-hydroxytryptamine (5-HT, serotonin), and norepinephrine. MAOA also plays a key role in emotional regulation. The aim of this study was to investigate the associations between the exonic single nucleotide polymorphisms (SNPs) of the MAOA gene located on the X chromosome and schizophrenia. We also analyzed the relationships between these SNPs and the common clinical symptoms of schizophrenia such as persecutory delusion, auditory hallucinations, affective disturbances, and poor concentration. Two hundred seventy five Korean schizophrenia patients and 289 control subjects were recruited. Three SNPs [rs6323 (Arg294Arg), rs1137070 (Asp470Asp), and rs3027407 (3'-untranslated region)] of the MAOA gene were selected and genotyped by direct sequencing. The common clinical symptoms of schizophrenia according to the Operation Criteria Checklist were analyzed. Three examined SNPs showed no associations with male and female schizophrenia, respectively (p>0.05). In the analysis of the common clinical symptoms of schizophrenia patients, three examined SNPs were associated with affective disturbances, especially restricted affect and blunted affect in male schizophrenia, respectively (restricted affect, p=0.002, OR=2.71, 95% CI 1.45-5.00; blunted affect, p=0.009, OR 2.25, 95% CI 1.22-4.12). The SNPs were not associated with other clinical symptoms of schizophrenia (persecutory delusion, auditory hallucinations, and poor concentration). These results suggest that exonic SNPs (rs6323, rs1137070, and rs3027407) of the MAOA gene may be contributed to affective disturbances of Korean males schizophrenia, especially restricted affect and blunted affect.

Development of a set of SNP markers present in expressed genes of the apple.

PubMed

Chagné, David; Gasic, Ksenija; Crowhurst, Ross N; Han, Yuepeng; Bassett, Heather C; Bowatte, Deepa R; Lawrence, Timothy J; Rikkerink, Erik H A; Gardiner, Susan E; Korban, Schuyler S

2008-11-01

Molecular markers associated with gene coding regions are useful tools for bridging functional and structural genomics. Due to their high abundance in plant genomes, single nucleotide polymorphisms (SNPs) are present within virtually all genomic regions, including most coding sequences. The objective of this study was to develop a set of SNPs for the apple by taking advantage of the wealth of genomics resources available for the apple, including a large collection of expressed sequenced tags (ESTs). Using bioinformatics tools, a search for SNPs within an EST database of approximately 350,000 sequences developed from a variety of apple accessions was conducted. This resulted in the identification of a total of 71,482 putative SNPs. As the apple genome is reported to be an ancient polyploid, attempts were made to verify whether those SNPs detected in silico were attributable either to allelic polymorphisms or to gene duplication or paralogous or homeologous sequence variations. To this end, a set of 464 PCR primer pairs was designed, PCR was amplified using two subsets of plants, and the PCR products were sequenced. The SNPs retrieved from these sequences were then mapped onto apple genetic maps, including a newly constructed map of a Royal Gala x A689-24 cross and a Malling 9 x Robusta 5, map using a bin mapping strategy. The SNP genotyping was performed using the high-resolution melting (HRM) technique. A total of 93 new markers containing 210 coding SNPs were successfully mapped. This new set of SNP markers for the apple offers new opportunities for understanding the genetic control of important horticultural traits using quantitative trait loci (QTL) or linkage disequilibrium analysis. These also serve as useful markers for aligning physical and genetic maps, and as potential transferable markers across the Rosaceae family.

Single-Nucleotide Polymorphisms of FAS and FASL Genes and Risk of Idiopathic Aplastic Anemia.

PubMed

Rehman, Sadia; Saba, Nusrat; Naz, Madiha; Ahmed, Parvez; Munir, Saeeda; Sajjad, Sumaira; Tabassum, Sobia; Naseem, Lubna

2018-04-03

FAS/FASL signaling system plays a vital role in the regulation of apoptosis, envisaged as a death process required for immune surveillance to prevent autoimmunity and tumorigenesis along with several other biological activities. Several single-nucleotide polymorphisms (SNPs) of FAS/FASL system can result in aberrant apoptosis, which can cause different cancers and autoimmune diseases. Aplastic anemia (AA) is an autoimmune dysfunction characterized by peripheral blood pancytopenia associated with hypoplasia of bone marrow. The aim of this study was to screen Pakistani AA patients and controls for two Fas SNPs rs2234767 and rs1800682 and two FASLG SNPs rs763110 and rs5030772. Genotyping of 392 DNA samples was done by Tetra-ARMS polymerase chain reaction. Genotypic frequencies of Fas rs1800682 and FASLG rs5030772 showed significance difference in their distribution in both controls and patients, while Fas rs2234767 and FASLG rs763110 SNPs had no such difference. Carriers of rs1800682 AG+GG had a very odd ratio of 4.63, with 95% confidence interval (CI) of 3.01-7.11, while individuals with FASLG rs5030772 AG+GG were more common in controls than patients with OR 0.53 and 95% CI of 0.34-0.83. Cumulative effects of these SNPs were analyzed, and they showed almost similar trends; however, Fas rs2234767 and FASLG rs763110 genotypes in combination with Fas rs1800682 and FASLG rs5030772 demonstrated significant association. This study provided information that endorsed the involvement of FAS/FASL system SNPs in the pathogenesis of AA; further studies should be designed to understand the exact role of SNPs that can help in early diagnosis and treatment.

Translating natural genetic variation to gene expression in a computational model of the Drosophila gap gene regulatory network

PubMed Central

Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.

2017-01-01

Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266

Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

PubMed

Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

2001-11-14

The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

Choline intake and genetic polymorphisms influence choline metabolite concentrations in human breast milk and plasma123

PubMed Central

Fischer, Leslie M; da Costa, Kerry Ann; Galanko, Joseph; Sha, Wei; Stephenson, Brigitte; Vick, Julie; Zeisel, Steven H

2010-01-01

Background: Choline is essential for infant nutrition, and breast milk is a rich source of this nutrient. Common single nucleotide polymorphisms (SNPs) change dietary requirements for choline intake. Objective: The aim of this study was to determine whether total choline intake and/or SNPs influence concentrations of choline and its metabolites in human breast milk and plasma. Design: We gave a total of 103 pregnant women supplemental choline or a placebo from 18 wk gestation to 45 d postpartum and genotyped the women for 370 common SNPs. At 45 d postpartum, we measured choline metabolite concentrations in breast milk and plasma and assessed the dietary intake of choline by using a 3-d food record. Results: On average, lactating women in our study ate two-thirds of the recommended intake for choline (Adequate Intake = 550 mg choline/d). Dietary choline intake (no supplement) correlated with breast-milk phosphatidylcholine and plasma choline concentrations. A supplement further increased breast-milk choline, betaine, and phosphocholine concentrations and increased plasma choline and betaine concentrations. We identified 5 SNPs in MTHFR that altered the slope of the intake–metabolite concentration relations, and we identified 2 SNPs in PEMT that shifted these curves upward. Individuals who shared sets of common SNPs were outliers in plots of intake–metabolite concentration curves; we suggest that these SNPs should be further investigated to determine how they alter choline metabolism. Conclusion: Total intake of choline and genotype can influence the concentrations of choline and its metabolites in the breast milk and blood of lactating women and thereby affect the amount of choline available to the developing infant. This study was registered at clinicaltrials.gov as NCT00678925. PMID:20534746

Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

PubMed

Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

2016-01-01

Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

Identification of Polymorphisms in the 3′-Untranslated Region of the Human Pregnane X Receptor (PXR) Gene Associated with Variability in Cytochrome P450 3A (CYP3A) Metabolism

PubMed Central

Oleson, Lauren; von Moltke, Lisa L.; Greenblatt, David J.; Court, Michael H.

2013-01-01

Single nucleotide polymorphisms (SNPs) in the 3′untranslated region (3′UTR) of human pregnane X receptor (PXR) gene may contribute to interindividual variability in cytochrome P450 3A (CYP3A) activity. Genotype-phenotype associations involving PXR-3′UTR SNPs were investigated through in vitro (53 human livers from primarily white donors) and in vivo (26 white or African-American volunteers) studies using midazolam 1′-hydroxylation and midazolam apparent oral clearance (CL/F), respectively, as CYP3A-specific probes. PXR-3′UTR resequencing identified 12 SNPs, including 2 that were novel. Although none of the SNPs evaluated were associated with altered midazolam 1′-hydroxylation in the liver bank, both rs3732359 homozygotes and rs3732360 carriers showed 80% higher (P<0.05) CL/F compared with homozygous reference individuals. These differences in CL/F were even larger (100 and 120% higher, respectively; P<0.01) when only African-American subjects (n=14) were considered. Five major haplotypes were identified containing the PXR-3′UTR SNPs and previously identified intron SNPs. Although CL/F differences were not statistically significant within the entire study cohort, African-American carriers of Haplotype-1 (which includes both rs3732359 and rs3732360 variants) exhibited 70% higher median CL/F compared with African-American non-carriers (P=0.036). Our results identify rs3732359 and rs3732360 as PXR-3′UTR SNPs associated with higher CYP3A activity in vivo in African-Americans. PMID:20082578

Association of MYF5 and KLF15 gene polymorphisms with carcass traits in domestic pigeons (Columba livia).

PubMed

Yin, Z Z; Dong, X Y; Dong, D J; Ma, Y Z

2016-10-01

Single nucleotide polymorphisms (SNPs) in the exons of the myogenic factor 5 (MYF5) and Kruppel-like factor 15 (KLF15) genes were identified and analysed by using DNA sequencing methods in 60 female domestic pigeons (Columba livia). Five SNPs (T5067A, C5084T, C5101T, T5127A and C5154G) were detected in exon 3 of MYF5 and 6 SNPs (C1398T, C1464T, G1542A, C1929T, G1965A and A2355G) were found in exon 2 of KLF15, respectively. The analysis revealed three genotypes, in which the AA genotype was dominant and the A allele showed a dominant advantage. For the MYF5 gene, the C5084T and T5127A SNP genotypes were significantly associated with carcass traits of pigeons. Within those two SNPs, the BB genotype showed relatively higher trait association values than those of AA or AB genotypes. No significant association was observed between the KLF15 SNP genotypes and carcass traits. These results indicated that the MYF5 gene is a potential major gene affecting carcass traits in domestic pigeons. The BB genotype of the C5084T and T5127A SNPs could be a potential candidate genetic marker for marker-assisted selection in pigeon.

Polymorphisms in genes involved in the triglyceride synthesis pathway and marine omega-3 polyunsaturated fatty acid supplementation modulate plasma triglyceride levels.

PubMed

Ouellette, Catherine; Cormier, Hubert; Rudkowska, Iwona; Guénard, Frédéric; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-01-01

Marine omega-3 (n-3) polyunsaturated fatty acids (PUFA) reduce plasma triglyceride (TG) levels. Genetic factors such as single nucleotide polymorphisms (SNPs) could be responsible for the variability of the plasma TG response to n-3 PUFA supplementation. Previous studies have demonstrated that n-3 PUFA supplementation using fish oil modified the expression levels of three genes involved in the TG synthesis pathway (GPAM, AGPAT3 and AGPAT4) in peripheral blood mononuclear cells. A total of 210 subjects consumed 5 g/day of a fish oil supplement for 6 weeks. Plasma lipids were measured before and after the supplementation period. Three SNPs in GPAM, 13 SNPs in AGPAT3 and 35 SNPs in AGPAT4 were genotyped. In an ANOVA for repeated measures adjusted for age, sex and BMI, genotype effects on plasma TG levels were observed for rs1838452 in AGPAT3 as well as for rs746731 and rs2293286 in AGPAT4. Genotype × supplementation interaction effects on plasma TG levels were observed for rs2792751 and rs17129561 in GPAM as well as for rs3798943 and rs9458172 in AGPAT4 (p < 0.05). These results suggest that SNPs in genes involved in the TG synthesis pathway may influence plasma TG levels after n-3 PUFA supplementation. © 2014 S. Karger AG, Basel.

Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2011-06-01

Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

Activating Transcription Factor 6 (ATF6) Sequence Polymorphisms in Type 2 Diabetes and Pre-Diabetic Traits

PubMed Central

Chu, Winston S.; Das, Swapan Kumar; Wang, Hua; Chan, Juliana C.; Deloukas, Panos; Froguel, Philippe; Baier, Leslie J.; Jia, Weiping; McCarthy, Mark I.; Ng, Maggie C.Y.; Damcott, Coleen; Shuldiner, Alan R.; Zeggini, Eleftheria; Elbein, Steven C.

2009-01-01

Activating transcription factor 6 (ATF6) is located within the region of linkage to type 2 diabetes on chromosome 1q21-q23 and is a key activator of the endoplasmic reticulum stress response. We evaluated 78 single nucleotide polymorphisms (SNPs) spanning >213 kb in 95 people, from which we selected 64 SNPs for evaluation in 191 Caucasian case subjects from Utah and between 165 and 188 control subjects. Six SNPs showed nominal associations with type 2 diabetes (P = 0.001-0.04), including the nonsynonymous SNP rs1058405 (M67V) in exon 3 and rs11579627 in the 3′ flanking region. Only rs1159627 remained significant on permutation testing. The associations were not replicated in 353 African-American case subjects and 182 control subjects, nor were ATF6 SNPs associated with altered insulin secretion or insulin sensitivity in nondiabetic Caucasian individuals. No association with type 2 diabetes was found in a subset of 44 SNPs in Caucasian (n = 2,099), Pima Indian (n = 293), and Chinese (n = 287) samples. Allelic expression imbalance was found in transformed lymphocyte cDNA for 3′ untranslated region variants, thus suggesting cis-acting regulatory variants. ATF6 does not appear to play a major role in type 2 diabetes, but further work is required to identify the cause of the allelic expression imbalance. PMID:17327457

Association of interactions between dietary salt consumption and hypertension-susceptibility genetic polymorphisms with blood pressure among Japanese male workers.

PubMed

Imaizumi, Takahiro; Ando, Masahiko; Nakatochi, Masahiro; Maruyama, Shoichi; Yasuda, Yoshinari; Honda, Hiroyuki; Kuwatsuka, Yachiyo; Kato, Sawako; Kondo, Takaaki; Iwata, Masamitsu; Nakashima, Toru; Yasui, Hiroshi; Takamatsu, Hideki; Okajima, Hiroshi; Yoshida, Yasuko; Matsuo, Seiichi

2017-06-01

Blood pressure is influenced by hereditary factors and dietary habits. The objective of this study was to examine the effect of dietary salt consumption and single-nucleotide polymorphisms (SNPs) on blood pressure (BP). This was a cross-sectional analysis of 2728 male participants who participated in a health examination in 2009. Average dietary salt consumption was estimated using electronically collected meal purchase data from cafeteria. A multivariate analysis, adjusting for clinically relevant factors, was conducted to examine whether the effect on BP of salt consumption, SNPs, and interaction between salt consumption and each SNP. This study examined the SNPs AGT rs699 (Met235Thr), ADD1 rs4961 (Gly460Trp), NPPA rs5063 (Val32Met), GPX1 rs1050450 (Pro198Leu), and AGTR1 rs5186 (A1166C) in relation to hypertension and salt sensitivity. BP was not significantly associated with SNPs or salt consumption. The interaction between salt consumption and SNPs with systolic BP showed a significant association in NPPA rs5063 (Val32Met) (P = 0.023) and a marginal trend toward significance in rs4961 and rs1050450 (P = 0.060 and 0.067, respectively). The effect of salt consumption on BP differed by genotype. Dietary salt consumption and genetic variation can predict a high risk of hypertension.

Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans

PubMed Central

Kwon, Ki-Sung; Cho, Hye-Young

2016-01-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2, rs887369 in CXorf21, rs9782955 in LYST, and rs3794060 in NADSYN1). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans. PMID:27729837

Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans.

PubMed

Kwon, Ki-Sung; Cho, Hye-Young; Chung, Yeun-Jun

2016-09-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2 , rs887369 in CXorf21 , rs9782955 in LYST , and rs3794060 in NADSYN1 ). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans.

Molecular analysis of MLH1 variants in Chinese sporadic colorectal cancer patients.

PubMed

Peng, H X; Xu, X; Yang, R; Chu, Y M; Yang, D M; Xu, Y; Zhou, F L; Ma, W Z; Zhang, X J; Guan, M; Yang, Z H; Jin, Z D

2016-04-26

Single nucleotide polymorphisms (SNPs) in mismatch repair genes, especially in the MLH1 gene, are closely associated with susceptibility to hereditary nonpolyposis colorectal cancer. However, few relevant findings are available regarding the association between sporadic colorectal cancer (SCRC) and SNPs of MLH1 in Chinese patients. Therefore, the present study aimed to describe the pathogenic association between three important MLH1 polymorphisms and SCRC in the Chinese population. Peripheral blood samples from 156 SCRC patients and 311 healthy controls were collected. DNA was purified from peripheral blood, and the V384D, R217C, and I219V polymorphisms were evaluated using high-resolution melting analysis and direct sequencing. The association between the three important MLH1 polymorphisms and clinical pathological features of the SCRC patients was analyzed. In addition, PMS2-MLH1 protein interactions were determined by co-immunoprecipitation (Co-IP) to determine the protein functional alteration induced by these SNPs. Among the three polymorphisms, V384D was significantly associated with the risk of SCRC (OR = 31.36, P < 0.0001). The allele frequencies were 4.81 and 0.16% in the SCRC group. No association was found between SCRC and R217C, or between SCRC and I219V. Moreover, the allele frequency of R217C was significantly higher in the SCRC patients younger than 60 years than in those older than 60 years. Co-IP showed that the MLH1 R217C, V384D, and I219V variants had relative binding abilities with PMS2 of 0.59, 0.70, and 0.80, respectively, compared with the wild-type. These findings suggest that MLH1 V384D could be a promising genetic marker for susceptibility to SCRC.

Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

PubMed

Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

2016-08-01

The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

A haplotype of three SNPs in FTO had a strong association with body composition and BMI in Iranian male adolescents.

PubMed

Kalantari, Naser; Keshavarz Mohammadi, Nastaran; Izadi, Pantea; Doaei, Saeid; Gholamalizadeh, Maryam; Eini-Zinab, Hassan; Salonurmi, Tuire; Rafieifar, Shahram; Janipoor, Reza; Azizi Tabesh, Ghasem

2018-01-01

Single-nucleotide polymorphisms (SNPs), which are located in the first intron of the FTO gene, are reported to be associated with body weight and the body mass index (BMI). However, their effects on anthropometric measurements in adolescents are poorly understood. This study aimed to investigate the association of three adjacent polymorphisms (rs9930506, rs9930501, & rs9932754) in the FTO gene with anthropometric indices in Iranian adolescent males. The participants comprised a total of 237 adolescent males who were recruited randomly from two high schools in Tehran, Iran. The DNA samples were genotyped for the FTO gene polymorphisms by DNA sequencing. BMI, body fat percentage (BF%), and body muscle percentage (BM%) were determined using a validated bioelectrical impedance analysis scale. The association of the FTO polymorphisms with weight, height, BMI, BF%, and BM% was investigated. A haplotype of rs9930506, rs9930501, and rs9932754 (GGT) in the first intron of the FTO with complete linkage disequilibrium (LD) was found to be significantly associated with higher weight (OR = 1.32), BMI (OR = 5.36) and BF% (OR = 1.46), and lower BM% (OR = 3.59) (all P<0.001). None of the students with GGC genotypes were underweight, while all of the students with AAT genotypes had high muscle mass. A haplotype in the first intron of the FTO gene had a strong association with obesity indices in Iranian adolescent males. The FTO gene polymorphisms might have greater effects on anthropometric indices than what was previously imagined. Moreover, we suggested that the FTO gene exerted their effects on anthropometric measurements through haplotypes (and not single SNPs).

Maternal and offspring genetic variants of AKR1C3 and the risk of childhood leukemia

PubMed Central

Liu, Chen-yu; Hsu, Yi-Hsiang; Pan, Pi-Chen; Wu, Ming-Tsang; Ho, Chi-Kung; Su, Li; Xu, Xin; Li, Yi; Christiani, David C.

2008-01-01

The aldo-keto reductase 1C3 (AKR1C3) gene located on chromosome 10p15-p14, a regulator of myeloid cell proliferation and differentiation, represents an important candidate gene for studying human carcinogenesis. In a prospectively enrolled population-based case–control study of Han Chinese conducted in Kaohsiung in southern Taiwan, a total of 114 leukemia cases and 221 controls <20 years old were recruited between November 1997 and December 2005. The present study set out to evaluate the association between childhood leukemia and both maternal and offspring's genotypes. To do so, we conducted a systematic assessment of common single-nucleotide polymorphisms (SNPs) at the 5′ flanking 10 kb to 3′ UTR of AKR1C3 gene. Gln5His and three tagSNPs (rs2245191, rs10508293 and rs3209896) and one multimarker (rs2245191, rs10508293 and rs3209896) were selected with average 90% coverage of untagged SNPs by using the HapMap II data set. Odds ratios and 95% confidence intervals were adjusted for age and gender. After correcting for multiple comparisons, we observed that risk of developing childhood leukemia is significantly associated with rs10508293 polymorphism on intron 4 of the AKR1C3 gene in both offspring alone and in the combined maternal and offspring genotypes (nominal P < 0.0001, permutation P < 0.005). The maternal methylenetetrahydrofolate reductase A1298C polymorphism was found to be an effect modifier of the maternal intron 4 polymorphism of the AKR1C3 gene (rs10508293) and the childhood leukemia risk. In conclusion, this study suggests that AKR1C3 polymorphisms may be important predictive markers for childhood leukemia susceptibility. PMID:18339682

Uncoupling protein 2 gene polymorphisms are associated with obesity

PubMed Central

2012-01-01

Background Uncoupling protein 2 (UCP2) gene polymorphisms have been reported as genetic risk factors for obesity and type 2 diabetes mellitus (T2DM). We examined the association of commonly observed UCP2 G(−866)A (rs659366) and Ala55Val (C > T) (rs660339) single nucleotide polymorphisms (SNPs) with obesity, high fasting plasma glucose, and serum lipids in a Balinese population. Methods A total of 603 participants (278 urban and 325 rural subjects) were recruited from Bali Island, Indonesia. Fasting plasma glucose (FPG), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and total cholesterol (TC) were measured. Obesity was determined based on WHO classifications for adult Asians. Participants were genotyped for G(−866)A and Ala55Val polymorphisms of the UCP2 gene. Results Obesity prevalence was higher in urban subjects (51%) as compared to rural subjects (23%). The genotype, minor allele (MAF), and heterozygosity frequencies were similar between urban and rural subjects for both SNPs. All genotype frequencies were in Hardy-Weinberg equilibrium. A combined analysis of genotypes and environment revealed that the urban subjects carrying the A/A genotype of the G(−866)A SNP have higher BMI than the rural subjects with the same genotype. Since the two SNPs showed strong linkage disequilibrium (D’ = 0.946, r2 = 0.657), a haplotype analysis was performed. We found that the AT haplotype was associated with high BMI only when the urban environment was taken into account. Conclusions We have demonstrated the importance of environmental settings in studying the influence of the common UCP2 gene polymorphisms in the development of obesity in a Balinese population. PMID:22533685

Association of SNPs from IL1A, IL1B, and IL6 Genes with Human Cytomegalovirus Infection Among Pregnant Women.

PubMed

Wujcicka, Wioletta Izabela; Wilczyński, Jan Szczęsny; Nowakowska, Dorota Ewa

2017-05-01

The study was aimed to estimate the role and prevalence rates of genotypes, haplotypes, and alleles, located within the single-nucleotide polymorphisms (SNPs) of interleukin (IL) 1A, IL1B, and IL6 genes, in the occurrence and development of human cytomegalovirus (HCMV) infection among pregnant women. A research was conducted in 129 pregnant women, out of whom, 65 were HCMV infected and 64 were age-matched control uninfected individuals. HCMV DNA was quantitated for UL55 gene by the real-time Q PCR in the body fluids. The genotypic statuses within the SNPs were determined by nested PCR-RFLP assays and confirmed, by sequencing for randomly selected representative PCR products. A relationship between the genotypes and alleles, as well as haplotypes and multiple variants in the studied polymorphisms, and the occurrence of HCMV infection in pregnant women, was determined using a logistic regression model. TT genotype within IL1A polymorphism significantly decreased the risk of HCMV infection (OR 0.32, 95% CI 0.09-1.05; p ≤ 0.050). Considering IL6 SNP, the prevalence rate of GC genotype was significantly decreased among the HCMV infected, compared to the uninfected control individuals (OR 0.45, 95% CI 0.21-0.99; p ≤ 0.050). Moreover, CC homozygotic status in IL6 SNP, found in pregnant women, significantly decreased the risk of congenital infection with HCMV in their offsprings (OR 0.12; p ≤ 0.050). In multiple SNP analysis, TC haplotype within the IL1 polymorphisms significantly decreased the risk of the infection in pregnant women (OR 0.38 95% CI 0.15-0.96; p ≤ 0.050). In addition, TTG complex variants for all the studied polymorphisms and TG variants for IL1B and IL6 SNPs were significantly more prevalent among the infected offsprings with symptomatic congenital cytomegaly than among the asymptomatic cases (p ≤ 0.050). In conclusion, the analyzed IL1A -889 C>T, IL1B +3954 C>T, and IL6 -174 G>C polymorphisms may be associated with the occurrence and development of HCMV infection among studied patients.

Association of CASP9, CASP10 gene polymorphisms and tea drinking with colorectal cancer risk in the Han Chinese population.

PubMed

Liu, He; Jiang, Xia; Zhang, Ming-wu; Pan, Yi-feng; Yu, Yun-xian; Zhang, Shan-chun; Ma, Xin-yuan; Li, Qi-long; Chen, Kun

2013-01-01

The initiators caspase-9 (CASP9) and caspase-10 (CASP10) are two key controllers of apoptosis and play important roles in carcinogenesis. This study aims to explore the association between CASPs gene polymorphisms and colorectal cancer (CRC) susceptibility in a population-based study. A two-stage designed population-based case-control study was carried out, including a testing set with 300 cases and 296 controls and a validation set with 206 cases and 845 controls. A total of eight tag selected single nucleotide polymorphisms (SNPs) in CASP9 and CASP10 were chosen based on HapMap and the National Center of Biotechnology Information (NCBI) datasets and genotyped by restriction fragment length polymorphism (RFLP) assay. Multivariate logistic regression models were applied to evaluate the association of SNPs with CRC risk. In the first stage, from eight tag SNPs, three polymorphisms rs4646077 (odds ratio (OR)(AA+AG): 0.654, 95% confidence interval (CI): 0.406-1.055; P=0.082), rs4233532 (OR(CC): 1.667, 95% CI: 0.967-2.876; OR(CT): 1.435, 95% CI: 0.998-2.063; P=0.077), and rs2881930 (OR(CC): 0.263, 95% CI: 0.095-0.728, P=0.036) showed possible association with CRC risk. However, none of the three SNPs, rs4646077 (OR(AA+AG): 1.233, 95% CI: 0.903-1.683), rs4233532 (OR(CC): 0.892, 95% CI: 0.640-1.243; OR(CT): 1.134, 95% CI: 0.897-1.433), and rs2881930 (OR(CC): 1.096, 95% CI: 0.620-1.938; OR(CT): 1.009, 95% CI: 0.801-1.271), remained significant with CRC risk in the validation set, even after stratification for different tumor locations (colon or rectum). In addition, never tea drinking was associated with a significantly increased risk of CRC in testing set together with validation set (OR: 1.755, 95% CI: 1.319-2.334). Our results found that polymorphisms of CASP9 and CASP10 genes may not contribute to CRC risk in Chinese population and thereby the large-scale case-control studies might be in consideration. In addition, tea drinking was a protective factor for CRC.

Association of CASP9, CASP10 gene polymorphisms and tea drinking with colorectal cancer risk in the Han Chinese population*

PubMed Central

Liu, He; Jiang, Xia; Zhang, Ming-wu; Pan, Yi-feng; Yu, Yun-xian; Zhang, Shan-chun; Ma, Xin-yuan; Li, Qi-long; Chen, Kun

2013-01-01

The initiators caspase-9 (CASP9) and caspase-10 (CASP10) are two key controllers of apoptosis and play important roles in carcinogenesis. This study aims to explore the association between CASPs gene polymorphisms and colorectal cancer (CRC) susceptibility in a population-based study. A two-stage designed population-based case-control study was carried out, including a testing set with 300 cases and 296 controls and a validation set with 206 cases and 845 controls. A total of eight tag selected single nucleotide polymorphisms (SNPs) in CASP9 and CASP10 were chosen based on HapMap and the National Center of Biotechnology Information (NCBI) datasets and genotyped by restriction fragment length polymorphism (RFLP) assay. Multivariate logistic regression models were applied to evaluate the association of SNPs with CRC risk. In the first stage, from eight tag SNPs, three polymorphisms rs4646077 (odds ratio (OR)AA+AG: 0.654, 95% confidence interval (CI): 0.406–1.055; P=0.082), rs4233532 (ORCC: 1.667, 95% CI: 0.967–2.876; ORCT: 1.435, 95% CI: 0.998–2.063; P=0.077), and rs2881930 (ORCC: 0.263, 95% CI: 0.095–0.728, P=0.036) showed possible association with CRC risk. However, none of the three SNPs, rs4646077 (ORAA+AG: 1.233, 95% CI: 0.903–1.683), rs4233532 (ORCC: 0.892, 95% CI: 0.640–1.243; ORCT: 1.134, 95% CI: 0.897–1.433), and rs2881930 (ORCC: 1.096, 95% CI: 0.620–1.938; ORCT: 1.009, 95% CI: 0.801–1.271), remained significant with CRC risk in the validation set, even after stratification for different tumor locations (colon or rectum). In addition, never tea drinking was associated with a significantly increased risk of CRC in testing set together with validation set (OR: 1.755, 95% CI: 1.319–2.334). Our results found that polymorphisms of CASP9 and CASP10 genes may not contribute to CRC risk in Chinese population and thereby the large-scale case-control studies might be in consideration. In addition, tea drinking was a protective factor for CRC. PMID:23303631

In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

PubMed Central

Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

2011-01-01

Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues were determined and secondary structures were observed for solvent accessibility to confirm the protein stability. The functional study in this investigation may be a good model for additional future studies. PMID:22028795

Apolipoprotein gene involved in lipid metabolism

DOEpatents

Rubin, Edward [Berkeley, CA; Pennacchio, Len A [Sebastopol, CA

2007-07-03

Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.

Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

PubMed Central

Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

2001-01-01

We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

SNPs of bovine HGF gene and their association with growth traits in Nanyang cattle.

PubMed

Cai, Hanfang; Lan, Xianyong; Li, Aimin; Zhou, Yang; Sun, Jiajie; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

2013-10-01

Hepatocyte growth factor (HGF) is one of the multifunctional cell factors that regulates cellular proliferation, motility and morphogenesis in mammalians. And its medical research has deep significance. In this paper, polymorphisms of HGF gene were investigated in 1433 health and irrelated Chinese cattle by PCR-RFLP and DNA sequencing approach. Ten novel Single nucleotide polymorphisms (SNPs) were identified, which included one missense mutation, g.72801G>A in the coding region, and the others in the intron. Association analysis between four of them, g.288T>C, g.72801G>A, g.77172G>T, and g.77408T>G, and growth traits in Nanyang, were performed. The results indicated that SNPs within bovine HGF gene were significantly associated with growth traits. Phylogenetic analysis showed that the genetic background of Caoyuan Red cattle was different from the others in the tested breeds. The findings will provide a background for application of bovine HGF gene in the selection program in Chinese cattle. Copyright © 2013 Elsevier Ltd. All rights reserved.

DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

PubMed

Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

2017-05-23

A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single nucleotide polymorphisms of DNA repair genes as predictors of radioresponse.

PubMed

Parliament, Matthew B; Murray, David

2010-10-01

Radiation therapy is a key modality in the treatment of cancer. Substantial progress has been made in unraveling the molecular events which underpin the responses of malignant and surrounding normal tissues to ionizing radiation. An understanding of the genes involved in processes such as DNA double-strand break repair, DNA damage response, cell-cycle control, apoptosis, cellular antioxidant defenses, and cytokine production, has evolved toward examination of how genetic variants, most often, single nucleotide polymorphisms (SNPs), may influence interindividual radioresponse. Experimental approaches, such as candidate SNP-association studies, genome-wide association studies, and massively parallel sequencing are being proposed to address these questions. We present a focused review of the evidence supporting an association between SNPs in DNA repair genes and radioresponse in normal tissues and tumors. Although preliminary results indicate possible associations, there are methodological weaknesses in many of the studies, and independent validation of SNPs as biomarkers of radioresponse in much larger cohorts will likely require research cooperation through international consortia. Copyright © 2010 Elsevier Inc. All rights reserved.

Neuroantibodies (NAB) in African-American Children with Heavy Metal Exposures are Associated with Cytokine and Human Leukocyte Antigen (HLA) Polymorphisms (SNP)

EPA Science Inventory

Polymorphisms in cytokine and HLA genes are associated with allergies, autoimmunity and neurodegeneration (ND). Samples from 131 African-American children (71 males; 60 females) in the Mechanistic Indicators of Childhood Asthma (MICA) study were used to determine SNPs of IL-4, IL...

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

USDA-ARS?s Scientific Manuscript database

Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

USDA-ARS?s Scientific Manuscript database

Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

Association between AMELX polymorphisms and dental caries in Koreans.

PubMed

Kang, S W; Yoon, I; Lee, H W; Cho, J

2011-05-01

Dental caries is greatly influenced disease by environmental factors, but recently there are increasing evidences for a genetic component in caries susceptibility. AMELX is the gene coding amelogenin, which is the most important factor for normal enamel development. The aim of this study was to examine the relationship between dental caries and single nucleotide polymorphisms (SNPs) in AMELX. For this study, we used DNA samples collected from 120 unrelated individuals older than 12 years of age. All of them were examined for their oral and dental status under the WHO recommended criteria, and clinical information such as DMFT and DMFS were evaluated. Individuals whose DMFT and DMFS index lower than 2 were designated 'very low caries experience' and higher than 3 were designated 'higher caries experience'. Genomic DNA was extracted from hair samples, and single nucleotide polymorphisms of AMELX were genotyped. Genotyping of three SNPs (rs17878486, rs5933871, rs5934997, intron) in AMELX gene was determined by direct sequencing and analyzed with SNPStats. There were significant associations between rs5933871 and rs5934997 SNP and caries susceptibility in the water fluoridation group. These results suggest that SNPs of AMELX might be associated with dental caries susceptibility in Korean population. © 2010 John Wiley & Sons A/S.

Genetic polymorphisms of cytokine genes in type 2 diabetes mellitus

PubMed Central

Banerjee, Monisha; Saxena, Madhukar

2014-01-01

Diabetes mellitus is a combined metabolic disorder which includes hyperglycemia, dyslipidemia, stroke and several other complications. Various groups all over the world are relentlessly working out the possible role of a vast number of genes associated with type 2 diabetes (T2DM). Inflammation is an important outcome of any kind of imbalance in the body and is therefore an indicator of several diseases, including T2DM. Various ethnic populations around the world show different levels of variations in single nucleotide polymorphisms (SNPs). The present review was undertaken to explore the association of cytokine gene polymorphisms with T2DM in populations of different ethnicities. This will lead to the understanding of the role of cytokine genes in T2DM risk and development. Association studies of genotypes of SNPs present in cytokine genes will help to identify risk haplotype(s) for disease susceptibility by developing prognostic markers and alter treatment strategies for T2DM and related complications. This will enable individuals at risk to take prior precautionary measures and avoid or delay the onset of the disease. Future challenges will be to understand the genotypic interactions between SNPs in one cytokine gene or several genes at different loci and study their association with T2DM. PMID:25126395

Polymorphisms in HSD17B1: Early Onset and Increased Risk of Alzheimer's Disease in Women with Down Syndrome.

PubMed

Lee, Joseph H; Gurney, Susan; Pang, Deborah; Temkin, Alexis; Park, Naeun; Janicki, Sarah C; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Schupf, Nicole

2012-01-01

Background/Aims. Genetic variants that affect estrogen activity may influence the risk of Alzheimer's disease (AD). In women with Down syndrome, we examined the relation of polymorphisms in hydroxysteroid-17beta-dehydrogenase (HSD17B1) to age at onset and risk of AD. HSD17B1 encodes the enzyme 17β-hydroxysteroid dehydrogenase (HSD1), which catalyzes the conversion of estrone to estradiol. Methods. Two hundred and thirty-eight women with DS, nondemented at baseline, 31-78 years of age, were followed at 14-18-month intervals for 4.5 years. Women were genotyped for 5 haplotype-tagging single-nucleotide polymorphisms (SNPs) in the HSD17B1 gene region, and their association with incident AD was examined. Results. Age at onset was earlier, and risk of AD was elevated from two- to threefold among women homozygous for the minor allele at 3 SNPs in intron 4 (rs676387), exon 6 (rs605059), and exon 4 in COASY (rs598126). Carriers of the haplotype TCC, based on the risk alleles for these three SNPs, had an almost twofold increased risk of developing AD (hazard ratio = 1.8, 95% CI, 1.1-3.1). Conclusion. These findings support experimental and clinical studies of the neuroprotective role of estrogen.

Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

PubMed Central

Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

2015-01-01

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

Cytochrome P2A13 and P1A1 gene polymorphisms are associated with the occurrence of uterine leiomyoma.

PubMed

Herr, D; Bettendorf, H; Denschlag, D; Keck, C; Pietrowski, D

2006-10-01

To investigate the association between the occurrence of uterine leiomyoma and two SNPs of the CYP 2A13 and CYP 1A1 genes. Prospective case control study with 132 women with clinically and surgically diagnosed uterine leiomyoma and 260 controls. Genotyping was performed by polymerase chain reaction (PCR) based amplification of CYP 2A13 and CYP 1A1 genes, and restriction fragment length polymorphism (RFLP) analysis. Comparing women with uterine leiomyoma and controls, we demonstrate statistical significant differences of allele frequency and genotype distribution for the CYP 1A1 polymorphism (P = 0.025 and P = 0.046, respectively). Furthermore, for the CYP 2A13 polymorphism we found a significant difference concerning allele frequency (P = 0.033). However, for the genotype distribution, only borderline significance was observed (P = 0.064). The CYP 2A13 and CYP 1A1 SNPs are associated with uterine leiomyoma in a Caucasian population and may contribute to the understanding of the pathogenic mechanisms of uterine leiomyoma.

The polymorphism rs2480258 within CYP2E1 is associated with different rates of acrylamide metabolism in vivo in humans.

PubMed

Pellè, Lucia; Carlsson, Henrik; Cipollini, Monica; Bonotti, Alessandra; Foddis, Rudy; Cristaudo, Alfonso; Romei, Cristina; Elisei, Rossella; Gemignani, Federica; Törnqvist, Margareta; Landi, Stefano

2018-05-10

In a recent study, we demonstrated that the variant allele of rs2480258 within intron VIII of CYP2E1 is associated with reduced levels of mRNA, protein, and enzyme activity. CYP2E1 is the most important enzyme in the metabolism of acrylamide (AA) by operating its oxidation into glycidamide (GA). AA occurs in food, is neurotoxic and classified as a probable human carcinogen. The goal of the present study was to further assess the role of rs2480258 by measuring the rate of AA > GA biotransformation in vivo. In blood samples from a cohort of 120 volunteers, the internal doses of AA and GA were assessed by AA and GA adducts to hemoglobin (Hb) measured by mass spectrometry. The rate of biotransformation was assessed by calculating the GA-Hb/AA-Hb ratio. To maximize the statistical power, 60 TT was compared to 60 CC-homozygotes and the results showed that TT homozygotes had a statistically significant reduced rate of biotransformation. Present results reinforced the notion that T-allele of rs2480258 is a marker of low functional activity of CYP2E1. Moreover, we studied the role of polymorphisms (SNPs) within glutathione-S-transferases (GSTs) enzymes and epoxide hydrolase (EPHX), verifying previous findings that SNPs within GSTs and EPHX influence the metabolism rate.

DNA repair variants and breast cancer risk.

PubMed

Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

2016-05-01

A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P < 0.05), although no associations were observed for other DNA repair SNPs. Interactions of six SNPs in multiple DNA repair pathways with physical activity were evident prior to correction for FDR, following which there was support for only one of the interaction terms (P < 0.05). No consistent associations between variants in DNA repair genes and breast cancer risk or their modification by breast cancer risk factors were observed. © 2016 Wiley Periodicals, Inc.

A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

PubMed Central

Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

2010-01-01

Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

Common genetic variants in metabolism and detoxification pathways and the risk of papillary thyroid cancer

PubMed Central

Aschebrook-Kilfoy, Briseis; Neta, Gila; Brenner, Alina V; Hutchinson, Amy; Pfeiffer, Ruth M; Sturgis, Erich M; Xu, Li; Wheeler, William; Doody, Michele M; Chanock, Stephen J; Sigurdson, Alice J

2012-01-01

Relationships are unclear between polymorphisms in genes involved in metabolism and detoxification of various chemicals and papillary thyroid cancer (PTC) risk as well as their potential modification by alcohol or tobacco intake. We evaluated associations between 1647 tagging single nucleotide polymorphisms (SNPs) in 132 candidate genes/regions involved in metabolism of exogenous and endogenous compounds (Phase I/II, oxidative stress, and metal binding pathways) and PTC risk in 344 PTC cases and 452 controls. For 15 selected regions and their respective SNPs, we also assessed interaction with alcohol and tobacco use. Logistic regression models were used to evaluate the main effect of SNPs (Ptrend) and interaction with alcohol/tobacco intake. Gene- and pathway-level associations and interactions (Pgene interaction) were evaluated by combining Ptrend values using the adaptive rank-truncated product method. While we found associations between PTC risk and nine SNPs (Ptrend≤0.01) and seven genes/regions (Pregion<0.05), none remained significant after correction for the false discovery rate. We found a significant interaction between UGT2B7 and NAT1 genes and alcohol intake (Pgene interaction=0.01 and 0.02 respectively) and between the CYP26B1 gene and tobacco intake (Pgene interaction=0.02). Our results are suggestive of interaction between the genetic polymorphisms in several detoxification genes and alcohol or tobacco intake on risk of PTC. Larger studies with improved exposure assessment should address potential modification of PTC risk by alcohol and tobacco intake to confirm or refute our findings. PMID:22389382

Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

PubMed Central

Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

2012-01-01

Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

Neuropeptide S Receptor Induces Neuropeptide Expression and Associates with Intermediate Phenotypes of Functional Gastrointestinal Disorders

PubMed Central

Camilleri, Michael; Carlson, Paula; Zinsmeister, Alan R.; McKinzie, Sanna; Busciglio, Irene; Burton, Duane; Zucchelli, Marco; D’Amato, Mauro

2009-01-01

Background & Aims NPSR1, the receptor for neuropeptide S (NPS), is expressed by gastrointestinal (GI) enteroendocrine (EE) cells, and is involved in inflammation, anxiety and nociception. NPSR1 polymorphisms are associated with asthma and inflammatory bowel disease. We aimed to determine whether NPS induces expression of GI neuropeptides; and to associate NPSR1 single nucleotide polymorphisms (SNPs) with symptom phenotype and GI functions in health and functional GI disorders (FGID). Methods The effect of NPS on mRNA expression of neuropeptides was assessed using real-time PCR in NPSR1-tranfected HEK293 cells. Seventeen NPSR1 SNPs were successfully genotyped in 699 subjects from a regional cohort of 466 FGID patients and 233 healthy controls. Associations were sought using sex-adjusted regression analysis and false discovery rate (FDR) correction. Results NPS-NPSR1 signaling induced increased expression of CCK, VIP, PYY, and somatostatin. There were no significant associations with phenotypes of FGID symptoms. There were several NPSR1 SNPs associated with individual motor or sensory functions; the associations of SNPs rs2609234, rs6972158 and rs1379928 with colonic transit rate remained significant after FDR correction. The rs1379928 polymorphism was also associated with pain, gas and urgency sensory ratings at 36 mm Hg distension, the level pre-specified for formal testing. Associations with rectal sensory ratings were not significant after FDR correction. Conclusions Expression of several neuropeptides is induced upon NPS-NPSR1 signaling; NPSR1 variants are associated with colonic transit in FGID. The role of the NPS system in FGID deserves further study. PMID:19732772

Association of TRPV4 gene polymorphisms with chronic obstructive pulmonary disease.

PubMed

Zhu, Guohua; Gulsvik, Amund; Bakke, Per; Ghatta, Srinivas; Anderson, Wayne; Lomas, David A; Silverman, Edwin K; Pillai, Sreekumar G

2009-06-01

Chronic obstructive pulmonary disease (COPD) is characterized by airway epithelial damage, bronchoconstriction, parenchymal destruction and mucus hypersecretion. Upon activation by a broad range of stimuli, transient receptor potential vanilloid 4 (TRPV4) functions to control airway epithelial cell volume and epithelial and endothelial permeability; it also triggers bronchial smooth muscle contraction and participates in autoregulation of mucociliary transport. These functions of TRPV4 may be important for the regulation of COPD pathogenesis, so TRPV4 is a candidate gene for COPD. We genotyped 20 single nucleotide polymorphisms (SNPs) in TRPV4, and tested qualitative COPD and quantitative FEV(1) and FEV(1)/(F)VC phenotypes in two independent large populations. The family population had 606 pedigrees including 1891 individuals, and the case-control sample included 953 COPD cases and 956 controls. Family-based association tests were performed in the family data. Logistic regression and linear models were used in the case-control data to replicate the association results. In the family data, seven out of 20 SNPs tested were associated with COPD (2.5 x 10(-4) < or = P < or = 0.04) and six SNPs were associated with FEV(1)/VC (0.02 < or = P < or = 0.03) from family-based association tests (PBAT) analysis. Four out of the seven SNPs associated with COPD demonstrated replicated associations with the same effect directions in the case-control population (0.02 < or = P < or = 0.03). Significant haplotype associations supported the results of single SNP analyses. Thus, polymorphisms in the TRPV4 gene are associated with COPD.

[Evaluation of association between 9 genetic polymorphism and myocardial infarction in the Siberian population].

PubMed

Maksimov, V N; Kulikov, I V; Orlov, P S; Gafarov, V V; Maliutina, S K; Romashchenko, A G; Voevoda, M I

2012-01-01

to evaluate association between genetic polymorphism (SNPs) and myocardial infarction (identified in recent GWAS) as markers of high risk of myocardial infarction (MI) in Siberian population. Patients were divided into 2 groups - MI patients and control group (ratio 1:2) and presented the sapmle of population of Novosibirsk (9400 patients, 45-69 years) within international project HAPIEE (Health, Alcohol and Psychosocial factors In Eastern Europe). 200 patients with MI (129 men, 71 women) were included. Control group - individuals without MI (420) matched for age and sex. Genomic DNA was extracted from venous blood by phenol-chloroform extraction. Gene polymorphism of genes tested by real-time PCR according to protocol (probes TaqMan, Applied Biosystems, USA) with the use of ABI 7900HT. The following SNPs were studied: rs28711149, rs499818, rs619203, rs10757278 and rs1333049 (hr. 9), rs1376251, rs2549513, rs4804611, rs17465637. The association of SNP and MI was confirmed for 4 of 9 studied SNPs: rs1333049 (hr. 9), rs10757278 (hr. 9), rs499818 (hr. 6), rs619203 gene ROS1. Heart rate was associated with rs1333049 and rs10757278. Glucose level was associated with rs619203, rs28711149 and rs1376251. Total cholesterol and atherogenic index was associated with rs28711149. For the first time in Russian population the associations of GWAS with myocardial infarction SNPs was detected for rs619203, rs499818, rs1333049 and rs10757278. These genetic markers can be used for assessing the risk of myocardial infarction in Russian population.

Single-Nucleotide Polymorphism Markers from De-Novo Assembly of the Pomegranate Transcriptome Reveal Germplasm Genetic Diversity

PubMed Central

Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

2014-01-01

Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature. PMID:24558460

Single-nucleotide polymorphism markers from de-novo assembly of the pomegranate transcriptome reveal germplasm genetic diversity.

PubMed

Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

2014-01-01

Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature.

Heterospecific SNP diversity in humans and rhesus macaque (Macaca mulatta)

PubMed Central

Ng, Jillian; Trask, Jessica Satkoski; Smith, David Glenn; Kanthaswamy, Sree

2018-01-01

Background Conservation of single nucleotide polymorphisms (SNPs) between human and other primates (i.e., heterospecific SNPs) in candidate genes can be used to assess the utility of those organisms as models for human biomedical research. Methods 59,691 heterospecific SNPs in 22 rhesus macaques and 20 humans were analyzed for human trait associations and 4,207 heterospecific SNPs biallelic in both taxa were compared for genetic variation. Results Variation comparisons at the 4,207 SNPs showed that humans were more genetically diverse than rhesus macaques with observed and expected heterozygosities of 0.337 and 0.323 versus 0.119 and 0.102, and minor allele frequencies of 0.239 and 0.063, respectively. 431 of the 59,691 heterospecific SNPs are reportedly associated with human-specific traits. Conclusion While comparisons between human and rhesus macaque genomes are plausible, functional studies of heterospecific SNPs are necessary to determine whether rhesus macaque alleles are associated with the same phenotypes as their corresponding human alleles. PMID:25963897

Identification of new genetic polymorphisms that alter the dietary requirement for choline and vary in their distribution across ethnic and racial groups

PubMed Central

da Costa, Kerry-Ann; Corbin, Karen D.; Niculescu, Mihai D.; Galanko, Joseph A.; Zeisel, Steven H.

2014-01-01

Effect alleles (alleles with a polymorphism that is associated with the effect being measured) in a small number of single-nucleotide polymorphisms (SNPs) are known to influence the dietary requirement for choline. In this study, we examined a much larger number of SNPs (n=200) in 10 genes related to choline metabolism for associations with development of organ dysfunction (liver or muscle) when 79 humans were fed a low-choline diet. We confirmed that effect alleles in SNPs such as the C allele of PEMT rs12325817 increase the risk of developing organ dysfunction in women when they consume a diet low in choline, and we identified novel effect alleles, such as the C allele of CHKA SNP rs7928739, that alter dietary choline requirements. When fed a low-choline diet, some people presented with muscle damage rather than liver damage; several effect alleles in SLC44A1 (rs7873937, G allele; rs2771040, G; rs6479313, G; rs16924529, A; and rs3199966, C) and one in CHKB (rs1557502, A) were more common in these individuals. This suggests that pathways related to choline metabolism are more important for normal muscle function than previously thought. In European, Mexican, and Asian Americans, and in individuals of African descent, we examined the prevalence of the effect alleles in SNPs that alter choline requirement and found that they are differentially distributed among people of different ethnic and racial backgrounds. Overall, our study has identified novel genetic variants that modulate choline requirements and suggests that the dietary requirement for choline may be different across racial and ethnic groups.—Da Costa, K.-A., Corbin, K. D., Niculescu, M. D., Galanko, J. A., Zeisel, S. H. Identification of new genetic polymorphisms that alter the dietary requirement for choline and vary in their distribution across ethnic and racial groups. PMID:24671709

Relationship of the MTHFD1 (rs2236225), eNOS (rs1799983), CBS (rs2850144) and ACE (rs4343) gene polymorphisms in a population of Iranian pediatric patients with congenital heart defects.

PubMed

Khatami, Mehri; Ratki, Farzaneh Morteza; Tajfar, Saba; Akrami, Fatemeh

2017-09-01

Congenital heart defects are structural cardiovascular malformations that arise from abnormal formation of the heart or major blood vessels during the fetal period. To investigate the association of 4 single nucleotide polymorphisms (SNPs) in the MTHFD1, eNOS, CBS and ACE genes, we evaluated their relationship with CHD in Iranian patients. In this case-control study, a total of 102 children with CHD and 98 control children were enrolled. Four SNPs including MTHFD1 G1958A, eNOS G894T, CBS C-4673G and ACE A2350G were genotyped by PCR-SSCP, Multiplex ARMS PCR and PCR-RFLP methods and confirmed by direct sequencing. We genotyped 102 patients and 98 controls for four polymorphisms by statistically analysis. There were three SNPs including MTHFD1 G1958A, eNOS G894T and ACE A2350G which might increase the risk of CHD, but CBS C-4673G was not significantly different between patients and controls. (P = 0.017, P = 0.048, P = 0.025 and P = 0.081 respectively). The allele frequencies of three SNPs for MTHFD1 G1958A, eNOS G894T and ACE A2350G in CHD are higher than that in control. Our results show that there is a significant relationship between MTHFD1 G1958A, eNOS G894T and ACE A2350G polymorphisms with CHD. Therefore, The AA and GA genotypes of MTHFD1 G1958A, TT and GT genotypes of eNOS G894T and the AA and GA genotypes of ACE A2350G are susceptible factors for CHD and may increase the risk of CHD. Copyright © 2017. Published by Elsevier Taiwan.

Tumor Necrosis Factor-alpha Induced Protein 3 Interacting Protein 1 Gene Polymorphisms and Pustular Psoriasis in Chinese Han Population

PubMed Central

Han, Jian-Wen; Wang, Yong; Alateng, Chulu; Li, Hong-Bin; Bai, Yun-Hua; Lyu, Xin-Xiang; Wu, Rina

2016-01-01

Background: Psoriasis is a common immune-mediated inflammatory dermatosis. Generalized pustular psoriasis (GPP) is the severe and rare type of psoriasis. The association between tumor necrosis factor-alpha induced protein 3 interacting protein 1 (TNIP1) gene and psoriasis was confirmed in people with multiple ethnicities. This study was to investigate the association between TNIP1 gene polymorphisms and pustular psoriasis in Chinese Han population. Methods: Seventy-three patients with GPP, 67 patients with palmoplantar pustulosis (PPP), and 476 healthy controls were collected from Chinese Han population. Six single nucleotide polymorphisms (SNPs) of the TNIP1 gene, namely rs3805435, rs3792798, rs3792797, rs869976, rs17728338, and rs999011 were genotyped by using polymerase chain reaction-ligase detection reaction. Statistical analyses were performed using the PLINK 1.07 package. Allele frequencies and genotyping frequencies for six SNPs were compared by using Chi-square test, odd ratio (OR) (including 95% confidence interval) were calculated. The haplotype analysis was conducted by Haploview software. Results: The frequencies of alleles of five SNPs were significantly different between the GPP group and the control group (P ≤ 7.22 × 10−3), especially in the GPP patients without psoriasis vulgaris (PsV). In the haplotype analysis, the most significantly different haplotype was H4: ACGAAC, with 13.1% frequency in the GPP group but only 3.4% in the control group (OR = 4.16, P = 4.459 × 10−7). However, no significant difference in the allele frequencies was found between the PPP group and control group for each of the six SNPs (P > 0.05). Conclusions: Polymorphisms in TNIP1 are associated with GPP in Chinese Han population. However, no association with PPP was found. These findings suggest that TNIP1 might be a susceptibility gene for GPP. PMID:27364786

The impact of single nucleotide polymorphism in monomeric alpha-amylase inhibitor genes from wild emmer wheat, primarily from Israel and Golan

PubMed Central

2010-01-01

Background Various enzyme inhibitors act on key insect gut digestive hydrolases, including alpha-amylases and proteinases. Alpha-amylase inhibitors have been widely investigated for their possible use in strengthening a plant's defense against insects that are highly dependent on starch as an energy source. We attempted to unravel the diversity of monomeric alpha-amylase inhibitor genes of Israeli and Golan Heights' wild emmer wheat with different ecological factors (e.g., geography, water, and temperature). Population methods that analyze the nature and frequency of allele diversity within a species and the codon analysis method (comparing patterns of synonymous and non-synonymous changes in protein coding sequences) were used to detect natural selection. Results Three hundred and forty-eight sequences encoding monomeric alpha-amylase inhibitors (WMAI) were obtained from 14 populations of wild emmer wheat. The frequency of SNPs in WMAI genes was 1 out of 16.3 bases, where 28 SNPs were detected in the coding sequence. The results of purifying and the positive selection hypothesis (p < 0.05) showed that the sequences of WMAI were contributed by both natural selection and co-evolution, which ensured conservation of protein function and inhibition against diverse insect amylases. The majority of amino acid substitutions occurred at the C-terminal (positive selection domain), which ensured the stability of WMAI. SNPs in this gene could be classified into several categories associated with water, temperature, and geographic factors, respectively. Conclusions Great diversity at the WMAI locus, both between and within populations, was detected in the populations of wild emmer wheat. It was revealed that WMAI were naturally selected for across populations by a ratio of dN/dS as expected. Ecological factors, singly or in combination, explained a significant proportion of the variations in the SNPs. A sharp genetic divergence over very short geographic distances compared to a small genetic divergence between large geographic distances also suggested that the SNPs were subjected to natural selection, and ecological factors had an important evolutionary role in polymorphisms at this locus. According to population and codon analysis, these results suggested that monomeric alpha-amylase inhibitors are adaptively selected under different environmental conditions. PMID:20534122

Single-Nucleotide Polymorphisms of the MSH2 and MLH1 Genes, Potential Molecular Markers for Susceptibility to the Development of Basal Cell Carcinoma in the Brazilian Population.

PubMed

da Silva Calixto, Poliane; Lopes, Otávio Sérgio; Dos Santos Maia, Mayara; Herrero, Sylvia Satomi Takeno; Longui, Carlos Alberto; Melo, Cynthia Germoglio Farias; de Carvalho Filho, Ivan Rodrigues; Soares, Leonardo Ferreira; de Medeiros, Arnaldo Correia; Delatorre, Plínio; Khayat, André Salim; Burbano, Rommel Rodriguez; Lima, Eleonidas Moura

2018-07-01

Basal cell carcinoma - BCC is considered a multifactorial neoplasm involving genetic, epigenetic and environmental factors. Where UVB radiation is considered the main physical agent involved in BCC carcinogenesis. The Brazil and state of Paraíba are exposed to high levels of UVB rays. The mismatch repair - MMR is important DNA repair mechanisms to maintain replication fidelity. Therefore, single nucleotide polymorphisms (SNPs) in genes encoding proteins involved in MMR may be potential molecular markers of susceptibility to BCC. The objective of this study was to evaluate and describe for the first time the SNPs rs560246973, rs2303425 and rs565410865 and risk of developing BCC. The present study analyzed 100 samples of paraffin-embedded tissue from patients with histopathological diagnosis of BCC and 100 control samples. The results were obtained by genotyping method, Dideoxy Unique Allele Specific - PCR (DSASP). The SNPs rs2303425 were not associated with Basal Cell Carcinoma. However, the SNPs rs560246973 and rs565410865 was shown to be associated with the development of BCC when compared to control samples (P < 0.0001). The SNPs rs565410865 was also statistical significance between the genotypes of and the age group (p = 0.0027) and tumor location (p = 0,0191). The result suggests that SNPs rs2303425 and rs565410865 are associated with susceptibility to the development of BCC in the Brazilian population and may be considered as potential molecular markers for BCC.

Effects of GWAS-Associated Genetic Variants on lncRNAs within IBD and T1D Candidate Loci

PubMed Central

Brorsson, Caroline A.; Pociot, Flemming

2014-01-01

Long non-coding RNAs are a new class of non-coding RNAs that are at the crosshairs in many human diseases such as cancers, cardiovascular disorders, inflammatory and autoimmune disease like Inflammatory Bowel Disease (IBD) and Type 1 Diabetes (T1D). Nearly 90% of the phenotype-associated single-nucleotide polymorphisms (SNPs) identified by genome-wide association studies (GWAS) lie outside of the protein coding regions, and map to the non-coding intervals. However, the relationship between phenotype-associated loci and the non-coding regions including the long non-coding RNAs (lncRNAs) is poorly understood. Here, we systemically identified all annotated IBD and T1D loci-associated lncRNAs, and mapped nominally significant GWAS/ImmunoChip SNPs for IBD and T1D within these lncRNAs. Additionally, we identified tissue-specific cis-eQTLs, and strong linkage disequilibrium (LD) signals associated with these SNPs. We explored sequence and structure based attributes of these lncRNAs, and also predicted the structural effects of mapped SNPs within them. We also identified lncRNAs in IBD and T1D that are under recent positive selection. Our analysis identified putative lncRNA secondary structure-disruptive SNPs within and in close proximity (+/−5 kb flanking regions) of IBD and T1D loci-associated candidate genes, suggesting that these RNA conformation-altering polymorphisms might be associated with diseased-phenotype. Disruption of lncRNA secondary structure due to presence of GWAS SNPs provides valuable information that could be potentially useful for future structure-function studies on lncRNAs. PMID:25144376

A genetic variant in SLC28A3, rs56350726, is associated with progression to castration-resistant prostate cancer in a Korean population with metastatic prostate cancer.

PubMed

Jo, Jung Ku; Oh, Jong Jin; Kim, Yong Tae; Moon, Hong Sang; Choi, Hong Yong; Park, Seunghyun; Ho, Jin-Nyoung; Yoon, Sungroh; Park, Hae Young; Byun, Seok-Soo

2017-11-14

Genetic variation which related with progression to castration-resistant prostate cancer (CRPC) during androgen-deprivation therapy (ADT) has not been elucidated in patients with metastatic prostate cancer (mPCa). Therefore, we assessed the association between genetic variats in mPCa and progession to CRPC. Analysis of exome genotypes revealed that 42 SNPs were significantly associated with mPCa. The top five polymorphisms were statistically significantly associated with metastatic disease. In addition, one of these SNPs, rs56350726, was significantly associated with time to CRPC in Kaplan-Meier analysis (Log-rank test, p = 0.011). In multivariable Cox regression, rs56350726 was strongly associated with progression to CRPC (HR = 4.172 95% CI = 1.223-14.239, p = 0.023). We assessed genetic variation among 1000 patients with PCa with or without metastasis, using 242,221 single nucleotide polymorphisms (SNPs) on the custom HumanExome BeadChip v1.0 (Illuminam Inc.). We analyzed the time to CRPC in 110 of the 1000 patients who were treated with ADT. Genetic data were analyzed using unconditional logistic regression and odds ratios calculated as estimates of relative risk of metastasis. We identified SNPs associated with metastasis and analyzed the relationship between these SNPs and time to CRPC in mPCa. Based on a genetic variation, the five top SNPs were observed to associate with mPCa. And one (SLC28A3, rs56350726) of five SNP was found the association with the progression to CRPC in patients with mPCa.

Influence of ghrelin gene polymorphisms on hypertension and atherosclerotic disease.

PubMed

Berthold, Heiner K; Giannakidou, Eleni; Krone, Wilhelm; Trégouët, David-Alexandre; Gouni-Berthold, Ioanna

2010-02-01

Ghrelin is involved in several metabolic and cardiovascular processes. Recent evidence suggests its involvement in blood pressure regulation and hypertension. The aim of the study was to determine associations of single-nucleotide polymorphisms (SNPs) and haplotypes of the ghrelin gene (GHRL) with hypertension and atherosclerotic disease. Six GHRL SNPs (rs27647, rs26802, rs34911341, rs696217, rs4684677 and a -473G/A (with no assigned rsID)) were investigated in a sample of 1143 hypertensive subjects and 1489 controls of Caucasian origin. Both single-locus and haplotype association analyses were performed. In single-locus analyses, only the non-synonymous rs34911341 was associated with hypertension (odds ratio (OR)=1.95 (95% confidence interval (CI): 1.26-3.02), P=0.003). Six common haplotypes with frequency >1% were inferred from the studied GHRL SNPs, and their frequency distribution was significantly different between hypertensive subjects and controls (chi(2)=12.96 with 5 d.f. (degree of freedom), P=0.024). The effect of rs26802 was found to be significantly (P=0.017) modulated by other GHRL SNPs, as its C allele conferred either an increased risk (OR=1.30 (1.08-1.57), P=0.005) or a decreased risk (OR=0.50 (0.23-1.06), P=0.07) of hypertension according to the two different haplotypes on which it can be found. No association of GHRL SNPs or haplotypes with atherosclerotic disease was observed. In conclusion, we observed statistical evidence for association between GHRL SNPs and risk of hypertension.

Association of Symptoms and Severity of Rift Valley Fever with Genetic Polymorphisms in Human Innate Immune Pathways

PubMed Central

Hise, Amy G.; Traylor, Zachary; Hall, Noémi B.; Sutherland, Laura J.; Dahir, Saidi; Ermler, Megan E.; Muiruri, Samuel; Muchiri, Eric M.; Kazura, James W.; LaBeaud, A. Desirée; King, Charles H.; Stein, Catherine M.

2015-01-01

Background Multiple recent outbreaks of Rift Valley Fever (RVF) in Africa, Madagascar, and the Arabian Peninsula have resulted in significant morbidity, mortality, and financial loss due to related livestock epizootics. Presentation of human RVF varies from mild febrile illness to meningoencephalitis, hemorrhagic diathesis, and/or ophthalmitis with residual retinal scarring, but the determinants for severe disease are not understood. The aim of the present study was to identify human genes associated with RVF clinical disease in a high-risk population in Northeastern Province, Kenya. Methodology/Principal Findings We conducted a cross-sectional survey among residents (N = 1,080; 1–85 yrs) in 6 villages in the Sangailu Division of Ijara District. Participants completed questionnaires on past symptoms and exposures, physical exam, vision testing, and blood collection. Single nucleotide polymorphism (SNP) genotyping was performed on a subset of individuals who reported past clinical symptoms consistent with RVF and unrelated subjects. Four symptom clusters were defined: meningoencephalitis, hemorrhagic fever, eye disease, and RVF-not otherwise specified. SNPs in 46 viral sensing and response genes were investigated. Association was analyzed between SNP genotype, serology and RVF symptom clusters. The meningoencephalitis symptom phenotype cluster among seropositive patients was associated with polymorphisms in DDX58/RIG-I and TLR8. Having three or more RVF-related symptoms was significantly associated with polymorphisms in TICAM1/TRIF, MAVS, IFNAR1 and DDX58/RIG-I. SNPs significantly associated with eye disease included three different polymorphisms TLR8 and hemorrhagic fever symptoms associated with TLR3, TLR7, TLR8 and MyD88. Conclusions/Significance Of the 46 SNPs tested, TLR3, TLR7, TLR8, MyD88, TRIF, MAVS, and RIG-I were repeatedly associated with severe symptomatology, suggesting that these genes may have a robust association with RVFV-associated clinical outcomes. Studies of these and related genetic polymorphisms are warranted to advance understanding of RVF pathogenesis. PMID:25756647

The first report of prion-related protein gene (PRNT) polymorphisms in goat.

PubMed

Kim, Yong-Chan; Jeong, Byung-Hoon

2017-06-01

Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

Association between Ghrelin gene (GHRL) polymorphisms and clinical response to atypical antipsychotic drugs in Han Chinese schizophrenia patients

PubMed Central

2012-01-01

Background Ghrelin (GHRL) is a pivotal peptide regulator of food intake, energy balance, and body mass. Weight gain (WG) is a common side effect of the atypical antipsychotics (AAPs) used to treat schizophrenia (SZ). Ghrelin polymorphisms have been associated with pathogenic variations in plasma lipid concentrations, blood pressure, plasma glucose, and body mass index (BMI). However, it is unclear whether GHRL polymorphisms are associated with WG due to AAPs. Furthermore, there is no evidence of an association between GHRL polymorphisms and SZ or the therapeutic response to AAPs. We explored these potential associations by genotyping GHRL alleles in SZ patients and controls. We also examined the relation between these SNPs and changes in metabolic indices during AAP treatment in SZ subgroups distinguished by high or low therapeutic response. Methods Four SNPs (Leu72Met, -501A/C, -604 G/A, and -1062 G > C) were genotyped in 634 schizophrenia patients and 606 control subjects. Results There were no significant differences in allele frequencies, genotype distributions, or the distributions of two SNP haplotypes between SZ patients and healthy controls (P > 0.05). There was also no significant difference in symptom reduction between genotypes after 8 weeks of AAP treatment as measured by positive and negative symptom scale scores (PANSS). However, the -604 G/A polymorphism was associated with a greater BMI increase in response to AAP administration in both APP responders and non-responders as distinguished by PANSS score reduction (P < 0.001). There were also significant differences in WG when the responder group was further subdivided according to the specific AAP prescribed (P < 0.05). Conclusions These four GHRL gene SNPs were not associated with SZ in this Chinese Han population. The -604 G/A polymorphism was associated with significant BW and BMI increases during AAP treatment. Patients exhibiting higher WG showed greater improvements in positive and negative symptoms than patients exhibiting lower weight gain or weight loss. PMID:22369141

Association between ghrelin gene (GHRL) polymorphisms and clinical response to atypical antipsychotic drugs in Han Chinese schizophrenia patients.

PubMed

Yang, Yongfeng; Li, Wenqiang; Zhao, Jingyuan; Zhang, Hongxing; Song, Xueqin; Xiao, Bo; Yang, Ge; Jiang, Chengdi; Zhang, Dai; Yue, Weihua; Lv, Luxian

2012-02-28

Ghrelin (GHRL) is a pivotal peptide regulator of food intake, energy balance, and body mass. Weight gain (WG) is a common side effect of the atypical antipsychotics (AAPs) used to treat schizophrenia (SZ). Ghrelin polymorphisms have been associated with pathogenic variations in plasma lipid concentrations, blood pressure, plasma glucose, and body mass index (BMI). However, it is unclear whether GHRL polymorphisms are associated with WG due to AAPs. Furthermore, there is no evidence of an association between GHRL polymorphisms and SZ or the therapeutic response to AAPs. We explored these potential associations by genotyping GHRL alleles in SZ patients and controls. We also examined the relation between these SNPs and changes in metabolic indices during AAP treatment in SZ subgroups distinguished by high or low therapeutic response. Four SNPs (Leu72Met, -501A/C, -604 G/A, and -1062 G > C) were genotyped in 634 schizophrenia patients and 606 control subjects. There were no significant differences in allele frequencies, genotype distributions, or the distributions of two SNP haplotypes between SZ patients and healthy controls (P > 0.05). There was also no significant difference in symptom reduction between genotypes after 8 weeks of AAP treatment as measured by positive and negative symptom scale scores (PANSS). However, the -604 G/A polymorphism was associated with a greater BMI increase in response to AAP administration in both APP responders and non-responders as distinguished by PANSS score reduction (P < 0.001). There were also significant differences in WG when the responder group was further subdivided according to the specific AAP prescribed (P < 0.05). These four GHRL gene SNPs were not associated with SZ in this Chinese Han population. The -604 G/A polymorphism was associated with significant BW and BMI increases during AAP treatment. Patients exhibiting higher WG showed greater improvements in positive and negative symptoms than patients exhibiting lower weight gain or weight loss.

Association of single nucleotide polymorphisms in CACNA 1A/CACNA 1C/CACNA 1H calcium channel genes with diabetic peripheral neuropathy in Chinese population.

PubMed

Sun, Lin; Ma, Jun; Mao, Qian; Yang, Yun-Long; Ma, Lin-Lin; Niu, Ling; Liu, Li-Feng

2018-06-29

The present study was conducted to explore the correlations between single nucleotide polymorphisms (SNPs) in the calcium channel CACNA 1A, CACNA 1C, and CACNA 1H genes and diabetic peripheral neuropathy (DPN) amongst the Chinese population. In total, 281 patients diagnosed with type 2 diabetes participated in the present study. These patients were divided into the case group, which was subdivided into the DPN (143 cases) and the non-DPN groups (138 cases). Subsequently, 180 healthy individuals that had undergone routine health examinations were also recruited and assigned to the control group. PCR-restriction fragment length polymorphism (PCR-RFLP) was used to detect the genotype and allele frequencies of CACNA 1A, CACNA 1C, and CACNA 1H genes; logistic regression analysis to investigate the association of gene polymorphisms with DNP. Gene-gene interactions were then detected by generalized multifactor dimensionality reduction (GMDR). The results revealed that CACNA 1A rs2248069 and rsl6030, CACNA 1C rs216008 and rs2239050, and CACNA 1H rs3794619, and rs7191246 SNPs were all associated with DPN, while rs2248069, rsl6030, rs2239050, and rs7191246 polymorphisms were attributed to the susceptibility to DPN. It was also observed that the optimal models were three-, four- and five-dimensional models with a prediction accuracy of 61.05% and the greatest consistency of cross-validation was 10/10. In summary, these findings demonstrated that the SNPs in the CACNA 1A, CACNA 1C, and CACNA 1H genes were involved in the pathophysiology of DPN. In addition, polymorphisms in the CACNA 1A, CACNA 1C, and CACNA 1H genes and their interactions also had effects on DPN. © 2018 The Author(s).

Selection and sex-biased dispersal in a coastal shark: the influence of philopatry on adaptive variation.

PubMed

Portnoy, D S; Puritz, J B; Hollenbeck, C M; Gelsleichter, J; Chapman, D; Gold, J R

2015-12-01

Sex-biased dispersal is expected to homogenize nuclear genetic variation relative to variation in genetic material inherited through the philopatric sex. When site fidelity occurs across a heterogeneous environment, local selective regimes may alter this pattern. We assessed spatial patterns of variation in nuclear-encoded, single nucleotide polymorphisms (SNPs) and sequences of the mitochondrial control region in bonnethead sharks (Sphyrna tiburo), a species thought to exhibit female philopatry, collected from summer habitats used for gestation. Geographic patterns of mtDNA haplotypes and putatively neutral SNPs confirmed female philopatry and male-mediated gene flow along the northeastern coast of the Gulf of Mexico. A total of 30 outlier SNP loci were identified; alleles at over half of these loci exhibited signatures of latitude-associated selection. Our results indicate that in species with sex-biased dispersal, philopatry can facilitate sorting of locally adaptive variation, with the dispersing sex facilitating movement of potentially adaptive variation among locations and environments. © 2015 John Wiley & Sons Ltd.

Leptin and leptin receptor gene polymorphisms and their association with plasma leptin levels and obesity in a multi-ethnic Malaysian suburban population.

PubMed

Fan, Sook-Ha; Say, Yee-How

2014-06-20

This study was to investigate the prevalence of single nucleotide polymorphisms (SNPs) in leptin gene LEP (A19G and G2548A) and leptin receptor gene LEPR (K109R and Q223R) and their association with fasting plasma leptin level (PLL) and obesity in a Malaysian suburban population in Kampar, Perak. Convenience sampling was performed with informed consents, and the study sample was drawn from patients who were patrons of the Kampar Health Clinic. A total of 408 subjects (mean age, 52.4 ± 13.7 years; 169 men, 239 women; 190 obese, 218 non-obese; 148 Malays, 177 ethnic Chinese, 83 ethnic Indians) participated. Socio-demographic data and anthropometric measurements were taken, and genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The LEP A19G, G2548A and LEPR K109R, Q223R variant allele frequencies were 0.74, 0.67 and 0.61, 0.79, respectively. The genotype and allele distributions of these gene variants were significantly different among ethnic groups, but not among body mass index (BMI) classes. Subjects with LEPR K109 and Q223 allele had significantly higher systolic blood pressure and adiposity indices after adjustment for ethnicity (higher BMI, total body and subcutaneous fat; lower skeletal muscle percentage). Subjects with LEPR 109R allele had lower PLL than their wild-type allele counterparts. The influence of LEP A19G and G2548A SNPs on blood pressures, anthropometrics, and PLL was not evident. Interestingly, synergistic effect of the LEP and LEPR SNPs was observed as subjects homozygous for all four SNPs studied exhibited significantly higher subcutaneous fat and PLL than those with other genotype combinations. The LEP and LEPR SNPs in this study may not be an obesity marker among Malaysians in this population, but were associated with ethnicity. Our findings suggest that each of these SNPs contributes to minor but significant variation in obesity-related traits and in combination they display synergistic effects on subcutaneous fat and PLL.

Leptin and leptin receptor gene polymorphisms and their association with plasma leptin levels and obesity in a multi-ethnic Malaysian suburban population

PubMed Central

2014-01-01

Background This study was to investigate the prevalence of single nucleotide polymorphisms (SNPs) in leptin gene LEP (A19G and G2548A) and leptin receptor gene LEPR (K109R and Q223R) and their association with fasting plasma leptin level (PLL) and obesity in a Malaysian suburban population in Kampar, Perak. Methods Convenience sampling was performed with informed consents, and the study sample was drawn from patients who were patrons of the Kampar Health Clinic. A total of 408 subjects (mean age, 52.4 ± 13.7 years; 169 men, 239 women; 190 obese, 218 non-obese; 148 Malays, 177 ethnic Chinese, 83 ethnic Indians) participated. Socio-demographic data and anthropometric measurements were taken, and genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results The LEP A19G, G2548A and LEPR K109R, Q223R variant allele frequencies were 0.74, 0.67 and 0.61, 0.79, respectively. The genotype and allele distributions of these gene variants were significantly different among ethnic groups, but not among body mass index (BMI) classes. Subjects with LEPR K109 and Q223 allele had significantly higher systolic blood pressure and adiposity indices after adjustment for ethnicity (higher BMI, total body and subcutaneous fat; lower skeletal muscle percentage). Subjects with LEPR 109R allele had lower PLL than their wild-type allele counterparts. The influence of LEP A19G and G2548A SNPs on blood pressures, anthropometrics, and PLL was not evident. Interestingly, synergistic effect of the LEP and LEPR SNPs was observed as subjects homozygous for all four SNPs studied exhibited significantly higher subcutaneous fat and PLL than those with other genotype combinations. Conclusions The LEP and LEPR SNPs in this study may not be an obesity marker among Malaysians in this population, but were associated with ethnicity. Our findings suggest that each of these SNPs contributes to minor but significant variation in obesity-related traits and in combination they display synergistic effects on subcutaneous fat and PLL. PMID:24947733

Non-synonymous single nucleotide polymorphisms in the watermelon eIF4E gene are closely associated with resistance to zucchini yellow mosaic virus.

PubMed

Ling, Kai-Shu; Harris, Karen R; Meyer, Jenelle D F; Levi, Amnon; Guner, Nihat; Wehner, Todd C; Bendahmane, Abdelhafid; Havey, Michael J

2009-12-01

Zucchini yellow mosaic virus (ZYMV) is one of the most economically important potyviruses infecting cucurbit crops worldwide. Using a candidate gene approach, we cloned and sequenced eIF4E and eIF(iso)4E gene segments in watermelon. Analysis of the nucleotide sequences between the ZYMV-resistant watermelon plant introduction PI 595203 (Citrullus lanatus var. lanatus) and the ZYMV-susceptible watermelon cultivar 'New Hampshire Midget' ('NHM') showed the presence of single nucleotide polymorphisms (SNPs). Initial analysis of the identified SNPs in association studies indicated that SNPs in the eIF4E, but not eIF(iso)4E, were closely associated to the phenotype of ZYMV-resistance in 70 F(2) and 114 BC(1R) progenies. Subsequently, we focused our efforts in obtaining the entire genomic sequence of watermelon eIF4E. Three SNPs were identified between PI 595203 and NHM. One of the SNPs (A241C) was in exon 1 and the other two SNPs (C309A and T554G) were in the first intron of the gene. SNP241 which resulted in an amino acid substitution (proline to threonine) was shown to be located in the critical cap recognition and binding area, similar to that of several plant species resistance to potyviruses. Analysis of a cleaved amplified polymorphism sequence (CAPS) marker derived from this SNP in F(2) and BC(1R) populations demonstrated a cosegregation between the CAPS-2 marker and their ZYMV resistance or susceptibility phenotype. When we investigated whether such SNP mutation in the eIF4E was also conserved in several other PIs of C. lanatus var. citroides, we identified a different SNP (A171G) resulting in another amino acid substitution (D71G) from four ZYMV-resistant C. lanatus var. citroides (PI 244018, PI 482261, PI 482299, and PI 482322). Additional CAPS markers were also identified. Availability of all these CAPS markers will enable marker-aided breeding of watermelon for ZYMV resistance.

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

PubMed Central

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

2017-01-01

Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. Conclusions This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments. PMID:28234981

[Relationship between single nucleotide polymorphisms in thiopurine methyltransferase gene and tolerance to thiopurines in acute leukemia].

PubMed

Ma, Xiao-li; Zhu, Ping; Wu, Min-yuan; Li, Zhi-gang; Hu, Ya-mei

2003-12-01

For the purpose of clarifying the influence of thiopurine methyltransferase (TPMT) gene single nucleotide polymorphisms (SNPs) on the efficacy of thiopurines and risk for its toxicity and therefore improving the safety and efficacy of thiopurines, the authors investigated TPMT genotype in acute leukemia in children who were intolerant to the treatment with 6-mercap topurine (6-MP). TPMT genotype was determined in an unrelated population of 250 Chinese healthy blood donors and 280 children with acute leukemia. TPMT genotyping assay was based on polymerase chain reaction (PCR), restriction digestion of PCR products, denaturing high-performance liquid chromatography (DHPLC) and direct DNA sequencing in the TPMT * 2 (G238C), TPMT * 3A (G460A, A719G) and TPMT * 3C (A719G). There were 10 TPMT * 1/TPMT * 3C heterozygotes in 280 children. The frequency of the polymorphism was 3.6%. All the involved alleles were TPMT * 3C. Of the 160 children acute leukemia evaluated, 45 (26%) were intolerant to 6-MP. Presentations included hepatotoxicity and hematological toxicity. Six out of 45 children were heterozygous, while the other 39 were wild type homozygous. Before dosage adjustments for thiopurine, the hematologic toxicity and hepatotoxicity in TPMT heterozygous individuals occurred more frequently than in homozygous. Therefore, cases of TPMT heterozygotes experienced more missed doses of 6-MP. TPMT genotype is associated with tolerance in acute leukemia in children. The heterozygote individuals have low TPMT activity. Therefore the frequencies of hemtopoietic toxicity and hepatoxicity are high after using 6-MP. Detection of SNPs in the TPMT genes is useful in identifying children before administration of 6-MP.

Single nucleotide polymorphism coverage and inference of N-acetyltransferase-2 acetylator phenotypes in wordwide population groups.

PubMed

Suarez-Kurtz, Guilherme; Fuchshuber-Moraes, Mateus; Struchiner, Claudio J; Parra, Esteban J

2016-08-01

Several algorithms have been proposed to reduce the genotyping effort and cost, while retaining the accuracy of N-acetyltransferase-2 (NAT2) phenotype prediction. Data from the 1000 Genomes (1KG) project and an admixed cohort of Black Brazilians were used to assess the accuracy of NAT2 phenotype prediction using algorithms based on paired single nucleotide polymorphisms (SNPs) (rs1041983 and rs1801280) or a tag SNP (rs1495741). NAT2 haplotypes comprising SNPs rs1801279, rs1041983, rs1801280, rs1799929, rs1799930, rs1208 and rs1799931 were assigned according to the arylamine N-acetyltransferases database. Contingency tables were used to visualize the agreement between the NAT2 acetylator phenotypes on the basis of these haplotypes versus phenotypes inferred by the prediction algorithms. The paired and tag SNP algorithms provided more than 96% agreement with the 7-SNP derived phenotypes in Europeans, East Asians, South Asians and Admixed Americans, but discordance of phenotype prediction occurred in 30.2 and 24.8% 1KG Africans and in 14.4 and 18.6% Black Brazilians, respectively. Paired SNP panel misclassification occurs in carriers of NATs haplotypes *13A (282T alone), *12B (282T and 803G), *6B (590A alone) and *14A (191A alone), whereas haplotype *14, defined by the 191A allele, is the major culprit of misclassification by the tag allele. Both the paired SNP and the tag SNP algorithms may be used, with economy of scale, to infer NAT2 acetylator phenotypes, including the ultra-slow phenotype, in European, East Asian, South Asian and American populations represented in the 1KG cohort. Both algorithms, however, perform poorly in populations of predominant African descent, including admixed African-Americans, African Caribbeans and Black Brazilians.

Radiogenomics Consortium (RGC)

Cancer.gov

The Radiogenomics Consortium's hypothesis is that a cancer patient's likelihood of developing toxicity to radiation therapy is influenced by common genetic variations, such as single nucleotide polymorphisms (SNPs).

Frequency and Distribution of Single-Nucleotide Polymorphisms within mprF in Methicillin-Resistant Staphylococcus aureus Clinical Isolates and Their Role in Cross-Resistance to Daptomycin and Host Defense Antimicrobial Peptides.

PubMed

Bayer, Arnold S; Mishra, Nagendra N; Chen, Liang; Kreiswirth, Barry N; Rubio, Aileen; Yang, Soo-Jin

2015-08-01

MprF is responsible for the lysinylation of phosphatidylglycerol (PG) to synthesize the positively charged phospholipid (PL) species, lysyl-PG (L-PG). It has been proposed that the single-nucleotide polymorphisms (SNPs) within the mprF open reading frame (ORF) are associated with a gain-in-function phenotype in terms of daptomycin resistance in Staphylococcus aureus. (Note that although the official term is daptomycin nonsusceptibility, we use the term daptomycin resistance in this paper for ease of presentation.) Using 22 daptomycin-susceptible (DAP(s))/daptomycin-resistant (DAP(r)) clinical methicillin-resistant S. aureus (MRSA) strain pairs, we assessed (i) the frequencies and distribution of putative mprF gain-in-function SNPs, (ii) the relationships of the SNPs to both daptomycin resistance and cross-resistance to the prototypical endovascular host defense peptide (HDP) thrombin-induced platelet microbicidal protein (tPMP), and (iii) the impact of mprF SNPs on positive surface charge phenotype and modifications of membrane PL profiles. Most of the mprF SNPs identified in our DAP(r) strains were clustered within the two MprF loci, (i) the central bifunctional domain and (ii) the C-terminal synthase domain. Moreover, we were able to correlate the presence and location of mprF SNPs in DAP(r) strains with HDP cross-resistance, positive surface charge, and L-PG profiles. Although DAP(r) strains with mprF SNPs in the bifunctional domain showed higher resistance to tPMPs than DAP(r) strains with SNPs in the synthase domain, this relationship was not observed in positive surface charge assays. These results demonstrated that both charge-mediated and -unrelated mechanisms are involved in DAP resistance and HDP cross-resistance in S. aureus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

PubMed

Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

2018-01-01

Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In general, our results demonstrated the usefulness of Random Forest in combination to other reduction techniques to identify population informative SNPs.

Association of variants in innate immune genes with asthma and eczema

PubMed Central

Sharma, Sunita; Poon, Audrey; Himes, Blanca E.; Lasky-Su, Jessica; Sordillo, Joanne E.; Belanger, Kathleen; Milton, Donald K.; Bracken, Michael B.; Triche, Elizabeth W.; Leaderer, Brian P.; Gold, Diane R.; Litonjua, Augusto A.

2012-01-01

Background The innate immune pathway is important in the pathogenesis of asthma and eczema. However, only a few variants in these genes have been associated with either disease. We investigate the association between polymorphisms of genes in the innate immune pathway with childhood asthma and eczema. In addition, we compare individual associations with those discovered using a multivariate approach. Methods Using a novel method, case control based association testing (C2BAT), 569 single nucleotide polymorphisms (SNPs) in 44 innate immune genes were tested for association with asthma and eczema in children from the Boston Home Allergens and Asthma Study and the Connecticut Childhood Asthma Study. The screening algorithm was used to identify the top SNPs associated with asthma and eczema. We next investigated the interaction of innate immune variants with asthma and eczema risk using Bayesian networks. Results After correction for multiple comparisons, 7 SNPs in 6 genes (CARD25, TGFB1, LY96, ACAA1, DEFB1, and IFNG) were associated with asthma (adjusted p-value<0.02), while 5 SNPs in 3 different genes (CD80, STAT4, and IRAKI) were significantly associated with eczema (adjusted p-value < 0.02). None of these SNPs were associated with both asthma and eczema. Bayesian network analysis identified 4 SNPs that were predictive of asthma and 10 SNPs that predicted eczema. Of the genes identified using Bayesian networks, only CD80 was associated with eczema in the single-SNP study. Using novel methodology that allows for screening and replication in the same population, we have identified associations of innate immune genes with asthma and eczema. Bayesian network analysis suggests that additional SNPs influence disease susceptibility via SNP interactions. Conclusion Our findings suggest that innate immune genes contribute to the pathogenesis of asthma and eczema, and that these diseases likely have different genetic determinants. PMID:22192168

Functional Genomics Analysis of Big Data Identifies Novel Peroxisome Proliferator-Activated Receptor γ Target Single Nucleotide Polymorphisms Showing Association With Cardiometabolic Outcomes.

PubMed

Richardson, Kris; Schnitzler, Gavin R; Lai, Chao-Qiang; Ordovas, Jose M

2015-12-01

Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator-activated receptor γ (PPARγ) that is involved in lipid and glucose metabolism and maintenance of metabolic homeostasis. We used a functional genomics methodology to interrogate human chromatin immunoprecipitation-sequencing, genome-wide association studies, and expression quantitative trait locus data to inform selection of candidate functional single nucleotide polymorphisms (SNPs) falling in PPARγ motifs. We derived 27 328 chromatin immunoprecipitation-sequencing peaks for PPARγ in human adipocytes through meta-analysis of 3 data sets. The PPARγ consensus motif showed greatest enrichment and mapped to 8637 peaks. We identified 146 SNPs in these motifs. This number was significantly less than would be expected by chance, and Inference of Natural Selection from Interspersed Genomically coHerent elemenTs analysis indicated that these motifs are under weak negative selection. A screen of these SNPs against genome-wide association studies for cardiometabolic traits revealed significant enrichment with 16 SNPs. A screen against the MuTHER expression quantitative trait locus data revealed 8 of these were significantly associated with altered gene expression in human adipose, more than would be expected by chance. Several SNPs fall close, or are linked by expression quantitative trait locus to lipid-metabolism loci including CYP26A1. We demonstrated the use of functional genomics to identify SNPs of potential function. Specifically, that SNPs within PPARγ motifs that bind PPARγ in adipocytes are significantly associated with cardiometabolic disease and with the regulation of transcription in adipose. This method may be used to uncover functional SNPs that do not reach significance thresholds in the agnostic approach of genome-wide association studies. © 2015 American Heart Association, Inc.

Association of LMX1A genetic polymorphisms with susceptibility to congenital scoliosis in Chinese Han population.

PubMed

Wu, Nan; Yuan, Suomao; Liu, Jiaqi; Chen, Jun; Fei, Qi; Liu, Sen; Su, Xinlin; Wang, Shengru; Zhang, Jianguo; Li, Shugang; Wang, Yipeng; Qiu, Guixing; Wu, Zhihong

2014-10-01

A genetic association study of single nucleotide polymorphisms (SNPs) for the LMX1A gene with congenital scoliosis (CS) in the Chinese Han population. To determine whether LMX1A genetic polymorphisms are associated with susceptibility to CS. CS is a lateral curvature of the spine due to congenital vertebral defects, whose exact genetic cause has not been well established. The LMX1A gene was suggested as a potential human candidate gene for CS. However, no genetic study of LMX1A in CS has ever been reported. We genotyped 13 SNPs of the LMX1A gene in 154 patients with CS and 144 controls with matched sex and age. After conducting the Hardy-Weinberg equilibrium test, the data of 13 SNPs were analyzed by the allelic and genotypic association with logistic regression analysis. Furthermore, the genotype-phenotype association and haplotype association analysis were also performed. The 13 SNPs of the LMX1A gene met Hardy-Weinberg equilibrium in the controls, which was not in the cases. None of the allelic and genotypic frequencies of these SNPs showed significant difference between case and control groups (P > 0.05). However, the genotypic frequencies of rs1354510 and rs16841013 in the LMX1A gene were associated with CS predisposition in the unconditional logistic regression analysis (P = 0.02 and 0.018, respectively). Genotypic frequencies of 3 SNPs at rs6671290, rs1354510, and rs16841013 were found to exhibit significant differences between patients with CS with failure of formation and the healthy controls (P = 0.019, 0.007, and 0.006, respectively). Besides, in the model analysis by using unconditional logistic regression analysis, the optimized model for the 3 genotypic positive SNPs with failure of formation were rs6671290 (codominant; P = 0.025, Akaike information value = 316.6, Bayesian information criterion = 333.9), rs1354510 (overdominant; P = 0.0017, Akaike information value = 312.1, Bayesian information criterion = 325.9), and rsl6841013 (overdominant; P = 0.0016, Akaike information value = 311.1, Bayesian information criterion = 325), respectively. However, the haplotype distributions in the case group were not significantly different from those of the control group in the 3 haplotype blocks. To our knowledge, this is the first study to identify that the SNPs of the LMX1A gene might be associated with the susceptibility to CS and different clinical phenotypes of CS in the Chinese Han population. 4.

Investigating the association between polymorphisms in connective tissue growth factor and susceptibility to colon carcinoma.

PubMed

Ahmad, Abrar; Askari, Shlear; Befekadu, Rahel; Hahn-Strömberg, Victoria

2015-04-01

There have been numerous studies on the gene expression of connective tissue growth factor (CTGF) in colorectal cancer, however very few have investigated polymorphisms in this gene. The present study aimed to determine whether single nucleotide polymorphisms (SNPs) in the CTGF gene are associated with a higher susceptibility to colon cancer and/or an invasive tumor growth pattern. The CTGF gene was genotyped for seven SNPs (rs6918698, rs1931002, rs9493150, rs12526196, rs12527705, rs9399005 and rs12527379) by pyrosequencing. Formalin‑fixed paraffin‑embedded tissue samples (n=112) from patients diagnosed with colon carcinoma, and an equal number of blood samples from healthy controls, were selected for genomic DNA extraction. The complexity index was measured using images of tumor samples (n=64) stained for cytokeratin‑8. The images were analyzed and correlated with the identified CTGF SNPs and clinicopathological parameters of the patients, including age, gender, tumor penetration, lymph node metastasis, systemic metastasis, differentiation and localization of tumor. It was demonstrated that the frequency of the SNP rs6918698 GG genotype was significantly associated (P=0.05) with an increased risk of colon cancer, as compared with the GC and CC genotypes. The other six SNPs (rs1931002, rs9493150, rs12526196, rs12527705, rs9399005 and rs12527379) exhibited no significant difference in the genotype and allele frequencies between patients diagnosed with colon carcinoma and the normal healthy population. A trend was observed between genotype variation at rs6918698 and the complexity index (P=0.052). The complexity index and genotypes for any of the studied SNPs were not significantly correlated with clinical or pathological parameters of the patients. These results indicate that the rs6918698 GG genotype is associated with an increased risk of developing colon carcinoma, and genetic variations at the rs6918698 are associated with the growth pattern of the tumor. The present results may facilitate the identification of potential biomarkers of the disease in addition to drug targets.

Microsatellite genotyping and genome-wide single nucleotide polymorphism-based indices of Plasmodium falciparum diversity within clinical infections.

PubMed

Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J

2016-05-12

In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P < 0.001). However, the microsatellite analysis revealed that most isolates contained mixed genotypes, even those that had no detectable genome sequence heterogeneity. Random sampling of different numbers of SNPs showed that an F ws index derived from ten or more SNPs with minor allele frequencies of >10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).

Interleukin-10 family cytokines pathway: genetic variants and psoriasis.

PubMed

Galimova, E; Rätsep, R; Traks, T; Kingo, K; Escott-Price, V; Kõks, S

2017-06-01

Interleukin (IL)-10 family cytokines IL-10, IL-19, IL-20 and IL-24 have been implicated in autoimmune diseases and we have previously reported that genetic variants in the IL10 gene cluster were associated with psoriasis. To analyse the relationship between genetic polymorphisms in the IL10 gene cluster and psoriasis. This study also explores whether there are gene-gene interactions among these genetic polymorphisms. A total of 377 patients with psoriasis and 403 matched healthy controls were enrolled to carry out a case-control study for 48 single-nucleotide polymorphisms (SNPs) of the IL10 gene cluster. Genotyping for the SNPs was conducted on the Applied Biosystems 3730 DNA Analyzer using SNPlex ® technology. Generalized multifactor dimensionality reduction (GMDR) analysis was applied to discover a likely gene-gene interaction model among the SNPs. The results showed that the allele distributions of IL10 gene cluster SNPs are significantly different between the case and control groups. Carriers of the IL10 T allele (rs1554286) and the IL20 T allele (rs1400986) conferred protection from psoriasis [odds ratio (OR) = 0·63, corrected P-value (Pc) = 0·007; OR = 0·62, Pc = 0·038, respectively]. GMDR analysis displayed a significant gene-gene interaction between IL10 (rs1554286) and IL20 (rs1518108) variants. The strongest protective effect was found with the block 1 haplotype ACATA in the IL10 gene (Pc = 0·004). This study presents a novel finding that the combination of the two SNPs, IL10 (rs1554286) and IL20 (rs1518108), is associated with a reduced risk of psoriasis. Our results indicate that genetic variants of the immunomodulatory IL10 and IL20 genes may offer a protective effect in Europeans from Russia. Independent studies are required to verify the results and find a possible functional explanation. © 2017 British Association of Dermatologists.

The APOC3 T-455C and C-482T promoter region polymorphisms are not associated with the severity of liver damage independently of PNPLA3 I148M genotype in patients with nonalcoholic fatty liver.

PubMed

Valenti, Luca; Nobili, Valerio; Al-Serri, Ahmad; Rametta, Raffaela; Leathart, Julian B S; Zappa, Marco A; Dongiovanni, Paola; Fracanzani, Anna L; Alterio, Arianna; Roviaro, Giancarlo; Daly, Ann K; Fargion, Silvia; Day, Christopher P

2011-12-01

The T-455C and C-482T APOC3 promoter region polymorphisms (SNPs) have recently been reported to predispose to dyslipidemia, insulin resistance, and nonalcoholic fatty liver disease (NAFLD) in Indian subjects, but the association with liver damage has not been evaluated so far. The aim was to assess the association between APOC3 SNPs and liver damage in Caucasian patients. We considered 437 Italian patients with histological diagnosis of NAFLD (including 137 children, 120 morbid obese) and 316 healthy controls, 71 Italian family trios, and 321 patients from the UK. APOC3 SNPs were determined by sequencing, allele-specific oligonucleotide probes and PCR-restriction fragment length polymorphism analysis, hepatic APOC3 mRNA levels by real-time PCR. APOC3 SNPs were not associated with NAFLD in Italian subjects, although a borderline significance for the transmission of the -455T allele was observed in the family study. Homozygosity for the APOC3 wild-type genotype (APOC3 WT) was associated with a more favorable lipid profile in control subjects, and consistently with lower hepatic APOC3 mRNA levels in obese patients without diabetes. However, APOC3 SNPs, alone or in combination, were not associated with insulin resistance, altered lipid levels, liver enzymes, and with liver damage (severity of steatosis, nonalcoholic steatohepatitis, and moderate/severe fibrosis) in Italian as well as in UK patients, and in the whole cohort. Stratification for the I148M PNPLA3 mutation, associated with the susceptibility to NASH, did not alter the results. APOC3 genotype is not associated with progressive liver damage in Caucasian patients with NAFLD. Copyright © 2011 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Kallikrein 3 and vitamin D receptor polymorphisms: potentials environmental risk factors for prostate cancer

PubMed Central

2014-01-01

Objective To investigate the relationship and interaction of the single nucleotide polymorphisms (SNPs) of KLK3 and VDR and environmental factors with the predisposition to prostate cancer within Chinese population. Methods The comparison between 108 patients and 242 healthy people was carried out by using the TaqMan/MGB Probe Technology to determine the genotypes of KLK3(rs2735839 is located between KLK2 and KLK3) and VDR (rs731236 is located exon 9). Univariate and multivariate logistic regression model were used to assess the connection of genetic polymorphisms and environmental risk factors with PCa by collecting demographic information, as well as BMI, consumption of cigarettes, alcohol, and tea, exercise, and other environmental risk factors. Results The appearing frequencies of AA, AG, and GG genotypes at the SNPs rs2735839 (A/G) for KLK3 were 13.89%, 62.96% and 23.15% in PCa and 37.19%, 44.63%, 18.18% in control, respectively; these two groups are statistically different (P = 0.00). While the appearing frequencies of TT, TC, and CC genotypes at the SNPs rs731236 (T/C) for VDR were 88.89%, 9, 26%, 1.85% and 90.50%, 9.10%, 0.40% in control, respectively, with no significant statistical difference between the two group. The study confirmed decreasing risk in tea drinkers (OR = 0.58, 95% CI = 0.35-0.96). Conclusions Our studies indicate that environmental factor-tea drinking is associated with the development of PCa. The habit of drinking tea is a protective factor against PCa. The SNPs rs2735839 for KLK3 is strongly related to the development of PCa, while the SNPs rs731236 for VDR is not. Virtual slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/9759981571058803. PMID:24755043

Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar).

PubMed

Houston, Ross D; Taggart, John B; Cézard, Timothé; Bekaert, Michaël; Lowe, Natalie R; Downing, Alison; Talbot, Richard; Bishop, Stephen C; Archibald, Alan L; Bron, James E; Penman, David J; Davassi, Alessandro; Brew, Fiona; Tinch, Alan E; Gharbi, Karim; Hamilton, Alastair

2014-02-06

Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in salmonids and in aquaculture breeding programs via genomic selection.

CCDC26, CDKN2BAS, RTEL1 and TERT Polymorphisms in pediatric brain tumor susceptibility.

PubMed

Adel Fahmideh, Maral; Lavebratt, Catharina; Schüz, Joachim; Röösli, Martin; Tynes, Tore; Grotzer, Michael A; Johansen, Christoffer; Kuehni, Claudia E; Lannering, Birgitta; Prochazka, Michaela; Schmidt, Lisbeth S; Feychting, Maria

2015-08-01

The role of genetic polymorphisms in pediatric brain tumor (PBT) etiology is poorly understood. We hypothesized that single nucleotide polymorphisms (SNPs) identified in genome-wide association studies (GWAS) on adult glioma would also be associated with PBT risk. The study is based on the Cefalo study, a population-based multicenter case-control study. Saliva DNA from 245 cases and 489 controls, aged 7-19 years at diagnosis/reference date, was extracted and genotyped for 29 SNPs reported by GWAS to be significantly associated with risk of adult glioma. Data were analyzed using unconditional logistic regression. Stratified analyses were performed for two histological subtypes: astrocytoma alone and the other tumor types combined. The results indicated that four SNPs, CDKN2BAS rs4977756 (p = 0.036), rs1412829 (p = 0.037), rs2157719 (p = 0.018) and rs1063192 (p = 0.021), were associated with an increased susceptibility to PBTs, whereas the TERT rs2736100 was associated with a decreased risk (p = 0.018). Moreover, the stratified analyses showed a decreased risk of astrocytoma associated with RTEL1 rs6089953, rs6010620 and rs2297440 (p trend = 0.022, p trend = 0.042, p trend = 0.029, respectively) as well as an increased risk of this subtype associated with RTEL1 rs4809324 (p trend = 0.033). In addition, SNPs rs10464870 and rs891835 in CCDC26 were associated with an increased risk of non-astrocytoma tumor subtypes (p trend = 0.009, p trend = 0.007, respectively). Our findings indicate that SNPs in CDKN2BAS, TERT, RTEL1 and CCDC26 may be associated with the risk of PBTs. Therefore, we suggest that pediatric and adult brain tumors might share common genetic risk factors and similar etiological pathways. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Associations of ATM Polymorphisms With Survival in Advanced Esophageal Squamous Cell Carcinoma Patients Receiving Radiation Therapy.

PubMed

Du, Zhongli; Zhang, Wencheng; Zhou, Yuling; Yu, Dianke; Chen, Xiabin; Chang, Jiang; Qiao, Yan; Zhang, Meng; Huang, Ying; Wu, Chen; Xiao, Zefen; Tan, Wen; Lin, Dongxin

2015-09-01

To investigate whether single nucleotide polymorphisms (SNPs) in the ataxia telangiectasia mutated (ATM) gene are associated with survival in patients with esophageal squamous cell carcinoma (ESCC) receiving radiation therapy or chemoradiation therapy or surgery only. Four tagSNPs of ATM were genotyped in 412 individuals with clinical stage III or IV ESCC receiving radiation therapy or chemoradiation therapy, and in 388 individuals with stage I, II, or III ESCC treated with surgery only. Overall survival time of ESCC among different genotypes was estimated by Kaplan-Meier plot, and the significance was examined by log-rank test. The hazard ratios (HRs) and 95% confidence intervals (CIs) for death from ESCC among different genotypes were computed by a Cox proportional regression model. We found 2 SNPs, rs664143 and rs664677, associated with survival time of ESCC patients receiving radiation therapy. Individuals with the rs664143A allele had poorer median survival time compared with the rs664143G allele (14.0 vs 20.0 months), with the HR for death being 1.45 (95% CI 1.12-1.89). Individuals with the rs664677C allele also had worse median survival time than those with the rs664677T allele (14.0 vs 23.5 months), with the HR of 1.57 (95% CI 1.18-2.08). Stratified analysis showed that these associations were present in both stage III and IV cancer and different radiation therapy techniques. Significant associations were also found between the SNPs and locosregional progression or progression-free survival. No association between these SNPs and survival time was detected in ESCC patients treated with surgery only. These results suggest that the ATM polymorphisms might serve as independent biomarkers for predicting prognosis in ESCC patients receiving radiation therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar)

PubMed Central

2014-01-01

Background Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. Results SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. Conclusions This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in salmonids and in aquaculture breeding programs via genomic selection. PMID:24524230

Polymorphisms of Interlukin-1β rs16944 confer susceptibility to myelodysplastic syndromes.

PubMed

Yin, Congcong; He, Na; Li, Peng; Zhang, Chen; Yu, Jie; Hua, Mingqiang; Ji, Chunyan; Ma, Daoxin

2016-11-15

Genetic factors have been shown to be associated with Myelodysplastic syndromes (MDS) susceptibility. In recent years, the role of inflammation in the promotion of tumor growth is supported by a broad range of experimental and clinical evidence. But the relationship between polymorphisms in NOD-like receptor protein 3 (NLRP3) inflammasome and MDS is rarely reported. Thus, we conducted a case-control study, and genotyped five single nucleotide polymorphisms (SNPs) (NLRP3, IL-1β, IL-18, CARD8, and NF-κB) in MDS patients and healthy controls. The association of different genotypes with patient characteristics was analyzed. Comparing MDS patients with controls, GG genotype of IL-1β (rs16944) was observed to be associated with a significantly increased risk of MDS 78/166 (48.8%) vs 26/96 (27.0%), OR=2.1, CI (1.0-4.4). No significant association was identified regarding the rest of investigated polymorphisms and MDS susceptibility. Complex karyotypes were more frequent in patients with GG genotype of IL-1β (rs16944). Patients with IL-1β polymorphisms (rs16944) GG and GA had lower hemoglobin than those without. Patients with IL-1β polymorphisms (rs16944) GG had higher IPSS scores than those without IL-1β polymorphisms. In conclusion, our present data shows that the IL-1β polymorphisms (rs16944) GG were frequently occurred in MDS. IL-1β (rs16944) GG genotype might serve as a novel biomarker and potential targets for MDS. Copyright © 2016 Elsevier Inc. All rights reserved.

Polymorphism in exons of the myostatin gene and its relationship with body weight traits in the Bian chicken.

PubMed

Zhang, Genxi; Ding, Fuxiang; Wang, Jinyu; Dai, Guojun; Xie, Kaizhou; Zhang, Lijun; Wang, Wei; Zhou, Shenghua

2011-02-01

In our research, single nucleotide polymorphisms (SNPs) of exon regions of the myostatin gene were detected by PCR-SSCP in the Bian chicken and three reference chicken populations (Jinghai, Youxi, and Arbor Acre). Four novel SNPs (G2283A, C7552T, C7638T, and T7661A) were detected. The findings from the least square means showed that Bian chickens with EE and DE genotypes had significantly higher body weight, at 6-18 weeks of age, than those of the DD genotype (P < 0.05). The results suggest that the mutation G2283A, detected in exon 1, has potential as a genetic marker for body weight traits in the Bian chicken.

Genomic Variability of Serial Human Isolates of Salmonella enterica Serovar Typhimurium Associated with Prolonged Carriage.

PubMed

Octavia, Sophie; Wang, Qinning; Tanaka, Mark M; Sintchenko, Vitali; Lan, Ruiting

2015-11-01

Salmonella enterica serovar Typhimurium is an important foodborne human pathogen that often causes self-limiting but severe gastroenteritis. Prolonged excretion of S. Typhimurium after the infection can lead to secondary transmissions. However, little is known about within-host genomic variation in bacteria associated with asymptomatic shedding. Genomes of 35 longitudinal isolates of S. Typhimurium recovered from 11 patients (children and adults) with culture-confirmed gastroenteritis were sequenced. There were three or four isolates obtained from each patient. Single nucleotide polymorphisms (SNPs) were analyzed in these isolates, which were recovered between 1 and 279 days after the initial diagnosis. Limited genomic variation (5 SNPs or fewer) was associated with short- and long-term carriage of S. Typhimurium. None of the isolates was shown to be due to reinfection. SNPs occurred randomly, and the majority of the SNPs were nonsynonymous. Two nonsense mutations were observed. A nonsense mutation in flhC rendered the isolate nonmotile, whereas the significance of a nonsense mutation in yihV is unknown. The estimated mutation rate is 1.49 × 10(-6) substitution per site per year. S. Typhimurium isolates excreted in stools following acute gastroenteritis in children and adults demonstrated limited genomic variability over time, regardless of the duration of carriage. These findings have important implications for the detection of possible transmission events suspected by public health genomic surveillance of S. Typhimurium infections. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

USDA-ARS?s Scientific Manuscript database

Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

Connecting Common Genetic Polymorphisms to Protein Function: A Modular Project Sequence for Lecture or Lab

ERIC Educational Resources Information Center

Berndsen, Christopher E.; Young, Byron H.; McCormick, Quinlin J.; Enke, Raymond A.

2016-01-01

Single nucleotide polymorphisms (SNPs) in DNA can result in phenotypes where the biochemical basis may not be clear due to the lack of protein structures. With the growing number of modeling and simulation software available on the internet, students can now participate in determining how small changes in genetic information impact cellular…

The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study

USDA-ARS?s Scientific Manuscript database

Background-Low high-density lipoprotein cholesterol (HDL-C) is associated with an increased risk for atherosclerosis and concentrations are modulated by genetic and environmental factors such as smoking. Objective- To assess whether the association of common single nucleotide polymorphisms (SNPs...

Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

USDA-ARS?s Scientific Manuscript database

Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

Vitamin D, Vitamin D Receptor Polymorphisms and Breast Cancer Aggressiveness in African American and European American Women

DTIC Science & Technology

2011-05-01

we investigated SNPs in VDR and in key vitamin D metabolizing genes CYP27B1 and CYP24A1 in relation to breast cancer risk in AA and EA women. We... SNP . SNPs with poor clustering or excessive heterozygosity (n=3) and samples with lower call rate than 85% were removed (n=20). Among 5% blind...mL increase in 25OHD was associated with a 64% lower odds of having TNBC (OR=0.36, 95% CI=0.22-0.56). In AAs 4 VDR SNPs were associated with BC risk

Genome-wide DNA polymorphism in the indica rice varieties RGD-7S and Taifeng B as revealed by whole genome re-sequencing.

PubMed

Fu, Chong-Yun; Liu, Wu-Ge; Liu, Di-Lin; Li, Ji-Hua; Zhu, Man-Shan; Liao, Yi-Long; Liu, Zhen-Rong; Zeng, Xue-Qin; Wang, Feng

2016-03-01

Next-generation sequencing technologies provide opportunities to further understand genetic variation, even within closely related cultivars. We performed whole genome resequencing of two elite indica rice varieties, RGD-7S and Taifeng B, whose F1 progeny showed hybrid weakness and hybrid vigor when grown in the early- and late-cropping seasons, respectively. Approximately 150 million 100-bp pair-end reads were generated, which covered ∼86% of the rice (Oryza sativa L. japonica 'Nipponbare') reference genome. A total of 2,758,740 polymorphic sites including 2,408,845 SNPs and 349,895 InDels were detected in RGD-7S and Taifeng B, respectively. Applying stringent parameters, we identified 961,791 SNPs and 46,640 InDels between RGD-7S and Taifeng B (RGD-7S/Taifeng B). The density of DNA polymorphisms was 256.8 SNPs and 12.5 InDels per 100 kb for RGD-7S/Taifeng B. Copy number variations (CNVs) were also investigated. In RGD-7S, 1989 of 2727 CNVs were overlapped in 218 genes, and 1231 of 2010 CNVs were annotated in 175 genes in Taifeng B. In addition, we verified a subset of InDels in the interval of hybrid weakness genes, Hw3 and Hw4, and obtained some polymorphic InDel markers, which will provide a sound foundation for cloning hybrid weakness genes. Analysis of genomic variations will also contribute to understanding the genetic basis of hybrid weakness and heterosis.

Significance of neurexin and neuroligin polymorphisms in regulating risk of Hirschsprung's disease.

PubMed

Li, Yanhong; Liu, Hui; Dong, Yubin

2018-06-01

By performing a basic case-control study among a Chinese population, the aims of this study were to explore if single nucleotide polymorphisms (SNPs) within neurexin and neuroligin were associated with susceptibility to Hirschsprung's disease (HD). Eleven SNPs within neurexin and neuroligin were selected in this basic case-control study, and this study recruited 210 children with HD and 187 healthy children. The t-test and Χ 2 test were used to find the difference between case and control in their clinical variables. OR and 95% CI were used to assess the association between HD susceptibility and neurexin/neuroligin polymorphisms/haplotypes. Several SNPs were significantly associated with altered risk of HD in the Chinese Han population, including rs1421589 within NRXN1 , rs11795613 and rs4844285 within NLGN3, as well as rs5961397, rs7157669 and rs724373 within NLGX4X (all P<0.05). Further studies presented that the effects of rs1421589 within NRXN1 , rs4844285 and rs11795613 within NLGN3 , as well as rs5961397 within NLGX4X on HD phenotypes were also statistically significant (all P<0.05). Conclusively, the polymorphisms and haplotypes situated within neurexin and neuroligin were markedly associated with the onset of HD, implying that mutations of neurexin and neuroligin might serve as the treatment target for HD for the Chinese children. © American Federation for Medical Research (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Exploring associations between taste perception, oral anatomy and polymorphisms in the carbonic anhydrase (gustin) gene CA6.

PubMed

Feeney, Emma L; Hayes, John E

2014-04-10

Recent reports suggest that polymorphisms in the carbonic anhydrase gene CA6 (also known as gustin) may explain additional variation in the bitterness of 6-n-propylthiouracil beyond that explained by variation in the bitter receptor gene TAS2R38. CA6 (gustin) has been implicated in taste bud function and salivary buffer capacity. In the present study we examined associations between polymorphisms in the CA6 gene with salt and bitter taste perception, and oral anatomy. 243 subjects (146 female) aged 18-45 rated the intensity of five concentrations of 6-n-propylthiouracil and NaCl on a generalized Labeled Magnitude Scale (gLMS) in duplicate and one concentration of potassium chloride (KCl). Using salivary DNA, we examined 12 SNPs within CA6 in relation to taste intensity and number of fungiform papillae. We observed no difference in bitter taste perception from 6-n-propylthiouracil (PROP) or from potassium chloride for any of the SNPs examined. Perceived saltiness of NaCl on the other hand was significantly associated with a number of CA6 polymorphisms, and particularly rs3737665. Nonetheless, FP density did not vary between alleles of rs3737665, nor with any of the other CA6 SNPs. Also, we fail to find any evidence that CA6 effects on taste perception are due to differences in fungiform papilla number. Additional work is needed to confirm whether variations within the CA6 gene may be responsible for differences in salt taste perception. Copyright © 2014 Elsevier Inc. All rights reserved.