The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet

ERIC Educational Resources Information Center

Dunlap, Dacey; Patrick, Patricia

2012-01-01

During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…

An algorithm for converting a virtual-bond chain into a complete polypeptide backbone chain

NASA Technical Reports Server (NTRS)

Luo, N.; Shibata, M.; Rein, R.

1991-01-01

A systematic analysis is presented of the algorithm for converting a virtual-bond chain, defined by the coordinates of the alpha-carbons of a given protein, into a complete polypeptide backbone. An alternative algorithm, based upon the same set of geometric parameters used in the Purisima-Scheraga algorithm but with a different "linkage map" of the algorithmic procedures, is proposed. The global virtual-bond chain geometric constraints are more easily separable from the loal peptide geometric and energetic constraints derived from, for example, the Ramachandran criterion, within the framework of this approach.

Understanding disordered and unfolded proteins using single-molecule FRET and polymer theory.

PubMed

Hofmann, Hagen

2016-11-17

Understanding protein folding and the functional properties of intrinsically disordered proteins (IDPs) requires detailed knowledge of the forces that act in polypeptide chains. These forces determine the dimensions and dynamics of unfolded and disordered proteins and have been suggested to impact processes such as the coupled binding and folding of IDPs, or the rate of protein folding reactions. Much of the progress in understanding the physical and chemical properties of unfolded and intrinsically disordered polypeptide chains has been made possible by the recent developments in single-molecule fluorescence techniques. However, the interpretation of the experimental results requires concepts from polymer physics in order to be understood. Here, I review some of the theories used to describe the dimensions of unfolded polypeptide chains under varying solvent conditions together with their more recent application to experimental data.

Repetition as the essence of life on this earth: music and genes.

PubMed

Ohno, S

1987-01-01

In prebiotic nucleic acid replication, templates appear to have been in short supply. A single round of tandem duplication of existing oligomers assured progressive extension of templates to the length adequate for encoding of polypeptide chains. Thus, the first set of coding sequences had to be repeats of base oligomers encoding polypeptide chains of various periodicities. On one hand, the readiness of these periodical polypeptide chains to assume alpha-helical and/or beta-sheet secondary structures contributed to the extremely rapid initial functional diversification of these polypeptide chains. It would be recalled that most, if not all, of the sugar-metabolizing enzymes had already achieved the inviolable functional competence before the division of prokaryotes from eukaryotes. On the other hand, a certain (dipeptidic?) of the peptidic periodicities was apparently chosen as the timekeeping unit by the biological clock. Musical compositions too apparently evolved originally as a timekeeping device. Accordingly, repetitiousness is evident in all musical compositions. Evolution of musical compositions from the early Baroque to the late Romantic parallels that of coding sequences from rather exact repeats of base oligomers to more complex modern coding sequences in which repetitious elements are less conspicuous and more varied. Inasmuch as the earth is governed by the hierarchy of periodicities (days, months and years), such reliance on periodicities is rather expected.

The Generation of Dehydroalanine Residues in Protonated Polypeptides: Ion/Ion Reactions for Introducing Selective Cleavages

NASA Astrophysics Data System (ADS)

Peng, Zhou; Bu, Jiexun; McLuckey, Scott A.

2017-09-01

We examine a gas-phase approach for converting a subset of amino acid residues in polypeptide cations to dehydroalanine (Dha). Subsequent activation of the modified polypeptide ions gives rise to specific cleavage N-terminal to the Dha residue. This process allows for the incorporation of selective cleavages in the structural characterization of polypeptide ions. An ion/ion reaction within the mass spectrometer between a multiply protonated polypeptide and the sulfate radical anion introduces a radical site into the multiply protonated polypeptide reactant. Subsequent collisional activation of the polypeptide radical cation gives rise to radical side chain loss from one of several particular amino acid side chains (e.g., leucine, asparagine, lysine, glutamine, and glutamic acid) to yield a Dha residue. The Dha residues facilitate preferential backbone cleavages to produce signature c- and z-ions, demonstrated with cations derived from melittin, mechano growth factor (MGF), and ubiquitin. The efficiencies for radical side chain loss and for subsequent generation of specific c- and z-ions have been examined as functions of precursor ion charge state and activation conditions using cations of ubiquitin as a model for a small protein. It is noted that these efficiencies are not strongly dependent on ion trap collisional activation conditions but are sensitive to precursor ion charge state. Moderate to low charge states show the greatest overall yields for the specific Dha cleavages, whereas small molecule losses (e.g., water/ammonia) dominate at the lowest charge states and proton catalyzed amide bond cleavages that give rise to b- and y-ions tend to dominate at high charge states. [Figure not available: see fulltext.

Normal and reversed supramolecular chirality of insulin fibrils probed by vibrational circular dichroism at the protofilament level of fibril structure.

PubMed

Kurouski, Dmitry; Dukor, Rina K; Lu, Xuefang; Nafie, Laurence A; Lednev, Igor K

2012-08-08

Fibrils are β-sheet-rich aggregates that are generally composed of several protofibrils and may adopt variable morphologies, such as twisted ribbons or flat-like sheets. This polymorphism is observed for many different amyloid associated proteins and polypeptides. In a previous study we proposed the existence of another level of amyloid polymorphism, namely, that associated with fibril supramolecular chirality. Two chiral polymorphs of insulin, which can be controllably grown by means of small pH variations, exhibit opposite signs of vibrational circular dichroism (VCD) spectra. Herein, using atomic force microscopy (AFM) and scanning electron microscopy (SEM), we demonstrate that indeed VCD supramolecular chirality is correlated not only by the apparent fibril handedness but also by the sense of supramolecular chirality from a deeper level of chiral organization at the protofilament level of fibril structure. Our microscopic examination indicates that normal VCD fibrils have a left-handed twist, whereas reversed VCD fibrils are flat-like aggregates with no obvious helical twist as imaged by atomic force microscopy or scanning electron microscopy. A scheme is proposed consistent with observed data that features a dynamic equilibrium controlled by pH at the protofilament level between left- and right-twist fibril structures with distinctly different aggregation pathways for left- and right-twisted protofilaments. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Polycondensation of Asparagine-comprising Dipeptides in Aqueous Media-A Simulation of Polypeptide Formation in Primordial Earth Hydrosphere

NASA Astrophysics Data System (ADS)

Munegumi, Toratane; Tanikawa, Naoya

2017-09-01

Asparagine and aspartic acid might have mutually transformed in the primordial hydrosphere of the earth, if ammonia and aspartic acid had existed in equilibrium. These amino acids seem to contribute to polypeptides, while the simple amino acids glycine and alanine easily form cyclic dipeptides and do not achieve long peptide chains. Asparagine-comprising dipeptides contribute some kinds of activation forms of dipeptides because these can polymerize faster than asparagine only. The new finding of polypeptide formation suggests a pathway of sequential polypeptides to evolve a diversity of polypeptides.

Polycondensation of Asparagine-comprising Dipeptides in Aqueous Media-A Simulation of Polypeptide Formation in Primordial Earth Hydrosphere.

PubMed

Munegumi, Toratane; Tanikawa, Naoya

2017-09-01

Asparagine and aspartic acid might have mutually transformed in the primordial hydrosphere of the earth, if ammonia and aspartic acid had existed in equilibrium. These amino acids seem to contribute to polypeptides, while the simple amino acids glycine and alanine easily form cyclic dipeptides and do not achieve long peptide chains. Asparagine-comprising dipeptides contribute some kinds of activation forms of dipeptides because these can polymerize faster than asparagine only. The new finding of polypeptide formation suggests a pathway of sequential polypeptides to evolve a diversity of polypeptides.

Identification of the gene for fly non-muscle myosin heavy chain: Drosophila myosin heavy chains are encoded by a gene family.

PubMed Central

Kiehart, D P; Lutz, M S; Chan, D; Ketchum, A S; Laymon, R A; Nguyen, B; Goldstein, L S

1989-01-01

In contrast to vertebrate species Drosophila has a single myosin heavy chain gene that apparently encodes all sarcomeric heavy chain polypeptides. Flies also contain a cytoplasmic myosin heavy chain polypeptide that by immunological and peptide mapping criteria is clearly different from the major thoracic muscle isoform. Here, we identify the gene that encodes this cytoplasmic isoform and demonstrate that it is distinct from the muscle myosin heavy chain gene. Thus, fly myosin heavy chains are the products of a gene family. Our data suggest that the contractile function required to power myosin based movement in non-muscle cells requires myosin diversity beyond that available in a single heavy chain gene. In addition, we show, that accumulation of cytoplasmic myosin transcripts is regulated in a developmental stage specific fashion, consistent with a key role for this protein in the movements of early embryogenesis. Images PMID:2498088

Homoallylglycine residues are superior precursors to orthogonally modified thioether containing polypeptides.

PubMed

Perlin, Pesach; Gharakhanian, Eric G; Deming, Timothy J

2018-06-12

Homoallylglycine N-carboxyanhydride, Hag NCA, monomers were synthesized and used to prepare polypeptides containing Hag segments with controllable lengths of up to 245 repeats. Poly(l-homoallylglycine), GHA, was found to adopt an α-helical conformation, which provided good solubility in organic solvents and allowed high yield functionalization of its alkene side-chains via radical promoted addition of thiols. The conformations of these derivatives were shown to be switchable between α-helical and disordered states in aqueous media using thioether alkylation or oxidation reactions. Incorporation of GHA segments into block copolymers with poly(l-methionine), M, segments provided a means to orthogonally modify thioether side-chains different ways in separate copolypeptide domains. This approach allows preparation of functional polypeptides containing discrete domains of oxidized and alkylated thioether containing residues, where chain conformation and functionality of each domain can be independently modified.

Anderson transition in a multiply-twisted helix.

PubMed

Ugajin, R

2001-06-01

We investigated the Anderson transition in a multiply-twisted helix in which a helical chain of components, i.e., atoms or nanoclusters, is twisted to produce a doubly-twisted helix, which itself can be twisted to produce a triply-twisted helix, and so on, in which there are couplings between adjacent rounds of helices. As the strength of the on-site random potentials increases, an Anderson transition occurs, suggesting that the number of dimensions is 3 for electrons running along the multiply-twisted helix when the couplings between adjacent rounds are strong enough. If the couplings are weakened, the dimensionality becomes less, resulting in localization of electrons. The effect of random connections between adjacent rounds of helices and random magnetic fields that thread the structure is analyzed using the spectral statistics of a quantum particle.

The role of protein homochirality in shaping the energy landscape of folding

PubMed Central

Nanda, Vikas; Andrianarijaona, Aina; Narayanan, Chitra

2007-01-01

The homochirality, or isotacticity, of the natural amino acids facilitates the formation of regular secondary structures such as α-helices and β-sheets. However, many examples exist in nature where novel polypeptide topologies use both l- and d-amino acids. In this study, we explore how stereochemistry of the polypeptide backbone influences basic properties such as compactness and the size of fold space by simulating both lattice and all-atom polypeptide chains. We formulate a rectangular lattice chain model in both two and three dimensions, where monomers are chiral, having the effect of restricting local conformation. Syndiotactic chains with alternating chirality of adjacent monomers have a very large ensemble of accessible conformations characterized predominantly by extended structures. Isotactic chains on the other hand, have far fewer possible conformations and a significant fraction of these are compact. Syndiotactic chains are often unable to access maximally compact states available to their isotactic counterparts of the same length. Similar features are observed in all-atom models of isotactic versus syndiotactic polyalanine. Our results suggest that protein isotacticity has evolved to increase the enthalpy of chain collapse by facilitating compact helical states and to reduce the entropic cost of folding by restricting the size of the unfolded ensemble of competing states. PMID:17600146

Automated main-chain model building by template matching and iterative fragment extension.

PubMed

Terwilliger, Thomas C

2003-01-01

An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.

Slavnov and Gaudin-Korepin Formulas for Models without U(1) Symmetry: the Twisted XXX Chain

NASA Astrophysics Data System (ADS)

Belliard, Samuel; Pimenta, Rodrigo A.

2015-12-01

We consider the XXX spin-1/2 Heisenberg chain on the circle with an arbitrary twist. We characterize its spectral problem using the modified algebraic Bethe anstaz and study the scalar product between the Bethe vector and its dual. We obtain modified Slavnov and Gaudin-Korepin formulas for the model. Thus we provide a first example of such formulas for quantum integrable models without U(1) symmetry characterized by an inhomogenous Baxter T-Q equation.

Tracking polypeptide folds on the free energy surface: effects of the chain length and sequence.

PubMed

Brukhno, Andrey V; Ricchiuto, Piero; Auer, Stefan

2012-07-26

Characterization of the folding transition in polypeptides and assessing the thermodynamic stability of their structured folds are of primary importance for approaching the problem of protein folding. We use molecular dynamics simulations for a coarse grained polypeptide model in order to (1) obtain the equilibrium conformation diagram of homopolypeptides in a broad range of the chain lengths, N = 10, ..., 100, and temperatures, T (in a multicanonical ensemble), and (2) determine free energy profiles (FEPs) projected onto an optimal, so-called "natural", reaction coordinate that preserves the height of barriers and the diffusion coefficients on the underlying free energy hyper-surface. We then address the following fundamental questions. (i) How well does a kinetically determined free energy landscape of a single chain represent the polypeptide equilibrium (ensemble) behavior? In particular, under which conditions might the correspondence be lost, and what are the possible implications for the folding processes? (ii) How does the free energy landscape depend on the chain length (homopolypeptides) and the monomer interaction sequence (heteropolypeptides)? Our data reveal that at low T values equilibrium structures adopted by relatively short homopolypeptides (N < 60) are dominated by α-helical folds which correspond to the primary and secondary minima of the FEP. In contrast, longer homopolypeptides (N > 70), upon quasi-equilibrium cooling, fold preferentially in β-bundles with small helical portions, while the FEPs exhibit no distinct global minima. Moreover, subject to the choice of the initial configuration, at sufficiently low T, essentially metastable structures can be found and prevail far from the true thermodynamic equilibrium. We also show that, by sequence-enabling the polypeptide model, it is possible to restrict the chain to a very specific part of the configuration space, which results in substantial simplification and smoothing of the free energy landscape as compared to the case of the corresponding homopolypeptide.

Protein amyloids develop an intrinsic fluorescence signature during aggregation†

PubMed Central

Chan, Fiona T. S.; Kaminski Schierle, Gabriele S.; Kumita, Janet R.; Bertoncini, Carlos W.; Dobson, Christopher M.; Kaminski, Clemens F.

2017-01-01

We report observations of an intrinsic fluorescence in the visible range, which develops during the aggregation of a range of polypeptides, including the disease-related human peptides amyloid-β(1–40) and (1–42), lysozyme and tau. Characteristic fluorescence properties such as the emission lifetime and spectra were determined experimentally. This intrinsic fluorescence is independent of the presence of aromatic side-chain residues within the polypeptide structure. Rather, it appears to result from electronic levels that become available when the polypeptide chain folds into a cross-β sheet scaffold similar to what has been reported to take place in crystals. We use these findings to quantify protein aggregation in vitro by fluorescence imaging in a label-free manner. PMID:23420088

Free energy landscapes of short peptide chains using adaptively biased molecular dynamics

NASA Astrophysics Data System (ADS)

Karpusenka, Vadzim; Babin, Volodymyr; Roland, Christopher; Sagui, Celeste

2009-03-01

We present the results of a computational study of the free energy landscapes of short polypeptide chains, as a function of several reaction coordinates meant to distinguish between several known types of helices. The free energy landscapes were calculated using the recently developed adaptively biased molecular dynamics method followed up with equilibrium ``umbrella correction'' runs. Specific polypeptides investigated include small chains of pure and mixed alanine, glutamate, leucine, lysine and methionine (all amino acids with strong helix-forming propensities), as well as glycine, proline(having a low helix forming propensities), tyrosine, serine and arginine. Our results are consistent with the existing experimental and other theoretical evidence.

Tandem catalysis for the preparation of cylindrical polypeptide brushes.

PubMed

Rhodes, Allison J; Deming, Timothy J

2012-11-28

Here, we report a method for synthesis of cylindrical copolypeptide brushes via N-carboxyanhydride (NCA) polymerization utilizing a new tandem catalysis approach that allows preparation of brushes with controlled segment lengths in a straightforward, one-pot procedure requiring no intermediate isolation or purification steps. To obtain high-density brush copolypeptides, we used a "grafting from" approach where alloc-α-aminoamide groups were installed onto the side chains of NCAs to serve as masked initiators. These groups were inert during cobalt-initiated NCA polymerization and gave allyloxycarbonyl-α-aminoamide-substituted polypeptide main chains. The alloc-α-aminoamide groups were then activated in situ using nickel to generate initiators for growth of side-chain brush segments. This use of stepwise tandem cobalt and nickel catalysis was found to be an efficient method for preparation of high-chain-density, cylindrical copolypeptide brushes, where both the main chains and side chains can be prepared with controlled segment lengths.

Quantitative assessments of the distinct contributions of polypeptide backbone amides versus sidechain groups to chain expansion via chemical denaturation

PubMed Central

Holehouse, Alex S.; Garai, Kanchan; Lyle, Nicholas; Vitalis, Andreas; Pappu, Rohit V.

2015-01-01

In aqueous solutions with high concentrations of chemical denaturants such as urea and guanidinium chloride (GdmCl) proteins expand to populate heterogeneous conformational ensembles. These denaturing environments are thought to be good solvents for generic protein sequences because properties of conformational distributions align with those of canonical random coils. Previous studies showed that water is a poor solvent for polypeptide backbones and therefore backbones form collapsed globular structures in aqueous solvents. Here, we ask if polypeptide backbones can intrinsically undergo the requisite chain expansion in aqueous solutions with high concentrations of urea and GdmCl. We answer this question using a combination of molecular dynamics simulations and fluorescence correlation spectroscopy. We find that the degree of backbone expansion is minimal in aqueous solutions with high concentrations denaturants. Instead, polypeptide backbones sample conformations that are denaturant-specific mixtures of coils and globules, with a persistent preference for globules. Therefore, typical denaturing environments cannot be classified as good solvents for polypeptide backbones. How then do generic protein sequences expand in denaturing environments? To answer this question, we investigated the effects of sidechains using simulations of two archetypal sequences with amino acid compositions that are mixtures of charged, hydrophobic, and polar groups. We find that sidechains lower the effective concentration of backbone amides in water leading to an intrinsic expansion of polypeptide backbones in the absence of denaturants. Additional dilution of the effective concentration of backbone amides is achieved through preferential interactions with denaturants. These effects lead to conformational statistics in denaturing environments that are congruent with those of canonical random coils. Our results highlight the role of sidechain-mediated interactions as determinants of the conformational properties of unfolded states in water and in influencing chain expansion upon denaturation. PMID:25664638

Origin of chiral interactions in cellulose supra-molecular microfibrils.

PubMed

Khandelwal, Mudrika; Windle, Alan

2014-06-15

The formation of a chiral-nematic phase from cellulose nanowhiskers has been frequently reported in the literature. The most popular theory used to explain the chiral interactions is that of twisted morphology of cellulose nanowhiskers. Two possible origins of twist have been suggested: the intrinsic chirality of cellulose chains and result of interaction of chiral surfaces. High resolution SEM and AFM have been used to locate twists in cellulose microfibrils and nanowhiskers. The origin of the twisted morphology in cellulose microfibrils has been studied with reference to the protein aggregation theory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular structure of the pyruvate dehydrogenase complex from Escherichia coli K-12.

PubMed

Vogel, O; Hoehn, B; Henning, U

1972-06-01

The pyruvate dehydrogenase core complex from E. coli K-12, defined as the multienzyme complex that can be obtained with a unique polypeptide chain composition, has a molecular weight of 3.75 x 10(6). All results obtained agree with the following numerology. The core complex consists of 48 polypeptide chains. There are 16 chains (molecular weight = 100,000) of the pyruvate dehydrogenase component, 16 chains (molecular weight = 80,000) of the dihydrolipoamide dehydrogenase component, and 16 chains (molecular weight = 56,000) of the dihydrolipoamide dehydrogenase component. Usually, but not always, pyruvate dehydrogenase complex is produced in vivo containing at least 2-3 mol more of dimers of the pyruvate dehydrogenase component than the stoichiometric ratio with respect to the core complex. This "excess" component is bound differently than are the eight dimers in the core complex.

Fluorescence probe of polypeptide conformational dynamics in gas phase and in solution

NASA Astrophysics Data System (ADS)

Iavarone, Anthony T.; Meinen, Jan; Schulze, Susanne; Parks, Joel H.

2006-07-01

Fluorescence measurements of polypeptides derivatized with the fluorescent dye BODIPY TMR have been used to probe the polypeptide conformational dynamics as a function of temperature and charge state. Measurements of (BODIPY TMR)-[Pro]n-Arg-Trp and (BODIPY TMR)-[Gly-Ser]m-Arg-Trp have been performed for charge states 1+ and 2+ of n = 4 and 10 and m = 2 and 5. The 2+ charge states of both of these polypeptides exhibit similar temperature dependences for equal chain lengths (n = 4, m = 2 and n = 10, m = 5) and suggest conformations dominated by Coulomb repulsion. In the absence of such Coulomb repulsion, the 1+ charge state conformations appear to be characterized by the flexibility of the polypeptide chain for which [Gly-Ser]m > [Pro]n. Comparisons of these gas phase polypeptide measurements with corresponding measurements in solution provide a direct measure of the effects of solvent on the conformational dynamics. The change in fluorescence as a function of temperature in the gas phase is two orders of magnitude greater than that in solution, a dramatic result we attribute to the restrictions on intramolecular dynamics imposed by diffusion-limited kinetics and the lack of shielding by solvent. Measurements were also made of unsolvated Pron peptides without the tryptophan (Trp) residue to isolate the interaction of the fluorescent dye with charges.

Molecular Structure of the Pyruvate Dehydrogenase Complex from Escherichia coli K-12

PubMed Central

Vogel, Otto; Hoehn, Barbara; Henning, Ulf

1972-01-01

The pyruvate dehydrogenase core complex from E. coli K-12, defined as the multienzyme complex that can be obtained with a unique polypeptide chain composition, has a molecular weight of 3.75 × 106. All results obtained agree with the following numerology. The core complex consists of 48 polypeptide chains. There are 16 chains (molecular weight = 100,000) of the pyruvate dehydrogenase component, 16 chains (molecular weight = 80,000) of the dihydrolipoamide dehydrogenase component, and 16 chains (molecular weight = 56,000) of the dihydrolipoamide dehydrogenase component. Usually, but not always, pyruvate dehydrogenase complex is produced in vivo containing at least 2-3 mol more of dimers of the pyruvate dehydrogenase component than the stoichiometric ratio with respect to the core complex. This “excess” component is bound differently than are the eight dimers in the core complex. Images PMID:4556465

The topological basis expression of four-qubit XXZ spin chain with twist boundary condition

NASA Astrophysics Data System (ADS)

Du, Guijiao; Xue, Kang; Zhou, Chengcheng; Sun, Chunfang; Wang, Gangcheng

2013-07-01

We investigate the XXZ model's characteristic with the twisted boundary condition and the topological basis expression. Owing to twist boundary condition, the ground state energy will changing back and forth between E_{13} and E_{15} by modulate the parameter φ . By using TLA generators, the XXZ model's Hamiltonian can be constructed. All the eigenstates can be expressed by topological basis, and the whole of eigenstates' entanglement are maximally entangle states (Q(|φ _i> )=1).

Chirality and chiroptical properties of amyloid fibrils.

PubMed

Dzwolak, Wojciech

2014-09-01

Chirality of amyloid fibrils-linear beta-sheet-rich aggregates of misfolded protein chains-often manifests in morphological traits such as helical twist visible in atomic force microscopy and in chiroptical properties accessible to vibrational circular dichroism (VCD). According to recent studies the relationship between molecular chirality of polypeptide building blocks and superstructural chirality of amyloid fibrils may be more intricate and less deterministic than previously assumed. Several puzzling experimental findings have put into question earlier intuitive ideas on: 1) the bottom-up chirality transfer upon amyloidogenic self-assembly, and 2) the structural origins of chiroptical properties of protein aggregates. For example, removal of a single amino acid residue from an amyloidogenic all-L peptide was shown to reverse handedness of fibrils. On the other hand, certain types of amyloid aggregates revealed surprisingly strong VCD spectra with the sign and shape dependent on the conditions of fibrillation. Hence, microscopic and chiroptical studies have highlighted chirality as one more aspect of polymorphism of amyloid fibrils. This brief review is intended to outline the current state of research on amyloid-like fibrils from the perspective of their structural and superstructural chirality and chiroptical properties. © 2014 Wiley Periodicals, Inc.

Probing the organic-mineral interface at the molecular level in model biominerals.

PubMed

Metzler, Rebecca A; Kim, Il Won; Delak, Katya; Evans, John Spencer; Zhou, Dong; Beniash, Elia; Wilt, Fred; Abrecht, Mike; Chiou, Jau-Wern; Guo, Jinghua; Coppersmith, Susan N; Gilbert, P U P A

2008-03-18

It is widely known that macromolecules, such as proteins, can control the nucleation and growth of inorganic solids in biomineralizing organisms. However, what is not known are the complementary molecular interactions, organization, and rearrangements that occur when proteins interact with inorganic solids during the formation of biominerals. The organic-mineral interface (OMI) is expected to be the site for these phenomena, and is therefore extraordinarily interesting to investigate. In this report, we employ X-ray absorption near edge (XANES) spectromicroscopy to investigate the electronic structure of both calcium carbonate mineral crystals and polypeptides, and detect changing bonds at the OMI during crystal growth in the presence of polypeptides. We acquired XANES spectra from calcium carbonate crystals grown in the presence of three mollusk nacre-associated polypeptides (AP7N, AP24N, n16N) and in the presence of a sea urchin spicule matrix protein, LSM34. All these model biominerals gave similar results, including the disruption of CO bonds in calcite and enhancement of the peaks associated with C-H bonds and C-O bonds in peptides, indicating ordering of the amino acid side chains in the mineral-associated polypeptides and carboxylate binding. This is the first evidence of the mutual effect of calcite on peptide chain and peptide chain on calcite during biomineralization. We also show that these changes do not occur when Asp and Glu are replaced in the n16N sequence with Asn and Gln, respectively, demonstrating that carboxyl groups in Asp and Glu do participate in polypeptide-mineral molecular associations.

Twisting singular solutions of Betheʼs equations

NASA Astrophysics Data System (ADS)

Nepomechie, Rafael I.; Wang, Chunguang

2014-12-01

The Bethe equations for the periodic XXX and XXZ spin chains admit singular solutions, for which the corresponding eigenvalues and eigenvectors are ill-defined. We use a twist regularization to derive conditions for such singular solutions to be physical, in which case they correspond to genuine eigenvalues and eigenvectors of the Hamiltonian.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Method for altering antibody light chain interactions

DOEpatents

Stevens, Fred J.; Stevens, Priscilla Wilkins; Raffen, Rosemarie; Schiffer, Marianne

2002-01-01

A method for recombinant antibody subunit dimerization including modifying at least one codon of a nucleic acid sequence to replace an amino acid occurring naturally in the antibody with a charged amino acid at a position in the interface segment of the light polypeptide variable region, the charged amino acid having a first polarity; and modifying at least one codon of the nucleic acid sequence to replace an amino acid occurring naturally in the antibody with a charged amino acid at a position in an interface segment of the heavy polypeptide variable region corresponding to a position in the light polypeptide variable region, the charged amino acid having a second polarity opposite the first polarity. Nucleic acid sequences which code for novel light chain proteins, the latter of which are used in conjunction with the inventive method, are also provided.

Geometric somersaults of a polymer chain through cyclic twisting motions

NASA Astrophysics Data System (ADS)

Yanao, Tomohiro; Hino, Taiko

2017-01-01

This study explores the significance of geometric angle shifts, which we call geometric somersaults, arising from cyclic twisting motions of a polymer chain. A five-bead polymer chain serves as a concise and minimal model of a molecular shaft throughout this study. We first show that this polymer chain can change its orientation about its longitudinal axis largely, e.g., 120∘, under conditions of zero total angular momentum by changing the two dihedral angles in a cyclic manner. This phenomenon is an example of the so-called "falling cat" phenomenon, where a falling cat undergoes a geometric somersault by changing its body shape under conditions of zero total angular momentum. We then extend the geometric somersault of the polymer chain to a noisy and viscous environment, where the polymer chain is steered by external driving forces. This extension shows that the polymer chain can achieve an orientation change keeping its total angular momentum and total external torque fluctuating around zero in a noisy and viscous environment. As an application, we argue that the geometric somersault of the polymer chain by 120∘ may serve as a prototypical and coarse-grained model for the rotary motion of the central shaft of ATP synthase (FOF1 -ATPase). This geometric somersault is in clear contrast to the standard picture for the rotary motion of the central shaft as a rigid body, which generally incurs nonzero total angular momentum and nonzero total external torque. The power profile of the geometric somersault implies a preliminary mechanism for elastic power transmission. The results of this study may be of fundamental interest in twisting and rotary motions of biomolecules.

Characterization of a novel wheat endosperm protein belonging to the prolamin superfamily

USDA-ARS?s Scientific Manuscript database

Starch granule surface-associated proteins were separated by HPLC and identified by direct protein sequencing. Among the proteins identified was one that consisted of two polypeptide chains of 11 kDa and 19 kDa linked by disulfide bonds. Sequencing of tryptic peptides from each of the polypeptide ch...

Exploring amino acid side chain decomposition using enzymatic digestion and HPLC-MS: combined lysine transformations in chlorinated waters

USDA-ARS?s Scientific Manuscript database

Characterizing the transformations of polypeptides is important across a broad range of scientific disciplines. As polypeptides are an important constituent of dissolved organic matter within seawater and freshwater, it is important to understand their fate. Oxidants formed in blood, as part of the ...

Energy transport in the three coupled α-polypeptide chains of collagen molecule with long-range interactions effect

NASA Astrophysics Data System (ADS)

Mvogo, Alain; Ben-Bolie, G. H.; Kofané, T. C.

2015-06-01

The dynamics of three coupled α-polypeptide chains of a collagen molecule is investigated with the influence of power-law long-range exciton-exciton interactions. The continuum limit of the discrete equations reveal that the collagen dynamics is governed by a set of three coupled nonlinear Schrödinger equations, whose dispersive coefficient depends on the LRI parameter r. We construct the analytic symmetric and asymmetric (antisymmetric) soliton solutions, which match with the structural features of collagen related with the acupuncture channels. These solutions are used as initial conditions for the numerical simulations of the discrete equations, which reveal a coherent transport of energy in the molecule for r > 3. The results also indicate that the width of the solitons is a decreasing function of r, which help to stabilize the solitons propagating in the molecule. To confirm further the efficiency of energy transport in the molecule, the modulational instability of the system is performed and the numerical simulations show that the energy can flow from one polypeptide chain to another in the form of nonlinear waves.

Conformational energy calculations on polypeptides and proteins: use of a statistical mechanical procedure for evaluating structure and properties.

PubMed

Scheraga, H A; Paine, G H

1986-01-01

We are using a variety of theoretical and computational techniques to study protein structure, protein folding, and higher-order structures. Our earlier work involved treatments of liquid water and aqueous solutions of nonpolar and polar solutes, computations of the stabilities of the fundamental structures of proteins and their packing arrangements, conformations of small cyclic and open-chain peptides, structures of fibrous proteins (collagen), structures of homologous globular proteins, introduction of special procedures as constraints during energy minimization of globular proteins, and structures of enzyme-substrate complexes. Recently, we presented a new methodology for predicting polypeptide structure (described here); the method is based on the calculation of the probable and average conformation of a polypeptide chain by the application of equilibrium statistical mechanics in conjunction with an adaptive, importance sampling Monte Carlo algorithm. As a test, it was applied to Met-enkephalin.

CAT-tailing as a fail-safe mechanism for efficient degradation of stalled nascent polypeptides

PubMed Central

Kostova, Kamena K.; Hickey, Kelsey L.; Osuna, Beatriz A.; Hussmann, Jeffrey A.; Frost, Adam; Weinberg, David E.; Weissman, Jonathan S.

2017-01-01

Ribosome stalling leads to recruitment of the Ribosome Quality control Complex (RQC), which targets the partially synthesized polypeptide for proteasomal degradation through the action of the ubiquitin ligase Ltn1p. A second core RQC component, Rqc2p, modifies the nascent polypeptide by adding a Carboxy-terminal Alanine and Threonine (CAT) tail through a non-canonical elongation reaction. Here we explore the role of CATtailing in nascent-chain degradation in budding yeast. We show that Ltn1p can efficiently access only nascent chain lysines immediately proximal to the ribosome exit tunnel. For substrates without Ltn1p-accessible lysines, CAT-tailing enables degradation by exposing lysines sequestered in the ribosome exit tunnel. Thus, CAT-tails do not serve as a degron, but rather provide a fail-safe mechanism that expands the range of RQC-degradable substrates. PMID:28751611

Synthesis, characterization, conformation and self-assembly behavior of polypeptide-based brush with oligo (ethylene glycol) side chains

NASA Astrophysics Data System (ADS)

Huang, Yugang; Luo, Weiang; Ye, Guodong

2015-02-01

A new polypeptide-based copolymer brush composed of poly (γ-propargyl-L-glutamate)-block-poly (propylene oxide)-block-poly (γ-propargyl-L-glutamate) backbone (PPLG-b-PPO-b-PPLG) and oligo (ethylene glycol) (PEG) side-chain was synthesized by combination of N-carboxyanhydride ring-opening polymerization and click chemistry. Nearly 100% grafting efficiency was achieved by copper-catalyzed azide-alkyne Huisgen 1,3-dipolar cycloaddition (CuAAc) reaction. The α-helical conformation adopted by the grafted polypeptide blocks in water was relatively stable and showed a reversible change in a heating-cooling circle from 5 to 70 °C. It displayed weak stability against elevated temperature but still reversible changes in the presence of 0.47 M NaCl. The brushes were amphiphilic and could self-assemble into thermo-sensitive micelles in water. Big micelles could break into small micelles upon heating due to the improved solubility.

Molecular description of the LCST behavior of an elastin-like polypeptide.

PubMed

Li, Nan K; García Quiroz, Felipe; Hall, Carol K; Chilkoti, Ashutosh; Yingling, Yaroslava G

2014-10-13

Elastin-like polypeptides (ELPs) with the repeat sequence of VPGVG are widely used as a model system for investigation of lower critical solution temperature (LCST) transition behavior. In this paper, the effect of temperature on the structure, dynamics and association of (VPGVG)18 in aqueous solution is investigated using atomistic molecular dynamics simulations. Our simulations show that as the temperature increases the ELP backbones undergo gradual conformational changes, which are attributed to the formation of more ordered secondary structures such as β-strands. In addition, increasing temperature changes the hydrophobicity of the ELP by exposure of hydrophobic valine-side chains to the solvent and hiding of proline residues. Based on our simulations, we conclude that the transition behavior of (VPGVG)18 can be attributed to a combination of thermal disruption of the water network that surrounds the polypeptide, reduction of solvent accessible surface area of the polypeptide, and increase in its hydrophobicity. Simulations of the association of two (VPGVG)18 molecules demonstrated that the observed gradual changes in the structural properties of the single polypeptide chain are enough to cause the aggregation of polypeptides above the LCST. These results lead us to propose that the LCST phase behavior of poly(VPGVG) is a collective phenomenon that originates from the correlated gradual changes in single polypeptide structure and the abrupt change in properties of hydration water around the peptide and is a result of a competition between peptide-peptide and peptide-water interactions. This is a computational study of an important intrinsically disordered peptide system that provides an atomic-level description of structural features and interactions that are relevant in the LCST phase behavior.

Catalytic and reactive polypeptides and methods for their preparation and use

DOEpatents

Schultz, Peter

1994-01-01

Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like.

Isolation and initial characterisation of complement components C3 and C4 of the nurse shark and the channel catfish.

PubMed

Dodds, A W; Smith, S L; Levine, R P; Willis, A C

1998-01-01

Complement components C3 and C4 have been isolated from the serum of the nurse shark (Ginglymostoma cirratum) and of the channel catfish (Ictalurus punctatus). As in the higher vertebrates, the fish C4 proteins have three-chain structures while the C3 proteins have two-chain structures. All four proteins have intra-chain thioesters located within their highest molecular mass polypeptides. N-terminal sequence analysis of the polypeptides has confirmed the identity of the proteins. In all cases except the catfish C3 alpha-chain, which appears to have a blocked N-terminus, sequence similarities are apparent in comparisons with the chains of C3 and C4 from higher vertebrates. We have confirmed that the activity/protein previously designated C2n is the nurse shark analogue of mammalian C4. This is the first report of structural evidence for C4 in both the bony and cartilaginous fish.

DNA Packaging in Bacteriophage: Is Twist Important?

PubMed Central

Spakowitz, Andrew James; Wang, Zhen-Gang

2005-01-01

We study the packaging of DNA into a bacteriophage capsid using computer simulation, specifically focusing on the potential impact of twist on the final packaged conformation. We perform two dynamic simulations of packaging a polymer chain into a spherical confinement: one where the chain end is rotated as it is fed, and one where the chain is fed without end rotation. The final packaged conformation exhibits distinct differences in these two cases: the packaged conformation from feeding with rotation exhibits a spool-like character that is consistent with experimental and previous theoretical work, whereas feeding without rotation results in a folded conformation inconsistent with a spool conformation. The chain segment density shows a layered structure, which is more pronounced for packaging with rotation. However, in both cases, the conformation is marked by frequent jumps of the polymer chain from layer to layer, potentially influencing the ability to disentangle during subsequent ejection. Ejection simulations with and without Brownian forces show that Brownian forces are necessary to achieve complete ejection of the polymer chain in the absence of external forces. PMID:15805174

DNA packaging in bacteriophage: is twist important?

PubMed

Spakowitz, Andrew James; Wang, Zhen-Gang

2005-06-01

We study the packaging of DNA into a bacteriophage capsid using computer simulation, specifically focusing on the potential impact of twist on the final packaged conformation. We perform two dynamic simulations of packaging a polymer chain into a spherical confinement: one where the chain end is rotated as it is fed, and one where the chain is fed without end rotation. The final packaged conformation exhibits distinct differences in these two cases: the packaged conformation from feeding with rotation exhibits a spool-like character that is consistent with experimental and previous theoretical work, whereas feeding without rotation results in a folded conformation inconsistent with a spool conformation. The chain segment density shows a layered structure, which is more pronounced for packaging with rotation. However, in both cases, the conformation is marked by frequent jumps of the polymer chain from layer to layer, potentially influencing the ability to disentangle during subsequent ejection. Ejection simulations with and without Brownian forces show that Brownian forces are necessary to achieve complete ejection of the polymer chain in the absence of external forces.

Three-Dimensional Polypeptide Architectures Through Tandem Catalysis and Click Chemistry

NASA Astrophysics Data System (ADS)

Rhodes, Allison Jane

Rapid renal clearance, liver accumulation, proteolytic degradation and non-specificity are challenges small molecule drugs, peptides, proteins and nucleic acid therapeutics encounter en route to their intended destination within the body. Nanocarriers (i.e. dendritric polymers, vesicles, and micelles) of approximately 100 nm in diameter, shuttle small molecule drugs to their desired location through passive (EPR effect) and active (ligand-mediated) targeting, maximizing therapeutic efficiency. Polypeptide-based polymers are water-soluble, biocompatible, non-toxic and are therefore excellent candidates for nanocarriers. Dendritic polymers, including dendrimers, cylindrical brushes, and star polymers, are the newest class of nanomedicine drug delivery vehicles. The synthesis and characterization of dendritic polymers is challenging, with tedious and costly procedures. Dendritic polymers possess peripheral pendent functional groups that can potentially be used in ligand-mediated drug delivery vehicles and bioimaging applications. More specifically, cylindrical brushes are dendritic polymers where a single linear polymer (primary chain) has polymer chains (secondary chains) grafted to it. Recently, research groups have shown that cylindrical brush polymers are capable of nanoparticle and supramolecular structure self-assembly. The facile preparation of high-density brush copolypeptides by the "grafting from" approach will be discussed. This approach utilizes a novel, tandem catalytic methodology where alloc-alpha-aminoamide groups are installed within the side-chains of the alpha-amino-N-carboxyanhydride (NCA) monomer serving as masked initiators. These groups are inert during cobalt initiated NCA polymerization, and give alloc-alpha-aminoamide substituted polypeptide main-chains. The alloc-alpha-aminoamide groups are activated in situ using nickel to generate initiators for growth of side-chain brush segments. This method proves to be efficient, yielding well-defined, high-density brushes for applications in drug delivery and imaging. Here, we also report a method for the synthesis of soluble, well-defined, azido functionalized polypeptides in a straightforward, 3-step synthesis. Homo and diblock azidopolypeptides were prepared with controlled segment lengths via living polymerization using Co(PMe3)4 initiator. Through copper azide alkyne click chemistry (CuAAC) in organic solvent, azidopolypeptides were regioselectively and quantitatively modified with carboxylic acid (pH-responsive), amino acid and sugar functional groups. Finally, the advances towards well-defined hyperbranched polypeptides through alpha-amino-acid-N-thiocarboxyanhydrides (NTAs) will be discussed. Within the past 10 years, controlled NCA (alpha-amino acid-N-carboxyanhydride) ring-opening polymerization (ROP) has emerged, expanding the application of copolypeptide polymers in various drug delivery and tissue engineering motifs. Modification of NCA monomers to the corresponding alpha-amino-acid-N-thiocarboxyanhydride (NTA) will diversify ROP reactions, leading to more complex polypeptides (such as hyperbranched polymers), in addition to the possibility of performing these polymerizations under ambient conditions, which would greatly expand their potential utility. The project focuses on the preparation of hyperbranched polypeptides with well-defined architectures and controlled branching density in a one-pot reaction. This will be accomplished by taking advantage of the different selectivities of Co(PMe3)4 and depeNi(COD) polymerization initiators, and by exploiting the reactivity difference between NCA and the more stable NTA monomers.

Three mouse models of human thalassemia.

PubMed Central

Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F

1981-01-01

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454

Identification of globular mechanochemical heads of kinesin.

PubMed

Scholey, J M; Heuser, J; Yang, J T; Goldstein, L S

1989-03-23

Kinesin is a mechanoenzyme which uses energy liberated from ATP hydrolysis to transport particles towards the 'plus ends' of microtubules. The enzyme consists of two polypeptide heavy chains of relative molecular mass (Mr) approximately 110,000-140,000 (110K-140K) plus copurifying light chains; these polypeptides are arranged in a structure consisting of two globular heads attached to a fibrous stalk which terminates in a 'feathered' tail. Here we report that a function-disrupting monoclonal antikinesin, which binds to the 45K fragment of the kinesin heavy chain, recognizes an epitope located towards the N-terminal end of the heavy chain, and decorates the two globular heads lying at one end of the intact molecules (one antibody per head). The results show that the two heavy chains of native kinesin are arranged in parallel, and that the 45K fragments, which display nucleotide-sensitive interactions with microtubules, represent mechanochemical 'heads' located at the N-terminal regions of the heavy chains. Thus, it is likely that the kinesin heads are analogous to the subfragment-1 domains of myosin.

Aqueous cholesteric liquid crystals using uncharged rodlike polypeptides. Polypeptide vesicles by conformation-specific assembly. Ordered chiral macroporous hybrid silica-polypeptide composites

NASA Astrophysics Data System (ADS)

Bellomo, Enrico Giuseppe

2005-07-01

Aqueous cholesteric liquid crystals using uncharged rodlike polypeptides . The aqueous, lyotropic liquid-crystalline phase behavior of an alpha helical polypeptide, has been studied using optical microscopy and X-ray scattering. Solutions of optically pure polypeptide were found to form cholesteric liquid crystals at volume fractions that decreased with increasing average chain length. At very high volume fractions, the formation of a hexagonal mesophase was observed. The pitch of the cholesteric phase could be varied by a mixture of enantiomeric samples, where the pitch increased as the mixture approached equimolar. The cholesteric phases could be untwisted, using either magnetic field or shear flow, into nematic phases, which relaxed into cholesterics upon removal of field or shear. We have found that the phase diagram of this polypeptide in aqueous solution parallels that of poly(gamma-benzyl glutamate) in organic solvents, thus providing a useful system for liquid-crystal applications requiring water as solvent. Polypeptide vesicles by conformation-specific assembly. We have found that block copolymers composed of polypeptide segments provide significant advantages in controlling both the function and supramolecular structure of bioinspired self-assemblies. Incorporation of the stable chain conformations found in proteins into block copolymers was found to provide an additional element of control, beyond amphiphilicity and composition that defines self-assembled architecture. The abundance of functionality present in amino acids, and the ease by which they can be incorporated into these materials, also provides a powerful mechanism to impart block copolypeptides with function. This combination of structure and function work synergistically to enable significant advantages in the preparation of therapeutic agents as well as provide insight into design of self-assemblies beginning to approach the complexity of natural structures such as virus capsids. Ordered chiral macroporous hybrid silica-polypeptide composites. The mineralization of organic templates has been investigated as an effective way to control the size and structure of inorganic frameworks. Hybrid structures incorporating polypeptide with silica have been prepared and characterized using X-ray scattering, TGA, SEM and TEM. The results support the interaction between silica and polymer to form ordered chiral macroporous structures that can be easily controlled by polymer molecular weight and volume fraction.

The universality of β-hairpin misfolding indicated by molecular dynamics simulations.

PubMed

Shao, Qiang; Wang, Jinan; Shi, Jiye; Zhu, Weiliang

2013-10-28

Previous molecular dynamics simulations showed that besides the experimentally measured folded structures, several β-structured polypeptides could also have misfolded "out-of-register" structures. Through the enhanced sampling molecular dynamics simulations on a series of polypeptides using either implicit or explicit solvent model, the present study systematically investigated the universality of β-hairpin misfolding and its determinants. It was observed that the misfolding could take place for almost all polypeptides under study, especially in the presence of weak side chain hydrophobicity. Moreover, the observed misfolded structures for various polypeptides share the following common features: (1) the turn length in misfolded structure is one-residue shorter than that in folded structure; (2) the hydrophobic side chains on the two strands are pointed to the opposite directions instead of packing in the same direction to form hydrophobic core cluster in the folded structure; and (3) the misfolded structure is one-residue-shifted asymmetric β-hairpin structure. The detailed analysis suggested that the misfolding of β-hairpin is the result of the competition between the formation of the alterable turn configurations and the inter-strand hydrophobic interactions. These predictions are desired to be tested by experiments.

The universality of β-hairpin misfolding indicated by molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Shao, Qiang; Wang, Jinan; Shi, Jiye; Zhu, Weiliang

2013-10-01

Previous molecular dynamics simulations showed that besides the experimentally measured folded structures, several β-structured polypeptides could also have misfolded "out-of-register" structures. Through the enhanced sampling molecular dynamics simulations on a series of polypeptides using either implicit or explicit solvent model, the present study systematically investigated the universality of β-hairpin misfolding and its determinants. It was observed that the misfolding could take place for almost all polypeptides under study, especially in the presence of weak side chain hydrophobicity. Moreover, the observed misfolded structures for various polypeptides share the following common features: (1) the turn length in misfolded structure is one-residue shorter than that in folded structure; (2) the hydrophobic side chains on the two strands are pointed to the opposite directions instead of packing in the same direction to form hydrophobic core cluster in the folded structure; and (3) the misfolded structure is one-residue-shifted asymmetric β-hairpin structure. The detailed analysis suggested that the misfolding of β-hairpin is the result of the competition between the formation of the alterable turn configurations and the inter-strand hydrophobic interactions. These predictions are desired to be tested by experiments.

On the occurrence of polyproline II structure in elastin

NASA Astrophysics Data System (ADS)

Martino, M.; Bavoso, A.; Guantieri, V.; Coviello, A.; Tamburro, A. M.

2000-02-01

To shed light on the occurrence of the polyproline II (PP II) structure in the elastomeric protein elastin, the octapeptide sequence ALGGGALG of the N-terminal region of human elastin was studied in its monomeric and polymeric form, both in solution and in the solid state. Furthermore, the polymer poly(PG), chosen by us as an a priori reference compound for investigating the stability of PP II structure in presence of alternating proline and glycine residues along the polypeptide chain, was studied by circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy. Its "monomeric" form Boc-PG-OH, was also analyzed by X-ray diffraction. It was shown that, in the solid state the presence of PG or GGG sequences in polypeptide chains and even in a short peptide as Boc-PG-OH induces the acquisition of the PP II structural motif. However, in solution this conformation appears to be much more unstable even in the case of long polypeptide chains. The finding that at room temperature the PP II structure is always in equilibrium with other conformers suggests that its dynamics could also contribute to the molecular mechanism of elastin elasticity.

J chain in the nurse shark: implications for function in a lower vertebrate.

PubMed

Hohman, Valerie S; Stewart, Sue E; Rumfelt, Lynn L; Greenberg, Andrew S; Avila, David W; Flajnik, Martin F; Steiner, Lisa A

2003-06-15

J chain is a small polypeptide covalently attached to polymeric IgA and IgM. In humans and mice, it plays a role in binding Ig to the polymeric Ig receptor for transport into secretions. The putative orthologue of mammalian J chain has been identified in the nurse shark by sequence analysis of cDNA and the polypeptide isolated from IgM. Conservation with J chains from other species is relatively poor, especially in the carboxyl-terminal portion, and, unlike other J chains, the shark protein is not acidic. The only highly conserved segment in all known J chains is a block of residues surrounding an N-linked glycosylation site. Of the eight half-cystine residues that are conserved in mammalian J chains, three are lacking in the nurse shark, including two in the carboxyl-terminal segment that have been reported to be required for binding of human J chain-containing IgA to secretory component. Taken together with these data, the relative abundance of J chain transcripts in the spleen and their absence in the spiral valve (intestine) suggest that J chain in nurse sharks may not have a role in Ig secretion. Analysis of J chain sequences in diverse species is in agreement with accepted phylogenetic relationships, with the exception of the earthworm, suggesting that the reported presence of J chain in invertebrates should be reassessed.

Self-assembly and electrostriction of arrays and chains of hopfion particles in chiral liquid crystals

PubMed Central

Ackerman, Paul J.; van de Lagemaat, Jao; Smalyukh, Ivan I.

2015-01-01

Some of the most exotic condensed matter phases, such as twist grain boundary and blue phases in liquid crystals and Abrikosov phases in superconductors, contain arrays of topological defects in their ground state. Comprised of a triangular lattice of double-twist tubes of magnetization, the so-called ‘A-phase’ in chiral magnets is an example of a thermodynamically stable phase with topologically nontrivial solitonic field configurations referred to as two-dimensional skyrmions, or baby-skyrmions. Here we report that three-dimensional skyrmions in the form of double-twist tori called ‘hopfions’, or ‘torons’ when accompanied by additional self-compensating defects, self-assemble into periodic arrays and linear chains that exhibit electrostriction. In confined chiral nematic liquid crystals, this self-assembly is similar to that of liquid crystal colloids and originates from long-range elastic interactions between particle-like skyrmionic torus knots of molecular alignment field, which can be tuned from isotropic repulsive to weakly or highly anisotropic attractive by low-voltage electric fields. PMID:25607778

Angular momentum transport with twisted exciton wave packets

NASA Astrophysics Data System (ADS)

Zang, Xiaoning; Lusk, Mark T.

2017-10-01

A chain of cofacial molecules with CN or CN h symmetry supports excitonic states with a screwlike structure. These can be quantified with the combination of an axial wave number and an azimuthal winding number. Combinations of these states can be used to construct excitonic wave packets that spiral down the chain with well-determined linear and angular momenta. These twisted exciton wave packets can be created and annihilated using laser pulses, and their angular momentum can be optically modified during transit. This allows for the creation of optoexcitonic circuits in which information, encoded in the angular momentum of light, is converted into excitonic wave packets that can be manipulated, transported, and then reemitted. A tight-binding paradigm is used to demonstrate the key ideas. The approach is then extended to quantify the evolution of twisted exciton wave packets in a many-body, multilevel time-domain density functional theory setting. In both settings, numerical methods are developed that allow the site-to-site transfer of angular momentum to be quantified.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

Twisting integrin receptors increases endothelin-1 gene expression in endothelial cells

NASA Technical Reports Server (NTRS)

Chen, J.; Fabry, B.; Schiffrin, E. L.; Wang, N.; Ingber, D. E. (Principal Investigator)

2001-01-01

A magnetic twisting stimulator was developed based on the previously published technique of magnetic twisting cytometry. Using ligand-coated ferromagnetic microbeads, this device can apply mechanical stresses with varying amplitudes, duration, frequencies, and waveforms to specific cell surface receptors. Biochemical and biological responses of the cells to the mechanical stimulation can be assayed. Twisting integrin receptors with RGD (Arg-Gly-Asp)-containing peptide-coated beads increased endothelin-1 (ET-1) gene expression by >100%. In contrast, twisting scavenger receptors with acetylated low-density lipoprotein-coated beads or twisting HLA antigen with anti-HLA antibody-coated beads did not lead to alterations in ET-1 gene expression. In situ hybridization showed that the increase in ET-1 mRNA was localized in the cells that were stressed with the RGD-coated beads. Blocking stretch-activated ion channels with gadolinium, chelating Ca2+ with EGTA, or inhibiting tyrosine phosphorylation with genistein abolished twist-induced ET-1 mRNA elevation. Abolishing cytoskeletal tension with an inhibitor of the myosin ATPase, with an inhibitor of myosin light chain kinase, or with an actin microfilament disrupter blocked twisted-induced increases in ET-1 expression. Our results are consistent with the hypothesis that the molecular structural linkage of integrin-cytoskeleton is an important pathway for stress-induced ET-1 gene expression.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

CAT-tailing as a fail-safe mechanism for efficient degradation of stalled nascent polypeptides.

PubMed

Kostova, Kamena K; Hickey, Kelsey L; Osuna, Beatriz A; Hussmann, Jeffrey A; Frost, Adam; Weinberg, David E; Weissman, Jonathan S

2017-07-28

Ribosome stalling leads to recruitment of the ribosome quality control complex (RQC), which targets the partially synthesized polypeptide for proteasomal degradation through the action of the ubiquitin ligase Ltn1p. A second core RQC component, Rqc2p, modifies the nascent polypeptide by adding a carboxyl-terminal alanine and threonine (CAT) tail through a noncanonical elongation reaction. Here we examined the role of CAT-tailing in nascent-chain degradation in budding yeast. We found that Ltn1p efficiently accessed only nascent-chain lysines immediately proximal to the ribosome exit tunnel. For substrates without Ltn1p-accessible lysines, CAT-tailing enabled degradation by exposing lysines sequestered in the ribosome exit tunnel. Thus, CAT-tails do not serve as a degron, but rather provide a fail-safe mechanism that expands the range of RQC-degradable substrates. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Folding of a single domain protein entering the endoplasmic reticulum precedes disulfide formation.

PubMed

Robinson, Philip J; Pringle, Marie Anne; Woolhead, Cheryl A; Bulleid, Neil J

2017-04-28

The relationship between protein synthesis, folding, and disulfide formation within the endoplasmic reticulum (ER) is poorly understood. Previous studies have suggested that pre-existing disulfide links are absolutely required to allow protein folding and, conversely, that protein folding occurs prior to disulfide formation. To address the question of what happens first within the ER, that is, protein folding or disulfide formation, we studied folding events at the early stages of polypeptide chain translocation into the mammalian ER using stalled translation intermediates. Our results demonstrate that polypeptide folding can occur without complete domain translocation. Protein disulfide isomerase (PDI) interacts with these early intermediates, but disulfide formation does not occur unless the entire sequence of the protein domain is translocated. This is the first evidence that folding of the polypeptide chain precedes disulfide formation within a cellular context and highlights key differences between protein folding in the ER and refolding of purified proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

PubMed Central

Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

2008-01-01

Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

Tuning Thermoresponsive Properties of Cationic Elastin-like Polypeptides by Varying Counterions and Side-Chains.

PubMed

Petitdemange, Rosine; Garanger, Elisabeth; Bataille, Laure; Bathany, Katell; Garbay, Bertrand; Deming, Timothy J; Lecommandoux, Sébastien

2017-05-17

We report the synthesis of methionine-containing recombinant elastin-like polypeptides (ELPs) of different lengths that contain periodically spaced methionine residues. These ELPs were chemoselectively alkylated at all methionine residues to give polycationic derivatives. Some of these samples were found to possess solubility transitions in water, where the temperature of these transitions varied with ELP concentration, nature of the methionine alkylating group, and nature of the sulfonium counterions. These studies show that introduction and controlled spacing of methionine sulfonium residues into ELPs can be used as a means both to tune their solubility transition temperatures in water using a variety of different parameters and to introduce new side-chain functionality.

Theoretical and computational validation of the Kuhn barrier friction mechanism in unfolded proteins.

PubMed

Avdoshenko, Stanislav M; Das, Atanu; Satija, Rohit; Papoian, Garegin A; Makarov, Dmitrii E

2017-03-21

A long time ago, Kuhn predicted that long polymers should approach a limit where their global motion is controlled by solvent friction alone, with ruggedness of their energy landscapes having no consequences for their dynamics. In contrast, internal friction effects are important for polymers of modest length. Internal friction in proteins, in particular, affects how fast they fold or find their binding targets and, as such, has attracted much recent attention. Here we explore the molecular origins of internal friction in unfolded proteins using atomistic simulations, coarse-grained models and analytic theory. We show that the characteristic internal friction timescale is directly proportional to the timescale of hindered dihedral rotations within the polypeptide chain, with a proportionality coefficient b that is independent of the chain length. Such chain length independence of b provides experimentally testable evidence that internal friction arises from concerted, crankshaft-like dihedral rearrangements. In accord with phenomenological models of internal friction, we find the global reconfiguration timescale of a polypeptide to be the sum of solvent friction and internal friction timescales. At the same time, the time evolution of inter-monomer distances within polypeptides deviates both from the predictions of those models and from a simple, one-dimensional diffusion model.

Translation and assembly of HLA-DR antigens in Xenopus oocytes injected with mRNA from a human B-cell line.

PubMed Central

Long, E O; Gross, N; Wake, C T; Mach, J P; Carrel, S; Accolla, R; Mach, B

1982-01-01

HLA-DR antigens are polymorphic cell surface glycoproteins, expressed primarily in B lymphocytes and macrophages, which are thought to play an important role in the immune response. Two polypeptide chains, alpha and beta, are associated at the cell surface, and a third chain associates with alpha and beta intracellularly. RNA isolated from the human B-cell line Raji was injected in Xenopus laevis oocytes. Immunoprecipitates of translation products with several monoclonal antibodies revealed the presence of HLA-DR antigens similar to those synthesized in Raji cells. One monoclonal antibody was able to bind the beta chain after dissociation of the three polypeptide chains with detergent. The presence of all three chains was confirmed by two-dimensional gel electrophoresis. The glycosylation pattern of the three chains was identical to that observed in vivo, as evidenced in studies using tunicamycin, an inhibitor of N-linked glycosylation. The presence of alpha chains assembled with beta chains in equimolar ratio was further demonstrated by amino-terminal sequencing. An RNA fraction enriched for the three mRNAs, encoding alpha, beta, and intracellular chains, was isolated. This translation-assembly system and the availability of monoclonal antibodies make it possible to assay for mRNA encoding specific molecules among the multiple human Ia-like antigens. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6821356

Internal friction of single polypeptide chains at high stretch.

PubMed

Khatri, Bhavin S; Byrne, Katherine; Kawakami, Masaru; Brockwell, David J; Smith, D Alastair; Radford, Sheena E; McLeish, Tom C B

2008-01-01

Experiments that measure the viscoelasticity of single molecules from the Brownian fluctuations of an atomic force microscope (AFM) have provided a new window onto their internal dynamics in an underlying conformational landscape. Here we develop and apply these methods to examine the internal friction of unfolded polypeptide chains at high stretch. The results reveal a power law dependence of internal friction with tension (exponent 1.3 +/- 0.5) and a relaxation time approximately independent of force. To explain these results we develop a frictional worm-like chain (FWLC) model based on the Rayleigh dissipation function of a stiff chain with dynamical resistance to local bending. We analyse the dissipation rate integrated over the chain length by its Fourier components to calculate an effective tension-dependent friction constant for the end-to-end vector of the chain. The result is an internal friction that increases as a power law with tension with an exponent 3/2, consistent with experiment. Extracting the intrinsic bending friction constant of the chain it is found to be approximately 7 orders of magnitude greater than expected from solvent friction alone; a possible explanation we offer is that the underlying energy landscape for bending amino acids and/or peptide bond is rough, consistent with recent results on both proteins and polysaccharides.

Problem-Solving Test: The Mechanism of Protein Synthesis

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: protein synthesis, ribosomes, amino acids, peptides, peptide bond, polypeptide chain, N- and C-terminus, hemoglobin, [alpha]- and [beta]-globin chains, radioactive labeling, [[to the third power]H] and [[to the fourteenth power]C]leucine, cytosol, differential centrifugation, density…

Purification and characterization of human pancreatic polypeptide expressed in E. coli.

PubMed

Griko, Y V; Kapanadze, M D

1995-08-04

The region of cDNA encoding human pancreatic polypeptide (hPP) was obtained by polymerase chain reaction (PCR) and subcloned into an expression vector. The pancreatic polypeptide gene was expressed in Escherichia coli in two versions: as a cleavable fusion protein with IgG-binding synthetic ZZ domains of protein A from Staphylococcus aureus or with the 1-48 fragment of lambda Cro repressor. Site-specific hydrolysis by hydroxylamine was used to cleave the fusion protein, releasing the human polypeptide. The structure of the obtained hPP has been studied by scanning microcalorimetry and circular dichroism spectrometry. It has been shown that hPP in solutions close to neutral has a compact and unique spatial structure with an extended hydrophobic core. This structure is stable at 20 degrees C and co-operatively breaks down upon heating from this temperature.

Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

PubMed Central

Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

2012-01-01

Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

Self-Assembly and Electrostriction of Arrays and Chains of Hopfion Particles in Chiral Liquid Crystals

DOE PAGES

Ackerman, P. J.; van de Lagemaat, J.; Smalyukh, I. I.

2015-01-21

Some of the most exotic condensed matter phases, such as twist grain boundary and blue phases in liquid crystals and Abrikosov phases in superconductors, contain arrays of topological defects in their ground state. Comprised of a triangular lattice of double-twist tubes of magnetization, the so-called ‘A-phase’ in chiral magnets is an example of a thermodynamically stable phase with topologically nontrivial solitonic field configurations referred to as two-dimensional skyrmions, or baby-skyrmions. Here we report that three-dimensional skyrmions in the form of double-twist tori called ‘hopfions’, or ‘torons’ when accompanied by additional self-compensating defects, self-assemble into periodic arrays and linear chains thatmore » exhibit electrostriction. In confined chiral nematic liquid crystals, this self-assembly is similar to that of liquid crystal colloids and originates from long-range elastic interactions between particle-like skyrmionic torus knots of molecular alignment field, which can be tuned from isotropic repulsive to weakly or highly anisotropic attractive by low-voltage electric fields.« less

A versatile expression vector for the growth and amplification of unmodified phage display polypeptides.

PubMed

Winton, Alexander J; Baptiste, Janae L; Allen, Mark A

2018-09-01

Proteins and polypeptides represent nature's most complex and versatile polymer. They provide complicated shapes, diverse chemical functionalities, and tightly regulated and controlled sizes. Several disease states are related to the misfolding or overproduction of polypeptides and yet polypeptides are present in several therapeutic molecules. In addition to biological roles; short chain polypeptides have been shown to interact with and drive the bio-inspired synthesis or modification of inorganic materials. This paper outlines the development of a versatile cloning vector which allows for the expression of a short polypeptide by controlling the incorporation of a desired DNA coding insert. As a demonstration of the efficacy of the expression system, a solid binding polypeptide identified from M13 phage display was expressed and purified. The solid binding polypeptide was expressed as a soluble 6xHis-SUMO tagged construct. Expression was performed in E. coli using auto-induction followed by Ni-NTA affinity chromatography and ULP1 protease cleavage. Methodology demonstrates the production of greater than 8 mg of purified polypeptide per liter of E. coli culture. Isotopic labeling of the peptide is also demonstrated. The versatility of the designed cloning vector, use of the 6xHis-SUMO solubility partner, bacterial expression in auto-inducing media and the purification methodology make this expressionun vector a readily scalable and user-friendly system for the creation of desired peptide domains. Copyright © 2018. Published by Elsevier Inc.

Heat-induced formation of a specific binding site for self-assembled Congo Red in the V domain of immunoglobulin L chain lambda.

PubMed

Piekarska, B; Konieczny, L; Rybarska, J; Stopa, B; Zemanek, G; Szneler, E; Król, M; Nowak, M; Roterman, I

2001-11-01

Moderate heating (40-50 degrees C) of immunoglobulins makes them accessible for binding with Congo Red and some related highly associated dyes. The binding is specific and involves supramolecular dye ligands presenting ribbon-like micellar bodies. The L chain lambda dimer, which upon heating disclosed the same binding requirement with respect to supramolecular dye ligands, was used in this work to identify the site of their attachment. Two clearly defined dye-protein (L lambda chain) complexes arise upon heating, here called complex I and complex II. The first is formed at low temperatures (up to 40-45 degrees C) and hence by a still native protein, while the formation of the second one is associated with domain melting above 55 degrees C. They contain 4 and 8 dye molecules bound per L chain monomer, respectively. Complex I also forms efficiently at high dye concentration even at ambient temperature. Complex I and its formation was the object of the present studies. Three structural events that could make the protein accessible to penetration by the large dye ligand were considered to occur in L chains upon heating: local polypeptide chain destabilization, VL-VL domain incoherence, and protein melting. Of these three possibilities, local low-energy structural alteration was found to correlate best with the formation of complex I. It was identified as decreased packing stability of the N-terminal polypeptide chain fragment, which as a result made the V domain accessible for dye penetration. The 19-amino acid N-terminal fragment becomes susceptible to proteolytic cleavage after being replaced by the dye at its packing locus. Its splitting from the dye-protein complex was proved by amino acid sequence analysis. The emptied packing locus, which becomes the site that holds the dye, is bordered by strands of amino acids numbered 74-80 and 105-110, as shown by model analysis. The character of the temperature-induced local polypeptide chain destabilization and its possible role in intramolecular antibody signaling is discussed. Copyright 2001 John Wiley & Sons, Inc.

Design of a Software for Calculating Isoelectric Point of a Polypeptide According to Their Net Charge Using the Graphical Programming Language LabVIEW

ERIC Educational Resources Information Center

Tovar, Glomen

2018-01-01

A software to calculate the net charge and to predict the isoelectric point (pI) of a polypeptide is developed in this work using the graphical programming language LabVIEW. Through this instrument the net charges of the ionizable residues of the chains of the proteins are calculated at different pH values, tabulated, pI is predicted and an Excel…

In vitro myogenesis induced by human recombinant elastin-like proteins.

PubMed

D'Andrea, Paola; Scaini, Denis; Ulloa Severino, Luisa; Borelli, Violetta; Passamonti, Sabina; Lorenzon, Paola; Bandiera, Antonella

2015-10-01

Mammalian adult skeletal muscle has a limited ability to regenerate after injury, usage or trauma. A promising strategy for successful regenerative technology is the engineering of bio interfaces that mimic the characteristics of the extracellular matrix. Human elastin-like polypeptides (HELPs) have been synthesized as biomimetic materials that maintain some peculiar properties of the native protein. We developed a novel Human Elastin Like Polypeptide obtained by fusing the elastin-like backbone to a domain present in the α2 chain of type IV collagen, containing two RGD motives. We employed this peptide as adhesion substrate for C2C12 myoblasts and compared its effects to those induced by two other polypeptides of the HELP series. Myoblast adhered to all HELPs coatings, where they assumed morphology and cytoarchitecture that depended on the polypeptide structure. Adhesion to HELPs stimulated at a different extent cell proliferation and differentiation, the expression of Myosin Heavy Chain and the fusion of aligned fibers into multinucleated myotubes. Adhesion substrates significantly altered myotubes stiffness, measured by Atomic Force Microscopy, and differently affected the cells Ca(2+) handling capacity and the maturation of excitation-contraction coupling machinery, evaluated by Ca(2+) imaging. Overall, our findings indicate that the properties of HELP biopolymers can be exploited for dissecting the molecular connections underlying myogenic differentiation and for designing novel substrates for skeletal muscle regeneration. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of Intrinsic Twist on Length of Crystalline and Disordered Regions in Cellulose Microfibrils

NASA Astrophysics Data System (ADS)

Nili, Abdolmadjid; Shklyaev, Oleg; Zhao, Zhen; Zhong, Linghao; Crespi, Vincent

2013-03-01

Cellulose is the most abundant biological material in the world. It provides mechanical reinforcement for plant cell wall, and could potentially serve as renewable energy source for biofuel. Native cellulose forms a non-centrosymmetric chiral crystal due to lack of roto-inversion symmetry of constituent glucose chains. Chirality of cellulose crystal could result in an overall twist. Competition between unwinding torsional/extensional and twisting energy terms leads to twist induced frustration along fibril's axis. The accumulated frustration could be the origin of periodic disordered regions observed in cellulose microfibrils. These regions could play significant role in properties of cellulose bundles and ribbons as well as biological implications on plant cell walls. We propose a mechanical model based on Frenkel-Kontorova mechanism to investigate effects of radius dependent twist on crystalline size in cellulose microfibrils. Parameters of the model are adjusted according to all-atom molecular simulations. This work is supported by the US Department of Energy, Office of Basic Energy Sciences as part of The Center for LignoCellulose Structure and Formation, an Energy Frontier Research Center

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cirilo Antonio, N.; Manojlovic, N.; Departamento de Matematica, FCT, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro

sl{sub 2} Gaudin model with jordanian twist is studied. This system can be obtained as the semiclassical limit of the XXX spin chain deformed by the jordanian twist. The appropriate creation operators that yield the Bethe states of the Gaudin model and consequently its spectrum are defined. Their commutation relations with the generators of the corresponding loop algebra as well as with the generating function of integrals of motion are given. The inner products and norms of Bethe states and the relation to the solutions of the Knizhnik-Zamolodchikov equations are discussed.

KnotProt: a database of proteins with knots and slipknots

PubMed Central

Jamroz, Michal; Niemyska, Wanda; Rawdon, Eric J.; Stasiak, Andrzej; Millett, Kenneth C.; Sułkowski, Piotr; Sulkowska, Joanna I.

2015-01-01

The protein topology database KnotProt, http://knotprot.cent.uw.edu.pl/, collects information about protein structures with open polypeptide chains forming knots or slipknots. The knotting complexity of the cataloged proteins is presented in the form of a matrix diagram that shows users the knot type of the entire polypeptide chain and of each of its subchains. The pattern visible in the matrix gives the knotting fingerprint of a given protein and permits users to determine, for example, the minimal length of the knotted regions (knot's core size) or the depth of a knot, i.e. how many amino acids can be removed from either end of the cataloged protein structure before converting it from a knot to a different type of knot. In addition, the database presents extensive information about the biological functions, families and fold types of proteins with non-trivial knotting. As an additional feature, the KnotProt database enables users to submit protein or polymer chains and generate their knotting fingerprints. PMID:25361973

Self-assemble nanoparticles based on polypeptides containing C-terminal luminescent Pt-cysteine complex

NASA Astrophysics Data System (ADS)

Vlakh, E. G.; Grachova, E. V.; Zhukovsky, D. D.; Hubina, A. V.; Mikhailova, A. S.; Shakirova, J. R.; Sharoyko, V. V.; Tunik, S. P.; Tennikova, T. B.

2017-02-01

The growing attention to the luminescent nanocarriers is strongly stimulated by their potential application as drug delivery systems and by the necessity to monitor their distribution in cells and tissues. In this communication we report on the synthesis of amphiphilic polypeptides bearing C-terminal phosphorescent label together with preparation of nanoparticles using the polypeptides obtained. The approach suggested is based on a unique and highly technological process where the new phosphorescent Pt-cysteine complex serves as initiator of the ring-opening polymerization of α-amino acid N-carboxyanhydrides to obtain the polypeptides bearing intact the platinum chromophore covalently bound to the polymer chain. It was established that the luminescent label retains unchanged its emission characteristics not only in the polypeptides but also in more complicated nanoaggregates such as the polymer derived amphiphilic block-copolymers and self-assembled nanoparticles. The phosphorescent nanoparticles display no cytotoxicity and hemolytic activity in the tested range of concentrations and easily internalize into living cells that makes possible in vivo cell visualization, including prospective application in time resolved imaging and drug delivery monitoring.

RECOMBINATION OF ANTIBODY POLYPEPTIDE CHAINS IN THE PRESENCE OF ANTIGEN

PubMed Central

Metzger, Henry; Mannik, Mart

1964-01-01

Conditions were developed by which the separated H and L chains of gamma2 globulins recombined to form four-chained molecules in good yields. In the absence of antigen, anti-2,4-dinitrophenyl (anti-DNP) H chains randomly reassociated with a mixture of antibody and non-specific gamma2 globulin L chains. In the presence of a specific hapten, however, the antibody H chains preferentially interacted with the anti-DNP L chains. Antibody H chain-antibody L chain recombinants formed in the presence of hapten were more active than the corresponding recombinants formed in the absence of hapten. Speculations are made regarding the possible mechanisms and biological significance of these effects. PMID:14247718

Effects of side group functionality and molecular weight on the activity of synthetic antimicrobial polypeptides.

PubMed

Engler, Amanda C; Shukla, Anita; Puranam, Sravanthi; Buss, Hilda G; Jreige, Nina; Hammond, Paula T

2011-05-09

The rapid emergence of antibiotic-resistant bacteria along with increasing difficulty in biofilm treatment has caused an immediate need for the development of new classes of antimicrobial therapeutics. We have developed a library of antimicrobial polypeptides, prepared by the ring-opening polymerization of γ-propargyl-L-glutamate N-carboxyanhydride and the alkyne-azide cycloaddition click reaction, which mimic the favorable characteristics of naturally occurring antimicrobial peptides (AmPs). AmPs are known not to cause drug resistance as well as prevent bacteria attachment on surfaces. The ease and scale of synthesis of the antimicrobial polypeptides developed here are significantly improved over the traditional Merrifield synthetic peptide approaches needed for naturally occurring antimicrobial peptides and avoids the unique challenges of biosynthetic pathways. The polypeptides range in length from 30 to 140 repeat units and can have varied side group functionality, including primary, secondary, tertiary, and quaternary amines with hydrocarbon side chains ranging from 1 to 12 carbons long. Overall, we find these polypeptides to exhibit broad-spectrum activity against both Gram positive and Gram negative bacteria, namely, S. aureus and E. coli , while having very low hemolytic activity. Many of the polypeptides can also be used as surface coatings to prevent bacterial attachment. The polypeptide library developed in this work addresses the need for effective biocompatible therapeutics for drug delivery and medical device coatings.

Crystal structure of 4-meth-oxy-N-(piperidine-1-carbono-thio-yl)benzamide.

PubMed

Suhud, Khairi; Hasbullah, Siti Aishah; Ahmad, Musa; Heng, Lee Yook; Kassim, Mohammad B

2017-10-01

In the title compound, C 14 H 18 N 2 O 2 S, the piperidine ring has a chair conformation. Its mean plane is twisted with respect to the 4-meth-oxy-benzoyl ring, with a dihedral angle of 63.0 (3)°. The central N-C(=S)-N(H)-C(=O) bridge is twisted with an N-C-N-C torsion angle of 74.8 (6)°. In the crystal, mol-ecules are linked by N-H⋯O and C-H⋯O hydrogen bonds, forming chains along the c -axis direction. Adjacent chains are linked by C-H⋯π inter-actions, forming layers parallel to the ac plane. The layers are linked by offset π-π inter-actions [inter-centroid distance = 3.927 (3) Å], forming a supra-molecular three-dimensional structure.

Chain Collapse of an Amyloidogenic Intrinsically Disordered Protein

PubMed Central

Jain, Neha; Bhattacharya, Mily; Mukhopadhyay, Samrat

2011-01-01

Natively unfolded or intrinsically disordered proteins (IDPs) are under intense scrutiny due to their involvement in both normal biological functions and abnormal protein misfolding disorders. Polypeptide chain collapse of amyloidogenic IDPs is believed to play a key role in protein misfolding, oligomerization, and aggregation leading to amyloid fibril formation, which is implicated in a number of human diseases. In this work, we used bovine κ-casein, which serves as an archetypal model protein for amyloidogenic IDPs. Using a variety of biophysical tools involving both prediction and spectroscopic techniques, we first established that monomeric κ-casein adopts a collapsed premolten-globule-like conformational ensemble under physiological conditions. Our time-resolved fluorescence and light-scattering data indicate a change in the mean hydrodynamic radius from ∼4.6 nm to ∼1.9 nm upon chain collapse. We then took the advantage of two cysteines separated by 77 amino-acid residues and covalently labeled them using thiol-reactive pyrene maleimide. This dual-labeled protein demonstrated a strong excimer formation upon renaturation from urea- and acid-denatured states under both equilibrium and kinetic conditions, providing compelling evidence of polypeptide chain collapse under physiological conditions. The implication of the IDP chain collapse in protein aggregation and amyloid formation is also discussed. PMID:21961598

A split motor domain in a cytoplasmic dynein

PubMed Central

Straube, Anne; Enard, Wolfgang; Berner, Alexandra; Wedlich-Söldner, Roland; Kahmann, Regine; Steinberg, Gero

2001-01-01

The heavy chain of dynein forms a globular motor domain that tightly couples the ATP-cleavage region and the microtubule-binding site to transform chemical energy into motion along the cytoskeleton. Here we show that, in the fungus Ustilago maydis, two genes, dyn1 and dyn2, encode the dynein heavy chain. The putative ATPase region is provided by dyn1, while dyn2 includes the predicted microtubule-binding site. Both genes are located on different chromosomes, are transcribed into independent mRNAs and are translated into separate polypeptides. Both Dyn1 and Dyn2 co-immunoprecipitated and co-localized within growing cells, and Dyn1–Dyn2 fusion proteins partially rescued mutant phenotypes, suggesting that both polypeptides interact to form a complex. In cell extracts the Dyn1–Dyn2 complex dissociated, and microtubule affinity purification indicated that Dyn1 or associated polypeptides bind microtubules independently of Dyn2. Both Dyn1 and Dyn2 were essential for cell survival, and conditional mutants revealed a common role in nuclear migration, cell morphogenesis and microtubule organization, indicating that the Dyn1–Dyn2 complex serves multiple cellular functions. PMID:11566874

Coarse-grained, foldable, physical model of the polypeptide chain.

PubMed

Chakraborty, Promita; Zuckermann, Ronald N

2013-08-13

Although nonflexible, scaled molecular models like Pauling-Corey's and its descendants have made significant contributions in structural biology research and pedagogy, recent technical advances in 3D printing and electronics make it possible to go one step further in designing physical models of biomacromolecules: to make them conformationally dynamic. We report here the design, construction, and validation of a flexible, scaled, physical model of the polypeptide chain, which accurately reproduces the bond rotational degrees of freedom in the peptide backbone. The coarse-grained backbone model consists of repeating amide and α-carbon units, connected by mechanical bonds (corresponding to ϕ and ψ) that include realistic barriers to rotation that closely approximate those found at the molecular scale. Longer-range hydrogen-bonding interactions are also incorporated, allowing the chain to readily fold into stable secondary structures. The model is easily constructed with readily obtainable parts and promises to be a tremendous educational aid to the intuitive understanding of chain folding as the basis for macromolecular structure. Furthermore, this physical model can serve as the basis for linking tangible biomacromolecular models directly to the vast array of existing computational tools to provide an enhanced and interactive human-computer interface.

Oxidation of Methionine Residues in Polypeptide Ions via Gas-Phase Ion/Ion Chemistry

PubMed Central

Pilo, Alice L.; McLuckey, Scott A.

2014-01-01

The gas-phase oxidation of methionine residues is demonstrated here using ion/ion reactions with periodate anions. Periodate anions are observed to attach to varying degrees to all polypeptide ions irrespective of amino acid composition. Direct proton transfer yielding a charge reduced peptide ion is also observed. In the case of methionine and, to a much lesser degree, tryptophan containing peptide ions, collisional activation of the complex ion generated by periodate attachment yields an oxidized peptide product (i.e., [M+H+O]+), in addition to periodic acid detachment. Detachment of periodic acid takes place exclusively for peptides that do not contain either a methionine or tryptophan side-chain. In the case of methionine containing peptides, the [M+H+O]+ product is observed at a much greater abundance than the proton transfer product (viz., [M+H]+). Collisional activation of oxidized Met-containing peptides yields a signature loss of 64 Da from the precursor and/or product ions. This unique loss corresponds to the ejection of methanesulfenic acid from the oxidized methionine side chain and is commonly used in solution-phase proteomics studies to determine the presence of oxidized methionine residues. The present work shows that periodate anions can be used to ‘label’ methionine residues in polypeptides in the gas-phase. The selectivity of the periodate anion for the methionine side chain suggests several applications including identification and location of methionine residues in sequencing applications. PMID:24671696

Carbohydrate moieties of myelin-associated glycoprotein, major glycoprotein of the peripheral nervous system myelin and other myelin glycoproteins potentially involved in cell adhesion.

PubMed

Badache, A; Burger, D; Villarroya, H; Robert, Y; Kuchler, S; Steck, A J; Zanetta, J P

1992-01-01

The myelin-associated glycoprotein (MAG) and the major glycoprotein of the peripheral nervous system myelin (P0) are two members of the family of cell adhesion molecules (CAMs). A role in cell adhesion of the carbohydrate moiety of these molecules has been attributed to the presence of N-glycans bearing the HNK-1 carbohydrate epitope. On the other hand, it has been suggested that these glycoproteins could be ligands of an endogenous mannose-binding lectin present in myelin, the cerebellar soluble lectin (CSL). In order to further document the heterogeneity of the glycans of these two CAMs, we have used several probes: an anti-carbohydrate antibody of the HNK-1 type, called Elec-39, the plant lectin concanavalin A (ConA), and the endogenous lectin CSL involved in myelin compaction. This study shows that CSL binds to a small proportion of the polypeptide chains of MAG found in adult CNS of rats and man and the polypeptide chains of P0 molecules from adult human and rat sciatic nerve. For MAG from adult rat brain, the binding of CSL is restricted to glycans of polypeptide chains which could be separated from the others according to their solubility properties. These MAG molecular entities react also with the Elec-39 antibody and with ConA. These results confirm that P0 and MAG are heterogeneous in their carbohydrate moieties.(ABSTRACT TRUNCATED AT 250 WORDS)

Peptides, polypeptides and peptide-polymer hybrids as nucleic acid carriers.

PubMed

Ahmed, Marya

2017-10-24

Cell penetrating peptides (CPPs), and protein transduction domains (PTDs) of viruses and other natural proteins serve as a template for the development of efficient peptide based gene delivery vectors. PTDs are sequences of acidic or basic amphipathic amino acids, with superior membrane trespassing efficacies. Gene delivery vectors derived from these natural, cationic and cationic amphipathic peptides, however, offer little flexibility in tailoring the physicochemical properties of single chain peptide based systems. Owing to significant advances in the field of peptide chemistry, synthetic mimics of natural peptides are often prepared and have been evaluated for their gene expression, as a function of amino acid functionalities, architecture and net cationic content of peptide chains. Moreover, chimeric single polypeptide chains are prepared by a combination of multiple small natural or synthetic peptides, which imparts distinct physiological properties to peptide based gene delivery therapeutics. In order to obtain multivalency and improve the gene delivery efficacies of low molecular weight cationic peptides, bioactive peptides are often incorporated into a polymeric architecture to obtain novel 'polymer-peptide hybrids' with improved gene delivery efficacies. Peptide modified polymers prepared by physical or chemical modifications exhibit enhanced endosomal escape, stimuli responsive degradation and targeting efficacies, as a function of physicochemical and biological activities of peptides attached onto a polymeric scaffold. The focus of this review is to provide comprehensive and step-wise progress in major natural and synthetic peptides, chimeric polypeptides, and peptide-polymer hybrids for nucleic acid delivery applications.

Analysis of urine composition in type Ⅱ diabetic mice after intervention therapy using holothurian polypeptides

NASA Astrophysics Data System (ADS)

Li, Yanyan; Xu, Jiajie; Su, Xiurong

2017-07-01

Hydrolysates and peptide fractions (PF) obtained from sea cucumber with commercial enzyme were studied on the hpyerglycemic and renal protective effects on db/db rats using urine metabolomics. Compared with the control group the polypeptides from the two species could significantly reduce the urine glucose and urea. We also tried to address the compositions of highly expressed urinary proteins using a proteomics approach. They were serum albumins, AMBP proteins, negative trypsin, elastase and urinary protein, GAPDH, a receptor of urokinase-type plasminogen activator (uPAR), and Ig kappa chain C region. We used the electronic nose to quickly detect changes in the volatile substances in mice urine after holothurian polypeptides fed, and the results show it can identify the difference between treatment groups with the control group without overlapping. The protein express mechanism of holothurian polypeptides treating diabetes was discussed, and we suggested these two peptides with the hypoglycemic and renal protective activity might be utilized as nutraceuticals.

Hydration and conformational mechanics of single, end-tethered elastin-like polypeptides.

PubMed

Valiaev, Alexei; Lim, Dong Woo; Schmidler, Scott; Clark, Robert L; Chilkoti, Ashutosh; Zauscher, Stefan

2008-08-20

We investigated the effect of temperature, ionic strength, solvent polarity, and type of guest residue on the force-extension behavior of single, end-tethered elastin-like polypeptides (ELPs), using single molecule force spectroscopy (SMFS). ELPs are stimulus-responsive polypeptides that contain repeats of the five amino acids Val-Pro-Gly-Xaa-Gly (VPGXG), where Xaa is a guest residue that can be any amino acid with the exception of proline. We fitted the force-extension data with a freely jointed chain (FJC) model which allowed us to resolve small differences in the effective Kuhn segment length distributions that largely arise from differences in the hydrophobic hydration behavior of ELP. Our results agree qualitatively with predictions from recent molecular dynamics simulations and demonstrate that hydrophobic hydration modulates the molecular elasticity for ELPs. Furthermore, our results show that SMFS, when combined with our approach for data analysis, can be used to study the subtleties of polypeptide-water interactions and thus provides a basis for the study of hydrophobic hydration in intrinsically unstructured biomacromolecules.

Functional Modification of Thioether Groups in Peptides, Polypeptides, and Proteins.

PubMed

Deming, Timothy J

2017-03-15

Recent developments in the modification of methionine and other thioether-containing residues in peptides, polypeptides, and proteins are reviewed. Properties and potential applications of the resulting functionalized products are also discussed. While much of this work is focused on natural Met residues, modifications at other side-chain residues have also emerged as new thioether-containing amino acids have been incorporated into peptidic materials. Functional modification of thioether-containing amino acids has many advantages and is a complementary methodology to the widely utilized methods for modification at cysteine residues.

Natural polypeptide scaffolds: beta-sheets, beta-turns, and beta-hairpins.

PubMed

Rotondi, Kenneth S; Gierasch, Lila M

2006-01-01

This paper provides an introduction to fundamental conformational states of polypeptides in the beta-region of phi,psi space, in which the backbone is extended near to its maximal length, and to more complex architectures in which extended segments are linked by turns and loops. There are several variants on these conformations, and they comprise versatile scaffolds for presentation of side chains and backbone amides for molecular recognition and designed catalysts. In addition, the geometry of these fundamental folds can be readily mimicked in peptidomimetics. Copyright 2005 Wiley Periodicals, Inc.

Crystal structure of 4-meth­oxy-N-(piperidine-1-carbono­thio­yl)benzamide

PubMed Central

Suhud, Khairi; Hasbullah, Siti Aishah; Ahmad, Musa; Heng, Lee Yook

2017-01-01

In the title compound, C14H18N2O2S, the piperidine ring has a chair conformation. Its mean plane is twisted with respect to the 4-meth­oxy­benzoyl ring, with a dihedral angle of 63.0 (3)°. The central N—C(=S)—N(H)—C(=O) bridge is twisted with an N—C—N—C torsion angle of 74.8 (6)°. In the crystal, mol­ecules are linked by N—H⋯O and C—H⋯O hydrogen bonds, forming chains along the c-axis direction. Adjacent chains are linked by C—H⋯π inter­actions, forming layers parallel to the ac plane. The layers are linked by offset π–π inter­actions [inter­centroid distance = 3.927 (3) Å], forming a supra­molecular three-dimensional structure. PMID:29250374

Continuous higher-order sliding mode control with time-varying gain for a class of uncertain nonlinear systems.

PubMed

Han, Yaozhen; Liu, Xiangjie

2016-05-01

This paper presents a continuous higher-order sliding mode (HOSM) control scheme with time-varying gain for a class of uncertain nonlinear systems. The proposed controller is derived from the concept of geometric homogeneity and super-twisting algorithm, and includes two parts, the first part of which achieves smooth finite time stabilization of pure integrator chains. The second part conquers the twice differentiable uncertainty and realizes system robustness by employing super-twisting algorithm. Particularly, time-varying switching control gain is constructed to reduce the switching control action magnitude to the minimum possible value while keeping the property of finite time convergence. Examples concerning the perturbed triple integrator chains and excitation control for single-machine infinite bus power system are simulated respectively to demonstrate the effectiveness and applicability of the proposed approach. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Chronic changes in pituitary adenylate cyclase-activating polypeptide and related receptors in response to repeated chemical dural stimulation in rats.

PubMed

Han, Xun; Ran, Ye; Su, Min; Liu, Yinglu; Tang, Wenjing; Dong, Zhao; Yu, Shengyuan

2017-01-01

Background Preclinical experimental studies revealed an acute alteration of pituitary adenylate cyclase-activating polypeptide in response to a single activation of the trigeminovascular system, which suggests a potential role of pituitary adenylate cyclase-activating polypeptide in the pathogenesis of migraine. However, changes in pituitary adenylate cyclase-activating polypeptide after repeated migraine-like attacks in chronic migraine are not clear. Therefore, the present study investigated chronic changes in pituitary adenylate cyclase-activating polypeptide and related receptors in response to repeated chemical dural stimulations in the rat. Methods A rat model of chronic migraine was established by repeated chemical dural stimulations using an inflammatory soup for a different numbers of days. The pituitary adenylate cyclase-activating polypeptide levels were quantified in plasma, the trigeminal ganglia, and the trigeminal nucleus caudalis using radioimmunoassay and Western blotting in trigeminal ganglia and trigeminal nucleus caudalis tissues. Western blot analysis and real-time polymerase chain reaction were used to measure the protein and mRNA expression of pituitary adenylate cyclase-activating polypeptide-related receptors (PAC1, VPAC1, and VPAC2) in the trigeminal ganglia and trigeminal nucleus caudalis to identify changes associated with repetitive applications of chemical dural stimulations. Results All rats exhibited significantly decreased periorbital nociceptive thresholds to repeated inflammatory soup stimulations. Radioimmunoassay and Western blot analysis demonstrated significantly decreased pituitary adenylate cyclase-activating polypeptide levels in plasma and trigeminal ganglia after repetitive chronic inflammatory soup stimulation. Protein and mRNA analyses of pituitary adenylate cyclase-activating polypeptide-related receptors demonstrated significantly increased PAC1 receptor protein and mRNA expression in the trigeminal ganglia, but not in the trigeminal nucleus caudalis, and no significant differences were found in the expression of the VPAC1 and VPAC2 receptors. Conclusions This study demonstrated the chronic alteration of pituitary adenylate cyclase-activating polypeptide and related receptors in response to repeated chemical dural stimulation in the rat, which suggests the crucial involvement of pituitary adenylate cyclase-activating polypeptide in the development of migraine. The selective increase in pituitary adenylate cyclase-activating polypeptide-related receptors suggests that the PAC1 receptor pathway is a novel target for the treatment of migraine.

KnotProt: a database of proteins with knots and slipknots.

PubMed

Jamroz, Michal; Niemyska, Wanda; Rawdon, Eric J; Stasiak, Andrzej; Millett, Kenneth C; Sułkowski, Piotr; Sulkowska, Joanna I

2015-01-01

The protein topology database KnotProt, http://knotprot.cent.uw.edu.pl/, collects information about protein structures with open polypeptide chains forming knots or slipknots. The knotting complexity of the cataloged proteins is presented in the form of a matrix diagram that shows users the knot type of the entire polypeptide chain and of each of its subchains. The pattern visible in the matrix gives the knotting fingerprint of a given protein and permits users to determine, for example, the minimal length of the knotted regions (knot's core size) or the depth of a knot, i.e. how many amino acids can be removed from either end of the cataloged protein structure before converting it from a knot to a different type of knot. In addition, the database presents extensive information about the biological functions, families and fold types of proteins with non-trivial knotting. As an additional feature, the KnotProt database enables users to submit protein or polymer chains and generate their knotting fingerprints. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparison of effects of ingested medium- and long-chain triglyceride on gallbladder volume and release of cholecystokinin and other gut peptides.

PubMed

Isaacs, P E; Ladas, S; Forgacs, I C; Dowling, R H; Ellam, S V; Adrian, T E; Bloom, S R

1987-05-01

In a double-blind, crossover study of the effect of ingested medium-chain triglyceride (MCT) and long-chain triglyceride (LCT) in six normal subjects, the gallbladder did not contract after ingestion of MCT but instead had significantly increased in volume at 2 hr after the meal. Plasma cholecystokinin (CCK) increased after the MCT meal, but gastrin, motilin, pancreatic polypeptide (PP), and GIP were unaffected. The long-chain triglyceride meal evoked a brisk and sustained gallbladder contraction, higher levels of CCK, and a significant increase in plasma PP and GIP levels.

Development of novel ligands for peptide GPCRs.

PubMed

Moran, Brian M; McKillop, Aine M; O'Harte, Finbarr Pm

2016-12-01

Incretin based glucagon-like peptide-1 receptor (GLP-1R) agonists which target a G-protein coupled receptor (GPCR) are currently used in the treatment of type 2 diabetes. This review focuses on GPCRs from pancreatic β-cells, including GLP-1, glucose-dependent insulinotropic polypeptide (GIP), glucagon, somatostatin, pancreatic polypeptide (PP), cholecystokinin (CCK), peptide YY (PYY), oxyntomodulin (OXM) and ghrelin receptors. In addition, fatty acids GPCRs are thought to have an increasing role in regulating peptide secretions namely short fatty acids GPCR (GPR41, GPR43), medium chain fatty acid GPCR (GPR84), long chain fatty acid GPCR (GPR40, GPR120) and cannabinoid-like GPCR (GPR55, GPR119). Several pre-clinical and clinical trials are currently ongoing in peptide GPCR based therapies, including dual and triple agonist peptides which activate two or more GPCRs simultaneously. Copyright © 2016 Elsevier Ltd. All rights reserved.

Beta-Barrel Scaffold of Fluorescent Proteins: Folding, Stability and Role in Chromophore Formation

PubMed Central

Stepanenko, Olesya V.; Stepanenko, Olga V.; Kuznetsova, Irina M.; Verkhusha, Vladislav V.; Turoverov, Konstantin K.

2013-01-01

This review focuses on the current view of the interaction between the β-barrel scaffold of fluorescent proteins and their unique chromophore located in the internal helix. The chromophore originates from the polypeptide chain and its properties are influenced by the surrounding protein matrix of the β-barrel. On the other hand, it appears that a chromophore tightens the β-barrel scaffold and plays a crucial role in its stability. Furthermore, the presence of a mature chromophore causes hysteresis of protein unfolding and refolding. We survey studies measuring protein unfolding and refolding using traditional methods as well as new approaches, such as mechanical unfolding and reassembly of truncated fluorescent proteins. We also analyze models of fluorescent protein unfolding and refolding obtained through different approaches, and compare the results of protein folding in vitro to co-translational folding of a newly synthesized polypeptide chain. PMID:23351712

Asymmetry at the molecular level in biology

NASA Astrophysics Data System (ADS)

Johnson, Louise N.

2005-10-01

Naturally occurring biological molecules are made of homochiral building blocks. Proteins are composed of L-amino acids (and not D-amino acids); nucleic acids such as DNA have D-ribose sugars (and not L-ribose sugars). It is not clear why nature selected a particular chirality. Selection could have occurred by chance or as a consequence of basic physical chemistry. Possible proposals, including the contribution of the parity violating the weak nuclear force, are discussed together with the mechanisms by which this very small contribution might be amplified. Homochirality of the amino acids has consequences for protein structure. Helices are right handed and beta sheets have a left-hand twist. When incorporated into the tertiary structure of a protein these chiralities limit the topologies of connections between helices and sheets. Polypeptides comprised of D-amino acids can be synthesized chemically and have been shown to adopt stable structures that are the mirror image of the naturally occurring L-amino acid polypeptides. Chirality is important in drug design. Three examples are discussed: penicillin; the CD4 antagonistic peptides; and thalidomide. The absolute hand of a biological structure can only be established by X-ray crystallographic methods using the technique of anomalous scattering.

Photoaffinity Labeling of Developing Jojoba Seed Microsomal Membranes with a Photoreactive Analog of Acyl-Coenzyme A (Acyl-CoA) (Identification of a Putative Acyl-CoA:Fatty Alcohol Acyltransferase.

PubMed Central

Shockey, J. M.; Rajasekharan, R.; Kemp, J. D.

1995-01-01

Jojoba (Simmondsia chinensis, Link) is the only plant known that synthesizes liquid wax. The final step in liquid wax biosynthesis is catalyzed by an integral membrane enzyme, fatty acyl-coenzyme A (CoA):fatty alcohol acyltransferase, which transfers an acyl chain from acyl-CoA to a fatty alcohol to form the wax ester. To purify the acyltransferase, we have labeled the enzyme with a radioiodinated, photoreactive analog of acyl-CoA, 12-[N-(4-azidosalicyl)amino] dodecanoyl-CoA (ASD-CoA). This molecule acts as an inhibitor of acyltransferase activity in the dark and as an irreversible inhibitor upon exposure to ultraviolet light. Oleoyl-CoA protects enzymatic activity in a concentration-dependent manner. Photolysis of microsomal membranes with labeled ASD-CoA resulted in strong labeling of two polypeptides of 57 and 52 kD. Increasing concentrations of oleoyl-CoA reduced the labeling of the 57-kD polypeptide dramatically, whereas the labeling of the 52-kD polypeptide was much less responsive to oleoyl-CoA. Also, unlike the other polypeptide, the labeling of the 57-kD polypeptide was enhanced considerably when photolyzed in the presence of dodecanol. These results suggest that a 57-kD polypeptide from jojoba microsomes may be the acyl-CoA:fatty alcohol acyltransferase. PMID:12228351

Photoaffinity Labeling of Developing Jojoba Seed Microsomal Membranes with a Photoreactive Analog of Acyl-Coenzyme A (Acyl-CoA) (Identification of a Putative Acyl-CoA:Fatty Alcohol Acyltransferase.

PubMed

Shockey, J. M.; Rajasekharan, R.; Kemp, J. D.

1995-01-01

Jojoba (Simmondsia chinensis, Link) is the only plant known that synthesizes liquid wax. The final step in liquid wax biosynthesis is catalyzed by an integral membrane enzyme, fatty acyl-coenzyme A (CoA):fatty alcohol acyltransferase, which transfers an acyl chain from acyl-CoA to a fatty alcohol to form the wax ester. To purify the acyltransferase, we have labeled the enzyme with a radioiodinated, photoreactive analog of acyl-CoA, 12-[N-(4-azidosalicyl)amino] dodecanoyl-CoA (ASD-CoA). This molecule acts as an inhibitor of acyltransferase activity in the dark and as an irreversible inhibitor upon exposure to ultraviolet light. Oleoyl-CoA protects enzymatic activity in a concentration-dependent manner. Photolysis of microsomal membranes with labeled ASD-CoA resulted in strong labeling of two polypeptides of 57 and 52 kD. Increasing concentrations of oleoyl-CoA reduced the labeling of the 57-kD polypeptide dramatically, whereas the labeling of the 52-kD polypeptide was much less responsive to oleoyl-CoA. Also, unlike the other polypeptide, the labeling of the 57-kD polypeptide was enhanced considerably when photolyzed in the presence of dodecanol. These results suggest that a 57-kD polypeptide from jojoba microsomes may be the acyl-CoA:fatty alcohol acyltransferase.

A pH- and temperature-responsive bioresorbable injectable hydrogel based on polypeptide block copolymers for the sustained delivery of proteins in vivo.

PubMed

Turabee, Md Hasan; Thambi, Thavasyappan; Duong, Huu Thuy Trang; Jeong, Ji Hoon; Lee, Doo Sung

2018-02-27

Sustained delivery of protein therapeutics is limited owing to the fragile nature of proteins. Despite its great potential, delivery of proteins without any loss of bioactivity remains a challenge in the use of protein therapeutics in the clinic. To surmount this shortcoming, we report a pH- and temperature-responsive in situ-forming injectable hydrogel based on comb-type polypeptide block copolymers for the controlled delivery of proteins. Polypeptide block copolymers, composed of hydrophilic polyethylene glycol (PEG), temperature-responsive poly(γ-benzyl-l-glutamate) (PBLG), and pH-responsive oligo(sulfamethazine) (OSM), exhibit pH- and temperature-induced sol-to-gel transition behavior in aqueous solutions. Polypeptide block copolymers were synthesized by combining N-carboxyanhydride-based ring-opening polymerization and post-functionalization of the chain-end using N-hydroxy succinimide ester activated OSM. The physical properties of polypeptide-based hydrogels were tuned by varying the composition of temperature- and pH-responsive PBLG and OSM in block copolymers. Polypeptide block copolymers were non-toxic to human embryonic kidney cells at high concentrations (2000 μg mL -1 ). Subcutaneous administration of polypeptide block copolymer sols formed viscoelastic gel instantly at the back of Sprague-Dawley (SD) rats. The in vivo gels exhibited sustained degradation and were found to be bioresorbable in 6 weeks without any noticeable inflammation at the injection site. Anionic characteristics of hydrogels allow efficient loading of a cationic model protein, lysozyme, through electrostatic interaction. Lysozyme-loaded polypeptide block copolymer sols readily formed a viscoelastic gel in vivo and sustained lysozyme release for at least a week. Overall, the results demonstrate an elegant approach to control the release of certain charged proteins and open a myriad of therapeutic possibilities in protein therapeutics.

Probing protein surface with a solvent mimetic carbene coupled to detection by mass spectrometry.

PubMed

Gómez, Gabriela E; Mundo, Mariana R; Craig, Patricio O; Delfino, José M

2012-01-01

Much knowledge into protein folding, ligand binding, and complex formation can be derived from the examination of the nature and size of the accessible surface area (SASA) of the polypeptide chain, a key parameter in protein science not directly measurable in an experimental fashion. To this end, an ideal chemical approach should aim at exerting solvent mimicry and achieving minimal selectivity to probe the protein surface regardless of its chemical nature. The choice of the photoreagent diazirine to fulfill these goals arises from its size comparable to water and from being a convenient source of the extremely reactive methylene carbene (:CH(2)). The ensuing methylation depends primarily on the solvent accessibility of the polypeptide chain, turning it into a valuable signal to address experimentally the measurement of SASA in proteins. The superb sensitivity and high resolution of modern mass spectrometry techniques allows us to derive a quantitative signal proportional to the extent of modification (EM) of the sample. Thus, diazirine labeling coupled to electrospray mass spectrometry (ESI-MS) detection can shed light on conformational features of the native as well as non-native states, not easily addressable by other methods. Enzymatic fragmentation of the polypeptide chain at the level of small peptides allows us to locate the covalent tag along the amino acid sequence, therefore enabling the construction of a map of solvent accessibility. Moreover, by subsequent MS/MS analysis of peptides, we demonstrate here the feasibility of attaining amino acid resolution in defining the target sites. © American Society for Mass Spectrometry, 2011

Proline-Rich Salivary Proteins Have Extended Conformations

PubMed Central

Boze, Hélène; Marlin, Thérèse; Durand, Dominique; Pérez, Javier; Vernhet, Aude; Canon, Francis; Sarni-Manchado, Pascale; Cheynier, Véronique; Cabane, Bernard

2010-01-01

Abstract Three basic proline-rich salivary proteins have been produced through the recombinant route. IB5 is a small basic proline-rich protein that is involved in the binding of plant tannins in the oral cavity. II-1 is a larger protein with a closely related backbone; it is glycosylated, and it is also able to bind plant tannins. II-1ng has the same polypeptidic backbone as II-1, but it is not glycosylated. Small angle x-ray scattering experiments on dilute solutions of these proteins confirm that they are intrinsically disordered. IB5 and II-1ng can be described through a chain model including a persistence length and cross section. The measured radii of gyration (Rg = 27.9 and 41.0 ± 1 Å respectively) and largest distances (rmax = 110 and 155 ± 10 Å respectively) show that their average conformations are rather extended. The length of the statistical segment (twice the persistence length) is b = 30 Å, which is larger than the usual value (18 Å − 20 Å) for unstructured polypeptide chains. These characteristics are presumably related to the presence of polyproline helices within the polypeptidic backbones. For both proteins, the radius of gyration of the chain cross-section is Rc = 2.7 ± 0.2Å. The glycosylated protein II-1 has similar conformations but the presence of large polyoside sidegroups yields the structure of a branched macromolecule with the same hydrophobic backbone and hydrophilic branches. It is proposed that the unusually extended conformations of these proteins in solution facilitate the capture of plant tannins in the oral cavity. PMID:20643086

Differences in α and β polypeptide chains of tubulin resolved by electron microscopy with image reconstruction

PubMed Central

Crepeau, Richard H.; McEwen, Bruce; Edelstein, Stuart J.

1978-01-01

Electron microscopic techniques have been used to reveal two classes of subunits of tubulin in ordered arrays. Presumably the two classes correspond to the α and β polypeptide chains of tubulin that have been distinguished by chemical criteria. The two types of subunits alternate along individual protofilaments in microtubules, microtubule-precursor sheets, and extended zinc-tubulin sheets. The resolution of the two types of polypeptide chains is achieved by improved negative staining methods which produce micrographs with layer lines at 28 Å-1 and 84 Å-1 in optical or computed transforms, in addition to the layer lines at 21 Å-1 and 42 Å-1 described previously [Crepeau, R. H., McEwen, B., Dykes, G. & Edelstein, S. J. (1977) J Mol. Biol. 116, 301-315]. In microtubules or microtubule-precursor sheets, adjacent protofilaments are staggered by about 10 Å, but parallel, in the sense that the α-β vector points in the same direction for all of the protofilaments of the microtubule. However, for the sheets assembled in the presence of zinc, adjacent protofilaments are staggered by about 21 Å and oriented in an antiparallel arrangement with alternate protofilaments related by a 2-fold screw axis. The antiparallel alignment of the protofilaments in the zinc-tubulin sheets accounts for their planarity (no tubular structures are found in the presence of moderate concentrations of zinc), since the intrinsic curvature found with parallel alignment of protofilaments in the absence of zinc would be cancelled by the antiparallel arrangement. Images PMID:283410

The complete amino acid sequence of echinoidin, a lectin from the coelomic fluid of the sea urchin Anthocidaris crassispina. Homologies with mammalian and insect lectins.

PubMed

Giga, Y; Ikai, A; Takahashi, K

1987-05-05

The complete amino acid sequence of echinoidin, the proposed name for a lectin from the coelomic fluid of the sea urchin Anthocidaris crassispina, has been determined by sequencing the peptides obtained from tryptic, Staphylococcus aureus V8 protease, chymotryptic, and thermolysin digestions. Echinoidin is a multimeric protein (Giga, Y., Sutoh, K., and Ikai, A. (1985) Biochemistry 24, 4461-4467) whose subunit consists of a total of 147 amino acid residues and one carbohydrate chain attached to Ser38. The molecular weight of the polypeptide without carbohydrate was calculated to be 16,671. Each polypeptide chain contains seven half-cystines, and six of them form three disulfide bonds in the single polypeptide chain (Cys3-Cys14, Cys31-Cys141, and Cys116-Cys132), while Cys2 is involved in an interpolypeptide disulfide linkage. From secondary structure prediction by the method of Chou and Fasman (Chou, P. Y., and Fasman, G. D. (1974) Biochemistry 13, 211-222) the protein appears to be rich in beta-sheet and beta-turn structures and poor in alpha-helical structure. The sequence of the COOH-terminal half of echinoidin is highly homologous to those of the COOH-terminal carbohydrate recognition portions of rat liver mannose-binding protein and several other hepatic lectins. This COOH-terminal region of echinoidin is also homologous to the central portion of the lectin from the flesh fly Sarcophaga peregrina. Moreover, echinoidin contains an Arg-Gly-Asp sequence which has been proposed to be a basic functional unit in cellular recognition proteins.

Catalytic and reactive polypeptides and methods for their preparation and use

DOEpatents

Schultz, Peter

1994-01-01

Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like. This invention was made with Government support under Grant Contract No. AI-24695, awarded by the Department of health and Human Services, and under Grant Contract No. N 00014-87-K-0256, awarded by the Office of Naval Research. The Government has certain rights in this invention.

Role of Monomer Sequence, Hydrogen Bonding and Mesoscale Architecture in Marine Antifouling Coatings

NASA Astrophysics Data System (ADS)

Segalman, Rachel

Polypeptoids are non-natural, sequence specific polymers that offer the opportunity to probe the effect of monomer sequence, chirality, and chain shape on self-assembly and surface properties. Additionally, polypeptoid synthesis is more scaleable than traditional polypeptides suggesting their utility in large area applications. We have designed efficient marine anti-fouling coatings by using triblock copolymer scaffolds to which polypeptoids are tethered in order to tune both the modulus and surface energies with great precision. Surprisingly, when short sequences are tethered to a polymer backbone, polypeptoids consistently outperform analogous polypeptides in antifouling properties. We hypothesize that the hydrogen bonding inherent to the polypeptide backbone drives the observed differences in performance. We also find that the polymer scaffold housing the polypeptoids also plays a crucial role in directing surface presentation and therefore the overall coating properties.

Statistical thermodynamics of protein folding: Comparison of a mean-field theory with Monte Carlo simulations

NASA Astrophysics Data System (ADS)

Hao, Ming-Hong; Scheraga, Harold A.

1995-01-01

A comparative study of protein folding with an analytical theory and computer simulations, respectively, is reported. The theory is based on an improved mean-field formalism which, in addition to the usual mean-field approximations, takes into account the distributions of energies in the subsets of conformational states. Sequence-specific properties of proteins are parametrized in the theory by two sets of variables, one for the energetics of mean-field interactions and one for the distribution of energies. Simulations are carried out on model polypeptides with different sequences, with different chain lengths, and with different interaction potentials, ranging from strong biases towards certain local chain states (bond angles and torsional angles) to complete absence of local conformational preferences. Theoretical analysis of the simulation results for the model polypeptides reveals three different types of behavior in the folding transition from the statistical coiled state to the compact globular state; these include a cooperative two-state transition, a continuous folding, and a glasslike transition. It is found that, with the fitted theoretical parameters which are specific for each polypeptide under a different potential, the mean-field theory can describe the thermodynamic properties and folding behavior of the different polypeptides accurately. By comparing the theoretical descriptions with simulation results, we verify the basic assumptions of the theory and, thereby, obtain new insights about the folding transitions of proteins. It is found that the cooperativity of the first-order folding transition of the model polypeptides is determined mainly by long-range interactions, in particular the dipolar orientation; the local interactions (e.g., bond-angle and torsion-angle potentials) have only marginal effect on the cooperative characteristic of the folding, but have a large impact on the difference in energy between the folded lowest-energy structure and the unfolded conformations of a protein.

Coulomb repulsion in short polypeptides.

PubMed

Norouzy, Amir; Assaf, Khaleel I; Zhang, Shuai; Jacob, Maik H; Nau, Werner M

2015-01-08

Coulomb repulsion between like-charged side chains is presently viewed as a major force that impacts the biological activity of intrinsically disordered polypeptides (IDPs) by determining their spatial dimensions. We investigated short synthetic models of IDPs, purely composed of ionizable amino acid residues and therefore expected to display an extreme structural and dynamic response to pH variation. Two synergistic, custom-made, time-resolved fluorescence methods were applied in tandem to study the structure and dynamics of the acidic and basic hexapeptides Asp6, Glu6, Arg6, Lys6, and His6 between pH 1 and 12. (i) End-to-end distances were obtained from the short-distance Förster resonance energy transfer (sdFRET) from N-terminal 5-fluoro-l-tryptophan (FTrp) to C-terminal Dbo. (ii) End-to-end collision rates were obtained for the same peptides from the collision-induced fluorescence quenching (CIFQ) of Dbo by FTrp. Unexpectedly, the very high increase of charge density at elevated pH had no dynamical or conformational consequence in the anionic chains, neither in the absence nor in the presence of salt, in conflict with the common view and in partial conflict with accompanying molecular dynamics simulations. In contrast, the cationic peptides responded to ionization but with surprising patterns that mirrored the rich individual characteristics of each side chain type. The contrasting results had to be interpreted, by considering salt screening experiments, N-terminal acetylation, and simulations, in terms of an interplay of local dielectric constant and peptide-length dependent side chain charge-charge repulsion, side chain functional group solvation, N-terminal and side chain charge-charge repulsion, and side chain-side chain as well as side chain-backbone interactions. The common picture that emerged is that Coulomb repulsion between water-solvated side chains is efficiently quenched in short peptides as long as side chains are not in direct contact with each other or the main chain.

Mapping the Geometric Evolution of Protein Folding Motor.

PubMed

Jerath, Gaurav; Hazam, Prakash Kishore; Shekhar, Shashi; Ramakrishnan, Vibin

2016-01-01

Polypeptide chain has an invariant main-chain and a variant side-chain sequence. How the side-chain sequence determines fold in terms of its chemical constitution has been scrutinized extensively and verified periodically. However, a focussed investigation on the directive effect of side-chain geometry may provide important insights supplementing existing algorithms in mapping the geometrical evolution of protein chains and its structural preferences. Geometrically, folding of protein structure may be envisaged as the evolution of its geometric variables: ϕ, and ψ dihedral angles of polypeptide main-chain directed by χ1, and χ2 of side chain. In this work, protein molecule is metaphorically modelled as a machine with 4 rotors ϕ, ψ, χ1 and χ2, with its evolution to the functional fold is directed by combinations of its rotor directions. We observe that differential rotor motions lead to different secondary structure formations and the combinatorial pattern is unique and consistent for particular secondary structure type. Further, we found that combination of rotor geometries of each amino acid is unique which partly explains how different amino acid sequence combinations have unique structural evolution and functional adaptation. Quantification of these amino acid rotor preferences, resulted in the generation of 3 substitution matrices, which later on plugged in the BLAST tool, for evaluating their efficiency in aligning sequences. We have employed BLOSUM62 and PAM30 as standard for primary evaluation. Generation of substitution matrices is a logical extension of the conceptual framework we attempted to build during the development of this work. Optimization of matrices following the conventional routines and possible application with biologically relevant data sets are beyond the scope of this manuscript, though it is a part of the larger project design.

Heat-stable, FE-dependent alcohol dehydrogenase for aldehyde detoxification

DOEpatents

Elkins, James G.; Clarkson, Sonya

2018-04-24

The present invention relates to microorganisms and polypeptides for detoxifying aldehydes associated with industrial fermentations. In particular, a heat-stable, NADPH- and iron-dependent alcohol dehydrogenase was cloned from Thermoanaerobacter pseudethanolicus 39E and displayed activity against a number of aldehydes including inhibitory compounds that are produced during the dilute-acid pretreatment process of lignocellulosic biomass before fermentation to biofuels. Methods to use the microorganisms and polypeptides of the invention for improved conversion of bio mass to biofuel are provided as well as use of the enzyme in metabolic engineering strategies for producing longer-chain alcohols from sugars using thermophilic, fermentative microorganisms.

Cotranslational structure acquisition of nascent polypeptides monitored by NMR spectroscopy.

PubMed

Eichmann, Cédric; Preissler, Steffen; Riek, Roland; Deuerling, Elke

2010-05-18

The folding of proteins in living cells may start during their synthesis when the polypeptides emerge gradually at the ribosomal exit tunnel. However, our current understanding of cotranslational folding processes at the atomic level is limited. We employed NMR spectroscopy to monitor the conformation of the SH3 domain from alpha-spectrin at sequential stages of elongation via in vivo ribosome-arrested (15)N,(13)C-labeled nascent polypeptides. These nascent chains exposed either the entire SH3 domain or C-terminally truncated segments thereof, thus providing snapshots of the translation process. We show that nascent SH3 polypeptides remain unstructured during elongation but fold into a compact, native-like beta-sheet assembly when the entire sequence information is available. Moreover, the ribosome neither imposes major conformational constraints nor significantly interacts with exposed unfolded nascent SH3 domain moieties. Our data provide evidence for a domainwise folding of the SH3 domain on ribosomes without significant population of folding intermediates. The domain follows a thermodynamically favorable pathway in which sequential folding units are stabilized, thus avoiding kinetic traps during the process of cotranslational folding.

Evolution of prokaryote and eukaryote lines inferred from sequence evidence

NASA Technical Reports Server (NTRS)

Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.

1984-01-01

This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.

Shape-Persistent, Thermoresponsive Polypeptide Brushes Prepared by Vapor Deposition Surface-Initiated Ring-Opening Polymerization of α-Amino Acid N -Carboxyanhydrides

DOE PAGES

Shen, Yong; Desseaux, Solenne; Aden, Bethany; ...

2015-04-20

We report that surface-grafting thermoresponsive polymers allows the preparation of thin polymer brush coatings with surface properties that can be manipulated by variation of temperature. In most instances, thermoresponsive polymer brushes are produced using polymers that dehydrate and collapse above a certain temperature. This report presents the preparation and properties of polymer brushes that show thermoresponsive surface properties, yet are shape-persistent in that they do not undergo main chain collapse. The polymer brushes presented here are obtained via vapor deposition surface-initiated ring-opening polymerization (SI-ROP) of γ-di- or tri(ethylene glycol)-modified glutamic acid N-carboxyanhydrides. Vapor deposition SI-ROP of γ-di- or tri(ethylene glycol)-modifiedmore » L- or D-glutamic acid N-carboxyanhydrides affords helical surface-tethered polymer chains that do not show any changes in secondary structure between 10 and 70 °C. QCM-D experiments, however, revealed significant dehydration of poly(γ-(2-(2-methoxyethoxy)ethyl)-l-glutamate) (poly(L-EG 2-Glu)) brushes upon heating from 10 to 40 °C. At the same time, AFM and ellipsometry studies did not reveal significant variations in film thickness over this temperature range, which is consistent with the shape-persistent nature of these polypeptide brushes and indicates that the thermoresponsiveness of the films is primarily due to hydration and dehydration of the oligo(ethylene glycol) side chains. The results we present here illustrate the potential of surface-initiated NCA ring-opening polymerization to generate densely grafted assemblies of polymer chains that possess well-defined secondary structures and tunable surface properties. These polypeptide brushes complement their conformationally unordered counterparts that can be generated via surface-initiated polymerization of vinyl-type monomers and represent another step forward to biomimetic surfaces and interfaces.« less

Cooperative polymerization of α-helices induced by macromolecular architecture

NASA Astrophysics Data System (ADS)

Baumgartner, Ryan; Fu, Hailin; Song, Ziyuan; Lin, Yao; Cheng, Jianjun

2017-07-01

Catalysis observed in enzymatic processes and protein polymerizations often relies on the use of supramolecular interactions and the organization of functional elements in order to gain control over the spatial and temporal elements of fundamental cellular processes. Harnessing these cooperative interactions to catalyse reactions in synthetic systems, however, remains challenging due to the difficulty in creating structurally controlled macromolecules. Here, we report a polypeptide-based macromolecule with spatially organized α-helices that can catalyse its own formation. The system consists of a linear polymeric scaffold containing a high density of initiating groups from which polypeptides are grown, forming a brush polymer. The folding of polypeptide side chains into α-helices dramatically enhances the polymerization rate due to cooperative interactions of macrodipoles between neighbouring α-helices. The parameters that affect the rate are elucidated by a two-stage kinetic model using principles from nucleation-controlled protein polymerizations; the key difference being the irreversible nature of this polymerization.

Investigation of light-induced conformation changes in spiropyran-modified succinylated poly(L-lysine).

PubMed

Cooper, T M; Stone, M O; Natarajan, L V; Crane, R L

1995-08-01

To determine the maximum range of coupling between side-chain photochromism and polypeptide conformation change, we modified the carboxylate side chains of succinylated poly(L-lysine) with a spiropyran to form polypeptide I. The extent of modification was determined to be 35.5%. The spacer group length between the polypeptide alpha-carbon and the dye was 12 atoms, providing minimum polypeptide-dye interaction. Conformation changes were monitored by circular dichroism as a function of light adaptation and solvent composition (hexafluoroisopropanol [HFIP] vs trifluoroethanol [TFE]). Under all solvent compositions, the dark-adapted dye was in the merocyanine form. Light adaptation by visible light converted the dye to the spiropyran form. When dissolved in TFE, I adopted a helical conformation insensitive to light adaptation. With increasing percentage HFIP, a solvent-induced helix-to-coil transition was observed around 80% (vol/vol) HFIP. At 100% HFIP, both light- and dark-adapted forms of I were in the coil state. Near the midpoint of the solvent-induced helix-to-coil transition, light adaptation caused conformation changes. Applying helix-to-coil transition theory, we measured a statistically significant difference in coil segment-HFIP binding constant for light- vs dark-adapted solutions (6.38 +/- 0.03 M-1 vs 6.56 +/- 0.03 M-1), but not for the nucleation parameter sigma (1.2 +/- 0.4 10(-3) vs 1.3 +/- 0.3 x 10(-3). The small binding constant difference translated to a light-induced binding energy difference of 17 cal/mol/monomer. Near the midpoint of the helix-to-coil transition, collective interactions between monomer units made possible the translation of a small energy difference (less than RT) into large macromolecular conformation changes.(ABSTRACT TRUNCATED AT 250 WORDS)

Effect of double-tailed surfactant architecture on the conformation, self-assembly, and processing in polypeptide-surfactant complexes.

PubMed

Junnila, Susanna; Hanski, Sirkku; Oakley, Richard J; Nummelin, Sami; Ruokolainen, Janne; Faul, Charl F J; Ikkala, Olli

2009-10-12

This work describes the solid-state conformational and structural properties of self-assembled polypeptide-surfactant complexes with double-tailed surfactants. Poly(L-lysine) was complexed with three dialkyl esters of phosphoric acid (i.e., phosphodiester surfactants), where the surfactant tail branching and length was varied to tune the supramolecular architecture in a facile way. After complexation with the branched surfactant bis(2-ethylhexyl) phosphate in an aqueous solution, the polypeptide chains adopted an alpha-helical conformation. These rod-like helices self-assembled into cylindrical phases with the amorphous alkyl tails pointing outward. In complexes with dioctyl phosphate and didodecyl phosphate, which have two linear n-octyl or n-dodecyl tails, respectively, the polypeptide formed antiparallel beta-sheets separated by alkyl layers, resulting in well-ordered lamellar self-assemblies. By heating, it was possible to trigger a partial opening of the beta-sheets and disruption of the lamellar phase. After repeated heating/cooling, all of these complexes also showed a glass transition between 37 and 50 degrees C. Organic solvent treatment and plasticization by overstoichiometric amount of surfactant led to structure modification in poly(L-lysine)-dioctyl phosphate complexes, PLL(diC8)(x) (x = 1.0-3.0). Here, the alpha-helical PLL is surrounded by the surfactants and these bottle-brush-like chains self-assemble in a hexagonal cylindrical morphology. As x is increased, the materials are clearly plasticized and the degree of ordering is improved: The stiff alpha-helical backbones in a softened surfactant matrix give rise to thermotropic liquid-crystalline phases. The complexes were examined by Fourier transform infrared spectroscopy, small- and wide-angle X-ray scattering, transmission electron microscopy, differential scanning calorimetry, polarized optical microscopy, and circular dichroism.

Interplay of signal recognition particle and trigger factor at L23 near the nascent chain exit site on the Escherichia coli ribosome

PubMed Central

Ullers, Ronald S.; Houben, Edith N.G.; Raine, Amanda; ten Hagen-Jongman, Corinne M.; Ehrenberg, Måns; Brunner, Joseph; Oudega, Bauke; Harms, Nellie; Luirink, Joen

2003-01-01

As newly synthesized polypeptides emerge from the ribosome, they interact with chaperones and targeting factors that assist in folding and targeting to the proper location in the cell. In Escherichia coli, the chaperone trigger factor (TF) binds to nascent polypeptides early in biosynthesis facilitated by its affinity for the ribosomal proteins L23 and L29 that are situated around the nascent chain exit site on the ribosome. The targeting factor signal recognition particle (SRP) interacts specifically with the signal anchor (SA) sequence in nascent inner membrane proteins (IMPs). Here, we have used photocross-linking to map interactions of the SA sequence in a short, in vitro–synthesized, nascent IMP. Both TF and SRP were found to interact with the SA with partially overlapping binding specificity. In addition, extensive contacts with L23 and L29 were detected. Both purified TF and SRP could be cross-linked to L23 on nontranslating ribosomes with a competitive advantage for SRP. The results suggest a role for L23 in the targeting of IMPs as an attachment site for TF and SRP that is close to the emerging nascent chain. PMID:12756233

Macromolecules Vis-a-Vis the Traditions of Chemistry

ERIC Educational Resources Information Center

Flory, Paul J.

1973-01-01

Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…

Kinetics of Contact Formation and End-to-End Distance Distributions of Swollen Disordered Peptides

PubMed Central

Soranno, Andrea; Longhi, Renato; Bellini, Tommaso; Buscaglia, Marco

2009-01-01

Unstructured polypeptide chains are subject to various degrees of swelling or compaction depending on the combination of solvent condition and amino acid sequence. Highly denatured proteins generally behave like random-coils with excluded volume repulsion, whereas in aqueous buffer more compact conformations have been observed for the low-populated unfolded state of globular proteins as well as for naturally disordered sequences. To quantitatively account for the different mechanisms inducing the swelling of polypeptides, we have examined three 14-residues peptides in aqueous buffer and in denaturant solutions, including the well characterized AGQ repeat as a reference and two variants, in which we have successively introduced charged side chains and removed the glycines. Quenching of the triplet state of tryptophan by close contact with cysteine has been used in conjunction with Förster resonance energy transfer to study the equilibrium and kinetic properties of the peptide chains. The experiments enable accessing end-to-end root mean-square distance, probability of end-to-end contact formation and intrachain diffusion coefficient. The data can be coherently interpreted on the basis of a simple chain model with backbone angles obtained from a library of coil segments of proteins and hard sphere repulsion at each Cα position. In buffered water, we find that introducing charges in a glycine-rich sequence induces a mild chain swelling and a significant speed-up of the intrachain dynamics, whereas the removal of the glycines results in almost a two-fold increase of the chain volume and a drastic slowing down. In denaturants we observe a pronounced swelling of all the chains, with significant differences between the effect of urea and guanidinium chloride. PMID:19217868

Pituitary adenylate cyclase-activating polypeptide is a potent inhibitor of the growth of light chain-secreting human multiple myeloma cells.

PubMed

Li, Min; Cortez, Shirley; Nakamachi, Tomoya; Batuman, Vecihi; Arimura, Akira

2006-09-01

Multiple myeloma represents a malignant proliferation of plasma cells in the bone marrow, which often overproduces immunoglobulin light chains. We have shown previously that pituitary adenylate cyclase-activating polypeptide (PACAP) markedly suppresses the release of proinflammatory cytokines from light chain-stimulated human renal proximal tubule epithelial cells and prevents the resulting tubule cell injury. In this study, we have shown that PACAP suppresses the proliferation of human kappa and lambda light chain-secreting multiple myeloma-derived cells. The addition of PACAP suppressed light chain-producing myeloma cell-stimulated interleukin 6 (IL-6) secretion by the bone marrow stromal cells (BMSCs). A specific antagonist to either the human PACAP-specific receptor or the vasoactive intestinal peptide receptor attenuated the suppressive effect of PACAP on IL-6 production in the adhesion of human multiple myeloma cells to BMSCs. The secretion of IL-6 by BMSCs was completely inhibited by 10(-9) mol/L PACAP, which also attenuated the phosphorylation of both p42/44 and p38 mitogen-activated protein kinases (MAPK) as well as nuclear factor-kappaB (NF-kappaB) activation in response to the adhesion of multiple myeloma cells to BMSCs, whereas the inhibition of p42/44 MAPK signaling attenuated PACAP action. The signaling cascades involved in the inhibitory effect of PACAP on IL-6-mediated paracrine stimulation of light chain-secreting myeloma cell growth was mediated through the suppression of p38 MAPK as well as modulation of activation of transcription factor NF-kappaB. These findings suggest that PACAP may be a new antitumor agent that directly suppresses light chain-secreting myeloma cell growth and indirectly affects tumor cell growth by modifying the bone marrow milieu of the multiple myeloma.

An alternative view of protein fold space.

PubMed

Shindyalov, I N; Bourne, P E

2000-02-15

Comparing and subsequently classifying protein structures information has received significant attention concurrent with the increase in the number of experimentally derived 3-dimensional structures. Classification schemes have focused on biological function found within protein domains and on structure classification based on topology. Here an alternative view is presented that groups substructures. Substructures are long (50-150 residue) highly repetitive near-contiguous pieces of polypeptide chain that occur frequently in a set of proteins from the PDB defined as structurally non-redundant over the complete polypeptide chain. The substructure classification is based on a previously reported Combinatorial Extension (CE) algorithm that provides a significantly different set of structure alignments than those previously described, having, for example, only a 40% overlap with FSSP. Qualitatively the algorithm provides longer contiguous aligned segments at the price of a slightly higher root-mean-square deviation (rmsd). Clustering these alignments gives a discreet and highly repetitive set of substructures not detectable by sequence similarity alone. In some cases different substructures represent all or different parts of well known folds indicative of the Russian doll effect--the continuity of protein fold space. In other cases they fall into different structure and functional classifications. It is too early to determine whether these newly classified substructures represent new insights into the evolution of a structural framework important to many proteins. What is apparent from on-going work is that these substructures have the potential to be useful probes in finding remote sequence homology and in structure prediction studies. The characteristics of the complete all-by-all comparison of the polypeptide chains present in the PDB and details of the filtering procedure by pair-wise structure alignment that led to the emergent substructure gallery are discussed. Substructure classification, alignments, and tools to analyze them are available at http://cl.sdsc.edu/ce.html.

Complex of a Protective Antibody with its Ebola Virus GP Peptide Epitope: Unusual Features of a V lambda x Light Chain

DTIC Science & Technology

2007-10-01

twists. Bioinformatics, 19, ii246–ii255. 52. Lawrence, M. C. & Colman, P. M. (1993). Shape complementarity at protein / protein interfaces . J. Mol. Biol...envelope spike, which is the sole protein expressed on the surface of the Ebola virus and is involved in receptor binding, tropism, and viral entry.6–9 It...26 At the variable light chain/heavy chain (VL/VH) interface of 13F6-1-2, ∼1025 Å2 surface area is buried on VL Fig. 1. Nucleotide and translated amino

In situ characterization of N-carboxy anhydride polymerization in nanoporous anodic alumina.

PubMed

Lau, K H Aaron; Duran, Hatice; Knoll, Wolfgang

2009-03-12

Poly(gamma-benzyl-L-glutamate) (PBLG) has been a popular model polypeptide for a range of physicochemical studies, and its modifiable ester side chains make it an attractive platform for various potential applications. Thin films of Poly(gamma-benzyl-L-glutamate) PBLG were surface grafted within nanoporous anodic alumina (AAO) by surface-initiated polymerization of the N-carboxy anhydride of benzyl-L-glutamate (BLG-NCA). The grafting process was characterized by optical waveguide spectroscopy (OWS), infrared spectroscopy (FT-IR), and scanning electron microscopy (SEM). OWS was able to track the PBLG layer thickness increase in situ, and ex situ FT-IR gave complementary information on the PBLG chain's secondary structure. Transitions in the PBLG growth rate could be correlated with transitions in the polypeptide secondary structure. The emergence of a three-dimensional, anisotropic PBLG morphology within the cylindrical pores of the AAO membrane was also identified as the grafted PBLG average layer thickness increased. Comparison of the PBLG/AAO results with those on a planar silicon dioxide surface indicated that both the conformational transitions and the PBLG nanostructure development could be attributed to the confining geometry within the pores of the nanoporous AAO matrix. The use of a nanoporous AAO matrix, combined with the surface grafting of a thin film of PBLG chains with multiple modifiable side chains, could potentially offer a nanoporous platform with a very high density of functional sites.

A single-chain TALEN architecture for genome engineering.

PubMed

Sun, Ning; Zhao, Huimin

2014-03-04

Transcription-activator like effector nucleases (TALENs) are tailor-made DNA endonucleases and serve as a powerful tool for genome engineering. Site-specific DNA cleavage can be made by the dimerization of FokI nuclease domains at custom-targeted genomic loci, where a pair of TALENs must be positioned in close proximity with an appropriate orientation. However, the simultaneous delivery and coordinated expression of two bulky TALEN monomers (>100 kDa) in cells may be problematic to implement for certain applications. Here, we report the development of a single-chain TALEN (scTALEN) architecture, in which two FokI nuclease domains are fused on a single polypeptide. The scTALEN was created by connecting two FokI nuclease domains with a 95 amino acid polypeptide linker, which was isolated from a linker library by high-throughput screening. We demonstrated that scTALENs were catalytically active as monomers in yeast and human cells. The use of this novel scTALEN architecture should reduce protein payload, simplify design and decrease production cost.

Euclidean perspective on the unfolding of azurin: angular correlations

NASA Astrophysics Data System (ADS)

Warren, Jeffrey J.; Gray, Harry B.; Winkler, Jay R.; Kozak, John J.

2013-12-01

The geometrical model introduced previously by the authors has been extended quantitatively to document changes in angular correlations between and among residues as azurin unfolds. In the early stages of denaturation, these changes are found to be more pronounced than changes in the spatial displacement of residues, a result that is also found for residues acting in concert, viz., α-helices, β-sheet residues and residues in 'turning regions.' Our analysis leads to a picture of the large-scale motion of the polypeptide chain as azurin denatures. Flanking a central 'ribbon' of residues whose orientation remains essentially invariant, we find that in the early stages of unfolding, left- and right-hand 'wings' adjacent to this stationary scaffolding pivot counterclockwise, while smaller regions on opposing ends of the β-barrel pivot clockwise. As spatial constraints characterising the native state are further relaxed, our calculations show that some regions reverse their orientational motion, reflecting the enhanced flexibility of the polypeptide chain in the denatured state.

Residue length and solvation model dependency of elastinlike polypeptides

NASA Astrophysics Data System (ADS)

Bilsel, Mustafa; Arkin, Handan

2010-05-01

We have performed exhaustive multicanonical Monte Carlo simulations of elastinlike polypeptides with a chain including amino acids (valine-proline-glycine-valine-glycine)n or in short (VPGVG)n , where n changes from 1 to 4, in order to investigate the thermodynamic and structural properties. To predict the characteristic secondary structure motifs of the molecules, Ramachandran plots were prepared and analyzed as well. In these studies, we utilized a realistic model where the interactions between all types of atoms were taken into account. Effects of solvation were also simulated by using an implicit-solvent model with two commonly used solvation parameter sets and compared with the vacuum case.

Geometry motivated alternative view on local protein backbone structures.

PubMed

Zacharias, Jan; Knapp, Ernst Walter

2013-11-01

We present an alternative to the classical Ramachandran plot (R-plot) to display local protein backbone structure. Instead of the (φ, ψ)-backbone angles relating to the chemical architecture of polypeptides generic helical parameters are used. These are the rotation or twist angle ϑ and the helical rise parameter d. Plots with these parameters provide a different view on the nature of local protein backbone structures. It allows to display the local structures in polar (d, ϑ)-coordinates, which is not possible for an R-plot, where structural regimes connected by periodicity appear disconnected. But there are other advantages, like a clear discrimination of the handedness of a local structure, a larger spread of the different local structure domains--the latter can yield a better separation of different local secondary structure motives--and many more. Compared to the R-plot we are not aware of any major disadvantage to classify local polypeptide structures with the (d, ϑ)-plot, except that it requires some elementary computations. To facilitate usage of the new (d, ϑ)-plot for protein structures we provide a web application (http://agknapp.chemie.fu-berlin.de/secsass), which shows the (d, ϑ)-plot side-by-side with the R-plot. © 2013 The Protein Society.

Reversible thermal denaturation of a 60-kDa genetically engineered beta-sheet polypeptide.

PubMed

Lednev, Igor K; Ermolenkov, Vladimir V; Higashiya, Seiichiro; Popova, Ludmila A; Topilina, Natalya I; Welch, John T

2006-11-15

A de novo 687-amino-acid residue polypeptide with a regular 32-amino-acid repeat sequence, (GA)(3)GY(GA)(3)GE(GA)(3)GH(GA)(3)GK, forms large beta-sheet assemblages that exhibit remarkable folding properties and, as well, form fibrillar structures. This construct is an excellent tool to explore the details of beta-sheet formation yielding intimate folding information that is otherwise difficult to obtain and may inform folding studies of naturally occurring materials. The polypeptide assumes a fully folded antiparallel beta-sheet/turn structure at room temperature, and yet is completely and reversibly denatured at 125 degrees C, adopting a predominant polyproline II conformation. Deep ultraviolet Raman spectroscopy indicated that melting/refolding occurred without any spectroscopically distinct intermediates, yet the relaxation kinetics depend on the initial polypeptide state, as would be indicative of a non-two-state process. Thermal denaturation and refolding on cooling appeared to be monoexponential with characteristic times of approximately 1 and approximately 60 min, respectively, indicating no detectable formation of hairpin-type nuclei in the millisecond timescale that could be attributed to nonlocal "nonnative" interactions. The polypeptide folding dynamics agree with a general property of beta-sheet proteins, i.e., initial collapse precedes secondary structure formation. The observed folding is much faster than expected for a protein of this size and could be attributed to a less frustrated free-energy landscape funnel for folding. The polypeptide sequence suggests an important balance between the absence of strong nonnative contacts (salt bridges or hydrophobic collapse) and limited repulsion of charged side chains.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Uozumi, Naoki; Matsumoto, Hotaru; Saitoh, Hisato, E-mail: hisa@kumamoto-u.ac.jp

The amino-nucleoside antibiotic, puromycin, acts by covalently linking to elongating polypeptide chains on ribosomes to generate prematurely terminated immature polypeptides. The trafficking of puromycin-conjugated (puromycylated) immature polypeptides within cell has, however, remained elusive. In this study, using O-propargyl-puromycin (OP-Puro), the distribution of puromycylated polypeptides was assessed in HeLa cells by click chemistry. Under standard culture conditions, OP-Puro signals were detected in the cytoplasm and nucleus with the highest concentrations in the nucleolus. Intriguingly, when proteasome activities were aborted using MG132, OP-Puro signals began to accumulate at promyelocytic leukemia nuclear bodies (PML-NBs) in addition to the nucleolus. We also found promiscuousmore » association of OP-Puro signals with SUMO-2/3 and ubiquitin at PML-NBs, but not at the nucleolus, during abortive proteasome activities. This study reveals a previously unknown distribution of OP-Puro that argues for a nuclear function in regulating immature protein homeostasis. -- Highlights: •Click chemistry detects O-propargyl-puromycin (OP-Puro) signals in the nucleus. •OP-Puro accumulates at PML-NBs during abortive proteasome activities. •SUMO and ubiquitin are promiscuously associated with OP-Puro at PML-NBs. •The nucleus may function in immature protein homeostasis.« less

Elastin as a self-organizing biomaterial: use of recombinantly expressed human elastin polypeptides as a model for investigations of structure and self-assembly of elastin.

PubMed

Keeley, Fred W; Bellingham, Catherine M; Woodhouse, Kimberley A

2002-02-28

Elastin is the major extracellular matrix protein of large arteries such as the aorta, imparting characteristics of extensibility and elastic recoil. Once laid down in tissues, polymeric elastin is not subject to turnover, but is able to sustain its mechanical resilience through thousands of millions of cycles of extension and recoil. Elastin consists of ca. 36 domains with alternating hydrophobic and cross-linking characteristics. It has been suggested that these hydrophobic domains, predominantly containing glycine, proline, leucine and valine, often occurring in tandemly repeated sequences, are responsible for the ability of elastin to align monomeric chains for covalent cross-linking. We have shown that small, recombinantly expressed polypeptides based on sequences of human elastin contain sufficient information to self-organize into fibrillar structures and promote the formation of lysine-derived cross-links. These cross-linked polypeptides can also be fabricated into membrane structures that have solubility and mechanical properties reminiscent of native insoluble elastin. Understanding the basis of the self-organizational ability of elastin-based polypeptides may provide important clues for the general design of self-assembling biomaterials.

Characterization of mutants expressing thermostable D1 and D2 polypeptides of photosystem II in the cyanobacterium Synechococcus elongatus PCC 7942.

PubMed

Haraguchi, Norihisa; Kaseda, Jun; Nakayama, Yasumune; Nagahama, Kazuhiro; Ogawa, Takahira; Matsuoka, Masayoshi

2018-06-08

Photosystem II complex embedded in thylakoid membrane performs oxygenic photosynthesis where the reaction center D1/D2 heterodimer accommodates all components of the electron transport chain. To express thermostable D1/D2 heterodimer in a cyanobacterium Synechococcus elongatus PCC 7942, we constructed a series of mutant strains whose psbA1 and psbD1 genes encoding, respectively, the most highly expressed D1 and D2 polypeptides were replaced with those of a thermophilic strain, Thermosynechococcus vulcanus. Because the C-terminal 16 amino acid sequences of D1 polypeptides should be processed prior to maturation but diverge from each other, we also constructed the psbA1ΔC-replaced strain expressing a thermostable D1 polypeptide devoid of the C-terminal extension. The psbA1/psbD1-replaced strain showed decreased growth rate and oxygen evolution rate, suggesting inefficient photosystem II. Immunoblot analyses for thermostable D1, D2 polypeptides revealed that the heterologous D1 protein was absent in thylakoid membrane from any mutant strains with psbA1, psbA1ΔC, and psbA1/psbD1-replacements, whereas the heterologous D2 protein was present in thylakoid membrane as well as purified photosystem II complex from the psbA1/psbD1-replaced strain. In the latter strain, the compensatory expression of psbA3 and psbD2 genes was elevated. These data suggest that heterologous D2 polypeptide could be combined with the host D1 polypeptide to form chimeric D1/D2 heterodimer, whereas heterologous D1 polypeptide even without the C-terminal extension was unable to make complex with the host D2 polypeptide. Since the heterologous D1 could not be detected even in the whole cells of psbA1/psbD1-replaced strain, the rapid degradation of unprocessed or unassembled heterologous D1 was implicated. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Differential effects of Phe19 and Phe20 on fibril formation by amyloidogenic peptide A beta 16-22 (Ac-KLVFFAE-NH2).

PubMed

Inouye, Hideyo; Gleason, Katherine A; Zhang, Dong; Decatur, Sean M; Kirschner, Daniel A

2010-08-01

The sequence KLVFFAE (A beta 16-22) in Alzheimer's beta-amyloid is thought to be a core beta-structure that could act as a template for folding other parts of the polypeptide or molecules into fibrillar assemblies rich in beta-sheet. To elucidate the mechanism of the initial folding process, we undertook combined X-ray fiber/powder diffraction and infrared (IR) spectroscopy to analyze lyophilized A beta 16-22 and solubilized/dried peptide containing nitrile probes at F19 and/or F20. Solubilized/dried wild-type (WT) A beta 16-22 and the peptide containing cyanophenylalanine at F19 (19CN) or at F20 (20CN) gave fiber patterns consistent with slab-like beta-crystallites that were cylindrically averaged around the axis parallel to the polypeptide chain direction. The WT and 19CN assemblies showed 30-A period arrays arising from the stacking of the slabs along the peptide chain direction, whereas the 20CN assemblies lacked any such stacking. The electron density projection along the peptide chain direction indicated similar side-chain dispositions for WT and 20CN, but not for 19CN. These X-ray results and modeling imply that in the assembly of WT A beta 16-22 the F19 side chain is localized within the intersheet space and is involved in hydrophobic contact with amino acids across the intersheet space, whereas the F20 side chain localized near the slab surface is less important for the intersheet interaction, but involved in slab stacking. IR observations for the same peptides in dilute solution showed a greater degree of hydrogen bonding for the nitrile groups in 20CN than in 19CN, supporting this interpretation. (c) 2010 Wiley-Liss, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ackerman, P. J.; van de Lagemaat, J.; Smalyukh, I. I.

Some of the most exotic condensed matter phases, such as twist grain boundary and blue phases in liquid crystals and Abrikosov phases in superconductors, contain arrays of topological defects in their ground state. Comprised of a triangular lattice of double-twist tubes of magnetization, the so-called ‘A-phase’ in chiral magnets is an example of a thermodynamically stable phase with topologically nontrivial solitonic field configurations referred to as two-dimensional skyrmions, or baby-skyrmions. Here we report that three-dimensional skyrmions in the form of double-twist tori called ‘hopfions’, or ‘torons’ when accompanied by additional self-compensating defects, self-assemble into periodic arrays and linear chains thatmore » exhibit electrostriction. In confined chiral nematic liquid crystals, this self-assembly is similar to that of liquid crystal colloids and originates from long-range elastic interactions between particle-like skyrmionic torus knots of molecular alignment field, which can be tuned from isotropic repulsive to weakly or highly anisotropic attractive by low-voltage electric fields.« less

Expectation values of twist fields and universal entanglement saturation of the free massive boson

NASA Astrophysics Data System (ADS)

Blondeau-Fournier, Olivier; Doyon, Benjamin

2017-07-01

The evaluation of vacuum expectation values (VEVs) in massive integrable quantum field theory (QFT) is a nontrivial renormalization-group ‘connection problem’—relating large and short distance asymptotics—and is in general unsolved. This is particularly relevant in the context of entanglement entropy, where VEVs of branch-point twist fields give universal saturation predictions. We propose a new method to compute VEVs of twist fields associated to continuous symmetries in QFT. The method is based on a differential equation in the continuous symmetry parameter, and gives VEVs as infinite form-factor series which truncate at two-particle level in free QFT. We verify the method by studying U(1) twist fields in free models, which are simply related to the branch-point twist fields. We provide the first exact formulae for the VEVs of such fields in the massive uncompactified free boson model, checking against an independent calculation based on angular quantization. We show that logarithmic terms, overlooked in the original work of Callan and Wilczek (1994 Phys. Lett. B 333 55-61), appear both in the massless and in the massive situations. This implies that, in agreement with numerical form-factor observations by Bianchini and Castro-Alvaredo (2016 Nucl. Phys. B 913 879-911), the standard power-law short-distance behavior is corrected by a logarithmic factor. We discuss how this gives universal formulae for the saturation of entanglement entropy of a single interval in near-critical harmonic chains, including loglog corrections.

Multimodal switching of conformation and solubility in homocysteine derived polypeptides.

PubMed

Kramer, Jessica R; Deming, Timothy J

2014-04-16

We report the design and synthesis of poly(S-alkyl-L-homocysteine)s, which were found to be a new class of readily prepared, multiresponsive polymers that possess the unprecedented ability to respond in different ways to different stimuli, either through a change in chain conformation or in water solubility. The responsive properties of these materials are also effected under mild conditions and are completely reversible for all pathways. The key components of these polymers are the incorporation of water solubilizing alkyl functional groups that are integrated with precisely positioned, multiresponsive thioether linkages. This promising system allows multimodal switching of polypeptide properties to obtain desirable features, such as coupled responses to multiple external inputs.

Density functional theory study of the conformational space of an infinitely long polypeptide chain

NASA Astrophysics Data System (ADS)

Ireta, Joel; Scheffler, Matthias

2009-08-01

The backbone conformational space of infinitely long polyalanine is investigated with density-functional theory and mapping the potential energy surface in terms of (L, θ) cylindrical coordinates. A comparison of the obtained (L, θ) Ramachandran-like plot with results from an extended set of protein structures shows excellent conformity, with the exception of the polyproline II region. It is demonstrated the usefulness of infinitely long polypeptide models for investigating the influence of hydrogen bonding and its cooperative effect on the backbone conformations. The results imply that hydrogen bonding together with long-range electrostatics is the main actuator for most of the structures assumed by protein residues.

The Multiple-Minima Problem in Protein Folding

NASA Astrophysics Data System (ADS)

Scheraga, Harold A.

1991-10-01

The conformational energy surface of a polypeptide or protein has many local minima, and conventional energy minimization procedures reach only a local minimum (near the starting point of the optimization algorithm) instead of the global minimum (the multiple-minima problem). Several procedures have been developed to surmount this problem, the most promising of which are: (a) build up procedure, (b) optimization of electrostatics, (c) Monte Carlo-plus-energy minimization, (d) electrostatically-driven Monte Carlo, (e) inclusion of distance restraints, (f) adaptive importance-sampling Monte Carlo, (g) relaxation of dimensionality, (h) pattern-recognition, and (i) diffusion equation method. These procedures have been applied to a variety of polypeptide structural problems, and the results of such computations are presented. These include the computation of the structures of open-chain and cyclic peptides, fibrous proteins and globular proteins. Present efforts are being devoted to scaling up these procedures from small polypeptides to proteins, to try to compute the three-dimensional structure of a protein from its amino sequence.

BAG-6 is essential for selective elimination of defective proteasomal substrates

PubMed Central

Minami, Ryosuke; Hayakawa, Atsuko; Kagawa, Hiroki; Yanagi, Yuko; Yokosawa, Hideyoshi

2010-01-01

BAG-6/Scythe/BAT3 is a ubiquitin-like protein that was originally reported to be the product of a novel gene located within the human major histocompatibility complex, although the mechanisms of its function remain largely obscure. Here, we demonstrate the involvement of BAG-6 in the degradation of a CL1 model defective protein substrate in mammalian cells. We show that BAG-6 is essential for not only model substrate degradation but also the ubiquitin-mediated metabolism of newly synthesized defective polypeptides. Furthermore, our in vivo and in vitro analysis shows that BAG-6 interacts physically with puromycin-labeled nascent chain polypeptides and regulates their proteasome-mediated degradation. Finally, we show that knockdown of BAG-6 results in the suppressed presentation of MHC class I on the cell surface, a procedure known to be affected by the efficiency of metabolism of defective ribosomal products. Therefore, we propose that BAG-6 is necessary for ubiquitin-mediated degradation of newly synthesized defective polypeptides. PMID:20713601

Primary structure of inorganic polyphosphate/ATP-NAD kinase from Micrococcus flavus, and occurrence of substrate inorganic polyphosphate for the enzyme.

PubMed

Kawai, Shigeyuki; Mori, Shigetarou; Murata, Kousaku

2003-08-01

The gene encoding an inorganic polyphosphate/ATP-NAD kinase was cloned from Micrococcus flavus, and its primary structure was analyzed. Alignment of the primary structure with those of other characterized NAD kinases revealed candidate amino acid residues, mainly charged ones, that would be related to inorganic polyphosphate use. The alignment also showed that the primary structure found carried a protruding C-terminal polypeptide. Although the C-terminal polypeptide was demonstrated to be dispensable for the kinase activities, and was proposed to be removed in M. flavus, the entire primary structure including the C-terminal polypeptide was homologous with that of the ATP synthase beta chain. The inorganic polyphosphate used by the inorganic polyphosphate/ATP-NAD kinase as a phosphoryl donor was isolated from cells of M. flavus, suggesting that the ability of the enzyme to use inorganic polyphosphate is of physiological significance and is not an evolutionary trait alone.

Controlled conjugated backbone twisting for an increased open-circuit voltage while having a high short-circuit current in poly(hexylthiophene) derivatives.

PubMed

Ko, Sangwon; Hoke, Eric T; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D; Brédas, Jean-Luc; Salleo, Alberto; Bao, Zhenan

2012-03-21

Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone--due to an increase in the polymer ionization potential--while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2':5',2''-terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C(71)-butyric acid methyl ester (PC(71)BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current.

Toughening of Thermoresponsive Arrested Networks of Elastin-Like Polypeptides To Engineer Cytocompatible Tissue Scaffolds.

PubMed

Glassman, Matthew J; Avery, Reginald K; Khademhosseini, Ali; Olsen, Bradley D

2016-02-08

Formulation of tissue engineering or regenerative scaffolds from simple bioactive polymers with tunable structure and mechanics is crucial for the regeneration of complex tissues, and hydrogels from recombinant proteins, such as elastin-like polypeptides (ELPs), are promising platforms to support these applications. The arrested phase separation of ELPs has been shown to yield remarkably stiff, biocontinuous, nanostructured networks, but these gels are limited in applications by their relatively brittle nature. Here, a gel-forming ELP is chain-extended by telechelic oxidative coupling, forming extensible, tough hydrogels. Small angle scattering indicates that the chain-extended polypeptides form a fractal network of nanoscale aggregates over a broad concentration range, accessing moduli ranging from 5 kPa to over 1 MPa over a concentration range of 5-30 wt %. These networks exhibited excellent erosion resistance and allowed for the diffusion and release of encapsulated particles consistent with a bicontinuous, porous structure with a broad distribution of pore sizes. Biofunctionalized, toughened networks were found to maintain the viability of human mesenchymal stem cells (hMSCs) in 2D, demonstrating signs of osteogenesis even in cell media without osteogenic molecules. Furthermore, chondrocytes could be readily mixed into these gels via thermoresponsive assembly and remained viable in extended culture. These studies demonstrate the ability to engineer ELP-based arrested physical networks on the molecular level to form reinforced, cytocompatible hydrogel matrices, supporting the promise of these new materials as candidates for the engineering and regeneration of stiff tissues.

Saethre-Chotzen syndrome, Pro136His TWIST mutation, hearing loss, and external and middle ear structural anomalies: report on a Brazilian family.

PubMed

Lamônica, Dionísia A C; Maximino, Luciana P; Feniman, Mariza Ribeiro; Silva, Greyce K; Zanchetta, Sthella; Abramides, Dagma V M; Passos-Bueno, Maria Rita; Rocha, Kátia; Richieri-Costa, Antonio

2010-09-01

To describe the clinical, speech, hearing, and imaging findings in three members of a Brazilian family with Saethre-Chotzen syndrome (SCS) who presented some unusual characteristics within the spectrum of the syndrome. Clinical evaluation was performed by a multidisciplinary team. Direct sequencing of the polymerase chain reaction-amplified coding region of the TWIST1 gene, routine and electrophysiological hearing evaluation, speech evaluation, and imaging studies through computed tomography (CT) scan and magnetic resonance imaging (MRI) were performed. TWIST1 gene analysis revealed a Pro136His mutation in all patients. Hearing evaluation showed peripherial and mixed hearing loss in two of the patients, one of them with severe unilateral microtia. Computed tomography scan showed structural middle ear anomalies, and MRI showed distortion of the skull contour as well as some of the brain structures. We report a previously undescribed TWIST1 gene mutation in patients with SCS. There is evidence that indicates hearing loss (conductive and mixed) can be related both with middle ear (microtia, high jugular bulb, and enlarged vestibules) as well as with brain stem anomalies. Here we discuss the relationship between the gene mutation and the clinical, imaging, speech, and hearing findings.

Self-assembling Polypeptide Nanoparticles: Design, Synthesis, Biophysical Characterization and Biomedical Applications

NASA Astrophysics Data System (ADS)

Araujo Pereira Falcao Pimentel, Tais de

Inspired by the architecture of icosahedral viruses, self-assembling polypeptide nanoparticles (SAPN) with icosahedral symmetry were developed. The building block for the SAPN was a single polypeptide chain. Similarly, the capsid of quite a few small viruses are built from one single peptide chain. The polypeptide chain of the SAPN consists of a pentameric coiled-coil domain at the N-terminus joined by a short linker segment to a trimeric coiled-coil domain at the C-terminus. Here we have studied factors governing self-assembly of the SAPN such as linker constitution and trimer length. The interdomain linker 2i88 afforded the most homogenous nanoparticles as verified by TEM and DLS. Furthermore, AUC and STEM analyses suggest that the nanoparticles formed using the linker 2i88 have a T=3-like architecture confirming computer modeling predictions. As for trimer length, we have shown that it is possible to synthesize SAPN with a trimer that is as short as only 17 amino acids. Given that the N-terminus and C-terminus of the SAPN can be extended to include epitopes and give rise to a repetitive antigen display system, vaccine applications of the SAPN were also investigated here. We grafted parts of the SARS virus' spike protein onto our SAPN to repetitively display this B-cell epitope. Biophysical characterization showed that single nanoparticles of the expected size range were formed. Immunization experiments in mice at University of Colorado Denver revealed that the antibodies elicited were conformation-specific. Moreover, the antibodies significantly inhibited SARS virus infection of Vero E6 cells. SAPN were also functionalized at the C-terminus with a B-cell epitope from the circumsporozoite protein (CSP) of the malaria parasite Plasmodium falciparum and at the N-terminus with CTL epitopes from CSP. The trimeric coiled-coil domains of these malaria SAPN were modified to include a HTL epitope. Even will all these modifications, self-assembly occurred as confirmed by TEM and DLS. In immunization experiments performed at WRAIR good immune responses were obtained. Another biomedical application of SAPN is the development of a peptide-based serodiagnostic assay for tuberculosis (Tb). In an ELISA format, Tb-SAPN showed modest responses in serodiagnosis of Tb.

High-resolution protein design with backbone freedom.

PubMed

Harbury, P B; Plecs, J J; Tidor, B; Alber, T; Kim, P S

1998-11-20

Recent advances in computational techniques have allowed the design of precise side-chain packing in proteins with predetermined, naturally occurring backbone structures. Because these methods do not model protein main-chain flexibility, they lack the breadth to explore novel backbone conformations. Here the de novo design of a family of alpha-helical bundle proteins with a right-handed superhelical twist is described. In the design, the overall protein fold was specified by hydrophobic-polar residue patterning, whereas the bundle oligomerization state, detailed main-chain conformation, and interior side-chain rotamers were engineered by computational enumerations of packing in alternate backbone structures. Main-chain flexibility was incorporated through an algebraic parameterization of the backbone. The designed peptides form alpha-helical dimers, trimers, and tetramers in accord with the design goals. The crystal structure of the tetramer matches the designed structure in atomic detail.

Expanding the Bethe/Gauge dictionary

NASA Astrophysics Data System (ADS)

Bullimore, Mathew; Kim, Hee-Cheol; Lukowski, Tomasz

2017-11-01

We expand the Bethe/Gauge dictionary between the XXX Heisenberg spin chain and 2d N = (2, 2) supersymmetric gauge theories to include aspects of the algebraic Bethe ansatz. We construct the wave functions of off-shell Bethe states as orbifold defects in the A-twisted supersymmetric gauge theory and study their correlation functions. We also present an alternative description of off-shell Bethe states as boundary conditions in an effective N = 4 supersymmetric quantum mechanics. Finally, we interpret spin chain R-matrices as correlation functions of Janus interfaces for mass parameters in the supersymmetric quantum mechanics.

Precise structural analysis of α-helical polypeptide by quantum-chemical calculation related to reciprocal side-chain combination of two L-phenylalanine residues

NASA Astrophysics Data System (ADS)

Niimura, Subaru; Kurosu, Hiromichi; Shoji, Akira

2010-04-01

To clarify the positive role of side-chain conformation in the stability of protein secondary structure (main-chain conformation), we successfully calculated the optimization structure of a series of well-defined α-helical octadecapeptides composed of two L-phenylalanine (Phe) and 16 L-alanine (Ala) residues, based on the molecular orbital calculation with density functional theory (DFT/B3LYP/6-31G(d)). From the total energy calculation and the precise secondary structural analysis, we found that the conformational stability of the α-helix is closely related to the reciprocal side-chain combinations (such as positional relation and side-chain conformation) of two Phe residues in this system. Furthermore, we demonstrated that the 1H, 13C, 15N and 17O isotropic chemical shifts of each Phe residue depend on the respective side-chain conformations of the Phe residue.

Biopolymers Containing Unnatural Amino Acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schultz, Peter

Although the main chain structure of polymers has a profound effect on their materials properties, the side groups can also have dramatic effects on their properties including conductivity, liquid crystallinity, hydrophobicity, elasticity and biodegradability. Unfortunately control over the side chain structure of polymers remains a challenge – it is difficult to control the sequence of chain elongation when mixtures of monomers are polymerized, and postpolymerization side chain modification is made difficult by polymer effects on side chain reactivity. In contrast, the mRNA templated synthesis of polypeptides on the ribosome affords absolute control over the primary sequence of the twenty aminomore » acid monomers. Moreover, the length of the biopolymer is precisely controlled as are sites of crosslinking. However, whereas synthetic polymers can be synthesized from monomers with a wide range of chemically defined structures, ribosomal biosynthesis is largely limited to the 20 canonical amino acids. For many applications in material sciences, additional building blocks would be desirable, for example, amino acids containing metallocene, photoactive, and halogenated side chains. To overcome this natural constraint we have developed a method that allows unnatural amino acids, beyond the common twenty, to be genetically encoded in response to nonsense or frameshift codons in bacteria, yeast and mammalian cells with high fidelity and good yields. Here we have developed methods that allow identical or distinct noncanonical amino acids to be incorporated at multiple sites in a polypeptide chain, potentially leading to a new class of templated biopolymers. We have also developed improved methods for genetically encoding unnatural amino acids. In addition, we have genetically encoded new amino acids with novel physical and chemical properties that allow selective modification of proteins with synthetic agents. Finally, we have evolved new metal-ion binding sites in proteins using a novel metal-ion binding amino acid, which may facilitate our ability to generate new protein based sensors and catalysts.« less

Surface structural conformations of fibrinogen polypeptides for improved biocompatibility.

PubMed

Yaseen, Mohammed; Zhao, Xiubo; Freund, Amy; Seifalian, Alexander M; Lu, Jian R

2010-05-01

This work reports on how incorporation of silica nanocages into poly(urethane) copolymers (PU) affects conformational orientations of adsorbed fibrinogen and how different surfaces subsequently influenced HeLa cell attachment and proliferation. Incorporation of 2 wt% silica nanocages into poly(urethane) (PU4) substantially altered the surface topography of the films and some 50% of the surface was covered with the nanocages due to their preferential exposure. AFM studies revealed the deposition of a dense protein network on the soft polymeric domains of PU4 and much reduced fibrinogen adsorption on the hard nanocage domains. As on the bare SiO(2) control surface, fibrinogen molecules adsorbed on top of the hard nanocages mainly took the dominant trinodular structures in monomeric and dimeric forms. In addition, net positively charged long alpha chains were prone to being hidden beneath the D domains whilst gamma chains predominantly remained exposed. Dynamic interfacial adsorption as probed by spectroscopic ellipsometry revealed fast changes in interfacial conformation induced by electrostatic interactions between different segments of fibrinogen and the surface, consistent with the AFM imaging. On the PU surfaces without nanocage incorporation (PUA), however, adsorbed fibrinogen molecules formed beads-like chain networks, consistent with the structure featured on the soft PU4 domains, showing very different effects of surface chemical nature. Monoclonal antibodies specific to the alpha and gamma chains showed reduced alpha but increased gamma chain binding at the silicon oxide control and PU4 surfaces, whilst on the PUA, C18 and amine surfaces (organic surface controls) the opposite binding trend was detected with alpha chain binding dominant, showing different fibrinogen conformations. Cell attachment studies revealed differences in cell attachment and proliferation, consistent with the different polypeptide conformations on the two types of surfaces, showing a strong preference to the extent of exposure of gamma chains. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

Biopolymers Containing Unnatural Building Blocks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schultz, Peter G.

2013-06-30

Although the main chain structure of polymers has a profound effect on their materials properties, the side groups can also have dramatic effects on their properties including conductivity, liquid crystallinity, hydrophobicity, elasticity and biodegradability. Unfortunately control over the side chain structure of polymers remains a challenge – it is difficult to control the sequence of chain elongation when mixtures of monomers are polymerized, and postpolymerization side chain modification is made difficult by polymer effects on side chain reactivity. In contrast, the mRNA templated synthesis of polypeptides on the ribosome affords absolute control over the primary sequence of the twenty aminomore » acid monomers. Moreover, the length of the biopolymer is precisely controlled as are sites of crosslinking. However, whereas synthetic polymers can be synthesized from monomers with a wide range of chemically defined structures, ribosomal biosynthesis is largely limited to the 20 canonical amino acids. For many applications in material sciences, additional building blocks would be desirable, for example, amino acids containing metallocene, photoactive, and halogenated side chains. To overcome this natural constraint we have developed a method that allows unnatural amino acids, beyond the common twenty, to be genetically encoded in response to nonsense or frameshift codons in bacteria, yeast and mammalian cells with high fidelity and good yields. Here we have developed methods that allow identical or distinct noncanonical amino acids to be incorporated at multiple sites in a polypeptide chain, potentially leading to a new class of templated biopolymers. We have also developed improved methods for genetically encoding unnatural amino acids. In addition, we have genetically encoded new amino acids with novel physical and chemical properties that allow selective modification of proteins with synthetic agents. Finally, we have evolved new metal-ion binding sites in proteins using a novel metal-ion binding amino acid, which may facilitate our ability to generate new protein based sensors and catalysts.« less

Discovery of J Chain in African Lungfish (Protopterus dolloi, Sarcopterygii) Using High Throughput Transcriptome Sequencing: Implications in Mucosal Immunity

PubMed Central

Tacchi, Luca; Larragoite, Erin; Salinas, Irene

2013-01-01

J chain is a small polypeptide responsible for immunoglobulin (Ig) polymerization and transport of Igs across mucosal surfaces in higher vertebrates. We identified a J chain in dipnoid fish, the African lungfish (Protopterus dolloi) by high throughput sequencing of the transcriptome. P. dolloi J chain is 161 aa long and contains six of the eight Cys residues present in mammalian J chain. Phylogenetic studies place the lungfish J chain closer to tetrapod J chain than to the coelacanth or nurse shark sequences. J chain expression occurs in all P. dolloi immune tissues examined and it increases in the gut and kidney in response to an experimental bacterial infection. Double fluorescent in-situ hybridization shows that 88.5% of IgM+ cells in the gut co-express J chain, a significantly higher percentage than in the pre-pyloric spleen. Importantly, J chain expression is not restricted to the B-cell compartment since gut epithelial cells also express J chain. These results improve our current view of J chain from a phylogenetic perspective. PMID:23967082

Casein hydrolysate augments antimicrobial and antioxidative efficacy of cheddar whey based edible coating of retail-cut beefsteak

USDA-ARS?s Scientific Manuscript database

Hydrolysis of casein using chymotrypsin results in the formation of polypeptides (casein hydrolyzate, CH) with a hydrophobic aromatic amino acid on one end of the chain because the enzyme selectively cleaves the adjacent peptide-bond. Due to resonance of the aromatic micro-domain, thiols become redo...

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Semisynthetic protein nanoreactor for single-molecule chemistry

PubMed Central

Lee, Joongoo; Bayley, Hagan

2015-01-01

The covalent chemistry of individual reactants bound within a protein pore can be monitored by observing the ionic current flow through the pore, which acts as a nanoreactor responding to bond-making and bond-breaking events. In the present work, we incorporated an unnatural amino acid into the α-hemolysin (αHL) pore by using solid-phase peptide synthesis to make the central segment of the polypeptide chain, which forms the transmembrane β-barrel of the assembled heptamer. The full-length αHL monomer was obtained by native chemical ligation of the central synthetic peptide to flanking recombinant polypeptides. αHL pores with one semisynthetic subunit were then used as nanoreactors for single-molecule chemistry. By introducing an amino acid with a terminal alkyne group, we were able to visualize click chemistry at the single-molecule level, which revealed a long-lived (4.5-s) reaction intermediate. Additional side chains might be introduced in a similar fashion, thereby greatly expanding the range of single-molecule covalent chemistry that can be investigated by the nanoreactor approach. PMID:26504203

Glucose-dependent insulinotropic polypeptide lowers branched chain amino acids in hyperglycemic rats.

PubMed

Spégel, Peter; Lindqvist, Andreas; Sandberg, Monica; Wierup, Nils

2014-02-10

Hypersecretion of the incretin hormone glucose-dependent insulinotropic polypeptide (GIP) has been associated with obesity and glucose intolerance. This condition has been suggested to be linked to GIP resistance. Besides its insulinotropic effect, GIP also directly affects glucose uptake and lipid metabolism. This notwithstanding, effects of GIP on other circulating metabolites than glucose have not been thoroughly investigated. Here, we examined effects of infusion of various concentrations of GIP in normo- and hyperglycemic rats on serum metabolite profiles. We found that, despite a decrease in serum glucose levels (-26%, p<0.01), the serum metabolite profile was largely unaffected by GIP infusion in normoglycemic rats. Interestingly, levels of branched chain amino acids and the ketone body β-hydroxybutyrate were decreased by 21% (p<0.05) and 27% (p<0.001), respectively, in hyperglycemic rats infused with 60 ng/ml GIP. Hence, our data suggest that GIP provokes a decrease in BCAA levels and ketone body production. Increased concentrations of these metabolites have been associated with obesity and T2D. Copyright © 2014. Published by Elsevier B.V.

The turn of the screw: an exercise in protein secondary structure.

PubMed

Pikaart, Michael

2011-01-01

An exercise using simple paper strips to illustrate protein helical and sheet secondary structures is presented. Drawing on the rich historical context of the use of physical models in protein biochemistry by early practitioners, in particular Linus Pauling, the purpose of this activity is to cultivate in students a hands-on, intuitive sense of protein secondary structure and to complement the common computer-based structural portrayals often used in teaching biochemistry. As students fold these paper strips into model secondary structures, they will better grasp how intramolecular hydrogen bonds form in the folding of a polypeptide into secondary structure, and how these hydrogen bonds direct the overall shape of helical and sheet structures, including the handedness of the α-helix and the difference between right- and the left-handed twist. Copyright © 2010 Wiley Periodicals, Inc.

Synthesis and studies of polypeptide materials: Enantioselective polymerization of gamma-benzyl glutamate-N-carboxyanhydride and synthesis of optically active poly(beta-peptides)

NASA Astrophysics Data System (ADS)

Cheng, Jianjun

A class of zero-valent transition metal complexes have been developed by Deming et al for the controlled polymerization of alpha-aminoacid-N-carboxyanhydrides (alpha-NCAs). This discovery provided a superior starting point for the development of enantioselective polymerizations of racemic alpha-NCAs. Bidentate chiral ligands were synthesized and tested for their abilities to induce enantioselective polymerization of gamma-benzyl-glutamate NCA (Glu NCA) when they were coordinated to zero-valent nickel complexes. When optically active 2-pyridinyl oxazoline ligands were mixed with bis(1,5-cyclooctadiene)nickel in THF, chiral nickel complexes were formed that selectively polymerized one enantiomer of Glu NCA over the other. The highest selectivity was observed with the nickel complex of (S)-4-tert-butyl-2-pyridinyl oxazoline, which gave a ratio of enantiomeric polymerization rate constants (kD/kL) of 5.2. It was found that subtle modification of this ligand by incorporation of additional substituents had a substantial impact on initiator enantioselectivities. In separate efforts, methodology was developed for the general synthesis of optically active beta-aminoacid-N-carboxyanhydrides (beta-NCAs) via cyclization of Nbeta-Boc- or Nbeta-Cbz-beta-amino acids using phosphorus tribromide. The beta-NCA molecules could be polymerized in good yields using strong bases or transition metal complexes to give optically active poly(beta-peptides) bearing proteinogenic side chains. The resulting poly(beta-peptides), which have moderate molecular weights, adopt stable helical conformations in solution. Poly(beta-homoglutamate and poly(beta-homolysine), the side-chain deprotected polymers, were found to display pH dependent helix-coil conformation transitions in aqueous solution, similar to their alpha-analogs. A novel method for poly(beta-aspartate) synthesis was developed via the polymerization of L-aspartate alkyl ester beta lactams using metal-amido complexes. Poly(beta-aspartates) bearing short ethylene glycol side chains were obtained with controlled molecular weights and narrow molecular weight distributions when Sc(N(TMS)2)3 was used as initiator for the beta-lactam polymerizations. Polymer chain lengths could be controlled by both stoichiometry and monomer conversion, characteristic of a living polymerization system. Di- and tri-block copoly(beta-peptides) with desired chain lengths were also synthesized using this method. It was found that these techniques were generally applicable for the synthesis of poly(beta-peptides), bearing other proteinogetic side chains. Synthesis and studies of polypeptide materials were extended to unexplored areas by incorporation of both alpha- and beta-amino acid residues into single polymer chains. Two sequence specific polypeptides bearing alternating beta-alpha, or beta-alpha-alpha amino acid residues were synthesized. Both polymers were found to adopt unprecedented stable conformations in solution.

Controlled synthesis of phosphorylcholine derivatives of poly(serine) and poly(homoserine).

PubMed

Yakovlev, Ilya; Deming, Timothy J

2015-04-01

We report methods for the synthesis of polypeptides that are fully functionalized with desirable phosphorylcholine, PC, groups. Because of the inherent challenges in the direct incorporation of the PC group into α-amino acid N-carboxyanhydride (NCA) monomers, we developed a synthetic approach that combined functional NCA polymerization with efficient postpolymerization modification. While poly(L-phosphorylcholine serine) was found to be unstable upon synthesis, we successfully prepared poly(L-phosphorylcholine homoserine) with controlled chain lengths and found these to be water-soluble with disordered chain conformations.

Performance of protein-structure predictions with the physics-based UNRES force field in CASP11.

PubMed

Krupa, Paweł; Mozolewska, Magdalena A; Wiśniewska, Marta; Yin, Yanping; He, Yi; Sieradzan, Adam K; Ganzynkowicz, Robert; Lipska, Agnieszka G; Karczyńska, Agnieszka; Ślusarz, Magdalena; Ślusarz, Rafał; Giełdoń, Artur; Czaplewski, Cezary; Jagieła, Dawid; Zaborowski, Bartłomiej; Scheraga, Harold A; Liwo, Adam

2016-11-01

Participating as the Cornell-Gdansk group, we have used our physics-based coarse-grained UNited RESidue (UNRES) force field to predict protein structure in the 11th Community Wide Experiment on the Critical Assessment of Techniques for Protein Structure Prediction (CASP11). Our methodology involved extensive multiplexed replica exchange simulations of the target proteins with a recently improved UNRES force field to provide better reproductions of the local structures of polypeptide chains. All simulations were started from fully extended polypeptide chains, and no external information was included in the simulation process except for weak restraints on secondary structure to enable us to finish each prediction within the allowed 3-week time window. Because of simplified UNRES representation of polypeptide chains, use of enhanced sampling methods, code optimization and parallelization and sufficient computational resources, we were able to treat, for the first time, all 55 human prediction targets with sizes from 44 to 595 amino acid residues, the average size being 251 residues. Complete structures of six single-domain proteins were predicted accurately, with the highest accuracy being attained for the T0769, for which the CαRMSD was 3.8 Å for 97 residues of the experimental structure. Correct structures were also predicted for 13 domains of multi-domain proteins with accuracy comparable to that of the best template-based modeling methods. With further improvements of the UNRES force field that are now underway, our physics-based coarse-grained approach to protein-structure prediction will eventually reach global prediction capacity and, consequently, reliability in simulating protein structure and dynamics that are important in biochemical processes. Freely available on the web at http://www.unres.pl/ CONTACT: has5@cornell.edu. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

2-[Anilino(phen-yl)meth-yl]cyclo-heptan-one.

PubMed

Eftekhari-Sis, Bagher; Mohajer, Sahar; Zirak, Maryam; Mozaffarnia, Sakineh; Büyükgüngör, Orhan

2013-01-01

In the title compound, C20H23NO, the cyclo-hepta-none ring adopts a twist-chair conformation, with the amino-methyl substituent in an equatorial position. The relative configuration of the two stereocenters is R,R. In the crystal, mol-ecules are linked by N-H⋯O hydrogen bonds into chains along [100].

Protein Complexation and pH Dependent Release Using Boronic Acid Containing PEG-Polypeptide Copolymers.

PubMed

Negri, Graciela E; Deming, Timothy J

2017-01-01

New poly(L-lysine)-b-poly(ethylene glycol) copolypeptides have been prepared, where the side-chain amine groups of lysine residues are modified to contain ortho-amine substituted phenylboronic acid, i.e., Wulff-type phenylboronic acid (WBA), groups to improve their pH responsive, carbohydrate binding properties. These block copolymers form nanoscale complexes with glycosylated proteins that are stable at physiological pH, yet dissociate and release the glycoproteins under acidic conditions, similar to those found in endosomal and lysosomal compartments within cells. These results suggest that WBA modified polypeptide copolymers are promising for further development as degradable carriers for intracellular protein delivery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Solubility of structurally complicated materials: 3. Hair.

PubMed

Horvath, Ari L

2009-04-27

Hair is composed of proteins, lipids, water, and small amounts of trace elements. All proteins in animal and human bodies are built from permutations of amino acid molecules in a polypeptide string. The polypeptide chains of protein keratin are organized into filaments in hair cells. Hair is one of the most difficult proteins to digest or solubilize. Among the most common dissolving procedures for hair are acidic, alkaline, and enzymatic hydrolysis. For the analysis of hair, the solid samples are transferred by solubilization via digestion into a liquid phase. Small molecular solvents and molecules with hydrophobic groups appear to have higher affinity for hair. A good solvent attacks the disulfide bonds between cystine molecules and hydrates the hair shaft. Consequently, the hair becomes a jelly-like mass.

Probing the contribution of internal cavities to the volume change of protein unfolding under pressure.

PubMed Central

Frye, K. J.; Royer, C. A.

1998-01-01

The structural origin of the decrease in system volume upon protein denaturation by pressure has remained a puzzle for decades. This negative volume change upon unfolding is assumed to arise globally from more intimate interactions between the polypeptide chain and water, including electrostriction of buried charges that become exposed upon unfolding, hydration of the polypeptide backbone and amino acid side chains and elimination of packing defects and internal void volumes upon unfolding of the chain. However, the relative signs and magnitudes of each of these contributing factors have not been experimentally determined. Our laboratory has probed the fundamental basis for the volume change upon unfolding of staphylococcal nuclease (Snase) using variable solution conditions and point mutants of Snase (Royer CA et al., 1993, Biochemistry 32:5222-5232; Frye KJ et al., 1996, Biochemistry 35:10234-10239). Our prior results indicate that for Snase, neither electrostriction nor polar or nonpolar hydration contributes significantly to the value of the volume change of unfolding. In the present work, we investigate the pressure induced unfolding of three point mutants of Snase in which internal cavity size is altered. The experimentally determined volume changes of unfolding for the mutants suggest that loss of internal void volume upon unfolding represents the major contributing factor to the value of the volume change of Snase unfolding. PMID:9792110

Reduced protein carbonylation of cube steak and catfish fillet using antioxidative coatings containing cheddar whey, casein hydrolyzate and oolong tea extract

USDA-ARS?s Scientific Manuscript database

Hydrolysis of casein using chymotrypsin results in the formation of polypeptides (casein hydrolyzate, CH) with a hydrophobic aromatic amino acid on one end of the chain because the enzyme selectively cleaves the adjacent peptide-bond. Due to resonance of the aromatic micro-domain, thiols become redo...

Elastin-like Polypeptide Linkers for Single-Molecule Force Spectroscopy.

PubMed

Ott, Wolfgang; Jobst, Markus A; Bauer, Magnus S; Durner, Ellis; Milles, Lukas F; Nash, Michael A; Gaub, Hermann E

2017-06-27

Single-molecule force spectroscopy (SMFS) is by now well established as a standard technique in biophysics and mechanobiology. In recent years, the technique has benefitted greatly from new approaches to bioconjugation of proteins to surfaces. Indeed, optimized immobilization strategies for biomolecules and refined purification schemes are being steadily adapted and improved, which in turn has enhanced data quality. In many previously reported SMFS studies, poly(ethylene glycol) (PEG) was used to anchor molecules of interest to surfaces and/or cantilever tips. The limitation, however, is that PEG exhibits a well-known trans-trans-gauche to all-trans transition, which results in marked deviation from standard polymer elasticity models such as the worm-like chain, particularly at elevated forces. As a result, the assignment of unfolding events to protein domains based on their corresponding amino acid chain lengths is significantly obscured. Here, we provide a solution to this problem by implementing unstructured elastin-like polypeptides as linkers to replace PEG. We investigate the suitability of tailored elastin-like polypeptides linkers and perform direct comparisons to PEG, focusing on attributes that are critical for single-molecule force experiments such as linker length, monodispersity, and bioorthogonal conjugation tags. Our results demonstrate that by avoiding the ambiguous elastic response of mixed PEG/peptide systems and instead building the molecular mechanical systems with only a single bond type with uniform elastic properties, we improve data quality and facilitate data analysis and interpretation in force spectroscopy experiments. The use of all-peptide linkers allows alternative approaches for precisely defining elastic properties of proteins linked to surfaces.

Critical role in CXCR4 signaling and internalization of the polypeptide main chain in the amino terminus of SDF-1α probed by novel N-methylated synthetically and modularly modified chemokine analogues.

PubMed

Dong, Chang-Zhi; Tian, Shaomin; Choi, Won-Tak; Kumar, Santhosh; Liu, Dongxiang; Xu, Yan; Han, Xiaofeng; Huang, Ziwei; An, Jing

2012-07-31

The replication of human immunodeficiency virus type 1 (HIV-1) can be profoundly inhibited by the natural ligands of two major HIV-1 coreceptors, CXCR4 and CCR5. Stromal cell-derived factor-1α (SDF-1α) is a natural ligand of CXCR4. We have recently developed a synthetic biology approach of using synthetically and modularly modified (SMM)-chemokines to dissect various aspects of the structure-function relationship of chemokines and their receptors. Here, we used this approach to design novel SMM-SDF-1α analogues containing unnatural N-methylated residues in the amino terminus to investigate whether the polypeptide main chain amide bonds in the N-terminus of SDF-1α play a role in SDF-1α signaling via CXCR4 and/or receptor internalization. The results show that SDF-1α analogues with a modified N-methylated main chain at position 2, 3, or 5 retain significant CXCR4 binding and yet completely lose signaling activities. Furthermore, a representative N-methylated analogue has been shown to be incapable of causing CXCR4 internalization. These results suggest that the ability of SDF-1α to activate CXCR4 signaling and internalization is dependent upon the main chain amide bonds in the N-terminus of SDF-1α. This study demonstrates the feasibility and value of applying a synthetic biology approach to chemically engineer natural proteins and peptide ligands as probes of important biological functions that are not addressed by other biological techniques.

Light Scattering Study of Mixed Micelles Made from Elastin-Like Polypeptide Linear Chains and Trimers

NASA Astrophysics Data System (ADS)

Terrano, Daniel; Tsuper, Ilona; Maraschky, Adam; Holland, Nolan; Streletzky, Kiril

Temperature sensitive nanoparticles were generated from a construct (H20F) of three chains of elastin-like polypeptides (ELP) linked to a negatively charged foldon domain. This ELP system was mixed at different ratios with linear chains of ELP (H40L) which lacks the foldon domain. The mixed system is soluble at room temperature and at a transition temperature (Tt) will form swollen micelles with the hydrophobic linear chains hidden inside. This system was studied using depolarized dynamic light scattering (DDLS) and static light scattering (SLS) to determine the size, shape, and internal structure of the mixed micelles. The mixed micelle in equal parts of H20F and H40L show a constant apparent hydrodynamic radius of 40-45 nm at the concentration window from 25:25 to 60:60 uM (1:1 ratio). At a fixed 50 uM concentration of the H20F, varying H40L concentration from 5 to 80 uM resulted in a linear growth in the hydrodynamic radius from about 11 to about 62 nm, along with a 1000-fold increase in VH signal. A possible simple model explaining the growth of the swollen micelles is considered. Lastly, the VH signal can indicate elongation in the geometry of the particle or could possibly be a result from anisotropic properties from the core of the micelle. SLS was used to study the molecular weight, and the radius of gyration of the micelle to help identify the structure and morphology of mixed micelles and the tangible cause of the VH signal.

Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

PubMed Central

Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

2016-01-01

Abstract The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

Membrane-associated precursor to poliovirus VPg identified by immunoprecipitation with antibodies directed against a synthetic heptapeptide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Semelr, B.L.; Anderson, C.W.; Hanecak, R.

1982-02-01

A synthetic heptapeptide corresponding to the C-terminal sequence of the poliovirus genome protein (VPg) has been linked to bovine serum albumin and used to raise antibodies in rabbits. These antibodies precipitate not only VPg but also at least two more virus-specific polypeptides. The smaller polypeptide, denoted P3-9 (12,000 daltons), has been mapped by Edman degradation and by fragmentation with cyanogen bromide and determined to be the N-terminal cleavage product of polypeptide P3-1b, a precursor to the RNA polymerase. P3-9 contains the sequence of the basic protein VPg (22 amino acids) at its C terminus. As predicted by the known RNAmore » sequence of poliovirus, P3-9 also contains a hydrophobic region of 22 amino acids preceding VPg, an observation suggesting that P3-9 may be membrane-associated. This was confirmed by fractionation of infected cells in the presence or absence of detergent. We speculate that P3-9 may be the donor of VPg to RNA chains in the membrane-bound RNA replication complex.« less

Design of a software for calculating isoelectric point of a polypeptide according to their net charge using the graphical programming language LabVIEW.

PubMed

Tovar, Glomen

2018-01-01

A software to calculate the net charge and to predict the isoelectric point (pI) of a polypeptide is developed in this work using the graphical programming language LabVIEW. Through this instrument the net charges of the ionizable residues of the polypeptide chains of the proteins are calculated at different pH values, tabulated, pI is predicted and an Excel (-xls) type file is generated. In this work, the experimental values of the pIs (pI) of different proteins are compared with the values of the pIs (pI) calculated graphically, achieving a correlation coefficient (R) of 0.934746 which represents a good reliability for a p < 0.01. In this way the generated program can constitute an instrument applicable in the laboratory, facilitating the calculation to graduate students and junior researchers. © 2017 by The International Union of Biochemistry and Molecular Biology, 46(1):39-46, 2018. © 2017 The International Union of Biochemistry and Molecular Biology.

Structure of chaotic magnetic field lines in IR-T1 tokamak due to ergodic magnetic limiter

NASA Astrophysics Data System (ADS)

Ahmadi, S.; Salar Elahi, A.; Ghorannevis, M.

2018-03-01

In this paper we have studied an Ergodic Magnetic Limiter (EML) based chaotic magnetic field for transport control in the edge plasma of IR-T1 tokamak. The resonance created by the EML causes perturbation of the equilibrium field line in tokamak and as a result, the field lines are chaotic in the vicinity of the dimerized island chains. Transport barriers are formed in the chaotic field line and actually observe in tokamak with reverse magnetic shear. We used area-preserving non-twist (and twist) Poincaré maps to describe the formation of transport barriers, which are actually features of Hamiltonian systems. This transport barrier is useful in reducing radial diffusion of the field line and thus improving the plasma confinement.

Protein folding: understanding the role of water and the low Reynolds number environment as the peptide chain emerges from the ribosome and folds.

PubMed

Sen, Siddhartha; Voorheis, H Paul

2014-12-21

The mechanism of protein folding during early stages of the process has three determinants. First, moving water molecules obey the rules of low Reynolds number physics without an inertial component. Molecular movement is instantaneous and size insensitive. Proteins emerging from the ribosome move and rotate without an external force if they change shape, forming and propagating helical structures that increases translocational efficiency. Forward motion ceases when the shape change or propelling force ceases. Second, application of quantum field theory to water structure predicts the spontaneous formation of low density coherent units of fixed size that expel dissolved atmospheric gases. Structured water layers with both coherent and non-coherent domains, form a sheath around the new protein. The surface of exposed hydrophobic amino acids is protected from water contact by small nanobubbles of dissolved atmospheric gases, 5 or 6 molecules on average, that vibrate, attracting even widely separated resonating nanobubbles. This force results from quantum effects, appearing only when the system is within and interacts with an oscillating electromagnetic field. The newly recognized quantum force sharply bends the peptide and is part of a dynamic field determining the pathway of protein folding. Third, the force initiating the tertiary folding of proteins arises from twists at the position of each hydrophobic amino acid, that minimizes surface exposure of the hydrophobic amino acids and propagates along the protein. When the total bend reaches 360°, the leading segment of water sheath intersects the trailing segment. This steric self-intersection expels water from overlapping segments of the sheath and by Newton׳s second law moves the polypeptide chain in an opposite direction. Consequently, with very few exceptions that we enumerate and discuss, tertiary structures are absent from proteins without hydrophobic amino acids, which control the early stages of protein folding and the overall shape of protein. Consequently, proteins only adopt a limited number of forms. The formation of quaternary structures is not necessarily prevented by the absence of hydrophobic amino acids. Copyright © 2014 Elsevier Ltd. All rights reserved.

NMR structural and dynamic characterization of the acid-unfolded state of apomyoglobin provides insights into the early events in protein folding.

PubMed

Yao, J; Chung, J; Eliezer, D; Wright, P E; Dyson, H J

2001-03-27

Apomyoglobin forms a denatured state under low-salt conditions at pH 2.3. The conformational propensities and polypeptide backbone dynamics of this state have been characterized by NMR. Nearly complete backbone and some side chain resonance assignments have been obtained, using a triple-resonance assignment strategy tailored to low protein concentration (0.2 mM) and poor chemical shift dispersion. An estimate of the population and location of residual secondary structure has been made by examining deviations of (13)C(alpha), (13)CO, and (1)H(alpha) chemical shifts from random coil values, scalar (3)J(HN,H)(alpha) coupling constants and (1)H-(1)H NOEs. Chemical shifts constitute a highly reliable indicator of secondary structural preferences, provided the appropriate random coil chemical shift references are used, but in the case of acid-unfolded apomyoglobin, (3)J(HN,H)(alpha) coupling constants are poor diagnostics of secondary structure formation. Substantial populations of helical structure, in dynamic equilibrium with unfolded states, are formed in regions corresponding to the A and H helices of the folded protein. In addition, the deviation of the chemical shifts from random coil values indicates the presence of helical structure encompassing the D helix and extending into the first turn of the E helix. The polypeptide backbone dynamics of acid-unfolded apomyoglobin have been investigated using reduced spectral density function analysis of (15)N relaxation data. The spectral density J(omega(N)) is particularly sensitive to variations in backbone fluctuations on the picosecond to nanosecond time scale. The central region of the polypeptide spanning the C-terminal half of the E helix, the EF turn, and the F helix behaves as a free-flight random coil chain, but there is evidence from J(omega(N)) of restricted motions on the picosecond to nanosecond time scale in the A and H helix regions where there is a propensity to populate helical secondary structure in the acid-unfolded state. Backbone fluctuations are also restricted in parts of the B and G helices due to formation of local hydrophobic clusters. Regions of restricted backbone flexibility are generally associated with large buried surface area. A significant increase in J(0) is observed for the NH resonances of some residues located in the A and G helices of the folded protein and is associated with fluctuations on a microsecond to millisecond time scale that probably arise from transient contacts between these distant regions of the polypeptide chain. Our results indicate that the equilibrium unfolded state of apomyoglobin formed at pH 2.3 is an excellent model for the events that are expected to occur in the earliest stages of protein folding, providing insights into the regions of the polypeptide that spontaneously undergo local hydrophobic collapse and sample nativelike secondary structure.

The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

PubMed Central

Francis, Brian R.

2015-01-01

Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and polypeptides is proposed. The cell consists of an iron-sulfide particle enclosed by tholin, a heterogeneous organic material that is produced by Miller-Urey type experiments that simulate conditions on the early Earth. As the synthesis of nucleic acids evolved from β-linked polyesters, the singlet coding system for replication evolved into a four nucleotide/four amino acid process (AMP = aspartic acid, GMP = glycine, UMP = valine, CMP = alanine) and then into the triplet ribosomal process that permitted multiple copies of protein to be synthesized independent of replication. This hypothesis reconciles the “genetics first” and “metabolism first” approaches to the origin of life and explains why there are four bases in the genetic alphabet. PMID:25679748

A Lie-Theoretic Perspective on O(n) Mass Matrix Inversion for Serial Manipulators and Polypeptide Chains.

PubMed

Lee, Kiju; Wang, Yunfeng; Chirikjian, Gregory S

2007-11-01

Over the past several decades a number of O(n) methods for forward and inverse dynamics computations have been developed in the multi-body dynamics and robotics literature. A method was developed in 1974 by Fixman for O(n) computation of the mass-matrix determinant for a serial polymer chain consisting of point masses. In other recent papers, we extended this method in order to compute the inverse of the mass matrix for serial chains consisting of point masses. In the present paper, we extend these ideas further and address the case of serial chains composed of rigid-bodies. This requires the use of relatively deep mathematics associated with the rotation group, SO(3), and the special Euclidean group, SE(3), and specifically, it requires that one differentiates functions of Lie-group-valued argument.

Solubility of Structurally Complicated Materials: 3. Hair

PubMed Central

Horvath, Ari L.

2009-01-01

Hair is composed of proteins, lipids, water, and small amounts of trace elements. All proteins in animal and human bodies are built from permutations of amino acid molecules in a polypeptide string. The polypeptide chains of protein keratin are organized into filaments in hair cells. Hair is one of the most difficult proteins to digest or solubilize. Among the most common dissolving procedures for hair are acidic, alkaline, and enzymatic hydrolysis. For the analysis of hair, the solid samples are transferred by solubilization via digestion into a liquid phase. Small molecular solvents and molecules with hydrophobic groups appear to have higher affinity for hair. A good solvent attacks the disulfide bonds between cystine molecules and hydrates the hair shaft. Consequently, the hair becomes a jelly-like mass. PMID:19412554

DOE Office of Scientific and Technical Information (OSTI.GOV)

FLANAGAN,J.M.; BEWLEY,M.C.

It is generally accepted that the information necessary to specify the native, functional, three-dimensional structure of a protein is encoded entirely within its amino acid sequence; however, efficient reversible folding and unfolding is observed only with a subset of small single-domain proteins. Refolding experiments often lead to the formation of kinetically-trapped, misfolded species that aggregate, even in dilute solution. In the cellular environment, the barriers to efficient protein folding and maintenance of native structure are even larger due to the nature of this process. First, nascent polypeptides must fold in an extremely crowded environment where the concentration of macromolecules approachesmore » 300-400 mg/mL and on average, each ribosome is within its own diameter of another ribosome (1-3). These conditions of severe molecular crowding, coupled with high concentrations of nascent polypeptide chains, favor nonspecific aggregation over productive folding (3). Second, folding of newly-translated polypeptides occurs in the context of their vehtorial synthesis process. Amino acids are added to a growing nascent chain at the rate of -5 residues per set, which means that for a 300 residue protein its N-terminus will be exposed to the cytosol {approx}1 min before its C-terminus and be free to begin the folding process. However, because protein folding is highly cooperative, the nascent polypeptide cannot reach its native state until a complete folding domain (50-250 residues) has emerged from the ribosome. Thus, for a single-domain protein, the final steps in folding are only completed post-translationally since {approx}40 residues of a nascent chain are sequestered within the exit channel of the ribosome and are not available for folding (4). A direct consequence of this limitation in cellular folding is that during translation incomplete domains will exist in partially-folded states that tend to expose hydrophobic residues that are prone to aggregation and/or misfolding. Thus it is not surprising that, in cells, the protein folding process is error prone and organisms have evolved ''editing'' or quality control (QC) systems to assist in the folding, maintenance and, when necessary, selective removal of damaged proteins. In fact, there is growing evidence that failure of these QC-systems contributes to a number of disease states (5-8). This chapter describes our current understanding of the nature and mechanisms of the protein quality control systems in the cytosol of bacteria. Parallel systems are exploited in the cytosol and mitochondria of eukaryotes to prevent the accumulation of misfolded proteins.« less

Chance, destiny, and the inner workings of ClpXP.

PubMed

Russell, Rick; Matouschek, Andreas

2014-07-31

AAA+ proteases are responsible for protein degradation in all branches of life. Using single-molecule and ensemble assays, Cordova et al. investigate how the bacterial protease ClpXP steps through a substrate's polypeptide chain and construct a quantitative kinetic model that recapitulates the interplay between stochastic and deterministic behaviors of ClpXP. Copyright © 2014 Elsevier Inc. All rights reserved.

Determination of the Gene Sequence of Poliovirus with Pactamycin

PubMed Central

Summers, D. F.; Maizel, J. V.

1971-01-01

By examination of the virus-specific polypeptides formed after the addition of pactamycin, an inhibitor of protein chain initiation, to infected cells, it has been possible to tentatively locate the virus coat proteins at the amino terminus of the large, virus-specific protein precursor, and, therefore, to assign the coat protein cistron to the 5′ end of the RNA. PMID:4330946

Selenium-Dependent Antioxidant Enzymes: Actions and Properties of Selenoproteins

PubMed Central

Zoidis, Evangelos; Seremelis, Isidoros; Kontopoulos, Nikolaos

2018-01-01

Unlike other essential trace elements that interact with proteins in the form of cofactors, selenium (Se) becomes co-translationally incorporated into the polypeptide chain as part of 21st naturally occurring amino acid, selenocysteine (Sec), encoded by the UGA codon. Any protein that includes Sec in its polypeptide chain is defined as selenoprotein. Members of the selenoproteins family exert various functions and their synthesis depends on specific cofactors and on dietary Se. The Se intake in productive animals such as chickens affect nutrient utilization, production performances, antioxidative status and responses of the immune system. Although several functions of selenoproteins are unknown, many disorders are related to alterations in selenoprotein expression or activity. Selenium insufficiency and polymorphisms or mutations in selenoproteins’ genes and synthesis cofactors are involved in the pathophysiology of many diseases, including cardiovascular disorders, immune dysfunctions, cancer, muscle and bone disorders, endocrine functions and neurological disorders. Finally, heavy metal poisoning decreases mRNA levels of selenoproteins and increases mRNA levels of inflammatory factors, underlying the antagonistic effect of Se. This review is an update on Se dependent antioxidant enzymes, presenting the current state of the art and is focusing on results obtained mainly in chicken. PMID:29758013

Strolling Toward New Concepts.

PubMed

Ito, Koreaki

2016-09-08

For more than four decades now, I have been studying how genetic information is transformed into protein-based cellular functions. This has included investigations into the mechanisms supporting cellular localization of proteins, disulfide bond formation, quality control of membranes, and translation. I tried to extract new principles and concepts that are universal among living organisms from our observations of Escherichia coli. While I wanted to distill complex phenomena into basic principles, I also tried not to overlook any serendipitous observations. In the first part of this article, I describe personal experiences during my studies of the Sec pathway, which have centered on the SecY translocon. In the second part, I summarize my views of the recent revival of translation studies, which has given rise to the concept that nonuniform polypeptide chain elongation is relevant for the subsequent fates of newly synthesized proteins. Our studies of a class of regulatory nascent polypeptides advance this concept by showing that the dynamic behaviors of the extraribosomal part of the nascent chain affect the ongoing translation process. Vibrant and regulated molecular interactions involving the ribosome, mRNA, and nascent polypeptidyl-tRNA are based, at least partly, on their autonomously interacting properties.

Selective ribosome profiling as a tool to study the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes

PubMed Central

Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd

2014-01-01

A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347

The primitive code and repeats of base oligomers as the primordial protein-encoding sequence.

PubMed Central

Ohno, S; Epplen, J T

1983-01-01

Even if the prebiotic self-replication of nucleic acids and the subsequent emergence of primitive, enzyme-independent tRNAs are accepted as plausible, the origin of life by spontaneous generation still appears improbable. This is because the just-emerged primitive translational machinery had to cope with base sequences that were not preselected for their coding potentials. Particularly if the primitive mitochondria-like code with four chain-terminating base triplets preceded the universal code, the translation of long, randomly generated, base sequences at this critical stage would have merely resulted in the production of short oligopeptides instead of long polypeptide chains. We present the base sequence of a mouse transcript containing tetranucleotide repeats conserved during evolution. Even if translated in accordance with the primitive mitochondria-like code, this transcript in its three reading frames can yield 245-, 246-, and 251-residue-long tetrapeptidic periodical polypeptides that are already acquiring longer periodicities. We contend that the first set of base sequences translated at the beginning of life were such oligonucleotide repeats. By quickly acquiring longer periodicities, their products must have soon gained characteristic secondary structures--alpha-helical or beta-sheet or both. PMID:6574491

Cycloheximide- and puromycin-induced heat resistance: different effects on cytoplasmic and nuclear luciferases

PubMed Central

Michels, Annemieke A; Kanon, Bart; Konings, Antonius W.T; Bensaude, Olivier; Kampinga, Harm H

2000-01-01

Inhibition of translation can result in cytoprotection against heat shock. The mechanism of this protection has remained elusive so far. Here, the thermoprotective effects of the translation inhibitor cycloheximide (CHX) and puromycin were investigated, using as reporter firefly luciferase localized either in the nucleus or in the cytoplasm. A short preincubation of O23 cells with either translation inhibitor was found to attenuate the heat inactivation of a luciferase directed into the cytoplasm, whereas the heat sensitivity of a nuclear-targeted luciferase remained unaffected. After a long-term CHX pretreatment, both luciferases were more heat resistant. Both the cytoplasmic and the nuclear luciferase are protected against heat-induced inactivation in thermotolerant cells and in cells overexpressing heat shock protein (Hsp)70. CHX incubations further attenuated cytoplasmic luciferase inactivation in thermotolerant and in Hsp70 overexpressing cells, even when Hsp70-mediated protection was saturated. It is concluded that protection by translation inhibition is unlikely due to an increase in the pool of free Hsps normally engaged in translation and released from the nascent polypeptide chains on the ribosomes. Rather, a decrease in nascent chains and thermolabile polypeptides may account for the heat resistance promoted by inhibitors of translation. PMID:11005376

Manipulating the membrane penetration mechanism of helical polypeptides via aromatic modification for efficient gene delivery.

PubMed

Zheng, Nan; Song, Ziyuan; Yang, Jiandong; Liu, Yang; Li, Fangfang; Cheng, Jianjun; Yin, Lichen

2017-08-01

The delivery performance of non-viral gene vectors is greatly related to their intracellular kinetics. Cationic helical polypeptides with potent membrane penetration properties and gene transfection efficiencies have been recently developed by us. However, they suffer from severe drawbacks in terms of their membrane penetration mechanisms that mainly include endocytosis and pore formation. The endocytosis mechanism leads to endosomal entrapment of gene cargos, while the charge- and helicity-induced pore formation causes appreciable cytotoxicity at high concentrations. With the attempt to overcome such critical challenges, we incorporated aromatic motifs into the design of helical polypeptides to enhance their membrane activities and more importantly, to manipulate their membrane penetration mechanisms. The aromatically modified polypeptides exhibited higher cellular internalization level than the unmodified analogue by up to 2.5 folds. Such improvement is possibly because aromatic domains promoted the polypeptides to penetrate cell membranes via direct transduction, a non-endocytosis and non-pore formation mechanism. As such, gene cargos were more efficiently delivered into cells by bypassing endocytosis and subsequently avoiding endosomal entrapment, and the material toxicity associated with excessive pore formation was also reduced. The top-performing aromatic polypeptide containing naphthyl side chains at the incorporated content of 20mol% revealed notably higher transfection efficiencies than commercial reagents in melanoma cells in vitro (by 11.7 folds) and in vivo (by 9.1 folds), and thus found potential utilities toward topical gene delivery for cancer therapy. Cationic helical polypeptides, as efficient gene delivery materials, suffer from severe drawbacks in terms of their membrane penetration mechanisms. The main cell penetration mechanisms involved are endocytosis and pore formation. However, the endocytosis mechanism has the limitation of endosomal entrapment of gene cargos, while the charge- and helicity-induced pore formation causes cytotoxicity at high concentrations. To address such critical issues toward the maximization of gene delivery efficiency, we incorporated aromatic domains into helical polypeptides to promote the cell membrane penetrations via direct transduction, which is a non-endocytosis and non-pore formation mechanism. The manipulation of their membrane penetration mechanisms allows gene cargos to be more efficiently delivered by bypassing endocytosis and subsequently avoiding endosomal entrapment. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Yong; Desseaux, Solenne; Aden, Bethany

We report that surface-grafting thermoresponsive polymers allows the preparation of thin polymer brush coatings with surface properties that can be manipulated by variation of temperature. In most instances, thermoresponsive polymer brushes are produced using polymers that dehydrate and collapse above a certain temperature. This report presents the preparation and properties of polymer brushes that show thermoresponsive surface properties, yet are shape-persistent in that they do not undergo main chain collapse. The polymer brushes presented here are obtained via vapor deposition surface-initiated ring-opening polymerization (SI-ROP) of γ-di- or tri(ethylene glycol)-modified glutamic acid N-carboxyanhydrides. Vapor deposition SI-ROP of γ-di- or tri(ethylene glycol)-modifiedmore » L- or D-glutamic acid N-carboxyanhydrides affords helical surface-tethered polymer chains that do not show any changes in secondary structure between 10 and 70 °C. QCM-D experiments, however, revealed significant dehydration of poly(γ-(2-(2-methoxyethoxy)ethyl)-l-glutamate) (poly(L-EG 2-Glu)) brushes upon heating from 10 to 40 °C. At the same time, AFM and ellipsometry studies did not reveal significant variations in film thickness over this temperature range, which is consistent with the shape-persistent nature of these polypeptide brushes and indicates that the thermoresponsiveness of the films is primarily due to hydration and dehydration of the oligo(ethylene glycol) side chains. The results we present here illustrate the potential of surface-initiated NCA ring-opening polymerization to generate densely grafted assemblies of polymer chains that possess well-defined secondary structures and tunable surface properties. These polypeptide brushes complement their conformationally unordered counterparts that can be generated via surface-initiated polymerization of vinyl-type monomers and represent another step forward to biomimetic surfaces and interfaces.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Bradshaw, B.S.; Skow, L.C.

Human alpha thalassemia is a congential disease causing a deficiency in the synthesis of alpha chains of hemoglobin. Homozygous individuals (hydrops fetalis) usually die during late pregnancy. Alpha thalassemia in mice has been induced by X-irradiation of males. Clinical symptoms in heterozygous mice are similar to those in man, e.g. microcytosis, reticulocytosis, poikilocytosis and hypochromia. Genetic studies showed that all viable alpha thalassemic progeny of matings of alpha thalassemic females and males were heterozygotes. Examination of preimplantation blastocysts flushed from the uterus of alpha thalassemic females at 86 hours after mating with alpha thalassemic males showed that about three-fourths ofmore » the embryos were composed of more than 32 blastomeres and had reached the early blastocyst stage while the remaining one-fourth of the embryos were composed of 32 or less blastomeres and were still at the morula stage of development. About one-fourth of the implantation sites did not contain live fetuses at 11 to 15 days of development. Histological examination at 5 to 8 days of gestation showed that the homozygous alpha thalassemic embryos implanted and developed to the late blastocyst stage when they became necrotic. At 11 to 15 days of development, the primitive nucleated erythrocytes appeared to be normal. However, the anucleated erythrocytes, which differentiate in the fetal liver, of alpha thalassemic fetuses contained abnormal eosinophilic inclusions that may be aggregations of beta chain polypeptides. The electrophoretic pattern of hemoglobins from alpha thalassemic fetuses and adults are distinguishable from those of their normal littermates. The differences can be explained on the basis of deficient alpha chain synthesis and the different affinities of the various kinds of alpha and non-alpha chains during the assembly of polypeptides of the tetrameric hemoglobin molecule.« less

Synthesis and characterization of poly-L-leucine initialized and immobilized by rehydrated hydrotalcite: understanding stability and the nature of interaction.

PubMed

Miranda, Ronald-Alexander; Finocchio, Elisabetta; Llorca, Jordi; Medina, Francisco; Ramis, Gianguido; Sueiras, Jesús E; Segarra, Anna M

2013-10-07

PLLs were synthesized by the ring-opening polycondensation (ROP) method using α-L-leucine N-carboxyanhydride (NCA) and initialized by triethylamine (Et3N), water or rehydrated hydrotalcite (HTrus). The role of temperature, different initiators and water in ROP was further investigated. In general, the initiators used in the polymerization reaction lead to PLL alpha-helical chains containing 5-40 monomers with NCA endgroups via a monomer-activated mechanism. However, the water has a twofold effect on ROP, as both a nucleophile and a base, which involves competition between two different types of initiating mechanisms (nucleophilic attack or deprotonation of the NCA monomer) in the polymerization reaction. This competition provides as a main product NCA endgroups with an alpha-helical structure and leads to the formation of the PLL cyclic-chains and beta-sheet structures which reduce the polymer Mw and the PD of the polypeptide. Furthermore, the water can hydrolyze the NCA endgroups resulting in PLL alpha-helical chains that contain living groups as the main product. On the other hand, the HTrus presents a double role: as both an initiator and a support. The polymers synthesized in the presence of HTrus presented a HT-carboxylate endgroup. The PLLs immobilized in HTrus through an anion-exchange method performed for just 30 minutes presented the PLL immobilized in the interlayer space of the HTrus. The PLL chains of the immobilized counterpart are stabilized by H-bonding with the M-OH of the HT structure. All the polypeptides and biohybrid materials synthesized have been characterized using different techniques (EA, ICP, XRD, Raman, MALDI-TOF, ESI-TOF, FT-IR at increasing temperatures, TG/DT analyses and TEM).

2-[Anilino(phen­yl)meth­yl]cyclo­heptan­one

PubMed Central

Eftekhari-Sis, Bagher; Mohajer, Sahar; Zirak, Maryam; Mozaffarnia, Sakineh; Büyükgüngör, Orhan

2013-01-01

In the title compound, C20H23NO, the cyclo­hepta­none ring adopts a twist-chair conformation, with the amino­methyl substituent in an equatorial position. The relative configuration of the two stereocenters is R,R. In the crystal, mol­ecules are linked by N—H⋯O hydrogen bonds into chains along [100]. PMID:23476371

Insight into the Structure of Amyloid Fibrils from the Analysis of Globular Proteins

PubMed Central

Trovato, Antonio; Chiti, Fabrizio; Maritan, Amos; Seno, Flavio

2006-01-01

The conversion from soluble states into cross-β fibrillar aggregates is a property shared by many different proteins and peptides and was hence conjectured to be a generic feature of polypeptide chains. Increasing evidence is now accumulating that such fibrillar assemblies are generally characterized by a parallel in-register alignment of β-strands contributed by distinct protein molecules. Here we assume a universal mechanism is responsible for β-structure formation and deduce sequence-specific interaction energies between pairs of protein fragments from a statistical analysis of the native folds of globular proteins. The derived fragment–fragment interaction was implemented within a novel algorithm, prediction of amyloid structure aggregation (PASTA), to investigate the role of sequence heterogeneity in driving specific aggregation into ordered self-propagating cross-β structures. The algorithm predicts that the parallel in-register arrangement of sequence portions that participate in the fibril cross-β core is favoured in most cases. However, the antiparallel arrangement is correctly discriminated when present in fibrils formed by short peptides. The predictions of the most aggregation-prone portions of initially unfolded polypeptide chains are also in excellent agreement with available experimental observations. These results corroborate the recent hypothesis that the amyloid structure is stabilised by the same physicochemical determinants as those operating in folded proteins. They also suggest that side chain–side chain interaction across neighbouring β-strands is a key determinant of amyloid fibril formation and of their self-propagating ability. PMID:17173479

Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

PubMed Central

Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

1998-01-01

Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

Low-intensity laser irradiation at 660 nm stimulates transcription of genes involved in the electron transport chain.

PubMed

Masha, Roland T; Houreld, Nicolette N; Abrahamse, Heidi

2013-02-01

Low-intensity laser irradiation (LILI) has been shown to stimulate cellular functions leading to increased adenosine triphosphate (ATP) synthesis. This study was undertaken to evaluate the effect of LILI on genes involved in the mitochondrial electron transport chain (ETC, complexes I-IV) and oxidative phosphorylation (ATP synthase). Four human skin fibroblast cell models were used in this study: normal non-irradiated cells were used as controls while wounded, diabetic wounded, and ischemic cells were irradiated. Cells were irradiated with a 660 nm diode laser with a fluence of 5 J/cm(2) and gene expression determined by quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR). LILI upregulated cytochrome c oxidase subunit VIb polypeptide 2 (COX6B2), cytochrome c oxidase subunit VIc (COX6C), and pyrophosphatase (inorganic) 1 (PPA1) in diabetic wounded cells; COX6C, ATP synthase, H+transporting, mitochondrial Fo complex, subunit B1 (ATP5F1), nicotinamide adenine dinucleotide (NADH) dehydrogenase (ubiquinone) 1 alpha subcomplex, 11 (NDUFA11), and NADH dehydrogenase (ubiquinone) Fe-S protein 7 (NDUFS7) in wounded cells; and ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2) in ischemic cells. LILI at 660 nm stimulates the upregulation of genes coding for subunits of enzymes involved in complexes I and IV and ATP synthase.

The dehydroalanine effect in the fragmentation of ions derived from polypeptides

PubMed Central

Pilo, Alice L.; Peng, Zhou; McLuckey, Scott A.

2016-01-01

The fragmentation of peptides and proteins upon collision-induced dissociation (CID) is highly dependent on sequence and ion type (e.g. protonated, deprotonated, sodiated, odd electron, etc.). Some amino acids, for example aspartic acid and proline, have been found to enhance certain cleavages along the backbone. Here, we show that peptides and proteins containing dehydroalanine, a non-proteinogenic amino acid with an unsaturated side-chain, undergo enhanced cleavage of the N—Cα bond of the dehydroalanine residue to generate c- and z-ions. Because these fragment ion types are not commonly observed upon activation of positively charged even-electron species, they can be used to identify dehydroalanine residues and localize them within the peptide or protein chain. While dehydroalanine can be generated in solution, it can also be generated in the gas phase upon CID of various species. Oxidized S-alkyl cysteine residues generate dehydroalanine upon activation via highly efficient loss of the alkyl sulfenic acid. Asymmetric cleavage of disulfide bonds upon collisional activation of systems with limited proton mobility also generates dehydroalanine. Furthermore, we show that gas-phase ion/ion reactions can be used to facilitate the generation of dehydroalanine residues via, for example, oxidation of S-alkyl cysteine residues and conversion of multiply-protonated peptides to radical cations. In the latter case, loss of radical side-chains to generate dehydroalanine from some amino acids gives rise to the possibility for residue-specific backbone cleavage of polypeptide ions. PMID:27484024

Experimental and in silico modelling analyses of the gene expression pathway for recombinant antibody and by-product production in NS0 cell lines.

PubMed

Mead, Emma J; Chiverton, Lesley M; Spurgeon, Sarah K; Martin, Elaine B; Montague, Gary A; Smales, C Mark; von der Haar, Tobias

2012-01-01

Monoclonal antibodies are commercially important, high value biotherapeutic drugs used in the treatment of a variety of diseases. These complex molecules consist of two heavy chain and two light chain polypeptides covalently linked by disulphide bonds. They are usually expressed as recombinant proteins from cultured mammalian cells, which are capable of correctly modifying, folding and assembling the polypeptide chains into the native quaternary structure. Such recombinant cell lines often vary in the amounts of product produced and in the heterogeneity of the secreted products. The biological mechanisms of this variation are not fully defined. Here we have utilised experimental and modelling strategies to characterise and define the biology underpinning product heterogeneity in cell lines exhibiting varying antibody expression levels, and then experimentally validated these models. In undertaking these studies we applied and validated biochemical (rate-constant based) and engineering (nonlinear) models of antibody expression to experimental data from four NS0 cell lines with different IgG4 secretion rates. The models predict that export of the full antibody and its fragments are intrinsically linked, and cannot therefore be manipulated individually at the level of the secretory machinery. Instead, the models highlight strategies for the manipulation at the precursor species level to increase recombinant protein yields in both high and low producing cell lines. The models also highlight cell line specific limitations in the antibody expression pathway.

Monoclonal antibodies for the identification and purification of vNAR domains and IgNAR immunoglobulins from the horn shark Heterodontus francisci.

PubMed

Juarez, Karla; Dubberke, Gudrun; Lugo, Pavel; Koch-Nolte, Friedrich; Buck, Friedrich; Haag, Friedrich; Licea, Alexei

2011-08-01

In addition to conventional antibodies, cartilaginous fish have evolved a distinctive type of immunoglobulin, designated as IgNAR, which lacks the light polypeptide chains and is composed entirely by heavy chains. IgNAR molecules can be manipulated by molecular engineering to produce the variable domain of a single heavy chain polypeptide (vNARs). These, together with the VHH camel domains, constitute the smallest naturally occurring domains able to recognize an antigen. Their special features, such as small size, long extended finger-like CDR3, and thermal and chemical stability, make them suitable candidates for biotechnological purposes. Here we describe the generation of two mouse monoclonal antibodies (MAbs), MAb 370-12 and MAb 533-10, that both specifically react with vNAR domains of the horn shark Heterodontus francisci. While the former recognizes a broad spectrum of recombinant vNAR proteins, the latter is more restricted. MAb 370-12 precipitated a single band from whole shark serum, which was identified as IgNAR by mass spectrometry. Additionally, we used MAb 370-12 to follow the IgNAR-mediated immune response of sharks during immunization protocols with two different antigens (complete cells and a synthethic peptide), thus corroborating that MAb 370-12 recognizes both isolated vNAR domains and whole IgNAR molecules. Both MAbs represent an affordable molecular, biochemical, and biotechnological tool in the field of shark single-domain antibodies.

Assembly and Function of Heterotypic Ubiquitin Chains in Cell-Cycle and Protein Quality Control.

PubMed

Yau, Richard G; Doerner, Kerstin; Castellanos, Erick R; Haakonsen, Diane L; Werner, Achim; Wang, Nan; Yang, X William; Martinez-Martin, Nadia; Matsumoto, Marissa L; Dixit, Vishva M; Rape, Michael

2017-11-02

Posttranslational modification with ubiquitin chains controls cell fate in all eukaryotes. Depending on the connectivity between subunits, different ubiquitin chain types trigger distinct outputs, as seen with K48- and K63-linked conjugates that drive protein degradation or complex assembly, respectively. Recent biochemical analyses also suggested roles for mixed or branched ubiquitin chains, yet without a method to monitor endogenous conjugates, the physiological significance of heterotypic polymers remained poorly understood. Here, we engineered a bispecific antibody to detect K11/K48-linked chains and identified mitotic regulators, misfolded nascent polypeptides, and pathological Huntingtin variants as their endogenous substrates. We show that K11/K48-linked chains are synthesized and processed by essential ubiquitin ligases and effectors that are mutated across neurodegenerative diseases; accordingly, these conjugates promote rapid proteasomal clearance of aggregation-prone proteins. By revealing key roles of K11/K48-linked chains in cell-cycle and quality control, we establish heterotypic ubiquitin conjugates as important carriers of biological information. Copyright © 2017 Elsevier Inc. All rights reserved.

Excitations of breathers and rogue wave in the Heisenberg spin chain

NASA Astrophysics Data System (ADS)

Qi, Jian-Wen; Duan, Liang; Yang, Zhan-Ying; Yang, Wen-Li

2018-01-01

We study the excitations of breathers and rogue wave in a classical Heisenberg spin chain with twist interaction, which is governed by a fourth-order integrable nonlinear Schrödinger equation. The dynamics of these waves have been extracted from an exact solution. In particular, the corresponding existence conditions based on the parameters of perturbation wave number K, magnon number N, background wave vector ks and amplitude c are presented explicitly. Furthermore, the characteristics of magnetic moment distribution corresponding to these nonlinear waves are also investigated in detail. Finally, we discussed the state transition of three types nonlinear localized waves under the different excitation conditions.

A Lie-Theoretic Perspective on O(n) Mass Matrix Inversion for Serial Manipulators and Polypeptide Chains

PubMed Central

Lee, Kiju; Wang, Yunfeng; Chirikjian, Gregory S.

2010-01-01

Over the past several decades a number of O(n) methods for forward and inverse dynamics computations have been developed in the multi-body dynamics and robotics literature. A method was developed in 1974 by Fixman for O(n) computation of the mass-matrix determinant for a serial polymer chain consisting of point masses. In other recent papers, we extended this method in order to compute the inverse of the mass matrix for serial chains consisting of point masses. In the present paper, we extend these ideas further and address the case of serial chains composed of rigid-bodies. This requires the use of relatively deep mathematics associated with the rotation group, SO(3), and the special Euclidean group, SE(3), and specifically, it requires that one differentiates functions of Lie-group-valued argument. PMID:20165563

Variable context Markov chains for HIV protease cleavage site prediction.

PubMed

Oğul, Hasan

2009-06-01

Deciphering the knowledge of HIV protease specificity and developing computational tools for detecting its cleavage sites in protein polypeptide chain are very desirable for designing efficient and specific chemical inhibitors to prevent acquired immunodeficiency syndrome. In this study, we developed a generative model based on a generalization of variable order Markov chains (VOMC) for peptide sequences and adapted the model for prediction of their cleavability by certain proteases. The new method, called variable context Markov chains (VCMC), attempts to identify the context equivalence based on the evolutionary similarities between individual amino acids. It was applied for HIV-1 protease cleavage site prediction problem and shown to outperform existing methods in terms of prediction accuracy on a common dataset. In general, the method is a promising tool for prediction of cleavage sites of all proteases and encouraged to be used for any kind of peptide classification problem as well.

Dysfunctional C8 beta chain in patients with C8 deficiency.

PubMed

Tschopp, J; Penea, F; Schifferli, J; Späth, P

1986-12-01

Two sera from unrelated individuals, each lacking C8 activity, were examined by Western blot analysis. Using antisera raised against whole C8, the two sera are shown to lack the C8 beta chain, indicating a C8 beta deficiency, which is frequently observed in cases of dysfunctional C8. In contrast, by means of a specific anti-C8-beta antiserum, a C8 beta-like polypeptide chain of apparently identical molecular weight compared to normal C8 beta was detected. Digestion of normal and dysfunctional C8 beta with Staphylococcus aureus V8 protease revealed distinct differences in the enzymatic digestion pattern. We conclude that the dysfunction in the C8 protein in these two patients resides in the dysfunctional C8 beta chain, and that this form of C8 deficiency is distinct from C8 deficiencies previously reported, in which one or both C8 subunits are lacking.

Helical Inversion of Gel Fibrils by Elongation of Perfluoroalkyl Chains as Studied by Vibrational Circular Dichroism.

PubMed

Sato, Hisako; Yajima, Tomoko; Yamagishi, Akihiko

2016-05-01

Vibrational circular dichroism (VCD) spectroscopy was applied to gelation by a chiral low-molecular mass weight gelator, N,N'-diperfluoroalkanoyl-1,2-trans-diaminocyclohexane. Attention was focused on the winding effects of (-CF2 )n chains on the gelating ability. For this purpose, a series of gelators were synthesized with perfluoroalkyl chains of different length (n = 6-8). When gelation was studied using acetonitrile as a solvent, the fibrils took different morphologies, depending on the chain length: twisted saddle-like ribbon or helical ribbon from fibril (n = 6) and a helical ribbon from platelet (n = 8). The signs of VCD peaks assigned to the couplet of C=O stretching and to the C-F stretching were also dependent on n, indicating that a gelator molecule changed conformation on elongating perfluoroalkyl chains. A model is proposed for the aggregation modes in fibrils. Chirality 28:361-364, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Targeting Cell Surface Proteins in Molecular Photoacoustic Imaging to Detect Ovarian Cancer Early

DTIC Science & Technology

2013-07-01

biology, nanotechnology, and imaging technology, molecular imaging utilizes specific probes as contrast agents to visualize cellular processes at the...This reagent was covalently coupled to the oligosaccharides attached to polypeptide side-chains of extracellular membrane proteins on living cells...website. The normal tissue gene expression profile dataset was modified and processed as described by Fang (8) and mean intensities and standard

Web-ware bioinformatical analysis and structure modelling of N-terminus of human multisynthetase complex auxiliary component protein p43.

PubMed

Deineko, Viktor

2006-01-01

Human multisynthetase complex auxiliary component, protein p43 is an endothelial monocyte-activating polypeptide II precursor. In this study, comprehensive sequence analysis of N-terminus has been performed to identify structural domains, motifs, sites of post-translation modification and other functionally important parameters. The spatial structure model of full-chain protein p43 is obtained.

Anti-Idiotype Probes for Toxin Detection

DTIC Science & Technology

1991-09-13

NMurine macrophage activation by staphylococcal exotoxins. Gordo,, Conference .)n Staphylococcal Diseases . Salve Regina Univ. Newport. RI. 16 I I...multisystem disease , toxic shock syndrome. The toxins are serologically distinct, single polypeptide chains, with sizes ranging from 22 kDa to approximately...pleotropic effects on the immune system and in the pathogenesis of disease (21,22,66). Glucocorticoids were reported to be potent inhibitors of the LPS

JPRS Report, Science & Technology, USSR: Life Sciences.

DTIC Science & Technology

1988-02-12

polypeptide chain frag- ments inside protein membranes or on their surfaces using bacteriorhodopsin as the test object. Purple membranes, partially...outside the membrane or close to its surface . A model was developed from these data which involved folding of certain regions of bacteriorhodopsin...into hepatic endothelial and Kupffer cells. These findings point to the putative usefulness of the PLP approach in gene therapy. Figures h

Structure and hydrodynamic properties of plectin molecules.

PubMed

Foisner, R; Wiche, G

1987-12-05

Plectin is a cytoskeletal, high molecular weight protein of widespread and abundant occurrence in cultured cells and tissues. To study its molecular structure, the protein was purified from rat glioma C6 cells and subjected to chemical and biophysical analyses. Plectin's polypeptide chains have an apparent molecular weight of 300,000, as shown by one-dimensional sodium dodecyl sulfate/polyacrylamide electrophoresis. Cross-linking of non-denatured plectin in solution with dimethyl suberimidate and electrophoretic analyses on sodium dodecyl sulfate/agarose gels revealed that the predominant soluble plectin species was a molecule of 1200 X 10(3) Mr consisting of four 300 X 10(3) Mr polypeptide chains. Hydrodynamic properties of plectin in solution were obtained by sedimentation velocity centrifugation and high-pressure liquid chromatography analysis yielding a sedimentation coefficient of 10 S and a Stokes radius of 27 nm. The high f/fmin ratio of 4.0 indicated a very elongated shape of plectin molecules and an axial ratio of about 50. Shadowing and negative staining electron microscopy of plectin molecules revealed multiple domains: a rigid rod of 184 nm in length and 2 nm in diameter, and two globular heads of 9 nm diameter at each end of the rod. Circular dichroism spectra suggested a composition of 30% alpha-helix, 9% beta-structure and 61% random coil or aperiodic structure. The rod-like shape, the alpha-helix content as well as the thermal transition within a midpoint of 45 degrees C and the transition enthalpy (168 kJ/mol) of secondary structure suggested a double-stranded, alpha-helical coiled coil rod domain. Based on the available data, we favor a model of native plectin as a dumb-bell-like association of four 300 X 10(3) Mr polypeptide chains. Electron microscopy and turbidity measurements showed that plectin molecules self-associate into various oligomeric states in solutions of nearly physiological ionic strength. These interactions apparently involved the globular end domains of the molecule. Given its rigidity and elongated shape, and its tendency towards self-association, plectin may well be an interlinking element of the cytoskeleton that may also form a network of its own.

Single Protein Structural Analysis with a Solid-state Nanopore Sensor

NASA Astrophysics Data System (ADS)

Li, Jiali; Golovchenko, Jene; McNabb, David

2005-03-01

We report on the use of solid-state nanopore sensors to detect single polypeptides. These solid-state nanopores are fabricated in thin membranes of silicon nitride by ion beam sculpting...[1]. When an electrically biased nanopore is exposed to denatured proteins in ionic solution, discrete transient electronic signals: current blockages are observed. We demonstrate examples of such transient electronic signals for Bovine Serum Albumin (BSA) and human placental laminin M proteins in Guanidine hydrochloride solution, which suggest that these polypeptides are individually translocating through the nanopore during the detecting process. The amplitude of the current blockages is proportional to the bias voltage. No transient current blockages are observed when proteins are not present in the solution. To probe protein-folding state, pH and temperature dependence experiments are performed. The results demonstrate a solid-state nanopore sensor can be used to detect and analyze single polypeptide chains. Similarities and differences with signals obtained from double stranded DNA in a solid-state nanopore and single stranded DNA in a biological nanopore are discussed. [.1] Li, J., D. Stein, C. McMullan, D. Branton, M.J. Aziz, and J.A. Golovchenko, Ion-beam sculpting at nanometre length scales. Nature, 2001. 412(12 July): p. 166-169.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hev ein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

CDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Effects of hydrophobic and dipole-dipole interactions on the conformational transitions of a model polypeptide

NASA Astrophysics Data System (ADS)

Mu, Yan; Gao, Yi Qin

2007-09-01

We studied the effects of hydrophobicity and dipole-dipole interactions between the nearest-neighbor amide planes on the secondary structures of a model polypeptide by calculating the free energy differences between different peptide structures. The free energy calculations were performed with low computational costs using the accelerated Monte Carlo simulation (umbrella sampling) method, with a bias-potential method used earlier in our accelerated molecular dynamics simulations. It was found that the hydrophobic interaction enhances the stability of α helices at both low and high temperatures but stabilizes β structures only at high temperatures at which α helices are not stable. The nearest-neighbor dipole-dipole interaction stabilizes β structures under all conditions, especially in the low temperature region where α helices are the stable structures. Our results indicate clearly that the dipole-dipole interaction between the nearest neighboring amide planes plays an important role in determining the peptide structures. Current research provides a more unified and quantitative picture for understanding the effects of different forms of interactions on polypeptide structures. In addition, the present model can be extended to describe DNA/RNA, polymer, copolymer, and other chain systems.

Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

PubMed

Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

2016-08-30

The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

Crystal Structures of Lys-63-linked tri- and di-ubiquitin Reveal a Highly Extended Chain Architecture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weeks, S.; Grasty, K; Hernandez-Cuebas, L

2009-01-01

The covalent attachment of different types of poly-ubiquitin chains signal different outcomes for the proteins so targeted. For example, a protein modified with Lys-48-linked poly-ubiquitin chains is targeted for proteasomal degradation, whereas Lys-63-linked chains encode nondegradative signals. The structural features that enable these different types of chains to encode different signals have not yet been fully elucidated. We report here the X-ray crystal structures of Lys-63-linked tri- and di-ubiquitin at resolutions of 2.3 and 1.9 {angstrom}, respectively. The tri- and di-ubiquitin species adopt essentially identical structures. In both instances, the ubiquitin chain assumes a highly extended conformation with a left-handedmore » helical twist; the helical chain contains four ubiquitin monomers per turn and has a repeat length of {approx}110 {angstrom}. Interestingly, Lys-48 ubiquitin chains also adopt a left-handed helical structure with a similar repeat length. However, the Lys-63 architecture is much more open than that of Lys-48 chains and exposes much more of the ubiquitin surface for potential recognition events. These new crystal structures are consistent with the results of solution studies of Lys-63 chain conformation, and reveal the structural basis for differential recognition of Lys-63 versus Lys-48 chains.« less

Wide-angle x-ray scattering and solid-state nuclear magnetic resonance data combined to test models for cellulose microfibrils in mung bean cell walls.

PubMed

Newman, Roger H; Hill, Stefan J; Harris, Philip J

2013-12-01

A synchrotron wide-angle x-ray scattering study of mung bean (Vigna radiata) primary cell walls was combined with published solid-state nuclear magnetic resonance data to test models for packing of (1→4)-β-glucan chains in cellulose microfibrils. Computer-simulated peak shapes, calculated for 36-chain microfibrils with perfect order or uncorrelated disorder, were sharper than those in the experimental diffractogram. Introducing correlated disorder into the models broaden the simulated peaks but only when the disorder was increased to unrealistic magnitudes. Computer-simulated diffractograms, calculated for 24- and 18-chain models, showed good fits to experimental data. Particularly good fits to both x-ray and nuclear magnetic resonance data were obtained for collections of 18-chain models with mixed cross-sectional shapes and occasional twinning. Synthesis of 18-chain microfibrils is consistent with a model for cellulose-synthesizing complexes in which three cellulose synthase polypeptides form a particle and six particles form a rosette.

Nanostructure Control of Biologically Inspired Polymers

NASA Astrophysics Data System (ADS)

Rosales, Adrianne Marie

Biological polymers, such as polypeptides, are responsible for many of life's most sophisticated functions due to precisely evolved hierarchical structures. These protein structures are the result of monodisperse sequences of amino acids that fold into well-defined chain shapes and tertiary structures. Recently, there has been much interest in the design of such sequence-specific polymers for materials applications in fields ranging from biotechnology to separations membranes. Non-natural polymers offer the stability and robustness necessary for materials applications; however, our ability to control monomer sequence in non-natural polymers has traditionally operated on a much simpler level. In addition, the relationship between monomer sequence and self-assembly is not well understood for biological molecules, much less synthetic polymers. Thus, there is a need to explore self-assembly phase space with sequence using a model system. Polypeptoids are non-natural, sequence-specific polymers that offer the opportunity to probe the effect of sequence on self-assembly. A variety of monomer interactions have an impact on polymer properties, such as chirality, hydrophobicity, and electrostatic interactions. Thus, a necessary starting point for this project was to investigate monomer sequence effects on the bulk properties of polypeptoid homopolymers. It was found that several polypeptoids have experimentally accessible melting transitions that are dependent on the choice of side chains, and it was shown that this transition is tuned by the incorporation of "defects" or a comonomer. The polypeptoid chain shape is also controlled with the choice of monomer and monomer sequence. By using at least 50% monomers with bulky, chiral side chains, the polypeptoid backbone is sterically twisted into a helix, and as found for the first time in this work, the persistence length is increased. However, this persistence length, which is a measure of the stiffness of the polymer, is small compared to other folded helices, indicating the conformational flexibility of polypeptoid chains. With a firmer understanding of how monomer sequence and composition influence polypeptoid bulk properties, we designed block copolymer systems for self-assembly. Because the governing parameters of block copolymer self-assembly are well understood, this architecture provides a convenient starting point for probing the effect of changing polymer sequence. We found that polystyrene-polypeptoid block copolymers readily self-assemble into hexagonally-packed and lamellar morphologies with long range order, and furthermore, sequence control of the polypeptoid block enables us to tune the strength of segregation (and therefore the order-disorder transition) of the block copolymer. Polypeptoid chain shape also affects self-assembly. In classical synthetic block copolymers, it has typically been difficult to change chain shape without also changing polymer chemistry and therefore other factors affecting self-assembly. The advantage of the polypeptoid system is that it is modular, as the side chain chemistry (and therefore polymer properties) can easily be changed without changing the backbone chemistry. Thus, we have decoupled conformational effects from chemical composition by comparing the self-assembly of block copolymers containing either a helical peptoid block or its racemic, non-helical analog. The increase in the persistence length of the peptoid block due to helicity translates to an increase in the morphological domain spacing. In this work, we further the understanding of the effect of monomer sequence on bulk polypeptoid properties and self-assembly. Our findings pave the way for the rational design of structured synthetic polymers with tunable, sequence-specific properties.

Kinks, loops, and protein folding, with protein A as an example

PubMed Central

Krokhotin, Andrey; Liwo, Adam; Maisuradze, Gia G.; Niemi, Antti J.; Scheraga, Harold A.

2014-01-01

The dynamics and energetics of formation of loops in the 46-residue N-terminal fragment of the B-domain of staphylococcal protein A has been studied. Numerical simulations have been performed using coarse-grained molecular dynamics with the united-residue (UNRES) force field. The results have been analyzed in terms of a kink (heteroclinic standing wave solution) of a generalized discrete nonlinear Schrödinger (DNLS) equation. In the case of proteins, the DNLS equation arises from a Cα-trace-based energy function. Three individual kink profiles were identified in the experimental three-α-helix structure of protein A, in the range of the Glu16-Asn29, Leu20-Asn29, and Gln33-Asn44 residues, respectively; these correspond to two loops in the native structure. UNRES simulations were started from the full right-handed α-helix to obtain a clear picture of kink formation, which would otherwise be blurred by helix formation. All three kinks emerged during coarse-grained simulations. It was found that the formation of each is accompanied by a local free energy increase; this is expressed as the change of UNRES energy which has the physical sense of the potential of mean force of a polypeptide chain. The increase is about 7 kcal/mol. This value can thus be considered as the free energy barrier to kink formation in full α-helical segments of polypeptide chains. During the simulations, the kinks emerge, disappear, propagate, and annihilate each other many times. It was found that the formation of a kink is initiated by an abrupt change in the orientation of a pair of consecutive side chains in the loop region. This resembles the formation of a Bloch wall along a spin chain, where the Cα backbone corresponds to the chain, and the amino acid side chains are interpreted as the spin variables. This observation suggests that nearest-neighbor side chain–side chain interactions are responsible for initiation of loop formation. It was also found that the individual kinks are reflected as clear peaks in the principal modes of the analyzed trajectory of protein A, the shapes of which resemble the directional derivatives of the kinks along the chain. These observations suggest that the kinks of the DNLS equation determine the functionally important motions of proteins. PMID:24437917

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nekrasov, Nikita; ITEP, Moscow; Shatashvili, Samson

Supersymmetric vacua of two dimensional N = 4 gauge theories with matter, softly broken by the twisted masses down to N = 2, are shown to be in one-to-one correspondence with the eigenstates of integrable spin chain Hamiltonians. Examples include: the Heisenberg SU(2)XXX spin chain which is mapped to the two dimensional U(N) theory with fundamental hypermultiplets, the XXZ spin chain which is mapped to the analogous three dimensional super-Yang-Mills theory compactified on a circle, the XYZ spin chain and eight-vertex model which are related to the four dimensional theory compactified on T{sup 2}. A consequence of our correspondence ismore » the isomorphism of the quantum cohomology ring of various quiver varieties, such as cotangent bundles to (partial) flag varieties and the ring of quantum integrals of motion of various spin chains. The correspondence extends to any spin group, representations, boundary conditions, and inhomogeneity, it includes Sinh-Gordon and non-linear Schroedinger models as well as the dynamical spin chains like Hubbard model. Compactifications of four dimensional N = 2 theories on a two-sphere lead to the instanton-corrected Bethe equations.« less

Substituent effects that control conjugated oligomer conformation through non-covalent interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharber, Seth A.; Baral, Rom Nath; Frausto, Fanny

Although understanding the conformations and arrangements of conjugated materials as solids is key to their prospective applications, predictive power over these structural factors remains elusive. In this work, substituent effects tune non-covalent interactions between side-chain fluorinated benzyl esters and main-chain terminal arenes, in turn controlling the conformations and interchromophore aggregation of three-ring phenylene-ethynylenes (PEs). Cofacial fluoroarene–arene (ArF–ArH) interactions cause twisting in the PE backbone, interrupting intramolecular conjugation as well as blocking chromophore aggregation, both of which prevent the typically observed bathochromic shift observed upon transitioning PEs from solution to solid. This work highlights two structural factors that determine whether themore » ArF–ArH interactions, and the resulting twisted, unaggregated chromophores, occur in these solids: (i) the electron-releasing characteristic of substituents on ArH, with more electron-releasing character favoring ArF–ArH interactions, and (ii) the fluorination pattern of the ArF ring, with 2,3,4,5,6-pentafluorophenyl favoring ArF–ArH interactions over 2,4,6-trifluorophenyl. Furthermore, these trends indicate that considerations of electrostatic complementarity, whether through a polar-π or substituent–substituent mechanism, can serve as an effective design principle in controlling the interaction strengths, and therefore the optoelectronic properties, of these molecules as solids.« less

Substituent effects that control conjugated oligomer conformation through non-covalent interactions

DOE PAGES

Sharber, Seth A.; Baral, Rom Nath; Frausto, Fanny; ...

2017-03-31

Although understanding the conformations and arrangements of conjugated materials as solids is key to their prospective applications, predictive power over these structural factors remains elusive. In this work, substituent effects tune non-covalent interactions between side-chain fluorinated benzyl esters and main-chain terminal arenes, in turn controlling the conformations and interchromophore aggregation of three-ring phenylene-ethynylenes (PEs). Cofacial fluoroarene–arene (ArF–ArH) interactions cause twisting in the PE backbone, interrupting intramolecular conjugation as well as blocking chromophore aggregation, both of which prevent the typically observed bathochromic shift observed upon transitioning PEs from solution to solid. This work highlights two structural factors that determine whether themore » ArF–ArH interactions, and the resulting twisted, unaggregated chromophores, occur in these solids: (i) the electron-releasing characteristic of substituents on ArH, with more electron-releasing character favoring ArF–ArH interactions, and (ii) the fluorination pattern of the ArF ring, with 2,3,4,5,6-pentafluorophenyl favoring ArF–ArH interactions over 2,4,6-trifluorophenyl. Furthermore, these trends indicate that considerations of electrostatic complementarity, whether through a polar-π or substituent–substituent mechanism, can serve as an effective design principle in controlling the interaction strengths, and therefore the optoelectronic properties, of these molecules as solids.« less

Hole hopping through tyrosine/tryptophan chains protects proteins from oxidative damage

PubMed Central

Gray, Harry B.; Winkler, Jay R.

2015-01-01

Living organisms have adapted to atmospheric dioxygen by exploiting its oxidizing power while protecting themselves against toxic side effects. Reactive oxygen and nitrogen species formed during oxidative stress, as well as high-potential reactive intermediates formed during enzymatic catalysis, could rapidly and irreversibly damage polypeptides were protective mechanisms not available. Chains of redox-active tyrosine and tryptophan residues can transport potentially damaging oxidizing equivalents (holes) away from fragile active sites and toward protein surfaces where they can be scavenged by cellular reductants. Precise positioning of these chains is required to provide effective protection without inhibiting normal function. A search of the structural database reveals that about one third of all proteins contain Tyr/Trp chains composed of three or more residues. Although these chains are distributed among all enzyme classes, they appear with greatest frequency in the oxidoreductases and hydrolases. Consistent with a redox-protective role, approximately half of the dioxygen-using oxidoreductases have Tyr/Trp chain lengths ≥3 residues. Among the hydrolases, long Tyr/Trp chains appear almost exclusively in the glycoside hydrolases. These chains likely are important for substrate binding and positioning, but a secondary redox role also is a possibility. PMID:26195784

Energetically Unfavorable Amide Conformations for N6-Acetyllysine Side Chains in Refined Protein Structures

PubMed Central

Genshaft, Alexander; Moser, Joe-Ann S.; D'Antonio, Edward L.; Bowman, Christine M.; Christianson, David W.

2013-01-01

The reversible acetylation of lysine to form N6-acetyllysine in the regulation of protein function is a hallmark of epigenetics. Acetylation of the positively charged amino group of the lysine side chain generates a neutral N-alkylacetamide moiety that serves as a molecular “switch” for the modulation of protein function and protein-protein interactions. We now report the analysis of 381 N6-acetyllysine side chain amide conformations as found in 79 protein crystal structures and 11 protein NMR structures deposited in the Protein Data Bank (PDB) of the Research Collaboratory for Structural Bioinformatics. We find that only 74.3% of N6-acetyllysine residues in protein crystal structures and 46.5% in protein NMR structures contain amide groups with energetically preferred trans or generously trans conformations. Surprisingly, 17.6% of N6-acetyllysine residues in protein crystal structures and 5.3% in protein NMR structures contain amide groups with energetically unfavorable cis or generously cis conformations. Even more surprisingly, 8.1% of N6-acetyllysine residues in protein crystal structures and 48.2% in NMR structures contain amide groups with energetically prohibitive twisted conformations that approach the transition state structure for cis-trans isomerization. In contrast, 109 unique N-alkylacetamide groups contained in 84 highly-accurate small molecule crystal structures retrieved from the Cambridge Structural Database exclusively adopt energetically preferred trans conformations. Therefore, we conclude that cis and twisted N6-acetyllysine amides in protein structures deposited in the PDB are erroneously modeled due to their energetically unfavorable or prohibitive conformations. PMID:23401043

Pharmacological Studies on Clostridial Neurotoxins.

DTIC Science & Technology

1982-08-01

1974). The entire (e.g., dichain) molecule is needed to poison intact cells, but only the light chain polypeptide is needed to inhibit protein...synthesis in broken cell preparations. The sequence of events that underlies the ability of diphtheria toxin to poison eukaryotic cells is not unique to...may belong to a novel class of internalized poisons . In at least one respect the latter possibility is true. Most toxins that are internalized act in

Heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylated variants of a single polypeptide chain.

PubMed

Murphy, P A; Cebula, T A; Windle, B E

1981-10-01

Rabbit endogenous pyrogens were of about the same molecular size, but showed considerable heterogeneity of their isoelectric points. We attempted to show that this heterogeneity was attributable to variable glycosylation of a single polypeptide chain. When peritoneal exudate cells were stimulated to make pyrogens in the presence of 2-deoxy-D-glucose, there was a relatively trivial suppression of pyrogen release, and analysis by isoelectric focusing showed parallel inhibition of secretion of all the forms of endogenous pyrogen. When cells were stimulated in the presence of 3H-labeled amino acids and 14C-labeled glucosamine or glucose, the purified pyrogens were labeled with 3H but not with 14C. Macrophage membrane preparations were made which contained glycosyl transferases and could transfer sugar residues from sugar nucleotides to deglycosylated fetuin. These macrophage membrane preparations did not transfer sugars to the pI 7.3 endogenous pyrogen. Treatment of endogenous pyrogens with neuraminidase or with periodate produced no evidence suggesting that the pyrogens were glycosylated. Last, endogenous pyrogens did not bind to any of four lectins with different carbohydrate specificities. This evidence suggests that the heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylation and must have some other cause.

Heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylated variants of a single polypeptide chain.

PubMed Central

Murphy, P A; Cebula, T A; Windle, B E

1981-01-01

Rabbit endogenous pyrogens were of about the same molecular size, but showed considerable heterogeneity of their isoelectric points. We attempted to show that this heterogeneity was attributable to variable glycosylation of a single polypeptide chain. When peritoneal exudate cells were stimulated to make pyrogens in the presence of 2-deoxy-D-glucose, there was a relatively trivial suppression of pyrogen release, and analysis by isoelectric focusing showed parallel inhibition of secretion of all the forms of endogenous pyrogen. When cells were stimulated in the presence of 3H-labeled amino acids and 14C-labeled glucosamine or glucose, the purified pyrogens were labeled with 3H but not with 14C. Macrophage membrane preparations were made which contained glycosyl transferases and could transfer sugar residues from sugar nucleotides to deglycosylated fetuin. These macrophage membrane preparations did not transfer sugars to the pI 7.3 endogenous pyrogen. Treatment of endogenous pyrogens with neuraminidase or with periodate produced no evidence suggesting that the pyrogens were glycosylated. Last, endogenous pyrogens did not bind to any of four lectins with different carbohydrate specificities. This evidence suggests that the heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylation and must have some other cause. PMID:6271680

Consolidated conversion of protein waste into biofuels and ammonia using Bacillus subtilis.

PubMed

Choi, Kwon-Young; Wernick, David G; Tat, Christine A; Liao, James C

2014-05-01

The non-recyclable use of nitrogen fertilizers in microbial production of fuels and chemicals remains environmentally detrimental. Conversion of protein wastes into biofuels and ammonia by engineering nitrogen flux in Escherichia coli has been demonstrated as a method to reclaim reduced-nitrogen and curb its environmental deposition. However, protein biomass requires a proteolysis process before it can be taken up and converted by any microbe. Here, we metabolically engineered Bacillus subtilis to hydrolyze polypeptides through its secreted proteases and to convert amino acids into advanced biofuels and ammonia fertilizer. Redirection of B. subtilis metabolism for amino-acid conversion required inactivation of the branched-chain amino-acid (BCAA) global regulator CodY. Additionally, the lipoamide acyltransferase (bkdB) was deleted to prevent conversion of branched-chain 2-keto acids into their acyl-CoA derivatives. With these deletions and heterologous expression of a keto-acid decarboxylase and an alcohol dehydrogenase, the final strain produced biofuels and ammonia from an amino-acid media with 18.9% and 46.6% of the maximum theoretical yield. The process was also demonstrated on several waste proteins. The results demonstrate the feasibility of direct microbial conversion of polypeptides into sustainable products. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Molecular basis of activation of endopeptidase activity of botulinum neurotoxin type E.

PubMed

Kukreja, Roshan V; Sharma, Shashi K; Singh, Bal Ram

2010-03-23

Botulinum neurotoxins (BoNTs) are a group of large proteins that are responsible for the clinical syndrome of botulism. The seven immunologically distinct serotypes of BoNTs (A-G), each produced by various strains of Clostridium botulinum, act on the neuromuscular junction by blocking the release of the neurotransmitter acetylcholine, thereby resulting in flaccid muscle paralysis. BoNTs are synthesized as single inactive polypeptide chains that are cleaved by endogenous or exogenous proteases to generate the active dichain form of the toxin. Nicking of the single chain BoNT/E to the dichain form is associated with 100-fold increase in toxicity. Here we investigated the activation mechanism of botulinum neurotoxin type E upon nicking and subsequent reduction of disulfide bond. It was observed that nicking of BoNT/E significantly enhances its endopeptidase activity and that at the physiological temperature of 37 degrees C the reduced form of nicked BoNT/E adopts a dynamically flexible conformation resulting from the exposure of hydrophobic segments and facilitating optimal cleavage of its substrate SNAP-25. Such reduction-induced increase in the flexibility of the polypeptide folding provides a rationale for the mechanism of BoNT/E endopeptidase against its intracellular substrate, SNAP-25, and complements current understanding of the mechanistics of interaction between the substrate and BoNT endopeptidase.

Selenomethionine incorporation into amyloid sequences regulates fibrillogenesis and toxicity.

PubMed

Martínez, Javier; Lisa, Silvia; Sánchez, Rosa; Kowalczyk, Wioleta; Zurita, Esther; Teixidó, Meritxell; Giralt, Ernest; Andreu, David; Avila, Jesús; Gasset, María

2011-01-01

The capacity of a polypeptide chain to engage in an amyloid formation process and cause a conformational disease is contained in its sequence. Some of the sequences undergoing fibrillation contain critical methionine (Met) residues which in vivo can be synthetically substituted by selenomethionine (SeM) and alter their properties. Using peptide synthesis, biophysical techniques and cell viability determinations we have studied the effect of the substitution of methionine (Met) by selenomethionine (SeM) on the fibrillogenesis and toxic properties of Aβ40 and HuPrP(106-140). We have found that the effects display site-specificity and vary from inhibition of fibrillation and decreased toxicity ([SeM(35)]Aβ40, [SeM(129)]HuPrP(106-140) and [SeM(134)]HuPrP(106-140)), retarded assembly, modulation of polymer shape and retention of toxicity ([SeM(112)]HuPrP(106-140) to absence of effects ([SeM(109)]HuPrP(106-140)). This work provides direct evidence that the substitution of Met by SeM in proamyloid sequences has a major impact on their self-assembly and toxic properties, suggesting that the SeM pool can play a major role in dictating the allowance and efficiency of a polypeptide chain to undergo toxic polymerization.

Sensations induced by medium and long chain triglycerides: role of gastric tone and hormones

PubMed Central

Barbera, R; Peracchi, M; Brighenti, F; Cesana, B; Bianchi, P; Basilisco, G

2000-01-01

BACKGROUND—The relative roles of gastric relaxation and the neuroendocrine signals released by the small intestine in the perception of nutrient induced sensations are controversial. The different effects of long chain (LCT) and medium chain (MCT) triglyceride ingestion on perception, gastric relaxation, and hormonal release may help to elucidate the mechanisms underlying nutrient induced sensations.
AIMS—To compare the effects of intraduodenal LCT and MCT infusions on perception, gastric tone, and plasma gut hormone levels in healthy subjects.
SUBJECTS—Nine fasting healthy volunteers.
METHODS—The subjects received duodenal infusions of saline followed by LCTs and MCTs in a randomised order on two different days. The sensations were rated on a visual analogue scale. Gastric tone was measured using a barostat, and plasma gut hormone levels by radioimmunoassay.
RESULTS—LCT infusion increased satiation scores, reduced gastric tone, and increased the levels of plasma cholecystokinin, gastric inhibitory polypeptide, neurotensin, and pancreatic polypeptide. MCT infusion reduced gastric tone but did not significantly affect perception or plasma gut hormone levels. LCTs produced greater gastric relaxation than MCTs.
CONCLUSIONS—The satiation induced by intraduodenal LCT infusion seems to involve changes in gastric tone and plasma gut hormone levels. The gastric relaxation induced by MCT infusion, together with the absence of any significant change in satiation scores and plasma hormone levels, suggests that, at least up to a certain level, gastric relaxation is not sufficient to induce satiation and that nutrient induced gastric relaxation may occur through cholecystokinin independent mechanisms.


Keywords: gastric tone; triglyceride; hormones; satiation; cholecystokinin; nutrients PMID:10601051

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

PROGEN: An automated modelling algorithm for the generation of complete protein structures from the α-carbon atomic coordinates

NASA Astrophysics Data System (ADS)

Mandal, Chhabinath; Linthicum, D. Scott

1993-04-01

A modelling algorithm (PROGEN) for the generation of complete protein atomic coordinates from only the α-carbon coordinates is described. PROGEN utilizes an optimal geometry parameter (OGP) database for the positioning of atoms for each amino acid of the polypeptide model. The OGP database was established by examining the statistical correlations between 23 different intra-peptide and inter-peptide geometric parameters relative to the α-carbon distances for each amino acid in a library of 19 known proteins from the Brookhaven Protein Database (BPDB). The OGP files for specific amino acids and peptides were used to generate the atomic positions, with respect to α-carbons, for main-chain and side-chain atoms in the modelled structure. Refinement of the initial model was accomplished using energy minimization (EM) and molecular dynamics techniques. PROGEN was tested using 60 known proteins in the BPDB, representing a wide spectrum of primary and secondary structures. Comparison between PROGEN models and BPDB crystal reference structures gave r.m.s.d. values for peptide main-chain atoms between 0.29 and 0.76 Å, with a grand average of 0.53 Å for all 60 models. The r.m.s.d. for all non-hydrogen atoms ranged between 1.44 and 1.93 Å for the 60 polypeptide models. PROGEN was also able to make the correct assignment of cis- or trans-proline configurations in the protein structures examined. PROGEN offers a fully automatic building and refinement procedure and requires no special or specific structural considerations for the protein to be modelled.

Effect of proline and glycine residues on dynamics and barriers of loop formation in polypeptide chains.

PubMed

Krieger, Florian; Möglich, Andreas; Kiefhaber, Thomas

2005-03-16

Glycine and proline residues are frequently found in turn and loop structures of proteins and are believed to play an important role during chain compaction early in folding. We investigated their effect on the dynamics of intrachain loop formation in various unstructured polypeptide chains. Loop formation is significantly slower around trans prolyl peptide bonds and faster around glycine residues compared to any other amino acid. However, short loops are formed fastest around cis prolyl bonds with a time constant of 6 ns for end-to-end contact formation in a four-residue loop. Formation of short loops encounters activation energies in the range of 15 to 30 kJ/mol. The altered dynamics around glycine and trans prolyl bonds can be mainly ascribed to their effects on the activation energy. The fast dynamics around cis prolyl bonds, in contrast, originate in a higher Arrhenius pre-exponential factor, which compensates for an increased activation energy for loop formation compared to trans isomers. All-atom simulations of proline-containing peptides indicate that the conformational space for cis prolyl isomers is largely restricted compared to trans isomers. This leads to decreased average end-to-end distances and to a smaller loss in conformational entropy upon loop formation in cis isomers. The results further show that glycine and proline residues only influence formation of short loops containing between 2 and 10 residues, which is the typical loop size in native proteins. Formation of larger loops is not affected by the presence of a single glycine or proline residue.

[Collagens: why such a structural complexity?].

PubMed

Borel, J P; Monboisse, J C

1993-01-01

The collagens are a family of extracellular fibrillar proteins, characterized by the presence of one or several domains termed "triple helix", that are made of three polypeptide chains folded around each other. They elicit a huge worldwide research activity, marked every year by the publishing of dozens of books and thousands of papers. This family is presently represented by more than 16 individualized types, all differing by their molecular structure and by the way helical and globular domains are arranged. In any case, however, at least one triple helical domain exists. It is formed by the association of three polypeptide chains, each of them containing a glycine every three residues and many proline or hydroxyproline residues, and attests for the belonging of the protein to the collagen group. These multiple molecular forms and their specific architecture raise questions that remain unsolved. Why is this triple helix structure adopted in the case of collagens? Is it because the simple alpha helix of protein cannot extend over more than a few nanometers and is not solid enough? Why not a double helix like that of DNA? It would probably not be rigid enough. Why are there many globular domains interspersed between fibrillar ones? Probably these domains are useful for the association of peptide chains in register prior to their folding, then they participate in the transport of the elementary molecules from the synthesizing cells to their final place in the connective tissue and, finally, they insert the molecules into their specific place inside the growing fibrils. Collagen fibres as they are evidenced by histological methods, for instance in tendons, are of complex structure. Most of their constituting sub-units are type I tropocollagen molecules but they also contain in their center a filament of type V collagen that seems to serve as a guide during their edification. On the surface of the fibres are molecules of type III collagen that limit the growth in diameter and also type XII molecules that serve to bind the fibres to the surrounding substances. The collagen type multiplicity is explained by their various functions (mechanical role for tendons and ligaments, functions of wrapping around muscle cells, basement membrane role as a support for endothelial cells, function of glomerular filter, etc.). The fact that every collagen type contains several different polypeptide chains remains poorly explained. It may serve for the orientation of every elementary molecule inside the complex array of the polymer.(ABSTRACT TRUNCATED AT 400 WORDS)

Induced smectic phase in binary mixtures of twist-bend nematogens.

PubMed

Knežević, Anamarija; Dokli, Irena; Sapunar, Marin; Šegota, Suzana; Baumeister, Ute; Lesac, Andreja

2018-01-01

The investigation of liquid crystal (LC) mixtures is of great interest in tailoring material properties for specific applications. The recent discovery of the twist-bend nematic phase (N TB ) has sparked great interest in the scientific community, not only from a fundamental viewpoint, but also due to its potential for innovative applications. Here we report on the unexpected phase behaviour of a binary mixture of twist-bend nematogens. A binary phase diagram for mixtures of imino-linked cyanobiphenyl (CBI) dimer and imino-linked benzoyloxy-benzylidene (BB) dimer shows two distinct domains. While mixtures containing less than 35 mol % of BB possess a wide temperature range twist-bend nematic phase, the mixtures containing 55-80 mol % of BB exhibit a smectic phase despite that both pure compounds display a Iso-N-N TB -Cr phase sequence. The phase diagram shows that the addition of BB of up to 30 mol % significantly extends the temperature range of the N TB phase, maintaining the temperature range of the nematic phase. The periodicity, obtained by atomic force microscopy (AFM) imaging, is in the range of 6-7 nm. The induction of the smectic phase in the mixtures containing 55-80 mol % of BB was confirmed using polarising optical microscopy (POM), differential scanning calorimetry (DSC) and X-ray diffraction. The origin of the intercalated smectic phase was unravelled by combined spectroscopic and computational methods and can be traced to conformational disorder of the terminal chains. These results show the importance of understanding the phase behaviour of binary mixtures, not only in targeting a wide temperature range but also in controlling the self-organizing processes.

Single-molecule Protein Unfolding in Solid State Nanopores

PubMed Central

Talaga, David S.; Li, Jiali

2009-01-01

We use single silicon nitride nanopores to study folded, partially folded and unfolded single proteins by measuring their excluded volumes. The DNA-calibrated translocation signals of β-lactoglobulin and histidine-containing phosphocarrier protein match quantitatively with that predicted by a simple sum of the partial volumes of the amino acids in the polypeptide segment inside the pore when translocation stalls due to the primary charge sequence. Our analysis suggests that the majority of the protein molecules were linear or looped during translocation and that the electrical forces present under physiologically relevant potentials can unfold proteins. Our results show that the nanopore translocation signals are sensitive enough to distinguish the folding state of a protein and distinguish between proteins based on the excluded volume of a local segment of the polypeptide chain that transiently stalls in the nanopore due to the primary sequence of charges. PMID:19530678

Preformed mRNA in Cotyledons of Ungerminated Seeds of Cicer arietinum L. 1

PubMed Central

Matilla, Angel; Nicolás, Gregorio; Vicente, Oscar; Sierra, José Manuel

1980-01-01

Polyadenylated RNA was isolated from total RNA extracted from cotyledons of ungerminated or 18-hour-germinated chick-pea seeds by affinity chromatography on oligo(dT)-cellulose. Both poly(A)-containing RNA fractions exhibited a template activity when assayed in two cell-free translation systems, wheat germ extracts, and nuclease-treated reticulocyte lysates. Translation of preformed mRNA from cotyledons of dry seeds was completely abolished in the presence of several inhibitors of polypeptide chain initiation and also in the presence of the two “cap” analogues m7 GTP and m7 GMP. The patterns of polypeptides synthesized by translation of poly(A)-containing RNAs from cotyledons of ungerminated or 18-hour-germinated seeds, in the wheat germ system, analyzed by electrophoresis and autoradiography, were similar but not identical. It is concluded that cotyledons of dry Cicer arietinum L. seeds contain preformed mRNA. PMID:16661345

Prion-Associated Toxicity is Rescued by Elimination of Cotranslational Chaperones

PubMed Central

Keefer, Kathryn M.; True, Heather L.

2016-01-01

The nascent polypeptide-associated complex (NAC) is a highly conserved but poorly characterized triad of proteins that bind near the ribosome exit tunnel. The NAC is the first cotranslational factor to bind to polypeptides and assist with their proper folding. Surprisingly, we found that deletion of NAC subunits in Saccharomyces cerevisiae rescues toxicity associated with the strong [PSI+] prion. This counterintuitive finding can be explained by changes in chaperone balance and distribution whereby the folding of the prion protein is improved and the prion is rendered nontoxic. In particular, the ribosome-associated Hsp70 Ssb is redistributed away from Sup35 prion aggregates to the nascent chains, leading to an array of aggregation phenotypes that can mimic both overexpression and deletion of Ssb. This toxicity rescue demonstrates that chaperone modification can block key steps of the prion life cycle and has exciting implications for potential treatment of many human protein conformational disorders. PMID:27828954

Signatures of unfolding in the early stages of protein denaturation

NASA Astrophysics Data System (ADS)

Gray, Harry B.; Winkler, Jay R.; Kozak, John J.

2012-04-01

A comparative study of the early stages of unfolding of five proteins: cyt c, c-b 562, cyt c‧, azurin, and lysozyme is reported. From crystallographic data, helical regions and intervening non-helical (or 'turning') regions are identified in each. Exploiting a previously introduced geometrical model, the paper describes quantitatively the stepwise extension of a polypeptide chain subject to the geometrical constraint that the spatial relationship among the residues of each triplet is fixed by native-state crystallographic data. Despite differences among the above-cited proteins, remarkable universality of behavior is found in the early stages of unfolding. At the very earliest stages, internal residues in each helical region have a common unfolding history; the terminal residues, however, are extraordinarily sensitive to structural perturbations. Residues in non-helical sections of the polypeptide unfold after residues in the internal helical regions, but with increasing steric perturbation playing a dominant role in advancing denaturation.

Effects of Trichostatin A on drug uptake transporters in primary rat hepatocyte cultures

PubMed Central

Ramboer, Eva; Rogiers, Vera; Vanhaecke, Tamara; Vinken, Mathieu

2015-01-01

The present study was set up to investigate the effects of Trichostatin A (TSA), a prototypical epigenetic modifier, on the expression and activity of hepatic drug uptake transporters in primary cultured rat hepatocytes. To this end, the expression of the sinusoidal transporters sodium-dependent taurocholate cotransporting polypeptide (Ntcp) and organic anion transporting polypeptide 4 (Oatp4) was monitored by real-time quantitative reverse transcriptase polymerase chain reaction analysis and immunoblotting. The activity of the uptake transporters was analyzed using radiolabeled substrates and chemical inhibitors. Downregulation of the expression and activity of Oatp4 and Ntcp was observed as a function of the cultivation time and could not be counteracted by TSA. In conclusion, the epigenetic modifier TSA does not seem to exert a positive effect on the expression and activity of the investigated uptake transporters in primary rat hepatocyte cultures. PMID:26648816

Fabricating and Characterizing Physical Properties of Electrospun Polypeptide-based Nanofibers

NASA Astrophysics Data System (ADS)

Khadka, Dhan Bahadur

This dissertation has aimed to fabricate polypeptide based biomaterial and characterize physical properties. Electrospinning is used as a tool for the sample fabrication. Project focused on determining the feasibility of electrospinning of certain synthetic polypeptides and certain elastin-like peptides from aqueous feedstocks and to characterize physical properties of polymer aqueous solution, cast film and spun fibers and fiber mats. The research involves peptide design, polymer electrospinning, fibers crosslinking, determining the extent of crosslinking, fibers protease degradation study, fibers stability and self-organization analysis, structure and composition determination by various spectroscopy and microscopy techniques and characterization of mechanical properties of individual suspended fibers. Fiber mats of a synthetic cationic polypeptide poly(L-ornithine) (PLO) and an anionic co-polypeptide of L-glutamic acid and L-tyrosine (PLEY) of defined composition have been produced by electrospinning. Fibers were obtained from polymer aqueous solution at concentrations of 20-45% (w/v) in PLO and at concentrations of 20-60% (w/v) in PLEY. Applied voltage and spinneret-collector distance were also found to influence polymer spinnability and fibers morphology. Oriented fibers were obtained by parallel electrodes geometry. Fiber diameter and morphology was analyzed by scanning electron microscopy (SEM) and atomic force microscopy (AFM). PLO fibers exposed on glutaraldehyde (GTA) vapor rendered fiber mats water-insoluble. A common chemical reagent, carbodiimide was used to crosslink PLEY fibers. Fiber solubility in aqueous solution varied as a function of crosslinking time and crosslinker concentration. Crosslink density has been quantified by a visible-wavelength dye-based method. Degradation of crosslinked fibers by different proteases has been demonstrated. Investigation of crosslinked PLEY fibers has provided insight into the mechanisms of stability at different pH values. Variations in fiber morphology, elemental composition and stability have been studied by microscopy and energy-dispersive X-ray spectroscopy (EDX), following the treatment of samples at different pH values in the 2-12 range. Fiber stability has been interpreted with reference to the pH dependence of the UV absorbance and fluorescence of PLEY chains in solution. The data show that fiber stability is crucially dependent on the extent of side chain ionization, even after crosslinking. Self-organization kinetics of electrospun PLO and PLEY fibers during solvent annealing has been studied. After being crosslinked in situ , fibers were annealed in water at 22 °C. Analysis by Fourier transform infrared spectroscopy (FTIR) has revealed that annealing involved fiber restructuring with an overall time constant of 29 min for PLO and 63 min for PLEY, and that changes in the distribution of polymer conformations occurred during the first 13 min of annealing. There was a substantial decrease in the amount of Na+ bound to PLEY fibers during annealing. Kinetic modeling has indicated that two parallel pathways better account for the annealing trajectory than a single pathway with multiple transition states. Taken together, the results will advance the rational design of polypeptides for peptide-based materials, especially materials prepared by electrospinning. It is believed that this research will increase basic knowledge of polymer electrospinning and advance the development of electrospun materials, especially in medicine and biotechnology. The study has yielded two advances on previous work in the area: avoidance of an animal source of peptides and avoidance of inorganic solvent. The present results thus advance the growing field of peptide-based materials. Non-woven electrospun fiber mats made of polypeptides are increasingly considered attractive for basic research and technology development in biotechnology, medicine and other areas. (Abstract shortened by UMI.)

Self-generated covalent cross-links in the cell-surface adhesins of Gram-positive bacteria.

PubMed

Baker, Edward N; Squire, Christopher J; Young, Paul G

2015-10-01

The ability of bacteria to adhere to other cells or to surfaces depends on long, thin adhesive structures that are anchored to their cell walls. These structures include extended protein oligomers known as pili and single, multi-domain polypeptides, mostly based on multiple tandem Ig-like domains. Recent structural studies have revealed the widespread presence of covalent cross-links, not previously seen within proteins, which stabilize these domains. The cross-links discovered so far are either isopeptide bonds that link lysine side chains to the side chains of asparagine or aspartic acid residues or ester bonds between threonine and glutamine side chains. These bonds appear to be formed by spontaneous intramolecular reactions as the proteins fold and are strategically placed so as to impart considerable mechanical strength. © 2015 Authors; published by Portland Press Limited.

Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

NASA Astrophysics Data System (ADS)

Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

1986-07-01

The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

NASA Astrophysics Data System (ADS)

Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

1989-06-01

The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

Crystallographic studies of bovine beta2-microglobulin.

PubMed Central

Becker, J W; Ziffer, J A; Edelman, G M; Cunningham, B A

1977-01-01

Crystals of the bovine milk protein lactollin yield x-ray diffraction data extending to a resolution of 2.8 A. Lactollin is a bovine analogue of beta2-microglobulin, a protein that is homologous in amino acid sequence to the constant domains of immunoglobulins and is the light chain of the human and murine major histocompatability antigens. The protein crystallizes in the orthorhombic space group P2(1)2(1)2(1) with a = 77.4, b = 47.9, and c = 34.3 A. The unit cell parameters and physical chemical solution studies indicate that the molecule exists in the crystal and in solution as a single polypeptide chain of 12,000 daltons. Images PMID:71731

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baraibar, Martin A.; Muhoberac, Barry B.; Garringer, Holly J.

Mutations in the coding sequence of the ferritin light chain (FTL) gene cause a neurodegenerative disease known as neuroferritinopathy or hereditary ferritinopathy, which is characterized by the presence of intracellular inclusion bodies containing the mutant FTL polypeptide and by abnormal accumulation of iron in the brain. Here, we describe the x-ray crystallographic structure and report functional studies of ferritin homopolymers formed from the mutant FTL polypeptide p.Phe167SerfsX26, which has a C terminus that is altered in amino acid sequence and length. The structure was determined and refined to 2.85 {angstrom} resolution and was very similar to the wild type betweenmore » residues Ile-5 and Arg-154. However, instead of the E-helices normally present in wild type ferritin, the C-terminal sequences of all 24 mutant subunits showed substantial amounts of disorder, leading to multiple C-terminal polypeptide conformations and a large disruption of the normally tiny 4-fold axis pores. Functional studies underscored the importance of the mutant C-terminal sequence in iron-induced precipitation and revealed iron mishandling by soluble mutant FTL homopolymers in that only wild type incorporated iron when in direct competition in solution with mutant ferritin. Even without competition, the amount of iron incorporation over the first few minutes differed severalfold. Our data suggest that disruption at the 4-fold pores may lead to direct iron mishandling through attenuated iron incorporation by the soluble form of mutant ferritin and that the disordered C-terminal polypeptides may play a major role in iron-induced precipitation and formation of ferritin inclusion bodies in hereditary ferritinopathy.« less

Site-specific orientation of an α-helical peptide ovispirin-1 from isotope-labeled SFG spectroscopy.

PubMed

Ding, Bei; Laaser, Jennifer E; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T; Chen, Zhan

2013-11-27

Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single-isotope-labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138° from the surface normal, and the transition dipole of the isotope-labeled C═O group is tilted at 23° from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrate that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope-labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution.

Site-specific Orientation of an α-helical Peptide Ovispirin-1 from Isotope Labeled SFG Spectroscopy

PubMed Central

Ding, Bei; Laaser, Jennifer E.; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T.; Chen, Zhan

2013-01-01

Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single isotope labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138 degrees from the surface normal, and the transition dipole of the isotope labeled C=O group is tilted at 23 degrees from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrated that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution. PMID:24228619

Controlling photophysical properties of ultrasmall conjugated polymer nanoparticles through polymer chain packing

PubMed Central

Piwoński, Hubert; Michinobu, Tsuyoshi; Habuchi, Satoshi

2017-01-01

Applications of conjugated polymer nanoparticles (Pdots) for imaging and sensing depend on their size, fluorescence brightness and intraparticle energy transfer. The molecular design of conjugated polymers (CPs) has been the main focus of the development of Pdots. Here we demonstrate that proper control of the physical interactions between the chains is as critical as the molecular design. The unique design of twisted CPs and fine-tuning of the reprecipitation conditions allow us to fabricate ultrasmall (3.0–4.5 nm) Pdots with excellent photostability. Extensive photophysical and structural characterization reveals the essential role played by the packing of the polymer chains in the particles in the intraparticle spatial alignment of the emitting sites, which regulate the fluorescence brightness and the intraparticle energy migration efficiency. Our findings enhance understanding of the relationship between chain interactions and the photophysical properties of CP nanomaterials, providing a framework for designing and fabricating functional Pdots for imaging applications. PMID:28508857

Science & Technology USSR: Life Sciences.

DTIC Science & Technology

1988-07-13

abscisic acid , and gibberellins, were also found to enhance survival of the shoots. Again, the mechanism of action involved increased water reten...communis Seeds. II. Isolation and Comparative Description of the Acid Form of Ricin From Seeds of Central Asian Castor Bean Ricinus communis [D.A...Polypeptide Chains in Acid Ricin [D.A. Khashimov et al; KHIMIYA PRIRODNYKH SOYEDINENIY, No 6, Nov-Dec 87] 3 Use of Meldrum’s Acid in the Synthesis of Low

Discovery and Testing of Ricin Therapeutics

DTIC Science & Technology

2011-06-01

reticulum (ER) lumen. While in the ER, the ricin A chain co-opts ER quality control to gain access to the cytosol by a process referred to as...containing N-linked oligosaccharides characteristic of ER-resident molecules (21). RTAE177D and RTA! polypeptides with the predicted molecular weight...U373RTA! cells by pulse - chase analysis (Figure 2B and C). The cells were metabolically labeled with 35S-methionine for 15 min and Lane 1

Alpha-Helical Protein Domains Unify Strength and Robustness through Hierarchical Nanostructures

DTIC Science & Technology

2009-01-23

backbone atom (hydrogen donor) of peptide i + 4 in the polypeptide chain. Consequently, at each convolution , 3.5 H- bonds are found in a parallel...signaling and deformation behavior of cytoskeletal protein networks in cells (e.g. intermediate filaments vimentin and lamin as well as actin [7, 8... convolution . The Hierarchical Bell model enables one to predict the strength of different hierarchical bond arrangements as a function of the

An energy function for dynamics simulations of polypeptides in torsion angle space

NASA Astrophysics Data System (ADS)

Sartori, F.; Melchers, B.; Böttcher, H.; Knapp, E. W.

1998-05-01

Conventional simulation techniques to model the dynamics of proteins in atomic detail are restricted to short time scales. A simplified molecular description, in which high frequency motions with small amplitudes are ignored, can overcome this problem. In this protein model only the backbone dihedrals φ and ψ and the χi of the side chains serve as degrees of freedom. Bond angles and lengths are fixed at ideal geometry values provided by the standard molecular dynamics (MD) energy function CHARMM. In this work a Monte Carlo (MC) algorithm is used, whose elementary moves employ cooperative rotations in a small window of consecutive amide planes, leaving the polypeptide conformation outside of this window invariant. A single of these window MC moves generates local conformational changes only. But, the application of many such moves at different parts of the polypeptide backbone leads to global conformational changes. To account for the lack of flexibility in the protein model employed, the energy function used to evaluate conformational energies is split into sequentially neighbored and sequentially distant contributions. The sequentially neighbored part is represented by an effective (φ,ψ)-torsion potential. It is derived from MD simulations of a flexible model dipeptide using a conventional MD energy function. To avoid exaggeration of hydrogen bonding strengths, the electrostatic interactions involving hydrogen atoms are scaled down at short distances. With these adjustments of the energy function, the rigid polypeptide model exhibits the same equilibrium distributions as obtained by conventional MD simulation with a fully flexible molecular model. Also, the same temperature dependence of the stability and build-up of α helices of 18-alanine as found in MD simulations is observed using the adapted energy function for MC simulations. Analyses of transition frequencies demonstrate that also dynamical aspects of MD trajectories are faithfully reproduced. Finally, it is demonstrated that even for high temperature unfolded polypeptides the MC simulation is more efficient by a factor of 10 than conventional MD simulations.

Monosaccharide transporter of the human erythrocyte. Characterization of an improved preparation.

PubMed

Baldwin, S A; Baldwin, J M; Lienhard, G E

1982-08-03

The human erythrocyte monosaccharide transporter has been purified through the use of the dialyzable detergent octyl glucoside. It was found that the transporter denatures in the detergent and that the rate of this process could be reduced by increasing the ratio of phospholipid to detergent. The transporter was obtained in higher yield and with a higher specific activity for cytochalasin B binding than has been previously reported. Scatchard plot analysis of cytochalasin B binding to the reconstituted preparations gave a dissociation constant of 1.5 X 10(-7) M, and there were found to be 15.3 nmol of sites/mg of protein. On the basis of a value of 46 000 for the molecular weight of the polypeptide, this specific activity corresponds to 0.70 site/polypeptide chain; and there are reasons to believe that the value of the stoichiometry may be one site per functional transporter polypeptide. The complete amino acid composition and the N- and C-terminal residues of the transporter have been determined. Both the intact transporter and transporter that had been partially depleted of carbohydrate by treatment with endo-beta-galactosidase were found to migrate anomalously upon sodium dodecyl sulfate--polyacrylamide gel electrophoresis, relative to the behavior of standard proteins.

Studies on the structure of sphingomyelinase. Amino acid composition and heterogeneity on isoelectric focusing.

PubMed Central

Jones, C S; Shankaran, P; Davidson, D J; Poulos, A; Callahan, J W

1983-01-01

Sphingomyelinase, purified to apparent homogeneity from human placenta, is an acidic protein, as judged from its amino acid composition and by isoelectric focusing of the carboxymethylated protein. The amino acid composition is characterized by an approximately equal content of hydrophobic and polar amino acid residues. The reduced-alkylated polypeptides were separated into two groups. Most of the polypeptides were heterogeneous with pI values of 4.4-5.0, but an additional more minor component was observed at pI 5.4. Liquid isoelectric focusing resolved the purified enzyme into a single major component (pI 4.7-4.8), a minor component (pI 5.0-5.4) and a plateau region of activity (pI 6-7). On thin-layer isoelectric focusing, the protein profile obtained from each of these regions was the same. In addition, the substrate specificity, Km values and effect of inhibitory substances were identical. We conclude that sphingomyelinase is an acidic, microheterogeneous protein that likely exists as a holopolymer of a single major polypeptide chain. the heterogeneity of the intact protein on isoelectric focusing appears to reflect this microheterogeneity, which is influenced by a tendency to associate with itself and with detergents such as Triton X-100. Images Fig. 1. Fig. 2. Fig. 4. PMID:6303305

Triplet and ground state potential energy surfaces of 1,4-diphenyl-1,3-butadiene: theory and experiment.

PubMed

Saltiel, J; Dmitrenko, O; Pillai, Z S; Klima, R; Wang, S; Wharton, T; Huang, Z-N; van de Burgt, L J; Arranz, J

2008-05-01

Relative energies of the ground state isomers of 1,4-diphenyl-1,3-butadiene (DPB) are determined from the temperature dependence of equilibrium isomer compositions obtained with the use of diphenyl diselenide as catalyst. Temperature and concentration effects on photostationary states and isomerization quantum yields with biacetyl or fluorenone as triplet sensitizers with or without the presence of O(2), lead to significant modification of the proposed DPB triplet potential energy surface. Quantum yields for ct-DPB formation from tt-DPB increase with [tt-DPB] revealing a quantum chain process in the tt --> ct direction, as had been observed for the ct --> tt direction, and suggesting an energy minimum at the (3)ct* geometry. They confirm the presence of planar and twisted isomeric triplets in equilibrium (K), with energy transfer from planar or quasi-planar geometries (quantum chain events from tt and ct triplets) and unimolecular decay (k(d)) from twisted geometries. Starting from cc-DPB, varphi(cc-->tt) increases with increasing [cc-DPB] whereas varphi(cc-->ct) is relatively insensitive to concentration changes. The concentration and temperature dependencies of the decay rate constants of DPB triplets in cyclohexane are consistent with the mechanism deduced from the photoisomerization quantum yields. The experimental DeltaH between (3)tt-DPB* and (3)tp-DPB*, 2.7 kcal mol(-1), is compared with the calculated energy difference [DFT with B3LYP/6-31+G(d,p) basis set]. Use of the calculated DeltaS = 4.04 eu between the two triplets gives k(d) = (2.4-6.4) x 10(7) s(-1), close to 1.70 x 10(7) s(-1), the value for twisted stilbene triplet decay. Experimental and calculated relative energies of DPB isomers on the ground and triplet state surfaces agree and theory is relied upon to deduce structural characteristics of the equilibrated conformers in the DPB triplet state.

pH-sensitive gating by conformational change of a polypeptide brush grafted onto a porous polymer membrane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ito, Yoshihiro; Ochiai, Yasushi; Park, Y.S.

1997-02-19

Benzyl glutamate NCA was graft-polymerized onto a porous poly(tetrafluoroethylene) membrane in order to study the effects of pH and ionic strength on permeation rate. The membrane was first glow-discharged in the presence of ammonia in order to produce amino groups on the surface. Following graft polymerization the graft chains were hydrolyzed to yield poly(glutamic acid). The rate of water permeation through this poly(glutamic acid)-grafted polymer membrane was pH-dependent and found to be slow under high-pH conditions and fast under low-pH conditions. Under high-pH conditions, randomly coiled graft chains extend to close the pores. The chains form a helix structure andmore » open the pores under low-pH conditions. The magnitude of the permeation rate was dependent upon the length and density of graft chains. Ionic strength also affected the permeation rate. 39 refs., 7 figs., 2 tabs.« less

Crystal structure of bovine Cu,Zn superoxide dismutase at 3 A resolution: chain tracing and metal ligands.

PubMed Central

Richardson, J; Thomas, K A; Rubin, B H; Richardson, D C

1975-01-01

An electron density map at 3 angstrom resolution has been calculated for Cu2+, Zn2+ superoxide dismutase from bovine erythrocytes, and the course of the main chain has been traced. The dominant structural feature is an 8-stranded barrel of antiparallel beta-pleated sheet. There is one very short helical section and two long loops of non-repetitive structure. The Cu and Zn are bound between the loops and one side of the beta barrel and are about 6 Angstrom apart, with a common histidine ligand. The Cu has four histidine ligands in a somewhat distorted square plane, and the Zn has three histidines and an aspartate in approximately tetrahedral arrangement. The two coppers of a dimer are about 34 Angstrom apart. The two subunits have essentially the same conformation and have an extensive contact area that mainly involves hydrophobic side chain interactions. The overall folding pattern of the polypeptide chain is very similar to that of an immunoglobulin domain. Images PMID:1055410

Wide-Angle X-Ray Scattering and Solid-State Nuclear Magnetic Resonance Data Combined to Test Models for Cellulose Microfibrils in Mung Bean Cell Walls1

PubMed Central

Newman, Roger H.; Hill, Stefan J.; Harris, Philip J.

2013-01-01

A synchrotron wide-angle x-ray scattering study of mung bean (Vigna radiata) primary cell walls was combined with published solid-state nuclear magnetic resonance data to test models for packing of (1→4)-β-glucan chains in cellulose microfibrils. Computer-simulated peak shapes, calculated for 36-chain microfibrils with perfect order or uncorrelated disorder, were sharper than those in the experimental diffractogram. Introducing correlated disorder into the models broaden the simulated peaks but only when the disorder was increased to unrealistic magnitudes. Computer-simulated diffractograms, calculated for 24- and 18-chain models, showed good fits to experimental data. Particularly good fits to both x-ray and nuclear magnetic resonance data were obtained for collections of 18-chain models with mixed cross-sectional shapes and occasional twinning. Synthesis of 18-chain microfibrils is consistent with a model for cellulose-synthesizing complexes in which three cellulose synthase polypeptides form a particle and six particles form a rosette. PMID:24154621

Nanostructure of cellulose microfibrils in spruce wood.

PubMed

Fernandes, Anwesha N; Thomas, Lynne H; Altaner, Clemens M; Callow, Philip; Forsyth, V Trevor; Apperley, David C; Kennedy, Craig J; Jarvis, Michael C

2011-11-22

The structure of cellulose microfibrils in wood is not known in detail, despite the abundance of cellulose in woody biomass and its importance for biology, energy, and engineering. The structure of the microfibrils of spruce wood cellulose was investigated using a range of spectroscopic methods coupled to small-angle neutron and wide-angle X-ray scattering. The scattering data were consistent with 24-chain microfibrils and favored a "rectangular" model with both hydrophobic and hydrophilic surfaces exposed. Disorder in chain packing and hydrogen bonding was shown to increase outwards from the microfibril center. The extent of disorder blurred the distinction between the I alpha and I beta allomorphs. Chains at the surface were distinct in conformation, with high levels of conformational disorder at C-6, less intramolecular hydrogen bonding and more outward-directed hydrogen bonding. Axial disorder could be explained in terms of twisting of the microfibrils, with implications for their biosynthesis.

Tuning calcium carbonate growth through physical confinement and templating with amyloid-like polypeptide aggregates

NASA Astrophysics Data System (ADS)

Colaco, Martin Francis

The creation of useful composite materials requires precise control of the interface between the components in order to tune the overall shape and material properties. Despite the current research into nanotechnology, our ability to create materials with nanoscale precision is nascent. However, nature has a paradigm for the creation of finely structured composites under mild conditions called biomineralization. Through control of protein template assembly, solution conditions, and physical confinement, organisms are able to create useful optical and structural materials, such as bones, teeth, and mollusk shells. The objective of this thesis is to elucidate the importance of these various controls in synthetic systems to further our ability to create nanostructured materials. We begin by examining the formation of self-assembled monolayers (SAMs) of organosilanes on silica oxides. The formation of functionalized surfaces can help control the mineralization of amorphous or crystalline calcium carbonate. Long-chained organosilanes organize on surfaces to form dense, solid-like films, with the terminal groups determining the hydrophobicity and stereochemistry of the film. Our work has shown that uniform hydrophobic and hydrophilic films can be formed by using cleaned silica over glass or mica and through a vapor phase reaction over a liquid one. Additionally, we showed that mixed SAMs with phase-separated domains could be created through the selection of organosilanes and reaction conditions. We have built on these functionalized surfaces through the use of microfabrication and a gas permeable polymer to create three-dimensionally confined microcrystallizers. Other researchers have shown that one-dimensional confinement with a multi-functional surface (patterned with a small nucleating ordered region in a disordered SAM) can stabilize the creation of an amorphous calcium carbonate film before a single, large, micropatterned crystal is grown. Our work has determined that this methodology does not extend to three-dimensional confined systems, as the water has no method of escape. Through the addition of an insoluble hydroscopic polymer to our microreactors, amorphous calcium carbonate of controllable sizes can be grown. However, crystalline calcium carbonate cannot be grown without some type of templating. Studies of calcium carbonate templating have predominantly been performed on SAMs or in poorly characterized gels or protein films. The use of ordered protein or polypeptide aggregates for templating permits both geometry and charge surface density to be varied. We have studied the kinetics and final morphology of ordered aggregates of poly-L-glutamic acid and a copolymer of glutamic acid and alanine through experiments and simulations. Electrostatics, not structure, of the monomer appeared to be the dominating factor in the aggregation, as pH and salt concentration changes led to dramatic changes in the kinetics. Examining our experimental with existing models provided inconsistent results, so we developed a new model that yielded physically realistic rate constants, while generating better fits with longer lag phases and faster growths. However, despite the similarity of aggregation conditions, the two polypeptides yielded vastly different morphologies, with the PEA forming typical amyloid-like fibrils and PE forming larger, twisted lamellar aggregates. Templating with these aggregates also yielded dramatically different patterns. Polycrystalline rhombohedral calcite with smooth faces and edges grew on PEA fibrils, with minimal templating in evidence. However, on PE, numerous calcite crystals with triangular projections tracked the surface of the aggregate. The PE lamellae are characterized by extensive beta-sheet structure. In this conformation, the glutamic acid spacings on the surface of the aggregates can mimic the spacings of the carboxylates in the calcite lattice. In addition, the high negative charge density on the polypeptide surface led to a large number of nucleation sites. As the crystals grow, they impinge on each other but are limited to grow in one direction, perpendicular to the aggregate surface. Thus, the crystal structure propagates even at large length scales.

Dock 'n roll: folding of a silk-inspired polypeptide into an amyloid-like beta solenoid.

PubMed

Zhao, Binwu; Cohen Stuart, Martien A; Hall, Carol K

2016-04-20

Polypeptides containing the motif ((GA)mGX)n occur in silk and have a strong tendency to self-assemble. For example, polypeptides containing (GAGAGAGX)n, where X = G or H have been observed to form filaments; similar sequences but with X = Q have been used in the design of coat proteins (capsids) for artificial viruses. The structure of the (GAGAGAGX)m filaments has been proposed to be a stack of peptides in a β roll structure with the hydrophobic side chains pointing outwards (hydrophobic shell). Another possible configuration, a β roll or β solenoid structure which has its hydrophobic side chains buried inside (hydrophobic core) was, however, overlooked. We perform ground state analysis as well as atomic-level molecular dynamics simulations, both on single molecules and on two-molecule stacks of the silk-inspired sequence (GAGAGAGQ)10, to decide whether the hydrophobic core or the hydrophobic shell configuration is the most stable one. We find that a stack of two hydrophobic core molecules is energetically more favorable than a stack of two hydrophobic shell molecules. A shell molecule initially placed in a perfect β roll structure tends to rotate its strands, breaking in-plane hydrogen bonds and forming out-of-plane hydrogen bonds, while a core molecule stays in the β roll structure. The hydrophobic shell structure has type II' β turns whereas the core configuration has type II β turns; only the latter secondary structure agrees well with solid-state NMR experiments on a similar sequence (GA)15. We also observe that the core stack has a higher number of intra-molecular hydrogen bonds and a higher number of hydrogen bonds between stack and water than the shell stack. Hence, we conclude that the hydrophobic core configuration is the most likely structure. In the stacked state, each peptide has more intra-molecular hydrogen bonds than a single folded molecule, which suggests that stacking provides the extra stability needed for molecules to reach the folded state.

A further insight into the biosorption mechanism of Au(III) by infrared spectrometry

PubMed Central

2011-01-01

Background The interactions of microbes with metal ions form an important basis for our study of biotechnological applications. Despite the recent progress in studying some properties of Au(III) adsorption and reduction by Bacillus megatherium D01 biomass, there is still a need for additional data on the molecular mechanisms of biosorbents responsible for their interactions with Au(III) to have a further insight and to make a better exposition. Results The biosorption mechanism of Au(III) onto the resting cell of Bacillus megatherium D01 biomass on a molecular level has been further studied here. The infrared (IR) spectroscopy on D01 biomass and that binding Au(III) demonstrates that the molecular recognition of and binding to Au(III) appear to occur mostly with oxygenous- and nitrogenous-active groups of polysaccharides and proteins in cell wall biopolymers, such as hydroxyl of saccharides, carboxylate anion of amino-acid residues (side-chains of polypeptide backbone), peptide bond (amide I and amide II bands), etc.; and that the active groups must serve as nucleation sites for Au(0) nuclei growth. A further investigation on the interactions of each of the soluble hydrolysates of D01, Bacillus licheniformis R08, Lactobacillus sp. strain A09 and waste Saccharomyces cerevisiae biomasses with Au(III) by IR spectrometry clearly reveals an essential biomacromolecule-characteristic that seems the binding of Au(III) to the oxygen of the peptide bond has caused a significant, molecular conformation-rearrangement in polypeptide backbones from β-pleated sheet to α-helices and/or β-turns of protein secondary structure; and that this changing appears to be accompanied by the occurrence, in the peptide bond, of much unbound -C=O and H-N- groups, being freed from the inter-molecular hydrogen-bonding of the β-pleated sheet and carried on the helical forms, as well as by the alternation in side chain steric positions of protein primary structure. This might be reasonably expected to result in higher-affinity interactions of peptide bond and side chains with Au(III). Conclusions The evidence suggests that the polypeptides appear to be activated by the intervention of Au(III) via the molecular reconformation and in turn react upon Au(III) actively and exert profound impacts on the course of Au(0) nucleation and crystal growth. PMID:22032692

Prefoldin–Nascent Chain Complexes in the Folding of Cytoskeletal Proteins

PubMed Central

Hansen, William J.; Cowan, Nicholas J.; Welch, William J.

1999-01-01

In vitro transcription/translation of actin cDNA and analysis of the translation products by native-PAGE was used to study the maturation pathway of actin. During the course of actin synthesis, several distinct actin-containing species were observed and the composition of each determined by immunological procedures. After synthesis of the first ∼145 amino acids, the nascent ribosome-associated actin chain binds to the recently identified heteromeric chaperone protein, prefoldin (PFD). PFD remains bound to the relatively unfolded actin polypeptide until its posttranslational delivery to cytosolic chaperonin (CCT). We show that α- and β-tubulin follow a similar maturation pathway, but to date find no evidence for an interaction between PFD and several noncytoskeletal proteins. We conclude that PFD functions by selectively targeting nascent actin and tubulin chains pending their transfer to CCT for final folding and/or assembly. PMID:10209023

The force-sensing peptide VemP employs extreme compaction and secondary structure formation to induce ribosomal stalling.

PubMed

Su, Ting; Cheng, Jingdong; Sohmen, Daniel; Hedman, Rickard; Berninghausen, Otto; von Heijne, Gunnar; Wilson, Daniel N; Beckmann, Roland

2017-05-30

Interaction between the nascent polypeptide chain and the ribosomal exit tunnel can modulate the rate of translation and induce translational arrest to regulate expression of downstream genes. The ribosomal tunnel also provides a protected environment for initial protein folding events. Here, we present a 2.9 Å cryo-electron microscopy structure of a ribosome stalled during translation of the extremely compacted VemP nascent chain. The nascent chain forms two α-helices connected by an α-turn and a loop, enabling a total of 37 amino acids to be observed within the first 50-55 Å of the exit tunnel. The structure reveals how α-helix formation directly within the peptidyltransferase center of the ribosome interferes with aminoacyl-tRNA accommodation, suggesting that during canonical translation, a major role of the exit tunnel is to prevent excessive secondary structure formation that can interfere with the peptidyltransferase activity of the ribosome.

Three-dimensional crystal structure of recombinant murine interferon-beta.

PubMed Central

Senda, T; Shimazu, T; Matsuda, S; Kawano, G; Shimizu, H; Nakamura, K T; Mitsui, Y

1992-01-01

The crystal structure of recombinant murine interferon-beta (IFN-beta) has been solved by the multiple isomorphous replacement method and refined to an R-factor of 20.5% against 2.6 A X-ray diffraction data. The structure shows a variant of the alpha-helix bundle with a new chain-folding topology, which seems to represent a basic structural framework of all the IFN-alpha and IFN-beta molecules belonging to the type I family. Functionally important segments of the polypeptide chain, as implied through numerous gene manipulation studies carried out so far, are spatially clustered indicating the binding site(s) to the receptor(s). Comparison of the present structure with those of other alpha-helical cytokine proteins, including porcine growth hormone, interleukin 2 and interferon gamma, indicated either a topological similarity in chain folding or a similar spatial arrangement of the alpha-helices. Images PMID:1505514

Effects of Variable Resistance Using Chains on Bench Throw Performance in Trained Rugby Players.

PubMed

Godwin, Mark S; Fernandes, John F T; Twist, Craig

2018-04-01

Godwin, MS, Fernandes, JFT, and Twist, C. Effects of variable resistance using chains on bench throw performance in trained rugby players. J Strength Cond Res 32(4): 950-954, 2018-This study sought to determine the effects of variable resistance using chain resistance on bench throw performance. Eight male rugby union players (19.4 ± 2.3 years, 88.8 ± 6.0 kg, 1RM 105.6 ± 17.0 kg) were recruited from a national league team. In a randomized crossover design, participant's performed 3 bench throws at 45% one repetition maximum (1RM) at a constant load (no chains) or a variable load (30% 1RM constant load and 15% 1RM variable load; chains) with 7 days between conditions. For each repetition, the peak and mean velocity, peak power, peak acceleration, and time to peak velocity were recorded. Differences in peak and mean power were very likely trivial and unclear between the chain and no chain conditions, respectively. Possibly greater peak and likely greater mean bar velocity were accompanied by likely to most likely greater bar velocity between 50 and 400 ms from initiation of bench press in the chain condition compared with the no chain condition. Accordingly, bar acceleration was very likely greater in the chain condition compared with the no chain condition. In conclusion, these results show that the inclusion of chain resistance can acutely enhance several variables in the bench press throw and gives support to this type of training.

Stretching of Single Polymer Chains Using the Atomic Force Microscope

NASA Astrophysics Data System (ADS)

Ortiz, C.; van der Vegte, E. W.; van Swieten, E.; Robillard, G. T.; Hadziioannou, G.

1998-03-01

A variety of macroscopic phenomenon involve "nanoscale" polymer deformation including rubber elasticity, shear yielding, strain hardening, stress relaxation, fracture, and flow. With the advent of new and improved experimental techniques, such as the atomic force microscope (AFM), the probing of physical properties of polymers has reached finer and finer scales. The development of mixed self-assembling monolayer techniques and the chemical functionalization of AFM probe tips has allowed for mechanical experiments on single polymer chains of molecular dimensions. In our experiments, mixed monolayers are prepared in which end-functionalized, flexible polymer chains of thiol-terminated poly(methacrylic acid) are covalently bonded, isolated, and randomly distributed on gold substrates. The coils are then imaged, tethered to a gold-coated AFM tip, and stretched between the tip and the substrate in a conventional force / distance experiment. An increase in the attractive force due to entropic, elastic resistance to stretching, as well as fracture of the polymer chain is observed. The effect of chain stiffness, topological constraints, strain rate, mechanical hysteresis, and stress relaxation were investigated. Force modulation techniques were also employed in order to image the viscoelastic character of the polymer chains. Parallel work includes similar studies of biological systems such as wheat gluten proteins and polypeptides.

Crystal structure and Hirshfeld surface analysis of 3-cyano­phenyl­boronic acid

PubMed Central

Cárdenas-Valenzuela, A. Jaquelin; González-García, Gerardo; Zárraga- Nuñez, Ramón; Höpfl, Herbert; Campos-Gaxiola, José J.; Cruz-Enríquez, Adriana

2018-01-01

In the title compound, C7H6BNO2, the mean plane of the –B(OH)2 group is twisted by 21.28 (6)° relative to the cyano­phenyl ring mean plane. In the crystal, mol­ecules are linked by O—H⋯O and O—H⋯N hydrogen bonds, forming chains propagating along the [101] direction. Offset π–π and B⋯π stacking inter­actions link the chains, forming a three-dimensional network. Hirshfeld surface analysis shows that van der Waals inter­actions constitute a further major contribution to the inter­molecular inter­actions, with H⋯H contacts accounting for 25.8% of the surface. PMID:29765741

2-(3-Chloro­phen­yl)-4,5-dihydro-1H-imidazole

PubMed Central

Kia, Reza; Fun, Hoong-Kun; Kargar, Hadi

2009-01-01

In the title compound, C9H9ClN2, a substituted imidazoline, the six- and five-membered rings are twisted from each other, making a dihedral angle of 17.07 (5)°. In the crystal structure, a short Cl⋯Cl [3.3540 (3) Å] inter­action is observed. Neighbouring mol­ecules are linked together by inter­molecular N—H⋯N hydrogen bonds into a one-dimensional infinite chain along the [101] direction and short Cl⋯Cl contacts link the chains into a three-dimensional network. There is also a significant π-stacking inter­action between the planar sections of the six- and five-membered rings. PMID:21581940

Targeting allosteric disulphide bonds in cancer.

PubMed

Hogg, Philip J

2013-06-01

Protein action in nature is generally controlled by the amount of protein produced and by chemical modification of the protein, and both are often perturbed in cancer. The amino acid side chains and the peptide and disulphide bonds that bind the polypeptide backbone can be post-translationally modified. Post-translational cleavage or the formation of disulphide bonds are now being identified in cancer-related proteins and it is timely to consider how these allosteric bonds could be targeted for new therapies.

Abnormal iron metabolism and oxidative stress in mice expressing a mutant form of the ferritin light polypeptide gene

PubMed Central

Barbeito, Ana G.; Garringer, Holly J.; Baraibar, Martin A.; Gao, Xiaoying; Arredondo, Miguel; Núñez, Marco T.; Smith, Mark A.; Ghetti, Bernardino; Vidal, Ruben

2009-01-01

Insertional mutations in exon 4 of the ferritin light chain (FTL) gene are associated with hereditary ferritinopathy (HF) or neuroferritinopathy, an autosomal dominant neurodegenerative disease characterized by progressive impairment of motor and cognitive functions. To determine the pathogenic mechanisms by which mutations in FTL lead to neurodegeneration, we investigated iron metabolism and markers of oxidative stress in the brain of transgenic (Tg) mice that express the mutant human FTL498-499InsTC cDNA. Compared with wild-type mice, brain extracts from Tg (FTL-Tg) mice showed an increase in the cytoplasmic levels of both FTL and ferritin heavy chain polypeptides, a decrease in the protein and mRNA levels of transferrin receptor-1, and a significant increase in iron levels. Transgenic mice also showed the presence of markers for lipid peroxidation, protein carbonyls, and nitrone–protein adducts in the brain. However, gene expression analysis of iron management proteins in the liver of Tg mice indicates that the FTL-Tg mouse liver is iron deficient. Our data suggest that disruption of iron metabolism in the brain has a primary role in the process of neurodegeneration in HF and that the pathogenesis of HF is likely to result from a combination of reduction in iron storage function and enhanced toxicity associated with iron-induced ferritin aggregates in the brain. PMID:19519778

Molecular diagnosis of analbuminemia: a new case caused by a nonsense mutation in the albumin gene.

PubMed

Dagnino, Monica; Caridi, Gianluca; Haenni, Ueli; Duss, Adrian; Aregger, Fabienne; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2011-01-01

Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin (ALB). We report here a new case diagnosed in a 45 years old man of Southwestern Asian origin, living in Switzerland, on the basis of his low ALB concentration (0.9 g/L) in the absence of renal or gastrointestinal protein loss, or liver dysfunction. The clinical diagnosis was confirmed by a mutational analysis of the albumin (ALB) gene, carried out by single-strand conformational polymorphism (SSCP), heteroduplex analysis (HA), and DNA sequencing. This screening of the ALB gene revealed that the proband is homozygous for two mutations: the insertion of a T in a stretch of eight Ts spanning positions c.1289 + 23-c.1289 + 30 of intron 10 and a c.802 G > T transversion in exon 7. Whereas the presence of an additional T in the poly-T tract has no direct deleterious effect, the latter nonsense mutation changes the codon GAA for Glu244 to the stop codon TAA, resulting in a premature termination of the polypeptide chain. The putative protein product would have a length of only 243 amino acid residues instead of the normal 585 found in the mature serum albumin, but no evidence for the presence in serum of such a truncated polypeptide chain could be obtained by two dimensional electrophoresis and western blotting analysis.

A general method for the derivation of the functional forms of the effective energy terms in coarse-grained energy functions of polymers. I. Backbone potentials of coarse-grained polypeptide chains

NASA Astrophysics Data System (ADS)

Sieradzan, Adam K.; Makowski, Mariusz; Augustynowicz, Antoni; Liwo, Adam

2017-03-01

A general and systematic method for the derivation of the functional expressions for the effective energy terms in coarse-grained force fields of polymer chains is proposed. The method is based on the expansion of the potential of mean force of the system studied in the cluster-cumulant series and expanding the all-atom energy in the Taylor series in the squares of interatomic distances about the squares of the distances between coarse-grained centers, to obtain approximate analytical expressions for the cluster cumulants. The primary degrees of freedom to average about are the angles for collective rotation of the atoms contained in the coarse-grained interaction sites about the respective virtual-bond axes. The approach has been applied to the revision of the virtual-bond-angle, virtual-bond-torsional, and backbone-local-and-electrostatic correlation potentials for the UNited RESidue (UNRES) model of polypeptide chains, demonstrating the strong dependence of the torsional and correlation potentials on virtual-bond angles, not considered in the current UNRES. The theoretical considerations are illustrated with the potentials calculated from the ab initio potential-energy surface of terminally blocked alanine by numerical integration and with the statistical potentials derived from known protein structures. The revised torsional potentials correctly indicate that virtual-bond angles close to 90° result in the preference for the turn and helical structures, while large virtual-bond angles result in the preference for polyproline II and extended backbone geometry. The revised correlation potentials correctly reproduce the preference for the formation of β-sheet structures for large values of virtual-bond angles and for the formation of α-helical structures for virtual-bond angles close to 90°.

Human lung surfactant protein A exists in several different oligomeric states: oligomer size distribution varies between patient groups.

PubMed Central

Hickling, T. P.; Malhotra, R.; Sim, R. B.

1998-01-01

BACKGROUND: Lung surfactant protein A (SP-A) is a complex molecule composed of up to 18 polypeptide chains. In vivo, SP-A probably binds to a wide range of inhaled materials via the interaction of surface carbohydrates with the lectin domains of SP-A and mediates their interaction with cells as part of a natural defense system. Multiplicity of lectin domains gives high-affinity binding to carbohydrate-bearing surfaces. MATERIALS AND METHODS: Gel filtration analyses were performed on bronchoalveolar lavage (BAL) fluid samples from three patient groups: pulmonary alveolar proteinosis (n = 12), birch pollen allergy (n = 11), and healthy volunteers (n = 4). Sucrose density gradient centrifugation was employed to determine molecular weights of SP-A oligomers. SP-A was solubilized from the lipid phase to compare oligomeric state with that of water soluble SP-A. RESULTS: SP-A exists as fully assembled complexes with 18 polypeptide chains, but it is also consistently found in smaller oligomeric forms. This is true for both the water- and lipid-soluble fractions of SP-A. CONCLUSION: The three patient groups analyzed show a shift towards lower oligomeric forms of SP-A in the following sequence: healthy-pulmonary alveolar proteinosis-pollen allergy. Depolymerization would be expected to lead to loss of binding affinity for carbohydrate-rich surfaces, with loss or alteration of biological function. While there are many complex factors involved in the establishment of an allergy, it is possible that reduced participation of SP-A in clearing a potential allergen from the lungs could be an early step in the chain of events. Images Fig. 4 FIG. 6 Fig. 7 Fig. 8 PMID:9606179

Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site

PubMed Central

Song, Lingyun; Caguiat, Jonathan; Li, Zhongrui; Shokes, Jacob; Scott, Robert A.; Olliff, Lynda; Summers, Anne O.

2004-01-01

The repressor-activator MerR that controls transcription of the mercury resistance (mer) operon is unusual for its high sensitivity and specificity for Hg(II) in in vivo and in vitro transcriptional assays. The metal-recognition domain of MerR resides at the homodimer interface in a novel antiparallel arrangement of α-helix 5 that forms a coiled-coil motif. To facilitate the study of this novel metal binding motif, we assembled this antiparallel coiled coil into a single chain by directly fusing two copies of the 48-residue α-helix 5 of MerR. The resulting 107-residue polypeptide, called the metal binding domain (MBD), and wild-type MerR were overproduced and purified, and their metal-binding properties were determined in vivo and in vitro. In vitro MBD bound ca. 1.0 equivalent of Hg(II) per pair of binding sites, just as MerR does, and it showed only a slightly lower affinity for Hg(II) than did MerR. Extended X-ray absorption fine structure data showed that MBD has essentially the same Hg(II) coordination environment as MerR. In vivo, cells overexpressing MBD accumulated 70 to 100% more 203Hg(II) than cells bearing the vector alone, without deleterious effects on cell growth. Both MerR and MBD variously bound other thiophilic metal ions, including Cd(II), Zn(II), Pb(II), and As(III), in vitro and in vivo. We conclude that (i) it is possible to simulate in a single polypeptide chain the in vitro and in vivo metal-binding ability of dimeric, full-length MerR and (ii) MerR's specificity in transcriptional activation does not reside solely in the metal-binding step. PMID:14996817

Characterization of myosin light chain in shrimp hemocytic phagocytosis.

PubMed

Han, Fang; Wang, Zhiyong; Wang, Xiaoqing

2010-11-01

Myosin light chain, a well-known cytoskeleton gene, regulates multiple processes that are involved in material transport, muscle shrink and cell division. However, its function in phagocytosis against invading pathogens in crustacean remains unknown. In this investigation, a myosin light chain gene was obtained from Marsupenaeus japonicus shrimp. The full-length cDNA of this gene was of 766 bp and an open reading frame (ORF) of 462 bp encoding a polypeptide of 153 amino acids. The myosin light chain protein was expressed in Escherichia coli and purified. Subsequently the specific antibody was raised using the purified GST fusion protein. As revealed by immuno-electron microscopy, the myosin light chain protein was only expressed in the dark bands of muscle. In the present study, the myosin light chain gene was up-regulated in the WSSV-resistant shrimp as revealed by real-time PCR and western blot. And the phagocytic percentage and phagocytic index using FITC-labeled Vibrio parahemolyticus were remarkably increased in the WSSV-resistant shrimp, suggesting that the myosin light chain protein was essential in hemocytic phagocytosis. On the other hand, RNAi assays indicated that the phagocytic percentage and phagocytic index were significantly decreased when the myosin light chain gene was silenced by sequence-specific siRNA. These findings suggested that myosin light chain protein was involved in the regulation of hemocytic phagocytosis of shrimp. Copyright 2010 Elsevier Ltd. All rights reserved.

Binding of Soluble Natural Ligands to a Soluble Human T-Cell Receptor Fragment Produced in Escherichia coli

NASA Astrophysics Data System (ADS)

Hilyard, Katherine L.; Reyburn, Hugh; Chung, Shan; Bell, John I.; Strominger, Jack L.

1994-09-01

An Escherichia coli expression system has been developed to produce milligram quantities of the variable domains of a human T-cell receptor from a cytotoxic T cell that recognizes the HLA-A2-influenza matrix peptide complex as a single polypeptide chain. The recombinant protein was purified by metal-chelate chromatography and then refolded in a redox buffer system. The refolded protein was shown to directly bind both Staphylococcus aureus enterotoxin B and the major histocompatibility complex protein-peptide complex using a BIAcore biosensor. Thus this preparation of a single-chain, variable-domain, T-cell receptor fragment can bind both of its natural ligands and some of it is therefore a functional fragment of the receptor molecule.

Molecules-in-molecules fragment-based method for the calculation of chiroptical spectra of large molecules: Vibrational circular dichroism and Raman optical activity spectra of alanine polypeptides.

PubMed

Jose, K V Jovan; Raghavachari, Krishnan

2016-12-01

The molecules-in-molecules (MIM) fragment-based method has recently been adapted to evaluate the chiroptical (vibrational circular dichroism [VCD] and Raman optical activity [ROA]) spectra of large molecules such as peptides. In the MIM-VCD and MIM-ROA methods, the relevant higher energy derivatives of the parent molecule are assembled from the corresponding derivatives of smaller fragment subsystems. In addition, the missing long-range interfragment interactions are accounted at a computationally less expensive level of theory (MIM2). In this work we employed the MIM-VCD and MIM-ROA fragment-based methods to explore the evolution of the chiroptical spectroscopic characteristics of 3 10 -helix, α-helix, β-hairpin, γ-turn, and β-extended conformers of gas phase polyalanine (chain length n = 6-14). The different conformers of polyalanine show distinctive features in the MIM chiroptical spectra and the associated spectral intensities increase with evolution of system size. For a better understanding the site-specific effects on the vibrational spectra, isotopic substitutions were also performed employing the MIM method. An increasing redshift with the number of isotopically labeled 13 C=O functional groups in the peptide molecule was seen. For larger polypeptides, we implemented the two-step-MIM model to circumvent the high computational expense associated with the evaluation of chiroptical spectra at a high level of theory using large basis sets. The chiroptical spectra of α-(alanine) 20 polypeptide obtained using the two-step-MIM model, including continuum solvation effects, show good agreement with the full calculations and experiment. This benchmark study suggests that the MIM-fragment approach can assist in predicting and interpreting chiroptical spectra of large polypeptides. © 2016 Wiley Periodicals, Inc.

Boundary perimeter Bethe ansatz

NASA Astrophysics Data System (ADS)

Frassek, Rouven

2017-06-01

We study the partition function of the six-vertex model in the rational limit on arbitrary Baxter lattices with reflecting boundary. Every such lattice is interpreted as an invariant of the twisted Yangian. This identification allows us to relate the partition function of the vertex model to the Bethe wave function of an open spin chain. We obtain the partition function in terms of creation operators on a reference state from the algebraic Bethe ansatz and as a sum of permutations and reflections from the coordinate Bethe ansatz.

Crystal structure of (2R*,3aR*)-2-phenyl-sulfonyl-2,3,3a,4,5,6-hexa-hydro-pyrrolo-[1,2-b]isoxazole.

PubMed

Hernández, Yaiza; Marcos, Isidro; Garrido, Narciso M; Sanz, Francisca; Diez, David

2017-01-01

The title compound, C 12 H 15 NO 3 S, was prepared by 1,3-dipolar cyclo-addition of 3,4-di-hydro-2 H -pyrrole 1-oxide and phenyl vinyl sulfone. In the mol-ecule, both fused five-membered rings display a twisted conformation. In the crystal, C-H⋯O hydrogen bonds link neighbouring mol-ecules, forming chains running parallel to the b axis.

Photoisomerization in bacteriorhodopsin studied by FTIR, linear dichroism and photoselection experiments combined with quantum chemical theoretical analysis

NASA Astrophysics Data System (ADS)

Fahmy, K.; Siebert, F.; Großjean, M. F.; Tavan, P.

1989-12-01

Orientations of IR transition moments of the retinal chromophore of bacteriorhodopsin (BR) and of the apo-protein are investigated by FTIR linear dichroism and photoselection measurements. Low temperature difference spectra for the photoinduced transitions of BR to its photocycle intermediates K and L are evaluated using improved methods. Quantum chemical calculations of directions of IR and electronic transition moments of model chromophores are employed to analyze corresponding observations. The chromophore of light-adapted BR 568 is shown to exhibit small (15-30°) twists around the CC single bonds of retinals polyene chain but no large overall helicity (⩽15°). The average retinal plane is demonstrated to form an angle of 90±20° with the plane of the purple membrane. The C 9C 10 double bond of retinal is found approximately parallel to the plane of the membrane. Upon photoisomerization the orientation of the chromophore moiety from C 1 to C 13 is estimated to be largely conserved. The single bond twists of the chromophore in L are shown to be larger than those in BR 568. This result is in agreement with the previous prediction of increased single bond twists in L, which can cause a p K decrease of the chromophore and, thereby, enforce its deprotonation in the L→M transition [Schulten and Tavan, Nature, 272 (1978) 85].

Is Supramolecular Filament Chirality the Underlying Cause of Major Morphology Differences in Amyloid Fibrils?

PubMed Central

2015-01-01

The unique enhanced sensitivity of vibrational circular dichroism (VCD) to the formation and development of amyloid fibrils in solution is extended to four additional fibril-forming proteins or peptides where it is shown that the sign of the fibril VCD pattern correlates with the sense of supramolecular filament chirality and, without exception, to the dominant fibril morphology as observed in AFM or SEM images. Previously for insulin, it has been demonstrated that the sign of the VCD band pattern from filament chirality can be controlled by adjusting the pH of the incubating solution, above pH 2 for “normal” left-hand-helical filaments and below pH 2 for “reversed” right-hand-helical filaments. From AFM or SEM images, left-helical filaments form multifilament braids of left-twisted fibrils while the right-helical filaments form parallel filament rows of fibrils with a flat tape-like morphology, the two major classes of fibril morphology that from deep UV resonance Raman scattering exhibit the same cross-β-core secondary structure. Here we investigate whether fibril supramolecular chirality is the underlying cause of the major morphology differences in all amyloid fibrils by showing that the morphology (twisted versus flat) of fibrils of lysozyme, apo-α-lactalbumin, HET-s (218–289) prion, and a short polypeptide fragment of transthyretin, TTR (105–115), directly correlates to their supramolecular chirality as revealed by VCD. The result is strong evidence that the chiral supramolecular organization of filaments is the principal underlying cause of the morphological heterogeneity of amyloid fibrils. Because fibril morphology is linked to cell toxicity, the chirality of amyloid aggregates should be explored in the widely used in vitro models of amyloid-associated diseases. PMID:24484302

Is supramolecular filament chirality the underlying cause of major morphology differences in amyloid fibrils?

PubMed

Kurouski, Dmitry; Lu, Xuefang; Popova, Ludmila; Wan, William; Shanmugasundaram, Maruda; Stubbs, Gerald; Dukor, Rina K; Lednev, Igor K; Nafie, Laurence A

2014-02-12

The unique enhanced sensitivity of vibrational circular dichroism (VCD) to the formation and development of amyloid fibrils in solution is extended to four additional fibril-forming proteins or peptides where it is shown that the sign of the fibril VCD pattern correlates with the sense of supramolecular filament chirality and, without exception, to the dominant fibril morphology as observed in AFM or SEM images. Previously for insulin, it has been demonstrated that the sign of the VCD band pattern from filament chirality can be controlled by adjusting the pH of the incubating solution, above pH 2 for "normal" left-hand-helical filaments and below pH 2 for "reversed" right-hand-helical filaments. From AFM or SEM images, left-helical filaments form multifilament braids of left-twisted fibrils while the right-helical filaments form parallel filament rows of fibrils with a flat tape-like morphology, the two major classes of fibril morphology that from deep UV resonance Raman scattering exhibit the same cross-β-core secondary structure. Here we investigate whether fibril supramolecular chirality is the underlying cause of the major morphology differences in all amyloid fibrils by showing that the morphology (twisted versus flat) of fibrils of lysozyme, apo-α-lactalbumin, HET-s (218-289) prion, and a short polypeptide fragment of transthyretin, TTR (105-115), directly correlates to their supramolecular chirality as revealed by VCD. The result is strong evidence that the chiral supramolecular organization of filaments is the principal underlying cause of the morphological heterogeneity of amyloid fibrils. Because fibril morphology is linked to cell toxicity, the chirality of amyloid aggregates should be explored in the widely used in vitro models of amyloid-associated diseases.

THE PURIFICATION OF AN ALKALINE PROTEINASE OBTAINED FROM ASPERGILLUS ORYZAE AND THE DETERMINATION OF ITS PROPERTIES.

DTIC Science & Technology

Aspergillopeptidase B, an alkaline protease in A , oryzae extracts, was obtained in highly purified form by conventional fractionation techniques. The...enzyme is a compact protein of 17,900 m.w. with a neutral isoelectric point. It contains no S-containing amino acids, phosphorus or metal ions. It is...composed of a single polypeptide chain with N-terminal glycine and C-terminal alanine residues. The protease activity toward casein is optimal at pH

Transmembrane Polyproline Helix.

PubMed

Kubyshkin, Vladimir; Grage, Stephan L; Bürck, Jochen; Ulrich, Anne S; Budisa, Nediljko

2018-05-03

The third most abundant polypeptide conformation in nature, the polyproline-II helix, is a polar, extended secondary structure with a local organization stabilized by intercarbonyl interactions within the peptide chain. Here we design a hydrophobic polyproline-II helical peptide based on an oligomeric octahydroindole-2-carboxylic acid scaffold and demonstrate its transmembrane alignment in model lipid bilayers by means of solid-state 19 F NMR. As result, we provide a first example of a purely artificial transmembrane peptide with a structural organization that is not based on hydrogen-bonding.

PASylation: a biological alternative to PEGylation for extending the plasma half-life of pharmaceutically active proteins

PubMed Central

Schlapschy, Martin; Binder, Uli; Börger, Claudia; Theobald, Ina; Wachinger, Klaus; Kisling, Sigrid; Haller, Dirk; Skerra, Arne

2013-01-01

A major limitation of biopharmaceutical proteins is their fast clearance from circulation via kidney filtration, which strongly hampers efficacy both in animal studies and in human therapy. We have developed conformationally disordered polypeptide chains with expanded hydrodynamic volume comprising the small residues Pro, Ala and Ser (PAS). PAS sequences are hydrophilic, uncharged biological polymers with biophysical properties very similar to poly-ethylene glycol (PEG), whose chemical conjugation to drugs is an established method for plasma half-life extension. In contrast, PAS polypeptides offer fusion to a therapeutic protein on the genetic level, permitting Escherichia coli production of fully active proteins and obviating in vitro coupling or modification steps. Furthermore, they are biodegradable, thus avoiding organ accumulation, while showing stability in serum and lacking toxicity or immunogenicity in mice. We demonstrate that PASylation bestows typical biologics, such as interferon, growth hormone or Fab fragments, with considerably prolonged circulation and boosts bioactivity in vivo. PMID:23754528

Hydrophobic Hydration of Stimulus-Responsive Polyproteins Measured by Single Molecule Force Spectroscopy

NASA Astrophysics Data System (ADS)

Zauscher, Stefan

2007-03-01

We present a new procedure to reduce and analyze force-extension data obtained by single molecule force spectroscopy (SMFS). This approach allows, for the first time, to infer effects of solvent quality and minor changes in molecular architecture on molecular-elasticity of individual (bio)macromolecules. Specifically, we show how changes in the effective Kuhn segment length can be used to interpret the hydrophobic hydration behavior of elastin-like polypeptides (ELPs).Our results are intriguing as they suggest that SMFS in combination with our analysis procedure can be used to study the subtleties of polypeptide-water interactions on the single molecule level. We also report on the force-induced cis-trans isomerization of prolines, which are repeated every fifth residue in the main chain of ELPs. We present evidence for this mechanism by Monte Carlo simulations of the force-extension curves using an elastically coupled two-state system. Our results suggest that SMFS could be used to assay proline cis-trans isomerization in proteins and may thus have significant potential diagnostic utility.

Electron capture dissociation of polypeptides using a 3 Tesla Fourier transform ion cyclotron resonance mass spectrometer.

PubMed

Polfer, Nicolas C; Haselmann, Kim F; Zubarev, Roman A; Langridge-Smith, Pat R R

2002-01-01

Electron capture dissociation (ECD) of polypeptides has been demonstrated using a commercially available 3 Tesla Fourier transform ion cyclotron resonance (FTICR) instrument. A conventional rhenium filament, designed for high-energy electron impact ionisation, was used to effect ECD of substance P, bee venom melittin and bovine insulin, oxidised B chain. A retarding field analysis of the effective electron kinetic energy distribution entering the ICR cell suggests that one of the most important parameters governing ECD for this particular instrument is the need to employ low trapping plate voltages. This is shown to maximise the abundance of low-energy electrons. The demonstration of ECD at this relatively low magnetic field strength could offer the prospect of more routine ECD analysis for the wider research community, given the reduced cost of such magnets and (at least theoretically) the greater ease of electron/ion cloud overlap at lower field. Copyright 2002 John Wiley & Sons, Ltd.

Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit

NASA Astrophysics Data System (ADS)

Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.

1987-10-01

The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.

Competition for hydrogen-bond formation in the helix-coil transition and protein folding

NASA Astrophysics Data System (ADS)

Badasyan, A. V.; Tonoyan, Sh. A.; Mamasakhlisov, Y. Sh.; Giacometti, Achille; Benight, A. S.; Morozov, V. F.

2011-05-01

The problem of the helix-coil transition of biopolymers in explicit solvents, such as water, with the ability for hydrogen bonding with a solvent is addressed analytically using a suitably modified version of the Generalized Model of Polypeptide Chains. Besides the regular helix-coil transition, an additional coil-helix or reentrant transition is also found at lower temperatures. The reentrant transition arises due to competition between polymer-polymer and polymer-water hydrogen bonds. The balance between the two types of hydrogen bonding can be shifted to either direction through changes not only in temperature, but also by pressure, mechanical force, osmotic stress, or other external influences. Both polypeptides and polynucleotides are considered within a unified formalism. Our approach provides an explanation of the experimental difficulty of observing the reentrant transition with pressure and underscores the advantage of pulling experiments for studies of DNA. Results are discussed and compared with those reported in a number of recent publications with which a significant level of agreement is obtained.

Effects of pituitary adenylate cyclase activating polypeptide in the urinary system, with special emphasis on its protective effects in the kidney.

PubMed

Reglodi, Dora; Kiss, Peter; Horvath, Gabriella; Lubics, Andrea; Laszlo, Eszter; Tamas, Andrea; Racz, Boglarka; Szakaly, Peter

2012-04-01

Pituitary adenylate cyclase activating polypeptide (PACAP) is a widespread neuropeptide with diverse effects in the nervous system and peripheral organs. One of the most well-studied effects of PACAP is its cytoprotective action, against different harmful stimuli in a wide variety of cells and tissues. PACAP occurs in the urinary system, from the kidney to the lower urinary tract. The present review focuses on the nephroprotective effects of PACAP and summarizes data obtained regarding the protective effects of PACAP in different models of kidney pathologies. In vitro data show that PACAP protects tubular cells against oxidative stress, myeloma light chain, cisplatin, cyclosporine-A and hypoxia. In vivo data provide evidence for its protective effects in ischemia/reperfusion, cisplatin, cyclosporine-A, myeloma kidney injury, diabetic nephropathy and gentamicin-induced kidney damage. Results accumulated on the renoprotective effects of PACAP suggest that PACAP is an emerging candidate for treatment of human kidney pathologies. Copyright © 2011 Elsevier Ltd. All rights reserved.

Light Scattering Characterization of Elastin-Like Polypeptide Trimer Micelles

NASA Astrophysics Data System (ADS)

Tsuper, Ilona; Terrano, Daniel; Maraschky, Adam; Holland, Nolan; Streletzky, Kiril

The elastin-like polypeptides (ELP) nanoparticles are composed of three-armed star polypeptides connected by a negatively charged foldon. Each of the three arms extending from the foldon domain includes 20 repeats of the (GVGVP) amino acid sequence. The ELP polymer chains are soluble at room temperature and become insoluble at the transition temperature (close to 50 ° C), forming micelles. The size and shape of the micelle are dependent on the temperature and the pH of the solution, and on the concentration of the phosphate buffered saline (PBS). The depolarized dynamic light scattering (DDLS) was employed to study the structure and dynamics of micelles at 62 ° C. The solution was maintained at an approximate pH level of 7.3 - 7.5, while varying PBS concentration. At low salt concentrations (<15 mM), the micelle radius was about 10nm but not very reproducible on account of unstable pH levels arising from low buffer concentrations. At intermediate salt concentrations (15 - 60 mM), the system formed spherically-shaped micelles, exhibiting a steady growth in the hydrodynamic radius (Rh) from 10 to 21 nm, with increasing PBS concentration. Interestingly, higher salt concentrations (>60 mM) displayed an apparent elongation of the micelles evident by a significant VH signal, along with a surge in the apparent Rh. A model of micelle growth (and potential elongation) with increase in salt concentration is considered.

Proline-poor hydrophobic domains modulate the assembly and material properties of polymeric elastin.

PubMed

Muiznieks, Lisa D; Reichheld, Sean E; Sitarz, Eva E; Miao, Ming; Keeley, Fred W

2015-10-01

Elastin is a self-assembling extracellular matrix protein that provides elasticity to tissues. For entropic elastomers such as elastin, conformational disorder of the monomer building block, even in the polymeric form, is essential for elastomeric recoil. The highly hydrophobic monomer employs a range of strategies for maintaining disorder and flexibility within hydrophobic domains, particularly involving a minimum compositional threshold of proline and glycine residues. However, the native sequence of hydrophobic elastin domain 30 is uncharacteristically proline-poor and, as an isolated polypeptide, is susceptible to formation of amyloid-like structures comprised of stacked β-sheet. Here we investigated the biophysical and mechanical properties of multiple sets of elastin-like polypeptides designed with different numbers of proline-poor domain 30 from human or rat tropoelastins. We compared the contributions of these proline-poor hydrophobic sequences to self-assembly through characterization of phase separation, and to the tensile properties of cross-linked, polymeric materials. We demonstrate that length of hydrophobic domains and propensity to form β-structure, both affecting polypeptide chain flexibility and cross-link density, play key roles in modulating elastin mechanical properties. This study advances the understanding of elastin sequence-structure-function relationships, and provides new insights that will directly support rational approaches to the design of biomaterials with defined suites of mechanical properties. © 2015 Wiley Periodicals, Inc.

Finite size effect on hydrogen bond cooperativity in (Ala)n polypeptides: A DFT study using numeric atom-centered orbitals

NASA Astrophysics Data System (ADS)

Blum, Volker; Ireta, Joel; Scheffler, Matthias

2007-03-01

An accurate representation of the energetic contribution Ehb of hydrogen bonds to structure formation is paramount to understand the secondary structure stability of proteins, both qualitatively and quantitatively. However, Ehb depends strongly on its environment, and even on the surrounding peptide conformation itself. For instance, a short α-helical polypeptide (Ala)4 can not be stabilized by its single hydrogen bond, whereas an infinite α-helical chain (Ala)∞ is clearly energetically stable over a fully extended conformation. We here use all-electron density functional calculations in the PBE generalized gradient approximation by a recently developed, computationally efficient numeric atom-centered orbital based code^1 to investigate this H-bond cooperativity that is intrinsic to Alanine-based polypeptides (Ala)n (n=1-20,∞). We compare finite and infinite prototypical helical conformations (α, π, 310) on equal footing, with both neutral and ionic termination for finite (Ala)n peptides. Moderately sized NAO basis sets allow to capture Ehb with meV accuracy, revealing a clear jump in Ehb (cooperativity) when two H-bonds first appear in line, followed by slower and more continuous increase of Ehb towards n->∞. ^1 V. Blum, R. Gehrke, P. Havu, V. Havu, M. Scheffler, The FHI Ab Initio Molecular Simulations (aims) Project, Fritz-Haber-Institut, Berlin (2006).

Molecular Characterization of Tomato 3-Dehydroquinate Dehydratase-Shikimate:NADP Oxidoreductase1

PubMed Central

Bischoff, Markus; Schaller, Andreas; Bieri, Fabian; Kessler, Felix; Amrhein, Nikolaus; Schmid, Jürg

2001-01-01

Analysis of cDNAs encoding the bifunctional 3-dehydroquinate dehydratase-shikimate:NADP oxidoreductase (DHQase-SORase) from tomato (Lycopersicon esculentum) revealed two classes of cDNAs that differed by 57 bp within the coding regions, but were otherwise identical. Comparison of these cDNA sequences with the sequence of the corresponding single gene unequivocally proved that the primary transcript is differentially spliced, potentially giving rise to two polypeptides that differ by 19 amino acids. Quantitative real-time polymerase chain reaction revealed that the longer transcript constitutes at most 1% to 2% of DHQase-SORase transcripts. Expression of the respective polypeptides in Escherichia coli mutants lacking the DHQase or the SORase activity gave functional complementation only in case of the shorter polypeptide, indicating that skipping of a potential exon is a prerequisite for the production of an enzymatically active protein. The deduced amino acid sequence revealed that the DHQase-SORase is most likely synthesized as a precursor with a very short (13-amino acid) plastid-specific transit peptide. Like other genes encoding enzymes of the prechorismate pathway in tomato, this gene is elicitor-inducible. Tissue-specific expression resembles the patterns obtained for 3-deoxy-d-arabino-heptulosonate 7-phosphate synthase 2 and dehydroquinate synthase genes. This work completes our studies of the prechorismate pathway in that cDNAs for all seven enzymes (including isozymes) of the prechorismate pathway from tomato have now been characterized. PMID:11299368

Internal friction in an intrinsically disordered protein—Comparing Rouse-like models with experiments

NASA Astrophysics Data System (ADS)

Soranno, Andrea; Zosel, Franziska; Hofmann, Hagen

2018-03-01

Internal friction is frequently found in protein dynamics. Its molecular origin however is difficult to conceptualize. Even unfolded and intrinsically disordered polypeptide chains exhibit signs of internal friction despite their enormous solvent accessibility. Here, we compare four polymer theories of internal friction with experimental results on the intrinsically disordered protein ACTR (activator of thyroid hormone receptor). Using nanosecond fluorescence correlation spectroscopy combined with single-molecule Förster resonance energy transfer (smFRET), we determine the time scales of the diffusive chain dynamics of ACTR at different solvent viscosities and varying degrees of compaction. Despite pronounced differences between the theories, we find that all models can capture the experimental viscosity-dependence of the chain relaxation time. In contrast, the observed slowdown upon chain collapse of ACTR is not captured by any of the theories and a mechanistic link between chain dimension and internal friction is still missing, implying that the current theories are incomplete. In addition, a discrepancy between early results on homopolymer solutions and recent single-molecule experiments on unfolded and disordered proteins suggests that internal friction is likely to be a composite phenomenon caused by a variety of processes.

Internal friction in an intrinsically disordered protein-Comparing Rouse-like models with experiments.

PubMed

Soranno, Andrea; Zosel, Franziska; Hofmann, Hagen

2018-03-28

Internal friction is frequently found in protein dynamics. Its molecular origin however is difficult to conceptualize. Even unfolded and intrinsically disordered polypeptide chains exhibit signs of internal friction despite their enormous solvent accessibility. Here, we compare four polymer theories of internal friction with experimental results on the intrinsically disordered protein ACTR (activator of thyroid hormone receptor). Using nanosecond fluorescence correlation spectroscopy combined with single-molecule Förster resonance energy transfer (smFRET), we determine the time scales of the diffusive chain dynamics of ACTR at different solvent viscosities and varying degrees of compaction. Despite pronounced differences between the theories, we find that all models can capture the experimental viscosity-dependence of the chain relaxation time. In contrast, the observed slowdown upon chain collapse of ACTR is not captured by any of the theories and a mechanistic link between chain dimension and internal friction is still missing, implying that the current theories are incomplete. In addition, a discrepancy between early results on homopolymer solutions and recent single-molecule experiments on unfolded and disordered proteins suggests that internal friction is likely to be a composite phenomenon caused by a variety of processes.

Structural dependence of MEH-PPV chromism in solution.

PubMed

de Magalhães, Carlos E T; Savedra, Ranylson M L; Dias, Karina S; Ramos, Rodrigo; Siqueira, Melissa F

2017-03-01

The chromism observed in the MEH-PPV polymer in tetrahydrofuran (THF) solution is discussed as a function of the structural morphology of the backbone chains. To evaluate this phenomenon, we carried out simulations employing a hybrid methodology using molecular dynamics and quantum mechanical approaches. Our results support the hypothesis that the morphological order-disorder transition is related to the change from red to blue phase observed experimentally. The morphological disorder is associated with total or partial twisted arrangements in the polymer backbone, which induces an electronic conjugation length more confined to shorter segments. In addition, the main band of the MEH-PPV UV-Vis spectrum at the lower wavelength is related to the blue phase, in contrast to the red phase found for the more planar backbone chains.

Architecture effects on multivalent interactions by polypeptide-based multivalent ligands

NASA Astrophysics Data System (ADS)

Liu, Shuang

Multivalent interactions are characterized by the simultaneous binding between multiple ligands and multiple binding sites, either in solutions or at interfaces. In biological systems, most multivalent interactions occur between protein receptors and carbohydrate ligands through hydrogen-bonding and hydrophobic interactions. Compared with weak affinity binding between one ligand and one binding site, i.e. monovalent interaction, multivalent interactioins provide greater avidity and specificity, and therefore play unique roles in a broad range of biological activities. Moreover, the studies of multivalent interactions are also essential for producing effective inhibitors and effectors of biological processes that could have important therapeutic applications. Synthetic multivalent ligands have been designed to mimic the biological functions of natural multivalent interactions, and various types of scaffolds have been used to display multiple ligands, including small molecules, linear polymers, dendrimers, nanoparticle surfaces, monolayer surfaces and liposomes. Studies have shown that multivalent interactions can be highly affected by various architectural parameters of these multivalent ligands, including ligand identities, valencies, spacing, ligand densities, nature of linker arms, scaffold length and scaffold conformation. Most of these multivalent ligands are chemically synthesized and have limitations of controlling over sequence and conformation, which is a barrier for mimicking ordered and controlled natural biological systems. Therefore, multivalent ligands with precisely controlled architecture are required for improved structure-function relationship studies. Protein engineering methods with subsequent chemical coupling of ligands provide significant advantages of controlling over backbone conformation and functional group placement, and therefore have been used to synthesize recombinant protein-based materials with desired properties similar to natural protein materials, including structural as well as functional proteins. Therefore, polypeptide-based multivalent scaffolds are used to display ligands to assess the contribution of different architectural parameters to the multivalent binding events. In this work, a family of alanine-rich alpha-helical glycopolypeptides was designed and synthesized by a combination of protein engineering and chemical coupling, to display two types of saccharide ligands for two different multivalent binding systems. The valencies, chain length and spacing between adjacent ligands of these multivalent ligands were designed in order to study architecture effects on multivalent interactions. The polypeptides and their glycoconjugates were characterized via various methods, including SDS-PAGE, NMR, HPLC, amino acid analysis (AAA), MALDI, circular dichroism (CD) and GPC. In the first multivalent binding system, cholera toxin B pentamer (CT B5) was chosen to be the protein receptor due to its well-characterized structure, lack of significant steric interference of binding to multiple binding sites, and requirement of only simple monosaccharide as ligands. Galactopyranoside was incorporated into polypeptide scaffolds through amine-carboxylic acid coupling to the side chains of glutamic acid residues. The inhibition and binding to CT B5 of these glycopolypeptide ligands were evaluated by direct enzyme-linked assay (DELA). As a complement method, weak affinity chromatography (WAC) was also used to evaluate glycopolypeptides binding to a CT B5 immobilized column. The architecture effects on CT B 5 inhibition are discussed. In the second system, cell surface receptor L-selectin was targeted by polypeptide-based multivalent ligands containing disulfated galactopyranoside ligands, due to its important roles in various immunological activities. The effects of glycopolypeptide architectural variables L-selectin shedding were evaluated via ELISA-based assays. These polypeptide-based multivalent ligands are suggested to be useful for elucidating architecture effects on multivalent interactions, manipulating multivalent interactions and the subsequent cellular responses in different systems. These materials have great potential applications in therapeutics and could also provide guidelines for design of multivalent ligands for other protein receptors.

Precise side-chain conformation analysis of L-phenylalanine in α-helical polypeptide by quantum-chemical calculation and 13C CP-MAS NMR measurement

NASA Astrophysics Data System (ADS)

Niimura, Subaru; Suzuki, Junya; Kurosu, Hiromichi; Yamanobe, Takeshi; Shoji, Akira

2010-04-01

To clarify the positive role of side-chain conformation in the stability of protein secondary structure (main-chain conformation), we successfully calculated the optimization structure of a well-defined α-helical octadecapeptide composed of L-alanine (Ala) and L-phenylalanine (Phe) residues, H-(Ala) 8-Phe-(Ala) 9-OH, based on the molecular orbital calculation with density functional theory (DFT/B3LYP/6-31G(d)). From the total energy and the precise secondary structural parameters such as main-chain dihedral angles and hydrogen-bond parameters of the optimized structure, we confirmed that the conformational stability of an α-helix is affected dominantly by the side-chain conformation ( χ1) of the Phe residue in this system: model A ( T form: around 180° of χ1) is most stable in α-helix and model B ( G + form: around -60° of χ1) is next stable, but model C ( G - form: around 60° of χ1) is less stable. In addition, we demonstrate that the stable conformation of poly( L-phenylalanine) is an α-helix with the side-chain T form, by comparison of the carbonyl 13C chemical shift measured by 13C CP-MAS NMR and the calculated one.

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

Homochiral Evolution in Self-Assembled Chiral Polymers and Block Copolymers.

PubMed

Wen, Tao; Wang, Hsiao-Fang; Li, Ming-Chia; Ho, Rong-Ming

2017-04-18

The significance of chirality transfer is not only involved in biological systems, such as the origin of homochiral structures in life but also in man-made chemicals and materials. How the chiral bias transfers from molecular level (molecular chirality) to helical chain (conformational chirality) and then to helical superstructure or phase (hierarchical chirality) from self-assembly is vital for the chemical and biological processes in nature, such as communication, replication, and enzyme catalysis. In this Account, we summarize the methodologies for the examination of homochiral evolution at different length scales based on our recent studies with respect to the self-assembly of chiral polymers and chiral block copolymers (BCPs*). A helical (H*) phase to distinguish its P622 symmetry from that of normal hexagonally packed cylinder phase was discovered in the self-assembly of BCPs* due to the chirality effect on BCP self-assembly. Enantiomeric polylactide-containing BCPs*, polystyrene-b-poly(l-lactide) (PS-PLLA) and polystyrene-b-poly(d-lactide) (PS-PDLA), were synthesized for the examination of homochiral evolution. The optical activity (molecular chirality) of constituted chiral repeating unit in the chiral polylactide is detected by electronic circular dichroism (ECD) whereas the conformational chirality of helical polylactide chain can be explicitly determined by vibrational circular dichroism (VCD). The H* phases of the self-assembled polylactide-containing BCPs* can be directly visualized by 3D transmission electron microscopy (3D TEM) technique at which the handedness (hierarchical chirality) of the helical nanostructure is thus determined. The results from the ECD, VCD, and 3D TEM for the investigated chirality at different length scales suggest the homochiral evolution in the self-assembly of the BCPs*. For chiral polylactides, twisted lamellae in crystalline banded spherulite can be formed by dense packing scheme and effective interactions upon helical chains from self-assembly. The handedness of the twisted lamella can be determined by using rotation experiment of polarized light microscopy (PLM). Similar to the self-assembly of BCPs*, the examined results suggest the homochiral evolution in the crystallized chiral polylactides. The results presented in this Account demonstrate the notable progress in the spectral and morphological determination for the examination of molecular, conformational, and hierarchical chirality in self-assembled twisted superstructures of chiral polymers and helical phases of block copolymers and suggest the attainability of homochiral evolution in the self-assembly of chiral homopolymers and BCPs*. The suggested methodologies for the understanding of the mechanisms of the chirality transfer at different length scales provide the approaches to give Supporting Information for disclosing the mysteries of the homochiral evolution from molecular level.

Biosynthesis and processing of platelet GPIIb-IIIa in human megakaryocytes.

PubMed

Duperray, A; Berthier, R; Chagnon, E; Ryckewaert, J J; Ginsberg, M; Plow, E; Marguerie, G

1987-06-01

Platelet membrane glycoprotein IIb-IIIa forms a calcium-dependent heterodimer and constitutes the fibrinogen receptor on stimulated platelets. GPIIb is a two-chain protein containing disulfide-linked alpha and beta subunits. GPIIIa is a single chain protein. These proteins are synthesized in the bone marrow by megakaryocytes, but the study of their synthesis has been hampered by the difficulty in obtaining enriched population of megakaryocytes in large numbers. To examine the biosynthesis and processing of GPIIb-IIIa, purified human megakaryocytes were isolated from liquid cultures of cryopreserved leukocytes stem cell concentrates from patients with chronic myelogenous leukemia. Immunoprecipitation of [35S]methionine pulse-chase-labeled cell extracts by antibodies specific for the alpha or beta subunits of GPIIb indicated that GPIIb was derived from a precursor of Mr 130,000 that contains the alpha and beta subunits. This precursor was converted to GPIIb with a half-life of 4-5 h. No precursor form of GPIIIa was detected. The glycosylation of GPIIb-IIIa was examined in megakaryocytes by metabolic labeling in the presence of tunicamycin, monensin, or treatment with endoglycosidase H. The polypeptide backbones of the GPIIb and the GPIIIa have molecular masses of 120 and 90 kD, respectively. High-mannose oligosaccharides are added to these polypeptide backbones co-translationally. The GPIIb precursor is then processed with conversion of high-mannose to complex type carbohydrates yielding the mature subunits GPIIb alpha (Mr 116,000) and GPIIb beta (Mr 25,000). No posttranslational processing of GPIIIa was detected.

Molecular Diagnosis of Analbuminemia: A New Case Caused by a Nonsense Mutation in the Albumin Gene

PubMed Central

Dagnino, Monica; Caridi, Gianluca; Haenni, Ueli; Duss, Adrian; Aregger, Fabienne; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2011-01-01

Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin (ALB). We report here a new case diagnosed in a 45 years old man of Southwestern Asian origin, living in Switzerland, on the basis of his low ALB concentration (0.9 g/L) in the absence of renal or gastrointestinal protein loss, or liver dysfunction. The clinical diagnosis was confirmed by a mutational analysis of the albumin (ALB) gene, carried out by single-strand conformational polymorphism (SSCP), heteroduplex analysis (HA), and DNA sequencing. This screening of the ALB gene revealed that the proband is homozygous for two mutations: the insertion of a T in a stretch of eight Ts spanning positions c.1289 + 23–c.1289 + 30 of intron 10 and a c.802 G > T transversion in exon 7. Whereas the presence of an additional T in the poly-T tract has no direct deleterious effect, the latter nonsense mutation changes the codon GAA for Glu244 to the stop codon TAA, resulting in a premature termination of the polypeptide chain. The putative protein product would have a length of only 243 amino acid residues instead of the normal 585 found in the mature serum albumin, but no evidence for the presence in serum of such a truncated polypeptide chain could be obtained by two dimensional electrophoresis and western blotting analysis. PMID:22174600

Preventative effect of OMZ-SPT on lipopolysaccharide-induced acute lung injury and inflammation via nuclear factor-kappa B signaling in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Ting; Department of Respiratory Medicine, Children's Hospital of Chongqing Medical University, Chongqing, 400014; Hou, Wanru

Acute lung injury (ALI) is an early pathophysiologic change in acute respiratory distress syndrome and its management can be challenging. Omalizumab (Xolair™) is a recombinant DNA-derived, humanized antibody. OMZ-SPT is a polypeptide on the heavy chain of omalizumab monoclonal antibody. Here, we found that intramuscular administration of OMZ-SPT significantly improved survival and attenuated lung inflammation in female C57BL/6 mice suffering from lipopolysaccharide (LPS)-induced ALI. We also demonstrated that OMZ-SPT can inhibit expression of the inflammatory cytokines tumor necrosis factor-α, interleukin-1β and interleukin-6 by ELISA in mice suffering from LPS-induced ALI and a mouse macrophage line (RAW264.7 cells). In addition, we showedmore » that OMZ-SPT inhibited LPS-induced activation of nuclear factor-kappa B (NF-κB) signaling and total expression of NF-κB by western blotting. These data suggest that OMZ-SPT could be a novel therapeutic choice for ALI. - Highlights: • OMZ-SPT is a polypeptide on the heavy chain of omalizumab monoclonal antibody. • Omalizumab (Xolair™) have anti-inflammatory effects. • OMZ-SPT can inhibit inflammatory responses and lung injury in LPS-induced ALI mice. • Protective effect of OMZ-SPT on ALI is due to inhibition of NF-κB signaling. • OMZ-SPT could be a novel therapeutic choice for ALI.« less

Dual effect of chloramphenicol peptides on ribosome inhibition.

PubMed

Bougas, Anthony; Vlachogiannis, Ioannis A; Gatos, Dimitrios; Arenz, Stefan; Dinos, George P

2017-05-01

Chloramphenicol peptides were recently established as useful tools for probing nascent polypeptide chain interaction with the ribosome, either biochemically, or structurally. Here, we present a new 10mer chloramphenicol peptide, which exerts a dual inhibition effect on the ribosome function affecting two distinct areas of the ribosome, namely the peptidyl transferase center and the polypeptide exit tunnel. According to our data, the chloramphenicol peptide bound on the chloramphenicol binding site inhibits the formation of both acetyl-phenylalanine-puromycin and acetyl-lysine-puromycin, showing, however, a decreased peptidyl transferase inhibition compared to chloramphenicol-mediated inhibition per se. Additionally, we found that the same compound is a strong inhibitor of green fluorescent protein synthesis in a coupled in vitro transcription-translation assay as well as a potent inhibitor of lysine polymerization in a poly(A)-programmed ribosome, showing that an additional inhibitory effect may exist. Since chemical protection data supported the interaction of the antibiotic with bases A2058 and A2059 near the entrance of the tunnel, we concluded that the extra inhibition effect on the synthesis of longer peptides is coming from interactions of the peptide moiety of the drug with residues comprising the ribosomal tunnel, and by filling up the tunnel and blocking nascent chain progression through the restricted tunnel. Therefore, the dual interaction of the chloramphenicol peptide with the ribosome increases its inhibitory effect and opens a new window for improving the antimicrobial potency of classical antibiotics or designing new ones.

The role of aromatic side-chains in amyloid growth and membrane interaction of the islet amyloid polypeptide fragment LANFLVH.

PubMed

Milardi, Danilo; Sciacca, Michele F M; Pappalardo, Matteo; Grasso, Domenico M; La Rosa, Carmelo

2011-01-01

Human islet amyloid polypeptide (hIAPP) is known to misfold and aggregate into amyloid deposits that may be found in pancreatic tissues of patients affected by type 2 diabetes. Recent studies have shown that the highly amyloidogenic peptide LANFLVH, corresponding the N-terminal 12-18 region of IAPP, does not induce membrane damage. Here we assess the role played by the aromatic residue Phe in driving both amyloid formation and membrane interaction of LANFLVH. To this aim, a set of variant heptapeptides in which the aromatic residue Phe has been substituted with a Leu and Ala is studied. Differential scanning calorimetry (DSC) and membrane-leakage experiments demonstrated that Phe substitution noticeably affects the peptide-induced changes in the thermotropic properties of the lipid bilayer but not its membrane damaging potential. Atomic force microscopy (AFM), ThT fluorescence and Congo red birefringence assays evidenced that the Phe residue is not required for fibrillogenesis, but it can influence the self-assembling kinetics. Molecular dynamics simulations have paralleled the outcome of the experimental trials also providing informative details about the structure of the different peptide assemblies. These results support a general theory suggesting that aromatic residues, although capable of affecting the self-assembly kinetics of small peptides and peptide-membrane interactions, are not essential either for amyloid formation or membrane leakage, and indicate that other factors such as β-sheet propensity, size and hydrophobicity of the side chain act synergistically to determine peptide properties.

Cellobiohydrolase I enzymes

DOEpatents

Adney, William S; Himmel, Michael E; Decker, Stephen R; Knoshaug, Eric P; Nimlos, Mark R; Crowley, Michael F; Jeoh, Tina

2014-01-28

Provided herein is an isolated Cel7A polypeptide comprising mutations in the catalytic domain of the polypeptide relative to the catalytic domain of a wild type Cel7A polypeptide, wherein the mutations reduce N-linked glycosylation of the isolated polypeptide relative to the wild type polypeptide. Also provided herein is an isolated Cel7A polypeptide comprising increased O-linked glycosylation of the linker domain relative to a linker domain of a wild type Cel7A polypeptide. The increased O-linked glycosylation is a result of the addition of and/or substitution of one or more serine and/or threonine residues to the linker domain relative to the linker domain of the wild type polypeptide. In some embodiments, the isolated Cel7A polypeptide comprising mutations in the catalytic domain of the polypeptide relative to the catalytic domain of a wild type Cel7A polypeptide further comprises increased O-linked glycosylation of the linker domain relative to a linker domain of a wild type Cel7A polypeptide. The mutations in the catalytic domain reduce N-linked glycosylation of the isolated polypeptide relative to the wild type polypeptide. The addition of and/or substitution of one or more serine and/or threonine residues to the linker domain relative to the linker domain of the wild type polypeptide increases O-linked glycosylation of the isolated polypeptide. Further provided are compositions comprising such polypeptides and nucleic acids encoding such polypeptides. Still further provided are methods for making such polypeptides.

Major immunoglobulin classes of the echidna (Tachyglossus aculeatus)

PubMed Central

Atwell, J. L.; Marchalonis, J. J.; Ealey, E. H. M.

1973-01-01

The Australian echidna responds to the antigen Salmonella adelaide flagella by producing antibodies characterized by mol. wt of 900,000 and 150,000. After cleavage of interchain disulphide bonds, both the high and low mol. wt immunoglobulins can be resolved into light and heavy polypeptide chains. In both cases, the light chains resemble those of other vertebrate immunoglobulins in size (22,500 Daltons) and electrophoretic mobility. The 900,000 Dalton immunoglobulin contains heavy chains similar to human μ chains in size (70,000 Daltons) and electrophoretic mobility. The 150,000 Dalton immunoglobulin contains a different class of heavy chain, similar in size (50,000 Daltons) and electrophoretic mobility to human γ chains. Proportional mass contributions of the light and heavy chains to the intact molecule suggest the structure of the intact molecules could be represented by (L2, μ2)5 and (L2, γ2) for the high and low mol. wt immunoglobulins respectively. These configurations are similar to those described for human γM and γG immunoglobulins. The results are relevant to theories of the evolution of the different classes of immunoglobulins. While the echidna is distinctly more primitive than eutherian mammals and still retains structural features characteristic of reptiles, its major immunoglobulin classes are very similar to human IgM and IgG. The striking similarities between the γ-like heavy chain of the echnidna and human IgG heavy chains suggest that the echidna may be the first species in which a γ chain gene directly homologous to mammalian γ chain genes is expressed. ImagesFIG. 4 PMID:4761634

Solution structure of a small protein containing a fluorinated side chain in the core

PubMed Central

Cornilescu, Gabriel; Hadley, Erik B.; Woll, Matthew G.; Markley, John L.; Gellman, Samuel H.; Cornilescu, Claudia C.

2007-01-01

We report the first high-resolution structure for a protein containing a fluorinated side chain. Recently we carried out a systematic evaluation of phenylalanine to pentafluorophenylalanine (Phe → F5-Phe) mutants for the 35-residue chicken villin headpiece subdomain (c-VHP), the hydrophobic core of which features a cluster of three Phe side chains (residues 6, 10, and 17). Phe → F5-Phe mutations are interesting because aryl–perfluoroaryl interactions of optimal geometry are intrinsically more favorable than either aryl–aryl or perfluoroaryl–perfluoroaryl interactions, and because perfluoroaryl units are more hydrophobic than are analogous aryl units. Only one mutation, Phe10 → F5-Phe, was found to provide enhanced tertiary structural stability relative to the native core (by ∼1 kcal/mol, according to guanidinium chloride denaturation studies). The NMR structure of this mutant, described here, reveals very little variation in backbone conformation or side chain packing relative to the wild type. Thus, although Phe → F5-Phe mutations offer the possibility of greater tertiary structural stability from side chain–side chain attraction and/or side chain desolvation, the constraints associated with the native c-VHP fold apparently prevent the modified polypeptide from taking advantage of this possibility. Our findings are important because they complement several studies that have shown that fluorination of saturated side chain carbon atoms can provide enhanced conformational stability. PMID:17123960

Immunoglobulin light chains, glycosaminoglycans and amyloid.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stevens, F. J.; Kisilevsky, R.; Biosciences Division

2000-03-01

Immunoglobulin light chains are the precursor proteins for fibrils that are formed during primary amyloidosis and in amyloidosis associated with multiple myeloma. As found for the approximately 20 currently described forms of focal, localized, or systemic amyloidoses, light chain-related fibrils extracted from physiological deposits are invariably associated with glycosaminoglycans, predominantly heparan sulfate. Other amyloid-related proteins are either structurally normal, such as g2-microglobulin and islet amyloid polypeptide, fragments of normal proteins such as serum amyloid A protein or the precursor protein of the g peptide involved in Alzheimer's disease, or are inherited forms of single amino acid variants of a normalmore » protein such as found in the familial forms of amyloid associated with transthyretin. In contrast, the primary structures of light chains involved in fibril formation exhibit extensive mutational diversity rendering some proteins highly amyloidogenic and others non-pathological. The interactions between light chains and glycosaminoglycans are also affected by amino acid variation and may influence the clinical course of disease by enhancing fibril stability and contributing to resistance to protease degradation. Relatively little is currently known about the mechanisms by which glycosaminoglycans interact with light chains and light-chain fibrils. It is probable that future studies of this uniquely diverse family of proteins will continue o shed light on the processes of amyloidosis, and contribute as well to a greater understanding of the normal physiological roles of glycosaminoglycans.« less

Switch from hapten-specific immunoglobulin M to immunoglobulin D secretion in a hybrid mouse cell line.

PubMed Central

Neuberger, M S; Rajewsky, K

1981-01-01

From a hybrid mouse cell line (B1-8) that secreted an IgM, lambda 1 anti-(4-hydroxy-3-nitrophenyl)acetyl antibody but that had no detectable surface IgM, selection for a variant with lambda 1 chains on the surface resulted in the isolation of a line that had switched from mu to delta expression. The surface and secreted Igs of this line were typed as IgD with two monoclonal antibodies, and the parental IgM and variant IgD molecules carried the same variable regions as judged by hapten-binding and idiotypic analysis. The surface and secreted delta chains of the IgD variant have apparent molecular weights of 64,000 and 61,000, respectively. However, the unglycosylated secreted delta polypeptide chain has a molecular weight of only 44,000. The secreted IgD exists predominantly in the delta 2 lambda A2 form, does not contain J protein, is relatively stable in serum, and does not fix complement. Images PMID:6940132

Recombinant dissection of myosin heavy chain of Toxocara canis shows strong clustering of antigenic regions.

PubMed

Obwaller, A; Duchêne, M; Bruhn, H; Steipe, B; Tripp, C; Kraft, D; Wiedermann, G; Auer, H; Aspöck, H

2001-05-01

Myosins from nematode parasites elicit strong humoral and cellular immune responses and have been investigated as vaccine candidates. In this study we cloned and sequenced a cDNA coding for myosin heavy chain from Toxocara canis, a nematode parasite of canids which may also infect humans and cause various unspecific symptoms. To determine the major antigenic regions the myosin heavy chain was systematically dissected into ten overlapping recombinant fusion polypeptides which were purified by metal chelate chromatography. Single fragments were then tested for their IgG reactivity in sera from toxocarosis patients and healthy probands. Two regions, one region at the mid to carboxy-terminal end of the head domain and one region in the rod domain, were identified as major antigens, which in combination were positive with 86% of the sera. The other domains were less reactive. This shows that the patients' IgG reactivity was not directed evenly against all parts of the molecule, but was rather clustered in few regions.

A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription.

PubMed

Zhou, Xin X; Zou, Xinzhi; Chung, Hokyung K; Gao, Yuchen; Liu, Yanxia; Qi, Lei S; Lin, Michael Z

2018-02-16

Optical control of CRISPR-Cas9-derived proteins would be useful for restricting gene editing or transcriptional regulation to desired times and places. Optical control of Cas9 functions has been achieved with photouncageable unnatural amino acids or by using light-induced protein interactions to reconstitute Cas9-mediated functions from two polypeptides. However, these methods have only been applied to one Cas9 species and have not been used for optical control of different perturbations at two genes. Here, we use photodissociable dimeric fluorescent protein domains to engineer single-chain photoswitchable Cas9 (ps-Cas9) proteins in which the DNA-binding cleft is occluded at baseline and opened upon illumination. This design successfully controlled different species and functional variants of Cas9, mediated transcriptional activation more robustly than previous optogenetic methods, and enabled light-induced transcription of one gene and editing of another in the same cells. Thus, a single-chain photoswitchable architecture provides a general method to control a variety of Cas9-mediated functions.

The force-sensing peptide VemP employs extreme compaction and secondary structure formation to induce ribosomal stalling

PubMed Central

Su, Ting; Cheng, Jingdong; Sohmen, Daniel; Hedman, Rickard; Berninghausen, Otto; von Heijne, Gunnar; Wilson, Daniel N; Beckmann, Roland

2017-01-01

Interaction between the nascent polypeptide chain and the ribosomal exit tunnel can modulate the rate of translation and induce translational arrest to regulate expression of downstream genes. The ribosomal tunnel also provides a protected environment for initial protein folding events. Here, we present a 2.9 Å cryo-electron microscopy structure of a ribosome stalled during translation of the extremely compacted VemP nascent chain. The nascent chain forms two α-helices connected by an α-turn and a loop, enabling a total of 37 amino acids to be observed within the first 50–55 Å of the exit tunnel. The structure reveals how α-helix formation directly within the peptidyltransferase center of the ribosome interferes with aminoacyl-tRNA accommodation, suggesting that during canonical translation, a major role of the exit tunnel is to prevent excessive secondary structure formation that can interfere with the peptidyltransferase activity of the ribosome. DOI: http://dx.doi.org/10.7554/eLife.25642.001 PMID:28556777

The Twist Box Domain is Required for Twist1-induced Prostate Cancer Metastasis

PubMed Central

Gajula, Rajendra P.; Chettiar, Sivarajan T.; Williams, Russell D.; Thiyagarajan, Saravanan; Kato, Yoshinori; Aziz, Khaled; Wang, Ruoqi; Gandhi, Nishant; Wild, Aaron T.; Vesuna, Farhad; Ma, Jinfang; Salih, Tarek; Cades, Jessica; Fertig, Elana; Biswal, Shyam; Burns, Timothy F.; Chung, Christine H.; Rudin, Charles M.; Herman, Joseph M.; Hales, Russell K.; Raman, Venu; An, Steven S.; Tran, Phuoc T.

2013-01-01

Twist1, a basic helix-loop-helix transcription factor, plays a key role during development and is a master regulator of the epithelial-mesenchymal transition (EMT) that promotes cancer metastasis. Structure-function relationships of Twist1 to cancer-related phenotypes are underappreciated, so we studied the requirement of the conserved Twist box domain for metastatic phenotypes in prostate cancer (PCa). Evidence suggests that Twist1 is overexpressed in clinical specimens and correlated with aggressive/metastatic disease. Therefore, we examined a transactivation mutant, Twist1-F191G, in PCa cells using in vitro assays which mimic various stages of metastasis. Twist1 overexpression led to elevated cytoskeletal stiffness and cell traction forces at the migratory edge of cells based on biophysical single-cell measurements. Twist1 conferred additional cellular properties associated with cancer cell metastasis including increased migration, invasion, anoikis resistance, and anchorage-independent growth. The Twist box mutant was defective for these Twist1 phenotypes in vitro. Importantly, we observed a high frequency of Twist1-induced metastatic lung tumors and extra-thoracic metastases in vivo using the experimental lung metastasis assay. The Twist box was required for PCa cells to colonize metastatic lung lesions and extra-thoracic metastases. Comparative genomic profiling revealed transcriptional programs directed by the Twist box that were associated with cancer progression, such as Hoxa9. Mechanistically, Twist1 bound to the Hoxa9 promoter and positively regulated Hoxa9 expression in PCa cells. Finally, Hoxa9 was important for Twist1-induced cellular phenotypes associated with metastasis. These data suggest that the Twist box domain is required for Twist1 transcriptional programs and PCa metastasis. PMID:23982216

Motion of spin label side chains in cellular retinol-binding protein: correlation with structure and nearest-neighbor interactions in an antiparallel beta-sheet.

PubMed

Lietzow, Michael A; Hubbell, Wayne L

2004-03-23

A goal in the development of site-directed spin labeling in proteins is to correlate the motion of a nitroxide side chain with local structure, interactions, and dynamics. Significant progress toward this goal has been made using alpha-helical proteins of known structure, and the present study is the first step in a similar exploration of a beta-sheet protein, cellular retinol-binding protein (CRBP). Nitroxide side chains were introduced along both interior and edge strands. At sites in interior strands, the side-chain motion is strongly influenced by interactions with side chains of neighboring strands, giving rise to a rich variety of dynamic modes (weakly ordered, strongly ordered, immobilized) and complex electron paramagnetic resonance spectra that are modulated by strand twist. The interactions giving rise to the dynamic modes are explored using mutagenesis, and the results demonstrate the particular importance of the non-hydrogen-bonded neighbor residue in giving rise to highly ordered states. Along edge strands of the beta-sheet, the motion of the side chain is simple and weakly ordered, resembling that at solvent-exposed surfaces of an alpha-helix. A simple working model is proposed that can account for the wide variety of dynamic modes encountered. Collectively, the results suggest that the nitroxide side chain is an effective probe of side-chain interactions, and that site-directed spin labeling should be a powerful means of monitoring conformational changes that involve changes in beta-sheet topology.

Comparison of Friction Characteristics on TN and VA Mode Alignment Films with Friction Force Microscopy

NASA Astrophysics Data System (ADS)

Kwak, Musun; Chung, Hanrok; Kwon, Hyukmin; Kim, Jehyun; Han, Daekyung; Yi, Yoonseon; Lee, Sangmun; Lee, Chulgu; Cha, Sooyoul

Using frictional force microscopy (FFM), the friction surface characteristics were compared between twisted nematic (TN) mode and vertical alignment (VA) mode alignment films (AFs). The friction asymmetry was detected depending on temperature conditions on TN mode AF, but not on VA mode AF. The difference between two modes was explained by leaning intermolecular repulsion caused by the pre-tilt angle uniformity and the density of side chain. No level difference according to temperature conditions appeared when the pre-tilt angle were measured after liquid crystal (LC) injection.

Dock ’n Roll: Folding of a Silk-Inspired Polypeptide into an Amyloid-like Beta Solenoid

PubMed Central

Zhao, Binwu; Cohen Stuart, Martien A.; Hall, Carol K.

2016-01-01

Polypeptides containing the motif ((GA)mGX)n occur in silk (we refer to them as ‘silk-like’) and have a strong tendency to self-assemble. For example, polypeptides containing (GAGAGAGX)n, where X = G or H have been observed to form filaments; similar sequences but with X = Q have been used in the design of coat proteins (capsids) for artificial viruses. The structure of the (GAGAGAGX)m filaments has been proposed to be a stack of peptides in a β roll structure with the hydrophobic side chains pointing outwards (hydrophobic shell). Another possible configuration, a β roll or β solenoid structure which has its hydrophobic side chains buried inside (hydrophobic core) was, however, overlooked. We perform ground state analysis as well as atomic-level molecular dynamics simulations, both on single molecules and on two-molecule stacks of the silk-inspired sequence (GAGAGAGQ)10, to decide whether the hydrophobic core or the hydrophobic shell configuration is the most stable one. We find that a stack of two hydrophobic core molecules is energetically more favorable than a stack of two shell molecules. A shell molecule initially placed in a perfect β roll structure tends to rotate its strands, breaking in-plane hydrogen bonds and forming out-of-plane hydrogen bonds, while a core molecule stays in the β roll structure. The hydrophobic shell structure has type II’ β turns whereas the core configuration has type II β turns; only the latter secondary structure agrees well with solid-state NMR experiments on a similar sequence (GA)15. We also observe that the core stack has a higher number of intra-molecular hydrogen bonds and a higher number of hydrogen bonds between stack and water than the shell stack. Hence, we conclude that the hydrophobic core configuration is the most likely structure. In the stacked state, each peptide has more intra-molecular hydrogen bonds than a single folded molecule, which suggests that stacking provides the extra stability needed for molecules to reach the folded state. PMID:26947809

Residue solvent accessibilities in the unfolded polypeptide chain.

PubMed Central

Zielenkiewicz, P; Saenger, W

1992-01-01

The difference of solvent accessibilities in the native and unfolded states of the protein is used as a measure of the hydrophobic contribution to the free energy of folding. We present a new approximation of amino acids solvent accessibilities in the unfolded state based on the 1-ns molecular dynamics simulation of Ala-X-Ala tripeptides at a temperature of 368 K. The standard accessibility values averaged from the molecular dynamics study are significantly lower from those previously obtained by considering only selected conformations of Ala-X-Ala tripeptides. PMID:1489908

Structural basis of substrate specificity in the serine proteases.

PubMed Central

Perona, J. J.; Craik, C. S.

1995-01-01

Structure-based mutational analysis of serine protease specificity has produced a large database of information useful in addressing biological function and in establishing a basis for targeted design efforts. Critical issues examined include the function of water molecules in providing strength and specificity of binding, the extent to which binding subsites are interdependent, and the roles of polypeptide chain flexibility and distal structural elements in contributing to specificity profiles. The studies also provide a foundation for exploring why specificity modification can be either straightforward or complex, depending on the particular system. PMID:7795518

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Type II toxin: antitoxin systems. More than small selfish entities?

PubMed

Rocker, Andrea; Meinhart, Anton

2016-05-01

Toxin-antitoxin (TA) modules regulate metabolism and viability of bacteria and archaea. In type II TA systems these functions are generally thought to be performed by two small proteins. However, evidence is increasing that the toxins are much more diverse and can form multi-domain proteins. Recently, we published a novel type II TA system in which toxin and antitoxin are covalently linked into a single polypeptide chain. In this review we summarize the current knowledge on these elongated toxin homologs and provide perspectives for future study.

DECOMP: a PDB decomposition tool on the web.

PubMed

Ordog, Rafael; Szabadka, Zoltán; Grolmusz, Vince

2009-07-27

The protein databank (PDB) contains high quality structural data for computational structural biology investigations. We have earlier described a fast tool (the decomp_pdb tool) for identifying and marking missing atoms and residues in PDB files. The tool also automatically decomposes PDB entries into separate files describing ligands and polypeptide chains. Here, we describe a web interface named DECOMP for the tool. Our program correctly identifies multi-monomer ligands, and the server also offers the preprocessed ligand-protein decomposition of the complete PDB for downloading (up to size: 5GB) AVAILABILITY: http://decomp.pitgroup.org.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yuzawa, Satoshi; Keasling, Jay D.; Katz, Leonard

Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. Finally, we have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

Molecular Properties of neurotoxin receptors sites associated with sodium channels from mammalian brain.

PubMed

Catterall, W A; Hartshorne, R P; Beneski, D A

1982-01-01

Neurotoxins that act at specific receptor sites on voltage-sensitive sodium channels have been used as molecular probes to identify and purify protein components of sodium channels from mammalian brain. Photoreactive derivatives of scorpion toxin have been prepared and used to covalently label sodium channels in intact synaptosomes. Two polypeptides, alpha with Mr approximately 270,000 and beta with Mr approximately 38,000, are specifically labeled indicating that they are components of the scorpion toxin receptor site on the sodium channel. The sodium channel can be solubilized with retention of specific binding of [3H] saxitoxin using nonionic detergents such as Triton X-100. The solubilized saxitoxin receptor has molecular weight of 316,000 +/- 63,000 and binds 0.9 g of Triton X-100 and phospholipid per g of protein. The solubilized receptor can be purified 750-fold by ion exchange chromatography, wheat germ lectin/Sepharose chromatography and sucrose gradient sedimentation to a final specific activity of 1488 pmol/mg. Analysis of the polypeptide chain composition of the most highly purified fractions indicates that alpha and beta comprise 65% of the protein of these fractions and are only the polypeptides whose presence correlates with saxitoxin binding activity. These studies lead to a working hypothesis of sodium channel structure in which the intact channel is comprised of a complex with Mr of approximately 316,000 containing one mole of alpha (Mr approximately 270,000) and one to three moles of beta (Mr approximately 38,000).

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Polypeptide Synthesis in Simian Virus 5-Infected Cells

PubMed Central

Peluso, Richard W.; Lamb, Robert A.; Choppin, Purnell W.

1977-01-01

Polypeptide synthesis in three different cell types infected with simian virus 5 has been examined using high-resolution polyacrylamide slab gel electrophoresis, and all of the known viral polypeptides have been identified above the host cell background. The polypeptides were synthesized in infected cells in unequal proportions, which are approximately the same as they are found in virions, suggesting that their relative rates of synthesis are controlled. The nucleocapsid polypeptide (NP) was the first to be detected in infected cells, and by 12 to 14 h the other virion structural polypeptides were identified, except for the polypeptides comprising the smaller glycoprotein (F). However, a glycosylated precursor (F0) with a molecular weight of 66,000 was found in each cell type, and pulse-chase experiments suggested that this precursor was cleaved to yield polypeptides F1 and F2. No other proteolytic processing was found. In addition to the structural polypeptides, the synthesis of five other polypeptides, designated I through V, has been observed in simian virus 5-infected cells. One of these (V), with a molecular weight of 24,000, was found in all cells examined and may be a nonstructural viral polypeptide. In contrast, there are polypeptides present in uninfected cells that correspond in size to polypeptides I through IV, and similar polypeptides have also been detected in increased amounts in cells infected with Sendai virus. These findings, and the fact that the synthesis of all four of these polypeptides is not increased in every cell type, suggest that they represent host polypeptides whose synthesis may be enhanced upon infection. When a high salt concentration was used to decrease host cell protein synthesis in infected cells, polypeptides IV and (to a lesser extent) I were synthesized in relatively greater amounts than other cellular polypeptides, as were the viral polypeptides. The possibility that these polypeptides may play some role in virus replication is discussed. Images PMID:196101

2-Amino­benzoic acid–4-(pyridin-4-yl­disulfan­yl)pyridine (1/1)

PubMed Central

Arman, Hadi D.; Kaulgud, Trupta; Tiekink, Edward R. T.

2011-01-01

The title 1:1 co-crystal, C7H7NO2·C10H8N2S2, features a highly twisted 4-(pyridin-4-yldisulfan­yl)pyridine mol­ecule [dihedral angle between the pyridine rings = 89.06 (10)°]. A small twist is evident in the 2-amino­benzoic acid mol­ecule, with the C—C—C—O torsion angle being −7.7 (3)°. An N—H⋯O hydrogen bond occurs in the 2-amino­benzoic acid mol­ecule. In the crystal, mol­ecules are linked by O—H⋯N and N—H⋯N hydrogen bonds into a supra­molecular chain along the b axis. These are connected into layers by π–π inter­actions occurring between pyridine rings [centroid–centroid distance = 3.8489 (15) Å]. The layers are connected along the a axis by C—H⋯O contacts. The crystal studied was a racemic twin. PMID:22199855

Solution structure of the His12 --> Cys mutant of the N-terminal zinc binding domain of HIV-1 integrase complexed to cadmium.

PubMed Central

Cai, M.; Huang, Y.; Caffrey, M.; Zheng, R.; Craigie, R.; Clore, G. M.; Gronenborn, A. M.

1998-01-01

The solution structure of His12 --> Cys mutant of the N-terminal zinc binding domain (residues 1-55; IN(1-55)) of HIV-1 integrase complexed to cadmium has been solved by multidimensional heteronuclear NMR spectroscopy. The overall structure is very similar to that of the wild-type N-terminal domain complexed to zinc. In contrast to the wild-type domain, however, which exists in two interconverting conformational states arising from different modes of coordination of the two histidine side chains to the metal, the cadmium complex of the His12 --> Cys mutant exists in only a single form at low pH. The conformation of the polypeptide chain encompassing residues 10-18 is intermediate between the two forms of the wild-type complex. PMID:9865962

Two-dimensional (2D) infrared correlation study of the structural characterization of a surface immobilized polypeptide film stimulated by pH

NASA Astrophysics Data System (ADS)

Chae, Boknam; Son, Seok Ho; Kwak, Young Jun; Jung, Young Mee; Lee, Seung Woo

2016-11-01

The pH-induced structural changes to surface immobilized poly (L-glutamic acid) (PLGA) films were examined by Fourier transform infrared (FTIR) spectroscopy and two-dimensional (2D) correlation analysis. Significant spectral changes were observed in the FTIR spectra of the surface immobilized PLGA film between pH 6 and 7. The 2D correlation spectra constructed from the pH-dependent FTIR spectra of the surface immobilized PLGA films revealed the spectral changes induced by the alternations of the protonation state of the carboxylic acid group in the PLGA side chain. When the pH was increased from 6 to 8, weak spectral changes in the secondary structure of the PLGA main chain were induced by deprotonation of the carboxylic acid side group.

The general mitochondrial processing peptidase from potato is an integral part of cytochrome c reductase of the respiratory chain.

PubMed Central

Braun, H P; Emmermann, M; Kruft, V; Schmitz, U K

1992-01-01

The major mitochondrial processing activity removing presequences from nuclear encoded precursor proteins is present in the soluble fraction of fungal and mammalian mitochondria. We found that in potato, this activity resides in the inner mitochondrial membrane. Surprisingly, the proteolytic activity co-purifies with cytochrome c reductase, a protein complex of the respiratory chain. The purified complex is bifunctional, as it has the ability to transfer electrons from ubiquinol to cytochrome c and to cleave off the presequences of mitochondrial precursor proteins. In contrast to the nine subunit fungal complex, cytochrome c reductase from potato comprises 10 polypeptides. Protein sequencing of peptides from individual subunits and analysis of corresponding cDNA clones reveals that subunit III of cytochrome c reductase (51 kDa) represents the general mitochondrial processing peptidase. Images PMID:1324169

A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

PubMed

Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

2016-11-08

Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

The NS2 polypeptide of parvovirus MVM is required for capsid assembly in murine cells.

PubMed

Cotmore, S F; D'Abramo, A M; Carbonell, L F; Bratton, J; Tattersall, P

1997-05-12

Mutants of minute virus of mice (MVM) which express truncated forms of the NS2 polypeptide are known to exhibit a host range defect, replicating productively in transformed human cells but not in cells from their normal murine host. To explore this deficiency we generated viruses with translation termination codons at various positions in the second exon of NS2. In human cells these mutants were viable, but showed a late defect in progeny virion release which put them at a selective disadvantage compared to the wildtype. In murine cells, however, duplex viral DNA amplification was reduced to 5% of wildtype levels and single-strand DNA synthesis was undetectable. These deficiencies could not be attributed to a failure to initiate infection or to a generalized defect in viral gene expression, since the viral replicator protein NS1 was expressed to normal or elevated levels early in infection. In contrast, truncated NS2 gene products failed to accumulate, so that each mutant exhibited a similar NS2-null phenotype. Expression of the capsid polypeptides VP1 and VP2 and their subsequent assembly into intact particles were examined in detail. Synchronized infected cell populations labeled under pulse-chase conditions were analyzed by differential immunoprecipitation of native or denatured extracts using antibodies which discriminated between intact particles and isolated polypeptide chains. These analyses showed that at early times in infection, capsid protein synthesis and stability were normal, but particle assembly was impaired. Unassembled VP proteins were retained in the cell for several hours, but as the unprocessed material accumulated, capsid protein synthesis progressively diminished, so that at later times relatively few VP molecules were synthesized. Thus in NS2-null infections of mouse cells there is a major primary defect in the folding or assembly processes required for effective capsid production.

The Evolution of the Secreted Regulatory Protein Progranulin.

PubMed

Palfree, Roger G E; Bennett, Hugh P J; Bateman, Andrew

2015-01-01

Progranulin is a secreted growth factor that is active in tumorigenesis, wound repair, and inflammation. Haploinsufficiency of the human progranulin gene, GRN, causes frontotemporal dementia. Progranulins are composed of chains of cysteine-rich granulin modules. Modules may be released from progranulin by proteolysis as 6kDa granulin polypeptides. Both intact progranulin and some of the granulin polypeptides are biologically active. The granulin module occurs in certain plant proteases and progranulins are present in early diverging metazoan clades such as the sponges, indicating their ancient evolutionary origin. There is only one Grn gene in mammalian genomes. More gene-rich Grn families occur in teleost fish with between 3 and 6 members per species including short-form Grns that have no tetrapod counterparts. Our goals are to elucidate progranulin and granulin module evolution by investigating (i): the origins of metazoan progranulins (ii): the evolutionary relationships between the single Grn of tetrapods and the multiple Grn genes of fish (iii): the evolution of granulin module architectures of vertebrate progranulins (iv): the conservation of mammalian granulin polypeptide sequences and how the conserved granulin amino acid sequences map to the known three dimensional structures of granulin modules. We report that progranulin-like proteins are present in unicellular eukaryotes that are closely related to metazoa suggesting that progranulin is among the earliest extracellular regulatory proteins still employed by multicellular animals. From the genomes of the elephant shark and coelacanth we identified contemporary representatives of a precursor for short-from Grn genes of ray-finned fish that is lost in tetrapods. In vertebrate Grns pathways of exon duplication resulted in a conserved module architecture at the amino-terminus that is frequently accompanied by an unusual pattern of tandem nearly identical module repeats near the carboxyl-terminus. Polypeptide sequence conservation of mammalian granulin modules identified potential structure-activity relationships that may be informative in designing progranulin based therapeutics.

The Evolution of the Secreted Regulatory Protein Progranulin

PubMed Central

Palfree, Roger G. E.; Bennett, Hugh P. J.; Bateman, Andrew

2015-01-01

Progranulin is a secreted growth factor that is active in tumorigenesis, wound repair, and inflammation. Haploinsufficiency of the human progranulin gene, GRN, causes frontotemporal dementia. Progranulins are composed of chains of cysteine-rich granulin modules. Modules may be released from progranulin by proteolysis as 6kDa granulin polypeptides. Both intact progranulin and some of the granulin polypeptides are biologically active. The granulin module occurs in certain plant proteases and progranulins are present in early diverging metazoan clades such as the sponges, indicating their ancient evolutionary origin. There is only one Grn gene in mammalian genomes. More gene-rich Grn families occur in teleost fish with between 3 and 6 members per species including short-form Grns that have no tetrapod counterparts. Our goals are to elucidate progranulin and granulin module evolution by investigating (i): the origins of metazoan progranulins (ii): the evolutionary relationships between the single Grn of tetrapods and the multiple Grn genes of fish (iii): the evolution of granulin module architectures of vertebrate progranulins (iv): the conservation of mammalian granulin polypeptide sequences and how the conserved granulin amino acid sequences map to the known three dimensional structures of granulin modules. We report that progranulin-like proteins are present in unicellular eukaryotes that are closely related to metazoa suggesting that progranulin is among the earliest extracellular regulatory proteins still employed by multicellular animals. From the genomes of the elephant shark and coelacanth we identified contemporary representatives of a precursor for short-from Grn genes of ray-finned fish that is lost in tetrapods. In vertebrate Grns pathways of exon duplication resulted in a conserved module architecture at the amino-terminus that is frequently accompanied by an unusual pattern of tandem nearly identical module repeats near the carboxyl-terminus. Polypeptide sequence conservation of mammalian granulin modules identified potential structure-activity relationships that may be informative in designing progranulin based therapeutics. PMID:26248158

Revisiting structure-property relationship of pH-responsive polymers for drug delivery applications.

PubMed

Bazban-Shotorbani, Salime; Hasani-Sadrabadi, Mohammad Mahdi; Karkhaneh, Akbar; Serpooshan, Vahid; Jacob, Karl I; Moshaverinia, Alireza; Mahmoudi, Morteza

2017-05-10

pH-responsive polymers contain ionic functional groups as pendants in their structure. The total number of charged groups on polymer chains determines the overall response of the system to changes in the external pH. This article reviews various pH-responsive polymers classified as polyacids (e.g., carboxylic acid based polymers, sulfonamides, anionic polysaccharides, and anionic polypeptides) and polybases (e.g., polyamines, pyridine and imidazole containing polymers, cationic polysaccharides, and cationic polypeptides). We correlate the pH variations in the body at the organ level (e.g., gastrointestinal tract and vaginal environment), tissue level (e.g., cancerous and inflamed tissues), and cellular level (e.g., sub-cellular organelles), with the intrinsic properties of pH-responsive polymers. This knowledge could help to select more effective ('smart') polymeric systems based on the biological target. Considering the pH differences in the body, various drug delivery systems can be designed by utilizing smart biopolymeric compounds with the required pH-sensitivity. We also review the pharmaceutical application of pH-responsive polymeric carriers including hydrogels, polymer-drug conjugates, micelles, dendrimers, and polymersomes. © 2016.

Kinetics of a Collagen-Like Polypeptide Fragmentation after Mid-IR Free-Electron Laser Ablation

PubMed Central

Zavalin, Andrey; Hachey, David L.; Sundaramoorthy, Munirathinam; Banerjee, Surajit; Morgan, Steven; Feldman, Leonard; Tolk, Norman; Piston, David W.

2008-01-01

Tissue ablation with mid-infrared irradiation tuned to collagen vibrational modes results in minimal collateral damage. The hypothesis for this effect includes selective scission of protein molecules and excitation of surrounding water molecules, with the scission process currently favored. In this article, we describe the postablation infrared spectral decay kinetics in a model collagen-like peptide (Pro-Pro-Gly)10. We find that the decay is exponential with different decay times for other, simpler dipeptides. Furthermore, we find that collagen-like polypeptides, such as (Pro-Pro-Gly)10, show multiple decay times, indicating multiple scission locations and cross-linking to form longer chain molecules. In combination with data from high-resolution mass spectrometry, we interpret these products to result from the generation of reactive intermediates, such as free radicals, cyanate ions, and isocyanic acid, which can form cross-links and protein adducts. Our results lead to a more complete explanation of the reduced collateral damage resulting from infrared laser irradiation through a mechanism involving cross-linking in which collagen-like molecules form a network of cross-linked fibers. PMID:18441025

Cloning of the chaperonin t-complex polypeptide 1 gene from Schistosoma mansoni and studies of its expression levels under heat shock and oxidative stress.

PubMed

Campos, E G; Hamdan, F F

2000-03-01

The protein TCP-1 (t-complex polypeptide 1) is a subunit of the hetero-oligomeric complex CCT (chaperonin containing TCP- 1) present in the eukaryotic cytosol. Chaperone function may be critical for the development and survival of the different life stages of Schistosoma mansoni, a parasite that is exposed to drastic environmental changes during its development. We isolated a full-length S. mansoni TCP-1 cDNA (SmTCP-1A) encoding a protein highly homologous with TCP-1. The deduced SmTCP-1A amino-acid sequence shows up to 65% identity with other eukaryotic CCT family members. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed that the mRNA expression levels of SmTCP-1A in adult S. mansoni were down-regulated in worms subjected to heat shock and oxidative stress conditions. This down-regulation of SmTCP-1A mRNA may reflect a switch in CCT subunits as an adaptive response to heat shock and oxidative stress conditions.

Genetically encoded lipid-polypeptide hybrid biomaterials that exhibit temperature-triggered hierarchical self-assembly

NASA Astrophysics Data System (ADS)

Mozhdehi, Davoud; Luginbuhl, Kelli M.; Simon, Joseph R.; Dzuricky, Michael; Berger, Rüdiger; Varol, H. Samet; Huang, Fred C.; Buehne, Kristen L.; Mayne, Nicholas R.; Weitzhandler, Isaac; Bonn, Mischa; Parekh, Sapun H.; Chilkoti, Ashutosh

2018-05-01

Post-translational modification of proteins is a strategy widely used in biological systems. It expands the diversity of the proteome and allows for tailoring of both the function and localization of proteins within cells as well as the material properties of structural proteins and matrices. Despite their ubiquity in biology, with a few exceptions, the potential of post-translational modifications in biomaterials synthesis has remained largely untapped. As a proof of concept to demonstrate the feasibility of creating a genetically encoded biohybrid material through post-translational modification, we report here the generation of a family of three stimulus-responsive hybrid materials—fatty-acid-modified elastin-like polypeptides—using a one-pot recombinant expression and post-translational lipidation methodology. These hybrid biomaterials contain an amphiphilic domain, composed of a β-sheet-forming peptide that is post-translationally functionalized with a C14 alkyl chain, fused to a thermally responsive elastin-like polypeptide. They exhibit temperature-triggered hierarchical self-assembly across multiple length scales with varied structure and material properties that can be controlled at the sequence level.

Structures and functions of proteins and nucleic acids in protein biosynthesis

NASA Astrophysics Data System (ADS)

Miyazawa, Tatsuo; Yokoyama, Shigeyuki

Infrared and Raman spectroscopy is useful for studying helical conformations of polypeptides, which are determined by molecular structure parameters. Nuclear magnetic resonance spectroscopy, as well as X-ray analysis, is now established to be important for conformation studies of proteins and nucleic acids in solution. This article is mainly concerned with the conformational aspect and function regulation in protein biosynthesis. The strict recognition of transfer ribonucleic acid (tRNA) by aminoacyl-tRNA synthetase (ARS) is achieved by multi-step mutual adaptation. The conformations of ARS-bound amino acids have been elucidated by transferred nuclear Overhauser effect analysis. Aminoacyl-tRNA takes the 3‧-isomeric form in the polypeptide chain elongation cycle. The regulation of codon recognition by post-transcriptional modification is achieved by conversion of the conformational characteristic of the anticodon of tRNA. The cytidine → lysidine modification of the anticodon of minor isoleucine tRNA concurrently converts the amino acid specificity and the codon specificity. As novel protein engineering, a basic strategy has been established for in vivo biosynthesis of proteins that are substituted with unnatural amino acids (alloproteins).

Luteinizing hormone-stimulated pituitary adenylate cyclase-activating polypeptide system and its role in progesterone production in human luteinized granulosa cells.

PubMed

Park, Hyun-Jeong; Choi, Bum-Chae; Song, Sang-Jin; Lee, Dong-Sik; Roh, Jaesook; Chun, Sang-Young

2010-01-01

The present study examined the gonadotropin regulation of pituitary adenylate cyclase-activating polypeptide (PACAP) and PACAP type I receptor (PAC(1)-R) expression, and its role in progesterone production in the human luteinized granulosa cells. The stimulation of both PACAP and PAC(1)-R mRNA levels by LH was detected using a competitive reverse transcription-polymerase chain reaction (RT-PCR). PACAP transcript was stimulated by LH reaching maximum levels at 12 hours in a dose dependent manner. LH treatment also stimulated PAC(1)-R mRNA levels within 24 hours. Addition of PACAP-38 (10(-7) M) as well as LH significantly stimulated progesterone production during 48 hours culture. Furthermore, co-treatment with PACAP antagonist partially inhibited LH-stimulated progesterone production. Treatment with vasoactive intestinal peptide, however, did not affect progesterone production. Taken together, the present study demonstrates that LH causes a transient stimulation of PACAP and PAC(1)-R expression and that PACAP stimulates progesterone production in the human luteinized granulosa cells, suggesting a possible role of PACAP as a local ovarian regulator in luteinization.

The isolation, purification and amino-acid sequence of insulin from the teleost fish Cottus scorpius (daddy sculpin).

PubMed

Cutfield, J F; Cutfield, S M; Carne, A; Emdin, S O; Falkmer, S

1986-07-01

Insulin from the principal islets of the teleost fish, Cottus scorpius (daddy sculpin), has been isolated and sequenced. Purification involved acid/alcohol extraction, gel filtration, and reverse-phase high-performance liquid chromatography to yield nearly 1 mg pure insulin/g wet weight islet tissue. Biological potency was estimated as 40% compared to porcine insulin. The sculpin insulin crystallised in the absence of zinc ions although zinc is known to be present in the islets in significant amounts. Two other hormones, glucagon and pancreatic polypeptide, were copurified with the insulin, and an N-terminal sequence for pancreatic polypeptide was determined. The primary structure of sculpin insulin shows a number of sequence changes unique so far amongst teleost fish. These changes occur at A14 (Arg), A15 (Val), and B2 (Asp). The B chain contains 29 amino acids and there is no N-terminal extension as seen with several other fish. Presumably as a result of the amino acid substitutions, sculpin insulin does not readily form crystals containing zinc-insulin hexamers, despite the presence of the coordinating B10 His.

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

Monoclonal antibodies to the light-harvesting chlorophyll a/b protein complex of photosystem II

PubMed Central

1986-01-01

A collection of 17 monoclonal antibodies elicited against the light- harvesting chlorophyll a/b protein complex which serves photosystem II (LHC-II) of Pisum sativum shows six classes of binding specificity. Antibodies of two of the classes recognize a single polypeptide (the 28- or the 26- kD polypeptides), thereby suggesting that the two proteins are not derived from a common precursor. Other classes of antibodies cross-react with several polypeptides of LHC-II or with polypeptides of both LHC-II and the light-harvesting chlorophyll a/b polypeptides of photosystem I (LHC-I), indicating that there are structural similarities among the polypeptides of LHC-II and LHC-I. The evidence for protein processing by which the 26-, 25.5-, and 24.5-kD polypeptides are derived from a common precursor polypeptide is discussed. Binding studies using antibodies specific for individual LHC- II polypeptides were used to quantify the number of antigenic polypeptides in the thylakoid membrane. 27 copies of the 26-kD polypeptide and two copies of the 28-kD polypeptide were found per 400 chlorophylls. In the chlorina f2 mutant of barley, and in intermittent light-treated barley seedlings, the amount of the 26-kD polypeptide in the thylakoid membranes was greatly reduced, while the amount of 28-kD polypeptide was apparently not affected. We propose that stable insertion and assembly of the 28-kD polypeptide, unlike the 26-kD polypeptide, is not regulated by the presence of chlorophyll b. PMID:3528171

Endothelial TWIST1 Promotes Pathological Ocular Angiogenesis

PubMed Central

Li, Jie; Liu, Chi-Hsiu; Sun, Ye; Gong, Yan; Fu, Zhongjie; Evans, Lucy P.; Tian, Katherine T.; Juan, Aimee M.; Hurst, Christian G.; Mammoto, Akiko; Chen, Jing

2014-01-01

Purpose. Pathological neovessel formation impacts many blinding vascular eye diseases. Identification of molecular signatures distinguishing pathological neovascularization from normal quiescent vessels is critical for developing new interventions. Twist-related protein 1 (TWIST1) is a transcription factor important in tumor and pulmonary angiogenesis. This study investigated the potential role of TWIST1 in modulating pathological ocular angiogenesis in mice. Methods. Twist1 expression and localization were analyzed in a mouse model of oxygen-induced retinopathy (OIR). Pathological ocular angiogenesis in Tie2-driven conditional Twist1 knockout mice were evaluated in both OIR and laser-induced choroidal neovascularization models. In addition, the effects of TWIST1 on angiogenesis and endothelial cell function were analyzed in sprouting assays of aortic rings and choroidal explants isolated from Twist1 knockout mice, and in human retinal microvascular endothelial cells treated with TWIST1 small interfering RNA (siRNA). Results. TWIST1 is highly enriched in pathological neovessels in OIR retinas. Conditional Tie2-driven depletion of Twist1 significantly suppressed pathological neovessels in OIR without impacting developmental retinal angiogenesis. In a laser-induced choroidal neovascularization model, Twist1 deficiency also resulted in significantly smaller lesions with decreased vascular leakage. In addition, loss of Twist1 significantly decreased vascular sprouting in both aortic ring and choroid explants. Knockdown of TWIST1 in endothelial cells led to dampened expression of vascular endothelial growth factor receptor 2 (VEGFR2) and decreased endothelial cell proliferation. Conclusions. Our study suggests that TWIST1 is a novel regulator of pathologic ocular angiogenesis and may represent a new molecular target for developing potential therapeutic treatments to suppress pathological neovascularization in vascular eye diseases. PMID:25414194

Structural parameterization and functional prediction of antigenic polypeptome sequences with biological activity through quantitative sequence-activity models (QSAM) by molecular electronegativity edge-distance vector (VMED).

PubMed

Li, ZhiLiang; Wu, ShiRong; Chen, ZeCong; Ye, Nancy; Yang, ShengXi; Liao, ChunYang; Zhang, MengJun; Yang, Li; Mei, Hu; Yang, Yan; Zhao, Na; Zhou, Yuan; Zhou, Ping; Xiong, Qing; Xu, Hong; Liu, ShuShen; Ling, ZiHua; Chen, Gang; Li, GenRong

2007-10-01

Only from the primary structures of peptides, a new set of descriptors called the molecular electronegativity edge-distance vector (VMED) was proposed and applied to describing and characterizing the molecular structures of oligopeptides and polypeptides, based on the electronegativity of each atom or electronic charge index (ECI) of atomic clusters and the bonding distance between atom-pairs. Here, the molecular structures of antigenic polypeptides were well expressed in order to propose the automated technique for the computerized identification of helper T lymphocyte (Th) epitopes. Furthermore, a modified MED vector was proposed from the primary structures of polypeptides, based on the ECI and the relative bonding distance of the fundamental skeleton groups. The side-chains of each amino acid were here treated as a pseudo-atom. The developed VMED was easy to calculate and able to work. Some quantitative model was established for 28 immunogenic or antigenic polypeptides (AGPP) with 14 (1-14) A(d) and 14 other restricted activities assigned as "1"(+) and "0"(-), respectively. The latter comprised 6 A(b)(15-20), 3 A(k)(21-23), 2 E(k)(24-26), 2 H-2(k)(27 and 28) restricted sequences. Good results were obtained with 90% correct classification (only 2 wrong ones for 20 training samples) and 100% correct prediction (none wrong for 8 testing samples); while contrastively 100% correct classification (none wrong for 20 training samples) and 88% correct classification (1 wrong for 8 testing samples). Both stochastic samplings and cross validations were performed to demonstrate good performance. The described method may also be suitable for estimation and prediction of classes I and II for major histocompatibility antigen (MHC) epitope of human. It will be useful in immune identification and recognition of proteins and genes and in the design and development of subunit vaccines. Several quantitative structure activity relationship (QSAR) models were developed for various oligopeptides and polypeptides including 58 dipeptides and 31 pentapeptides with angiotensin converting enzyme (ACE) inhibition by multiple linear regression (MLR) method. In order to explain the ability to characterize molecular structure of polypeptides, a molecular modeling investigation on QSAR was performed for functional prediction of polypeptide sequences with antigenic activity and heptapeptide sequences with tachykinin activity through quantitative sequence-activity models (QSAMs) by the molecular electronegativity edge-distance vector (VMED). The results showed that VMED exhibited both excellent structural selectivity and good activity prediction. Moreover, the results showed that VMED behaved quite well for both QSAR and QSAM of poly-and oligopeptides, which exhibited both good estimation ability and prediction power, equal to or better than those reported in the previous references. Finally, a preliminary conclusion was drawn: both classical and modified MED vectors were very useful structural descriptors. Some suggestions were proposed for further studies on QSAR/QSAM of proteins in various fields.

Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

PubMed

Xue, Gongda; Hemmings, Brian A

2012-02-01

The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

Twist functions in vertebral column formation in medaka, Oryzias latipes.

PubMed

Yasutake, Junichi; Inohaya, Keiji; Kudo, Akira

2004-07-01

Medaka twist, a basic helix-loop-helix (bHLH) transcription factor, is expressed in the sclerotome during embryogenesis. We previously established a line of twist-EGFP transgenic medaka, whose EGFP expression is regulated by the twist promoter; therefore, we could observe the behavior of sclerotomal cells in vivo. In the transgenic medaka embryos, EGFP-positive sclerotomal cells migrated dorsally around the notochord and the neural tube, where at a later stage the vertebral column would be formed. This finding strongly suggests that twist-expressing sclerotomal cells participate in vertebral column formation in medaka. To clarify the function of twist gene in the sclerotome, we performed knockdown analysis of twist by using two kinds of morpholino antisense oligonucleotides targeted against twist (MO1 and MO2). Both the MO1 and MO2 morphants exhibited absence of neural arches, which are bilaterally paired, dorsomedially oriented bones on the dorsal aspect of the centrum. In addition, MO2, which blocks translation of only endogenous twist mRNA in the twist-EGFP transgenic medaka, did not affect the migration pattern of EGFP-positive cells, revealing that the migration of sclerotome-derived cells were normal in the absence of twist gene function. These results demonstrate that medaka twist functions in vertebral column formation by regulating the sclerotomal cell differentiation.

Targeted polypeptide degradation

DOEpatents

Church, George M [Brookline, MA; Janse, Daniel M [Brookline, MA

2008-05-13

This invention pertains to compositions, methods, cells and organisms useful for selectively localizing polypeptides to the proteasome for degradation. Therapeutic methods and pharmaceutical compositions for treating disorders associated with the expression and/or activity of a polypeptide by targeting these polypeptides for degradation, as well as methods for targeting therapeutic polypeptides for degradation and/or activating therapeutic polypeptides by degradation are provided. The invention provides methods for identifying compounds that mediate proteasome localization and/or polypeptide degradation. The invention also provides research tools for the study of protein function.

Hydrogenase polypeptide and methods of use

DOEpatents

Adams, Michael W.W.; Hopkins, Robert C.; Jenney, JR, Francis E.; Sun, Junsong

2016-02-02

Provided herein are polypeptides having hydrogenase activity. The polypeptide may be multimeric, and may have hydrogenase activity of at least 0.05 micromoles H.sub.2 produced min.sup.-1 mg protein.sup.-1. Also provided herein are polynucleotides encoding the polypeptides, genetically modified microbes that include polynucleotides encoding one or more subunits of the multimeric polypeptide, and methods for making and using the polypeptides.

Role of left ventricular twist mechanics in cardiomyopathies, dance of the helices

PubMed Central

Kauer, Floris; Geleijnse, Marcel Leonard; van Dalen, Bastiaan Martijn

2015-01-01

Left ventricular twist is an essential part of left ventricular function. Nevertheless, knowledge is limited in “the cardiology community” as it comes to twist mechanics. Fortunately the development of speckle tracking echocardiography, allowing accurate, reproducible and rapid bedside assessment of left ventricular twist, has boosted the interest in this important mechanical aspect of left ventricular deformation. Although the fundamental physiological role of left ventricular twist is undisputable, the clinical relevance of assessment of left ventricular twist in cardiomyopathies still needs to be established. The fact remains; analysis of left ventricular twist mechanics has already provided substantial pathophysiological understanding on a comprehensive variety of cardiomyopathies. It has become clear that increased left ventricular twist in for example hypertrophic cardiomyopathy may be an early sign of subendocardial (microvascular) dysfunction. Furthermore, decreased left ventricular twist may be caused by left ventricular dilatation or an extensive myocardial scar. Finally, the detection of left ventricular rigid body rotation in noncompaction cardiomyopathy may provide an indispensible method to objectively confirm this difficult diagnosis. All this endorses the value of left ventricular twist in the field of cardiomyopathies and may further encourage the implementation of left ventricular twist parameters in the “diagnostic toolbox” for cardiomyopathies. PMID:26322187

Compact, singular G 2-holonomy manifolds and M/heterotic/F-theory duality

NASA Astrophysics Data System (ADS)

Braun, Andreas P.; Schäfer-Nameki, Sakura

2018-04-01

We study the duality between M-theory on compact holonomy G 2-manifolds and the heterotic string on Calabi-Yau three-folds. The duality is studied for K3-fibered G 2-manifolds, called twisted connected sums, which lend themselves to an application of fiber-wise M-theory/Heterotic Duality. For a large class of such G 2-manifolds we are able to identify the dual heterotic as well as F-theory realizations. First we establish this chain of dualities for smooth G 2-manifolds. This has a natural generalization to situations with non-abelian gauge groups, which correspond to singular G 2-manifolds, where each of the K3-fibers degenerates. We argue for their existence through the chain of dualities, supported by non-trivial checks of the spectra. The corresponding 4d gauge groups can be both Higgsable and non-Higgsable, and we provide several explicit examples of the general construction.

Crystal structure and absolute configuration of (3aS,4S,5R,7aR)-2,2,7-trimethyl-3a,4,5,7a-tetra-hydro-1,3-benzodioxole-4,5-diol.

PubMed

Macías, Mario A; Suescun, Leopoldo; Pandolfi, Enrique; Schapiro, Valeria; Tibhe, Gaurao D; Mombrú, Álvaro W

2015-09-01

The absolute configuration of the title compound, C10H16O4, determined as 3aS,4S,5R,7aR on the basis of the synthetic pathway, was confirmed by X-ray diffraction. The mol-ecule contains a five- and a six-membered ring that adopt twisted and envelope conformations, respectively. The dihedral angle between the mean planes of the rings is 76.80 (11)° as a result of their cis-fusion. In the crystal, mol-ecules are linked by two pairs of O-H⋯O hydrogen bonds, forming chains along [010]. These chains are further connected by weaker C-H⋯O inter-actions along [100], creating (001) sheets that inter-act only by weak van der Waals forces.

2-(2-Thien­yl)-4,5-dihydro-1H-imidazole

PubMed Central

Kia, Reza; Fun, Hoong-Kun; Kargar, Hadi

2009-01-01

In title compound, C7H8N2S, the five-membered rings are twisted by a dihedral angle of 5.17 (10)°. Two inter­molecular N—H⋯N and C—H⋯N hydrogen bonds to the same acceptor N atom form seven-membered rings, producing R 2 1(7) ring motifs. These inter­actions link neighbouring mol­ecules into one-dimensional chains extended along the c axis. The crystal structure is further stabilized by weak inter­molecular C—H⋯π inter­actions. PMID:21581910

Analysis of polypeptide composition and antigenic components of Rickettsia tsutsugamushi by polyacrylamide gel electrophoresis and immunoblotting.

PubMed Central

Tamura, A; Ohashi, N; Urakami, H; Takahashi, K; Oyanagi, M

1985-01-01

Polyacrylamide gel electrophoresis of lysates of purified Rickettsia tsutsugamushi revealed as many as 30 polypeptide bands, including major bands corresponding to molecular sizes of 70, 60, 54 to 56, and 46 to 47 kilodaltons. Compared with the polypeptide composition of the rickettsiae of Gilliam, Karp, and Kato strains and a newly isolated Shimokoshi strain, the major polypeptide in the Kato strain (54-56K) and in the Karp strain (46-47K) migrated a little faster and slower, respectively, than the corresponding polypeptides in the other strains. The largest major polypeptide (54-56K) was digestible by the treatment of intact rickettsiae with trypsin and variable in content in separate preparations, suggesting that the polypeptide exists on the rickettsial surface and is easily degraded during the handling of these microorganisms. Several surface polypeptides of rickettsiae, including the 54-56K and 46-47K polypeptides, were detected by radioiodination of intact rickettsiae followed by polyacrylamide gel electrophoresis of the lysate; however, the 70K and 60K polypeptides were not labeled. Immunoblotting experiments with hyperimmune sera prepared in guinea pigs against each strain demonstrated that the 70K, 54-56K, and 46-47K polypeptides showed antigenic activities. The 54-56K polypeptide appeared to be strain specific, whereas the 70K and 46-47K polypeptides cross-reacted with the heterologous antisera. Images PMID:3922893

Synthesis of hemoglobin Gun Hill: increased synthesis of the heme-free βGH globin chain and subunit exchange with a free α-chain pool

PubMed Central

Rieder, Ronald F.

1971-01-01

Hemoglobin Gun Hill is an unstable mutant hemoglobin associated with mild compensated hemolysis. This abnormal protein has a deletion of five amino acids in the β-chains. The deletion includes the heme-binding proximal histidine at position 92. The β-chains of hemoglobin Gun Hill lack heme groups. Approximately 32% of the circulating hemoglobin in heterozygous subjects consists of the mutant hemoglobin. When reticulocytes were incubated with radioactive amino acid the specific activity of hemoglobin Gun Hill was three to six times that of hemoglobin A. Total incorporation of radioactivity into hemoglobin Gun Hill was two to three times that into hemoglobin A. There were 20-50% more total counts in β-Gun Hill (βGH) than in βA. These results indicate that in reticulocytes there was greater synthesis of the abnormal β-chains than βA-chains. The ratio of the specific activities of the α-chains of hemoglobin Gun Hill to the α-chains of hemoglobin A was 20: 1. There was evidence of a free pool of α-chains in the reticulocytes containing hemoglobin Gun Hill. After 10 min of incubation approximately 40% of the total α-chain radioactivity was in the free pool. When protein synthesis was blocked by incubation of reticulocytes with puromycin, the specific activity of the α-chains of hemoglobin Gun Hill continued to increase due to direct exchange of α-subunits between the free pool and preformed hemoglobin Gun Hill. Studies of the assembly of βA and βGH revealed that the rates of translation of the two polypeptide chains were equal and uniform. No evidence was obtained for the existence of “slow points” in the process of globin chain assembly. The studies also suggest that lack of strong heme-globin binding does not hinder the synthesis of globin chains. PMID:5540175

Polypeptide synthesis induced in Nicotiana clevelandii protoplasts by infection with raspberry ringspot nepovirus.

PubMed

Acosta, O; Mayo, M A

1993-01-01

Infection of Nicotiana clevelandii protoplasts by raspberry ringspot nepovirus resulted in the accumulation of about 24 polypeptides that differed in M(r) and pI from polypeptides accumulating in mock-inoculated protoplasts. Similar polypeptides accumulated in protoplasts infected with the S and E strains of RRV but different infection-specific polypeptides were detected in protoplasts infected with tobacco ringspot nepovirus. The M(r) of RRV-specific polypeptides ranged from 210,000 to 18,000 and most are presumed to be derived from others by proteolytic cleavage. No evidence was found for marked changes in polypeptide abundance with time after inoculation or for any virus-specific polypeptide becoming disproportionately abundant in the medium during culture.

Polypeptides having laccase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Tang, Lan; Duan, Junxin

The present invention relates to isolated polypeptides having laccase activity and polynucleotides encoding the polypeptides and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Self-Assembly of Emulsion Droplets into Polymer Chains

NASA Astrophysics Data System (ADS)

Bargteil, Dylan; McMullen, Angus; Brujic, Jasna

We experimentally investigate `beads-on-a-string' models of polymers using the spontaneous assembly of emulsion droplets into linear chains. Droplets functionalized with surface-mobile DNA allow for programmable 'monomers' through which we can influence the three-dimensional structure of the assembled 'polymer'. Such model polymers can be used to study conformational changes of polypeptides and the principles governing protein folding. In our system, we find that droplets bind via complementary DNA strands that are recruited into adhesion patches. Recruitment is driven by the DNA hybridization energy, and is limited by the energy cost of surface deformation and the entropy loss of the mobile linkers, yielding adhesion patches of a characteristic size with a given number of linkers. By tuning the initial surface coverage of linkers, we control valency between the droplets to create linear or branched polymer chains. We additionally control the flexibility of the model polymers by varying the salt concentration and study their dynamics between extended and collapsed states. This system opens the possibility of programming stable three-dimensional structures, such as those found within folded proteins.

De novo modeling of the F420-reducing [NiFe]-hydrogenase from a methanogenic archaeon by cryo-electron microscopy

PubMed Central

Mills, Deryck J; Vitt, Stella; Strauss, Mike; Shima, Seigo; Vonck, Janet

2013-01-01

Methanogenic archaea use a [NiFe]-hydrogenase, Frh, for oxidation/reduction of F420, an important hydride carrier in the methanogenesis pathway from H2 and CO2. Frh accounts for about 1% of the cytoplasmic protein and forms a huge complex consisting of FrhABG heterotrimers with each a [NiFe] center, four Fe-S clusters and an FAD. Here, we report the structure determined by near-atomic resolution cryo-EM of Frh with and without bound substrate F420. The polypeptide chains of FrhB, for which there was no homolog, was traced de novo from the EM map. The 1.2-MDa complex contains 12 copies of the heterotrimer, which unexpectedly form a spherical protein shell with a hollow core. The cryo-EM map reveals strong electron density of the chains of metal clusters running parallel to the protein shell, and the F420-binding site is located at the end of the chain near the outside of the spherical structure. DOI: http://dx.doi.org/10.7554/eLife.00218.001 PMID:23483797

Hydrogen Bond Networks and Hydrophobic Effects in the Amyloid β30-35 Chain in Water: A Molecular Dynamics Study.

PubMed

Jong, KwangHyok; Grisanti, Luca; Hassanali, Ali

2017-07-24

We have studied the conformational landscape of the C-terminal fragment of the amyloid protein Aβ 30-35 in water using well-tempered metadynamics simulations and found that it resembles an intrinsically disordered protein. The conformational fluctuations of the protein are facilitated by a collective reorganization of both protein and water hydrogen bond networks, combined with electrostatic interactions between termini as well as hydrophobic interactions of the side chains. The stabilization of hydrophobic interactions in one of the conformers involves a collective collapse of the side chains along with a squeeze-out of water sandwiched between them. The charged N- and C-termini play a critical role in stabilizing different types of protein conformations, including those involving contact-ion salt bridges as well as solvent-mediated interactions of the termini and the amide backbone. We have examined this by probing the distribution of directed water wires forming the hydrogen bond network enveloping the polypeptide. Water wires and their fluctuations form an integral part of structural signature of the protein conformation.

The Effect of a Helix-Coil Transition on the Extension Elasticity

NASA Astrophysics Data System (ADS)

Buhot, Arnaud; Halperin, Avi

2000-03-01

The secondary structure of a polymer affects its deformation behavior in accordance with the Le Chatelier principle. An important example of such secondary structure is the alpha helix encountered in polypeptides. Similar structure was recently proposed for PEO in aqueous media. Our discussion concerns the coupling of the cooperative helix-coil transition and the extension elasticity. In particular, we analyze the extension of a long single chain by use of optical tweezers or AFM. We consider chains that exist in the coil-state when unperturbed. The transition nevertheless occurs because the extension favors the low entropy helical state. As a result, the corresponding force law exhibits a plateau. The analysis of this situation involves two ingredients: (I) the stretching free energy penalty for a rod-coil mutiblock copolymer (II) the entropy associated with the possible placements of the rod and coil blocks.

Drug-Sensing by the Ribosome Induces Translational Arrest via Active Site Perturbation

PubMed Central

Arenz, Stefan; Meydan, Sezen; Starosta, Agata L.; Berninghausen, Otto; Beckmann, Roland; Vázquez-Laslop, Nora; Wilson, Daniel N.

2014-01-01

SUMMARY During protein synthesis, nascent polypeptide chains within the ribosomal tunnel can act in cis to induce ribosome stalling and regulate expression of downstream genes. The Staphylococcus aureus ErmCL leader peptide induces stalling in the presence of clinically important macrolide antibiotics, such as erythromycin, leading to the induction of the downstream macrolide resistance methyltransferase ErmC. Here, we present a cryo-electron microscopy (EM) structure of the erythromycin-dependent ErmCL-stalled ribosome at 3.9 Å resolution. The structure reveals how the ErmCL nascent chain directly senses the presence of the tunnel-bound drug and thereby induces allosteric conformational rearrangements at the peptidyltransferase center (PTC) of the ribosome. ErmCL-induced perturbations of the PTC prevent stable binding and accommodation of the aminoacyl-tRNA at the A-site leading to inhibition of peptide bond formation and translation arrest. PMID:25306253

How main-chains of proteins explore the free-energy landscape in native states.

PubMed

Senet, Patrick; Maisuradze, Gia G; Foulie, Colette; Delarue, Patrice; Scheraga, Harold A

2008-12-16

Understanding how a single native protein diffuses on its free-energy landscape is essential to understand protein kinetics and function. The dynamics of a protein is complex, with multiple relaxation times reflecting a hierarchical free-energy landscape. Using all-atom molecular dynamics simulations of an alpha/beta protein (crambin) and a beta-sheet polypeptide (BS2) in their "native" states, we demonstrate that the mean-square displacement of dihedral angles, defined by 4 successive C(alpha) atoms, increases as a power law of time, t(alpha), with an exponent alpha between 0.08 and 0.39 (alpha = 1 corresponds to Brownian diffusion), at 300 K. Residues with low exponents are located mainly in well-defined secondary elements and adopt 1 conformational substate. Residues with high exponents are found in loops/turns and chain ends and exist in multiple conformational substates, i.e., they move on multiple-minima free-energy profiles.

Expansion and internal friction in unfolded protein chain.

PubMed

Yasin, U Mahammad; Sashi, Pulikallu; Bhuyan, Abani K

2013-10-10

Similarities in global properties of homopolymers and unfolded proteins provide approaches to mechanistic description of protein folding. Here, hydrodynamic properties and relaxation rates of the unfolded state of carbonmonoxide-liganded cytochrome c (cyt-CO) have been measured using nuclear magnetic resonance and laser photolysis methods. Hydrodynamic radius of the unfolded chain gradually increases as the solvent turns increasingly better, consistent with theory. Curiously, however, the rate of intrachain contact formation also increases with an increasing denaturant concentration, which, by Szabo, Schulten, and Schulten theory for the rate of intramolecular contact formation in a Gaussian polymer, indicates growing intramolecular diffusion. It is argued that diminishing nonbonded atom interactions with increasing denaturant reduces internal friction and, thus, increases the rate of polypeptide relaxation. Qualitative scaling of the extent of unfolding with nonbonded repulsions allows for description of internal friction by a phenomenological model. The degree of nonbonded atom interactions largely determines the extent of internal friction.

How main-chains of proteins explore the free-energy landscape in native states

PubMed Central

Senet, Patrick; Maisuradze, Gia G.; Foulie, Colette; Delarue, Patrice; Scheraga, Harold A.

2008-01-01

Understanding how a single native protein diffuses on its free-energy landscape is essential to understand protein kinetics and function. The dynamics of a protein is complex, with multiple relaxation times reflecting a hierarchical free-energy landscape. Using all-atom molecular dynamics simulations of an α/β protein (crambin) and a β-sheet polypeptide (BS2) in their “native” states, we demonstrate that the mean-square displacement of dihedral angles, defined by 4 successive Cα atoms, increases as a power law of time, tα, with an exponent α between 0.08 and 0.39 (α = 1 corresponds to Brownian diffusion), at 300 K. Residues with low exponents are located mainly in well-defined secondary elements and adopt 1 conformational substate. Residues with high exponents are found in loops/turns and chain ends and exist in multiple conformational substates, i.e., they move on multiple-minima free-energy profiles. PMID:19073932

Substrate specificity of the ubiquitin and Ubl proteases

PubMed Central

Ronau, Judith A; Beckmann, John F; Hochstrasser, Mark

2016-01-01

Conjugation and deconjugation of ubiquitin and ubiquitin-like proteins (Ubls) to cellular proteins are highly regulated processes integral to cellular homeostasis. Most often, the C-termini of these small polypeptides are attached to lysine side chains of target proteins by an amide (isopeptide) linkage. Deubiquitinating enzymes (DUBs) and Ubl-specific proteases (ULPs) comprise a diverse group of proteases that recognize and remove ubiquitin and Ubls from their substrates. How DUBs and ULPs distinguish among different modifiers, or different polymeric forms of these modifiers, remains poorly understood. The specificity of ubiquitin/Ubl-deconjugating enzymes for particular substrates depends on multiple factors, ranging from the topography of specific substrate features, as in different polyubiquitin chain types, to structural elements unique to each enzyme. Here we summarize recent structural and biochemical studies that provide insights into mechanisms of substrate specificity among various DUBs and ULPs. We also discuss the unexpected specificities of non-eukaryotic proteases in these families. PMID:27012468

In Search of Functional Advantages of Knots in Proteins.

PubMed

Dabrowski-Tumanski, Pawel; Stasiak, Andrzej; Sulkowska, Joanna I

2016-01-01

We analysed the structure of deeply knotted proteins representing three unrelated families of knotted proteins. We looked at the correlation between positions of knotted cores in these proteins and such local structural characteristics as the number of intra-chain contacts, structural stability and solvent accessibility. We observed that the knotted cores and especially their borders showed strong enrichment in the number of contacts. These regions showed also increased thermal stability, whereas their solvent accessibility was decreased. Interestingly, the active sites within these knotted proteins preferentially located in the regions with increased number of contacts that also have increased thermal stability and decreased solvent accessibility. Our results suggest that knotting of polypeptide chains provides a favourable environment for the active sites observed in knotted proteins. Some knotted proteins have homologues without a knot. Interestingly, these unknotted homologues form local entanglements that retain structural characteristics of the knotted cores.

Extension-twist coupling of composite circular tubes with application to tilt rotor blade design

NASA Technical Reports Server (NTRS)

Nixon, Mark W.

1987-01-01

This investigation was conducted to determine if twist deformation required for the design of full-scale extension-twist-coupled tilt-rotor blades can be achieved within material design limit loads, and to demonstrate the accuracy of a coupled-beam analysis in predicting twist deformations. Two extension-twist-coupled tilt-rotor blade designs were developed based on theoretically optimum aerodynamic twist distributions. The designs indicated a twist rate requirement of between .216 and .333 deg/in. Agreement between axial tests and analytical predictions was within 10 percent at design limit loads. Agreement between the torsion tests and predictions was within 11 percent.

The Twist Limit for Bipolar Active Regions

NASA Technical Reports Server (NTRS)

Moore, Ron; Falconer, David; Gary, Allen

2008-01-01

We present new evidence that further supports the standard idea that active regions are emerged magnetic-flux-rope omega loops. When the axial magnetic twist of a cylindrical flux rope exceeds a critical amount, the flux rope becomes unstable to kinking, and the excess axial twist is converted into writhe twist by the kinking. This suggests that, if active regions are emerged omega loops, then (1) no active region should have magnetic twist much above the limit set by kinking, (2) active regions having twist near the limit should often arise from kinked omega loops, and (3) since active regions having large delta sunspots are outstandingly twisted, these arise from kinked omega loops and should have twist near the limit for kinking. From each of 36 vector magnetograms of bipolar active regions, we have measured (1) the total flux of the vertical field above 100 G, (2) the area covered by this flux, and (3) the net electric current that arches over the polarity inversion line. These three quantities yield an estimate of the axial magnetic twist in a simple model cylindrical flux rope that corresponds to the top of the active region s hypothetical omega loop prior to emergence. In all 36 cases, the estimated twist is below the critical limit for kinking. The 11 most twisted active regions (1) have estimated twist within a factor of approx.3 of the limit, and (2) include all of our 6 active regions having large delta sunspots. Thus, our observed twist limit for bipolar active regions is in good accord with active regions being emerged omega loops.

The hydrolysis of polyimides

NASA Technical Reports Server (NTRS)

Hoagland, P. D.; Fox, S. W.

1973-01-01

Thermal polymerization of aspartic acid produces a polysuccinimide (I), a chain of aspartoyl residues. An investigation was made of the alkaline hydrolysis of the imide rings of (I) which converts the polyimide to a polypeptide. The alkaline hydrolysis of polyimides can be expected to be kinetically complex due to increasing negative charge generated by carboxylate groups. For this reason, a diimide, phthaloyl-DL-aspartoyl-beta-alanine (IIA) was synthesized for a progressive study of the hydrolysis of polyimides. In addition, this diimide (IIA) can be related to thalidomide and might be expected to exhibit similar reactivity during hydrolysis of the phthalimide ring.

Processing mechanics of alternate twist ply (ATP) yarn technology

NASA Astrophysics Data System (ADS)

Elkhamy, Donia Said

Ply yarns are important in many textile manufacturing processes and various applications. The primary process used for producing ply yarns is cabling. The speed of cabling is limited to about 35m/min. With the world's increasing demands of ply yarn supply, cabling is incompatible with today's demand activated manufacturing strategies. The Alternate Twist Ply (ATP) yarn technology is a relatively new process for producing ply yarns with improved productivity and flexibility. This technology involves self plying of twisted singles yarn to produce ply yarn. The ATP process can run more than ten times faster than cabling. To implement the ATP process to produce ply yarns there are major quality issues; uniform Twist Profile and yarn Twist Efficiency. The goal of this thesis is to improve these issues through process modeling based on understanding the physics and processing mechanics of the ATP yarn system. In our study we determine the main parameters that control the yarn twist profile. Process modeling of the yarn twist across different process zones was done. A computational model was designed to predict the process parameters required to achieve a square wave twist profile. Twist efficiency, a measure of yarn torsional stability and bulk, is determined by the ratio of ply yarn twist to singles yarn twist. Response Surface Methodology was used to develop the processing window that can reproduce ATP yarns with high twist efficiency. Equilibrium conditions of tensions and torques acting on the yarns at the self ply point were analyzed and determined the pathway for achieving higher twist efficiency. Mechanistic modeling relating equilibrium conditions to the twist efficiency was developed. A static tester was designed to zoom into the self ply zone of the ATP yarn. A computer controlled, prototypic ATP machine was constructed and confirmed the mechanistic model results. Optimum parameters achieving maximum twist efficiency were determined in this study. The successful results of this work have led to the filing of a US patent disclosing the method for producing ATP yarns with high yarn twist efficiency using a high convergence angle at the self ply point together with applying ply torque.

Genomic pathways modulated by Twist in breast cancer.

PubMed

Vesuna, Farhad; Bergman, Yehudit; Raman, Venu

2017-01-13

The basic helix-loop-helix transcription factor TWIST1 (Twist) is involved in embryonic cell lineage determination and mesodermal differentiation. There is evidence to indicate that Twist expression plays a role in breast tumor formation and metastasis, but the role of Twist in dysregulating pathways that drive the metastatic cascade is unclear. Moreover, many of the genes and pathways dysregulated by Twist in cell lines and mouse models have not been validated against data obtained from larger, independant datasets of breast cancer patients. We over-expressed the human Twist gene in non-metastatic MCF-7 breast cancer cells to generate the estrogen-independent metastatic breast cancer cell line MCF-7/Twist. These cells were inoculated in the mammary fat pad of female severe compromised immunodeficient mice, which subsequently formed xenograft tumors that metastasized to the lungs. Microarray data was collected from both in vitro (MCF-7 and MCF-7/Twist cell lines) and in vivo (primary tumors and lung metastases) models of Twist expression. Our data was compared to several gene datasets of various subtypes, classes, and grades of human breast cancers. Our data establishes a Twist over-expressing mouse model of breast cancer, which metastasizes to the lung and replicates some of the ontogeny of human breast cancer progression. Gene profiling data, following Twist expression, exhibited novel metastasis driver genes as well as cellular maintenance genes that were synonymous with the metastatic process. We demonstrated that the genes and pathways altered in the transgenic cell line and metastatic animal models parallel many of the dysregulated gene pathways observed in human breast cancers. Analogous gene expression patterns were observed in both in vitro and in vivo Twist preclinical models of breast cancer metastasis and breast cancer patient datasets supporting the functional role of Twist in promoting breast cancer metastasis. The data suggests that genetic dysregulation of Twist at the cellular level drives alterations in gene pathways in the Twist metastatic mouse model which are comparable to changes seen in human breast cancers. Lastly, we have identified novel genes and pathways that could be further investigated as targets for drugs to treat metastatic breast cancer.

Characterization of sequences in human TWIST required for nuclear localization

PubMed Central

Singh, Shalini; Gramolini, Anthony O

2009-01-01

Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

Teaching Spatial Awareness for Better Twisting Somersaults.

ERIC Educational Resources Information Center

Hennessy, Jeff T.

1985-01-01

The barani (front somersault with one-half twist) and the back somersault with one twist are basic foundation skills necessary for more advanced twisting maneuvers. Descriptions of these movements on a trampoline surface are offered. (DF)

Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

PubMed Central

Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

2014-01-01

All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

moxFG region encodes four polypeptides in the methanol-oxidizing bacterium Methylobacterium sp. strain AM1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, D.J.; Lidstrom, M.E.

The polypeptides encoded by a putative methanol oxidation (mox) operon of Methylobacterium sp. strain AM1 were expressed in Escherichia coli, using a coupled in vivo T7 RNA polymerase/promoter gene expression system. Two mox genes had been previously mapped to this region: moxF, the gene encoding the methanol dehydrogenase (MeDH) polypeptide; and moxG, a gene believed to encode a soluble type c cytochrome, cytochrome c/sub L/. In this study, four polypeptides of M/sub r/, 60,000, 30,000, 20,000, and 12,000 were found to be encoded by the moxFG region and were tentatively designated moxF, -J, -G, and -I, respectively. The arrangement ofmore » the genes (5' to 3') was found to be moxFJGI. The identities of three of the four polypeptides were determined by protein immunoblot analysis. The product of moxF, the M/sub r/-60,000 polypeptide, was confirmed to be the MeDH polypeptide. The product of moxG, the M/sub r/-20,000 polypeptide, was identified as mature cytochrome c/sub L/, and the product of moxI, the M/sub r/-12,000 polypeptide, was identified as a MeDH-associated polypeptide that copurifies with the holoenzyme. The identity of the M/sub r/-30,000 polypeptide (the moxJ gene product) could not be determined. The function of the M/sub r/-12,000 MeDH-associated polypeptide is not yet clear. However, it is not present in mutants that lack the M/sub r/-60,000 MeDH subunit, and it appears that the stability of the MeDH-associated polypeptide is dependent on the presence of the M/sub r/-60,000 MeDH polypeptide. Our data suggest that both the M/sub r/-30,000 and -12,000 polypeptides are involved in methanol oxidation, which would bring to 12 the number of mox genes in Methylobacterium sp. strain AM1.« less

Metastasis-associated in colon cancer-1 promotes vasculogenic mimicry in gastric cancer by upregulating TWIST1/2

PubMed Central

Wang, Lin; Lin, Li; Chen, Xi; Sun, Li; Liao, Yulin; Huang, Na; Liao, Wangjun

2015-01-01

Vasculogenic mimicry (VM) is a blood supply modality that is strongly associated with the epithelial-mesenchymal transition (EMT), TWIST1 activation and tumor progression. We previously reported that metastasis-associated in colon cancer-1 (MACC1) induced the EMT and was associated with a poor prognosis of patients with gastric cancer (GC), but it remains unknown whether MACC1 promotes VM and regulates the TWIST signaling pathway in GC. In this study, we investigated MACC1 expression and VM by immunohistochemistry in 88 patients with stage IV GC, and also investigated the role of TWIST1 and TWIST2 in MACC1-induced VM by using nude mice with GC xenografts and GC cell lines. We found that the VM density was significantly increased in the tumors of patients who died of GC and was positively correlated with MACC1 immunoreactivity (p < 0.05). The 3-year survival rate was only 8.6% in patients whose tumors showed double positive staining for MACC1 and VM, whereas it was 41.7% in patients whose tumors were negative for both MACC1 and VM. Moreover, nuclear expression of MACC1, TWIST1, and TWIST2 was upregulated in GC tissues compared with matched adjacent non-tumorous tissues (p < 0.05). Overexpression of MACC1 increased TWIST1/2 expression and induced typical VM in the GC xenografts of nude mice and in GC cell lines. MACC1 enhanced TWIST1/2 promoter activity and facilitated VM, while silencing of TWIST1 or TWIST2 inhibited VM. Hepatocyte growth factor (HGF) increased the nuclear translocation of MACC1, TWIST1, and TWIST2, while a c-Met inhibitor reduced these effects. These findings indicate that MACC1 promotes VM in GC by regulating the HGF/c-Met-TWIST1/2 signaling pathway, which means that MACC1 and this pathway are potential new therapeutic targets for GC. PMID:25895023

Supramolecular liquid crystalline π-conjugates: the role of aromatic π-stacking and van der Waals forces on the molecular self-assembly of oligophenylenevinylenes.

PubMed

Goel, Mahima; Jayakannan, M

2010-10-07

Here, we report a unique design strategy to trace the role of aromatic π-stacking and van der Waals interactions on the molecular self-organization of π-conjugated building blocks in a single system. A new series of bulky oligophenylenevinylenes (OPVs) bearing a tricyclodecanemethylene (TCD) unit in the aromatic π-core with flexible long methylene chains (n = 0-12 and 16) in the longitudinal position were designed and synthesized. The OPVs were found to be liquid crystalline, and their enthalpies of phase transitions (also entropies) showed odd-even oscillation with respect to the number of carbon atoms in alkyl chains. OPVs with an even number of methylene units in the side chains showed higher enthalpies with respect to their highly packed solid structures compared to odd-numbered ones. Polarized light microscopic analysis confirmed the formation of cholesteric liquid crystalline (LC) phases of fan shaped textures with focal conics in OPVs with 5 ≤ n ≤ 9. OPVs with longer alkyl chains (OPV-10 to OPV-12) produced a birefringence pattern consisting of dark and bright ring-banded suprastructures. The melting temperature followed a sigmoidal trend, indicating the transformation of molecular self-organization in OPVs from solid to ring-banded suprastructures via cholesteric LC intermediates. At longer alkyl chain lengths, the van der Waals interactions among the alkyl chains became predominant and translated the mesogenic effect across the lamellae; as a consequence, the lamellae underwent twisted self-organization along the radial growth direction of the spherulites to produce bright and dark bands. Scanning electron microscope (SEM) analysis of cholesteric LC and ring-banded textures strongly supported the existence of twisted lamellae in the OPVs with ring-banded textures. Variable temperature X-ray diffraction analysis confirmed the reversibility of the molecular self-organization in the solid state and also showed the existence of the higher ordered lamellar structure in ring-banded OPVs. Photophysical characterizations such as excitation, emission, and time resolved fluorescence decay measurements were employed to trace molecular self-organization in their liquid crystalline phases. The emission spectra of the OPV samples showed odd-even oscillation in their emission wavelengths with respect to the length of alkyl chains. Highly packed even-OPVs showed more blue shift compared to that of less crystalline odd-OPVs. Time dependent fluorescence decay of OPVs followed a biexponential fit, and their lifetimes (τ(1) and τ(2) values) revealed that the decay is faster for odd-OPVs compared to even-OPVs. Among all the OPVs, the τ(2) values for OPV-8 and OPV-12 were found to be much higher, indicating their high luminescent characteristics. In a nut shell, bulky liquid crystalline OPV chromophores were cleverly utilized, for the first time, to probe the aromatic π-stacking versus van der Waals interactions on the molecular self-organization of π-conjugated system.

Numerical investigation of heat transfer and friction factor characteristics in a circular tube fitted with V-cut twisted tape inserts.

PubMed

Salman, Sami D; Kadhum, Abdul Amir H; Takriff, Mohd S; Mohamad, Abu Bakar

2013-01-01

Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration.

Numerical Investigation of Heat Transfer and Friction Factor Characteristics in a Circular Tube Fitted with V-Cut Twisted Tape Inserts

PubMed Central

Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

2013-01-01

Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration. PMID:24078795

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Hu, F.; Das, Suprem R.; Luan, Y.; Chung, T.-F.; Chen, Y. P.; Fei, Z.

2017-12-01

We report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly due to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, F.; Das, Suprem R.; Luan, Y.

Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

Hydrogen bonds and twist in cellulose microfibrils.

PubMed

Kannam, Sridhar Kumar; Oehme, Daniel P; Doblin, Monika S; Gidley, Michael J; Bacic, Antony; Downton, Matthew T

2017-11-01

There is increasing experimental and computational evidence that cellulose microfibrils can exist in a stable twisted form. In this study, atomistic molecular dynamics (MD) simulations are performed to investigate the importance of intrachain hydrogen bonds on the twist in cellulose microfibrils. We systematically enforce or block the formation of these intrachain hydrogen bonds by either constraining dihedral angles or manipulating charges. For the majority of simulations a consistent right handed twist is observed. The exceptions are two sets of simulations that block the O2-O6' intrachain hydrogen bond, where no consistent twist is observed in multiple independent simulations suggesting that the O2-O6' hydrogen bond can drive twist. However, in a further simulation where exocyclic group rotation is also blocked, right-handed twist still develops suggesting that intrachain hydrogen bonds are not necessary to drive twist in cellulose microfibrils. Copyright © 2017 Elsevier Ltd. All rights reserved.

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

DOE PAGES

Hu, F.; Das, Suprem R.; Luan, Y.; ...

2017-12-13

Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

Gauge transformations for twisted spectral triples

NASA Astrophysics Data System (ADS)

Landi, Giovanni; Martinetti, Pierre

2018-05-01

It is extended to twisted spectral triples the fluctuations of the metric as bounded perturbations of the Dirac operator that arises when a spectral triple is exported between Morita equivalent algebras, as well as gauge transformations which are obtained by the action of the unitary endomorphisms of the module implementing the Morita equivalence. It is firstly shown that the twisted-gauged Dirac operators, previously introduced to generate an extra scalar field in the spectral description of the standard model of elementary particles, in fact follow from Morita equivalence between twisted spectral triples. The law of transformation of the gauge potentials turns out to be twisted in a natural way. In contrast with the non-twisted case, twisted fluctuations do not necessarily preserve the self-adjointness of the Dirac operator. For a self-Morita equivalence, conditions are obtained in order to maintain self-adjointness that are solved explicitly for the minimal twist of a Riemannian manifold.

Evaluation of the operatorial Q-system for non-compact super spin chains

NASA Astrophysics Data System (ADS)

Frassek, Rouven; Marboe, Christian; Meidinger, David

2017-09-01

We present an approach to evaluate the full operatorial Q-system of all u(p,q\\Big|r+s) -invariant spin chains with representations of Jordan-Schwinger type. In particular, this includes the super spin chain of planar N=4 super Yang-Mills theory at one loop in the presence of a diagonal twist. Our method is based on the oscillator construction of Q-operators. The Q-operators are built as traces over Lax operators which are degenerate solutions of the Yang-Baxter equation. For non-compact representations these Lax operators may contain multiple infinite sums that conceal the form of the resulting functions. We determine these infinite sums and calculate the matrix elements of the lowest level Q-operators. Transforming the Lax operators corresponding to the Q-operators into a representation involving only finite sums allows us to take the supertrace and to obtain the explicit form of the Q-operators in terms of finite matrices for a given magnon sector. Imposing the functional relations, we then bootstrap the other Q-operators from those of the lowest level. We exemplify this approach for non-compact spin - s spin chains and apply it to N=4 at the one-loop level using the BMN vacuum as an example.

Elastomeric Polypeptides

PubMed Central

van Eldijk, Mark B.; McGann, Christopher L.

2013-01-01

Elastomeric polypeptides are very interesting biopolymers and are characterized by rubber-like elasticity, large extensibility before rupture, reversible deformation without loss of energy, and high resilience upon stretching. Their useful properties have motivated their use in a wide variety of materials and biological applications. This chapter focuses on elastin and resilin – two elastomeric biopolymers – and the recombinant polypeptides derived from them (elastin-like polypeptides and resilin-like polypeptides). This chapter also discusses the applications of these recombinant polypeptides in the fields of purification, drug delivery, and tissue engineering. PMID:21826606

The Mr 140,000 Intermediate Chain of Chlamydomonas Flagellar Inner Arm Dynein Is a WD-Repeat Protein Implicated in Dynein Arm Anchoring

PubMed Central

Yang, Pinfen; Sale, Winfield S.

1998-01-01

Previous structural and biochemical studies have revealed that the inner arm dynein I1 is targeted and anchored to a unique site located proximal to the first radial spoke in each 96-nm axoneme repeat on flagellar doublet microtubules. To determine whether intermediate chains mediate the positioning and docking of dynein complexes, we cloned and characterized the 140-kDa intermediate chain (IC140) of the I1 complex. Sequence and secondary structural analysis, with particular emphasis on β-sheet organization, predicted that IC140 contains seven WD repeats. Reexamination of other members of the dynein intermediate chain family of WD proteins indicated that these polypeptides also bear seven WD/β-sheet repeats arranged in the same pattern along each intermediate chain protein. A polyclonal antibody was raised against a 53-kDa fusion protein derived from the C-terminal third of IC140. The antibody is highly specific for IC140 and does not bind to other dynein intermediate chains or proteins in Chlamydomonas flagella. Immunofluorescent microscopy of Chlamydomonas cells confirmed that IC140 is distributed along the length of both flagellar axonemes. In vitro reconstitution experiments demonstrated that the 53-kDa C-terminal fusion protein binds specifically to axonemes lacking the I1 complex. Chemical cross-linking indicated that IC140 is closely associated with a second intermediate chain in the I1 complex. These data suggest that IC140 contains domains responsible for the assembly and docking of the I1 complex to the doublet microtubule cargo. PMID:9843573

Cardiac metabolic pathways affected in the mouse model of barth syndrome.

PubMed

Huang, Yan; Powers, Corey; Madala, Satish K; Greis, Kenneth D; Haffey, Wendy D; Towbin, Jeffrey A; Purevjav, Enkhsaikhan; Javadov, Sabzali; Strauss, Arnold W; Khuchua, Zaza

2015-01-01

Cardiolipin (CL) is a mitochondrial phospholipid essential for electron transport chain (ETC) integrity. CL-deficiency in humans is caused by mutations in the tafazzin (Taz) gene and results in a multisystem pediatric disorder, Barth syndrome (BTHS). It has been reported that tafazzin deficiency destabilizes mitochondrial respiratory chain complexes and affects supercomplex assembly. The aim of this study was to investigate the impact of Taz-knockdown on the mitochondrial proteomic landscape and metabolic processes, such as stability of respiratory chain supercomplexes and their interactions with fatty acid oxidation enzymes in cardiac muscle. Proteomic analysis demonstrated reduction of several polypeptides of the mitochondrial respiratory chain, including Rieske and cytochrome c1 subunits of complex III, NADH dehydrogenase alpha subunit 5 of complex I and the catalytic core-forming subunit of F0F1-ATP synthase. Taz gene knockdown resulted in upregulation of enzymes of folate and amino acid metabolic pathways in heart mitochondria, demonstrating that Taz-deficiency causes substantive metabolic remodeling in cardiac muscle. Mitochondrial respiratory chain supercomplexes are destabilized in CL-depleted mitochondria from Taz knockdown hearts resulting in disruption of the interactions between ETC and the fatty acid oxidation enzymes, very long-chain acyl-CoA dehydrogenase and long-chain 3-hydroxyacyl-CoA dehydrogenase, potentially affecting the metabolic channeling of reducing equivalents between these two metabolic pathways. Mitochondria-bound myoglobin was significantly reduced in Taz-knockdown hearts, potentially disrupting intracellular oxygen delivery to the oxidative phosphorylation system. Our results identify the critical pathways affected by the Taz-deficiency in mitochondria and establish a future framework for development of therapeutic options for BTHS.

Methods for engineering polypeptide variants via somatic hypermutation and polypeptide made thereby

DOEpatents

Tsien, Roger Y; Wang, Lei

2015-01-13

Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

Study of nonlinear MHD equations governing the wave propagation in twisted coronal loops

NASA Technical Reports Server (NTRS)

Parhi, S.; DeBruyne, P.; Goossens, M.; Zhelyazkov, I.

1995-01-01

The solar corona, modelled by a low beta, resistive plasma slab, sustains MHD wave propagations due to shearing footpoint motions in the photosphere. By using a numerical algorithm the excitation and nonlinear development of MHD waves in twisted coronal loops are studied. The plasma responds to the footpoint motion by sausage waves if there is no twist. The twist in the magnetic field of the loop destroys initially developed sausage-like wave modes and they become kinks. The transition from sausage to kink modes is analyzed. The twist brings about mode degradation producing high harmonics and this generates more complex fine structures. This can be attributed to several local extrema in the perturbed velocity profiles. The Alfven wave produces remnants of the ideal 1/x singularity both for zero and non-zero twist and this pseudo-singularity becomes less pronounced for larger twist. The effect of nonlinearity is clearly observed by changing the amplitude of the driver by one order of magnitude. The magnetosonic waves also exhibit smoothed remnants of ideal logarithmic singularities when the frequency of the driver is correctly chosen. This pseudo-singularity for fast waves is absent when the coronal loop does not undergo any twist but becomes pronounced when twist is included. On the contrary, it is observed for slow waves even if there is no twist. Increasing the twist leads to a higher heating rate of the loop. The larger twist shifts somewhat uniformly distributed heating to layers inside the slab corresponding to peaks in the magnetic field strength.

Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.

PubMed

Cao, Jingying; Wang, Xin; Dai, Tao; Wu, Yuanzhong; Zhang, Meifang; Cao, Renxian; Zhang, Ruhua; Wang, Gang; Jiang, Rou; Zhou, Binhua P; Shi, Jian; Kang, Tiebang

2018-01-01

Rationale: Twist is a key transcription factor for induction of epithelial-mesenchymal transition (EMT), which promotes cell migration, invasion, and cancer metastasis, confers cancer cells with stem cell-like characteristics, and provides therapeutic resistance. However, the functional roles and targeted genes of Twist in EMT and cancer progression remain elusive. Methods: The potential targeted genes of Twist were identified from the global transcriptomes of T47D/Twist cells by microarray analysis. EMT phenotype was detected by western blotting and immunofluorescence of marker proteins. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional induction of ROR1 by Twist. A lung metastasis model was used to study the pro-metastatic role of Twist and ROR1 by injecting MDA-MB-231 cells into tail vein of nude mice. Bio-informatics analysis was utilized to measure the metastasis-free survival of breast cancer patients. Results: Twist protein was proved to directly activate the transcription of ROR1 gene, a receptor of Wnt5a in non-canonical WNT signaling pathway. Silencing of ROR1 inhibited EMT process, cell migration, invasion, and cancer metastasis of basal-like breast cancer (BLBC) cells. Knockdown of ROR1 also ameliorated the pro-metastatic effect of Twist. Furthermore, analyses of clinical specimens indicated that high expression of both ROR1 and Twist tightly correlates with poor metastasis-free survival of breast cancer patients. Conclusion: ROR1 is a targeted gene of Twist. Twist/ROR1 signaling is critical for invasion and metastasis of BLBC cells.

Twist for Snyder space

NASA Astrophysics Data System (ADS)

Meljanac, Daniel; Meljanac, Stjepan; Mignemi, Salvatore; Pikutić, Danijel; Štrajn, Rina

2018-03-01

We construct the twist operator for the Snyder space. Our starting point is a non-associative star product related to a Hermitian realisation of the noncommutative coordinates originally introduced by Snyder. The corresponding coproduct of momenta is non-coassociative. The twist is constructed using a general definition of the star product in terms of a bi-differential operator in the Hopf algebroid approach. The result is given by a closed analytical expression. We prove that this twist reproduces the correct coproducts of the momenta and the Lorentz generators. The twisted Poincaré symmetry is described by a non-associative Hopf algebra, while the twisted Lorentz symmetry is described by the undeformed Hopf algebra. This new twist might be important in the construction of different types of field theories on Snyder space.

Studying lipid-protein interactions with electron paramagnetic resonance spectroscopy of spin-labeled lipids.

PubMed

Páli, Tibor; Kóta, Zoltán

2013-01-01

Spin label electron paramagnetic resonance (EPR) of lipid-protein interactions reveals crucial features of the structure and assembly of integral membrane proteins. Spin label EPR spectroscopy is the technique of choice to characterize the protein-solvating lipid shell in its highly dynamic nature, because the EPR spectra of lipids that are spin labeled close to the terminal methyl end of their acyl chains display two spectral components, those corresponding to lipids directly contacting the protein and those corresponding to lipids in the bulk fluid bilayer regions of the membrane. In this chapter, typical spin label EPR procedures are presented that allow determination of the stoichiometry of interaction of spin-labeled lipids with the intra-membranous region of membrane proteins or polypeptides, as well as the association constant of the spin-labeled lipid with respect to the host lipid. The lipids giving rise to the so-called immobile spectral component in the EPR spectrum of such samples are identified as the motionally restricted first-shell lipids solvating membrane proteins in biomembranes. Stoichiometry and selectivity are directly related to the structure of the intra-membranous sections of membrane-associated proteins or polypeptides and can be used to study the state of assembly of such proteins in the membrane. Since these characteristics of lipid-protein interactions are discussed in detail in the literature [see Marsh (Eur Biophys J 39:513-525, 2010) for a most recent review], here we focus more on how to spin label model and biomembranes and how to measure and analyze the two-component EPR spectra of spin-labeled lipids in phospholipid bilayers that contain proteins or polypeptides. After a description of how to prepare spin-labeled model and native biological membranes, we present the reader with computational procedures for determining the molar fraction of motionally restricted lipids when both, one, or none of the pure isolated-mobile or immobile-spectral components are available. With these topics, this chapter complements a recent methodological paper [Marsh (Methods 46:83-96, 2008)]. The interpretation of the data is discussed briefly, as well as other relevant and recent spin label EPR techniques for studying lipid-protein interactions, not only from the point of view of lipid chain dynamics.

Effect of twist on single-mode fiber-optic 3 × 3 couplers

NASA Astrophysics Data System (ADS)

Chen, Dandan; Ji, Minning; Peng, Lei

2018-01-01

In the fabricating process of a 3 × 3 fused tapered coupler, the three fibers are usually twisted to be close-contact. The effect of twist on 3 × 3 fused tapered couplers is investigated in this paper. It is found that though a linear 3 × 3 coupler may realize equal power splitting ratio theoretically by twisting a special angle, it is hard to be fabricated actually because the twist angle and the coupler's length must be determined in advance. While an equilateral 3 × 3 coupler can not only realize approximate equal power splitting ratio theoretically but can also be fabricated just by controlling the elongation length. The effect of twist on the equilateral 3 × 3 coupler lies in the relationship between the equal ratio error and the twist angle. The more the twist angle is, the larger the equal ratio error may be. The twist angle usually should be no larger than 90° on one coupling period length in order to keep the equal ratio error small enough. The simulation results agree well with the experimental data.

Ion Trap Collisional Activation of c and z• Ions Formed via Gas-Phase Ion/Ion Electron Transfer Dissociation

PubMed Central

Han, Hongling; Xia, Yu; McLuckey, Scott A.

2008-01-01

A series of c- and z•-type product ions formed via gas-phase electron transfer ion/ion reactions between protonated polypeptides with azobenzene radical anions are subjected to ion trap collision activation in a linear ion trap. Fragment ions including a-, b-, y-type and ammonia-loss ions are typically observed in collision induced dissociation (CID) of c ions, showing almost identical CID patterns as those of the C-terminal amidated peptides consisting of the same sequences. Collisional activation of z• species mainly gives rise to side-chain losses and peptide backbone cleavages resulting in a-, b-, c-, x-, y-and z-type ions. Most of the fragmentation pathways of z• species upon ion trap CID can be accounted for by radical driven processes. The side-chain losses from z• species are different from the small losses observed from the charge-reduced peptide molecular species in electron transfer dissociation (ETD), which indicates rearrangement of the radical species. Characteristic side-chain losses are observed for several amino acid residues, which are useful to predict their presence in peptide/protein ions. Furthermore, the unique side-chain losses from leucine and isoleucine residues allow facile distinction of these two isomeric residues. PMID:17608403

How a Spatial Arrangement of Secondary Structure Elements Is Dispersed in the Universe of Protein Folds

PubMed Central

Minami, Shintaro; Sawada, Kengo; Chikenji, George

2014-01-01

It has been known that topologically different proteins of the same class sometimes share the same spatial arrangement of secondary structure elements (SSEs). However, the frequency by which topologically different structures share the same spatial arrangement of SSEs is unclear. It is important to estimate this frequency because it provides both a deeper understanding of the geometry of protein folds and a valuable suggestion for predicting protein structures with novel folds. Here we clarified the frequency with which protein folds share the same SSE packing arrangement with other folds, the types of spatial arrangement of SSEs that are frequently observed across different folds, and the diversity of protein folds that share the same spatial arrangement of SSEs with a given fold, using a protein structure alignment program MICAN, which we have been developing. By performing comprehensive structural comparison of SCOP fold representatives, we found that approximately 80% of protein folds share the same spatial arrangement of SSEs with other folds. We also observed that many protein pairs that share the same spatial arrangement of SSEs belong to the different classes, often with an opposing N- to C-terminal direction of the polypeptide chain. The most frequently observed spatial arrangement of SSEs was the 2-layer α/β packing arrangement and it was dispersed among as many as 27% of SCOP fold representatives. These results suggest that the same spatial arrangements of SSEs are adopted by a wide variety of different folds and that the spatial arrangement of SSEs is highly robust against the N- to C-terminal direction of the polypeptide chain. PMID:25243952

Characterization of Mixed Polypeptide Colloidal Particles by Light Scattering

NASA Astrophysics Data System (ADS)

Shuman, Hannah E.; Gaeckle, Grace K.; Gavin, John; Holland, Nolan B.; Streletzky, Kiril A.

2014-03-01

Temperature-dependent polymer surfactants have been developed by connecting three elastin-like polypeptide (ELP) chains to a charged protein domain (foldon), forming a three-armed star polymer. At low temperatures the polymer is soluble, while at higher temperatures it forms micelles. The behavior of mixtures of the three-armed star ELP (E20-Foldon) and H40-Linear ELP chains was analyzed under different salt and protein concentrations and various foldon to linear ELP ratio using Depolarized Dynamic Light Scattering. It was expected that under certain conditions the pure E20-Foldon would form spherical micelles, which upon adding the linear ELP would change in size and possibly shape. The pure E20-Foldon indeed formed largely spherical micelles with Rh of 10-20nm in solutions with 15-100mM salt and protein concentration between 10 μM and 100 μM. For the mixtures of 50 μM E20-Foldon and varying concentrations of H40-Linear in 25mM of salt, it was discovered that low and high H40-Linear concentration (4 μM and 50 μM) had only one transition. For the mixtures with of 10 and 25 μM of H40-Linear the two distinct transition temperatures were observed by spectrophotometry. The first transition corresponded to significantly elongated diffusive particles of apparent Rh of 30-50nm, while the second transition corresponded to slightly anisotropic diffusive particles with apparent Rh of about 20nm. At all H40-Linear concentrations studied, diffusive particles were seen above the second transition. Their radius and ability to depolarize light increased with the increase of H40-Linear concentration.

Molecular dynamics simulations of the Nip7 proteins from the marine deep- and shallow-water Pyrococcus species.

PubMed

Medvedev, Kirill E; Alemasov, Nikolay A; Vorobjev, Yuri N; Boldyreva, Elena V; Kolchanov, Nikolay A; Afonnikov, Dmitry A

2014-10-15

The identification of the mechanisms of adaptation of protein structures to extreme environmental conditions is a challenging task of structural biology. We performed molecular dynamics (MD) simulations of the Nip7 protein involved in RNA processing from the shallow-water (P. furiosus) and the deep-water (P. abyssi) marine hyperthermophylic archaea at different temperatures (300 and 373 K) and pressures (0.1, 50 and 100 MPa). The aim was to disclose similarities and differences between the deep- and shallow-sea protein models at different temperatures and pressures. The current results demonstrate that the 3D models of the two proteins at all the examined values of pressures and temperatures are compact, stable and similar to the known crystal structure of the P. abyssi Nip7. The structural deviations and fluctuations in the polypeptide chain during the MD simulations were the most pronounced in the loop regions, their magnitude being larger for the C-terminal domain in both proteins. A number of highly mobile segments the protein globule presumably involved in protein-protein interactions were identified. Regions of the polypeptide chain with significant difference in conformational dynamics between the deep- and shallow-water proteins were identified. The results of our analysis demonstrated that in the examined ranges of temperatures and pressures, increase in temperature has a stronger effect on change in the dynamic properties of the protein globule than the increase in pressure. The conformational changes of both the deep- and shallow-sea protein models under increasing temperature and pressure are non-uniform. Our current results indicate that amino acid substitutions between shallow- and deep-water proteins only slightly affect overall stability of two proteins. Rather, they may affect the interactions of the Nip7 protein with its protein or RNA partners.

A novel signal transduction protein: Combination of solute binding and tandem PAS-like sensor domains in one polypeptide chain: Periplasmic Ligand Binding Protein Dret_0059

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, R.; Wilton, R.; Cuff, M. E.

We report the structural and biochemical characterization of a novel periplasmic ligand-binding protein, Dret_0059, from Desulfohalobium retbaense DSM 5692, an organism isolated from the Salt Lake Retba in Senegal. The structure of the protein consists of a unique combination of a periplasmic solute binding protein (SBP) domain at the N-terminal and a tandem PAS-like sensor domain at the C-terminal region. SBP domains are found ubiquitously and their best known function is in solute transport across membranes. PAS-like sensor domains are commonly found in signal transduction proteins. These domains are widely observed as parts of many protein architectures and complexes butmore » have not been observed previously within the same polypeptide chain. In the structure of Dret_0059, a ketoleucine moiety is bound to the SBP, whereas a cytosine molecule is bound in the distal PAS-like domain of the tandem PAS-like domain. Differential scanning flourimetry support the binding of ligands observed in the crystal structure. There is significant interaction between the SBP and tandem PAS-like domains, and it is possible that the binding of one ligand could have an effect on the binding of the other. We uncovered three other proteins with this structural architecture in the non-redundant sequence data base, and predict that they too bind the same substrates. The genomic context of this protein did not offer any clues for its function. We did not find any biological process in which the two observed ligands are coupled. The protein Dret_0059 could be involved in either signal transduction or solute transport.« less

Two-dimensional sup 1 H nuclear magnetic resonance study of AaH IT, an anti-insect toxin from the scorpion Androctonus australis Hector. Sequential resonance assignments and folding of the polypeptide chain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Darbon, H.; Weber, C.; Braun, W.

1991-02-19

Sequence-specific nuclear magnetic resonance assignments for the polypeptide backbone and for most of the amino acid side-chain protons, as well as the general folding of AaH IT, are described. AaH IT is a neurotoxin purified from the venom of the scorpion Androctonus australis Hector and is specifically active on the insect nervous system. The secondary structure and the hydrogen-bonding patterns in the regular secondary structure elements are deduced from nuclear Overhauser effects and the sequence locations of the slowly exchanging amide protons. The backbone folding is determined by distance geometry calculations with the DISMAN program. The regular secondary structure includesmore » two and a half turns of {alpha}-helix running from residues 21 to 30 and a three-stranded antiparallel {beta}-sheet including peptides 3-5, 34-38, and 41-46. Two tight turns are present, one connecting the end of the {alpha}-helix to an external strand of the {beta}-sheet, i.e., turn 31-34, and another connecting this same strand to the central one, i.e., turn 38-41. The differences in the specificity of these related proteins, which are able to discriminate between mammalian and insect voltage-dependent sodium channels of excitable tissues, are most probably brought about by the position of the C-terminal peptide with regard to a hydrophobic surface common to all scorpion toxins examined thus far. Thus, the interaction of a given scorpion toxin with its receptor might well be governed by the presence of this solvent-exposed hydrophobic surface, whereas adjacent areas modulate the specificity of the interaction.« less

A novel signal transduction protein: Combination of solute binding and tandem PAS-like sensor domains in one polypeptide chain.

PubMed

Wu, R; Wilton, R; Cuff, M E; Endres, M; Babnigg, G; Edirisinghe, J N; Henry, C S; Joachimiak, A; Schiffer, M; Pokkuluri, P R

2017-04-01

We report the structural and biochemical characterization of a novel periplasmic ligand-binding protein, Dret_0059, from Desulfohalobium retbaense DSM 5692, an organism isolated from Lake Retba, in Senegal. The structure of the protein consists of a unique combination of a periplasmic solute binding protein (SBP) domain at the N-terminal and a tandem PAS-like sensor domain at the C-terminal region. SBP domains are found ubiquitously, and their best known function is in solute transport across membranes. PAS-like sensor domains are commonly found in signal transduction proteins. These domains are widely observed as parts of many protein architectures and complexes but have not been observed previously within the same polypeptide chain. In the structure of Dret_0059, a ketoleucine moiety is bound to the SBP, whereas a cytosine molecule is bound in the distal PAS-like domain of the tandem PAS-like domain. Differential scanning flourimetry support the binding of ligands observed in the crystal structure. There is significant interaction between the SBP and tandem PAS-like domains, and it is possible that the binding of one ligand could have an effect on the binding of the other. We uncovered three other proteins with this structural architecture in the non-redundant sequence data base, and predict that they too bind the same substrates. The genomic context of this protein did not offer any clues for its function. We did not find any biological process in which the two observed ligands are coupled. The protein Dret_0059 could be involved in either signal transduction or solute transport. © 2017 The Protein Society.

MS_RHII-RSD, a Dual-Function RNase HII-(p)ppGpp Synthetase from Mycobacterium smegmatis

PubMed Central

Murdeshwar, Maya S.

2012-01-01

In the noninfectious soil saprophyte Mycobacterium smegmatis, intracellular levels of the stress alarmones guanosine tetraphosphate and guanosine pentaphosphate, together termed (p)ppGpp, are regulated by the enzyme RelMsm. This enzyme consists of a single, bifunctional polypeptide chain that is capable of both synthesizing and hydrolyzing (p)ppGpp. The relMsm knockout strain of M. smegmatis (ΔrelMsm) is expected to show a (p)ppGpp null [(p)ppGpp0] phenotype. Contrary to this expectation, the strain is capable of synthesizing (p)ppGpp in vivo. In this study, we identify and functionally characterize the open reading frame (ORF), MSMEG_5849, that encodes a second functional (p)ppGpp synthetase in M. smegmatis. In addition to (p)ppGpp synthesis, the 567-amino-acid-long protein encoded by this gene is capable of hydrolyzing RNA·DNA hybrids and bears similarity to the conventional RNase HII enzymes. We have classified this protein as actRelMsm in accordance with the recent nomenclature proposed and have named it MS_RHII-RSD, indicating the two enzymatic activities present [RHII, RNase HII domain, originally identified as domain of unknown function 429 (DUF429), and RSD, RelA_SpoT nucleotidyl transferase domain, the SYNTH domain responsible for (p)ppGpp synthesis activity]. MS_RHII-RSD is expressed and is constitutively active in vivo and behaves like a monofunctional (p)ppGpp synthetase in vitro. The occurrence of the RNase HII and (p)ppGpp synthetase domains together on the same polypeptide chain is suggestive of an in vivo role for this novel protein as a link connecting the essential life processes of DNA replication, repair, and transcription to the highly conserved stress survival pathway, the stringent response. PMID:22636779

MS_RHII-RSD, a dual-function RNase HII-(p)ppGpp synthetase from Mycobacterium smegmatis.

PubMed

Murdeshwar, Maya S; Chatterji, Dipankar

2012-08-01

In the noninfectious soil saprophyte Mycobacterium smegmatis, intracellular levels of the stress alarmones guanosine tetraphosphate and guanosine pentaphosphate, together termed (p)ppGpp, are regulated by the enzyme Rel(Msm). This enzyme consists of a single, bifunctional polypeptide chain that is capable of both synthesizing and hydrolyzing (p)ppGpp. The rel(Msm) knockout strain of M. smegmatis (Δrel(Msm)) is expected to show a (p)ppGpp null [(p)ppGpp(0)] phenotype. Contrary to this expectation, the strain is capable of synthesizing (p)ppGpp in vivo. In this study, we identify and functionally characterize the open reading frame (ORF), MSMEG_5849, that encodes a second functional (p)ppGpp synthetase in M. smegmatis. In addition to (p)ppGpp synthesis, the 567-amino-acid-long protein encoded by this gene is capable of hydrolyzing RNA·DNA hybrids and bears similarity to the conventional RNase HII enzymes. We have classified this protein as actRel(Msm) in accordance with the recent nomenclature proposed and have named it MS_RHII-RSD, indicating the two enzymatic activities present [RHII, RNase HII domain, originally identified as domain of unknown function 429 (DUF429), and RSD, RelA_SpoT nucleotidyl transferase domain, the SYNTH domain responsible for (p)ppGpp synthesis activity]. MS_RHII-RSD is expressed and is constitutively active in vivo and behaves like a monofunctional (p)ppGpp synthetase in vitro. The occurrence of the RNase HII and (p)ppGpp synthetase domains together on the same polypeptide chain is suggestive of an in vivo role for this novel protein as a link connecting the essential life processes of DNA replication, repair, and transcription to the highly conserved stress survival pathway, the stringent response.

Nascent chain-monitored remodeling of the Sec machinery for salinity adaptation of marine bacteria

PubMed Central

Ishii, Eiji; Chiba, Shinobu; Hashimoto, Narimasa; Kojima, Seiji; Homma, Michio; Ito, Koreaki; Akiyama, Yoshinori; Mori, Hiroyuki

2015-01-01

SecDF interacts with the SecYEG translocon in bacteria and enhances protein export in a proton-motive-force-dependent manner. Vibrio alginolyticus, a marine-estuarine bacterium, contains two SecDF paralogs, V.SecDF1 and V.SecDF2. Here, we show that the export-enhancing function of V.SecDF1 requires Na+ instead of H+, whereas V.SecDF2 is Na+-independent, presumably requiring H+. In accord with the cation-preference difference, V.SecDF2 was only expressed under limited Na+ concentrations whereas V.SecDF1 was constitutive. However, it is not the decreased concentration of Na+ per se that the bacterium senses to up-regulate the V.SecDF2 expression, because marked up-regulation of the V.SecDF2 synthesis was observed irrespective of Na+ concentrations under certain genetic/physiological conditions: (i) when the secDF1VA gene was deleted and (ii) whenever the Sec export machinery was inhibited. VemP (Vibrio export monitoring polypeptide), a secretory polypeptide encoded by the upstream ORF of secDF2VA, plays the primary role in this regulation by undergoing regulated translational elongation arrest, which leads to unfolding of the Shine–Dalgarno sequence for translation of secDF2VA. Genetic analysis of V. alginolyticus established that the VemP-mediated regulation of SecDF2 is essential for the survival of this marine bacterium in low-salinity environments. These results reveal that a class of marine bacteria exploits nascent-chain ribosome interactions to optimize their protein export pathways to propagate efficiently under different ionic environments that they face in their life cycles. PMID:26392525

A novel signal transduction protein: Combination of solute binding and tandem PAS-like sensor domains in one polypeptide chain

DOE PAGES

Wu, R.; Wilton, R.; Cuff, M. E.; ...

2017-02-07

The tandem Per-Arnt-Sim (PAS) like sensors are commonly found in signal transduction proteins. The periplasmic solute binding protein (SBP) domains are found ubiquitously and are generally involved in solute transport. These domains are widely observed as parts of separate proteins but not within the same polypeptide chain. We report the structural and biochemical characterization of the extracellular ligand-binding receptor, Dret_0059 from Desulfohalobium retbaense DSM 5692, an organism isolated from the Retba salt lake in Senegal. The structure of Dret_0059 consists of a novel combination of SBP and TPAS sensor domains. The N-terminal region forms an SBP domain and the C-terminalmore » region folds into a tandem PAS-like domain structure. A ketoleucine moiety is bound to the SBP, whereas a cytosine molecule is bound in the distal PAS domain of the TPAS. The differential scanning flourimetry studies in solution support the ligands observed in the crystal structure. There are only two other proteins with this structural architecture in the non-redundant sequence data base and we predict that they too bind the same substrates. There is significant interaction between the SBP and TPAS domains, and it is quite conceivable that the binding of one ligand will have an effect on the binding of the other. Our attempts to remove the ligands bound to the protein during expression were not successful, therefore, it is not clear what the relative affects are. The genomic context of this receptor does not contain any protein components expected for transport function, hence, we suggest that Dret_0059 is likely involved in signal transduction and not in solute transport.« less

Twisted supersymmetry: Twisted symmetry versus renormalizability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dimitrijevic, Marija; Nikolic, Biljana; Radovanovic, Voja

We discuss a deformation of superspace based on a Hermitian twist. The twist implies a *-product that is noncommutative, Hermitian and finite when expanded in a power series of the deformation parameter. The Leibniz rule for the twisted supersymmetry transformations is deformed. A minimal deformation of the Wess-Zumino action is proposed and its renormalizability properties are discussed. There is no tadpole contribution, but the two-point function diverges. We speculate that the deformed Leibniz rule, or more generally the twisted symmetry, interferes with renormalizability properties of the model. We discuss different possibilities to render a renormalizable model.

Twist limits for late twisting double somersaults on trampoline.

PubMed

Yeadon, M R; Hiley, M J

2017-06-14

An angle-driven computer simulation model of aerial movement was used to determine the maximum amount of twist that could be produced in the second somersault of a double somersault on trampoline using asymmetrical movements of the arms and hips. Lower bounds were placed on the durations of arm and hip angle changes based on performances of a world trampoline champion whose inertia parameters were used in the simulations. The limiting movements were identified as the largest possible odd number of half twists for forward somersaulting takeoffs and even number of half twists for backward takeoffs. Simulations of these two limiting movements were found using simulated annealing optimisation to produce the required amounts of somersault, tilt and twist at landing after a flight time of 2.0s. Additional optimisations were then run to seek solutions with the arms less adducted during the twisting phase. It was found that 3½ twists could be produced in the second somersault of a forward piked double somersault with arms abducted 8° from full adduction during the twisting phase and that three twists could be produced in the second somersault of a backward straight double somersault with arms fully adducted to the body. These two movements are at the limits of performance for elite trampolinists. Copyright © 2017 Elsevier Ltd. All rights reserved.

Template-dependent polypeptide synthesis in a factor- and energy-free translation system promoted by pyridine.

PubMed

Nitta, I; Ueda, T; Nojima, T; Watanabe, K

1995-10-01

We demonstrate here that a high concentration (40-70%) of pyridine, an aromatic tertiary amine catalyst, is able to promote translation on ribosomes without the presence of soluble protein factors or chemical energy sources. Compared with Monro's fragment reaction [Methods Enzymol. 20, 472-481 (1971)] which reflects only the peptidyltransferase step, this novel translation system can produce polypeptides with chain lengths of at least several tens of residues depending on the template RNA. In the presence of 60% pyridine, poly(U) and poly(UC) promoted incorporation of the respective amino acids, phenylalanine and serine-leucine, twofold, whereas poly(A) promoted the incorporation of lysine by only 25%. The degrees of polymerization of phenylalanine and lysine were up to the decamer and around 40mer, respectively. In poly(UC)-dependent oligo(serine-leucine) synthesis, oligopeptides with a serine and leucine alternate sequence were the main products. This novel pyridine system evidently differs from the non-enzymatic translation system reported by Gavrilova and Spirin [FEBS Lett. 17, 324-326 (1971)]; the former system displays partial resistance toward deproteinization reagents such as SDS and proteinase K, whereas the latter system is completely sensitive.

The nuclear protein PH5P of the inter-alpha-inhibitor superfamily: a missing link between poly(ADP-ribose)polymerase and the inter-alpha-inhibitor family and a novel actor of DNA repair?

PubMed

Jean, L; Risler, J L; Nagase, T; Coulouarn, C; Nomura, N; Salier, J P

1999-03-05

Poly(ADP-ribose)polymerase is a nuclear NAD-dependent enzyme and an essential nick sensor involved in cellular processes where nicking and rejoining of DNA strands are required. The inter-alpha-inhibitor family is comprized of several plasma proteins that all harbor one or more so-called heavy chains designated H1-H4. The latter originate from precursor polypeptides H1P-H4P whose upper two thirds are highly homologous. We now describe a novel protein that includes (i) a so-called BRCT domain found in many proteins involved in DNA repair, (ii) an area that is homologous to the NAD-dependent catalytic domain of poly(ADP-ribose)polymerase, (iii) an area that is homologous to the upper two thirds of precursor polypeptides H1P-H4P and (iv) a proline-rich region with a potential nuclear localization signal. This protein now designated PH5P points to as yet unsuspected links between poly(ADP-ribose)polymerase and the inter-alpha-inhibitor family and is likely to be involved in DNA repair.

Expression of pituitary adenylate cyclase-activating polypeptide 1 and 2 receptor mRNA in gallbladder tissue of patients with gallstone or gallbladder polyps.

PubMed

Zhang, Zhen-Hai; Wu, Shuo-Dong; Gao, Hong; Shi, Gang; Jin, Jun-Zhe; Kong, Jing; Tian, Zhong; Su, Yang

2006-03-07

To detect the expression of pituitary adenylate cyclase-activating polypeptide receptor 1 (VPCAP1-R)and VPCAP2-R mRNA in gallbladder tissues of patients with gallstone or gallbladder polyps. The expression of VPCAP1-R and VPCAP2-R mRNA in gallbladder tissues was detected in 25 patients with gallstone,8 patients with gallbladder polyps and 7 donors of liver transplantation by reverse transcription polymerase chain reaction (RT-PCR). The VPCAP2-R mRNA expression level in the control group (1.09+/-0.58) was lower than that in the gallbladder polyp group (1.64+/-0.56) and the gallstone group (1.55+/-0.45) (P<0.05) while the VPCAP1-R mRNA expression level in the control group (1.15+/-0.23) was not apparently different from that in the gallbladder polyp group (1.28+/-0.56) and the gallstone group (1.27+/-0.38). The abnormal expression of VPCAP2-R mRNA in gallbladder tissue may play a role in the formation of gallbladder stone and gallbladder polyps.

Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

PubMed

Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

2014-06-01

Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

Proteostasis: bad news and good news from the endoplasmic reticulum.

PubMed

Noack, Julia; Brambilla Pisoni, Giorgia; Molinari, Maurizio

2014-01-01

The endoplasmic reticulum (ER) is an intracellular compartment dedicated to the synthesis and maturation of secretory and membrane proteins, totalling about 30% of the total eukaryotic cells proteome. The capacity to produce correctly folded polypeptides and to transport them to their correct intra- or extracellular destinations relies on proteostasis networks that regulate and balance the activity of protein folding, quality control, transport and degradation machineries. Nutrient and environmental changes, pathogen infection aging and, more relevant for the topics discussed in this review, mutations that impair attainment of the correct 3D structure of nascent polypeptide chains may compromise the activity of the proteostasis networks with devastating consequences on cells, organs and organisms' homeostasis. Here we present a review of mechanisms regulating folding and quality control of proteins expressed in the ER, and we describe the protein degradation and the ER stress pathways activated by the expression of misfolded proteins in the ER lumen. Finally, we highlight select examples of proteopathies (also known as conformational disorders or protein misfolding diseases) caused by protein misfolding in the ER and/or affecting cellular proteostasis and therapeutic interventions that might alleviate or cure the disease symptoms.

Characterization of a novel isoform of alpha-nascent polypeptide-associated complex as IgE-defined autoantigen.

PubMed

Mossabeb, Roschanak; Seiberler, Susanne; Mittermann, Irene; Reininger, Renate; Spitzauer, Susanne; Natter, Susanne; Verdino, Petra; Keller, Walter; Kraft, Dietrich; Valenta, Rudolf

2002-10-01

The nascent polypeptide-associated complex is required for intracellular translocation of newly synthesized polypeptides in eukaryotic cells. It may also act as a transcriptional coactivator in humans and various eukaryotic organisms and binds to nucleic acids. Recently, we provided evidence that a component of nascent polypeptide-associated complex, alpha-nascent polypeptide-associated complex, represents an IgE-reactive autoantigen for atopic dermatitis patients. By oligonucleotide screening we isolated a complete cDNA coding for a so far unknown alpha-nascent polypeptide-associated complex isoform from a human epithelial cDNA library. Southern blot hybridization experiments provided further evidence that alpha-nascent polypeptide-associated complex is encoded by a gene family. Recombinant alpha-nascent polypeptide-associated complex was expressed in Escherichia coli as a soluble, His-tagged protein, and purified via nickel affinity chromatography. By circular dichroism analysis it is demonstrated that purified recombinant alpha-nascent polypeptide-associated complex represents a folded protein of mixed alpha-helical and beta-sheet conformation with unusual high thermal stability and remarkable refolding capacity. Complete recombinant alpha-nascent polypeptide-associated complex (215 amino acids) and its 86 amino acid C-terminal fragment specifically bound IgE autoantibodies. Recombinant alpha-nascent polypeptide-associated complex also inhibited IgE binding to natural alpha-nascent polypeptide-associated complex, demonstrating the presence of common IgE epitopes between the recombinant and natural protein. Furthermore, recombinant alpha-nascent polypeptide-associated complex induced specific lymphoproliferative responses in peripheral blood mononuclear cells of a sensitized atopic dermatitis patient. As has been proposed for environmental allergens it is possible that T cell responses to IgE-defined autoantigens may contribute to the chronic skin manifestations in atopic dermatitis.

Polypeptides having catalase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Duan, Junxin; Zhang, Yu

Provided are isolated polypeptides having catalase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na

Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less

TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis

PubMed Central

Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.

2017-01-01

TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075

Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

PubMed Central

Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

2012-01-01

KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

Transverse kink oscillations in the presence of twist

NASA Astrophysics Data System (ADS)

Terradas, J.; Goossens, M.

2012-12-01

Context. Magnetic twist is thought to play an important role in coronal loops. The effects of magnetic twist on stable magnetohydrodynamic (MHD) waves is poorly understood because they are seldom studied for relevant cases. Aims: The goal of this work is to study the fingerprints of magnetic twist on stable transverse kink oscillations. Methods: We numerically calculated the eigenmodes of propagating and standing MHD waves for a model of a loop with magnetic twist. The azimuthal component of the magnetic field was assumed to be small in comparison to the longitudinal component. We did not consider resonantly damped modes or kink instabilities in our analysis. Results: For a nonconstant twist the frequencies of the MHD wave modes are split, which has important consequences for standing waves. This is different from the degenerated situation for equilibrium models with constant twist, which are characterised by an azimuthal component of the magnetic field that linearly increases with the radial coordinate. Conclusions: In the presence of twist standing kink solutions are characterised by a change in polarisation of the transverse displacement along the tube. For weak twist, and in the thin tube approximation, the frequency of standing modes is unaltered and the tube oscillates at the kink speed of the corresponding straight tube. The change in polarisation is linearly proportional to the degree of twist. This has implications with regard to observations of kink modes, since the detection of this variation in polarisation can be used as an indirect method to estimate the twist in oscillating loops.

Modeling and control of active twist aircraft

NASA Astrophysics Data System (ADS)

Cramer, Nicholas Bryan

The Wright Brothers marked the beginning of powered flight in 1903 using an active twist mechanism as their means of controlling roll. As time passed due to advances in other technologies that transformed aviation the active twist mechanism was no longer used. With the recent advances in material science and manufacturability, the possibility of the practical use of active twist technologies has emerged. In this dissertation, the advantages and disadvantages of active twist techniques are investigated through the development of an aeroelastic modeling method intended for informing the designs of such technologies and wind tunnel testing to confirm the capabilities of the active twist technologies and validate the model. Control principles for the enabling structural technologies are also proposed while the potential gains of dynamic, active twist are analyzed.

Secretion of pancreatic polypeptide in patients with pancreatic endocrine tumors.

PubMed

Adrian, T E; Uttenthal, L O; Williams, S J; Bloom, S R

1986-07-31

Pancreatic polypeptide is often secreted by pancreatic endocrine tumors and is considered a marker for such tumors. To investigate the diagnostic value of this marker, we studied 323 patients with proved pancreatic endocrine tumors. We found plasma concentrations of pancreatic polypeptide to be elevated (more than 300 pmol per liter) in 144 patients (diagnostic sensitivity, 45 percent). However, plasma levels of pancreatic polypeptide can also be elevated in the absence of a pancreatic tumor. To ascertain whether the administration of atropine could distinguish between normal and tumor-associated polypeptide secretion, we studied 30 patients with pancreatic tumors and high plasma levels of pancreatic polypeptide, 18 patients without tumors who had elevated levels of pancreatic polypeptide, and eight normal controls. Polypeptide levels in the 18 patients without tumors were substantially lower than in the 30 patients with tumors. Atropine (1 mg intramuscularly) did not suppress polypeptide levels in patients with tumors, but did suppress plasma levels by more than 50 percent in all subjects without tumors. Thus, although its diagnostic sensitivity is low, pancreatic polypeptide appears to be a useful adjunctive marker of many pancreatic endocrine tumors, and the atropine suppression test can be used to distinguish normal from tumor-related secretion of the polypeptide. Identification of the type of pancreatic endocrine tumor still requires measurement of the hormone that is specific for the tumor.

Evaluation of an Epigenetic Profile for the Detection of Bladder Cancer in Patients with Hematuria.

PubMed

van Kessel, Kim E M; Van Neste, Leander; Lurkin, Irene; Zwarthoff, Ellen C; Van Criekinge, Wim

2016-03-01

Many patients enter the care cycle with gross or microscopic hematuria and undergo cystoscopy to rule out bladder cancer. Sensitivity of this invasive examination is limited, leaving many patients at risk for undetected cancer. To improve current clinical practice more sensitive and noninvasive screening methods should be applied. A total of 154 urine samples were collected from patients with hematuria, including 80 without and 74 with bladder cancer. DNA from cells in the urine was epigenetically profiled using 2 independent assays. Methylation specific polymerase chain reaction was performed on TWIST1. SNaPshot™ methylation analysis was done for different loci of OTX1 and ONECUT2. Additionally all samples were analyzed for mutation status of TERT (telomerase reverse transcriptase), PIK3CA, FGFR3 (fibroblast growth factor receptor 3), HRAS, KRAS and NRAS. The combination of TWIST1, ONECUT2 (2 loci) and OTX1 resulted in the best overall performing panel. Logistic regression analysis on these methylation markers, mutation status of FGFR3, TERT and HRAS, and patient age resulted in an accurate model with 97% sensitivity, 83% specificity and an AUC of 0.93 (95% CI 0.88-0.98). Internal validation led to an optimism corrected AUC of 0.92. With an estimated bladder cancer prevalence of 5% to 10% in a hematuria cohort the assay resulted in a 99.6% to 99.9% negative predictive value. Epigenetic profiling using TWIST1, ONECUT2 and OTX1 results in a high sensitivity and specificity. Accurate risk prediction might result in less extensive and invasive examination of patients at low risk, thereby reducing unnecessary patient burden and health care costs. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Anterior segment dysgenesis correlation with epithelial-mesenchymal transition in Smad4 knockout mice.

PubMed

Li, Jing; Qin, Yu; Zhao, Fang-Kun; Wu, Di; He, Xue-Fei; Liu, Jia; Zhao, Jiang-Yue; Zhang, Jin-Song

2016-01-01

To explore the molecular mechanisms in lens development and the pathogenesis of Peters anomaly in Smad4 defective mice. Le-Cre transgenic mouse line was employed to inactivate Smad4 in the surface ectoderm selectively. Pathological techniques were used to reveal the morphological changes of the anterior segment in Smad4 defective eye. Immunohistochemical staining was employed to observe the expression of E-cadherin, N-cadherin and α-SMA in anterior segment of Smad4 defective mice and control mice at embryonic (E) day 16.5. Real-time quantitative polymerase chain reaction (qPCR) was performed to detect the expression of Snail, Zeb1, Zeb2 and Twist2 in lens of Smad4 defective mice and control mice at E16.5. Statistical evaluations were performed using the unpaired Student's t-test (two-tailed) by SPSS 11.0 software. Conditional deletion of Smad4 on eye surface ectoderm resulted in corneal dysplasia, iridocorneal angle closure, corneolenticular adhesions and cataract resembling Peters anomaly. Loss of Smad4 function inhibited E-cadherin expression in the lens epithelium cells and corneal epithelium cells in Smad4 defective eye. Expression of N-cadherin was up-regulated in corneal epithelium and corneal stroma. Both E-cadherin and N-cadherin were down-regulated at the future trabecular meshwork region in mutant eye. The qPCR results showed that the expression of Twist2 was increased significantly in the mutant lens (P<0.01). Smad4 is essential to eye development and likely a candidate pathogenic gene to Peters anomaly by regulating epithelial-mesenchymal transition. Twist2 can be regulated by Smad4 and plays an essential role in lens development.

Molecular structure of self-assembled chiral nanoribbons and nanotubules revealed in the hydrated state.

PubMed

Oda, Reiko; Artzner, Franck; Laguerre, Michel; Huc, Ivan

2008-11-05

A detailed molecular organization of racemic 16-2-16 tartrate self-assembled multi-bilayer ribbons in the hydrated state is proposed where 16-2-16 amphiphiles, tartrate ions, and water molecules are all accurately positioned by comparing experimental X-ray powder diffraction and diffraction patterns derived from modeling studies. X-ray diffuse scattering studies show that molecular organization is not fundamentally altered when comparing the flat ribbons of the racemate to chirally twisted or helical ribbons of the pure tartrate enantiomer. Essential features of the three-dimensional molecular organizations of these structures include interdigitation of alkyl chains within each bilayer and well-defined networks of ionic and hydrogen bonds between cations, anions, and water molecules between bilayers. The detailed study of diffraction patterns also indicated that the gemini headgroups are oriented parallel to the long edge of the ribbons. The structure thus possesses a high cohesion and good crystallinity, and for the first time, we could relate the packing of the chiral molecules to the expression of the chirality at a mesoscopic scale. The organization of the ribbons at the molecular level sheds light on a number of their macroscopic features. Among these are the reason why enantiomerically pure 16-2-16 tartrate forms ribbons that consist of exactly two bilayers, and a plausible mechanism by which a chirally twisted or helical shape may emerge from the packing of chiral tartrate ions. Importantly, the distinction between commonly observed helical and twisted morphologies could be related to a subtle symmetry breaking. These results demonstrate that accurately solving the molecular structure of self-assembled soft materials--a process rarely achieved--is within reach, that it is a valid approach to correlate molecular parameters to macroscopic properties, and thus that it offers opportunities to modulate properties through molecular design.

Association between Twist and multidrug resistance gene-associated proteins in Taxol®-resistant MCF-7 cells and a 293 cell model of Twist overexpression.

PubMed

Wang, Li; Tan, Rui-Zhi; Zhang, Zhi-Xia; Yin, Rui; Zhang, Yong-Liang; Cui, Wei-Jia; He, Tao

2018-01-01

Multidrug resistance (MDR) severely limits the effectiveness of chemotherapy. Previous studies have identified Twist as a key factor of acquired MDR in breast, gastric and prostate cancer. However, the underlying mechanisms of action of Twist in MDR remain unclear. In the present study, the expression levels of MDR-associated proteins, including lung resistance-related protein (LRP), topoisomerase IIα (TOPO IIα), MDR-associated protein (MRP) and P-glycoprotein (P-gp), and the expression of Twist in cancerous tissues and pericancerous tissues of human breast cancer, were examined. In order to simulate Taxol ® resistance in cells, a Taxol ® -resistant human mammary adenocarcinoma cell subline (MCF-7/Taxol ® ) was established by repeatedly exposing MCF-7 cells to high concentrations of Taxol ® (up to 15 µg/ml). Twist was also overexpressed in 293 cells by transfecting this cell line with pcDNA5/FRT/TO vector containing full-length hTwist cDNA to explore the dynamic association between Twist and MDR gene-associated proteins. It was identified that the expression levels of Twist, TOPO IIα, MRP and P-gp were upregulated and LRP was downregulated in human breast cancer tissues, which was consistent with the expression of these proteins in the Taxol ® -resistant MCF-7 cell model. Notably, the overexpression of Twist in 293 cells increased the resistance to Taxol ® , Trichostatin A and 5-fluorouracil, and also upregulated the expression of MRP and P-gp. Taken together, these data demonstrated that Twist may promote drug resistance in cells and cancer tissues through regulating the expression of MDR gene-associated proteins, which may assist in understanding the mechanisms of action of Twist in drug resistance.

Cerclage handling for improved fracture treatment. A biomechanical study on the twisting procedure.

PubMed

Wähnert, D; Lenz, M; Schlegel, U; Perren, S; Windolf, M

2011-01-01

Twisting is clinically the most frequently applied method for tightening and maintaining cerclage fixation. The twisting procedure is controversially discussed. Several factors during twisting affect the mechanical behaviour of the cerclage. This in vitro study investigated the influence of different parameters of the twisting procedure on the fixation strength of the cerclage in an experimental setup with centripetal force application. Cortical half shells of the femoral shaft were mounted on a testing fixture. 1.0 mm, 1.25 mm and 1.5 mm stainless ste- el wire cerclages as well as a 1.0mm cable cerclage were applied to the bone. Pretension of the cerclage during the installation was measured during the locking procedure. Subsequently, cyclic testing was performed up to failure. Higher pretension could be achieved with increasing wire diameter. However, with larger wire diameter the drop of pre- tension due to the bending and cutting the twist also increased. The cable cerclage showed the highest pretension after locking. Cerclages twisted under traction revealed significantly higher initial cerclage tension. Plastically deformed twists offered higher cerclage pretension compared to twists which were deformed in the elastic region of the material. Cutting the wire within the twist caused the highest loss of cerclage tension (44% initial tension) whereas only 11 % was lost when cutting the wire ends separately. The bending direction of the twist significantly influenced the cerclage pretension. 45% pretension was lost in forward bending of the twist, 53% in perpendicular bending and 90% in backward bending. Several parameters affect the quality of a cerclage fixation. Adequate installation of cerclage wires could markedly improve the clinical outcome of cerclage.

Polypeptides having beta-glucosidase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Duan, Junxin; Zhang, Yu

Provided are isolated polypeptides having beta-glucosidase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yu; Liu, Ye; Duan, Junxin

Provided are isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having beta-xylosidase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Tang, Lan; Zhang, Yu

Provided are isolated polypeptides having beta-xylosidase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Hybrid polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Liu, Ye; Shaghasi, Tarana

2016-11-01

The present invention provides hybrid polypeptides having cellobiohydrolase activity. The present invention also provides polynucleotides encoding the hybrid polypeptides; nucleic acid constructs, vectors and host cells comprising the polynucleotides; and processes of using the hybrid polypeptides.

Combinatorial discovery of enzymes with utility in biomass transformation

DOEpatents

Fox, Brian G; Elsen, Nathaniel L

2015-02-03

Methods for the cell-free identification of polypeptide and polypeptide combinations with utility in biomass transformation, as well as specific novel polypeptides and cell-free systems containing polypeptide combinations discovered by such methods are disclosed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Shyy Woei; Yang, Tsun Lirng; Liou, Jin Shuen

An experimental study measuring the axial heat transfer distributions and the pressure drop coefficients of the tube fitted with a broken twisted tape of twist ratio 1, 1.5, 2, 2.5 or {infinity} is performed in the Re range of 1000-40,000. This type of broken twisted tape is newly invented without previous investigations available. Local Nusselt numbers and mean Fanning friction factors in the tube fitted with the broken twisted tape increase as the twist ratio decreases. Heat transfer coefficients, mean Fanning friction factors and thermal performance factors in the tube fitted with the broken twisted tape are, respectively, augmented tomore » 1.28-2.4, 2-4.7 and 0.99-1.8 times of those in the tube fitted with the smooth twisted tape. Empirical heat transfer and pressure drop correlations which evaluate the local Nusselt number and the mean Fanning friction factor for the tube with the broken twisted tape insert are generated to assist the industrial applications. (author)« less

Conical twist fields and null polygonal Wilson loops

NASA Astrophysics Data System (ADS)

Castro-Alvaredo, Olalla A.; Doyon, Benjamin; Fioravanti, Davide

2018-06-01

Using an extension of the concept of twist field in QFT to space-time (external) symmetries, we study conical twist fields in two-dimensional integrable QFT. These create conical singularities of arbitrary excess angle. We show that, upon appropriate identification between the excess angle and the number of sheets, they have the same conformal dimension as branch-point twist fields commonly used to represent partition functions on Riemann surfaces, and that both fields have closely related form factors. However, we show that conical twist fields are truly different from branch-point twist fields. They generate different operator product expansions (short distance expansions) and form factor expansions (large distance expansions). In fact, we verify in free field theories, by re-summing form factors, that the conical twist fields operator product expansions are correctly reproduced. We propose that conical twist fields are the correct fields in order to understand null polygonal Wilson loops/gluon scattering amplitudes of planar maximally supersymmetric Yang-Mills theory.

The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis.

PubMed

Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

2011-02-01

The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis.

In Silico Measurements of Twist and Bend Moduli for β-Solenoid Protein Self-Assembly Units.

PubMed

Heinz, Leonard P; Ravikumar, Krishnakumar M; Cox, Daniel L

2015-05-13

We compute potentials of mean force for bend and twist deformations via force pulling and umbrella sampling experiments for four β-solenoid proteins (BSPs) that show promise in nanotechnology applications. In all cases, we find quasi-Hooke's law behavior until the point of rupture. Bending moduli show modest anisotropy for two-sided and three-sided BSPs, and little anisotropy for a four-sided BSP. There is a slight clockwise/counterclockwise asymmetry in the twist potential of mean force, showing greater stiffness when the applied twist follows the intrinsic twist. When we extrapolate to beam theory appropriate for amyloid fibrils of the BSPs, we find bend/twist moduli which are somewhat smaller than those in the literature for other amyloid fibrils. Twist persistence lengths are on the order of a micron, and bend persistence lengths are several microns. Provided the intrinsic twist can be reversed, these results support the usage of BSPs in biomaterials applications.

Hybrid polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Shaghasi, Tarana

The present invention relates to hybrid polypeptides having cellobiohydrolase activity. The present invention also relates to polynucleotides encoding the hybrid polypeptides; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and processes of using the hybrid polypeptides.

Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

DOEpatents

Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

2015-06-09

Provided are isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Liu, Ye; Duan, Junxin; Tang, Lan

2015-09-22

The present invention provides isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cell comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

DOEpatents

Liu, Ye; Tang, Lan; Duan, Junxin

2015-12-15

The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Isolation of Polypeptide Sample and Measurement of Its Concentration.

ERIC Educational Resources Information Center

Beanan, Maureen J.

2000-01-01

Introduces a laboratory experiment that isolates a bacterial polypeptide sample and measures the concentration of polypeptides in the sample. Uses Escherichia coli strain MM294 and performs a bio-rad assay to determine the concentration of polypeptides. (YDS)

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Liu, Ye; Tang, Lan

2015-07-14

The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Web life: Foldit

NASA Astrophysics Data System (ADS)

2009-07-01

So what is the site about? Like the popular SETI@home program, which uses the downtime of home computers to sift radio-telescope data for evidence of alien life, Foldit draws on the idle hours of several thousand data-crunchers for help in solving scientific puzzles. But there is a twist. For a start, Foldit is all about biophysics. The project's goal is to understand how proteins - the chains of amino acids that drive processes inside living cells - fold themselves into a myriad of different shapes. But the most striking difference is that Foldit's protein-folding operators are actual human beings, and the datasets they are sifting are disguised as an amazingly addictive computer game.

Analysis of lead twist in modern high-performance grinding methods

NASA Astrophysics Data System (ADS)

Kundrák, J.; Gyáni, K.; Felhő, C.; Markopoulos, AP; Deszpoth, I.

2016-11-01

According to quality requirements of road vehicles shafts, which bear dynamic seals, twisted-pattern micro-geometrical topography is not allowed. It is a question whether newer modern grinding methods - such as quick-point grinding and peel grinding - could provide twist- free topography. According to industrial experience, twist-free surfaces can be made, however with certain settings, same twist occurs. In this paper it is proved by detailed chip-geometrical analysis that the topography generated by the new procedures is theoretically twist-patterned because of the feeding motion of the CBN tool. The presented investigation was carried out by a single-grain wheel model and computer simulation.

Highly sensitive torsion sensor based on long period fiber grating fabricated by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Dong, Xinran; Xie, Zheng; Song, Yuxin; Yin, Kai; Luo, Zhi; Duan, Ji'an; Wang, Cong

2017-12-01

A highly sensitive torsion sensor based on long period fiber grating (LPFG) fabricated by 800 nm femtosecond laser pulses is proposed and demonstrated. LPFG with an attenuation depth of ∼14 dB is achieved within the wavelength range of 1425-1575 nm. The experiment results show that the LP02 and LP03 resonant wavelengths experience red-shift when the twist direction is clockwise while they occur blue-shift in the twist counterclockwise direction as the twist rate increases. However, the LP04 resonant wavelength is always shifted toward shorter wavelength independently of the twist directions and higher twist sensitivity is observed. In addition, the loss peak amplitude of LPFG shows a tendency to decrease with the twist rate increases whether the LPFG is twisted clockwise or counterclockwise. Meanwhile, the resonant wavelength occurs splitting phenomenon in the case of higher twist rate as well as the high order resonant wavelength performs more significantly. Additionally, the sensor shows a twist sensitivity as high as 118.7 pm/(rad/m) in the range of -105 to -52.5 rad/m and that of 181.7 pm/(rad/m) in the range of 52.5-105 rad/m.

Experimental Analysis of the Thermo-Hydraulic Performance on a Cylindrical Parabolic Concentrating Solar Water Heater with Twisted Tape Inserts in an Absorber Tube

NASA Astrophysics Data System (ADS)

Kumar, Birendra; Nayak, Rajen Kumar; Singh, S. N.

2018-05-01

A twisted tape inserted in an absorber tube may be an excellent option to enhance the performance of a cylindrical parabolic concentrating solar collector (CPC). The present work is an experimental study of the flow and heat transfer with and without twisted tape inserts in the absorber tube of a CPC. Results are presented for mass flow rates of water, ṁ=0.0198-0.0525 kg/s, twist ratio, y=5-10 and Reynolds number, Re=2577.46-6785.55. In the present study, we found that the outlet water temperature, collector efficiency and Nusselt number (Nu) are higher in the twisted tapes as compared to those without the twisted tape inserts in the absorber tube of the CPC. For fixed mass flow rate of water ṁ, the To and η increased with the decrease in twist ratio, y, and is higher in lower twist ratio, y=5, of the twisted tapes. The whole experiment was performed at the Indian Institute of Technology (ISM) in Dhanbad, India during the months of March-April 2017. Based on the experimental data, the correlations for the Nu and friction factor were also developed.

Electronic and Optical Properties of Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Huang, Shengqiang

The ability to isolate single atomic layers of van der Waals materials has led to renewed interest in the electronic and optical properties of these materials as they can be fundamentally different at the monolayer limit. Moreover, these 2D crystals can be assembled together layer by layer, with controllable sequence and orientation, to form artificial materials that exhibit new features that are not found in monolayers nor bulk. Twisted bilayer graphene is one such prototype system formed by two monolayer graphene layers placed on top of each other with a twist angle between their lattices, whose electronic band structure depends on the twist angle. This thesis presents the efforts to explore the electronic and optical properties of twisted bilayer graphene by Raman spectroscopy and scanning tunneling microscopy measurements. We first synthesize twisted bilayer graphene with various twist angles via chemical vapor deposition. Using a combination of scanning tunneling microscopy and Raman spectroscopy, the twist angles are determined. The strength of the Raman G peak is sensitive to the electronic band structure of twisted bilayer graphene and therefore we use this peak to monitor changes upon doping. Our results demonstrate the ability to modify the electronic and optical properties of twisted bilayer graphene with doping. We also fabricate twisted bilayer graphene by controllable stacking of two graphene monolayers with a dry transfer technique. For twist angles smaller than one degree, many body interactions play an important role. It requires eight electrons per moire unit cell to fill up each band instead of four electrons in the case of a larger twist angle. For twist angles smaller than 0.4 degree, a network of domain walls separating AB and BA stacking regions forms, which are predicted to host topologically protected helical states. Using scanning tunneling microscopy and spectroscopy, these states are confirmed to appear on the domain walls when inversion symmetry is broken with an external electric field. We observe a double-line profile of these states on the domain walls, only occurring when the AB and BA regions are gaped. These states give rise to channels that could transport charge in a dissipationless manner making twisted bilayer graphene a promising platform to realize controllable topological networks for future applications.

Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12

PubMed Central

Tan, Jiangning; Tedrow, John R.; Nouraie, Mehdi; Dutta, Justin A.; Miller, David T.; Li, Xiaoyun; Yu, Shibing; Chu, Yanxia; Juan-Guardela, Brenda; Kaminski, Naftali; Ramani, Kritika; Biswas, Partha S.; Zhang, Yingze

2017-01-01

Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1-null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-κB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Transcriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may shape the IPF phenotype and regulate inflammation in fibrotic lung injury. PMID:28179498

Tight Placement of Erich Arch Bar While Avoiding Wire Fatigue Failure.

PubMed

Kirk, Daniel; Whitney, Joseph; Shafer, David; Song, Liansheng

2016-03-01

To determine the number of wire twists needed to acquire ideal Erich arch bar tightness before wire fatigue failure (fracture) in relation to different distances and angles at which different gauge wires are grasped to provide information to improve the efficiency of arch bar application. This study mimicked surgical placement of arch bars with 24- and 26-gauge wires. The number of twists to tightness and failure was evaluated when the wire distance between the arch bar and wire holder tip changed (5 vs 10 mm) and when the degree at which the wire was held relative to the tooth axis was changed (45° vs 90°). A wire shearing test also was used to investigate the fatigability of wires tightened under these same conditions. Wires twisted to tightness, past tightness, and after shearing test movements were visualized with electron microscopy. For 24-gauge wire held at 5 mm, 2.6 to 2.8 twists were needed for wire tightness, with failure after 1.7 to 1.9 twists past tightness; for 24-gauge wire held at 10 mm, 4.4 to 4.9 twists produced tightness, with failure after 2.3 to 2.9 twists past tightness. For 26-gauge wire held at 5 mm, 3.3 to 3.5 twists provided tightness, with 1.6 to 1.8 twists past tightness causing failure; for 26-gauge wire held at 10 mm, 5.1 to 5.5 twists produced tightness, with 3.1 to 3.7 twists past tightness causing failure. At a 45° angle, the wire tightened with fewer twists and showed more resistance to failure with twists past tightness compared with 90° using 24- and 26-gauge wires. In contrast, 24-gauge wire held at a 5-mm distance showed the opposite result, with decreased resistance to failure at the 45° angle. However, the differences were not statistically meaningful. Scanning election microscopy showed no wire fatigue for either angle for 26-gauge wire held at a 5-mm distance and twisted to tightness. After overtightening and oscillation, the 90° angle trials showed fatigue, whereas the 45° angle trials did not. Holding a 24-gauge wire at 45° to the tooth axis is recommended owing to fewer twists to tightness and more resistance to failure. A 5-mm grasping distance is recommended for experienced surgeons owing to fewer twists to tightness, whereas a 10-mm grasping distance is recommended for novice surgeons owing to a greater tolerance for over-twisting before failure. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Tang, Lan; Duan, Junxin

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spodsberg, Nikolaj

The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez de Leon, Alfredo; Rey, Michael

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spodsberg, Nikolaj

The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yu; Liu, Ye; Duan, Junxin

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Lopez de Leon, Alfredo; Rey, Michael

2012-09-18

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Lopez de Leon, Alfredo; Rey, Michael

2010-12-14

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Harris, Paul [Carnation, WA; Lopez de Leon, Alfredo [Davis, CA; Rey, Micheal [Davis, CA; Ding, Hanshu [Davis, CA; Vlasenko, Elena [Davis, CA

2012-02-21

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2016-06-28

The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Lopez de Leon, Alfredo; Rey, Michael

2016-05-31

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2015-02-10

The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2016-02-23

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Tang, Lan; Liu, Ye; Duan, Junxin; Ding, Hanshu

2013-04-30

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Tang, Lan; Liu, Ye; Duan, Junxin; Hanshu, Ding

2012-10-30

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Liu, Ye; Tang, Lan

2015-11-20

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Lopez de Leon, Alfredo; Rey, Michael

2015-01-27

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2014-10-21

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Lopez de Leon, Alfredo; Rey, Michael

2015-03-10

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2017-05-02

The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2015-03-31

The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2015-07-14

The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Brown, Kimberly [Elk Grove, CA; Harris, Paul [Carnation, WA; Lopez De Leon, Alfredo [Davis, CA; Merino, Sandra [West Sacremento, CA

2007-05-22

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Liu, Ye; Harris, Paul; Tang, Lan; Wu, Wenping

2013-11-19

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Morant, Marc D.; Harris, Paul

2015-10-13

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOEpatents

Liu, Ye; Tang, Lan; Harris, Paul; Wu, Wenping

2012-10-02

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Methods for using polypeptides having cellobiohydrolase activity

DOEpatents

Morant, Marc D; Harris, Paul

2016-08-23

The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polynucleotides encoding polypeptides having beta-glucosidase activity

DOEpatents

Harris, Paul; Golightly, Elizabeth

2010-03-02

The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Lopez de Leon, Alfredo; Rey, Michael

2013-06-18

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spodsberg, Nikolaj

2016-12-13

The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having xylanase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj

2014-10-14

The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

DOEpatents

Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang

2016-05-17

The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Nano polypeptide particles reinforced polymer composite fibers.

PubMed

Li, Jiashen; Li, Yi; Zhang, Jing; Li, Gang; Liu, Xuan; Li, Zhi; Liu, Xuqing; Han, Yanxia; Zhao, Zheng

2015-02-25

Because of the intensified competition of land resources for growing food and natural textile fibers, there is an urgent need to reuse and recycle the consumed/wasted natural fibers as regenerated green materials. Although polypeptide was extracted from wool by alkaline hydrolysis, the size of the polypeptide fragments could be reduced to nanoscale. The wool polypeptide particles were fragile and could be crushed down to nano size again and dispersed evenly among polymer matrix under melt extrusion condition. The nano polypeptide particles could reinforce antiultraviolet capability, moisture regain, and mechanical properties of the polymer-polypeptide composite fibers.

TWIST1-WDR5-Hottip Regulates Hoxa9 Chromatin to Facilitate Prostate Cancer Metastasis.

PubMed

Malek, Reem; Gajula, Rajendra P; Williams, Russell D; Nghiem, Belinda; Simons, Brian W; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R; True, Lawrence; An, Steven S; DeWeese, Theodore L; Ross, Ashley E; Schaeffer, Edward M; Pienta, Kenneth J; Hurley, Paula J; Morrissey, Colm; Tran, Phuoc T

2017-06-15

TWIST1 is a transcription factor critical for development that can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are coexpressed in mouse prostate and then silenced postnatally. Here we report that TWIST1 and HOXA9 coexpression are reactivated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to coenrichment of TWIST1 and WDR5 as well as increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter, which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacologic inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. Cancer Res; 77(12); 3181-93. ©2017 AACR . ©2017 American Association for Cancer Research.