USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...
Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).
Beecher, Brian S; Carter, Arron H; See, Deven R
2012-05-01
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y
2007-06-01
In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi
Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig
2009-01-01
In this study, the production of extracellular enzymes by fungi associated with southern pine beetle was investigated for the first time. Cellulase and polyphenol oxidase production were analyzed for three beetle associated fungi. Only the mutualistic symbiont Entomocorticium sp. A was found to produce cellulases and polyphenol oxidase....
A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.
Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y
2001-02-01
Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.
Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu
2016-01-01
It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
2012-01-01
Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on
Espín, J C; Tudela, J; García-Cánovas, F
1998-05-15
A continuous spectrophotometric method for determining the monophenolase activity of polyphenol oxidase from several plant sources is described. This assay method is based on the coupling reaction between 3-methyl-2-benzothiazolinone hydrazone and the quinone product of the oxidation of 4-hydroxyanisole in the presence of polyphenol oxidase. 4-Hydroxyanisole proved to be the best monophenol assayed to measure the monophenolase activity of polyphenol oxidase from apple, artichoke, avocado, medlar, pear, and strawberry. Kinetic constants of 4-hydroxyanisole were compared to those of p-hydroxyphenyl propionic acid, a very sensitive monophenol previously reported to assay the monophenolase activity of polyphenol oxidase from apple, pear, and mushroom. The high values of the maximum steady state rate obtained for 4-hydroxyanisole suggest the existence of high catalytic constant toward this monophenol. These kinetic values were supported by nuclear magnetic resonance assays which predicted the highest reactivity of 4-hydroxyanisole. Therefore nuclear magnetic resonance assays proved to be a valuable and useful tool to predict the best monophenolic substrate for plant polyphenol oxidases. The 3-methyl-2-benzothiazlolinone-adduct for 4-hydroxyanisole was stable, with high molar absorptivity at the optimum pHs of the polyphenol oxidases assayed. All this together makes the use of 4-hydroxyanisol as monophenolic substrate and 3-methyl-2-benzothiazolinone as coupling reagent the most sensitive and precise assay method up to date reported in the literature to determine the monophenolas activity of polyphenol oxidase from fruits and vegetables.
USDA-ARS?s Scientific Manuscript database
Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...
Marles, M A Susan; Vandenberg, Albert; Bett, Kirstin E
2008-08-27
Postharvest darkening of pinto bean (Phaseolus vulgaris L.) was evaluated in a population of recombinant inbred lines derived from a cross between CDC Pintium (a regular-darkening line) and 1533-15 (a slow-darkening line). Flavonoid metabolite concentrations, polyphenol oxidase activity, lignin concentration, and seed coat anatomy characteristics were assessed for cosegregation with the darkening phenotype. Significantly lower kaempferol concentrations (p = 0.00001) together with differences in polyphenol oxidase activity (p = 0.0045) were two of the key findings associated with these recombinant inbred lines. In addition, two different assays (thioglycolic acid and Klason lignin) to quantify lignin together with an assessment of extractable condensed tannin were used to estimate the contribution of these polymers to changes in the seed coat tissue. This is the first report of precise biochemical characterization of polyphenolics that associate with postharvest darkening in legumes.
Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism
USDA-ARS?s Scientific Manuscript database
Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...
Reducing peanut allergens by high pressure combined with polyphenol oxidase
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...
Calabriso, Nadia; Massaro, Marika; Scoditti, Egeria; D'Amore, Simona; Gnoni, Antonio; Pellegrino, Mariangela; Storelli, Carlo; De Caterina, Raffaele; Palasciano, Giuseppe; Carluccio, Maria Annunziata
2016-02-01
Previous studies have shown the antiinflammatory, antioxidant and antiangiogenic properties by pure olive oil polyphenols; however, the effects of olive oil phenolic fraction on the inflammatory angiogenesis are unknown. In this study, we investigated the effects of the phenolic fraction (olive oil polyphenolic extract, OOPE) from extra virgin olive oil and related circulating metabolites on the VEGF-induced angiogenic responses and NADPH oxidase activity and expression in human cultured endothelial cells. We found that OOPE (1-10 μg/ml), at concentrations achievable nutritionally, significantly reduced, in a concentration-dependent manner, the VEGF-induced cell migration, invasiveness and tube-like structure formation through the inhibition of MMP-2 and MMP-9. OOPE significantly (P<0.05) reduced VEGF-induced intracellular reactive oxygen species by modulating NADPH oxidase activity, p47phox membrane translocation and the expression of Nox2 and Nox4. Moreover, the treatment of endothelial cells with serum obtained 4 h after acute intake of extra virgin olive oil, with high polyphenol content, decreased VEGF-induced NADPH oxidase activity and Nox4 expression, as well as, MMP-9 expression, as compared with fasting control serum. Overall, native polyphenols and serum metabolites of extra virgin olive oil rich in polyphenols are able to lower the VEGF-induced angiogenic responses by preventing endothelial NADPH oxidase activity and decreasing the expression of selective NADPH oxidase subunits. Our results provide an alternative mechanism by which the consumption of olive oil rich in polyphenols may account for a reduction of oxidative stress inflammatory-related sequelae associated with chronic degenerative diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...
Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers
USDA-ARS?s Scientific Manuscript database
Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...
Tissue Printing to Visualize Polyphenol Oxidase and Peroxidase in Vegetables, Fruits, and Mushrooms
ERIC Educational Resources Information Center
Melberg, Amanda R.; Flurkey, William H.; Inlow, Jennifer K.
2009-01-01
A simple tissue-printing procedure to determine the tissue location of the endogenous enzymes polyphenol oxidase and peroxidase in a variety of vegetables, fruits, and mushrooms is described. In tissue printing, cell contents from the surface of a cut section of the tissue are transferred to an adsorptive surface, commonly a nitrocellulose…
Molecular Cloning and Characterization of Apricot Fruit Polyphenol Oxidase
Chevalier, Tony; de Rigal, David; Mbéguié-A-Mbéguié, Didier; Gauillard, Frédéric; Richard-Forget, Florence; Fils-Lycaon, Bernard R.
1999-01-01
A reverse transcriptase-polymerase chain reaction experiment was done to synthesize a homologous polyphenol oxidase (PPO) probe from apricot (Prunus armeniaca var Bergeron) fruit. This probe was further used to isolate a full-length PPO cDNA, PA-PPO (accession no. AF020786), from an immature-green fruit cDNA library. PA-PPO is 2070 bp long and contains a single open reading frame encoding a PPO precursor peptide of 597 amino acids with a calculated molecular mass of 67.1 kD and an isoelectric point of 6.84. The mature protein has a predicted molecular mass of 56.2 kD and an isoelectric point of 5.84. PA-PPO belongs to a multigene family. The gene is highly expressed in young, immature-green fruit and is turned off early in the ripening process. The ratio of PPO protein to total proteins per fruit apparently remains stable regardless of the stage of development, whereas PPO specific activity peaks at the breaker stage. These results suggest that, in addition to a transcriptional control of PPO expression, other regulation factors such as translational and posttranslational controls also occur. PMID:10198084
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) was isolated from Thompson seedless grape (Vitis vinifera 'Thompson Seedless') and its biochemical characteristics were studied. Optimum pH and temperature for grape PPO activity were pH 6.0 and 25 degrees C with 10 mM catechol as substrate. The enzyme was heat-stable betwee...
Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu
2014-03-11
Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning
2014-01-01
Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes
Effect of high pressure on peanut allergens in the presence of polyphenol oxidase and caffeic acid
USDA-ARS?s Scientific Manuscript database
High pressure (HP) enhances enzymatic reactions. Because polyphenol oxidase (PPO) is an enzyme, and reduces IgE binding of peanut allergens in presence of caffeic acid (CA), we postulated that a further reduction in IgE binding can be achieved, using HP together with PPO and CA. Peanut extracts cont...
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-01-01
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag+-responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism. PMID:28304398
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-03-17
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.
Molitor, Christian; Mauracher, Stephan Gerhard
2016-01-01
Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571
USDA-ARS?s Scientific Manuscript database
Incubation of dormant wild oat (Avena fatua L., isoline M73) caryopses for 1 to 3 days with Fusarium avenaceum seed-decay isolate F.a.1 induced activity of the plant defense enzyme polyphenol oxidase (PPO). Both extracts and leachates obtained from F.a.1-treated caryopses had decreased abundance of ...
Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects
Taranto, Francesca; Pasqualone, Antonella; Mangini, Giacomo; Tripodi, Pasquale; Miazzi, Monica Marilena; Pavan, Stefano; Montemurro, Cinzia
2017-01-01
Enzymatic browning is a colour reaction occurring in plants, including cereals, fruit and horticultural crops, due to oxidation during postharvest processing and storage. This has a negative impact on the colour, flavour, nutritional properties and shelf life of food products. Browning is usually caused by polyphenol oxidases (PPOs), following cell damage caused by senescence, wounding and the attack of pests and pathogens. Several studies indicated that PPOs play a role in plant immunity, and emerging evidence suggested that PPOs might also be involved in other physiological processes. Genomic investigations ultimately led to the isolation of PPO homologs in several crops, which will be possibly characterized at the functional level in the near future. Here, focusing on the botanic families of Poaceae and Solanaceae, we provide an overview on available scientific literature on PPOs, resulting in useful information on biochemical, physiological and genetic aspects. PMID:28208645
Kiralp, Senem; Toppare, Levent; Yağci, Yusuf
2003-11-01
Polyphenol oxidase (PPO) was immobilized in copolymers of thiophene functionalized menthyl monomer (MM) with pyrrole. Immobilization of enzyme was performed via entrapment in conducting copolymers during electrochemical polymerization of pyrrole. Maximum reaction rates, Michaelis-Menten constants and temperature, pH and operational stabilities of enzyme electrodes were investigated. Total amount of phenolic compounds in red wines of Turkey were analyzed by using these electrodes.
Purification and characterization of polyphenol oxidase from cauliflower (Brassica oleracea L.).
Rahman, Andi Nur Faidah; Ohta, Mayumi; Nakatani, Kazuya; Hayashi, Nobuyuki; Fujita, Shuji
2012-04-11
Polyphenol oxidase (PPO) of cauliflower was purified to 282-fold with a recovery rate of 8.1%, using phloroglucinol as a substrate. The enzyme appeared as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The estimated molecular weight of the enzyme was 60 and 54 kDa by SDS-PAGE and gel filtration, respectively. The purified enzyme, called phloroglucinol oxidase (PhO), oxidized phloroglucinol (K(m) = 3.3 mM) and phloroglucinolcarboxylic acid. The enzyme also had peroxidase (POD) activity. At the final step, the activity of purified cauliflower POD was 110-fold with a recovery rate of 3.2%. The PhO and POD showed the highest activity at pH 8.0 and 4.0 and were stable in the pH range of 3.0-11.0 and 5.0-8.0 at 5 °C for 20 h, respectively. The optimum temperature was 55 °C for PhO and 20 °C for POD. The most effective inhibitor for PhO was sodium diethyldithiocarbamate at 10 mM (IC(50) = 0.64 and K(i) = 0.15 mM), and the most effective inhibitor for POD was potassium cyanide at 1.0 mM (IC(50) = 0.03 and K(i) = 29 μM).
Characterization of polyphenol oxidase from blueberry (Vaccinium corymbosum L.).
Siddiq, M; Dolan, K D
2017-03-01
Polyphenol oxidase (PPO) was extracted and characterized from high-bush blueberries. PPO showed an optimum activity at pH 6.1-6.3 and 35°C, with the enzyme showing significant activity over a wide temperature range (25-60°C). Catechol was the most readily oxidized substrate followed by 4-methylcatechol, DL-DOPA, and dopamine. Blueberry PPO showed a K m of 15mM and V max of 2.57 ΔA 420 nm/min×10 -1 , determined with catechol. PPO was completely inactivated in 20min at 85°C, however, after 30minat 75°C it showed about 10% residual activity. Thermal treatment at 55 and 65°C for 30min resulted in the partial inactivation of PPO. Ascorbic acid, sodium diethyldithiocarbamic acid, L-cysteine, and sodium metabisulfite were effective inhibitors of PPO at 1.0mM. Benzoic acid and cinnamic acid series inhibitors showed relatively weak inhibition of PPO (21.8-27.6%), even at as high as 2.0mM concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Böyükbayram, A Elif; Kiralp, Senem; Toppare, Levent; Yağci, Yusuf
2006-10-01
Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique. Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO) into conducting copolymers prepared by electropolymerization of pyrrole with thiophene capped polytetrahydrofuran. Kinetic parameters, maximum reaction rate (V(max)) and Michaelis-Menten constant (K(m)) and optimum conditions regarding temperature and pH were determined for the immobilized enzyme. Operational stability and shelf-life of the enzyme electrodes were investigated. Enzyme electrodes of polyphenol oxidase were used to determine the amount of phenolic compounds in two brands of Turkish red wines and found very useful owing to their high kinetic parameters and wide pH working range.
Katayama-Ikegami, Ayako; Suehiro, Yuka; Katayama, Takane; Jindo, Kazushi; Itamura, Hiroyuki; Esumi, Tomoya
2017-12-01
Polyphenol oxidases (PPOs) catalyze browning reactions in various plant organs, therefore controlling the reactions is important for the food industry. PPOs have been assumed to be involved in skin browning of white grape cultivars; however, the molecular mechanism underlying PPO-mediated browning process remains elusive. We have recently identified a new PPO gene named VvPPO2 from "Shine Muscat" (Vitis labruscana Bailey × V. vinifera L.), and have shown that the gene is transcribed at a higher level than the previously identified VvPPO1 in browning, physiologically disordered berry skins at the maturation stage. In this study, we expressed VvPPO2 in Escherichia coli and, using the purified preparation, revealed unique physicochemical characteristics of the enzyme. Our study opens up a way to not only understand the berry skin browning process but also to elucidate the enzymatic maturation process of grape PPOs.
Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.
Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie
2015-09-09
Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols.
NASA Astrophysics Data System (ADS)
Udosen, I. R.; Nkang, A. E.; Sam, S. M.
2012-07-01
Activities of peroxidase (POD) and polyphenol Oxidase (PPO) were investigated in seeds of Pentaclethramacrophylla during low temperature treatment. The seeds from the small-sized fruits (variety A) and those of the big-sized fruits (variety B) showed high germination, with maximum germination values ranging between 60 ñ 90%. Low temperature treatment did not significantly (P< 0.5) affect maximum germination values. Activities of POD and PPO increased initially (2-4 days) but declined with prolonged (6ñ8 days) low temperature treatment.
Reducing peanut allergens by high pressure combined with polyphenol oxidase
NASA Astrophysics Data System (ADS)
Chung, Si-Yin; Houska, Milan; Reed, Shawndrika
2013-12-01
Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens. Since high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts containing caffeic acid were treated with each of the following: (1) HP; (2) HP+PPO; (3) PPO; and (4) none. HP was conducted at 300 and 500 MPa, each for 3 and 10 min, 37 °C. After treatment, SDS-PAGE was performed and allergenic capacity (IgE binding) was determined colorimetrically in inhibition enzyme-linked immunosorbent assay and Western blots, using a pooled plasma from peanut-allergic patients. Data showed that HP alone had no effect on major peanut allergens. However, HP at 500 MPa combined with PPO (HP500/PPO) induced a higher (approximately twofold) reduction of major peanut allergens and IgE binding than PPO alone or HP300/PPO. There was no difference between treatment times. We concluded that HP500/PPO at 3-min enhanced a twofold reduction of the allergenic capacity of peanut extracts, as compared to PPO itself.
von Schwartzenberg, Klaus
2012-01-01
Polyphenol oxidases (PPOs) are copper-binding enzymes of the plant secondary metabolism that oxidize polyphenols to quinones. Although PPOs are nearly ubiquitous in seed plants, knowledge on their evolution and function in other plant groups is missing. This study reports on the PPO gene family in the moss Physcomitrella patens (Hedw.) B.S.G. asan example for an early divergent plant. The P. patens PPO multigene family comprises 13 paralogues. Phylogenetic analyses suggest that plant PPOs evolved with the colonization of land and that PPO duplications within the monophyletic P. patens paralogue clade occurred after the separation of the moss and seed plant lineages. PPO functionality was demonstrated for recombinant PPO6. P. patens was analysed for phenolic compounds and six substances were detected intracellularly by LC-MS analysis: 4-hydroxybenzoic acid, p-cumaric acid, protocatechuic acid, salicylic acid, caffeic acid, and an ester of caffeic acid. Targeted PPO1 knockout (d|ppo1) plants were generated and plants lacking PPO1 exhibited only ~30% of the wild-type PPO activity in the culture medium, thus suggesting extracellular localization of PPO1, which is in contrast to the mostly plastidic PPO localization in seed plants. Further, d|ppo1 lines formed significantly more gametophores with a reduced areal plant size, which could be related to an increase of endogenously produced cytokinins and indicates an impact of PPO1 on plant development. d|ppo1 plants were less tolerant towards applied 4-methylcatechol compared to the wild type, which suggests a role of extracellular PPO1 in establishing appropriate conditions by the removal of inhibitory extracellular phenolic compounds. PMID:22865913
Molecular cloning and characterisation of banana fruit polyphenol oxidase.
Gooding, P S; Bird, C; Robinson, S P
2001-09-01
Polyphenol oxidase (PPO; EC 1.10.3.2) is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.
Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N
2001-02-01
Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives.
Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua
2014-01-01
Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257
Inhibition of polyphenol oxidases activity by various dipeptides.
Girelli, Anna M; Mattei, Enrico; Messina, Antonella; Tarola, Anna M
2004-05-19
In an effort to develop natural and nontoxic inhibitors on the activity of mushroom polyphenol oxidase (PPO) the effect of various glycyl-dipeptides (GlyAsp, GlyGly, GlyHis, GlyLeu, GlyLys, GlyPhe, GlyPro, GlyTyr) was investigated. The inhibition study with dihydroxyphenylalanine (DOPA) as substrate is based on separation of the enzymatic reaction components by reversed phase HPLC and the UV detection of the dopachrome formed. The results have evidenced that several of tested dipeptides inhibited PPO activity in the range of 20-40% while GlyPro and GlyLeu had no effect. The study has also permitted the characterization of the following kinetic pattern: a linear-mixed-type mechanism for GlyAsp, GlyGly, GlyLys, and GlyPhe and a hyperbolic-mixed-type for GlyTyr. It was not possible to identify the inhibition mechanism for GlyHis, although it affects PPO activity. In addition the effects of GlyAsp, GlyLys and GlyHis were evaluated for lessening the browning of fresh Golden Delicious apple and Irish White Skinned potato. The effectiveness of such inhibitors was determined by the difference between the colors observed in the dipeptide-treated sample and the controls using the color space CIE-Lab system. The % browning inhibition on potato (20-50%) was greater than of apple (20-30%) by the all tested dipeptides. Only GlyLys presented the significant value of 50%.
Tao, Yi-Ming; Yao, Le-Yi; Qin, Qiu-Yan; Shen, Wang
2013-12-26
Polyphenol oxidase (PPO) from jackfruit bulb was purified through acetone precipitation, ion-exchange column, and gel filtration column. PPO was a dimer with the molecular weight of 130 kDa determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration. The Km was 8.3 and 18.2 mM using catechol and 4-methylcatechol as substrates, respectively. The optimum pH was 7.0 (catechol as the substrate) or 6.5 (4-methylcatechol as the substrate). The optimum temperature was 8 °C. The enzyme was stable below 40 °C. The activation energy (Ea) of heat inactivation was estimated to be 103.30 kJ/mol. The PPO activity was activated by Mn(2+), SDS, Tween-20, Triton X-100, citric acid, and malic acid but inhibited by K(+), Zn(2+), Mg(2+), Ca(2+), Ba(2+), cetyl trimethyl ammonium bromide (CTAB), kojic acid, tropolone, glutathione (GSH), cysteine (Cys), and ascorbic acid (AA). Cys and AA were effective to reduce browning of jackfruit bulbs during the storage at 8 °C for 15 days.
Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.
Bravo, Karent; Osorio, Edison
2016-04-15
Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning. Copyright © 2015 Elsevier Ltd. All rights reserved.
Effects of water blanching on polyphenol reaction kinetics and quality of cocoa beans
NASA Astrophysics Data System (ADS)
Menon, A. S.; Hii, C. L.; Law, C. L.; Suzannah, S.; Djaeni, M.
2015-12-01
Several studies have been reported on the potential health benefits of cocoa polyphenols. However, drying has an inhibitory effect on the substantial recovery of cocoa polyphenols. This is majorly because of the high degradation of polyphenol compounds as well as the enhanced activity of polyphenol oxidases; a pre-cursor for browning of polyphenols during drying. Pre-treatment technique such as water blanching (80° and 90°C for 5 min, 10 min and 15 min exposure times respectively) can inactivate the polyphenol oxidases enzyme and promote high percent of the polyphenol recovery in dried cocoa bean. The degradation kinetics of cocoa polyphenols during hot water blanching are analyzed; The rate constant for the polyphenol degradation after blanching was found to be ranging from 0.0208 to 0.0340 /min. The results for dried fresh cocoa beans showed an optimal level of polyphenol recovery (118 mg GAE/g) when blanched at 90°C for 5 minutes duration. The antioxidant activity is also analyzed using DPPH scavenging assay.
Purification and characterization of polyphenol oxidase from banana (Musa sapientum L.) pulp.
Yang, C P; Fujita, S; Ashrafuzzaman, M; Nakamura, N; Hayashi, N
2000-07-01
Polyphenol oxidase (EC 1.10.3.1, PPO) in the pulp of banana (Musa sapientum L.) was purified to 636-fold with a recovery of 3.0%, using dopamine as substrate. The purified enzyme exhibited a clear single band on polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS)-PAGE. The molecular weight of the enzyme was estimated to be about 41000 and 42000 by gel filtration and SDS-PAGE, respectively. The enzyme quickly oxidized dopamine, and its K(m) value for dopamine was 2.8 mM. The optimum pH was at 6.5, and the enzyme activity was stable in the range of pH 5-11 at 5 degrees C for 48 h. The enzyme had an optimum temperature of 30 degrees C and was stable even after a heat treatment at 70 degrees C for 30 min. The enzyme activity was completely inhibited by L-ascorbic acid, cysteine, sodium diethyldithiocarbamate, and potassium cyanide. Under a low buffer capacity, the enzyme was also strongly inhibited by citric acid and acetic acid at 10 mM.
Purification and characterization of polyphenol oxidase from rape flower.
Sun, Han-Ju; Wang, Jing; Tao, Xue-Ming; Shi, Juan; Huang, Mei-Ying; Chen, Zhe
2012-01-25
The purification and partial enzymology characteristics of polyphenol oxidase (PPO) from rape flower were studied. After preliminary treatments, the crude enzyme solution was in turn purified with ammonium sulfate, dialysis, and Sephadex G-75 gel chromatography. The optimal conditions and stability of PPO were examined at different pH values and temperatures. Subsequently, PPO was also characterized by substrate (catechol) concentrations, inhibitors, kinetic parameters, and molecular weight. Results showed that the optimal pH for PPO activity was 5.5 in the presence of catechol and that PPO was relatively stable at pH 3.5-5.5. PPO was moderately stable at temperatures from 60 to 70 °C, whereas it was easily denatured at 80-90 °C. Ethylenediaminetetraacetic acid, sodium chloride, and calcium chloride had little inhibitive effects on PPO, whereas citric acid, sodium sulfite, and ascorbic acid had strongly inhibitive effects. The Michaelis-Menten constant (K(m)) and maximal reaction velocity (V(max)) of PPO were 0.767 mol/L and 0.519 Ab/min/mL of the crude PPO solution, respectively. PPO was finally purified to homogeneity with a purification factor of 4.41-fold and a recovery of 12.41%. Its molecular weight was 60.4 kDa, indicating that the PPO is a dimer. The data obtained in this research may help to prevent the enzymatic browning of rape flower during its storage and processing.
Polyphenol oxidase inhibitor from blue mussel (Mytilus edulis) extract.
Schulbach, Kurt F; Johnson, Jodie V; Simonne, Amarat H; Kim, Jeong-Mok; Jeong, Yoonhwa; Yagiz, Yavuz; Marshall, Maurice R
2013-03-01
Enzymatic browning remains a problem for the fruit and vegetable industry, especially new emerging markets like pre-cuts. A crude inhibitor from blue mussel (Mytilus edulis) showed broad inhibition for apple (58%), mushroom (32%), and potato (44%) polyphenol oxidase (PPO) and was further characterized. Inhibition increased as the concentration of inhibitor increased in the reaction mixture eventually leveling off at a maximum inhibition of 92% for apple PPO. The inhibitor was capable of bleaching the brown color formed in the reaction mixture with apple PPO. Identification of the inhibitor by mass spectrometry and high-performance liquid chromatography revealed it to be hypotaurine (C2 H7 NO2 S). Hypotaurine and other sulfinic acid analogs (methane and benzene sulfinic acids) showed very good inhibition for apple PPO at various concentrations with the highest inhibition occurring at 500 μM for hypotaurine (89%), methane sulfinic acid (100%), and benzene sulfinic acid (100%). An inhibitor found in the expressed liquid from blue mussel shows very good inhibition on enzymatic browning. Since this enzyme is responsible for losses to the fruit and vegetable industry, natural inhibitors that prevent browning would be valuable. Finding alternative chemistries that inhibit browning and understanding their mode of action would be beneficial to the fruit and vegetable industries and their segments such as pre-cuts, juices, and so on. Inhibitors from products ingested by consumers are more acceptable as natural ingredients. © 2013 Institute of Food Technologists®
Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo
2007-10-31
Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role.
Koivuniemi, Paul J.; Tolbert, N. E.; Carlson, Peter S.
1980-01-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (EC 4.1.1.39) was crystallized from a heterozygous tobacco (Nicotiana tabacum L.) aurea mutant (Su/su), its wild-type sibling (su/su), and green revertant plants regenerated from green spots found on leaves of haploid Su plants. No differences were found in the specific activity or kinetic parameters of this enzyme, when comparing Su/su and su/su plants of the same age, which had been grown under identical conditions. The enzyme crystallized from revertant plants was also identical to the enzyme from wild-type plants with the exception of one clone, designated R2. R2 has a chromosome number approximately double that of the wild-type (87.0 ± 11.1 versus 48). The enzyme from R2 had a lower Vmax for CO2, although the Km values were identical to those for the enzyme from the wild-type plant. The enzyme from all mutant plants had identical isoelectric points, identical molecular weight as demonstrated by migration on native and sodium dodecyl sulfate (SDS)-polyacrylamide gels, and the same ratio of large to small subunits as the enzyme from the wild-type. The large subunit of the enzyme from tobacco leaves exhibited a different electrophoretic pattern than did the large subunit from spinach; there were two to three bands on SDS-polyacrylamide gels for the tobacco enzyme whereas the enzyme from spinach had only one species of large subunit. Total polyphenol oxidase activity was the same in leaves from the heterozygous mutant (Su/su) and wild-type (su/su) plants when correlated with developmental age as represented by morphology rather than by the chronological age of the plants. There was a marked increase in the soluble activity of this enzyme with increasing age of both plant types and also as a result of varying environmental conditions. Ribulose-1,5-bisphosphate carboxylase/oxygenase activity correlated inversely with increases in the soluble activity of polyphenol oxidase in crude homogenates from which the
Palma-Orozco, Gisela; Marrufo-Hernández, Norma A; Sampedro, José G; Nájera, Hugo
2014-10-08
Polyphenol oxidase (PPO) is an enzyme widely distributed in the plant kingdom that has been detected in most fruits and vegetables. PPO was extracted and purified from Manila mango (Mangifera indica), and its biochemical properties were studied. PPO was purified 216-fold by hydrophobic interaction and ion exchange chromatography. PPO was purified to homogeneity, and the estimated PPO molecular weight (MW) by SDS-PAGE was ≈31.5 kDa. However, a MW of 65 kDa was determined by gel filtration, indicating a dimeric structure for the native PPO. The isolated PPO showed the highest affinity to pyrogallol (Km = 2.77 mM) followed by 4-methylcatechol (Km = 3.14 mM) and catechol (Km = 15.14 mM). The optimum pH for activity was 6.0. PPO was stable in the temperature range of 20-70 °C. PPO activity was completely inhibited by tropolone, ascorbic acid, sodium metabisulfite, and kojic acid at 0.1 mM.
Can, Zehra; Dincer, Barbaros; Sahin, Huseyin; Baltas, Nimet; Yildiz, Oktay; Kolayli, Sevgi
2014-12-01
In this study, firstly, antioxidant and polyphenol oxidase (PPO) properties of Yomra apple were investigated. Seventeen phenolic constituents were measured by reverse phase-high-performance liquid chromatography (RP-HPLC). Total phenolic compounds (TPCs), ferric reducing antioxidant power (FRAP) and 2, 2-diphenyl-1-picrylhydrazyl radical (DPPH) scavenging activities were performed to measure antioxidant capacity. Some kinetic parameters (Km, Vmax), and inhibition behaviors against five different substrates were measured in the crude extract. Catechin and chlorogenic acid were found as the major components in the methanolic extract, while ferulic acid, caffeic acid, p-hydroxybenzoic acid, quercetin and p-coumaric acid were small quantities. Km values ranged from 0.70 to 10.10 mM in the substrates, and also 3-(4-hydroxyphenyl) propanoic acid (HPPA) and L-DOPA showed the highest affinity. The inhibition constant of Ki were ranged from 0.05 to 14.90 mM against sodium metabisulphite, ascorbic acid, sodium azide and benzoic acid, while ascorbic acid and sodium metabisulphite were the best inhibitors.
Singh, Virendra; Jadhav, Swati B; Singhal, Rekha S
2015-09-01
Polysaccharides differing in structure and chemical nature were screened for their ability to bind non-covalently with polyphenol oxidase (PPO) from potato (as a model) and their effect on enzyme activity. All the polysaccharides selected inhibited the PPO but β-cyclodextrin showed maximum inhibition under optimum conditions. Process details for the inhibition of PPO were studied with respect to concentration of β-cyclodextrin, temperature, pH, and time. Higher inhibition constant and lower half life was obtained at 40 °C than at 30 °C in the presence of inhibitor. β-Cyclodextrin showed mixed type of inhibition of PPO. β-Cyclodextrin was further exploited as anti-browning agent in selected fruit juices. It not only showed a significant anti-browning effect on freshly prepared potato juice but was also effective in other fruit juices. Better effect was seen in pineapple, apple and pear as compared to banana, sugarcane and guava fruit juices. Copyright © 2015 Elsevier B.V. All rights reserved.
Condino-Neto, A; Whitney, C; Newburger, P E
1998-11-01
We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.
Richter, Carolin; Dirks, Mareike E; Gronover, Christian Schulze; Prüfer, Dirk; Moerschbacher, Bruno M
2012-02-01
Dandelion (Taraxacum officinale) possesses an unusually high degree of disease resistance. As this plant exhibits high polyphenol oxidase (PPO) activity and PPO have been implicated in resistance against pests and pathogens, we analyzed the potential involvement of five PPO isoenzymes in the resistance of dandelion against Botrytis cinerea and Pseudomonas syringae pv. tomato. Only one PPO (ppo-2) was induced during infection, and ppo-2 promoter and β-glucuronidase marker gene fusions revealed strong induction of the gene surrounding lesions induced by B. cinerea. Specific RNAi silencing reduced ppo-2 expression only, and concomitantly increased plant susceptibility to P. syringae pv. tomato. At 4 days postinoculation, P. syringae pv. tomato populations were strongly increased in the ppo-2 RNAi lines compared with wild-type plants. When the dandelion ppo-2 gene was expressed in Arabidopsis thaliana, a plant having no PPO gene, active protein was formed and protein extracts of the transgenic plants exhibited substrate-dependent antimicrobial activity against P. syringae pv. tomato. These results clearly indicate a strong contribution of a specific, single PPO isoform to disease resistance. Therefore, we propose that specific PPO isoenzymes be included in a new family of pathogenesis-related (PR) proteins.
Yu, Yanchun; Tang, Tian; Qian, Qian; Wang, Yonghong; Yan, Meixian; Zeng, Dali; Han, Bin; Wu, Chung-I; Shi, Suhua; Li, Jiayang
2008-11-01
Asian rice (Oryza sativa) cultivars originated from wild rice and can be divided into two subspecies by several criteria, one of which is the phenol reaction (PHR) phenotype. Grains of indica cultivars turn brown in a phenol solution that accelerates a similar process that occurs during prolonged storage. By contrast, the grains of japonica do not discolor. This distinction may reflect the divergent domestication of these two subspecies. The PHR is controlled by a single gene, Phr1; here, we report the cloning of Phr1, which encodes a polyphenol oxidase. The Phr1 gene is indeed responsible for the PHR phenotype, as transformation with a functional Phr1 can complement a PHR negative cultivar. Phr1 is defective in all japonica lines but functional in nearly all indica and wild strains. Phylogenetic analysis showed that the defects in Phr1 arose independently three times. The multiple recent origins and rapid spread of phr1 in japonica suggest the action of positive selection, which is further supported by several population genetic tests. This case may hence represent an example of artificial selection driving the differentiation among domesticated varieties.
Zhou, Dan; Li, Lin; Wu, Yanwen; Fan, Junfeng; Ouyang, Jie
2015-03-15
The inhibitory effect and associated mechanisms of salicylic acid (SA) on the browning of fresh-cut Chinese chestnut were investigated. Shelled and sliced chestnuts were immersed in different concentrations of an SA solution, and the browning of the chestnut surface and interior were inhibited. The activities of polyphenol oxidase (PPO) and peroxidase (POD) extracted from chestnuts were measured in the presence and absence of SA. SA at concentrations higher than 0.3g/L delayed chestnut browning by significantly inhibiting the PPO activity (P<0.01), and the POD activity was not significantly affected (P>0.05). The binding and inhibition modes of SA with PPO and POD, determined by AUTODOCK 4.2 and Lineweaver-Burk plots, respectively, established SA as a competitive inhibitor of PPO. Copyright © 2014 Elsevier Ltd. All rights reserved.
Forage polyphenol oxidase and ruminant livestock nutrition
Lee, Michael R. F.
2014-01-01
Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Yang, C P; Fujita, S; Kohno, K; Kusubayashi, A; Ashrafuzzaman, M; Hayashi, N
2001-03-01
Polyphenol oxidase (EC 1.10.3.1, o-diphenol: oxygen oxidoreductase, PPO) of banana (Musa sapientum L.) peel was partially purified about 460-fold with a recovery of 2.2% using dopamine as substrate. The enzyme showed a single peak on Toyopearl HW55-S chromatography. However, two bands were detected by staining with Coomassie brilliant blue on PAGE: one was very clear, and the other was faint. Molecular weight for purified PPO was estimated to be about 41 000 by gel filtration. The enzyme quickly oxidized dopamine, and its Km value (Michaelis constant) for dopamine was 3.9 mM. Optimum pH was 6.5 and the PPO activity was quite stable in the range of pH 5-11 for 48 h. The enzyme had an optimum temperature at 30 degrees C and was stable up to 60 degrees C after heat treatment for 30 min. The enzyme activity was strongly inhibited by sodium diethyldithiocarbamate, potassium cyanide, L-ascorbic acid, and cysteine at 1 mM. Under a low buffer capacity, the enzyme was also strongly inhibited by citric acid and acetic acid at 10 mM.
Effect of polyphenols from coffee and grape on gene expression in myoblasts.
Priftis, Alexandros; Goutzourelas, Nikolaos; Halabalaki, Maria; Ntasi, Georgia; Stagos, Dimitrios; Amoutzias, Grigorios D; Skaltsounis, Leandros A; Kouretas, Dimitrios
2018-06-01
Coffee and grape contain various bioactive compounds like polyphenols that may exert beneficial effects, especially antioxidant activity, on human health upon consumption. However, the molecular mechanisms through which these effects are achieved are not fully elucidated. Thus, in the present study in order to investigate these mechanisms, a whole genome expression DNA microarray analysis was carried out in myoblasts treated with polyphenols of coffee and grape pomace at concentrations that improved the redox status. Grape was composed of catechin, epicatechin, cyanidin, malvidin, delphinidin, petunidin, myrtillin, kuromanin, oenin, peonidin, quercetin, gallic acid and caftaric acid as LC-MS revealed, with a total polyphenolic content (TPC) of 648 mg of gallic acid equivalents/g of dry matter. Coffee had a TPC of 42.61 mg GAE/g coffee and was composed of 3-chlorogenic acid (16.61 mg/g), 4- and 5-chlorogenic acids (13.62 mg/g), as UHPLC-HRMS revealed. According to the results, grape polyphenols altered mainly the expression of cytoskeleton and differentiation-associated genes, while coffee compounds had a more profound effect, on the expression levels of many metabolic and antioxidant genes possibly through the nuclear factor (erythroid-derived 2) like-2 (Nrf2) pathway. Copyright © 2017 Elsevier B.V. All rights reserved.
Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong
2016-01-01
Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324
Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa
Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.
1996-01-01
Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590
Molecular evolution of the polyamine oxidase gene family in Metazoa
2012-01-01
Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including
Molecular evolution of the polyamine oxidase gene family in Metazoa.
Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela
2012-06-20
Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all
Raimbault, Astrid-Kim; Marie-Alphonsine, Paul-Alex; Horry, Jean-Pierre; Francois-Haugrin, Madlyn; Romuald, Karell; Soler, Alain
2011-01-12
Pineapple internal browning (IB) is a chilling injury that produces enzymatic browning associated with flesh translucency. Pineapple biodiversity allowed the investigation of how polyphenol oxidase (PPO) and peroxidase (POD) activities with their different isoforms are involved in the IB mechanism. Fruits of four varieties that expressed IB symptoms differently, Smooth Cayenne (SCay) and the hybrids MD2, Flhoran 41 (Flh 41), and Flhoran 53 (Flh 53), were stressed by cold. The susceptible varieties showed classical brown spots but different patterns of IB, whereas MD2 and controls showed no IB. Enzymatic activities were measured on fruit protein extracts and PPO and POD isoforms separated on mini-gels (PhastSystem). Only PPO activity was significantly enhanced in the presence of IB. Up to six PPO isoforms were identified in the susceptible varieties. PPO was barely detectable in the nonsusceptible variety MD2 and in controls. The number of PPO isoforms and the total PPO activity after chilling are varietal characteristics.
QTL and candidate gene mapping for polyphenolic composition in apple fruit
2012-01-01
Background The polyphenolic products of the phenylpropanoid pathway, including proanthocyanidins, anthocyanins and flavonols, possess antioxidant properties that may provide health benefits. To investigate the genetic architecture of control of their biosynthesis in apple fruit, various polyphenolic compounds were quantified in progeny from a 'Royal Gala' × 'Braeburn' apple population segregating for antioxidant content, using ultra high performance liquid chromatography of extracts derived from fruit cortex and skin. Results Construction of genetic maps for 'Royal Gala' and 'Braeburn' enabled detection of 79 quantitative trait loci (QTL) for content of 17 fruit polyphenolic compounds. Seven QTL clusters were stable across two years of harvest and included QTLs for content of flavanols, flavonols, anthocyanins and hydroxycinnamic acids. Alignment of the parental genetic maps with the apple whole genome sequence in silico enabled screening for co-segregation with the QTLs of a range of candidate genes coding for enzymes in the polyphenolic biosynthetic pathway. This co-location was confirmed by genetic mapping of markers derived from the gene sequences. Leucoanthocyanidin reductase (LAR1) co-located with a QTL cluster for the fruit flavanols catechin, epicatechin, procyanidin dimer and five unknown procyanidin oligomers identified near the top of linkage group (LG) 16, while hydroxy cinnamate/quinate transferase (HCT/HQT) co-located with a QTL for chlorogenic acid concentration mapping near the bottom of LG 17. Conclusion We conclude that LAR1 and HCT/HQT are likely to influence the concentration of these compounds in apple fruit and provide useful allele-specific markers for marker assisted selection of trees bearing fruit with healthy attributes. PMID:22269060
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene
Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji
2001-01-01
We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947
Noda, Takahiro; Iimure, Kazuhiko; Okamoto, Shunsuke; Saito, Akira
2017-08-01
Browning of plant tissue is generally considered attributable to enzymatic oxidation by polyphenol oxidase (PPO). Electrophoresis followed by activity staining has been used as an effective procedure to visually detect and isolate isozymes; however, it has not been applied for examination of various PPO isozymes in lettuce. Our study demonstrated that different lettuce PPO isozymes could be detected at different pH in active staining, and multiple isozymes were detected only under alkaline conditions. As a result, we concluded that activity staining with approximately pH 8 enabled to detect various PPO isozymes in lettuce. By expression analysis of the PPO isozymes after wounding, PPO isozymes that correlated with time-course of tissue browning were detected. The wound-induced PPO may play a key role in enzymatic browning.
Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G
1998-01-01
The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.
Liu, Fang; Zhao, Jin-Hong; Gan, Zhi-Lin; Ni, Yuan-Ying
2015-04-15
This study compared membrane-bound with soluble polyphenol oxidase (mPPO and sPPO, respectively) from Fuji apple. Purified mPPO and partially purified sPPO were used. mPPO was purified by temperature-induced phase partitioning and ion exchange chromatography. The specific activity of mPPO was 34.12× higher than that of sPPO. mPPO was more stable than sPPO at pH 5.0-8.5. Although mPPO was more easily inactivated at 25-55 °C, it is still more active than sPPO in this temperature range. The optimum substrate of mPPO was 4-methyl catechol, followed by catechol. L-cysteine had the highest inhibitory effects on mPPO followed by ascorbic acid and glutathione. Surprisingly, EDTA increased mPPO activity. The results revealed that purified mPPO is a dimer with a molecular weight of approximately 67 kDa. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ciou, Jhih-Ying; Lin, Hsin-Hung; Chiang, Po-Yuan; Wang, Chiun-C; Charles, Albert Linton
2011-07-15
The mechanism of browning involving enzymatic browning was investigated in the pericarp of water caltrop, an Asian vegetable popular for its taste and medicinal properties. Polyphenol oxidase (PPO) and peroxidase (POD) activities were determined in pericarp at various times and temperatures. Water caltrop consisted of 44.22% moisture content, 37.23% crude fibre, and 2.63% crude protein. PPO and POD activities dropped from 62 and 38units/g sample, respectively, as water temperature was increased from 30 to 80°C. Optimum pH and temperature for PPO activity was at pH 5.0, 25-45°C, and POD activity peaked at 60°C. High PPO and POD activities at 40-50°C resulted in degradation of phenolic compounds, which led to increased aggregation of browning pigments and discolouration (lower L-values) of the pericarp. Enzymatic browning was determined as the major factor in the browning discolouration of heat-treated water caltrop pericarp. Copyright © 2011 Elsevier Ltd. All rights reserved.
Kim, Bohkyung; Park, Youngki; Wegner, Casey J; Bolling, Bradley W; Lee, Jiyoung
2013-09-01
Black chokeberry (Aronia melanocarpa) is a rich source of polyphenols. The hypolipidemic effects of polyphenol-rich black chokeberry extract (CBE) have been reported, but underlying mechanisms have not been well characterized. We investigated the effect of CBE on the expression of genes involved in intestinal lipid metabolism. Caco-2 cells were incubated with 50 or 100 μg/ml of CBE for 24 h for quantitative realtime polymerase chain reaction analysis. Expression of genes for cholesterol synthesis (3-hydroxy-3-methylglutaryl coenzyme A reductase and sterol regulatory element binding protein 2), apical cholesterol uptake (Niemann-Pick C1 Like 1 and scavenger receptor class B Type 1) and basolateral cholesterol efflux [ATP-binding cassette transporter A1 (ABCA1)] was significantly decreased by CBE compared with control. Western blot analysis confirmed that CBE inhibited expression of these proteins. In contrast, CBE markedly induced mRNA and/or protein levels of ABCG5 and ABCG8 that mediate apical cholesterol efflux to the intestinal lumen. Furthermore, CBE significantly increased mRNA and protein levels of low-density lipoprotein (LDL) receptor, and cellular LDL uptake. Expression of genes involved in lipid metabolism and lipoprotein assembly, including sterol regulatory element-binding protein 1c, fatty acid synthase and acyl-CoA oxidase 1, was significantly decreased by CBE in a dose-dependent manner. Concomitantly, CBE significantly increased sirtuin 1, 3 and 5 mRNA levels, while it decreased SIRT-2. Our data suggest that hypolipidemic effects of CBE may be attributed, at least in part, to increased apical efflux of LDL-derived cholesterol and to decreased chylomicron formation in the intestine; and specific isoforms of SIRT may play an important role in this process. Copyright © 2013 Elsevier Inc. All rights reserved.
Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?
Kües, Ursula; Rühl, Martin
2011-01-01
Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246
Terefe, Netsanet Shiferaw; Delon, Antoine; Buckow, Roman; Versteeg, Cornelis
2015-12-01
Partially purified blueberry polyphenol oxidase (PPO) in Mcllvaine buffer (pH=3.6, typical pH of blueberry juice) was subjected to processing at isothermal-isobaric conditions at temperatures from 30 to 80 °C and pressure from 0.1 to 700 MPa. High pressure processing at 30-50 °C at all pressures studied caused irreversible PPO activity increase with a maximum of 6.1 fold increase at 500 MPa and 30 °C. Treatments at mild pressure-mild temperature conditions (0.1-400 MPa, 60 °C) also caused up to 3 fold PPO activity increase. Initial activity increase followed by a decrease occurred at relatively high pressure-mild temperature (400-600 MPa, 60 °C) and mild pressure-high temperature (0.1-400 MPa, 70-80 °C) combinations. At temperatures higher than 76 °C, monotonic decrease in PPO activity occurred at 0.1 MPa and pressures higher than 500 MPa. The activation/inactivation kinetics of the enzyme was successfully modelled assuming consecutive reactions in series with activation followed by inactivation. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Zuo, Xuezhi; Tian, Chong; Zhao, Nana; Ren, Weiye; Meng, Yi; Jin, Xin; Zhang, Ying; Ding, Shibin; Ying, Chenjiang; Ye, Xiaolei
2014-03-02
Hyperglycemia-induced endothelial hyperpermeability is crucial to cardiovascular disorders and macro-vascular complications in diabetes mellitus. The objective of this study is to investigate the effects of green tea polyphenols (GTPs) on endothelial hyperpermeability and the role of nicotinamide adenine dinucleotide phosphate (NADPH) pathway. Male Wistar rats fed on a high fat diet (HF) were treated with GTPs (0, 0.8, 1.6, 3.2 g/L in drinking water) for 26 weeks. Bovine aortic endothelial cells (BAECs) were treated with high glucose (HG, 33 mmol/L) and GTPs (0.0, 0.4, or 4 μg/mL) for 24 hours in vitro. The endothelial permeabilities in rat aorta and monolayer BAECs were measured by Evans blue injection method and efflux of fluorescein isothiocyanate (FITC)-dextran, respectively. The reactive oxygen species (ROS) levels in rat aorta and monolayer BAECs were measured by dihydroethidium (DHE) and 2', 7'-dichloro-fluorescein diacetate (DCFH-DA) fluorescent probe, respectively. Protein levels of NADPH oxidase subunits were determined by Western-blot. HF diet-fed increased the endothelial permeability and ROS levels in rat aorta while HG treatments increased the endothelial permeability and ROS levels in cultured BAECs. Co-treatment with GTPs alleviated those changes both in vivo and in vitro. In in vitro studies, GTPs treatments protected against the HG-induced over-expressions of p22phox and p67phox. Diphenylene iodonium chloride (DPI), an inhibitor of NADPH oxidase, alleviated the hyperpermeability induced by HG. GTPs could alleviate endothelial hyperpermeabilities in HF diet-fed rat aorta and in HG treated BAECs. The decrease of ROS production resulting from down-regulation of NADPH oxidase contributed to the alleviation of endothelial hyperpermeability.
De Neve, N; Vlaeminck, B; Gadeyne, F; Claeys, E; Van der Meeren, P; Fievez, V
2018-03-16
Previously, polyunsaturated fatty acids (PUFA) from linseed oil were effectively protected (>80%) against biohydrogenation through polyphenol-oxidase-mediated protein crosslinking of an emulsion, prepared with polyphenol oxidase (PPO) extract from potato tuber peelings. However, until now, emulsions of only 2 wt% oil have been successfully protected, which implies serious limitations both from a research perspective (e.g. in vivo trials) as well as for further upscaling toward practical applications. Therefore, the aim of this study was to increase the oil/PPO ratio. In the original protocol, the PPO extract served both an emulsifying function as well as a crosslinking function. Here, it was first evaluated whether alternative protein sources could replace the emulsifying function of the PPO extract, with addition of PPO extract and 4-methylcatechol (4MC) to induce crosslinking after emulsion preparation. This approach was then further used to evaluate protection of emulsions with higher oil content. Five candidate emulsifiers (soy glycinin, gelatin, whey protein isolate (WPI), bovine serum albumin and sodium caseinate) were used to prepare 10 wt% oil emulsions, which were diluted five times (w/w) with PPO extract (experiment 1). As a positive control, 2 wt% oil emulsions were prepared directly with PPO extract according to the original protocol. Further, emulsions of 2, 4, 6, 8 and 10 wt% oil were prepared, with 80 wt% PPO extract (experiment 2), or with 90, 80, 70, 60 and 50 wt% PPO extract, respectively (experiment 3) starting from WPI-stabilized emulsions. Enzymatic crosslinking was induced by 24-h incubation with 4MC. Ruminal protection efficiency was evaluated by 24-h in vitro batch simulation of the rumen metabolism. In experiment 1, protection efficiencies were equal or higher than the control (85.5% to 92.5% v. 81.3%). In both experiments 2 and 3, high protection efficiencies (>80%) were achieved, except for emulsions containing 10 wt% oil emulsions (<50
Ramiro, Daniel Alves; Guerreiro-Filho, Oliveiro; Mazzafera, Paulo
2006-09-01
We examined the role of phenolic compounds, and the enzymes peroxidase and polyphenol oxidase, in the expression of resistance of coffee plants to Leucoptera coffeella (Lepidoptera: Lyonetiidae). The concentrations of total soluble phenols and chlorogenic acid (5-caffeoylquinic acid), and the activities of the oxidative enzymes peroxidase (POD) and polyphenol oxidase (PPO), were estimated in leaves of Coffea arabica, C. racemosa, and progenies of crosses between these species, which have different levels of resistance, before and after attack by this insect. The results indicate that phenols do not play a central role in resistance to the coffee leaf miner. Differences were detected between the parental species in terms of total soluble phenol concentrations and activities of the oxidative enzymes. However, resistant and susceptible hybrid plants did not differ in any of these characteristics. Significant induction of chlorogenic acid and PPO was only found in C. racemosa, the parental donator of the resistance genes against L. coffeella. High-performance liquid chromatography (HPLC) analysis also showed qualitative similarity between hybrids and the susceptible C. arabica. These results suggest that the phenolic content and activities of POD and PPO in response to the attack by the leaf miner may not be a strong evidence of their participation in direct defensive mechanisms.
Wound-Induced Deposition of Polyphenols in Transgenic Plants Overexpressing Peroxidase 1
Lagrimini, L. Mark
1991-01-01
Tobacco (Nicotiana tabacum) plants transformed with a chimeric tobacco anionic peroxidase gene have previously been shown to synthesize high levels of peroxidase in all tissues throughout the plant. One of several distinguishable phenotypes of transformed plants is the rapid browning of pith tissue upon wounding. Pith tissue from plants expressing high levels of peroxidase browned within 24 hours of wounding, while tissue from control plants did not brown as late as 7 days after wounding. A correlation between peroxidase activity and wound-induced browning was observed, whereas no relationship between polyphenol oxidase activity and browning was found. The purified tobacco anionic peroxidase was subjected to kinetic analysis with substrates which resemble the precursors of lignin or polyphenolic acid. The purified enzyme was found to readily polymerize phenolic acids in the presence of H2O2 via a modified ping-pong mechanism. The percentage of lignin and lignin-related polymers in cell walls was nearly twofold greater in pith tissue isolated from peroxidase-overproducer plants compared to control plants. Lignin deposition in wounded pith tissue from control plants closely followed the induction of peroxidase activity. However, wound-induced lignification occurred 24 to 48 hours sooner in plants overexpressing the anionic peroxidase. This suggests that the availability of peroxidase rather than substrate may delay polyphenol deposition in wounded tissue. ImagesFigure 1Figure 2Figure 3 PMID:16668224
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Dicko, Mamoudou H; Hilhorst, Riet; Gruppen, Harry; Traore, Alfred S; Laane, Colja; van Berkel, Willem J H; Voragen, Alphons G J
2002-06-19
Analysis of fifty sorghum [Sorghum bicolor (L.) Moench] varieties used in Burkina Faso showed that they have different contents of phenolic compounds, peroxidase (POX), and polyphenol oxidase (PPO). Most of the varieties (82%) had a tannin content less than 0.25% (w/w). POX specific activity was higher than the monophenolase and o-diphenolase specific activities of PPO. For POX, there was a diversity of isoforms among varieties. No clear correlation could be made between the quantitative composition of the grain in phenolics, PPO, and POX, and resistance of plant to pathogens. In general, varieties good for a thick porridge preparation ("tô") had low phenolic compounds content and a medium POX activity. From the red varieties, those used for local beer ("dolo") had a high content in phenolic compounds and PPO, and a low POX activity. The variety considered good for couscous had a low POX content. The characteristics might be useful as selection markers for breeding for specific applications.
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
Characterization of two brassinosteroid C-6 oxidase genes in pea.
Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B
2007-04-01
C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.
Todaro, Aldo; Peluso, Orazio; Catalano, Anna Eghle; Mauromicale, Giovanni; Spagna, Giovanni
2010-02-10
Several papers helped with the development of more methods to control browning, or study thermal polyphenol oxidase (PPO) inactivation, but did not provide any solutions to technological process problems and food process improvement. Artichokes [ Cynara cardunculus L. var. scolymus L. (Fiori)] are susceptible to browning; this alteration could affect and reduce the suitability for its use, fresh or processed. Within this study, the catecholase and cresolase activities of PPO from three different Sicilian artichokes cultivar were characterized with regard to substrate specificity and enzyme kinetics, optimum pH and temperature, temperature and pH stability, and inhibitor test; all of the results were used for technological purposes, particularly to optimize minimally processed productions (ready-to-eat and cook-chilled artichokes).
García-García, María Inmaculada; Hernández-García, Samanta; Sánchez-Ferrer, Álvaro; García-Carmona, Francisco
2013-06-26
Red Globe grape polyphenol oxidase, partially purified using phase partitioning with Triton-X114, was used to study the oxidation of hydroxytytosol (HT) and its related compounds tyrosol (TS), tyrosol acetate (TSA), and hydroxytyrosol acetate (HTA). The enzyme showed activity toward both monophenols (monophenolase activity) and o-diphenols (diphenolase activity) with a pH optimum (pH 6.5) that was independent of the phenol used. However, the optimal temperature for diphenolase activity was substrate-dependent, with a broad optimum of 25-65 °C for HT, compared with the maximum obtained for HTA (40 °C). Monophenolase activity showed the typical lag period, which was modulated by pH, substrate and enzyme concentrations, and the presence of catalytic amounts of o-diphenols. When the catalytic power (Vmax/K(M)) was determined for both activities, higher values were observed for o-diphenols than for monophenols: 9-fold higher for the HT/TS pair and 4-fold higher for HTA/TSA pair. Surprisingly, this ratio was equally higher for TSA (2.2-fold) compared with that of TS, whereas no such effect was observed for o-diphenols. This higher efficiency of TSA could be related to its greater hydrophobicity. Acetyl modification of these phenols not only changes the kinetic parameters of the enzyme but also affects their antioxidant activity (ORAC-FL assays), which is lower in HTA than in HT.
Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R
2010-01-27
The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.
Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai
2016-01-01
Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ⩽ 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. Copyright © 2015 Elsevier Ltd. All rights reserved.
Diwakar, Sanjeev Kumar; Mishra, Sarad Kumar
2011-01-01
An ionically unbound and thermostable polyphenol oxidase (PPO) was extracted from the leaf of Musa paradisiaca. The enzyme was purified 2.54-fold with a total yield of 9.5% by ammonium sulfate precipitation followed by Sephadex G-100 gel filtration chromatography. The purified enzyme exhibited a clear single band on native polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS) PAGE. It was found to be monomeric protein with molecular mass of about 40 kD. The zymographic study using crude extract as enzyme source showed a very clear band around 40 kD and a faint band at around 15 kD, which might be isozymes. The enzyme was optimally active at pH 7.0 and 50°C temperature. The enzyme was active in wide range of pH (4.0-9.0) and temperature (30-90°C). From the thermal inactivation studies in the range 60-75°C, the half-life (t(1/2)) values of the enzyme ranged from 17 to 77 min. The inactivation energy (Ea) value of PPO was estimated to be 91.3 kJ mol(-1). It showed higher specificity with catechol (K(m) = 8 mM) as compared to 4-methylcatechol (K(m) = 10 mM). Among metal ions and reagents tested, Cu(2+), Fe(2+), Hg(2+), Mn(2+), Ni(2+), protocatechuic acid, and ferrulic acid enhanced the enzyme activity, while K(+), Na(+), Co(2+), kojic acid, ascorbic acid, ethylenediamine tetraacetic acid (EDTA), sodium azide, β-mercaptoethanol, and L-cysteine inhibited the activity of the enzyme.
Hemachandran, Hridya; Anantharaman, Amrita; Mohan, Sankari; Mohan, Gopalakrishnan; Kumar, D Thirumal; Dey, Diksha; Kumar, Drishty; Dey, Priyanka; Choudhury, Amrita; George Priya Doss, C; Ramamoorthy, Siva
2017-07-15
The hunt for anti-browning agents in the food and agricultural industries aims to minimize nutritional loss and prolong post harvest storage. In the present study, the effect of cyanidin-3-sophoroside (CS) from Garcinia mangostana rind, on polyphenol oxidase (PPO) activity was investigated. The non-competitive inhibition mode of CS was determined by Lineweaver Burk plot. CS forms a ground-state complex by quenching the intrinsic fluorescence of PPO. The static quenching was temperature-dependent with an activation energy of 4.654±0.1091kJmol -1 to withstand the disruption of amino acid residues of the enzyme binding site. The enzyme conformational change was validated by 3D fluorescence and CD spectrum. Docking (binding energy -8.124kcal/mol) and simulation studies confirmed the binding pattern and stability. CS decreased PPO activity and browning index of fresh cut apples and prolonged the shelf life. Thus, CS appears to be a promising anti-browning agent to control enzymatic browning. Copyright © 2017 Elsevier Ltd. All rights reserved.
Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan
2010-01-01
In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125
Dietary polyphenols and chromatin remodeling.
Russo, Gian Luigi; Vastolo, Viviana; Ciccarelli, Marco; Albano, Luigi; Macchia, Paolo Emidio; Ungaro, Paola
2017-08-13
Polyphenols are the most abundant phytochemicals in fruits, vegetables, and plant-derived beverages. Recent findings suggest that polyphenols display the ability to reverse adverse epigenetic regulation involved in pathological conditions, such as obesity, metabolic disorder, cardiovascular and neurodegenerative diseases, and various forms of cancer. Epigenetics, defined as heritable changes to the transcriptome, independent from those occurring in the genome, includes DNA methylation, histone modifications, and posttranscriptional gene regulation by noncoding RNAs. Sinergistically and cooperatively, these processes regulate gene expression by changing chromatin organization and DNA accessibility. Such induced epigenetic changes can be inherited during cell division, resulting in permanent maintenance of the acquired phenotype, but they may also occur throughout an individual life-course and may ultimately influence phenotypic outcomes (health and disease risk). In the last decade, a number of studies have shown that nutrients can affect metabolic traits by altering the structure of chromatin and directly regulate both transcription and translational processes. In this context, dietary polyphenol-targeted epigenetics becomes an attractive approach for disease prevention and intervention. Here, we will review how polyphenols, including flavonoids, curcuminoids, and stilbenes, modulate the establishment and maintenance of key epigenetic marks, thereby influencing gene expression and, hence, disease risk and health.
Bi, Xiufang; Hemar, Yacine; Balaban, Murat O; Liao, Xiaojun
2015-11-01
The effect of ultrasound treatment on particle size, color, viscosity, polyphenol oxidase (PPO) activity and microstructure in diluted avocado puree was investigated. The treatments were carried out at 20 kHz (375 W/cm(2)) for 0-10 min. The surface mean diameter (D[3,2]) was reduced to 13.44 μm from an original value of 52.31 μm by ultrasound after 1 min. A higher L(∗) value, ΔE value and lower a(∗) value was observed in ultrasound treated samples. The avocado puree dilution followed pseudoplastic flow behavior, and the viscosity of diluted avocado puree (at 100 s(-1)) after ultrasound treatment for 1 min was 6.0 and 74.4 times higher than the control samples for dilution levels of 1:2 and 1:9, respectively. PPO activity greatly increased under all treatment conditions. A maximum increase of 25.1%, 36.9% and 187.8% in PPO activity was found in samples with dilution ratios of 1:2, 1:5 and 1:9, respectively. The increase in viscosity and measured PPO activity might be related to the decrease in particle size. The microscopy images further confirmed that ultrasound treatment induced disruption of avocado puree structure. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo
2007-07-01
Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period.
Dirks-Hofmeister, Mareike E.; Singh, Ratna; Leufken, Christine M.; Inlow, Jennifer K.; Moerschbacher, Bruno M.
2014-01-01
Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure–function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a “selector” for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates. PMID:24918587
Dirks-Hofmeister, Mareike E; Singh, Ratna; Leufken, Christine M; Inlow, Jennifer K; Moerschbacher, Bruno M
2014-01-01
Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure-function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a "selector" for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates.
Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.
Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro
2002-07-19
The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.
MONOAMINE OXIDASE: From Genes to Behavior
Shih, J. C.; Chen, K.; Ridd, M. J.
2010-01-01
Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537
Niphadkar, Sonali S; Rathod, Virendra K
2015-01-01
Conventional three phase partitioning (TPP) and ultrasound assisted three phase partitioning (UATPP) were optimized for achieving the maximum extraction and purification of polyphenol oxidase (PPO) from waste potato peels. Different process parameters such as ammonium sulfate (NH4)2SO4 concentration, crude extract to t-butanol ratio, time, temperature and pH were studied for conventional TPP. Except agitation speed, the similar parameters were also optimized for UATPP. Further additional parameters were also studied for UATPP viz. irradiation time at different frequencies, duty cycle and, rated power in order to obtain the maximum purification factor and recovery of PPO. The optimized conditions for conventional TPP were (NH4)2SO4 0-40% (w/v), extract to t-butanol ratio 1:1 (v/v), time 40 min and pH 7 at 30°C. These conditions provided 6.3 purification factor and 70% recovery of PPO from bottom phase. On the other hand, UATPP gives maximum purification fold of 19.7 with 98.3% recovery under optimized parameters which includes (NH4)2SO4 0-40% (w/v), crude extract to t-butanol ratio 1: 1 (v/v) pH 7, irradiation time 5 min with 25 kHz, duty cycle 40% and rated power 150W at 30°C. UATPP delivers higher purification factor and % recovery of PPO along with reduced operation time from 40 min to 5 min when compared with TPP. SDS PAGE showed partial purification of PPO enzyme with UATPP with molecular weight in the range of 26-36 kDa. Results reveal that UATPP would be an attractive option for the isolation and purification of PPO without need of multiple steps. © 2015 American Institute of Chemical Engineers.
González-Cebrino, Francisco; Durán, Rocío; Delgado-Adámez, Jonathan; Contador, Rebeca; Bernabé, Rosario Ramírez
2016-04-01
Physicochemical parameters, bioactive compounds' content (carotenoids and total phenols), total antioxidant activity, and enzymatic activity of polyphenol oxidase (PPO) were evaluated after high pressure processing (HPP) on a pumpkin purée (cv. 'Butternut'). Three pressure levels (400, 500, and 600 MPa) were combined with three holding times (200, 400, and 600 s). The applied treatments reduced the levels of total aerobic mesophilic (TAM), total psychrophilic and psychrotrophic bacteria (TPP), and molds and yeasts (M&Y). All applied treatments did not affect enzymatic activity of PPO. Pressure level increased CIE L* values, which could enhance the lightness perception of high pressure (HP)-treated purées. No differences were found between the untreated and HP-treated purées regarding total phenols and carotenoids content (lutein, α-carotene, and β-carotene) and total antioxidant activity. HPP did not affect most quality parameters and maintained the levels of bioactive compounds. However, it did not achieve the complete inhibition of PPO, which could reduce the shelf-life of the pumpkin purée. © The Author(s) 2015.
Sellés-Marchart, Susana; Casado-Vela, Juan; Bru-Martínez, Roque
2007-08-15
The effects of detergents, trypsin and fatty acids on structural and functional properties of a pure loquat fruit latent polyphenol oxidase have been studied in relation to its regulation. Anionic detergents activated PPO at pH 6.0 below critical micelle concentration (cmc), but inhibited at pH 4.5 well above cmc. This behavior is due to a detergent-induced pH profile alkaline shift, accompanied by changes of intrinsic fluorescence of the protein. Gel filtration experiments demonstrate the formation of PPO-SDS mixed micelles. Partial PPO proteolysis suggest that latent PPO losses an SDS micelle-interacting region but conserves an SDS monomer-interacting site. Unsaturated fatty acids inhibit PPO at pH 4.5, the strongest being linolenic acid while the weakest was gamma-linolenic acid for both, the native and the trypsin-treated PPO. Down-regulation of PPO activity by anionic amphiphiles is discussed based on both, the pH profile shift induced upon anionic amphiphile binding and the PPO interaction with negatively charged membranes.
Hong, Mee Young; Seeram, Navindra P.; Heber, David
2008-01-01
Prostate cancer is dependent on circulating testosterone in its early stages and is treatable with radiation and surgery. However, recurrent prostate tumors advance to an androgen-independent state where they progress in the absence of circulating testosterone leading to metastasis and death. During the development of androgen independence, prostate cancer cells are known to increase intracellular testosterone synthesis which maintains cancer cell growth in the absence of significant amounts of circulating testosterone. Overexpression of the androgen receptor (AR) occurs in androgen-independent prostate cancer and has been proposed as another mechanism promoting the development of androgen independence. The LNCaP-AR cell line is engineered to overexpress AR but is otherwise similar to the widely studied LNCaP cell line. We have previously shown that pomegranate extracts inhibit both androgen-dependent and androgen-independent prostate cancer cell growth. In the present study, we examined the effects of pomegranate polyphenols, ellagitannin-rich extract and whole juice extract on the expression of genes for key androgen synthesizing enzymes and the AR. We measured expression of the HSD3B2, AKR1C3 and SRD5A1 genes for the respective androgen synthesizing enzymes in LNCaP, LNCaP-AR, and DU-145 human prostate cancer cells. A two-fold suppression of gene expression was considered statistically significant. Pomegranate polyphenols inhibited gene expression and AR most consistently in the LNCaP-AR cell line (P =.05). Therefore, inhibition by pomegranate polyphenols of gene expression involved in androgen synthesis enzymes and the AR may be of particular importance in androgen-independent prostate cancer cells and the subset of human prostate cancers where AR is upregulated. PMID:18479901
Antunes, Rafael Souza; Ferraz, Denes; Garcia, Luane Ferreira; Thomaz, Douglas Vieira; Luque, Rafael; Lobón, Germán Sanz; Gil, Eric de Souza; Lopes, Flávio Marques
2018-05-15
In this work, an innovative polyphenol oxidase biosensor was developed from Jenipapo ( Genipa americana L.) fruit and used to assess phenolic compounds in industrial effluent samples obtained from a textile industry located in Jaraguá-GO, Brasil. The biosensor was prepared and optimized according to: the proportion of crude vegetal extract, pH and overall voltammetric parameters for differential pulse voltammetry. The calibration curve presented a linear interval from 10 to 310 µM (r² = 0.9982) and a limit of detection of 7 µM. Biosensor stability was evaluated throughout 15 days, and it exhibited 88.22% of the initial response. The amount of catechol standard recovered post analysis varied between 87.50% and 96.00%. Moreover, the biosensor was able to detect phenolic compounds in a real sample, and the results were in accordance with standard spectrophotometric assays. Therefore, the innovatively-designed biosensor hereby proposed is a promising tool for phenolic compound detection and quantification when environmental contaminants are concerned.
Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.
2014-01-01
Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264
Konaté, K; Souza, A; Coulibaly, A Y; Meda, N T R; Kiendrebeogo, M; Lamien-Meda, A; Millogo-Rasolodimby, J; Lamidi, M; Nacoulma, O G
2010-11-15
In this study polyphenol content, antioxidant activity, lipoxygenase (LOX) and Xanthine Oxidase (XO) inhibitory effects of n-hexane, dichloromethane, ethyl acetate and n-butanol fractions of aqueous acetone extracts from S. alba L., S. acuta Burn f and Cienfuegosia digitata Cav. were investigated. The total phenolics, flavonoids, flavonols and total tannins were determined by spectrophotometric methods using Folin-ciocalteu, AlCl3 reagents and tannic acid, respectively. The antioxidant potential was evaluated using three methods: inhibition of free radical 2,2-diphenyl-1-picrylhydramzyl (DPPH), ABTS radical cation decolorization assay and Iron (III) to iron (II) reduction activity (FRAP). For enzymatic activity, lipoxygenase and xanthine oxidase inhibitory activities were used. This study shows a relationship between polyphenol contents, antioxidant and enzymatic activities. Present results showed that ethyl acetate and dichloromethane fractions elicit the highest polyphenol content, antioxidant and enzymatic activities.
Kimura, Yuji; Takahashi, Ayumi; Kashiwada, Ayumi; Yamada, Kazunori
2015-01-01
In this study, the combined use of a biopolymer chitosan and an oxidoreductase polyphenol oxidase (PPO) was systematically investigated for the removal of bisphenol derivatives from aqueous medium. The process parameters, such as the pH value, temperature, and PPO concentration, were estimated to conduct the enzymatic quinone oxidation of bisphenol derivatives by as little enzyme as possible. Bisphenol derivatives effectively underwent PPO-catalysed quinone oxidation without H2O2 unlike other oxidoreductases, such as peroxidase and tyrosinase, and the optimum conditions were determined to be pH 7.0 and 40°C for bisphenol B, bisphenol E, bisphenol O, and bisphenol Z; pH 7.0 and 30°C for bisphenol C and bisphenol F; and pH 8.0 and 40°C for bisphenol T. They were completely removed through adsorption of enzymatically generated quinone derivatives on chitosan beads or chitosan powders. Quinone adsorption on chitosan beads or chitosan powders in the heterogeneous system was found to be a more effective procedure than generation of aggregates in the homogeneous system with chitosan solution. The removal time was shortened by increasing the amount of chitosan beads or decreasing the size of the chitosan powders.
Segovia-Bravo, Kharla A; Jarén-Galan, Manuel; García-García, Pedro; Garrido-Fernandez, Antonio
2007-08-08
The crude extract of the polyphenol oxidase (PPO) enzyme from the Manzanilla cultivar (Olea europaea pomiformis) was obtained, and its properties were characterized. The browning reaction followed a zero-order kinetic model. Its maximum activity was at pH 6.0. This activity was completely inhibited at a pH below 3.0 regardless of temperature; however, in alkaline conditions, pH inhibition depended on temperature and was observed at values above 9.0 and 11.0 at 8 and 25 degrees C, respectively. The thermodynamic parameters of substrate oxidation depended on pH within the range in which activity was observed. The reaction occurred according to an isokinetic system because pH affected the enzymatic reaction rate but not the energy required to carry out the reaction. In the alkaline pH region, browning was due to a combination of enzymatic and nonenzymatic reactions that occurred in parallel. These results correlated well with the browning behavior observed in intentionally bruised fruits at different temperatures and in different storage solutions. The use of a low temperature ( approximately 8 degrees C) was very effective for preventing browning regardless of the cover solution used.
Deodorization of Garlic Breath by Foods, and the Role of Polyphenol Oxidase and Phenolic Compounds.
Mirondo, Rita; Barringer, Sheryl
2016-10-01
Garlic causes a strong garlic breath that may persist for almost a day. Therefore, it is important to study deodorization techniques for garlic breath. The volatiles responsible for garlic breath include diallyl disulfide, allyl mercaptan, allyl methyl disulfide, and allyl methyl sulfide. After eating garlic, water (control), raw, juiced or heated apple, raw or heated lettuce, raw or juiced mint leaves, or green tea were consumed immediately. The levels of the garlic volatiles on the breath were analyzed from 1 to 60 min by selected ion flow tube mass spectrometry (SIFT-MS). Garlic was also blended with water (control), polyphenol oxidase (PPO), rosemarinic acid, quercetin or catechin, and the volatiles in the headspace analyzed from 3 to 40 min by SIFT-MS. Raw apple, raw lettuce, and mint leaves significantly decreased all of the garlic breath volatiles in vivo. The proposed mechanism is enzymatic deodorization where volatiles react with phenolic compounds. Apple juice and mint juice also had a deodorizing effect on most of the garlic volatiles but were generally not as effective as the raw food, probably because the juice had enzymatic activity but the phenolic compounds had already polymerized. Both heated apple and heated lettuce produced a significant reduction of diallyl disulfide and allyl mercaptan. The presence of phenolic compounds that react with the volatile compounds even in the absence of enzymes is the most likely mechanism. Green tea had no deodorizing effect on the garlic volatile compounds. Rosmarinic acid, catechin, quercetin, and PPO significantly decreased all garlic breath volatiles in vitro. Rosmarinic acid was the most effective at deodorization. © 2016 Institute of Food Technologists®.
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake
2015-12-01
The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.
Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji
2015-08-01
Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at
Sullivan, Michael L; Foster, Jamie L
2013-08-15
Studies of perennial peanut (Arachis glabrata Benth.) suggest its hay and haylage have greater levels of rumen undegraded protein (RUP) than other legume forages such as alfalfa (Medicago sativa L.). Greater RUP can result in more efficient nitrogen utilization by ruminant animals with positive economic and environmental effects. We sought to determine whether, like red clover (Trifolium pretense L.), perennial peanut contains polyphenol oxidase (PPO) and PPO substrates that might be responsible for increased RUP. Perennial peanut extracts contain immunologically detectible PPO protein and high levels of PPO activity (>100 nkatal mg(-1) protein). Addition of caffeic acid (PPO substrate) to perennial peanut extracts depleted of endogenous substrates reduced proteolysis by 90%. Addition of phenolics prepared from perennial peanut leaves to extracts of either transgenic PPO-expressing or control (non-expressing) alfalfa showed peanut phenolics could reduce proteolysis >70% in a PPO-dependent manner. Two abundant likely PPO substrates are present in perennial peanut leaves including caftaric acid. Perennial peanut contains PPO and PPO substrates that together are capable of inhibiting post-harvest proteolysis, suggesting a possible mechanism for increased RUP in this forage. Research related to optimizing the PPO system in other forage crops will likely be applicable to perennial peanut. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Gouédard, Cédric; Barouki, Robert; Morel, Yannick
2004-01-01
Human paraoxonase 1 (PON-1) is a serum high-density lipoprotein-associated enzyme mainly secreted by the liver. It has endogenous and exogenous substrates and displays protective properties with respect to cardiovascular disease and organophosphate intoxication. In the HuH7 human hepatoma cell line, PON-1 activity and mRNA levels were increased by dietary polyphenolic compounds such as quercetin but also by toxic ligands of the aryl hydrocarbon receptor (AhR) such as 3-methylcholanthrene (3-MC). However, the 2,3,7,8-tetrachlorobenzo(p)dioxin (TCDD) was a poor inducer. Transient and stable transfection assays indicated that these compounds increased the PON-1 gene promoter activity in an AhR-dependent manner, since their effect was inhibited by 7-keto-cholesterol and AhR-directed short interfering RNA. Deletions and mutations studies showed that a xenobiotic responsive element (XRE)-like sequence within the PON-1 promoter mediated the effect of 3-MC and quercetin. In contrast with consensus XREs from the cytochrome P450 1A1 gene, the PON-1 XRE-like element mediated preferentially the effect of quercetin compared to the results seen with TCDD. Furthermore, AhR binding to this element was preferentially activated by quercetin. These observations provide a molecular mechanism for the regulation of the cardioprotective enzyme PON-1 by polyphenols. They suggest also that AhR ligands may differentially regulate gene expression depending on the DNA target sequence. PMID:15169886
Wedler, Jonas; Weston, Anna; Rausenberger, Julia; Butterweck, Veronika
2016-10-01
Classical production of rose oil is based on water steam distillation from the flowers of Rosa damascena. During this process, large quantities of waste water accrue which are discharged to the environment, causing severe pollution of both, groundwater and surface water due to a high content of polyphenols. We recently developed a strategy to purify the waste water into a polyphenol-depleted and a polyphenol-enriched fraction RF20-(SP-207). RF20-(SP-207) and sub-fraction F(IV) significantly inhibited cell proliferation and migration of HaCaT cells. Since there is a close interplay between these actions and inflammatory processes, here we focused on the fractions' influence on pro-inflammatory biomarkers. HaCaT keratinocytes were treated with RF20-(SP-207), F(IV) (both at 50μg/mL) and ellagic acid (10μM) for 24h under TNF-α (20ng/mL) stimulated and non-stimulated conditions. Gene expression of IL-1β, IL-6, IL-8, RANTES and MCP-1 was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR) and cellular protein secretion of IL-8, RANTES and MCP-1 was determined by ELISA based assays. RF20-(SP-207) and F(IV) significantly decreased the expression and cellular protein secretion of IL-1β, IL-6, IL-8, RANTES and MCP-1. The diminishing effects on inflammatory target gene expression were slightly less pronounced under TNF-α stimulated conditions. In conclusion, the recovered polyphenol fraction RF20-(SP-207) from rose oil distillation waste water markedly modified inflammatory target gene expression in vitro, and, therefore, could be further developed as alternative treatment of acute and chronic inflammation. Copyright © 2016 Elsevier B.V. All rights reserved.
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.
Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C
2003-05-01
Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.
Hystad, S M; Martin, J M; Graybosch, R A; Giroux, M J
2015-08-01
Characterized novel mutations present at Ppo loci account for the substantial reduction of the total kernel PPO activity present in a putative null Ppo - A1 genetic background. Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time-dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous Ppo genes, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels. To date, wheat noodle color improvement efforts have focused on breeding cultivars containing Ppo-D1 and Ppo-A1 alleles conferring reduced PPO activity. A major impediment to wheat quality improvement is a lack of additional Ppo alleles conferring reduced kernel PPO. In this study, a previously reported very low PPO line, 07OR1074, was found to contain a novel allele at Ppo-A2 and null alleles at the Ppo-A1 and Ppo-D1 loci. To examine the impact of each mutation upon kernel PPO, populations were generated from crosses between 07OR1074 and the hard white spring wheat cultivars Choteau and Vida. Expression analysis using RNA-seq demonstrated no detectable Ppo-A1 transcripts in 07OR1074 while Ppo-D1 transcripts were present at less than 10% of that seen in Choteau and Vida. Novel markers specific for the Ppo-D1 and Ppo-A2 mutations discovered in 07OR1074, along with the Ppo-A1 STS marker, were used to screen segregating populations. Evaluation of lines indicated a substantial genotypic effect on PPO with Ppo-A1 and Ppo-D1 alleles contributing significantly to total PPO in both populations. These results show that the novel mutations in Ppo-A1 and Ppo-D1 present in 07OR1074 are both important to lowering overall wheat seed PPO activity and may be useful to produce more desirable and marketable wheat-based products.
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...
Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R
2003-10-01
Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.
Tan, Thuan-Chew; Cheng, Lai-Hoong; Bhat, Rajeev; Rusul, Gulam; Easa, Azhar Mat
2014-01-01
Composition, physicochemical properties and enzyme inactivation kinetics of coconut water were compared between immature (IMC), mature (MC) and overly-mature coconuts (OMC). Among the samples studied, pH, turbidity and mineral contents for OMC water was the highest, whereas water volume, titratable acidity, total soluble solids and total phenolics content for OMC water were the lowest. Maturity was found to affect sugar contents. Sucrose content was found to increase with maturity, and the reverse trend was observed for fructose and glucose. Enzyme activity assessment showed that polyphenol oxidase (PPO) in all samples was more heat resistant than peroxidase (POD). Compared to IMC and MC, PPO and POD from OMC water showed the lowest thermal resistance, with D83.3°C=243.9s (z=27.9°C), and D83.3°C=129.9s (z=19.5°C), respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kanade, Santosh R.; Paul, Beena; Rao, A. G. Appu; Gowda, Lalitha R.
2006-01-01
Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase) – a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen – and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1±2 to 75.9±0.6 Å (1 Å=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141
Ozyürek, Mustafa; Bektaşoğlu, Burcu; Güçlü, Kubilay; Apak, Reşat
2009-03-16
Various dietary polyphenolics have been found to show an inhibitory effect on xanthine oxidase (XO) which mediates oxidative stress-originated diseases because of its ability to generate reactive oxygen species (ROS), including superoxide anion radical (O(2)(-)) and hydrogen peroxide. XO activity has usually been determined by following the rate of uric acid formation from xanthine-xanthine oxidase (X-XO) system using the classical XO activity assay (UV-method) at 295nm. Since some polyphenolics have strong absorption from the UV to visible region, XO-inhibitory activity of polyphenolics was alternatively determined without interference by directly measuring the formation of uric acid and hydrogen peroxide using the modified CUPRAC (cupric reducing antioxidant capacity) spectrophotometric method at 450nm. The CUPRAC absorbance of the incubation solution due to the reduction of Cu(II)-neocuproine reagent by the products of the X-XO system decreased in the presence of polyphenolics, the difference being proportional to the XO inhibition ability of the tested compound. The structure-activity relationship revealed that the flavones and flavonols with a 7-hydroxyl group such as apigenin, luteolin, kaempferol, quercetin, and myricetin inhibited XO-inhibitory activity at low concentrations (IC(50) values from 1.46 to 1.90microM), while the flavan-3-ols and naringin were less inhibitory. The findings of the developed method for quercetin and catechin in the presence of catalase were statistically alike with those of HPLC. In addition to polyphenolics, five kinds of herbs were evaluated for their XO-inhibitory activity using the developed method. The proposed spectrophotometric method was practical, low-cost, rapid, and could reliably assay uric acid and hydrogen peroxide in the presence of polyphenols (flavonoids, simple phenolic acids and hydroxycinnamic acids), and less open to interferences by UV-absorbing substances.
Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.
Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo
2004-10-01
The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.
Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P
2011-03-01
"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.
ERIC Educational Resources Information Center
May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.
2009-01-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…
Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime
2013-09-18
Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality.
Gu, Fenglin; Huang, Feifei; Wu, Guiping; Zhu, Hongying
2018-02-09
Black pepper ( Piper nigrum L.) is the most widely used spice in the world. Blackening is considered to be beneficial and important in the processing of black pepper because it contributes to its color and flavor. The purpose of this paper is to investigate polyphenol oxidation as well as the chlorophyll and vitamin C (VC) degradation in the blackening of Piper nigrum L. Black pepper was produced by four methods, and changes in polyphenols, chlorophyll and VC were studied by high performance liquid chromatography (HPLC) and ultraviolet-visible and visible (UV-Vis) spectrophotometry. The results show that polyphenol oxidase activity significantly decreased during the preparation of black pepper, and the concentrations of phenolic compounds, VC, and chlorophyll a and b also significantly decreased. Polyphenol oxidation and chlorophyll and VC degradation contribute to the blackening. A crude extract of phenolic compounds from black pepper was prepared by the system solvent method. The greater the polarity of the extraction solvent, the higher the extraction rates of the phenolic compounds and the total phenol content. Pepper phenolic compounds were analyzed by HPLC analysis.
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
QTL analysis and candidate gene mapping for the polyphenol content in cider apple.
Verdu, Cindy F; Guyot, Sylvain; Childebrand, Nicolas; Bahut, Muriel; Celton, Jean-Marc; Gaillard, Sylvain; Lasserre-Zuber, Pauline; Troggio, Michela; Guilet, David; Laurens, François
2014-01-01
Polyphenols have favorable antioxidant potential on human health suggesting that their high content is responsible for the beneficial effects of apple consumption. They control the quality of ciders as they predominantly account for astringency, bitterness, color and aroma. In this study, we identified QTLs controlling phenolic compound concentrations and the average polymerization degree of flavanols in a cider apple progeny. Thirty-two compounds belonging to five groups of phenolic compounds were identified and quantified by reversed phase liquid chromatography on both fruit extract and juice, over three years. The average polymerization degree of flavanols was estimated in fruit by phloroglucinolysis coupled to HPLC. Parental maps were built using SSR and SNP markers and used for the QTL analysis. Sixty-nine and 72 QTLs were detected on 14 and 11 linkage groups of the female and male maps, respectively. A majority of the QTLs identified in this study are specific to this population, while others are consistent with previous studies. This study presents for the first time in apple, QTLs for the mean polymerization degree of procyanidins, for which the mechanisms involved remains unknown to this day. Identification of candidate genes underlying major QTLs was then performed in silico and permitted the identification of 18 enzymes of the polyphenol pathway and six transcription factors involved in the apple anthocyanin regulation. New markers were designed from sequences of the most interesting candidate genes in order to confirm their co-localization with underlying QTLs by genetic mapping. Finally, the potential use of these QTLs in breeding programs is discussed.
Hisaminato, H; Murata, M; Homma, S
2001-05-01
Cut lettuce stored at 4 degrees C gradually turned brown on the cut section after several days of storage. Three factors for enzymatic browning, the polyphenol content, polyphenol oxidase activity, and phenylalanine ammonia-lyase (PAL) activity, were examined during the cold storage of cut lettuce. A relationship between the browning and PAL activity was apparent. We tried to prevent this browning by using the two enzyme inhibitors, 2-aminoindane-2-phosphonic acid (AIP), an inhibitor of the phenylpropanoid pathway, and glyphosate, an inhibitor of the shikimate pathway. AIP and glyphosate significantly inhibited the browning of cut lettuce. The polyphenol content and PAL activity were both reduced by the treatment with AIP. These results show that regulating the biosynthesis of polyphenols is essential to prevent the browning of cut lettuce.
Nawathean, P; Maslov, D A
2000-08-01
By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.
Inhibition of rat mammary microsomal oxidation of ethanol to acetaldehyde by plant polyphenols.
Maciel, María Eugenia; Castro, José Alberto; Castro, Gerardo Daniel
2011-07-01
We previously reported that the microsomal fraction from rat mammary tissue is able to oxidize ethanol to acetaldehyde, a mutagenic-carcinogenic metabolite, depending on the presence of NADPH and oxygen but not inhibited by carbon monoxide or other cytochrome P450 inhibitors. The process was strongly inhibited by diphenyleneiodonium, a known inhibitor of NADPH oxidase, and by nordihydroguaiaretic acid, an inhibitor of lipoxygenases. This led us to suggest that both enzymes could be involved. With the purpose of identifying natural compounds present in food with the ability to decrease the production of acetaldehyde in mammary tissue, in the present studies, several plant polyphenols having inhibitory effects on lipoxygenases and of antioxidant nature were tested as potential inhibitors of the rat mammary tissue microsomal pathway of ethanol oxidation. We included in the present screening study 32 polyphenols having ready availability and that were also tested against the rat mammary tissue cytosolic metabolism of ethanol to acetaldehyde. Several polyphenols were also able to inhibit the microsomal ethanol oxidation at concentrations as low was 10-50 μM. The results of these screening experiments suggest the potential of several plant polyphenols to prevent in vivo production and accumulation of acetaldehyde in mammary tissue.
A novel proteolytic processing of prolysyl oxidase
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo
2012-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931
A novel proteolytic processing of prolysyl oxidase.
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo
2011-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.
Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.
Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J
1979-12-01
Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.
Okai, Y; Higashi-Okai, K
1997-11-25
Antigenotoxic and antimutagenic activities of green tea extract and tea-derived polyphenols have been studied using in vitro and in vivo experiments. However, antigenotoxic substances in the non-polyphenolic fraction of green tea have been poorly elucidated. In the present study, the effect of the non-polyphenolic fraction of green tea on genotoxin-induced umu C gene expression was analyzed using a tester bacteria, and potent antigenotoxic substances in the non-polyphenolic fraction were identified. The non-polyphenolic fraction of green tea showed strong suppressive activities against umu C gene expression in Salmonella typhimurium (TA 1535/pSK 1002) induced by 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indol (Trp-P-1) or mitomycin C (MMC) in the presence or absence of S9 metabolizing enzyme mixture. The non-polyphenolic fraction of green tea exhibited major two-color bands in a silica gel TLC and they were identified as chlorophyll-related compounds, pheophytins a and b, judged by their specific colors, Rf values in silica gel TLC and absorption spectra. These pigments showed significant suppressive activities against umu C gene expression in tester bacteria induced by Trp-P- and MMC in a dose-dependent manner. These results suggest that the non-polyphenolic fraction of green tea contains pheophytins a and b as potent antigenotoxic substances.
Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki
2013-02-01
In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.
Isolation and characterization of the pea cytochrome c oxidase Vb gene.
Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi
2006-11-01
Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.
Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian
2007-08-01
A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.
Sheptovitsky, Y G; Brudvig, G W
1996-12-17
Photosystem II (PSII) membranes exhibit catalase and polyphenol oxidase (PPO) activities. Mild heat treatment of PSII membranes for 90 min at 30 degrees C releases most of these enzyme activities into the supernatant, accompanied by a 7-fold activation of PPO. In contrast, mild heat treatment of thylakoid membranes does not release significant amounts of either activity, indicating that both enzymes are bound to the luminal surface of the thylakoid membrane. The heat-released PSII membrane-associated catalase and PPO have been purified and characterized. Catalase activity was correlated with a 63 kDa polypeptide which was purified by batch adsorption to anion-exchange beads followed by gel filtration. The PSII membrane-associated catalase is unstable in solution, probably due to irreversible aggregation. The enzyme was characterized in terms of molecular and subunit size, amino-acid composition, UV-visible absorption, heme content, pH optimum, inhibitor sensitivity, and K(m) value for H2O2. Its properties indicate that the PSII membrane-associated catalase is a luminal thylakoid membrane-bound heme enzyme that has not been identified previously. The residual catalase activity of PSII membranes after mild heat treatment is irreversibly inhibited with 3-amino-1,2,4-triazole, a specific inhibitor of heme catalases, without inhibition of O2-evolution activity. This result indicates that little, if any, of the catalase activity from PSII membranes in the dark is catalyzed by the O2-evolving center of PSII. PPO activity was correlated with a 48 kDa polypeptide. However, the 48 kDa polypeptide and another heat-released polypeptide of 72 kDa have the same N-terminal sequence, which is also identical to that of a known 64 kDa protein [Hind, G., Marshak, D. R., & Coughlan, S. J. (1995) Biochemistry 34, 8157-8164]. During heat treatment of PSII membranes and further manipulations it was found that the 72 kDa polypeptide was largely converted into the 48 kDa polypeptide. Thus
Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus
Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds
2016-01-01
The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...
Cocoa polyphenols and fiber modify colonic gene expression in rats.
Massot-Cladera, Malen; Franch, Àngels; Castell, Margarida; Pérez-Cano, Francisco J
2017-08-01
Cocoa intake has been associated with health benefits, improving cardiovascular function and metabolism, as well as modulating intestinal immune function. The aim of this study was to take an in-depth look into the mechanisms affected by the cocoa intake by evaluating the colonic gene expression after nutritional intervention, and to ascertain the role of the fiber of cocoa in these effects. To achieve this, Wistar rats were fed for 3 weeks with either a reference diet, a diet containing 10 % cocoa (C10), a diet based on cocoa fiber (CF) or a diet containing inulin (I). At the end of the study, colon was excised to obtain the RNA to evaluate the differential gene expression by microarray. Results were validated by RT-PCR. The C10 group was the group with most changes in colonic gene expression, most of them down-regulated but a few in common with the CF diet. The C10 diet significantly up-regulated the expression of Scgb1a1 and Scnn1 g and down-regulated Tac4, Mcpt2, Fcer1a and Fabp1 by twofold, most of them related to lipid metabolism and immune function. The CF and I diets down-regulated the expression of Serpina10 and Apoa4 by twofold. Similar patterns of expression were found by PCR. Most of the effects attributed to cocoa consumption on genes related to the immune system (B cell and mast cell functionality) and lipid metabolism in the colon tissue were due not only to its fiber content, but also to the possible contribution of polyphenols and other compounds.
Sugie, Atsushi; Murai, Koji; Takumi, Shigeo
2007-06-01
Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.
Altındağ, Melek; Türkyılmaz, Meltem; Özkan, Mehmet
2018-05-01
Changes in polyphenols have important effects on the quality (especially color) and health benefits of dried apricots. SO 2 concentration, storage and the activities of polyphenol oxidase (PPO) and phenylalanine ammonia lyase (PAL) were factors which had significant effects on polyphenols. Polyphenol profile and activities of PPO and PAL in sulfured dried apricots (SDAs, 0, 451, 832, 2112 and 3241 mg SO 2 kg -1 ) were monitored during storage at 4, 20 and 30 °C for 379 days for the first time. Even the lowest SO 2 concentration (451 mg kg -1 ) was sufficient to inactivate PPO during the entire storage period. However, while SO 2 led to the increase in PAL activity of the samples (r = 0.767) before storage, PAL activities of SDAs decreased during storage. After 90 days of storage, PAL activity was determined in only non-sulfured dried apricots (NSDAs) and dried apricots containing 451 mg SO 2 kg -1 . Although the major polyphenol in NSDAs was epicatechin (611.4 mg kg -1 ), that in SDAs was chlorogenic acid (455-1508 mg kg -1 ), followed by epicatechin (0-426.8 mg kg -1 ), rutin (148.9-477.3 mg kg -1 ), ferulic acid (23.3-55.3 mg kg -1 ) and gallic acid (2.4-43.6 mg kg -1 ). After storage at 30 °C for 379 days, the major polyphenol in SDAs was gallic acid (706-2324 mg kg -1 ). However, the major polyphenol in NSDAs did not change after storage. The highest total polyphenol content was detected in SDAs containing 2112 mg SO 2 kg -1 and stored at 30 °C. To produce dried apricots having high polyphenol content, ∼2000 mg SO 2 kg -1 should be used. Low storage temperature (<30 °C) was not necessary for the protection of polyphenols. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Allam, Mai A; Saker, Mahmoud M
2017-01-01
The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.
Saric, Suzana; Sivamani, Raja K
2016-09-09
Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA) and ultraviolet B (UVB) radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats). Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP), Calluna vulgaris (Cv), grape seeds, honeybush, and Lepidium meyenii (maca). Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols.
Saric, Suzana; Sivamani, Raja K.
2016-01-01
Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA) and ultraviolet B (UVB) radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats). Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP), Calluna vulgaris (Cv), grape seeds, honeybush, and Lepidium meyenii (maca). Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols. PMID:27618035
Chai, Baozhong; Qiao, Yunqian; Wang, He; Zhang, Xiaoming; Wang, Jiao; Wang, Choushi; Zhou, Ping; Chen, Xiangdong
2017-01-01
Pyomelanin is the major constituent of pigment in melanogenic Aeromonas strains of bacteria. However, eumelanin, synthesized from tyrosine via L-DOPA and polyphenol oxidases (PPOs), may also be present in this genus since L-DOPA is frequently detected in culture fluids of several species. To address this question, we used a deletion mutant of Aeromonas media strain WS, in which pyomelanin synthesis is completely blocked under normal culture conditions. When tyrosine was supplied to the medium, we observed residual melanin accumulation, which we interpret as evidence for existence of the DOPA-melanin pathway. We traced enzymatic activity in this bacterium using native-polyacrylamide gel electrophoresis. Two PPOs: YfiH, a laccase-like protein, and CatA, a catalase, were identified. However, neither protein was critical for the residual pigmentation in pyomelanin-deficient mutant. We speculate that eumelanin synthesis may require other unknown enzymes. Deletion of yfiH did not affect pigmentation in A. media strain WS, while deletion of the CatA-encoding gene katE resulted in a reduction of melanin accumulation, but it started 9 h earlier than in the wild-type. Since catalases regulate reactive oxygen species levels during melanogenesis, we speculated that CatA affects pigmentation through its peroxyl radical scavenging capacity. Consistent with this, expression of the catalases Hpi or Hpii from Escherichia coli in the katE deletion strain of A. media strain WS restored pigmentation to the wild-type level. Hpi and Hpii also exhibited PPO activity, suggesting that catalase may represent a new class of PPOs. PMID:29051758
Okot-Kotber, Moses; Liavoga, Allan; Yong, Kwon-Joong; Bagorogoza, Katherine
2002-04-10
Polyphenol oxidase (PPO), known to induce browning in wheat-based products, has been shown to be activatable in wheat (Triticum aestivum) bran extracts by chemical compounds. The activity in the extracts could be increased to varying degrees with acetone, methanol, ethanol, 2-propanol, and n-butanol as additives in the extraction buffer. The most potent alcoholic activator was n-butanol (about a 3-fold increase), followed by 2-propanol and ethanol, whereas methanol had the least effect. Ionic detergents in the extraction buffer were also good activators, with sodium dodecyl sulfate (SDS) being more potent (3-fold increase) than cetyltrimethylammonium bromide (CTAB) that had only half as much effect, whereas the nonionic detergent, Triton X-114, was ineffective. The chaotropes, urea and guanidine x HCl (GND), were the most potent activators of all, increasing the activity over 4-fold. Of the two chaotropes, GND was more effective at lower concentrations (<6 M) than urea. However, the enzyme activity lessened at a higher concentration of GND (6 M), while there was a further increase in the activity with 6 M urea treatment. The activity lessened with higher concentration of GND presumably as a result of extensive denaturation of the enzyme, as GND is known to be a more potent denaturant than urea. It is hypothesized that in wheat PPO exists in an inactive form which may be activated by the presence of activators, hitherto unknown, similar in effect to that elicited by the chemical denaturants in this study.
Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks
Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong
2009-01-01
Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao
2017-01-01
Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149
Chen, Feng; Qian, Li-Hua; Deng, Bo; Liu, Zhi-Min; Zhao, Ying; Le, Ying-Ying
2013-09-01
Hyperglycemia-induced oxidative stress has been implicated in diabetic vascular complications in which NADPH oxidase is a major source of reactive oxygen species (ROS) generation. Resveratrol is a naturally occurring polyphenol, which has vasoprotective effects in diabetic animal models and inhibits high glucose (HG)-induced oxidative stress in endothelial cells. We aimed to examine whether HG-induced NADPH oxidase activation and ROS production contribute to glucotoxicity to endothelial cells and the effect of resveratrol on glucotoxicity. Using a murine brain microvascular endothelial cell line bEnd3, we found that NADPH oxidase inhibitor (apocynin) and resveratrol both inhibited HG-induced endothelial cell apoptosis. HG-induced elevation of NADPH oxidase activity and production of ROS were inhibited by apocynin, suggesting that HG induces endothelial cell apoptosis through NADPH oxidase-mediated ROS production. Mechanistic studies revealed that HG upregulated NADPH oxidase subunit Nox1 but not Nox2, Nox4, and p22(phox) expression through NF-κB activation, which resulted in elevation of NADPH oxidase activity and consequent ROS production. Resveratrol prevented HG-induced endothelial cell apoptosis through inhibiting HG-induced NF-κB activation, NADPH oxidase activity elevation, and ROS production. HG induces endothelial cell apoptosis through NF-κB/NADPH oxidase/ROS pathway, which was inhibited by resveratrol. Our findings provide new potential therapeutic targets against brain vascular complications of diabetes. © 2013 John Wiley & Sons Ltd.
Genetics Home Reference: cytochrome c oxidase deficiency
... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...
Kostyuk, Vladimir A; Potapovich, Alla I; Suhan, Tatyana O; de Luca, Chiara; Korkina, Liudmila G
2011-05-11
Oxidized low-density lipoproteins (oxLDL) play a critical role in the initiation of atherosclerosis through activation of inflammatory signaling. In the present work we investigated the role of antioxidant and signal modulation properties of plant polyphenols in controlling vascular inflammation. Significant decrease in intracellular NO level and superoxide overproduction was found in human umbilical vein endothelial cells (HUVEC) treated with oxLDL, but not with LDL. The redox imbalance was prevented by the addition of quercetin or resveratrol. Expression analysis of 14 genes associated with oxidative stress and inflammation revealed oxLDL-mediated up-regulation of genes specifically involved in leukocyte recruitment and adhesion. This up-regulation could be partially avoided by the addition of verbascoside or resveratrol, while treatment with quercetin resulted in a further increase in the expression of these genes. Lipopolysaccharide (LPS)-treated HUVEC were also used for the evaluation of anti-inflammatory potency of plant polyphenols. Significant differences between HUVEC treaded with oxLDL and LPS were found in both the expression pattern of inflammation-related genes and the effects of plant polyphenols on cellular responses. The present data indicate that plant polyphenols may affect vascular inflammation not only as antioxidants but also as modulators of inflammatory redox signaling pathways. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less
Martínez-Márquez, Ascensión; Morante-Carriel, Jaime; Sellés-Marchart, Susana; Martínez-Esteso, María José; Pineda-Lucas, José Luis; Luque, Ignacio; Bru-Martínez, Roque
2013-12-06
Multiple reaction monitoring (MRM) is emerging as a promising technique for the detection and quantification of protein biomarkers in complex biological samples. Compared to Western blotting or enzyme assays, its high sensitivity, specificity, accuracy, assay speed, and sample throughput represent a clear advantage for being the approach of choice for the analysis of proteins. MRM assays are capable of detecting and quantifying proteolytic peptides differing in mass unique to particular proteins, that is, proteotypic peptides, through which different protein isoforms can be distinguished. We have focused on polyphenol oxidase (PPO), a plant conspicuous enzyme encoded by a multigenic family in loquat (Eriobotrya japonica Lindl.) and other related species. PPO is responsible for both the protection of plants from biotic stress as a feeding deterrent for herbivore insects and the enzymatic browning of fruits and vegetables. The latter makes fruit more attractive to seed dispersal agents but is also a major cause of important economic losses in agriculture and food industry. An adequate management of PPO at plant breeding level would maximize the benefits and minimize the disadvantages of this enzyme, but it would require a precise knowledge of the biological role played by each isoform in the plant. Thus, for the functional study of the PPOs, we have cloned and overexpressed fragments of three PPO isoforms from loquat to develop MRM-based methods for the quantification of each isoform. The method was developed using an ion trap instrument and validated in a QQQ instrument. It resulted in the selection of at least two peptides for each isoform that can be monitored by at least three transitions. A combination of SDS-PAGE and MRM lead to detect two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. The method was applied to determine the amount of the PPO2 isoform in protein extracts from fruit samples using
Manna, Sugata; Mukherjee, Sudeshna; Roy, Anup; Das, Sukta; Panda, Chinmay Kr
2009-05-01
The modulatory influence of tea polyphenols (epigallocatechin gallate, epicatechin gallate and theaflavin) on benzo[a]pyrene (B[a]P)-induced lung carcinogenesis in mice was analyzed using histopathological and molecular parameters. Progression of lung lesions was restricted at the hyperplastic stage by tea polyphenols. A significant reduction in cellular proliferative index and an increase in apoptotic index were noted in the restricted lung lesions. High expression of H-ras, c-myc, cyclin D1 and p53 genes was seen at the inflammatory stage (9th week) and in subsequent premalignant lesions, but down-regulation of H-ras at the hyperplastic stage (17th week). Expression of bcl-2 was high in hyperplastic lesions, whereas the expression of mdm2 and bcl-xl increased only at the moderately dysplastic stage (36th week). The tea polyphenols inhibited inflammatory response in the lung lesions on the 9th week, when decreased expression of H-ras and c-myc and increased expression of bax were noted. Prolonged treatment (>9th week) with tea polyphenols resulted in changes in the expression of some additional genes, such as reduced expression of cyclin D1 (from the 17th week), bcl-2 (from the 26th week; mild dysplasia) and p21 (on the 36th week), and high expression of p53 (from the 17th week) and p27 (on the 36th week). These observations indicate that the tea polyphenols can restrict B[a]P-induced lung carcinogenesis by differential modulation of the expression of p53 and its associated genes such as bax, bcl-2, mdm2, p21 and p27, along with H-ras, c-myc and cyclin D1, at different time points.
Popović, B M; Štajner, D; Ždero-Pavlović, R; Tumbas-Šaponjac, V; Čanadanović-Brunet, J; Orlović, S
2016-08-01
This paper is aimed to characterize young poplar plants under the influence of water stress provoked by polyethileneglycol 6000 (PEG 6000). Three polar genotypes (M1, B229, and PE19/66) were grown in hydroponics and subjected to 100 and 200 mOsm PEG 6000 during six days. Polyphenol characterization, two enzymatic markers and antioxidant capacity in leaves and roots were investigated in stressed plants. Total phenol content, ferric reducing antioxidant capacity (FRAP) and DPPH antiradical power (DPPH ARP) were determined for estimating total antioxidant capacity. Polyphenol oxidase (PPO) and phenylalanine ammonia lyase (PAL) were determined as enzymatic markers. Polyphenol characterization of poplar samples was performed by HPLC-PDA analysis. All results were subjected to correlation analysis and principal component analysis (PCA). Inspite of the decrease of total phenol content in investigated genotypes, as well as total antioxidant capacity, some of polyphenols were affected by stress like flavonoids chrysin, myricetine, kaempferol and isoferulic acid in roots of B229 genotype (Populus deltoides). Genotype B229 also showed the increase of antioxidant capacity and PAL activity in root and leaves under stress what could be the indicator of the adaptability of poplar plants to water stress. Significant positive correlations were obtained between PAL, antioxidant capacity as well as phenolic acids among themselves. Chemometric evaluation showed close interdependence between flavonoids, FRAP, DPPH antiradical power and both investigated enzymes of polyphenol metabolism, PAL and PPO. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.
Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio
2013-08-01
A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.
Castresana, J; Lübben, M; Saraste, M; Higgins, D G
1994-06-01
Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.
Gu, Qihua; Hu, Chengping; Chen, Qiong; Xia, Ying
2013-01-01
Lung cancer is one of the cancers that have the highest incidence and the highest mortality rate, and it is of great interest to identify ways to prevent its occurrence. We had established an animal model by using 3,4-benzopyrene intra-pulmonary injection in our previous study, and had observed that the rats lung carcinoma incidence and multiplicity were significantly reduced by green tea administration. This study further investigated the effect of tea polyphenols on rat lung preneoplastic lesions using the lung carcinoma model established by 3,4-benzopyrene intra-pulmonary injection. Sprague-Dawley rats of the same age were randomly divided into 10 groups and treated with 3,4-benzopyrene by intra-pulmonary injection. Five groups were given 0.3% solution of tea polyphenols (equivalent to 1.2% of green tea) in drinking water, while the other 5 groups were given pure drinking water. The rats were sacrificed at 0, 1, 4, 8 and 16 weeks after carcinogen treatment. In the control groups of rats, local bronchial inflammation were observed at 1 week after 3,4-benzopyrene treatment. From 4 weeks to 16 weeks after carcinogen treatment, hyperplasia, cell hyperproliferation, heterogeneity were observed in the bronchial epithelium. Meanwhile, the expression of p53 mRNA and protein, as well as the level of bcl-2, increased in the bronchial epithelial lesion. Tea polyphenols treatment significantly alleviated the bronchial epithelial lesions. At the same time, tea polyphenols treatment enhanced p53 expression, but reduced bcl-2 expression. These results indicated that tea polyphenols may have preventive effect against lung preneoplasm lesions, possibly through regulating the expression of some critical genes such as p53 and bcl-2.
Altered gene expression in early postnatal monoamine oxidase A knockout mice.
Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C
2017-08-15
We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.
Characterization and purification of polyphenol oxidase from artichoke (Cynara scolymus L.).
Dogan, Serap; Turan, Yusuf; Ertürk, Hatibe; Arslan, Oktay
2005-02-09
In this study, the polyphenol oxidase (PPO) of artichoke (Cynara scolymus L.) was first purified by a combination of (NH(4))(2)SO(4) precipitation, dialysis, and a Sepharose 4B-L-tyrosine-p-aminobenzoic acid affinity column. At the end of purification, 43-fold purification was achieved. The purified enzyme migrated as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Polyacrylamide gel electrophoresis indicated that PPO had a 57 kDa molecular mass. Second, the contents of total phenolic and protein of artichoke head extracts were determined. The total phenolic content of artichoke head was determined spectrophotometrically according to the Folin-Ciocalteu procedure and was found to be 425 mg 100 g(-1) on a fresh weight basis. Protein content was determined according to Bradford method. Third, the effects of substrate specificity, pH, temperature, and heat inactivation were investigated on the activity of PPO purified from artichoke. The enzyme showed activity to 4-methylcatechol, pyrogallol, catechol, and L-dopa. No activity was detected toward L-tyrosine, resorsinol, and p-cresol. According to V(max)/K(m) values, 4-methylcatechol (1393 EU min(-1) mM(-1)) was the best substrate, followed by pyrogallol (1220 EU min(-1) mM(-1)), catechol (697 EU min(-1) mM(-1)), and L-dopa (102 EU min(-1) mM(-1)). The optimum pH values for PPO were 5.0, 8.0, and 7.0 using 4-methylcatechol, pyrogallol, and catechol as substrate, respectively. It was found that optimum temperatures were dependent on the substrates studied. The enzyme activity decreased due to heat denaturation of the enzyme with increasing temperature and inactivation time for 4-methylcatechol and pyrogallol substrates. However, all inactivation experiments for catechol showed that the activity of artichoke PPO increased with mild heating, reached a maximum, and then decreased with time. Finally, inhibition of artichoke PPO was investigated with inhibitors such as L-cysteine, EDTA, ascorbic
Polyphenols excreted in urine as biomarkers of total polyphenol intake.
Medina-Remón, Alexander; Tresserra-Rimbau, Anna; Arranz, Sara; Estruch, Ramón; Lamuela-Raventos, Rosa M
2012-11-01
Nutritional biomarkers have several advantages in acquiring data for epidemiological and clinical studies over traditional dietary assessment tools, such as food frequency questionnaires. While food frequency questionnaires constitute a subjective methodology, biomarkers can provide a less biased and more accurate measure of specific nutritional intake. A precise estimation of polyphenol consumption requires blood or urine sample biomarkers, although their association is usually highly complex. This article reviews recent research on urinary polyphenols as potential biomarkers of polyphenol intake, focusing on clinical and epidemiological studies. We also report a potentially useful methodology to assess total polyphenols in urine samples, which allows a rapid, simultaneous determination of total phenols in a large number of samples. This methodology can be applied in studies evaluating the utility of urinary polyphenols as markers of polyphenol intake, bioavailability and accumulation in the body.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-01-01
Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
[Chemical studies on plant polyphenols and formation of black tea polyphenols].
Tanaka, Takashi
2008-08-01
Recent biological and pharmacological studies strongly suggested that plant polyphenols in foods, beverages and crude drugs have various health benefits. However, still there are chemically uncharacterized polyphenols, especially those with large molecular weights. The typical example is black tea polyphenols. Four tea catechins of fresh tea leaves are enzymatically oxidized in tea fermentation process of black tea manufacture to give a complex mixture of the oxidation products. Despite many efforts since 1950's, major part of the black tea polyphenols has not been clarified yet. We have investigated the oxidation mechanism of each catechin by employing a newly developed in vitro model fermentation system. The oxidation was initiated by enzymatic dehydrogenation of catechins, and subsequent intermolecular quinone-phenol coupling reactions followed by cascade-type degradation of the unstable products resulted in the formation of complex black tea polyphenols. Besides black tea polyphenols, this review introduces the chemistry of insolubilization of persimmon proanthocyanidins, wood polyphenols in connection with whisky polyphenols, and co-polymerization of cinnamaldehyde and proanthocyanidins in cinnamon bark.
Sellés-Marchart, Susana; Casado-Vela, Juan; Bru-Martínez, Roque
2006-02-15
Polyphenol oxidase (PPO) has been extracted from both soluble and particulate fractions of loquat fruit (Eriobotrya japonica Lindl. cv. Algerie). The soluble PPO (20% of total activity) was partially purified 3.3-fold after ammonium sulfate fractionation being in its active state. The particulate PPO fraction (80% of total activity) was purified to homogeneity in a latent form being activable by sodium dodecyl sulfate (SDS). The enzyme was purified 40.0-fold with a total yield of 15.3% after extraction by phase partitioning in Triton X-114 followed by three chromatographic steps. The molecular weight was estimated to be about 59.2 and 61.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration chromatography, respectively, indicating that latent PPO is a monomer. Latent PPO catalyzed the oxidation of chlorogenic acid (CA) at a rate 50-fold faster than that of 4-tert-butylcatechol (TBC) but the soluble active counterpart only twice. Both PPOs exhibited similar Km values for TBC but Km for CA was 5-fold higher for the latent than for the active soluble PPO. Other kinetic characteristics, including sensitivity to inhibitors, substrate specificity, thermal stability, temperature, and pH profiles, were quite different between both PPOs. These results provide strong evidences that the soluble active and the particulate latent are different forms of PPO in loquat fruit flesh. The results suggest that the major PPO form for the oxidation of CA, leading to enzymatic browning under physiological conditions, is the latent one.
Saeidian, Shahriar; Keyhani, Ezzatollah; Keyhani, Jacqueline
2007-05-02
Polyphenol oxidase (PPO; EC 1.14.18.1) catalyzes the hydroxylation of monophenols to o-diphenols (cresolase activity) and the oxidation of o-diphenols to o-quinones (catecholase activity), leading to browning in plants and produce. Further interest in the enzyme has been triggered by the active role that it plays in plant defense systems. PPO can be found in latent forms and is activated in vitro by various agents including urea, detergents, and proteases. The activation of PPO from several sources by sodium dodecyl sulfate (SDS) has been extensively investigated, but reports on the effect of other detergents or on the differential effect of detergents on each of PPO's activities are scarce. In addition, investigations on the enzyme in other plant parts besides fruits and vegetables are also scarce. Here, the effect of various detergents and chaotropic agents on PPO from dormant saffron (Crocus sativus L.) corm extract was investigated. SDS and sarkosyl activated the cresolase activity, while only SDS activated the catecholase activity. All other detergents tested, in milli- or micromolar concentrations, inhibited the cresolase activity but barely affected the catecholase activity. In contrast, urea and guanidine-HCl drastically inhibited the catecholase activity but moderately inhibited the cresolase activity. The same effects were obtained on the partially purified enzyme. Results identified a PPO, present in dormant corms, which was activated only by anionic detergents and was inhibited by other reputed activating agents such as urea. Results also emphasized the differences in structure and accessibility of the active sites for cresolase and catecholase activities.
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at
2015-05-22
Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and themore » latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)« less
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H
2009-07-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Thornton, C R; Dewey, F M; Gilligan, C A
1997-01-01
ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L
The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis
Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel
2017-01-01
Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Sudjaroen, Yuttana; Hull, William E; Erben, Gerhard; Würtele, Gerd; Changbumrung, Supranee; Ulrich, Cornelia M; Owen, Robert W
2012-05-01
Longan (Dimocarpus longan Lour, syn. Euphoria longan Lam.) represents an important fruit in Northern Thailand and has significant economic impact. The fruit is either consumed fresh or as commercially prepared dried and canned products. The canning industry in Thailand produces considerable quantities of waste products, in particular Longan seeds. Because these seeds may be an exploitable source of natural phenolic antioxidants, it was of interest to identify, purify and quantitate the major potential antioxidant phenolics contained therein. The polyphenolic fraction from ground Longan seeds was obtained by extraction with methanol after delipidation with hexane. The hexane extract contained predominantly long-chain fatty acids with major contributions from palmitic (35%) and oleic (28%) acids. The polyphenolic fraction (80.90 g/kg dry weight) was dominated by ellagic acid (25.84 g/kg) and the known ellagitannins corilagin (13.31 g/kg), chebulagic acid (13.06 g/kg), ellagic acid 4-O-α-l-arabinofuranoside (9.93 g/kg), isomallotinic acid (8.56 g/kg) and geraniin (5.79 g/kg). Structure elucidation was performed with mass spectrometry and complete assignment of (1)H and (13)C NMR signals. The methanol extracts exhibited strong antioxidant capacities with an IC(50) of 154 μg/ml for reactive oxygen species attack on salicylic acid and 78 μg/ml for inhibition of xanthine oxidase in the hypoxanthine/xanthine oxidase assay. The extracts were less effective in the 2-deoxyguanosine assay (IC(50)=2.46 mg/ml), indicating that gallates along with ellagic acid and its congeners exert their potential antioxidant effects predominantly by precipitation of proteins such as xanthine oxidase. This was confirmed for the pure compounds gallic acid, methyl gallate, ellagic acid and corilagin. Copyright © 2012 Elsevier Ltd. All rights reserved.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Sen, Supatra; Mukherji, S
2009-07-01
Season-controlled changes in biochemical constituents viz. carotenoids (carotene and xanthophyll) and pectic substances along with IAA-oxidase and polyphenol oxidase (PPO) enzyme activities were estimated/assayed in leaves of Lycopersicon esculentum Mill. (tomato) in two developmental stages--pre-flowering (35 days after sowing) and post-flowering (75 days after sowing) in three different seasons--summer rainy and winter Carotenoid content along with pectic substances were highest in winter and declined significantly in summer followed by rainy i.e. winter > summer > rainy. Carotenoid content was significantly higher in the pre-flowering as compared to post-flowering in all three seasons while pectic substances increased in the post-flowering as compared to pre-flowering throughout the annual cycle. IAA oxidase and PPO enzyme activities were enhanced in rainy and decreased sharply in summer and winter i.e. rainy > summer > winter. Both the enzymes exhibited higher activity in the post-flowering stage as compared to pre-flowering in all three seasons. These results indicate winter to be the most favourable season for tomato plants while rainy season environmental conditions prove to be unfavourable (stressful) with diminished content of carotenoid and pectic substances and low activities of IAA oxidase and PPO, ultimately leading to poor growth and productivity.
Green tea polyphenols reduce body weight in rats by modulating obesity-related genes.
Lu, Chuanwen; Zhu, Wenbin; Shen, Chwan-Li; Gao, Weimin
2012-01-01
Beneficial effects of green tea polyphenols (GTP) against obesity have been reported, however, the mechanism of this protection is not clear. Therefore, the objective of this study was to identify GTP-targeted genes in obesity using the high-fat-diet-induced obese rat model. A total of three groups (n = 12/group) of Sprague Dawley (SD) female rats were tested, including the control group (rats fed with low-fat diet), the HF group (rats fed with high-fat diet), and the HF+GTP group (rats fed with high-fat diet and GTP in drinking water). The HF group increased body weight as compared to the control group. Supplementation of GTP in the drinking water in the HF+GTP group reduced body weight as compared to the HF group. RNA from liver samples was extracted for gene expression analysis. A total of eighty-four genes related to obesity were analyzed using PCR array. Compared to the rats in the control group, the rats in the HF group had the expression levels of 12 genes with significant changes, including 3 orexigenic genes (Agrp, Ghrl, and Nr3c1); 7 anorectic genes (Apoa4, Cntf, Ghr, IL-1β, Ins1, Lepr, and Sort); and 2 genes that relate to energy expenditure (Adcyap1r1 and Adrb1). Intriguingly, the HF+GTP group restored the expression levels of these genes in the high-fat-induced obese rats. The protein expression levels of IL-1β and IL-6 in the serum samples from the control, HF, and HF+GTP groups confirmed the results of gene expression. Furthermore, the protein expression levels of superoxide dismutase-1 (SOD1) and catechol-O-methyltransferase (COMT) also showed GTP-regulated protective changes in this obese rat model. Collectively, this study revealed the beneficial effects of GTP on body weight via regulating obesity-related genes, anti-inflammation, anti-oxidant capacity, and estrogen-related actions in high-fat-induced obese rats.
Green Tea Polyphenols Reduce Body Weight in Rats by Modulating Obesity-Related Genes
Lu, Chuanwen; Zhu, Wenbin; Shen, Chwan-Li; Gao, Weimin
2012-01-01
Beneficial effects of green tea polyphenols (GTP) against obesity have been reported, however, the mechanism of this protection is not clear. Therefore, the objective of this study was to identify GTP-targeted genes in obesity using the high-fat-diet-induced obese rat model. A total of three groups (n = 12/group) of Sprague Dawley (SD) female rats were tested, including the control group (rats fed with low-fat diet), the HF group (rats fed with high-fat diet), and the HF+GTP group (rats fed with high-fat diet and GTP in drinking water). The HF group increased body weight as compared to the control group. Supplementation of GTP in the drinking water in the HF+GTP group reduced body weight as compared to the HF group. RNA from liver samples was extracted for gene expression analysis. A total of eighty-four genes related to obesity were analyzed using PCR array. Compared to the rats in the control group, the rats in the HF group had the expression levels of 12 genes with significant changes, including 3 orexigenic genes (Agrp, Ghrl, and Nr3c1); 7 anorectic genes (Apoa4, Cntf, Ghr, IL-1β, Ins1, Lepr, and Sort); and 2 genes that relate to energy expenditure (Adcyap1r1 and Adrb1). Intriguingly, the HF+GTP group restored the expression levels of these genes in the high-fat-induced obese rats. The protein expression levels of IL-1β and IL-6 in the serum samples from the control, HF, and HF+GTP groups confirmed the results of gene expression. Furthermore, the protein expression levels of superoxide dismutase-1 (SOD1) and catechol-O-methyltransferase (COMT) also showed GTP-regulated protective changes in this obese rat model. Collectively, this study revealed the beneficial effects of GTP on body weight via regulating obesity-related genes, anti-inflammation, anti-oxidant capacity, and estrogen-related actions in high-fat-induced obese rats. PMID:22715380
Escalante-Minakata, Pilar; Ibarra-Junquera, Vrani; Ornelas-Paz, José de Jesús; García-Ibáñez, Victoria; Virgen-Ortíz, José J; González-Potes, Apolinar; Pérez-Martínez, Jaime D; Orozco-Santos, Mario
2018-01-01
This work presents a novel method to associate the polyphenol oxidase (PPO) and the peroxidase (POD) activities with the ripening-mediated color changes in banana peel and pulp by computational image analysis. The method was used to follow up the de-greening of peel and browning of homogenized pulp from 'Giant Dwarf' (GD: Musa AAA, subgroup Cavendish) and FHIA-23 (tetraploid hybrid, AAAA) banana cultivars. In both cultivars, the color changes of peel during the ripening process clearly showed four stages, which were used to group the fruit into ripening stages. The PPO and POD were extracted from pulp of fruit at these ripening stages, precipitated, and partially purified by gel filtration chromatography. Moreover, the pulp browning was digitally monitored after homogenization for a span time of up to 120 min. The browning level was higher for GD than FHIA-23 tissues. This fact correlated with an 11.7-fold higher PPO activity in the GD cultivar, as compared with that of FHIA-23. POD activity was 8.1 times higher for GD as compared that that of FHIA-23.
Marinić, Jelena; Broznić, Dalibor; Milin, Čedomila
2016-01-01
Polyphenols can act as oxidants in some conditions, inducing redox-sensitive genes. We investigated the effect of preexposure to the olive oil polyphenols extract (PFE) on time-dependent changes in the hepatic oxidative state in a model of liver regeneration—a process in which oxidative stress associated with the metabolic overload accounts for the early events that contribute to the onset of liver self-repair. Liver regeneration was induced by one-third hepatectomy in mice. Prior to hepatectomy, mice were intraperitoneally given either PFE (50 mg/kg body weight) or saline for seven consecutive days, while respective controls received vehicle alone. Redox state-regulating enzymes and thiol proteins along with the mRNA levels of Nrf2 gene and its targets γ-glutamylcysteine synthetase and heme oxygenase-1 were determined at different time intervals after hepatectomy. The liver mass restoration was calculated to assess hepatic regeneration. The resulting data demonstrate the effectiveness of preexposure to PFE in stimulating liver regeneration in a model of a small tissue loss which may be ascribed to the transient increase in oxidant load during the first hours after hepatectomy and associated induction of stress response gene-profiles under the control of Nrf2. PMID:26925195
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1
Smesrud, Logan; Tebo, Bradley M.
2016-01-01
ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira
1995-12-18
The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less
Polyphenols and Glycemic Control
Kim, Yoona; Keogh, Jennifer B.; Clifton, Peter M.
2016-01-01
Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1), stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5′ adenosine monophosphate-activated protein kinase (AMPK), modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols. PMID:26742071
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Sartori, Elen Romão; Vicentini, Fernando Campanhã; Fatibello-Filho, Orlando
2011-12-15
The modification of a glassy carbon electrode with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film for the development of a biosensor is proposed. This approach provides an efficient method used to immobilize polyphenol oxidase (PPO) obtained from the crude extract of sweet potato (Ipomoea batatas (L.) Lam.). The principle of the analytical method is based on the inhibitory effect of sulfite on the activity of PPO, in the reduction reaction of o-quinone to catechol and/or the reaction of o-quinone with sulfite. Under the optimum experimental conditions using the differential pulse voltammetry technique, the analytical curve obtained was linear in the concentration of sulfite in the range from 0.5 to 22 μmol L(-1) with a detection limit of 0.4 μmol L(-1). The biosensor was applied for the determination of sulfite in white and red wine samples with results in close agreement with those results obtained using a reference iodometric method (at a 95% confidence level). Copyright © 2011 Elsevier B.V. All rights reserved.
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Di Guardo, Mario; Tadiello, Alice; Farneti, Brian; Lorenz, Giorgia; Masuero, Domenico; Vrhovsek, Urska; Costa, Guglielmo; Velasco, Riccardo; Costa, Fabrizio
2013-01-01
In terms of the quality of minimally processed fruit, flesh browning is fundamentally important in the development of an aesthetically unpleasant appearance, with consequent off-flavours. The development of browning depends on the enzymatic action of the polyphenol oxidase (PPO). In the 'Golden Delicious' apple genome ten PPO genes were initially identified and located on three main chromosomes (2, 5 and 10). Of these genes, one element in particular, here called Md-PPO, located on chromosome 10, was further investigated and genetically mapped in two apple progenies ('Fuji x Pink Lady' and 'Golden Delicious x Braeburn'). Both linkage maps, made up of 481 and 608 markers respectively, were then employed to find QTL regions associated with fruit flesh browning, allowing the detection of 25 QTLs related to several browning parameters. These were distributed over six linkage groups with LOD values spanning from 3.08 to 4.99 and showed a rate of phenotypic variance from 26.1 to 38.6%. Anchoring of these intervals to the apple genome led to the identification of several genes involved in polyphenol synthesis and cell wall metabolism. Finally, the expression profile of two specific candidate genes, up and downstream of the polyphenolic pathway, namely phenylalanine ammonia lyase (PAL) and polyphenol oxidase (PPO), provided insight into flesh browning physiology. Md-PPO was further analyzed and two haplotypes were characterised and associated with fruit flesh browning in apple.
Farneti, Brian; Lorenz, Giorgia; Masuero, Domenico; Vrhovsek, Urska; Costa, Guglielmo; Velasco, Riccardo; Costa, Fabrizio
2013-01-01
In terms of the quality of minimally processed fruit, flesh browning is fundamentally important in the development of an aesthetically unpleasant appearance, with consequent off-flavours. The development of browning depends on the enzymatic action of the polyphenol oxidase (PPO). In the ‘Golden Delicious’ apple genome ten PPO genes were initially identified and located on three main chromosomes (2, 5 and 10). Of these genes, one element in particular, here called Md-PPO, located on chromosome 10, was further investigated and genetically mapped in two apple progenies (‘Fuji x Pink Lady’ and ‘Golden Delicious x Braeburn’). Both linkage maps, made up of 481 and 608 markers respectively, were then employed to find QTL regions associated with fruit flesh browning, allowing the detection of 25 QTLs related to several browning parameters. These were distributed over six linkage groups with LOD values spanning from 3.08 to 4.99 and showed a rate of phenotypic variance from 26.1 to 38.6%. Anchoring of these intervals to the apple genome led to the identification of several genes involved in polyphenol synthesis and cell wall metabolism. Finally, the expression profile of two specific candidate genes, up and downstream of the polyphenolic pathway, namely phenylalanine ammonia lyase (PAL) and polyphenol oxidase (PPO), provided insight into flesh browning physiology. Md-PPO was further analyzed and two haplotypes were characterised and associated with fruit flesh browning in apple. PMID:24205065
Modulation of endogenous antioxidant system by wine polyphenols in human disease.
Rodrigo, Ramón; Miranda, Andrés; Vergara, Leonardo
2011-02-20
Numerous studies indicate that moderate red wine consumption is associated with a protective effect against all-cause mortality. Since oxidative stress constitutes a unifying mechanism of injury of many types of disease processes, it should be expected that polyphenolic antioxidants account for this beneficial effect. Nevertheless, beyond the well-known antioxidant properties of these compounds, they may exert several other protective mechanisms. Indeed, the overall protective effect of polyphenols is due to their large array of biological actions, such as free radical-scavenging, metal chelation, enzyme modulation, cell signalling pathways modulation and gene expression effects, among others. Wine possesses a variety of polyphenols, being resveratrol its most outstanding representative, due to its pleiotropic biological properties. The presence of ethanol in wine aids to polyphenol absorption, thereby contributing to their bioavailability. Before absorption, polyphenols must be hydrolyzed by intestinal enzymes or by colonic microflora. Then, they undergo intestinal and liver metabolism. There have been no reported polyphenol adverse effects derived from intakes currently associated with the normal diet. However, supplements for health-protection should be cautiously used as no level definition has been given to make sure the dose is safe. The role of oxidative stress and the beneficial effects of wine polyphenols against cardiovascular, cancer, diabetes, microbial, inflammatory, neurodegenerative and kidney diseases and ageing are reviewed. Future large scale randomized clinical trials should be conducted to fully establish the therapeutic use of each individual wine polyphenol against human disease. Copyright © 2010 Elsevier B.V. All rights reserved.
High oxygen facilitates wound induction of suberin polyphenolics in kiwifruit.
Wei, Xiaopeng; Mao, Linchun; Han, Xueyuan; Lu, Wenjing; Xie, Dandan; Ren, Xingchen; Zhao, Yuying
2018-04-01
Rapid wound healing would be critical for successful long-term storage of fruits and vegetables. However, there was no direct evidence for the requirement and efficiency of oxygen in the fruit wound-healing process. This study was conducted to investigate the role of oxygen in wound-induced suberization by analyzing melanin, suberin polyphenolics (SPPs) and related enzymes in half-cut kiwifruits exposed to 100%, 50%, 21% and 0% oxygen. By 3 days after wounding, the wound surface of kiwifruit in high (50 and 100%) oxygen appeared as a continuous layer of melanin and SPPs underneath, which effectively prevent excessive water vapor loss from the fruit halves. In contrast, melanin and SPPs deposition in the wound surface in 0% oxygen was significantly reduced, with high water vapor loss. Rapid decrease of soluble phenolic acids (caffeic, p-coumaric, ferulic acids) was coupled with the increase of bound ferulic acid (coniferyl diacetate) especially in high oxygen by 9 days after wounding. Meanwhile, high oxygen enhanced peroxidase, catalase, phenylalanine ammonia-lyase, and polyphenol oxidase activities. Oxygen is required for wound-induced melanin and SPPs formation, and high oxygen is effective in promoting wound suberization in postharvest kiwifruit. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Regulation of inflammation and redox signaling by dietary polyphenols.
Rahman, Irfan; Biswas, Saibal K; Kirkham, Paul A
2006-11-30
Reactive oxygen species (ROS) play a key role in enhancing the inflammation through the activation of NF-kappaB and AP-1 transcription factors, and nuclear histone acetylation and deacetylation in various inflammatory diseases. Such undesired effects of oxidative stress have been found to be controlled by the antioxidant and/or anti-inflammatory effects of dietary polyphenols such as curcumin (diferuloylmethane, a principal component of turmeric) and resveratrol (a flavonoid found in red wine). The phenolic compounds in fruits, vegetables, tea and wine are mostly derivatives, and/or isomers of flavones, isoflavones, flavonols, catechins, tocopherols, and phenolic acids. Polyphenols modulate important cellular signaling processes such as cellular growth, differentiation and host of other cellular features. In addition, they modulate NF-kappaB activation, chromatin structure, glutathione biosynthesis, nuclear redox factor (Nrf2) activation, scavenge effect of ROS directly or via glutathione peroxidase activity and as a consequence regulate inflammatory genes in macrophages and lung epithelial cells. However, recent data suggest that dietary polyphenols can work as modifiers of signal transduction pathways to elicit their beneficial effects. The effects of polyphenols however, have been reported to be more pronounced in vitro using high concentrations which are not physiological in vivo. This commentary discusses the recent data on dietary polyphenols in the control of signaling and inflammation particularly during oxidative stress, their metabolism and bioavailability.
Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick
2005-03-01
The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.
Fiesel, Anja; Gessner, Denise K; Most, Erika; Eder, Klaus
2014-09-04
Feeding polyphenol-rich plant products has been shown to increase the gain:feed ratio in growing pigs. The reason for this finding has not yet been elucidated. In order to find the reasons for an increase of the gain:feed ratio, this study investigated the effect of two polyphenol-rich dietary supplements, grape seed and grape marc meal extract (GSGME) or spent hops (SH), on gut morphology, apparent digestibility of nutrients, microbial composition in faeces and the expression of pro-inflammatory genes in the intestine of pigs. Pigs fed GSGME or SH showed an improved gain:feed ratio in comparison to the control group (P < 0.10 for GSGME, P < 0.05 for SH). Villus height:crypt depth ratio in duodenum and jejunum as well as apparent total tract digestibility of nutrients were unchanged in the groups receiving GSGME or SH in comparison to the control group. However, the groups receiving GSGME or SH revealed an increased faecal pH value, lower levels of volatile fatty acids and lower counts of Streptococcus spp. and Clostridium Cluster XIVa in the faecal microbiota (P < 0.05). Moreover, both treatment groups had a lower expression of various pro-inflammatory genes in duodenum, ileum and colon than the control group (P < 0.05). The present study suggests that dietary plant products rich in polyphenols are able to improve the gain:feed ratio in growing pigs. It is assumed that an alteration in the microbial composition and anti-inflammatory effects of the polyphenol-rich plant products in the intestine might contribute to this effect.
Beltrán-Debón, Raúl; Rodríguez-Gallego, Esther; Fernández-Arroyo, Salvador; Senan-Campos, Oriol; Massucci, Francesco A; Hernández-Aguilera, Anna; Sales-Pardo, Marta; Guimerà, Roger; Camps, Jordi; Menendez, Javier A; Joven, Jorge
2015-09-01
We explored the acute multifunctional effects of polyphenols from Hibiscus sabdariffa in humans to assess possible consequences on the host's health. The expected dynamic response was studied using a combination of transcriptomics and metabolomics to integrate specific functional pathways through network-based methods and to generate hypotheses established by acute metabolic effects and/or modifications in the expression of relevant genes. Data were obtained from healthy male volunteers after 3 hours of ingestion of an aqueous Hibiscus sabdariffa extract. The data were compared with data obtained prior to the ingestion, and the overall findings suggest that these particular polyphenols had a simultaneous role in mitochondrial function, energy homeostasis and protection of the cardiovascular system. These findings suggest beneficial actions in inflammation, endothelial dysfunction, and oxidation, which are interrelated mechanisms. Among other effects, the activation of the heme oxygenase-biliverdin reductase axis, the systemic inhibition of the renin-angiotensin system, the inhibition of the angiotensin-converting enzyme, and several actions mirroring those of the peroxisome proliferator-activated receptor agonists further support this notion. We also found concordant findings in the serum of the participants, which include a decrease in cortisol levels and a significant increase in the active vasodilator metabolite of bradykinin (des-Arg(9)-bradykinin). Therefore, our data support the view that polyphenols from Hibiscus sabdariffa play a regulatory role in metabolic health and in the maintenance of blood pressure, thus implying a multi-faceted impact in metabolic and cardiovascular diseases.
Kim, Bohkyung; Ku, Chai Siah; Pham, Tho X; Park, Youngki; Martin, Derek A; Xie, Liyang; Taheri, Rod; Lee, Jiyoung; Bolling, Bradley W
2013-05-01
We hypothesized that a polyphenol-rich chokeberry extract (CBE) would modulate hepatic lipid metabolism and improve antioxidant function in apolipoprotein E knockout (apoE(-/-)) mice. ApoE(-/-) mice were fed diets containing 15% fat with 0.2% cholesterol alone or supplemented with 0.005% or 0.05% CBE for 4 weeks. CBE polyphenol content was determined by the total phenols, 4-dimethylaminocinnamaldehyde, and ultra high-performance liquid chromatography-mass spectrometry methods. The 0.05% CBE diet provided mice with mean daily doses of 1.2 mg gallic acid equivalents of total phenols, 0.19 mg anthocyanins, 0.17 mg phenolic acids, 0.06 mg proanthocyanidins (as catechin-equivalents), and 0.02 mg flavonols. The 0.05% CBE group had 12% less plasma total cholesterol concentrations than the control. Despite the hypocholesterolemic effect of CBE, hepatic mRNA levels of low-density lipoprotein receptor, hydroxyl-3-methylglutaryl coenzyme A reductase and cholesterol 7α-hydroxylase in CBE-fed mice were not significantly different from controls. Dietary CBE did not alter hepatic lipid content or the hepatic expression of genes involved in lipogenesis and fatty acid β-oxidation such as fatty acid synthase, carnitine palmitoyltransferase 1 and acyl-CoA oxidase. Plasma paraoxonase and catalase activities were significantly increased in mice fed 0.05% CBE. Both CBE diets increased hepatic glutathione peroxidase (GPx) activity but the 0.05% CBE group had 24% less proximal intestine GPx activity relative to controls. Thus, dietary CBE lowered total cholesterol and improved plasma and hepatic antioxidant function at nutritionally-relevant doses in apoE(-/-) mice. Furthermore, the CBE cholesterol-lowering mechanism in apoE(-/-) mice was independent of hepatic expression of genes involved in cholesterol metabolism. Copyright © 2013 Elsevier Inc. All rights reserved.
Modulation of Immune Function by Polyphenols: Possible Contribution of Epigenetic Factors
Cuevas, Alejandro; Saavedra, Nicolás; Salazar, Luis A.; Abdalla, Dulcineia S. P.
2013-01-01
Several biological activities have been described for polyphenolic compounds, including a modulator effect on the immune system. The effects of these biologically active compounds on the immune system are associated to processes as differentiation and activation of immune cells. Among the mechanisms associated to immune regulation are epigenetic modifications as DNA methylation of regulatory sequences, histone modifications and posttranscriptional repression by microRNAs that influences the gene expression of key players involved in the immune response. Considering that polyphenols are able to regulate the immune function and has been also demonstrated an effect on epigenetic mechanisms, it is possible to hypothesize that there exists a mediator role of epigenetic mechanisms in the modulation of the immune response by polyphenols. PMID:23812304
Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho
2014-01-01
Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465
Hassan, Mubashir; Abbas, Qamar; Ashraf, Zaman; Moustafa, Ahmed A; Seo, Sung-Yum
2017-06-01
Polyphenol oxidases (PPOs)/tyrosinases are metal-dependent enzymes and known as important targets for melanogenesis. Although considerable attempts have been conducted to control the melanin-associated diseases by using various inhibitors. However, the exploration of the best anti-melanin inhibitor without side effect still remains a challenge in drug discovery. In present study, protein structure prediction, ligand-based pharmacophore modeling, virtual screening, molecular docking and dynamic simulation study were used to screen the strong novel inhibitor to cure melanogenesis. The 3D structures of PPO1 and PPO2 were built through homology modeling, while the 3D crystal structures of PPO3 and PPO4 were retrieved from PDB. Pharmacophore modeling was performed using LigandScout 3.1 software and top five models were selected to screen the libraries (2601 of Aurora and 727, 842 of ZINC). Top 10 hit compounds (C1-10) were short-listed having strong binding affinities for PPO1-4. Drug and synthetic accessibility (SA) scores along with absorption, distribution, metabolism, excretion and toxicity (ADMET) assessment were employed to scrutinize the best lead hit. C4 (name) hit showed the best predicted SA score (5.75), ADMET properties and drug-likeness behavior among the short-listed compounds. Furthermore, docking simulations were performed to check the binding affinity of C1-C10 compounds against target proteins (PPOs). The binding affinity values of complex between C4 and PPOs were higher than those of other complexes (-11.70, -12.1, -9.90 and -11.20kcal/mol with PPO1, PPO2, PPO3, or PPO4, respectively). From comparative docking energy and binding analyses, PPO2 may be considered as better target for melanogenesis than others. The potential binding modes of C4, C8 and C10 against PPO2 were explored using molecular dynamics simulations. The root mean square deviation and fluctuation (RMSD/RMSF) graphs results depict the significance of C4 over the other compounds
Figueira, Inês; Tavares, Lucélia; Jardim, Carolina; Costa, Inês; Terrasso, Ana P; Almeida, Andreia F; Govers, Coen; Mes, Jurriaan J; Gardner, Rui; Becker, Jörg D; McDougall, Gordon J; Stewart, Derek; Filipe, Augusto; Kim, Kwang S; Brites, Dora; Brito, Catarina; Brito, M Alexandra; Santos, Cláudia N
2017-11-18
Epidemiological and intervention studies have attempted to link the health effects of a diet rich in fruits and vegetables with the consumption of polyphenols and their impact in neurodegenerative diseases. Studies have shown that polyphenols can cross the intestinal barrier and reach concentrations in the bloodstream able to exert effects in vivo. However, the effective uptake of polyphenols into the brain is still regarded with some reservations. Here we describe a combination of approaches to examine the putative transport of blackberry-digested polyphenols (BDP) across the blood-brain barrier (BBB) and ultimate evaluation of their neuroprotective effects. BDP was obtained by in vitro digestion of blackberry extract and BDP major aglycones (hBDP) were obtained by enzymatic hydrolysis. Chemical characterization and BBB transport of extracts were evaluated by LC-MS n . BBB transport and cytoprotection of both extracts was assessed in HBMEC monolayers. Neuroprotective potential of BDP was assessed in NT2-derived 3D co-cultures of neurons and astrocytes and in primary mouse cerebellar granule cells. BDP-modulated genes were evaluated by microarray analysis. Components from BDP and hBDP were shown to be transported across the BBB. Physiologically relevant concentrations of both extracts were cytoprotective at endothelial level and BDP was neuroprotective in primary neurons and in an advanced 3D cell model. The major canonical pathways involved in the neuroprotective effect of BDP were unveiled, including mTOR signaling and the unfolded protein response pathway. Genes such as ASNS and ATF5 emerged as novel BDP-modulated targets. BBB transport of BDP and hBDP components reinforces the health benefits of a diet rich in polyphenols in neurodegenerative disorders. Our results suggest some novel pathways and genes that may be involved in the neuroprotective mechanism of the BDP polyphenol components.
Mandal, Santi M; Chakraborty, Dipjyoti; Dutta, Suhrid R; Ghosh, Ananta K; Pati, Bikas R; Korpole, Suresh; Paul, Debarati
2016-06-01
A range of phenolic acids, viz., p-coumaric acid, 4-hydroxybenzaldehyde, 4-hydroxybenzoic acid, protocatechuic acid, caffeic acid, ferulic acid, and cinnamic acid have been isolated and identified by LC-MS analysis in the roots and root nodules of Mimosa pudica. The effects of identified phenolic acids on the regulation of nodulation (nod) genes have been evaluated in a betarhizobium isolate of M. pudica root nodule. Protocatechuic acid and p-hydroxybenzoic acid were most effective in inducing nod gene, whereas caffeic acid had no significant effect. Phenylalanine ammonia lyase, peroxidase, and polyphenol oxidase activities were estimated, indicating regulation and metabolism of phenolic acids in root nodules. These results showed that nodD gene expression of betarhizobium is regulated by simple phenolic acids such as protocatechuic acid and p-hydroxybenzoic acid present in host root nodule and sustains nodule organogenesis.
Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo
2006-01-01
The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.
Rehman, Hasibur; Krishnasamy, Yasodha; Haque, Khujista; Lemasters, John J.; Schnellmann, Rick G.; Zhong, Zhi
2013-01-01
Our previous studies showed that an extract from Camellia sinenesis (green tea), which contains several polyphenols, attenuates nephrotoxicity caused by cyclosporine A (CsA). Since polyphenols are stimulators of mitochondrial biogenesis (MB), this study investigated whether stimulation of MB plays a role in green tea polyphenol protection against CsA renal toxicity. Rats were fed a powdered diet containing green tea polyphenolic extract (0.1%) starting 3 days prior to CsA treatment (25 mg/kg, i.g. daily for 3 weeks). CsA alone decreased renal nuclear DNA-encoded oxidative phosphorylation (OXPHOS) protein ATP synthase-β (AS-β) by 42%, mitochondrial DNA (mtDNA)-encoded OXPHOS protein NADH dehydrogenase-3 (ND3) by 87% and their associated mRNAs. Mitochondrial DNA copy number was also decreased by 78% by CsA. Immunohistochemical analysis showed decreased cytochrome c oxidase subunit IV (COX-IV), an OXPHOS protein, in tubular cells. Peroxisome proliferator-activated receptor-γ coactivator (PGC)-1α, the master regulator of MB, and mitochondrial transcription factor-A (Tfam), the transcription factor that regulates mtDNA replication and transcription, were 42% and 90% lower, respectively, in the kidneys of CsA-treated than in untreated rats. These results indicate suppression of MB by chronic CsA treatment. Green tea polyphenols alone and following CsA increased AS-β, ND3, COX-IV, mtDNA copy number, PGC-1α mRNA and protein, decreased acetylated PGC-1α, and increased Tfam mRNA and protein. In association with suppressed MB, CsA increased serum creatinine, caused loss of brush border and dilatation of proximal tubules, tubular atrophy, vacuolization, apoptosis, calcification, and increased neutrophil gelatinase-associated lipocalin expression, leukocyte infiltration, and renal fibrosis. Green tea polyphenols markedly attenuated CsA-induced renal injury and improved renal function. Together, these results demonstrate that green tea polyphenols attenuate Cs
Recovery of choline oxidase activity by in vitro recombination of individual segments.
Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T
2008-11-01
Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.
Liu, Lei
2012-01-01
Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.
2010-01-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Polyphenols, Inflammation, and Cardiovascular Disease
Tangney, Christy; Rasmussen, Heather E.
2013-01-01
Polyphenols are compounds found in foods such as tea, coffee, cocoa, olive oil, and red wine and have been studied to determine if their intake may modify cardiovascular disease (CVD) risk. Historically, biologic actions of polyphenols have been attributed to antioxidant activities, but recent evidence suggests that immunomodulatory and vasodilatory properties of polyphenols may also contribute to CVD risk reduction. These properties will be discussed, and recent epidemiological evidence and intervention trials will be reviewed. Further identification of polyphenols in foods and accurate assessment of exposures through measurement of biomarkers (i.e., polyphenol metabolites) could provide the needed impetus to examine the impact of polyphenol-rich foods on CVD intermediate outcomes (especially those signifying chronic inflammation) and hard endpoints among high risk patients. Although we have mechanistic insight into how polyphenols may function in CVD risk reduction, further research is needed before definitive recommendations for consumption can be made. PMID:23512608
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Giovannelli, Lisa; Pitozzi, Vanessa; Luceri, Cristina; Giannini, Lucia; Toti, Simona; Salvini, Simonetta; Sera, Francesco; Souquet, Jean-Marc; Cheynier, Veronique; Sofi, Francesco; Mannini, Lucia; Gori, Anna Maria; Abbate, Rosanna; Palli, Domenico; Dolara, Piero
2011-02-01
Epidemiological studies suggest that a moderate consumption of wine is associated with a reduced risk of cardiovascular diseases and with a reduced mortality for all causes, possibly due to increased antioxidant defences. The present intervention study was undertaken to evaluate the in vivo effects of wine polyphenols on gene expression in humans, along with their supposed antioxidant activity. Blood haemorheology and platelet function were also evaluated. In order to avoid interferences from alcohol, we used de-alcoholised wine (DAW) with different polyphenol content. A randomised cross-over trial of high-proanthocyanidin (PA) red DAW (500 mL/die, PA dose = 7 mg/kg b.w.) vs. low-PA rosé DAW (500 mL/die, PA dose = 0.45 mg/kg) was conducted in 21 post-menopausal women in Florence, Italy. Oxidative DNA damage by the comet assay and gene expression by microarray was measured in peripheral blood lymphocytes, collected during the study period. Blood samples were also collected for the evaluation of haematological, haemostatic, haemorheological, and inflammatory parameters. The results of the present study provide evidence that consumption of substantial amounts of de-alcoholised wine for 1 month does not exert a protective activity towards oxidative DNA damage, nor modifies significantly the gene expression profile of peripheral lymphocytes, whereas it shows blood-fluidifying actions, expressed as a significant decrease in blood viscosity. However, this effect does not correlate with the dosage of polyphenols of the de-alcoholised wine. More intervention studies are needed to provide further evidence of the health-protective effects of wine proanthocyanidins.
Genetics Home Reference: isolated sulfite oxidase deficiency
... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...
A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong
2014-01-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425
Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.
Clary, D O; Wolstenholme, D R
1983-01-01
Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo
2016-04-15
The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.
Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu
2014-01-01
POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.
The role of the embryo and ethylene in avocado fruit mesocarp discoloration
Hershkovitz, Vera; Friedman, Haya; Goldschmidt, Eliezer E.; Pesis, Edna
2009-01-01
Chilling injury (CI) symptoms in avocado (Persea americana Mill.) fruit, expressed as mesocarp discoloration, were found to be associated with embryo growth and ethylene production during cold storage. In cvs Ettinger and Arad most mesocarp discoloration was located close to the base of the seed and was induced by ethylene treatment in seeded avocado fruit. However, ethylene did not increase mesocarp discoloration in seedless fruit stored at 5 °C. Application of ethylene to whole fruit induced embryo development inside the seed. It also induced seedling elongation when seeds were imbibed separately. Persea americana ethylene receptor (PaETR) gene expression and polyphenol oxidase activity were highest close to the base of the seed and decreased gradually toward the blossom end. By contrast, expressions of PaETR transcript and polyphenol oxidase activity in seedless avocado fruit were similar throughout the pulp at the base of the fruit. Application of the ethylene inhibitor, 1-methylcyclopropene, decreased mesocarp browning, embryo development, seedling growth, and ion leakage, and down-regulated polyphenol oxidase activity. The results demonstrate that ethylene-mediated embryo growth in whole fruit is involved in the mesocarp response to ethylene perception and the development of CI disorders. PMID:19196750
The role of the embryo and ethylene in avocado fruit mesocarp discoloration.
Hershkovitz, Vera; Friedman, Haya; Goldschmidt, Eliezer E; Pesis, Edna
2009-01-01
Chilling injury (CI) symptoms in avocado (Persea americana Mill.) fruit, expressed as mesocarp discoloration, were found to be associated with embryo growth and ethylene production during cold storage. In cvs Ettinger and Arad most mesocarp discoloration was located close to the base of the seed and was induced by ethylene treatment in seeded avocado fruit. However, ethylene did not increase mesocarp discoloration in seedless fruit stored at 5 degrees C. Application of ethylene to whole fruit induced embryo development inside the seed. It also induced seedling elongation when seeds were imbibed separately. Persea americana ethylene receptor (PaETR) gene expression and polyphenol oxidase activity were highest close to the base of the seed and decreased gradually toward the blossom end. By contrast, expressions of PaETR transcript and polyphenol oxidase activity in seedless avocado fruit were similar throughout the pulp at the base of the fruit. Application of the ethylene inhibitor, 1-methylcyclopropene, decreased mesocarp browning, embryo development, seedling growth, and ion leakage, and down-regulated polyphenol oxidase activity. The results demonstrate that ethylene-mediated embryo growth in whole fruit is involved in the mesocarp response to ethylene perception and the development of CI disorders.
Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei
2012-03-01
The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.
Exploiting algal NADPH oxidase for biophotovoltaic energy
Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...
2015-01-29
Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1
Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.
2001-01-01
It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345
Y Chromosome Regulation of Autism Susceptibility Genes
2009-06-01
with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved
A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping
2014-09-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Miyata, Naoyuki; Tani, Yukinori; Maruo, Kanako; Tsuno, Hiroshi; Sakata, Masahiro; Iwahori, Keisuke
2006-01-01
Ascomycetes that can deposit Mn(III, IV) oxides are widespread in aquatic and soil environments, yet the mechanism(s) involved in Mn oxide deposition remains unclear. A Mn(II)-oxidizing ascomycete, Acremonium sp. strain KR21-2, produced a Mn oxide phase with filamentous nanostructures. X-ray absorption near-edge structure (XANES) spectroscopy showed that the Mn phase was primarily Mn(IV). We purified to homogeneity a laccase-like enzyme with Mn(II) oxidase activity from cultures of strain KR21-2. The purified enzyme oxidized Mn(II) to yield suspended Mn particles; XANES spectra indicated that Mn(II) had been converted to Mn(IV). The pH optimum for Mn(II) oxidation was 7.0, and the apparent half-saturation constant was 0.20 mM. The enzyme oxidized ABTS [2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)] (pH optimum, 5.5; Km, 1.2 mM) and contained two copper atoms per molecule. Moreover, the N-terminal amino acid sequence (residues 3 to 25) was 61% identical with the corresponding sequence of an Acremonium polyphenol oxidase and 57% identical with that of a Myrothecium bilirubin oxidase. These results provide the first evidence that a fungal multicopper oxidase can convert Mn(II) to Mn(IV) oxide. The present study reinforces the notion of the contribution of multicopper oxidase to microbially mediated precipitation of Mn oxides and suggests that Acremonium sp. strain KR21-2 is a good model for understanding the oxidation of Mn in diverse ascomycetes. PMID:17021194
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
USDA-ARS?s Scientific Manuscript database
Cinnamon (Cinnamomum verum) has been widely used in spices, flavoring agents, and preservatives. Cinnamon polyphenol extract (CPE) may be important in the alleviation of chronic diseases, but the molecular evidence is not substantial. Tristetraprolin (TTP) family proteins have anti-inflammatory ef...
The monoamine oxidase A gene promoter repeat and prostate cancer risk.
White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S
2012-11-01
Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans
1998-01-01
Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772
Polyphenol levels in human urine after intake of six different polyphenol-rich beverages.
Ito, Hideyuki; Gonthier, Marie-Paule; Manach, Claudine; Morand, Christine; Mennen, Louise; Rémésy, Christian; Scalbert, Augustin
2005-10-01
Dietary polyphenols are suggested to participate in the prevention of CVD and cancer. It is essential for epidemiological studies to be able to compare intake of the main dietary polyphenols in populations. The present paper describes a fast method suitable for the analysis of polyphenols in urine, selected as potential biomarkers of intake. This method is applied to the estimation of polyphenol recovery after ingestion of six different polyphenol-rich beverages. Fifteen polyphenols including mammalian lignans (enterodiol and enterolactone), several phenolic acids (chlorogenic, caffeic, m-coumaric, gallic, and 4-O-methylgallic acids), phloretin and various flavonoids (catechin, epicatechin, quercetin, isorhamnetin, kaempferol, hesperetin, and naringenin) were simultaneously quantified in human urine by HPLC coupled with electrospray ionisation mass-MS (HPLC-electrospray-tandem mass spectrometry) with a run time of 6 min per sample. The method has been validated with regard to linearity, precision, and accuracy in intra- and inter-day assays. It was applied to urine samples collected from nine volunteers in the 24 h following consumption of either green tea, a grape-skin extract, cocoa beverage, coffee, grapefruit juice or orange juice. Levels of urinary excretion suggest that chlorogenic acid, gallic acid, epicatechin, naringenin or hesperetin could be used as specific biomarkers to evaluate the consumption of coffee, wine, tea or cocoa, and citrus juices respectively.
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension
FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.
2010-01-01
Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159
Targeting miRNAs by polyphenols: Novel therapeutic strategy for cancer.
Pandima Devi, Kasi; Rajavel, Tamilselvam; Daglia, Maria; Nabavi, Seyed Fazel; Bishayee, Anupam; Nabavi, Seyed Mohammad
2017-10-01
In the recent years, polyphenols have gained significant attention in scientific community owing to their potential anticancer effects against a wide range of human malignancies. Epidemiological, clinical and preclinical studies have supported that daily intake of polyphenol-rich dietary fruits have a strong co-relationship in the prevention of different types of cancer. In addition to direct antioxidant mechanisms, they also regulate several therapeutically important oncogenic signaling and transcription factors. However, after the discovery of microRNA (miRNA), numerous studies have identified that polyphenols, including epigallocatechin-3-gallate, genistein, resveratrol and curcumin exert their anticancer effects by regulating different miRNAs which are implicated in all the stages of cancer. MiRNAs are short, non-coding endogenous RNA, which silence the gene functions by targeting messenger RNA (mRNA) through degradation or translation repression. However, cancer associated miRNAs has emerged only in recent years to support its applications in cancer therapy. Preclinical experiments have suggested that deregulation of single miRNA is sufficient for neoplastic transformation of cells. Indeed, the widespread deregulation of several miRNA profiles of tumor and healthy tissue samples revealed the involvement of many types of miRNA in the development of numerous cancers. Hence, targeting the miRNAs using polyphenols will be a novel and promising strategy in anticancer chemotherapy. Herein, we have critically reviewed the potential applications of polyphenols on various human miRNAs, especially which are involved in oncogenic and tumor suppressor pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa
2012-12-30
The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Identification of NADPH oxidase family members associated with cold stress in strawberry.
Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru
2018-04-01
NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.
Lin, Yuling; Min, Jiumeng; Lai, Ruilian; Wu, Zhangyan; Chen, Yukun; Yu, Lili; Cheng, Chunzhen; Jin, Yuanchun; Tian, Qilin; Liu, Qingfeng; Liu, Weihua; Zhang, Chengguang; Lin, Lixia; Hu, Yan; Zhang, Dongmin; Thu, Minkyaw; Zhang, Zihao; Liu, Shengcai; Zhong, Chunshui; Fang, Xiaodong; Wang, Jian; Yang, Huanming
2017-01-01
Abstract Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems. To gain insights into the genomic basis of longan traits, a draft genome sequence was assembled. The draft genome (about 471.88 Mb) of a Chinese longan cultivar, “Honghezi,” was estimated to contain 31 007 genes and 261.88 Mb of repetitive sequences. No recent whole-genome-wide duplication event was detected in the genome. Whole-genome resequencing and analysis of 13 cultivated D. longan accessions revealed the extent of genetic diversity. Comparative transcriptome studies combined with genome-wide analysis revealed polyphenol-rich and pathogen resistance characteristics. Genes involved in secondary metabolism, especially those from significantly expanded (DHS, SDH, F3΄H, ANR, and UFGT) and contracted (PAL, CHS, and F3΄5΄H) gene families with tissue-specific expression, may be important contributors to the high accumulation levels of polyphenolic compounds observed in longan fruit. The high number of genes encoding nucleotide-binding site leucine-rich repeat (NBS-LRR) and leucine-rich repeat receptor-like kinase proteins, as well as the recent expansion and contraction of the NBS-LRR family, suggested a genomic basis for resistance to insects, fungus, and bacteria in this fruit tree. These data provide insights into the evolution and diversity of the longan genome. The comparative genomic and transcriptome analyses provided information about longan-specific traits, particularly genes involved in its polyphenol-rich and pathogen resistance characteristics. PMID:28368449
NASA Astrophysics Data System (ADS)
Zak, Dominik; Roth, Cyril; Gelbrecht, Jörg; Fenner, Nathalie; Reuter, Hendrik
2015-04-01
Recently, more than 30,000 ha of drained minerotrophic peatlands (= fens) in NE Germany were rewetted to restore their ecological functions. Due to an extended drainage history, a re-establishment of their original state is not expected in the short-term. Elevated concentrations of dissolved organic carbon, ammonium and phosphate have been measured in the soil porewater of the upper degraded peat layers of rewetted fens at levels of one to three orders higher than the values in pristine systems; an indicator of increased microbial activity in the upper degraded soil layers. On the other hand there is evidence that the substrate availability within the degraded peat layer is lowered since the organic matter has formerly been subject to intense decomposition over the decades of drainage and intense agricultural use of the areas. Previously however, it was suggested that inhibition of hydrolytic enzymes by polyphenolic substances is suspended during aeration of peat soils mainly due to the decomposition of the inhibiting polyphenols by oxidising enzymes such as phenol oxidase. Accordingly we hypothesised a lack of enzyme inhibiting polyphenols in degraded peat soils of rewetted fens compared to less decomposed peat of more natural fens. We collected both peat samples at the soil surface (0-20 cm) and fresh roots of dominating vascular plants and mosses (as peat parent material) from five formerly drained rewetted sites and five more natural sites of NE Germany and NW Poland. Less decomposed peat and living roots were used to obtain an internal standard for polyphenol analysis and to run enzyme inhibition tests. For all samples we determined the total phenolic contents and in addition we distinguished between the contents of hydrolysable and condensed tannic substances. From a methodical perspective the advantage of internal standards compared to the commercially available standards cyanidin chloride and tannic acid became apparent. Quantification with cyanidin or
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
Xu, Yan; Zhang, Min; Wu, Tao; Dai, ShengDong; Xu, Jinling; Zhou, Zhongkai
2015-01-01
Beneficial effects of green tea (Camellia sinensis, Theaceae) extracts against obesity have been reported; however, the anti-obesity ability of the major components of green tea, polysaccharides, polyphenols and caffeine is not clear. Therefore, experiments with total green tea extracts, polyphenols, polysaccharides, caffeine, and a complex of polysaccharide and polyphenol at a dose of 400 or 800 mg kg⁻¹ were conducted on high-fat diet fed rats for 6 weeks to investigate their anti-obesity effects. The results indicated that polyphenols and polysaccharides were responsible for the suppressive effect of green tea extracts on body weight increase and fat accumulation. Moreover, polyphenols, polysaccharides, or caffeine can improve blood lipid and antioxidant levels, and effectively reduce rat serum leptin levels, inhibit the absorption of fatty acids, and markedly reduce the expression levels of the IL-6 and TNF-α gene. Furthermore, it was shown that polysaccharides and polyphenols were synergistic in reduction of serum leptin levels and in anti-inflammatory activity. These results suggest that the polysaccharide combination with polyphenols might be a potential therapy against obesity.
Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brunner, H.G.; Nelen, M.; Ropers, H.H.
1993-10-22
Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less
Phenol oxidase activity in secondary transformed peat-moorsh soils
NASA Astrophysics Data System (ADS)
Styła, K.; Szajdak, L.
2009-04-01
The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci
Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.
Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T
2001-06-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.
Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori
Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo
2001-01-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170
Llorente, Briardo; de Souza, Flavio S J; Soto, Gabriela; Meyer, Cristian; Alonso, Guillermo D; Flawiá, Mirtha M; Bravo-Almonacid, Fernando; Ayub, Nicolás D; Rodríguez-Concepción, Manuel
2016-01-11
The plastid organelle comprises a high proportion of nucleus-encoded proteins that were acquired from different prokaryotic donors via independent horizontal gene transfers following its primary endosymbiotic origin. What forces drove the targeting of these alien proteins to the plastid remains an unresolved evolutionary question. To better understand this process we screened for suitable candidate proteins to recapitulate their prokaryote-to-eukaryote transition. Here we identify the ancient horizontal transfer of a bacterial polyphenol oxidase (PPO) gene to the nuclear genome of an early land plant ancestor and infer the possible mechanism behind the plastidial localization of the encoded enzyme. Arabidopsis plants expressing PPO versions either lacking or harbouring a plastid-targeting signal allowed examining fitness consequences associated with its subcellular localization. Markedly, a deleterious effect on plant growth was highly correlated with PPO activity only when producing the non-targeted enzyme, suggesting that selection favoured the fixation of plastid-targeted protein versions. Our results reveal a possible evolutionary mechanism of how selection against heterologous genes encoding cytosolic proteins contributed in incrementing plastid proteome complexity from non-endosymbiotic gene sources, a process that may also impact mitochondrial evolution.
Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu
2015-02-01
To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.
Unique metabolites protect earthworms against plant polyphenols.
Liebeke, Manuel; Strittmatter, Nicole; Fearn, Sarah; Morgan, A John; Kille, Peter; Fuchser, Jens; Wallis, David; Palchykov, Vitalii; Robertson, Jeremy; Lahive, Elma; Spurgeon, David J; McPhail, David; Takáts, Zoltán; Bundy, Jacob G
2015-08-04
All higher plants produce polyphenols, for defence against above-ground herbivory. These polyphenols also influence the soil micro- and macro-fauna that break down plant leaf litter. Polyphenols therefore indirectly affect the fluxes of soil nutrients and, ultimately, carbon turnover and ecosystem functioning in soils. It is unknown how earthworms, the major component of animal biomass in many soils, cope with high-polyphenol diets. Here, we show that earthworms possess a class of unique surface-active metabolites in their gut, which we term 'drilodefensins'. These compounds counteract the inhibitory effects of polyphenols on earthworm gut enzymes, and high-polyphenol diets increase drilodefensin concentrations in both laboratory and field populations. This shows that drilodefensins protect earthworms from the harmful effects of ingested polyphenols. We have identified the key mechanism for adaptation to a dietary challenge in an animal group that has a major role in organic matter recycling in soils worldwide.
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
Jesus, Ana Laura Tibério de; Leite, Thiago Soares; Cristianini, Marcelo
2018-03-01
The present study evaluated the effect of high isostatic pressure (HIP) on the activity of peroxidase (POD) and polyphenol oxidase (PPO) from açaí. Açaí pulp was submitted to several combinations of pressure (400, 500, 600MPa), temperature (25 and 65°C) for 5 and 15min. The combined effect of HIP technology and high temperatures (690MPa by 2 and 5min at 80°C) was also investigated and compared to the conventional thermal treatment (85°C/1min). POD and PPO enzyme activity and instrumental color were examined after processing and after 24h of refrigerated storage. Results showed stability of POD for all pressures at 25°C, which proved to be heat-resistant and baro-resistant at 65°C. For PPO, the inactivation at 65°C was 71.7% for 600MPa after 15min. In general, the increase in temperature from 25°C to 65°C reduced the PPO relative activity with no changes in color. Although the thermal treatment and the HIP (690MPa) along with high temperature (80°C) reduced the PPO relative activity, and relevant darkening was observed in the processed samples. Thus, it can be concluded that POD is more baro-resistant than PPO in açaí pulp subjected to the same HIP processing conditions and processing at 600MPa/65°C for 5min may be an effective alternative for thermal pasteurization treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Cancer Chemoprevention by Dietary Polyphenols: Promising Role for Epigenetics
Link, Alexander; Balaguer, Francesc; Goel, Ajay
2010-01-01
Epigenetics refers to heritable changes that are not encoded in the DNA sequence itself, but play an important role in the control of gene expression. In mammals, epigenetic mechanisms include changes in DNA methylation, histone modifications and non-coding RNAs. Although epigenetic changes are heritable in somatic cells, these modifications are also potentially reversible, which makes them attractive and promising avenues for tailoring cancer preventive and therapeutic strategies. Burgeoning evidence in the last decade has provided unprecedented clues that diet and environmental factors directly influence epigenetic mechanisms in humans. Dietary polyphenols from green tea, turmeric, soybeans, broccoli and others have shown to possess multiple cell-regulatory activities within cancer cells. More recently, we have begun to understand that some of the dietary polyphenols may exert their chemopreventive effects in part by modulating various components of the epigenetic machinery in humans. In this article, we first discuss the contribution of diet and environmental factors on epigenetic alterations; subsequently, we provide a comprehensive review of literature on the role of various dietary polyphenols. In particular, we summarize the current knowledge on a large number of dietary agents and their effects on DNA methylation, histone modifications and regulation of expression of non-coding miRNAs in various in vitro and in vivo models. We emphasize how increased understanding of the chemopreventive effects of dietary polyphenols on specific epigenetic alterations may provide unique and yet unexplored novel and highly effective chemopreventive strategies for reducing the health burden of cancer and other diseases in humans. PMID:20599773
Cocoa Polyphenols: Evidence from Epidemiological Studies.
Matsumoto, Chisa
2018-01-01
Accumulating evidence suggests potential preventive effects of chocolate/cocoa on the risk of cardio vascular disease (CVD). However, cocoa products also contain high levels of sugar and fat, which increase CVD risk factors. Even, the identity of the substance in chocolate/cocoa that has a favorable effect on CVD and CVD risk factors remains unclear, growing evidence from experimental studies suggests that cocoa polyphenols might be a major contributor to cardiovascular-protective effects. However, epidemiological studies, which are necessary to evaluate an association between the risk of CVD and cocoa polyphenol, remain sparse. We will discuss recent evidence regarding the association between cocoa polyphenol consumption and the risks of CVD and its risk factors by reviewing recent epidemiological studies. We shall also provide some guidance for patient counseling and will discuss the public health implications for recommending cocoa polyphenol consumption to prevent CVD. Epidemiological studies evaluating the association between cocoa polyphenol itself and the risk of CVD are sparse. However, evidence from limited epidemiological studies suggests that cocoa polyphenol consumption may lower the risk of CVD. Given the potential adverse effects of the consumption of cocoa products with high fat and sugar and the fact that the most appropriate dose of cocoa polyphenol for cardio-protective effects has not yet been established, health care providers should remain cautious about recommending cocoa/cocoa polyphenol consumption to their patients to reduce the risk of CVD, taking the characteristics of individual patients into careful consideration. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Herranz-López, María; Olivares-Vicente, Mariló; Barrajón-Catalán, Enrique; Segura-Carretero, Antonio; Joven, Jorge; Micol, Vicente
2017-01-01
Improper diet can alter gene expression by breaking the energy balance equation and changing metabolic and oxidative stress biomarkers, which can result in the development of obesity-related metabolic disorders. The pleiotropic effects of dietary plant polyphenols are capable of counteracting by modulating different key molecular targets at the cell, as well as through epigenetic modifications. Hibiscus sabdariffa (HS)-derived polyphenols are known to ameliorate various obesity-related conditions. Recent evidence leads to propose the complex nature of the underlying mechanism of action. This multi-targeted mechanism includes the regulation of energy metabolism, oxidative stress and inflammatory pathways, transcription factors, hormones and peptides, digestive enzymes, as well as epigenetic modifications. This article reviews the accumulated evidence on the multiple anti-obesity effects of HS polyphenols in cell and animal models, as well as in humans, and its putative molecular targets. In silico studies reveal the capacity of several HS polyphenols to act as putative ligands for different digestive and metabolic enzymes, which may also deserve further attention. Therefore, a global approach including integrated and networked omics techniques, virtual screening and epigenetic analysis is necessary to fully understand the molecular mechanisms of HS polyphenols and metabolites involved, as well as their possible implications in the design of safe and effective polyphenolic formulations for obesity. PMID:28825642
Herranz-López, María; Olivares-Vicente, Mariló; Encinar, José Antonio; Barrajón-Catalán, Enrique; Segura-Carretero, Antonio; Joven, Jorge; Micol, Vicente
2017-08-20
Improper diet can alter gene expression by breaking the energy balance equation and changing metabolic and oxidative stress biomarkers, which can result in the development of obesity-related metabolic disorders. The pleiotropic effects of dietary plant polyphenols are capable of counteracting by modulating different key molecular targets at the cell, as well as through epigenetic modifications. Hibiscus sabdariffa (HS)-derived polyphenols are known to ameliorate various obesity-related conditions. Recent evidence leads to propose the complex nature of the underlying mechanism of action. This multi-targeted mechanism includes the regulation of energy metabolism, oxidative stress and inflammatory pathways, transcription factors, hormones and peptides, digestive enzymes, as well as epigenetic modifications. This article reviews the accumulated evidence on the multiple anti-obesity effects of HS polyphenols in cell and animal models, as well as in humans, and its putative molecular targets. In silico studies reveal the capacity of several HS polyphenols to act as putative ligands for different digestive and metabolic enzymes, which may also deserve further attention. Therefore, a global approach including integrated and networked omics techniques, virtual screening and epigenetic analysis is necessary to fully understand the molecular mechanisms of HS polyphenols and metabolites involved, as well as their possible implications in the design of safe and effective polyphenolic formulations for obesity.
Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda
2017-01-01
Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251
González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.
2004-01-01
The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034
Wang, Wei; Liu, Ji-Hong
2015-01-25
Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.
Cellular Targets of Dietary Polyphenol Resveratrol
2005-03-01
attempts to generate affinity columns tagged with other polyphenols, e.g., epigallocatechin gallate ( EGCG ). Conceivably such columns, if generated, would...Similar affinity chromatography with the related polyphenol Epigallocatechin gallate does not produce similar results.” Answer: We did not make...addition, the PI does not provid expression. If there is “increased ex many bind the resveratrol affinity co related polyphenol Epigallocatechin Response
NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys
Peck, Ammon B.; Khan, Saeed R.
2013-01-01
A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917
CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity
Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin
2013-01-01
Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini
2014-06-19
The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Zhu, Jinyan; Wang, Yuehua; Li, Xinghe; Li, Bin; Liu, Suwen; Chang, Nan; Jie, Ding; Ning, Chong; Gao, Haiyan; Meng, Xianjun
2017-07-01
The objective of this study was to evaluate the effect of different treatments-heat treatment (HT), sonication (SC), thermosonication (TS), manosonication (MS), manothermal (MT), and manothermosonication (MTS) on Escherichia coli O157:H7, polyphenol oxidase (PPO), and anthocyanin content in blueberry juice. First, samples were treated at different temperatures (30, 40, 50, 60, 70, and 80°C) and power intensities (280, 420, 560, and 700W) for 10min. Subsequently, samples were treated using combinations of power intensity and mild temperature for 10min. For further study, samples were treated using HT (80°C), TS (40°C, 560W), MT (350MPa, 40°C), MS (560W, 5min/350MPa), or MTS (560W, 5min, 40°C/350MPa, 40°C) for 5, 10, 15, 20min for each treatment, and the results compared between treatments. HT significantly reduced PPO activation (2.05% residual activity after only 5min), and resulted in a 2.00-log reduction in E. coli O157:H7 and an 85.25% retention of anthocyanin. Escherichia coli O157:H7 was slightly inactivated by TS after 5min (0.17-log reduction), while residual PPO activity was 23.36% and anthocyanin retention was 98.48%. However, Escherichia coli O157:H7 was rapidly inactivated by MTS (5.85-log reduction) after 5min, while anthocyanin retention was 97.49% and residual PPO activity dropped to 10.91%. The destruction of E. coli cells as a result of these treatments were confirmed using SEM and TEM. Therefore, a combination of sonication, high pressure, and mild heat allows the safety of blueberry juice to be maintained without compromising the retention of desirable antioxidant compounds. Copyright © 2017 Elsevier B.V. All rights reserved.
Vascular effects of wine polyphenols.
Dell'Agli, Mario; Buscialà, Alessandra; Bosisio, Enrica
2004-09-01
Moderate consumption of red wine has been putatively associated with lowering the risk of developing coronary heart disease. This beneficial effect is mainly attributed to the occurrence of polyphenol compounds such as anthocyanosides (ACs), catechins, proanthocyanidins (PAs), stilbenes and other phenolics in red wine. This review focuses on the vascular effects of red wine polyphenols (RWPs), with emphasis on anthocyanosides and proanthocyanidins. From in vitro studies, the effect of red wine polyphenols on the vascular tone is thought to be due to short- and long-term mechanisms. NO-mediated vasorelaxation represents the short-term response to wine polyphenols, which exert the effect by increasing the influx of extracellular Ca(2+), and the mobilization of intracellular Ca(2+) in endothelial cells. Polyphenolic compounds may also have long-term properties, as they increase endothelial NO synthase expression acting on the promoter activity. In addition, they decrease the expression of adhesion molecules and growth factors, involved in migration and proliferation of vascular smooth muscle cells. Moreover, they inhibit platelet aggregation. However, a paucity of data as regards the bioavailability and metabolism of these compounds in human studies is a limiting factor to proving their efficacy in vivo.
Managing hypertension by polyphenols.
Fernández-Arroyo, Salvador; Camps, Jordi; Menendez, Javier A; Joven, Jorge
2015-06-01
Some polyphenols, obtained from plants of broad use, induce a favorable endothelial response in hypertension and beneficial effects in the management of other metabolic cardiovascular risks. Previous studies in our laboratories using the calyces of Hibiscus sabdariffa as a source of polyphenols show that significant effects on hypertension are noticeable in humans only when provided in high amounts. Available data are suggestive in animal models and ex vivo experiments, but data in humans are difficult to acquire. Additionally, and despite the low bioavailability of polyphenols, intervention studies provide evidence for the protective effects of secondary plant metabolites. Assumptions on public health benefits are limited by the lack of scientific knowledge, robust data derived from large randomized clinical trials, and an accurate assessment of the bioactive components provided by common foodstuff. Because it is likely that clinical effects are the result of multiple interactions among different polyphenols rather than the isolated action of unique compounds, to provide polyphenol-rich botanical extracts as dietary supplements is a suggestive option. Unfortunately, the lack of patent perspectives for the pharmaceutical industries and the high cost of production and release for alimentary industries will hamper the performance of the necessary clinical trials. Here we briefly discuss whether and how such limitations may complicate the extensive use of plant-derived products in the management of hypertension and which steps are the necessary to deal with the predictable complexity in a possible clinical practice. Georg Thieme Verlag KG Stuttgart · New York.
Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio
2015-03-24
L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome
Kampatsikas, Ioannis; Bijelic, Aleksandar; Pretzler, Matthias; Rompel, Annette
2017-08-01
Tyrosinases are type 3 copper enzymes that belong to the polyphenol oxidase (PPO) family and are able to catalyze both the ortho-hydroxylation of monophenols and their subsequent oxidation to o-quinones, which are precursors for the biosynthesis of colouring substances such as melanin. The first plant pro-tyrosinase from Malus domestica (MdPPO1) was recombinantly expressed in its latent form (56.4 kDa) and mutated at four positions around the catalytic pocket which are believed to influence the activity of the enzyme. Mutating the amino acids, which are known as activity controllers, yielded the mutants MdPPO1-Ala239Thr and MdPPO1-Leu243Arg, whereas mutation of the so-called water-keeper and gatekeeper residues resulted in the mutants MdPPO1-Glu234Ala and MdPPO1-Phe259Ala, respectively. The wild-type enzyme and two of the mutants, MdPPO1-Ala239Thr and MdPPO1-Phe259Ala, were successfully crystallized, leading to single crystals that diffracted to 1.35, 1.55 and 1.70 Å resolution, respectively. All crystals belonged to space group P2 1 2 1 2 1 , exhibiting similar unit-cell parameters: a = 50.70, b = 80.15, c = 115.96 Å for the wild type, a = 50.58, b = 79.90, c = 115.76 Å for MdPPO1-Ala239Thr and a = 50.53, b = 79.76, c = 116.07 Å for MdPPO1-Phe259Ala. In crystallo activity tests with the crystals of the wild type and the two mutants were performed by adding the monophenolic substrate tyramine and the diphenolic substrate dopamine to crystal-containing drops. The effects of the mutation on the activity of the enzyme were observed by colour changes of the crystals owing to the conversion of the substrates to dark chromophore products.
Kampatsikas, Ioannis; Bijelic, Aleksandar; Pretzler, Matthias
2017-01-01
Tyrosinases are type 3 copper enzymes that belong to the polyphenol oxidase (PPO) family and are able to catalyze both the ortho-hydroxylation of monophenols and their subsequent oxidation to o-quinones, which are precursors for the biosynthesis of colouring substances such as melanin. The first plant pro-tyrosinase from Malus domestica (MdPPO1) was recombinantly expressed in its latent form (56.4 kDa) and mutated at four positions around the catalytic pocket which are believed to influence the activity of the enzyme. Mutating the amino acids, which are known as activity controllers, yielded the mutants MdPPO1-Ala239Thr and MdPPO1-Leu243Arg, whereas mutation of the so-called water-keeper and gatekeeper residues resulted in the mutants MdPPO1-Glu234Ala and MdPPO1-Phe259Ala, respectively. The wild-type enzyme and two of the mutants, MdPPO1-Ala239Thr and MdPPO1-Phe259Ala, were successfully crystallized, leading to single crystals that diffracted to 1.35, 1.55 and 1.70 Å resolution, respectively. All crystals belonged to space group P212121, exhibiting similar unit-cell parameters: a = 50.70, b = 80.15, c = 115.96 Å for the wild type, a = 50.58, b = 79.90, c = 115.76 Å for MdPPO1-Ala239Thr and a = 50.53, b = 79.76, c = 116.07 Å for MdPPO1-Phe259Ala. In crystallo activity tests with the crystals of the wild type and the two mutants were performed by adding the monophenolic substrate tyramine and the diphenolic substrate dopamine to crystal-containing drops. The effects of the mutation on the activity of the enzyme were observed by colour changes of the crystals owing to the conversion of the substrates to dark chromophore products. PMID:28777094
Select polyphenolic fractions from dried plum enhance osteoblast activity through BMP-2 signaling.
Graef, Jennifer L; Rendina-Ruedy, Elizabeth; Crockett, Erica K; Ouyang, Ping; King, Jarrod B; Cichewicz, Robert H; Lucas, Edralin A; Smith, Brenda J
2018-05-01
Dried plum supplementation has been shown to enhance bone formation while suppressing bone resorption. Evidence from previous studies has demonstrated that these responses can be attributed in part to the fruit's polyphenolic compounds. The purpose of this study was to identify the most bioactive polyphenolic fractions of dried plum with a focus on their osteogenic activity and to investigate their mechanisms of action under normal and inflammatory conditions. Utilizing chromatographic techniques, six fractions of polyphenolic compounds were prepared from a crude extract of dried plum. Initial screening assays revealed that two fractions (DP-FrA and DP-FrB) had the greatest osteogenic potential. Subsequent experiments using primary bone-marrow-derived osteoblast cultures demonstrated these two fractions enhanced extracellular alkaline phosphatase (ALP), an indicator of osteoblast activity, and mineralized nodule formation under normal conditions. Both fractions enhanced bone morphogenetic protein (BMP) signaling, as indicated by increased Bmp2 and Runx2 gene expression and protein levels of phosphorylated Smad1/5. DP-FrB was most effective at up-regulating Tak1 and Smad1, as well as protein levels of phospho-p38. Under inflammatory conditions, TNF-α suppressed ALP and tended to decrease nodule formation (P=.0674). This response coincided with suppressed gene expression of Bmp2 and the up-regulation of Smad6, an inhibitor of BMP signaling. DP-FrA and DP-FrB partially normalized these responses. Our results show that certain fractions of polyphenolic compounds in dried plum up-regulate osteoblast activity by enhancing BMP signaling, and when this pathway is inhibited by TNF-α, the osteogenic response is attenuated. Copyright © 2017 Elsevier Inc. All rights reserved.
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Andriamihaja, Mireille; Lan, Annaïg; Beaumont, Martin; Grauso, Marta; Gotteland, Martin; Pastene, Edgar; Cires, Maria Jose; Carrasco-Pozo, Catalina; Tomé, Daniel; Blachier, François
2018-06-01
Hydrogen sulfide (H 2 S), a metabolic end product synthesized by the microbiota from L-cysteine, has been shown to act at low micromolar concentration as a mineral oxidative substrate in colonocytes while acting as an inhibitor of oxygen consumption at higher luminal concentrations (65 µM and above). From the previous works showing that polyphenols can bind volatile sulfur compounds, we hypothesized that different dietary proanthocyanidin-containing polyphenol (PACs) plant extracts might modulate the inhibitory effect of H 2 S on colonocyte respiration. Using the model of human HT-29 Glc-/+ cell colonocytes, we show here that pre-incubation of 65 µM of the H 2 S donor NaHS with the different polyphenol extracts markedly reduced the inhibitory effect of NaHS on colonocyte oxygen consumption. Our studies on HT-29 Glc-/+ cell respiration performed in the absence or the presence of PACs reveal rapid binding of H 2 S with the sulfide-oxidizing unit and slower binding of H 2 S to the cytochrome c oxidase (complex IV of the respiratory chain). Despite acute inhibition of colonocyte respiration, no measurable effect of NaHS on paracellular permeability was recorded after 24 h treatment using the Caco-2 colonocyte monolayer model. The results are discussed in the context of the binding of excessive bacterial metabolites by unabsorbed dietary compounds and of the capacity of colonocytes to adapt to changing luminal environment.
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.
A Review of Polyphenolics in Oak Woods
Zhang, Bo; Cai, Jian; Duan, Chang-Qing; Reeves, Malcolm J.; He, Fei
2015-01-01
Polyphenolics, which are ubiquitous in plants, currently are among the most studied phytochemicals because of their perceptible chemical properties and antioxidant activity. Oak barrels and their alternatives, which are widely used in winemaking nowadays, contribute polyphenolics to wines and are thought to play crucial roles in the development of wines during aging. This study summarizes the detailed information of polyphenolics in oak woods and their products by examining their structures and discussing their chemical reactions during wine aging. This paper evaluates the most recent developments in polyphenolic chemistry by summarizing their extraction, separation, and their identification by the use of chromatographic and spectral techniques. In addition, this paper also introduces polyphenol bioactive ingredients in other plant foods. PMID:25826529
Metabolism of 2,4-dichlorophenol in tobacco engineered with bacterial degradative genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Perkins, E.J.; Sekine, M.; Gordon, M.P.
1990-05-01
The potential use of plants in toxic waste remediation has been overlooked. While chlorophenols are relatively slowly metabolized in Nicotiana tabacum var. Xanthi leaf extracts, chlorocatechols are rapidly metabolized, presumably by polyphenol oxidases. Our initial focus has been the fate of 2,4-dichlorophenol (2,4DCP) in var. Xanthi plants which express a bacterial 2,4DCP hydroxylase, which converts 2,4DCP to 3,5-dichlorocatechol. The roots of wild type and 2,4DCP hydroxylase transgenic plants growing in hydroponics were exposed to {sup 14}C-2,4DCP. Approximately 95% of {sup 14}C-2,4DCP metabolites remained in the roots when exposed to 2,4DCP. Upon extraction of root tissue, three major metabolites were foundmore » in untransformed plants and four major metabolites in transformed plants. Upon digestion with beta-D-glucosidase, these metabolites disappeared concomitant with the appearance of free 2,4DCP in wild type plants and 2,4DCP and 3,5-dichlorocatechol in transgenic plants. It is apparent that the chlorophenols are not readily available substrates for polyphenol oxidases in whole plants.« less
Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro
2010-11-01
Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.
Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.
2008-01-01
Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363
Busatto, Nicola; Farneti, Brian; Tadiello, Alice; Vrhovsek, Urska; Cappellin, Luca; Biasioli, Franco; Velasco, Riccardo; Costa, Guglielmo; Costa, Fabrizio
2014-07-20
Fruit quality features resulting from ripening processes need to be preserved throughout storage for economical reasons. However, during this period several physiological disorders can occur, of which superficial scald is one of the most important, due to the development of large brown areas on the fruit skin surface. This study examined the variation in polyphenolic content with the progress of superficial scald in apple, also with respect to 1-MCP, an ethylene competitor interacting with the hormone receptors and known to interfere with this etiology. The change in the accumulation of these metabolites was further correlated with the gene set involved in this pathway, together with two specific VOCs (Volatile Organic Compounds), α-farnesene and its oxidative form, 6-methyl-5-hepten-2-one. Metabolite profiling and qRT-PCR assay showed these volatiles are more heavily involved in the signalling system, while the browning coloration would seem to be due more to a specific accumulation of chlorogenic acid (as a consequence of the activation of MdPAL and MdC3H), and its further oxidation carried out by a polyphenol oxidase gene (MdPPO). In this physiological scenario, new evidence regarding the involvement of an anti-apoptotic regulatory mechanism for the compartmentation of this phenomenon in the skin alone was also hypothesized, as suggested by the expression profile of the MdDAD1, MdDND1 and MdLSD1 genes. The results presented in this work represent a step forward in understanding the physiological mechanisms of superficial scald in apple, shedding light on the regulation of the specific physiological cascade.
Yang, Yi-Chao; Sun, Da-Wen; Wang, Nan-Nan; Xie, Anguo
2015-07-01
A novel method of using hyperspectral imaging technique with the weighted combination of spectral data and image features by fuzzy neural network (FNN) was proposed for real-time prediction of polyphenol oxidase (PPO) activity in lychee pericarp. Lychee images were obtained by a hyperspectral reflectance imaging system operating in the range of 400-1000nm. A support vector machine-recursive feature elimination (SVM-RFE) algorithm was applied to eliminating variables with no or little information for the prediction from all bands, resulting in a reduced set of optimal wavelengths. Spectral information at the optimal wavelengths and image color features were then used respectively to develop calibration models for the prediction of PPO in pericarp during storage, and the results of two models were compared. In order to improve the prediction accuracy, a decision strategy was developed based on weighted combination of spectral data and image features, in which the weights were determined by FNN for a better estimation of PPO activity. The results showed that the combined decision model was the best among all of the calibration models, with high R(2) values of 0.9117 and 0.9072 and low RMSEs of 0.45% and 0.459% for calibration and prediction, respectively. These results demonstrate that the proposed weighted combined decision method has great potential for improving model performance. The proposed technique could be used for a better prediction of other internal and external quality attributes of fruits. Copyright © 2015 Elsevier B.V. All rights reserved.
Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.
Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela
2014-01-01
Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.
Barak, S; Nejidat, A; Heimer, Y; Volokita, M
2001-03-01
The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.
Buades-Rotger, Macià; Gallardo-Pujol, David
2014-01-01
Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607
Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza
2011-01-01
Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.
Encapsulation of Natural Polyphenolic Compounds; a Review
Munin, Aude; Edwards-Lévy, Florence
2011-01-01
Natural polyphenols are valuable compounds possessing scavenging properties towards radical oxygen species, and complexing properties towards proteins. These abilities make polyphenols interesting for the treatment of various diseases like inflammation or cancer, but also for anti-ageing purposes in cosmetic formulations, or for nutraceutical applications. Unfortunately, these properties are also responsible for a lack in long-term stability, making these natural compounds very sensitive to light and heat. Moreover, polyphenols often present a poor biodisponibility mainly due to low water solubility. Lastly, many of these molecules possess a very astringent and bitter taste, which limits their use in food or in oral medications. To circumvent these drawbacks, delivery systems have been developed, and among them, encapsulation would appear to be a promising approach. Many encapsulation methods are described in the literature, among which some have been successfully applied to plant polyphenols. In this review, after a general presentation of the large chemical family of plant polyphenols and of their main chemical and biological properties, encapsulation processes applied to polyphenols are classified into physical, physico-chemical, chemical methods, and other connected stabilization methods. After a brief description of each encapsulation process, their applications to polyphenol encapsulation for pharmaceutical, food or cosmetological purposes are presented. PMID:24309309
Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui
2016-01-10
Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.
Kita, K; Konishi, K; Anraku, Y
1986-01-01
Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.
Le Sage, Fanny; Meilhac, Olivier; Gonthier, Marie-Paule
2017-05-01
In obesity, gut microbiota LPS may translocate into the blood stream and then contribute to adipose tissue inflammation and oxidative stress, leading to insulin resistance. A causal link between periodontal infection, obesity and type 2 diabetes has also been suggested. We evaluated the ability of polyphenols from Antirhea borbonica medicinal plant to improve the inflammatory and redox status of 3T3-L1 adipocytes exposed to LPS of Porphyromonas gingivalis periodontopathogen or Escherichia coli enterobacteria. Our results show that LPS enhanced the production of Toll-like receptor-dependent MyD88 and NFκB signaling factors as well as IL-6, MCP-1, PAI-1 and resistin. Plant polyphenols reduced LPS pro-inflammatory action. Concomitantly, polyphenols increased the production of adiponectin and PPARγ, known as key anti-inflammatory and insulin-sensitizing mediators. Moreover, both LPS increased intracellular ROS levels and the expression of genes encoding ROS-producing enzymes including NOX2, NOX4 and iNOS. Plant polyphenols reversed these effects and up-regulated MnSOD and catalase antioxidant enzyme gene expression. Noticeably, preconditioning of cells with caffeic acid, chlorogenic acid or kaempferol identified among A. borbonica major polyphenols, led to similar protective properties. Altogether, these findings demonstrate the anti-inflammatory and antioxidant effects of A. borbonica polyphenols on adipocytes, in response to P. gingivalis or E. coli LPS. It will be of major interest to assess A. borbonica polyphenol benefits against obesity-related metabolic disorders such as insulin resistance in vivo. Copyright © 2017 Elsevier Ltd. All rights reserved.
Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.
1999-01-01
Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia
2001-01-01
Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688
Yemenicioğlu, Ahmet; Cemeroğlu, Bekir
2003-04-09
Destabilization of thermostable polyphenol oxidase (TS-PPO) during the ripening of peaches has been previously shown (Yemenicioğlu, A.; Cemeroğlu, B. Tr. J. Agric. For. 1998, 22, 261-265). This work studied the effect of ripening on thermal stability of apricot PPO for three different cultivars. Kabaaşi cultivar contained thermolabile PPO, whereas TS-PPO appeared in Hacihaliloğlu and Cataloğlu cultivars. The TS-PPO showed biphasic inactivation curves, and its D and z values between 60 and 90 degrees C varied in the ranges of 357-1.12 min and 11.9-12.7 degrees C, respectively. In Hacihaliloğlu cultivar the TS-PPO was very consistent and existed at all stages of ripening, whereas in Cataloğlu cultivar it appeared only at the half-ripe stage. The loss of consistent TS-PPO in Hacihaliloğlu apricots after partial purification by acetone precipitation and DEAE-cellulose chromatography suggested the non-covalent nature of its stabilization. The main purified fractions (F1 and F2) showed monophasic inactivation curves with similar thermal inactivation parameters (z(F1) = 10.4 degrees C, z(F2) = 10.1 degrees C). However, their kinetic properties against catechol (K(mF1) = 61 mM, K(mF2) = 122.7 mM) and substrate specificities were considerably different. The results of this study showed the presence of TS-PPO forming and destabilizing mechanisms in apricots. Further studies are needed for the solution of these mechanisms and to develop some new strategies that may be utilized by molecular techniques for a planned production of apricot cultivars provided with heat labile but normal PPO activity.
Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae
2010-10-01
DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.
Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band
2007-05-01
Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.
Novel insights of dietary polyphenols and obesity
Wang, Shu; Moustaid-Moussa, Naima; Chen, Lixia; Mo, Huanbiao; Shastri, Anuradha; Su, Rui; Bapat, Priyanka; Kwun, InSook; Shen, Chwan-Li
2013-01-01
Prevalence of obesity has steadily increased over the past three decades both in the United States and worldwide. Recent studies have shown the role of dietary polyphenols in the prevention of obesity and obesity-related chronic diseases. Here we evaluated the impact of commonly consumed polyphenols, including green tea catechins and epigallocatechin gallates, resveratrol, and curcumin, on obesity and obesity-related-inflammation. Cellular studies demonstrated that these dietary polyphenols reduce viability of adipocytes and proliferation of preadipocytes, suppress adipocyte differentiation and triglyceride accumulation, stimulate lipolysis and fatty acid β-oxidation, and reduce inflammation. Concomitantly, the polyphenols modulate signaling pathways including the AMP-activated protein kinase, peroxisome proliferator activated receptor γ, CCAAT/enhancer binding protein α, PPAR gamma activator 1-alpha, sirtuin 1, sterol regulatory element binding protein-1c, uncoupling proteins 1 and 2, and nuclear factor kappa B that regulate adipogenesis, antioxidant and anti-inflammatory responses. Animal studies strongly suggest that commonly consumed polyphenols described in this review have a pronounced effect on obesity as shown by lower body weight, fat mass, and triglycerides through enhancing energy expenditure and fat utilization, and modulating glucose hemostasis. Limited human studies have been conducted in this area, and are inconsistent about the anti-obesity impact of dietary polyphenols, probably due to the various study designs and lengths, variation among subjects (age, gender, ethnicity), chemical forms of the dietary polyphenols used and confounding factors such as other weight reducing agents. Future randomized controlled trials are warranted to reconcile the discrepancies between preclinical efficacies and inconclusive clinic outcomes of these polyphenols. PMID:24314860
Influence of diabetes on the pharmacokinetic behavior of natural polyphenols.
Xiao, Jianbo; Högger, Petra
2014-01-01
The development of food fortified with polyphenols and polyphenol-rich foods represents a novel approach to prevent or attenuate type 2 diabetes. It has been reported that type 2 diabetes may affect the pharmacokinetics of various drugs in several animal models. There is powerful evidence linking dietary polyphenols consumption with the risk factors defining type 2 diabetes, even if some opposite results occurred. This mini-review summarizes important advances on diabetes-associated changes in pharmacokinetics of natural polyphenols. The pharmacokinetic behavior between drugs and dietary polyphenols probably may be different due to (i) Ingested dose/amount per day. The dietary polyphenol intake per day is much higher than that of clinical drugs; (ii) Complexity of the components. Clinical drugs are well-characterized and typically small molecules. However, the polyphenols in diet are unimaginably complex; (iii) Interaction with food proteins. Although the effects of food proteins on the bioavailability of polyphenols are still not examined in much detail, direct binding interactions of polyphenols to proteins always occur; (iv) The most common polyphenols in the human diet have a low intrinsic activity and are poorly absorbed from the intestine, highly metabolized, or rapidly eliminated. Although there is very limited information available so far, it is proposed that type 2 diabetes influences the pharmacokinetic behavior of dietary polyphenols including: i) competition of glucose with polyphenols regarding binding to plasma proteins; ii) weakened non-covalent interaction affinities of plasma proteins for natural polyphenols due to protein glycation in type II diabetes; iii) the enhanced clearance of polyphenols in type 2 diabetes. An understanding of diabetes-associated changes in absorption, distribution, metabolism, elimination and bioactivities of natural polyphenols as well as the mechanism of the variability should lead to the improvement of the benefits of
Polyphenols from cocoa and vascular health-a critical review.
Rimbach, Gerald; Melchin, Mona; Moehring, Jennifer; Wagner, Anika E
2009-11-20
Cocoa is a rich source of dietary polyphenols. In vitro as well as cell culture data indicate that cocoa polyphenols may exhibit antioxidant and anti-inflammatory, as well as anti-atherogenic activity. Several molecular targets (e.g., nuclear factor kappa B, endothelial nitric oxide synthase, angiotensin converting enzyme) have been recently identified which may partly explain potential beneficial cardiovascular effects of cocoa polyphenols. However cocoa polyphenol concentrations, as used in many cell culture studies, are not physiologically achievable. Bioavailability studies indicate that plasma concentrations of cocoa polyphenols following dietary intake are low and in the nanomolar range. Human studies regarding the effect of cocoa polyphenols on vascular health are often underpowered and lack a rigorous study design. If dietary cocoa polyphenol intake is due to chocolate its high energy content needs to be taken into account. In order to determine potential health benefits of cocoa polyphenols large scale, long term, randomized, placebo controlled studies, (ideally with a cross-over design) as well as prospective studies are warranted.
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Wu, Ying-Hui; Fischer, David F; Swaab, Dick F
2007-09-05
Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.
Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah
2016-06-17
The effects of different drying methods (freeze drying, vacuum oven drying, and shade drying) on the phytochemical constituents associated with the antioxidant activities of Z. officinale var. rubrum Theilade were evaluated to determine the optimal drying process for these rhizomes. Total flavonoid content (TFC), total phenolic content (TPC), and polyphenol oxidase (PPO) activity were measured using the spectrophotometric method. Individual phenolic acids and flavonoids, 6- and 8-gingerol and shogaol were identified by ultra-high performance liquid chromatography method. Ferric reducing antioxidant potential (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays were used for the evaluation of antioxidant activities. The highest reduction in moisture content was observed after freeze drying (82.97%), followed by vacuum oven drying (80.43%) and shade drying (72.65%). The highest TPC, TFC, and 6- and 8-shogaol contents were observed in samples dried by the vacuum oven drying method compared to other drying methods. The highest content of 6- and 8-gingerol was observed after freeze drying, followed by vacuum oven drying and shade drying methods. Fresh samples had the highest PPO activity and lowest content of flavonoid and phenolic acid compounds compared to dried samples. Rhizomes dried by the vacuum oven drying method represent the highest DPPH (52.9%) and FRAP activities (566.5 μM of Fe (II)/g DM), followed by freeze drying (48.3% and 527.1 μM of Fe (II)/g DM, respectively) and shade drying methods (37.64% and 471.8 μM of Fe (II)/g DM, respectively) with IC50 values of 27.2, 29.1, and 34.8 μg/mL, respectively. Negative and significant correlations were observed between PPO and antioxidant activity of rhizomes. Vacuum oven dried rhizomes can be utilized as an ingredient for the development of value-added food products as they contain high contents of phytochemicals with valuable antioxidant potential.
Plant Polyphenols as Chemopreventive Agents for Lung Cancer
Amararathna, Madumani; Johnston, Michael R.; Rupasinghe, H. P. Vasantha
2016-01-01
Lung cancer may be prevented by a diet rich in fruits and vegetables as they are enriched with dietary antioxidant polyphenols, such as flavonoids, proanthocyanidins, lignans, stilbenes, and phenolic acids. Dietary polyphenols exert a wide range of beneficial biological functions beyond their antioxidative properties and are involved in regulation of cell survival pathways leading to anticarcinogenic and antimutagenic functions. There are sufficient evidence from in vitro, in vivo, and epidemiological studies to suggest that the dietary intervention of polyphenols in cancer prevention, including the chemopreventive ability of dietary polyphenols, act against lung carcinogens. Cohort and epidemiological studies in selected risk populations have evaluated clinical effects of polyphenols. Polyphenols have demonstrated three major actions: antioxidative activity, regulation of phase I and II enzymes, and regulation of cell survival pathways against lung carcinogenesis. They have also shown an inverse association of lung cancer occurrences among high risk populations who consumed considerable amounts of fruits and vegetables in their daily diet. In in vitro cell culture experimental models, polyphenols bind with electrophilic metabolites from carcinogens, inactivate cellular oxygen radicals, prevent membrane lipid peroxidation and DNA oxidative damage, and adduct formation. Further, polyphenols enhance the detoxifying enzymes such as the phase II enzymes, glutathione transferases and glucuronosyl transferases. PMID:27548149
Effect of fermentation and drying on cocoa polyphenols.
Albertini, Barbara; Schoubben, Aurélie; Guarnaccia, Davide; Pinelli, Filippo; Della Vecchia, Mirco; Ricci, Maurizio; Di Renzo, Gian Carlo; Blasi, Paolo
2015-11-18
Cocoa seed polyphenols have demonstrated interesting beneficial effects in humans. Most polyphenols contained in fresh seeds are chemically modified during fermentation, drying, and cocoa powder or chocolate production. The improvement of these procedures to obtain a high-polyphenol-content cocoa is highly desirable. To this aim, a field investigation on the effect of fermentation and natural drying on fine flavor National cocoa (cacao Nacional) was performed. Cocoa seeds were fermented for 6 days and, every day, samples were sun-dried and analyzed for polyphenol content and antioxidant power. During the first 2 days of fermentation, Folin-Ciocalteu and FRAP tests evidenced a significant reduction of polyphenol content and antioxidant capacity, respectively. Changes during the following days of fermentation were less significant. Epicatechin, the most studied member of the catechin family, followed a similar pathway of degradation. Data confirmed the high impact of fermentation and drying on cocoa seed polyphenols. Fermentation and drying are, on the one hand, necessary to obtain cocoa flavor and palatability but, on the other hand, are responsible for greatly compromising polyphenol content. To obtain high-polyphenol-content cocoa, the existing fermentation, drying, and manufacturing protocols should be scientifically reviewed to understand and modify the critical steps.
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N
2002-04-01
Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Chemistry and Biochemistry of Dietary Polyphenols
Tsao, Rong
2010-01-01
Polyphenols are the biggest group of phytochemicals, and many of them have been found in plant-based foods. Polyphenol-rich diets have been linked to many health benefits. This paper is intended to review the chemistry and biochemistry of polyphenols as related to classification, extraction, separation and analytical methods, their occurrence and biosynthesis in plants, and the biological activities and implications in human health. The discussions are focused on important and most recent advances in the above aspects, and challenges are identified for future research. PMID:22254006
Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi
2013-06-01
Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.
The role of polyphenols in modern nutrition.
Williamson, G
2017-09-01
Polyphenols are found in plant-based foods and beverages, notably apples, berries, citrus fruit, plums, broccoli, cocoa, tea and coffee and many others. There is substantial epidemiological evidence that a diet high in polyphenol-rich fruit, vegetables, cocoa and beverages protects against developing cardiovascular disease and type 2 diabetes. The absorption and metabolism of these compounds have been well described and, for many, the gut microbiota play a critical role in absorption; taking into consideration the parent compound and the metabolites from colon bacteria catabolism, more than 80% of a dose can be absorbed and ultimately excreted in the urine. Common polyphenols in the diet are flavanols (cocoa, tea, apples, broad beans), flavanones (hesperidin in citrus fruit), hydroxycinnamates (coffee, many fruits), flavonols (quercetin in onions, apples and tea) and anthocyanins (berries). Many intervention studies, mechanistic in vitro data and epidemiological studies support a role for polyphenols against the development of chronic diseases. For example, flavanols decrease endothelial dysfunction, lower blood pressure and cholesterol, and modulate energy metabolism. Coffee and tea both reduce the risk of developing type 2 diabetes, through action of their constituent polyphenols. Despite extensive research, the exact mechanisms of action of polyphenols in the human body have not been decisively proven, but there is strong evidence that some targets such as nitric oxide metabolism, carbohydrate digestion and oxidative enzymes are important for health benefits. Consumption of polyphenols as healthy dietary components is consistent with the advice to eat five or more portions of fruit and vegetables per day, but it is currently difficult to recommend what 'doses' of specific polyphenols should be consumed to derive maximum benefit.
Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič
2018-04-23
Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.
Ultraviolet Irradiation Effect on Apple Juice Bioactive Compounds during Shelf Storage
Juarez-Enriquez, Edmundo; Salmerón, Ivan; Gutierrez-Mendez, Nestor; Ortega-Rivas, Enrique
2016-01-01
Clarified and standardized apple juice was ultraviolet-irradiated to inactivate polyphenol oxidase enzyme and microbiota, and its effect on bioactive compounds and stability during storage was also evaluated. Apple juice was irradiated with 345.6 J/cm2 and treatment effect was evaluated in terms of color, antioxidant capacity, polyphenol content, pH, titratable acidity and total soluble solids. Using a linear regression design, inactivation kinetic of polyphenol oxidase enzyme was also described. In addition, a repeated measures design was carried out to evaluate apple juice during 24 days of storage at 4 °C and 20 °C. After irradiation, reduction of antioxidant capacity was observed while during storage, ascorbic acid content decreased up to 40% and total polyphenol content remain stable. Ultraviolet irradiation achieved a complete inactivation of polyphenol oxidase enzyme and microbiota, keeping apple juice antioxidants during ultraviolet treatment and storage available until juice consumption. UV-treated apple juice can be used as a regular beverage, ensuring antioxidant intake. PMID:28231106
Use of Polyphenolic Compounds in Dermatologic Oncology
Costa, Adilson; Bonner, Michael Yi
2017-01-01
Polyphenols are a widely used class of compounds in dermatology. While phenol itself, the most basic member of the phenol family, is chemically synthesized, most polyphenolic compounds are found in plants and form part of their defense mechanism against decomposition. Polyphenolic compounds, which include phenolic acids, flavonoids, stilbenes, and lignans, play an integral role in preventing the attack on plants by bacteria and fungi, as well as serving as cross-links in plant polymers. There is also mounting evidence that polyphenolic compounds play an important role in human health as well. One of the most important benefits, which puts them in the spotlight of current studies, is their antitumor profile. Some of these polyphenolic compounds have already presented promising results in either in vitro or in vivo studies for non-melanoma skin cancer and melanoma. These compounds act on several biomolecular pathways including cell division cycle arrest, autophagy, and apoptosis. Indeed, such natural compounds may be of potential for both preventive and therapeutic fields of cancer. This review evaluates the existing scientific literature in order to provide support for new research opportunities using polyphenolic compounds in oncodermatology. PMID:27164914
NADPH oxidases in the arbuscular mycorrhizal symbiosis.
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.
NADPH oxidases in the arbuscular mycorrhizal symbiosis
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Polyphenols from Cocoa and Vascular Health—A Critical Review
Rimbach, Gerald; Melchin, Mona; Moehring, Jennifer; Wagner, Anika E.
2009-01-01
Cocoa is a rich source of dietary polyphenols. In vitro as well as cell culture data indicate that cocoa polyphenols may exhibit antioxidant and anti-inflammatory, as well as anti-atherogenic activity. Several molecular targets (e.g., nuclear factor kappa B, endothelial nitric oxide synthase, angiotensin converting enzyme) have been recently identified which may partly explain potential beneficial cardiovascular effects of cocoa polyphenols. However cocoa polyphenol concentrations, as used in many cell culture studies, are not physiologically achievable. Bioavailability studies indicate that plasma concentrations of cocoa polyphenols following dietary intake are low and in the nanomolar range. Human studies regarding the effect of cocoa polyphenols on vascular health are often underpowered and lack a rigorous study design. If dietary cocoa polyphenol intake is due to chocolate its high energy content needs to be taken into account. In order to determine potential health benefits of cocoa polyphenols large scale, long term, randomized, placebo controlled studies, (ideally with a cross-over design) as well as prospective studies are warranted. PMID:20057946
Noh, Hwayoung; Freisling, Heinz; Assi, Nada; Zamora-Ros, Raul; Achaintre, David; Affret, Aurélie; Mancini, Francesca; Boutron-Ruault, Marie-Christine; Flögel, Anna; Boeing, Heiner; Kühn, Tilman; Schübel, Ruth; Trichopoulou, Antonia; Naska, Androniki; Kritikou, Maria; Palli, Domenico; Pala, Valeria; Tumino, Rosario; Ricceri, Fulvio; Santucci de Magistris, Maria; Cross, Amanda; Slimani, Nadia; Scalbert, Augustin; Ferrari, Pietro
2017-07-25
We identified urinary polyphenol metabolite patterns by a novel algorithm that combines dimension reduction and variable selection methods to explain polyphenol-rich food intake, and compared their respective performance with that of single biomarkers in the European Prospective Investigation into Cancer and Nutrition (EPIC) study. The study included 475 adults from four European countries (Germany, France, Italy, and Greece). Dietary intakes were assessed with 24-h dietary recalls (24-HDR) and dietary questionnaires (DQ). Thirty-four polyphenols were measured by ultra-performance liquid chromatography-electrospray ionization-tandem mass spectrometry (UPLC-ESI-MS-MS) in 24-h urine. Reduced rank regression-based variable importance in projection (RRR-VIP) and least absolute shrinkage and selection operator (LASSO) methods were used to select polyphenol metabolites. Reduced rank regression (RRR) was then used to identify patterns in these metabolites, maximizing the explained variability in intake of pre-selected polyphenol-rich foods. The performance of RRR models was evaluated using internal cross-validation to control for over-optimistic findings from over-fitting. High performance was observed for explaining recent intake (24-HDR) of red wine ( r = 0.65; AUC = 89.1%), coffee ( r = 0.51; AUC = 89.1%), and olives ( r = 0.35; AUC = 82.2%). These metabolite patterns performed better or equally well compared to single polyphenol biomarkers. Neither metabolite patterns nor single biomarkers performed well in explaining habitual intake (as reported in the DQ) of polyphenol-rich foods. This proposed strategy of biomarker pattern identification has the potential of expanding the currently still limited list of available dietary intake biomarkers.
Loke, Wai Mun; Proudfoot, Julie M; Hodgson, Jonathan M; McKinley, Allan J; Hime, Neil; Magat, Maria; Stocker, Roland; Croft, Kevin D
2010-04-01
Animal and clinical studies have suggested that polyphenols in fruits, red wine, and tea may delay the development of atherosclerosis through their antioxidant and anti-inflammatory properties. We investigated whether individual dietary polyphenols representing different polyphenolic classes, namely quercetin (flavonol), (-)-epicatechin (flavan-3-ol), theaflavin (dimeric catechin), sesamin (lignan), or chlorogenic acid (phenolic acid), reduce atherosclerotic lesion formation in the apolipoprotein E (ApoE)(-/-) gene-knockout mouse. Quercetin and theaflavin (64-mg/kg body mass daily) significantly attenuated atherosclerotic lesion size in the aortic sinus and thoracic aorta (P<0.05 versus ApoE(-/-) control mice). Quercetin significantly reduced aortic F(2)-isoprostane, vascular superoxide, vascular leukotriene B(4), and plasma-sP-selectin concentrations; and augmented vascular endothelial NO synthase activity, heme oxygenase-1 protein, and urinary nitrate excretion (P<0.05 versus control ApoE(-/-) mice). Theaflavin showed similar, although less extensive, significant effects. Although (-)-epicatechin significantly reduced F(2)-isoprostane, superoxide, and endothelin-1 production (P<0.05 versus control ApoE(-/-) mice), it had no significant effect on lesion size. Sesamin and chlorogenic acid treatments exerted no significant effects. Quercetin, but not (-)-epicatechin, significantly increased the expression of heme oxygenase-1 protein in lesions versus ApoE(-/-) controls. Specific dietary polyphenols, in particular quercetin and theaflavin, may attenuate atherosclerosis in ApoE(-/-) gene-knockout mice by alleviating inflammation, improving NO bioavailability, and inducing heme oxygenase-1. These data suggest that the cardiovascular protection associated with diets rich in fruits, vegetables, and some beverages may in part be the result of flavonoids, such as quercetin.
Wang, Li; Yamasaki, Masayuki; Katsube, Takuya; Sun, Xufeng; Yamasaki, Yukikazu; Shiwaku, Kuninori
2011-03-01
Dietary supplementation with polyphenolic compounds is associated with reduced diet-induced obesity and metabolic disorders in humans. The antioxidative properties of polyphenolic compounds contribute to their antiobesity effect in animal experiments and human studies. The aim of the study was to investigate the antiobesity effect of polyphenolic compounds from molokheiya leaves in LDLR-/- mice fed high-fat diet and to elucidate the mechanism of this effect. Three groups of LDLR-/- mice were fed with a high-fat diet, supplemented with 0% (control), 1 or 3% molokheiya leaf powder (MLP). Gene expression in the liver associated with lipid and glucose metabolism was analyzed, and physical parameters and blood biochemistry were determined. Compared to controls, mice body weight gain (P = 0.003), liver weight (P = 0.001) and liver triglyceride levels (P = 0.005) were significantly lower in the two MLP groups. Epididymal adipose tissue weight (P = 0.003) was reduced in the 3% MLP group. Liver tissue gene expression of gp91phox (NOX2), involved in oxidative stress, was significantly down-regulated (P = 0.005), and PPARα and CPT1A, related to the activation of β-oxidation, were significantly up-regulated (P = 0.025 and 0.006, respectively) in the 3% MLP group compared to the control group. Our results demonstrate an antiobesity effect of polyphenolic compounds from molokheiya leaves and that this effect is associated with reduction in oxidative stress and enhancement of β-oxidation in the liver. Consumption of molokheiya leaves may be beneficial for preventing diet-induced obesity.
Modulation of neurotrophic signaling pathways by polyphenols
Moosavi, Fatemeh; Hosseini, Razieh; Saso, Luciano; Firuzi, Omidreza
2016-01-01
Polyphenols are an important class of phytochemicals, and several lines of evidence have demonstrated their beneficial effects in the context of a number of pathologies including neurodegenerative disorders such as Alzheimer’s and Parkinson’s disease. In this report, we review the studies on the effects of polyphenols on neuronal survival, growth, proliferation and differentiation, and the signaling pathways involved in these neurotrophic actions. Several polyphenols including flavonoids such as baicalein, daidzein, luteolin, and nobiletin as well as nonflavonoid polyphenols such as auraptene, carnosic acid, curcuminoids, and hydroxycinnamic acid derivatives including caffeic acid phentyl ester enhance neuronal survival and promote neurite outgrowth in vitro, a hallmark of neuronal differentiation. Assessment of underlying mechanisms, especially in PC12 neuronal-like cells, reveals that direct agonistic effect on tropomyosin receptor kinase (Trk) receptors, the main receptors of neurotrophic factors including nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) explains the action of few polyphenols such as 7,8-dihydroxyflavone. However, several other polyphenolic compounds activate extracellular signal-regulated kinase (ERK) and phosphoinositide 3-kinase (PI3K)/Akt pathways. Increased expression of neurotrophic factors in vitro and in vivo is the mechanism of neurotrophic action of flavonoids such as scutellarin, daidzein, genistein, and fisetin, while compounds like apigenin and ferulic acid increase cyclic adenosine monophosphate response element-binding protein (CREB) phosphorylation. Finally, the antioxidant activity of polyphenols reflected in the activation of Nrf2 pathway and the consequent upregulation of detoxification enzymes such as heme oxygenase-1 as well as the contribution of these effects to the neurotrophic activity have also been discussed. In conclusion, a better understanding of the neurotrophic effects of polyphenols and
Suppressors of systemin signaling identify genes in the tomato wound response pathway.
Howe, G A; Ryan, C A
1999-01-01
In tomato plants, systemic induction of defense genes in response to herbivory or mechanical wounding is regulated by an 18-amino-acid peptide signal called systemin. Transgenic plants that overexpress prosystemin, the systemin precursor, from a 35S::prosystemin (35S::prosys) transgene exhibit constitutive expression of wound-inducible defense proteins including proteinase inhibitors and polyphenol oxidase. To study further the role of (pro)systemin in the wound response pathway, we isolated and characterized mutations that suppress 35S::prosys-mediated phenotypes. Ten recessive, extragenic suppressors were identified. Two of these define new alleles of def-1, a previously identified mutation that blocks both wound- and systemin-induced gene expression and renders plants susceptible to herbivory. The remaining mutants defined four loci designated Spr-1, Spr-2, Spr-3, and Spr-4 (for Suppressed in 35S::prosystemin-mediated responses). spr-3 and spr-4 mutants were not significantly affected in their response to either systemin or mechanical wounding. In contrast, spr-1 and spr-2 plants lacked systemic wound responses and were insensitive to systemin. These results confirm the function of (pro)systemin in the transduction of systemic wound signals and further establish that wounding, systemin, and 35S::prosys induce defensive gene expression through a common signaling pathway defined by at least three genes (Def-1, Spr-1, and Spr-2). PMID:10545469
Kawai, Yoshichika
2011-01-01
It has been suggested that polyphenol-rich diets decrease the risk of cardiovascular diseases. Although studies of the bioavailability of polyphenols, particularly their absorption and metabolism, have been reported recently, the tissue and cellular distributions underlying their biological mechanisms remain unknown. It is difficult to evaluate the specific localization of tissue and/or cellular polyphenols, because the method is limited to chromatography. To overcome these difficulties, we have developed anti-polyphenol antibodies to characterize immunohistochemically the localization of polyphenols and their metabolites in vivo. Two novel monoclonal antibodies were raised against quercetin and tea catechins, which represent flavonoid-type polyphenols distributed in foods and beverages, and are expected to exhibit anti-oxidative and anti-inflammatory activities in vivo. Using these antibodies, we identified activated macrophages as a specific target of these flavonoids during the development of atherosclerotic lesions. This review describes recent findings on the molecular actions of flavonoids that underly their anti-atherosclerotic activity in vivo.
2014-01-01
Background Fruit quality features resulting from ripening processes need to be preserved throughout storage for economical reasons. However, during this period several physiological disorders can occur, of which superficial scald is one of the most important, due to the development of large brown areas on the fruit skin surface. Results This study examined the variation in polyphenolic content with the progress of superficial scald in apple, also with respect to 1-MCP, an ethylene competitor interacting with the hormone receptors and known to interfere with this etiology. The change in the accumulation of these metabolites was further correlated with the gene set involved in this pathway, together with two specific VOCs (Volatile Organic Compounds), α-farnesene and its oxidative form, 6-methyl-5-hepten-2-one. Metabolite profiling and qRT-PCR assay showed these volatiles are more heavily involved in the signalling system, while the browning coloration would seem to be due more to a specific accumulation of chlorogenic acid (as a consequence of the activation of MdPAL and MdC3H), and its further oxidation carried out by a polyphenol oxidase gene (MdPPO). In this physiological scenario, new evidence regarding the involvement of an anti-apoptotic regulatory mechanism for the compartmentation of this phenomenon in the skin alone was also hypothesized, as suggested by the expression profile of the MdDAD1, MdDND1 and MdLSD1 genes. Conclusions The results presented in this work represent a step forward in understanding the physiological mechanisms of superficial scald in apple, shedding light on the regulation of the specific physiological cascade. PMID:25038781
Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu
2016-01-01
The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723
[Polyphenol availability in fruits and vegetables consumed in Brazil].
Faller, Ana Luísa Kremer; Fialho, Eliane
2009-04-01
To estimate total polyphenol availability in fruits and vegetables commonly consumed in Brazil and its regions, and to identify the main food sources that constitute food habits in this country. Total polyphenols were determined by the Folin-Ciocalteu method and the availability estimated according to the Pesquisa de Orçamentos Familiares 2002/ 2003 (2002/2003 Family Budget Survey). Twelve highly consumed food items were chosen, of which six were 'tropical fruits' and six were vegetables under the categories of 'leafy and flower vegetables', 'fruit vegetables' and 'tuberous vegetables'. Polyphenol quantification was performed with three independent experiments, each one in duplicate. The national polyphenol availability was estimated in grams per fresh weight of each analyzed food. Daily per capita availability in Brazil and its regions was calculated using the amount of polyphenol provided by the consumption of the 12 foods analyzed. Polyphenol contents of foods varied from 15.35 to 214.84 mg GAE/ 100 g of fresh weight. Polyphenol availability in Brazil, based on the amount in kilograms that is annually acquired in Brazil, of the 12 selected foods was 48.3 mg/ day, and the Southeast and Central-West regions had the highest and lowest values, respectively. Banana was the main polyphenol source consumed in Brazil, even though this pattern varied among regions. The estimated daily polyphenol availability in Brazil was similar to other countries. Differences observed among regions could be directly related to distinct cultural habits. Although there is no recommended daily availability of polyphenols, consumption of the recommended daily amount of fruits and vegetables can increase the availability of polyphenols 16 times, showing a clear relationship between the consumption of these food groups and the availability of beneficial bioactive compounds.
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
Hernáez, Álvaro; Remaley, Alan T; Farràs, Marta; Fernández-Castillejo, Sara; Subirana, Isaac; Schröder, Helmut; Fernández-Mampel, Mireia; Muñoz-Aguayo, Daniel; Sampson, Maureen; Solà, Rosa; Farré, Magí; de la Torre, Rafael; López-Sabater, María-Carmen; Nyyssönen, Kristiina; Zunft, Hans-Joachim F; Covas, María-Isabel; Fitó, Montserrat
2015-08-01
Olive oil polyphenols have shown protective effects on cardiovascular risk factors. Their consumption decreased oxidative stress biomarkers and improved some features of the lipid profile. However, their effects on LDL concentrations in plasma and LDL atherogenicity have not yet been elucidated. Our objective was to assess whether the consumption of olive oil polyphenols could decrease LDL concentrations [measured as apolipoprotein B-100 (apo B-100) concentrations and the total number of LDL particles] and atherogenicity (the number of small LDL particles and LDL oxidizability) in humans. The study was a randomized, cross-over controlled trial in 25 healthy European men, aged 20-59 y, in the context of the EUROLIVE (Effect of Olive Oil Consumption on Oxidative Damage in European Populations) study. Volunteers ingested 25 mL/d raw low-polyphenol-content olive oil (LPCOO; 366 mg/kg) or high-polyphenol-content olive oil (HPCOO; 2.7 mg/kg) for 3 wk. Interventions were preceded by 2-wk washout periods. Effects of olive oil polyphenols on plasma LDL concentrations and atherogenicity were determined in the sample of 25 men. Effects on lipoprotein lipase (LPL) gene expression were assessed in another sample of 18 men from the EUROLIVE study. Plasma apo B-100 concentrations and the number of total and small LDL particles decreased (mean ± SD: by 5.94% ± 16.6%, 11.9% ± 12.0%, and 15.3% ± 35.1%, respectively) from baseline after the HPCOO intervention. These changes differed significantly from those after the LPCOO intervention, which resulted in significant increases of 6.39% ± 16.6%, 4.73% ± 22.0%, and 13.6% ± 36.4% from baseline (P < 0.03). LDL oxidation lag time increased by 5.0% ± 10.3% from baseline after the HPCOO intervention, which was significantly different only relative to preintervention values (P = 0.038). LPL gene expression tended to increase by 26% from baseline after the HPCOO intervention (P = 0.08) and did not change after the LPCOO intervention
ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.
Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver
2011-07-20
Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.
Polyphenols in Food: Cancer Prevention and Apoptosis Induction.
Sharma, Ashita; Kaur, Mandeep; Katnoria, Jatinder Kaur; Nagpal, Avinash Kaur
2017-10-06
Polyphenols are group of water-soluble organic compounds, mainly of natural origin. The compounds having about 5-7 aromatic rings and more than 12 phenolic hydroxyl groups are classified as polyphenols. These are the antioxidants which protect the body from oxidative damage. In plants, they are the secondary metabolites produced as a defense mechanism against stress factors. Antioxidant property of polyphenols is suggested to provide protection against many diseases associated with reactive oxygen species (ROS), including cancer. Various studies carried out across the world have suggested that polyphenols can inhibit the tumor generation, induce apoptosis in cancer cells and interfere in progression of tumors. This group of wonder compounds is present in surplus in natural plants and food products. Intake of polyphenols through diet can scavenge ROS and thus can help in cancer prevention. The plant derived products can also be used along with conventional chemotherapy to enhance the chemopreventive effects. The present review focuses on various in vitro and in vivo studies carried out to assess the anti-carcinogenic potential of polyphenols present in our food. Also, the pathways involved in cancer chemopreventive effects of various subclasses (flavonoids, lignans, stilbenes and phenolic acids) of polyphenols are discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
The Relevance of Dietary Polyphenols in Cardiovascular Protection.
Murillo, Ana G; Fernandez, Maria L
2017-01-01
The chemical structure of polyphenols consisting of aromatic rings, capable of quenching free radicals, makes them ideal candidates to protect against oxidation. Polyphenols are present in a variety of foods including grapes, berries, dark chocolate, coffee and tea to mention a few. A number of studies have shown that dietary polyphenols exert a protective effect against hypertension, dyslipidemias, inflammation, endothelial function and atherosclerosis, conditions associated with increased risk for cardiovascular disease. Studies indicate that by decreasing cholesterol absorption, polyphenols alter hepatic cholesterol homeostasis resulting in decreases in plasma lipids and reduction in atherogenic lipoproteins thus having a protective effect against atherosclerosis; polyphenols have also been shown to decrease the activity of enzymes involved in the renin-angiotensinaldosterone system and improve blood pressure. Further, they have been recognized to increase nitric oxide production and to improve endothelial function. In this review we will present some of the evidence derived from epidemiological studies, clinical interventions as well as animal and cell studies supporting the cardioprotective effects of dietary polyphenols. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Xu, Yanqun; Charles, Marie Thérèse; Luo, Zisheng; Mimee, Benjamin; Veronneau, Pierre-Yves; Rolland, Daniel; Roussel, Dominique
2017-11-22
Preharvest ultraviolet C (UV-C) irradiation is an innovative approach for increasing the bioactive phytochemical content of strawberries to increase the disease resistance and nutritional value. This study investigated the changes in individual flavonoids in strawberry developed with three different cumulative doses of preharvest UV-C treatment (low, 9.6 kJ m -2 ; middle, 15 kJ m -2 ; and high , 29.4 kJ m -2 ). Significant accumulation (p < 0.05) of phenolics (25-75% increase), namely, cyanidin 3-glucoside, pelargonidin 3-glucoside/rutinoside, glucoside and glucuronide of quercetin and kaempferol, and ellagic acid, was found in the fruit subjected to low and middle supplemental doses of UV-C radiation. The expression of the flavonoid pathway structural genes, i.e., FaCHS1, FaCHI, FaFHT, FaDFR, FaFLS, and FaFGT, was upregulated in the low- and middle-dose groups, while the early stage genes were not affected by the high dose. FaMYB1 was also relatively enhanced in the low- and middle-dose groups, while FaASR was upregulated in only the low-dose group. Hormetic preharvest UV-C dose ranges for enhancing the polyphenol content of strawberries were established for the first time.
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Kidd, Parris M
2009-09-01
Plant-derived polyphenols are increasingly receiving attention as dietary supplements for the homeostatic management of inflammation, to support detoxication, and for anticancer, weight loss, and other benefits. Their pro-homeostatic effects on genes, transcription factors, enzymes, and cell signaling pathways are being intensively explored, but the poor bioavailability of some polyphenols likely contributes to poor clinical trial outcomes. This review covers four polyphenol preparations with poor bioavailability and their complexation into phytosomes to bypass this problem. Silybin and the other silymarin flavonolignans from milk thistle conserve tissue glutathione, are liver-protective, and have anticancer potential. Curcumin and its related diphenolic curcuminoids have potent antioxidant, anti-inflammatory, and anti-carcinogenic properties. The green tea flavan-3-ol catechins have antioxidant, anti-inflammatory, cardio- and neuro-protective effects, and anti-carcinogenic benefits, with fat oxidation effects coupled to weight loss. The complex grape seed proanthocyanidin mix (including catechin and epicatechin monomers and oligomers) counters oxidative stress and protects the circulatory system. For each of these preparations, conversion into phytosomes has improved efficacy without compromising safety. The phytosome technology creates intermolecular bonding between individual polyphenol molecules and one or more molecules of the phospholipid, phosphatidylcholine (PC). Molecular imaging suggests that PC molecule(s) enwrap each polyphenol; upon oral intake the amphipathic PC molecules likely usher the polyphenol through the intestinal epithelial cell outer membrane, subsequently accessing the bloodstream. PC itself has proven clinical efficacy that contributes to phytosome in vivo actions. As a molecular delivery vehicle, phytosome technology substantially improves the clinical applicabilities of polyphenols and other poorly absorbed plant medicinals.
Landi, Marco; Degl'Innocenti, Elena; Guglielminetti, Lorenzo; Guidi, Lucia
2013-06-01
Polyphenol oxidase (PPO) and, to a minor extent, peroxidase (POD) represent the key enzymes involved in enzymatic browning, a negative process induced by cutting fresh-cut produce such as lettuce (Lactuca sativa) and rocket salad (Eruca sativa). Although ascorbic acid is frequently utilised as an anti-browning agent, its mechanism in the prevention of the browning phenomenon is not clearly understood. The activity of PPO and POD and their isoforms in lettuce (a high-browning and low-ascorbic acid species) and rocket salad (a low-browning and high-ascorbic species) was characterised. The kinetic parameters of PPO and in vitro ascorbic acid-PPO inhibition were also investigated. In rocket salad, PPO activity was much lower than that in lettuce and cutting induced an increase in PPO activity only in lettuce. Exogenous ascorbic acid (5 mmol L(-1)) reduced PPO activity by about 90% in lettuce. POD did not appear to be closely related to browning in lettuce. PPO is the main enzyme involved in the browning phenomenon; POD appears to play a minor role. The concentration of endogenous ascorbic acid in rocket salad was related to its low-browning sensitivity after cutting. In lettuce, the addition of ascorbic acid directly inhibited PPO activity. The results suggest that the high ascorbic acid content found in rocket salad plays an effective role in reducing PPO activity. © 2012 Society of Chemical Industry.
Recent advances on tea polyphenols
Kanwar, Jyoti; Taskeen, Mujtaba; Mohammad, Imthiyaz; Huo, Congde; Chan, Tak Hang; Dou, Qing Ping
2012-01-01
Over the past decade many scientific and medical studies have focused on green tea for its long-purported health benefits. There is convincing evidence that tea is a cup of life. It has multiple preventive and therapeutic effects. This review thus focuses on the recent advances of tea polyphenols and their applications in the prevention and treatment of human cancers. Of the various polyphenols in tea, (−)-Epigallocatechin-3-gallate (EGCG) is the most abundant, and active compound studied in tea research. EGCG inhibits several molecular targets to inhibit cancer initiation and modulates several essential survival pathways to block cancer progression. Herein, we describe the various mechanisms of action of EGCG and also discuss previous and current ongoing clinical trials of EGCG and green tea polyphenols in different cancer types. PMID:22201858
Reducing Breast Cancer Recurrence: The Role of Dietary Polyphenolics.
Braakhuis, Andrea J; Campion, Peta; Bishop, Karen S
2016-09-06
Evidence from numerous observational and clinical studies suggest that polyphenolic phytochemicals such as phenolic acids in olive oil, flavonols in tea, chocolate and grapes, and isoflavones in soy products reduce the risk of breast cancer. A dietary food pattern naturally rich in polyphenols is the Mediterranean diet and evidence suggests those of Mediterranean descent have a lower breast cancer incidence. Whilst dietary polyphenols have been the subject of breast cancer risk-reduction, this review will focus on the clinical effects of polyphenols on reducing recurrence. Overall, we recommend breast cancer patients consume a diet naturally high in flavonol polyphenols including tea, vegetables (onion, broccoli), and fruit (apples, citrus). At least five servings of vegetables and fruit daily appear protective. Moderate soy protein consumption (5-10 g daily) and the Mediterranean dietary pattern show the most promise for breast cancer patients. In this review, we present an overview of clinical trials on supplementary polyphenols of dietary patterns rich in polyphenols on breast cancer recurrence, mechanistic data, and novel delivery systems currently being researched.
Reducing Breast Cancer Recurrence: The Role of Dietary Polyphenolics
Braakhuis, Andrea J.; Campion, Peta; Bishop, Karen S.
2016-01-01
Evidence from numerous observational and clinical studies suggest that polyphenolic phytochemicals such as phenolic acids in olive oil, flavonols in tea, chocolate and grapes, and isoflavones in soy products reduce the risk of breast cancer. A dietary food pattern naturally rich in polyphenols is the Mediterranean diet and evidence suggests those of Mediterranean descent have a lower breast cancer incidence. Whilst dietary polyphenols have been the subject of breast cancer risk-reduction, this review will focus on the clinical effects of polyphenols on reducing recurrence. Overall, we recommend breast cancer patients consume a diet naturally high in flavonol polyphenols including tea, vegetables (onion, broccoli), and fruit (apples, citrus). At least five servings of vegetables and fruit daily appear protective. Moderate soy protein consumption (5–10 g daily) and the Mediterranean dietary pattern show the most promise for breast cancer patients. In this review, we present an overview of clinical trials on supplementary polyphenols of dietary patterns rich in polyphenols on breast cancer recurrence, mechanistic data, and novel delivery systems currently being researched. PMID:27608040
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Qin, Yao; Guo, Xing Wei; Li, Lei; Wang, Hong Wei; Kim, Wook
2013-06-01
The present study examined, for the first time, the in vitro wound healing potential of chitosan green tea polyphenols (CGP) complex based on the activation of transglutaminase (TGM) genes in epidermal morphogenesis. Response surface methodology was applied to determine the optimal processing condition that gave maximum extraction of green tea polyphenols. The antioxidant activity, scavenging ability, and chelating ability were studied and expressed as average EC50 values of CGP and other treatments. In silico analysis and gene coexpression network was subjected to the TGM sequences analysis. The temporal expressions of TGMs were profiled by semi-quantitative reverse transcription (RT)-PCR technology within 10 days after wounding and 2 days postwounding. CGP showed the effectiveness of antioxidant properties, and the observations of histopathological photography showed advanced tissue granulation and epithelialization formation by CGP treatment. In silico and coexpression analysis confirmed the regulation via TGM gene family in dermatological tissues. RT-PCR demonstrated increased levels of TGM1-3 expression induced by CGP treatment. The efficacy of CGP in wound healing based on these results may be ascribed to its antioxidant properties and activation of the expression of TGMs, and is, thus, essential for the facilitated repair of skin injury.
Wine Polyphenols: Potential Agents in Neuroprotection
Basli, Abdelkader; Soulet, Stéphanie; Chaher, Nassima; Mérillon, Jean-Michel; Chibane, Mohamed; Monti, Jean-Pierre; Richard, Tristan
2012-01-01
There are numerous studies indicating that a moderate consumption of red wine provides certain health benefits, such as the protection against neurodegenerative diseases. This protective effect is most likely due to the presence of phenolic compounds in wine. Wine polyphenolic compounds are well known for the antioxidant properties. Oxidative stress is involved in many forms of cellular and molecular deterioration. This damage can lead to cell death and various neurodegenerative disorders, such as Parkinson's or Alzheimer's diseases. Extensive investigations have been undertaken to determine the neuroprotective effects of wine-related polyphenols. In this review we present the neuroprotective abilities of the major classes of wine-related polyphenols. PMID:22829964
Wine polyphenols: potential agents in neuroprotection.
Basli, Abdelkader; Soulet, Stéphanie; Chaher, Nassima; Mérillon, Jean-Michel; Chibane, Mohamed; Monti, Jean-Pierre; Richard, Tristan
2012-01-01
There are numerous studies indicating that a moderate consumption of red wine provides certain health benefits, such as the protection against neurodegenerative diseases. This protective effect is most likely due to the presence of phenolic compounds in wine. Wine polyphenolic compounds are well known for the antioxidant properties. Oxidative stress is involved in many forms of cellular and molecular deterioration. This damage can lead to cell death and various neurodegenerative disorders, such as Parkinson's or Alzheimer's diseases. Extensive investigations have been undertaken to determine the neuroprotective effects of wine-related polyphenols. In this review we present the neuroprotective abilities of the major classes of wine-related polyphenols.
Polyphenol contents and antioxidant activity of Maydis stigma extracts.
Maksimović, Zoran; Malencić, Dorde; Kovacević, Nada
2005-05-01
The antioxidant activity and contents of various polyphenol classes in the silks of fifteen maize hybrids with economic importance in Serbia were evaluated. Total polyphenols, tannins and proanthocyanidins were determined spectrophotometrically, after extraction of plant material with 70% aqueous acetone under sonication at room temperature. In addition, flavonoid content was determined. Antioxidant activity of aqueous acetone extracts was evaluated by FRAP assay. A positive linear correlation between antioxidant activity and contents of all investigated polyphenol classes was established. The highest antioxidant activity was observed in the extract of NS 640 hybrid, which had high levels of all polyphenol classes examined. Results suggested strongly that polyphenol content should be considered as an important feature of the herbal drug Maydis stigma. For that reason, the biological source of this herbal drug needs to be more precisely defined, as observed activities and polyphenol contents were greatly dependent on plant material source.
NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology
Ushio-Fukai, Masuko; Malik, Asrar B.
2009-01-01
Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313
Polyphenol-Rich Lentils and Their Health Promoting Effects.
Ganesan, Kumar; Xu, Baojun
2017-11-10
Polyphenols are a group of plant metabolites with potent antioxidant properties, which protect against various chronic diseases induced by oxidative stress. Evidence showed that dietary polyphenols have emerged as one of the prominent scientific interests due to their role in the prevention of degenerative diseases in humans. Possible health beneficial effects of polyphenols are measured based on the human consumption and their bioavailability. Lentil ( Lens culinaris ; Family: Fabaceae) is a great source of polyphenol compounds with various health-promoting properties. Polyphenol-rich lentils have a potential effect on human health, possessing properties such as antioxidant, antidiabetic, anti-obesity, anti-hyperlipidemic, anti-inflammatory and anticancer. Based on the explorative study, the current comprehensive review aims to give up-to-date information on nutritive compositions, bioactive compounds and the health-promoting effect of polyphenol-rich lentils, which explores their therapeutic values for future clinical studies. All data of in vitro , in vivo and clinical studies of lentils and their impact on human health were collected from a library database and electronic search (Science Direct, PubMed and Google Scholar). Health-promoting information was gathered and orchestrated in the suitable place in the review.
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming
2018-05-12
The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.
Cocoa Polyphenols and Inflammatory Markers of Cardiovascular Disease
Khan, Nasiruddin; Khymenets, Olha; Urpí-Sardà, Mireia; Tulipani, Sara; Garcia-Aloy, Mar; Monagas, María; Mora-Cubillos, Ximena; Llorach, Rafael; Andres-Lacueva, Cristina
2014-01-01
Epidemiological studies have demonstrated the beneficial effect of plant-derived food intake in reducing the risk of cardiovascular disease (CVD). The potential bioactivity of cocoa and its polyphenolic components in modulating cardiovascular health is now being studied worldwide and continues to grow at a rapid pace. In fact, the high polyphenol content of cocoa is of particular interest from the nutritional and pharmacological viewpoints. Cocoa polyphenols are shown to possess a range of cardiovascular-protective properties, and can play a meaningful role through modulating different inflammatory markers involved in atherosclerosis. Accumulated evidence on related anti-inflammatory effects of cocoa polyphenols is summarized in the present review. PMID:24566441
Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry
2015-01-01
Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Potential Health Benefits of Olive Oil and Plant Polyphenols
Gorzynik-Debicka, Monika; Przychodzen, Paulina; Cappello, Francesco; Kuban-Jankowska, Alicja; Marino Gammazza, Antonella; Knap, Narcyz; Wozniak, Michal; Gorska-Ponikowska, Magdalena
2018-01-01
Beneficial effects of natural plant polyphenols on the human body have been evaluated in a number of scientific research projects. Bioactive polyphenols are natural compounds of various chemical structures. Their sources are mostly fruits, vegetables, nuts and seeds, roots, bark, leaves of different plants, herbs, whole grain products, processed foods (dark chocolate), as well as tea, coffee, and red wine. Polyphenols are believed to reduce morbidity and/or slow down the development of cardiovascular and neurodegenerative diseases as well as cancer. Biological activity of polyphenols is strongly related to their antioxidant properties. They tend to reduce the pool of reactive oxygen species as well as to neutralize potentially carcinogenic metabolites. A broad spectrum of health-promoting properties of plant polyphenols comprises antioxidant, anti-inflammatory, anti-allergic, anti-atherogenic, anti-thrombotic, and anti-mutagenic effects. Scientific studies present the ability of polyphenols to modulate the human immune system by affecting the proliferation of white blood cells, and also the production of cytokines or other factors that participate in the immunological defense. The aim of the review is to focus on polyphenols of olive oil in context of their biological activities. PMID:29495598
Potential Health Benefits of Olive Oil and Plant Polyphenols.
Gorzynik-Debicka, Monika; Przychodzen, Paulina; Cappello, Francesco; Kuban-Jankowska, Alicja; Marino Gammazza, Antonella; Knap, Narcyz; Wozniak, Michal; Gorska-Ponikowska, Magdalena
2018-02-28
Beneficial effects of natural plant polyphenols on the human body have been evaluated in a number of scientific research projects. Bioactive polyphenols are natural compounds of various chemical structures. Their sources are mostly fruits, vegetables, nuts and seeds, roots, bark, leaves of different plants, herbs, whole grain products, processed foods (dark chocolate), as well as tea, coffee, and red wine. Polyphenols are believed to reduce morbidity and/or slow down the development of cardiovascular and neurodegenerative diseases as well as cancer. Biological activity of polyphenols is strongly related to their antioxidant properties. They tend to reduce the pool of reactive oxygen species as well as to neutralize potentially carcinogenic metabolites. A broad spectrum of health-promoting properties of plant polyphenols comprises antioxidant, anti-inflammatory, anti-allergic, anti-atherogenic, anti-thrombotic, and anti-mutagenic effects. Scientific studies present the ability of polyphenols to modulate the human immune system by affecting the proliferation of white blood cells, and also the production of cytokines or other factors that participate in the immunological defense. The aim of the review is to focus on polyphenols of olive oil in context of their biological activities.
Tea Derived Galloylated Polyphenols Cross-Link Purified Gastrointestinal Mucins
Georgiades, Pantelis; Pudney, Paul D. A.; Rogers, Sarah; Thornton, David J.; Waigh, Thomas A.
2014-01-01
Polyphenols derived from tea are thought to be important for human health. We show using a combination of particle tracking microrheology and small-angle neutron scattering that polyphenols acts as cross-linkers for purified gastrointestinal mucin, derived from the stomach and the duodenum. Both naturally derived purified polyphenols, and green and black tea extracts are shown to act as cross-linkers. The main active cross-linking component is found to be the galloylated forms of catechins. The viscosity, elasticity and relaxation time of the mucin solutions experience an order of magnitude change in value upon addition of the polyphenol cross-linkers. Similarly small-angle neutron scattering experiments demonstrate a sol-gel transition with the addition of polyphenols, with a large increase in the scattering at low angles, which is attributed to the formation of large scale (>10 nm) heterogeneities during gelation. Cross-linking of mucins by polyphenols is thus expected to have an impact on the physicochemical environment of both the stomach and duodenum; polyphenols are expected to modulate the barrier properties of mucus, nutrient absorption through mucus and the viscoelastic microenvironments of intestinal bacteria. PMID:25162539
Giacomelli, Lisa
2013-01-01
Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417
Yamagata, Kazuo; Izawa, Yuri; Onodera, Daiki; Tagami, Motoki
2018-04-01
Previous studies indicated that chlorogenic acid, a compound present in many fruits and vegetables, has anti-cancer activities. We report that chlorogenic acid regulates the expression of apoptosis-related genes and self-renewal-related stem cell markers in cancer cells. The lung cancer cell line A549 was cultured with or without chlorogenic acid. The presence of chlorogenic acid decreased cell proliferation as measured by MTT activity. Polymerase chain reaction (PCR) showed that treatment of cells with chlorogenic acid reduced the expression of BCL2 but increased that of both BAX and CASP3. Chlorogenic acid enhanced annexin V expression as measured using fluorescently labeled annexin V. Chlorogenic acid also induced p38 MAPK and JNK gene expression. Meanwhile, several agents, including SB203580 (p38 MAP kinase inhibitor), N-acetylcysteine (antioxidant inhibitor), dipyridamole (phosphodiesterase inhibitor), and apocynin (NADPH-oxidase inhibitor) blocked chlorogenic acid-induced BAX gene expression. Chlorogenic acid reduced gene expression levels of stem cell-associated markers NANOG, POU5F1, and SOX2. Together these results indicate that chlorogenic acid affects the expression of apoptosis-related genes that are part of oxidative stress and p38 MAP-dependent pathways, as well as genes encoding stem cell markers. In conclusion, chlorogenic acid may contribute to the polyphenolic anti-cancer effect associated with consumption of vegetables and fruits.
Dijkman, Willem P.
2014-01-01
In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Natural Polyphenol Disposition via Coupled Metabolic Pathways
Liu, Zhongqiu; Hu, Ming
2009-01-01
A major challenge associated with the development of chemopreventive polyphenols is the lack of bioavailability in vivo, which are primarily the result of coupled metabolic activities of conjugating enzymes and efflux transporters. These coupling processes are present in most of tissues and organs in mammals and are efficient for the purposes of drug metabolism, elimination and detoxification. Therefore, it was expected that these coupling processes represent a significant barrier to the oral bioavailabilities of polyphenols. In various studies of this coupling process, it was identified that various conjugating enzymes such as UGT and SULT are capable of producing very hydrophilic metabolites of polyphenols, which cannot diffuse out of the cells and needs the action of efflux transporters to pump them out of the cells. Additional studies have shown that efflux transporters such as MRP2, BCRP and OAT appear to serve as the gate keeper when there is an excess capacity to metabolize the compounds. These efflux transporters may also act as the facilitator of metabolism when there is a product/metabolite inhibition. For polyphenols, these coupled processes enable a duo recycling scheme of enteric and enterohepatic recycling, which allows the polyphenols to be reabsorbed and results in longer than expected apparent plasma half-lives for these compounds and their conjugates. Since the vast majority of polyphenols in plasma are hydrophilic conjugates, more research is needed to determine if the metabolites are active or reactive, which will help explain their mechanism of actions. PMID:17539746
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6
Anti-inflammatory effects of polyphenols in arthritis.
Oliviero, Francesca; Scanu, Anna; Zamudio-Cuevas, Yessica; Punzi, Leonardo; Spinella, Paolo
2018-03-01
Polyphenols have been extensively investigated with regard to their antioxidant, anti-inflammatory, and immunomodulant properties in many inflammatory chronic conditions. The aim of this review is to summarise how these compounds can modulate the inflammatory pathways which characterise the most prevalent arthropathies including osteoarthritis, rheumatoid arthritis and crystal-induced arthritis. Among polyphenols, epigallocatechin gallate, carnosol, hydroxytyrosol, curcumin, resveratrol, kaempferol and genistein have been the most widely investigated in arthritis. The most important results of the studies outlined in this article show how polyphenolic compounds are able to inhibit the expression and the release of a number of pro-inflammatory mediators and proteolytic enzymes, the activity of different transcriptional factors and the production of reactive oxygen species in vitro. Studies on animal models of rheumatoid arthritis, osteoarthritis and gout show interesting results in terms of reduced tissue damage, restored cartilage homeostasis, and decreased levels of uric acid, respectively. Despite the multiple protective effects of polyphenols, there are no dietary recommendations for patients affected by rheumatic diseases. Future studies, including intervention trials, should be conducted to determine the relevance of polyphenols consumption or supplementation in arthritis. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Protection of Dietary Polyphenols against Oral Cancer
Ding, Yijian; Yao, Hua; Yao, Yanan; Yenwong Fai, Leonard; Zhang, Zhuo
2013-01-01
Oral cancer represents a health burden worldwide with approximate 275,000 new cases diagnosed annually. Its poor prognosis is due to local tumor invasion and frequent lymph node metastasis. Better understanding and development of novel treatments and chemo-preventive approaches for the preventive and therapeutic intervention of this type of cancer are necessary. Recent development of dietary polyphenols as cancer preventives and therapeutic agents is of great interest due to their antioxidant and anti-carcinogenic activities. Polyphenols may inhibit carcinogenesis in the stage of initiation, promotion, or progression. In particular, dietary polyphenols decrease incidence of carcinomas and exert protection against oral cancer by induction of cell death and inhibition of tumor growth, invasion, and metastasis. In this review, we discuss current progress of dietary polyphenols against oral cancers in vitro, in vivo, and at population levels. PMID:23771133
Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun
2015-01-01
Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822
Li, Rong; Liang, Tao; Xu, Lingyuan; Li, Yongwen; Zhang, Shijun; Duan, Xiaoqun
2013-01-01
This study was designed to investigate the potential effects of 14days' intragastrically given of cinnamon polyphenols (CPS) in treating diabetic mice induced by intraperitoneal injection of streptozotocin (150mgkg(-1)) and fed high-sugar, high-fat diet. The diabetic mice model was successfully established through determining on fasting blood-glucose (FBG) test. As revealed by glucose oxidase (GOD) and radioimmunoassay (RIA), both dimethyldiguanide (DC, 0.6gkg(-1)d(-1)) and CPS (0.3, 0.6, 1.2gkg(-1)d(-1)) treatments significantly resulted in down-regulation of blood glucose and insulin levels in serum, while the levels of oxidative stress markers were markedly lowered through ELISA assay. Meanwhile, the pathological damage in islet with pancreatic beta cells was ameliorated by treatment of CPS at different doses, as shown in HE stain. At the same time, the treatments also caused notable reduction of iNOS, NF-κB expressions showing in Western blot analysis. These findings demonstrate that cinnamon polyphenols can exert the hypoglycemic and hypolipidemic effects through the mechanisms that may be associated with repairing pancreatic beta cells in diabetic mice and improving its anti-oxidative capacity, as well as attenuating cytotoxicity via inhibition of iNOS, NF-κB activation. Published by Elsevier Ltd.
Polyphenol estimated intake and dietary sources among older adults from Mallorca Island
Karam, Joanne; Bibiloni, Maria del Mar
2018-01-01
The aim was the assessment of the polyphenol estimated intake and dietary sources among older adults from Mallorca Island. The study was carried out (2013–2014) in 211 participants dwelling women (n = 112) and men (n = 99). Polyphenol intake was calculated from two non-consecutive 24-h recall diets using the Polyphenol Explorer. The mean daily intake of polyphenol was 332.7 mg/d (SD: 237.9; median: 299 mg/d). Highest polyphenol intake was observed among females, 64–67 y.o. people, higher income and educational level, alcohol consumers, and physically active people. Most polyphenols consumed were flavonoids, and among them the major subclass was flavanols. Alcoholic beverages were the major contributors to the total polyphenol intake (118.3 mg/d, SD: 127.5), and red wine contributed 17.7% of total polyphenols consumed. Polyphenol intake was highest among alcohol drinkers, high educational level, high income, and physical active people. Flavonoids were the highest ingested polyphenols. Alcoholic beverages were the major contributors to the total polyphenol intake, mainly red wine. PMID:29381732
Simultaneous determination of all polyphenols in vegetables, fruits, and teas.
Sakakibara, Hiroyuki; Honda, Yoshinori; Nakagawa, Satoshi; Ashida, Hitoshi; Kanazawa, Kazuki
2003-01-29
Polyphenols, which have beneficial effects on health and occur ubiquitously in plant foods, are extremely diverse. We developed a method for simultaneously determining all the polyphenols in foodstuffs, using HPLC and a photodiode array to construct a library comprising retention times, spectra of aglycons, and respective calibration curves for 100 standard chemicals. The food was homogenized in liquid nitrogen, lyophilized, extracted with 90% methanol, and subjected to HPLC without hydrolysis. The recovery was 68-92%, and the variation in reproducibility ranged between 1 and 9%. The HPLC eluted polyphenols with good resolution within 95 min in the following order: simple polyphenols, catechins, anthocyanins, glycosides of flavones, flavonols, isoflavones and flavanones, their aglycons, anthraquinones, chalcones, and theaflavins. All the polyphenols in 63 vegetables, fruits, and teas were then examined in terms of content and class. The present method offers accuracy by avoiding the decomposition of polyphenols during hydrolysis, the ability to determine aglycons separately from glycosides, and information on simple polyphenol levels simultaneously.
NADPH oxidase inhibitors: a patent review.
Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam
2011-08-01
NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.
Curcumin and dietary polyphenol research: beyond drug discovery.
Jin, Tian-Ru
2018-05-01
Numerous natural products available over the counter are commonly consumed by healthy, sub-healthy or ill people for the treatment and prevention of various chronic diseases. Among them, a few dietary polyphenols, including the curry compound curcumin, have been attracting the most attention from biomedical researchers and drug developers. Unlike many so-called "good drug candidates", curcumin and several other dietary polyphenols do not have a single known therapeutic target or defined receptor. In addition, the bioavailability of these polyphenols is usually very low due to their poor absorption in the gut. These recently debated features have created enormous difficulties for drug developers. In this review, I do not discuss how to develop curcumin, other dietary polyphenols or their derivatives into pharmaceutical agents. Instead, I comment on how curcumin and dietary polyphenol research has enriched our knowledge of insulin signaling, including the presentation of my perspectives on how these studies will add to our understanding of the famous hepatic insulin function paradox.
Anti-Hypertensive Effects of Acacia Polyphenol in Spontaneously Hypertensive Rats
Ikarashi, Nobutomo; Toda, Takahiro; Hatakeyama, Yusuke; Kusunoki, Yoshiki; Kon, Risako; Mizukami, Nanaho; Kaneko, Miho; Ogawa, Sosuke; Sugiyama, Kiyoshi
2018-01-01
We have previously demonstrated that acacia polyphenol (AP) exerts strong anti-obesity, anti-diabetic, and anti-atopic dermatitis effects. In the present study, we investigated the anti-hypertensive effects of AP. Spontaneously hypertensive rats (SHR) with hypertension and control Wistar Kyoto rats (WKY) were used. WKY and SHR were fed AP-containing food or AP-free food (control group) ad libitum for 4 weeks, and their blood pressures were measured. After AP administration, both systolic and diastolic blood pressures were significantly lower in the SHR group than in the control group. There were no differences in the systolic or diastolic blood pressure of WKY between the AP group and the control group. Angiotensin-converting enzyme (ACE) activity, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase expression, and superoxide dismutase (SOD) activity in SHR kidneys were not altered by AP administration. Blood SOD activity in SHR was significantly higher in the AP group than in the control group. AP exerts anti-hypertensive effects on hypertension but has almost no effect on normal blood pressure. The anti-hypertensive effects of AP may be related to the anti-oxidative effects of increased blood SOD activity. PMID:29494506
Kschonsek, Josephine; Wolfram, Theresa; Stöckl, Annette; Böhm, Volker
2018-01-01
Polyphenols are antioxidant ingredients in apples and are related to human health because of their free radical scavenging activities. The polyphenolic profiles of old and new apple cultivars (n = 15) were analysed using high-performance liquid chromatography (HPLC) with diode array detection (DAD). The in vitro antioxidant capacity was determined by total phenolic content (TPC) assay, hydrophilic trolox equivalent antioxidant capacity (H-TEAC) assay and hydrophilic oxygen radical absorbance (H-ORAC) assay. Twenty polyphenolic compounds were identified in all investigated apples by HPLC analysis. Quercetin glycosides (203 ± 108 mg/100 g) were the main polyphenols in the peel and phenolic acids (10 ± 5 mg/100 g) in the flesh. The calculated relative contribution of single compounds indicated flavonols (peel) and vitamin C (flesh) as the major contributors to the antioxidant capacity, in all cultivars investigated. The polyphenolic content (HPLC data) of the flesh differed significantly between old (29 ± 7 mg/100 g) and new (13 ± 4 mg/100 g) cultivars, and the antioxidant capacity of old apple cultivars was up to 30% stronger compared to new ones. PMID:29364189
State of polyphenols in the drying process of fruits and vegetables.
McSweeney, M; Seetharaman, K
2015-01-01
This review presents an overview of drying technologies and its impact on the polyphenol content of vegetables and fruits. Polyphenols contribute to many health benefits and can act as antioxidants. Specifically an increased intake of polyphenols has been shown to decrease the incidence of cardiovascular disease; furthermore, it has been shown to help reduce the risk of neurodegenerative diseases in humans. Many researchers have reported on the effect of different drying techniques on the polyphenol content in fruits and vegetables. Polyphenol degradation mechanisms proposed in literature and pretreatments that potentially lead to higher retention of polyphenols during drying are also discussed.
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao
2003-06-01
To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Dietary Polyphenols in the Prevention of Stroke
Eder, M.
2017-01-01
Polyphenols have an important protective role against a number of diseases, such as atherosclerosis, brain dysfunction, stroke, cardiovascular diseases, and cancer. Cardiovascular diseases are the number one cause of death worldwide: more people die annually from cardiovascular diseases than from any other cause. The most important behavioural risk factors of heart disease and stroke are unhealthy diet, physical inactivity, tobacco use, and excess alcohol intake. The dietary consumption of polyphenols has shown to be inversely associated with morbidity and mortality by cardio- and cerebrovascular diseases. It is well-known that the protective effects of polyphenols in vivo depend on the grade how they are extracted from food and on their intestinal absorption, metabolism, and biological action with target tissues. The aim of this review was to summarise the relation between polyphenols of different plant sources and stroke in human intervention studies, animal models, and in vitro studies. PMID:29204249
Miccadei, Stefania; Di Venere, Donato; Cardinali, Angela; Romano, Ferdinando; Durazzo, Alessandra; Foddai, Maria Stella; Fraioli, Rocco; Mobarhan, Sohrab; Maiani, Giuseppe
2008-01-01
Cultured rat hepatocytes and human hepatoma HepG2 cells were used to evaluate the hepatoprotective properties of polyphenolic extracts from the edible part of artichoke (AE). The hepatocytes were exposed to H2O2generated in situ by glucose oxidase and were treated with either AE, or pure chlorogenic acid (ChA) or with the well known antioxidant, N, N'-diphenyl-p-phenilenediamine (DPPD). Addition of glucose oxidase to the culture medium caused depletion of intracellular glutathione (GSH) content, accumulation of malondialdehyde (MDA) in the cultures, as a lipid peroxidation indicator, and cell death. These results demonstrated that AE protected cells from the oxidative stress caused by glucose oxidase, comparable to DPPD. Furthermore, AE, as well as ChA, prevented the loss of total GSH and the accumulation of MDA. Treatment of HepG2 cells for 24 h with AE reduced cell viability in a dose-dependent manner, however, ChA had no prominent effects on the cell death rate. Similarly, AE rather than ChA induced apoptosis, measured by flow cytometric analysis of annexin and by activation of caspase-3, in HepG2 cells. Our findings indicate that AE had a marked antioxidative potential that protects hepatocytes from an oxidative stress. Furthermore, AE reduced cell viability and had an apoptotic activity on a human liver cancer cell line.
Predictive relationship between polyphenol and nonfat cocoa solids content of chocolate.
Cooper, Karen A; Campos-Giménez, Esther; Jiménez Alvarez, Diego; Rytz, Andreas; Nagy, Kornél; Williamson, Gary
2008-01-09
Chocolate is often labeled with percent cocoa solids content. It is assumed that higher cocoa solids contents are indicative of higher polyphenol concentrations, which have potential health benefits. However, cocoa solids include polyphenol-free cocoa butter and polyphenol-rich nonfat cocoa solids (NFCS). In this study the strength of the relationship between NFCS content (estimated by theobromine as a proxy) and polyphenol content was tested in chocolate samples with labeled cocoa solids contents in the range of 20-100%, grouped as dark (n = 46), milk (n = 8), and those chocolates containing inclusions such as wafers or nuts (n = 15). The relationship was calculated with regard to both total polyphenol content and individual polyphenols. In dark chocolates, NFCS is linearly related to total polyphenols (r2 = 0.73). Total polyphenol content appears to be systematically slightly higher for milk chocolates than estimated by the dark chocolate model, whereas for chocolates containing other ingredients, the estimates fall close to or slightly below the model results. This shows that extra components such as milk, wafers, or nuts might influence the measurements of both theobromine and polyphenol contents. For each of the six main polyphenols (as well as their sum), the relationship with the estimated NFCS was much lower than for total polyphenols (r2 < 0.40), but these relationships were independent of the nature of the chocolate type, indicating that they might still have some predictive capabilities.
Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281
Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N
2011-01-01
The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.
Chavan, Yogita V; Singhal, Rekha S
2013-08-15
Areca nut (Areca catechu L.) or betel nut, a commercial cash crop, is a rich source of polyphenols but also contains toxic alkaloids, mainly arecoline. Separation of these bioactive polyphenols from toxic constituents could propel the safe and beneficial use of betel nut; also it will help arecanut processing industries to produce arecoline-free products. With the aim to develop an effective method for maximum extraction of polyphenols with minimum arecoline, several factors such as nature of the solvent, pH (2-10), substrate concentration (6-14 %) and extraction time (30-150 min) under shaking conditions were evaluated. Qualitative analysis was done using spectrophotometry and high-performance liquid chromatography (HPLC). Maximum extraction of polyphenols (407.47 mg GAE g(-1)), total tannin and its antioxidant activity with minimum arecoline (1.73 mg g(-1) of sample) was achieved by using 80% acetone at pH 4 for 90 min with 10% w/v substrate under shaking conditions. Solvent extraction under optimized parameters gave maximum polyphenols with minimum extraction of arecoline, and highest ratio of polyphenols to arecoline. HPLC and liquid chromatography-mass spectrometry results confirmed the presence of catechin and epicatechin in the extract, which suggests its potential as a source of bioactives. © 2013 Society of Chemical Industry.
Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.
Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C
2001-05-01
Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.
The Reciprocal Interactions between Polyphenols and Gut Microbiota and Effects on Bioaccessibility
Ozdal, Tugba; Sela, David A.; Xiao, Jianbo; Boyacioglu, Dilek; Chen, Fang; Capanoglu, Esra
2016-01-01
As of late, polyphenols have increasingly interested the scientific community due to their proposed health benefits. Much of this attention has focused on their bioavailability. Polyphenol–gut microbiota interactions should be considered to understand their biological functions. The dichotomy between the biotransformation of polyphenols into their metabolites by gut microbiota and the modulation of gut microbiota composition by polyphenols contributes to positive health outcomes. Although there are many studies on the in vivo bioavailability of polyphenols, the mutual relationship between polyphenols and gut microbiota is not fully understood. This review focuses on the biotransformation of polyphenols by gut microbiota, modulation of gut microbiota by polyphenols, and the effects of these two-way mutual interactions on polyphenol bioavailability, and ultimately, human health. PMID:26861391
High nitrogen availability reduces polyphenol content in Sphagnum peat.
Bragazza, Luca; Freeman, Chris
2007-05-15
Peat mosses of the genus Sphagnum constitute the bulk of living and dead biomass in bogs. These plants contain peculiar polyphenols which hamper litter peat decomposition through their inhibitory activity on microbial breakdown. In the light of the increasing availability of biologically active nitrogen in natural ecosystems, litter derived from Sphagnum mosses is an ideal substrate to test the potential effects of increased atmospheric nitrogen deposition on polyphenol content in litter peat. To this aim, we measured total nitrogen and soluble polyphenol concentration in Sphagnum litter peat collected in 11 European bogs under a chronic gradient of atmospheric nitrogen deposition. Our results demonstrate that increasing nitrogen concentration in Sphagnum litter, as a consequence of increased exogenous nitrogen availability, is accompanied by a decreasing concentration of polyphenols. This inverse relationship is consistent with reports that in Sphagnum mosses, polyphenol and protein biosynthesis compete for the same precursor. Our observation of modified Sphagnum litter chemistry under chronic nitrogen eutrophication has implications in the context of the global carbon balance, because a lower content of decay-inhibiting polyphenols would accelerate litter peat decomposition.
Polyphenol supplementation: benefits for exercise performance or oxidative stress?
Myburgh, Kathryn H
2014-05-01
Supplement use among athletes is widespread, including non-traditional and biological compounds. Despite increasing research, a comprehensive and critical review on polyphenol supplementation and exercise is still lacking. This review is relevant for researchers directly involved in the topic, as well as those with a broad interest in athletic performance enhancement and sports nutrition. The purpose of this review is to present background information on groups of polyphenols and their derivatives because their differing chemical structures influence mechanisms of action; to discuss the potential of plant, fruit and vegetable-based biological supplements, high in polyphenol content, to affect exercise performance and biomarkers of oxidative stress and exercise-induced muscle damage; and to critically discuss the exercise studies and biomarkers used. Subjects in the studies reviewed were either sedentary, healthy individuals, or active, recreationally trained or well-trained athletes. Polyphenol supplementation in exercise studies included mainly extracts (multicomponent or purified), juices, infusions or an increased intake of polyphenol-rich foods. This review includes details of supplement doses and exercise test protocols. Many studies considered only the performance or one or two selected biomarkers of antioxidant capacity instead of a comprehensive choice of biomarkers to assess damage to lipids or proteins. Evidence is insufficient to make recommendations for or against the use of polyphenol supplementation (neither specific polyphenols nor specific doses) for either recreational, competitive or elite athletes. Polyphenols have multiple biological effects, and future exercise studies must be designed appropriately and specifically to determine physiological interactions between exercise and the selected supplement, rather than considering performance alone.
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Antioxidative and anti-carcinogenic activities of tea polyphenols.
Yang, Chung S; Lambert, Joshua D; Sang, Shengmin
2009-01-01
Tea (Camellia sinensis, Theaceace), a popular beverage consumed world-wide, has been studied for its preventive effects against cancer as well as cardiovascular, neurodegenerative, and other diseases. Most of the proposed beneficial effects have been attributed to the polyphenolic compounds in tea, but the nature of these activities and the molecular mechanisms of their actions remain unclear. Tea polyphenols are known to be strong antioxidants. Prevention of oxidative stress, modulation of carcinogen metabolism, and prevention of DNA damage have been suggested as possible cancer preventive mechanisms for tea and tea polyphenols. In this chapter, we discuss these topics in the light of biotransformation and bioavailability of tea polyphenols. We also review the preventive effects of tea polyphenols in animal models of carcinogenesis and some of the possible post-initiation mechanisms of action. Finally, we discuss the effects of tea consumption on cancer risk in humans. It is our aim to raise some of the unanswered questions regarding cancer prevention by tea and to stimulate further research in this area.
The role of dietary polyphenols in the management of inflammatory bowel disease.
Farzaei, Mohammad H; Rahimi, Roja; Abdollahi, Mohammad
2015-01-01
Inflammatory bowel disease (IBD) is an idiopathic chronic, relapsing inflammation of the bowel which is caused by dysregulation of the mucosal immune system. Polyphenols as the secondary plant metabolites universally present in vegetables and fruits and are the most abundant antioxidants in the human diet. There is evidence demonstrating the beneficial health effects of dietary polyphenols. This review criticizes the potential of commonly used polyphenols including apple polyphenol, bilberry anthocyanin, curcumin, epigallocatechin-3-gallate (EGCG) and green tea polyphenols, naringenin, olive oil polyphenols, pomegranate polyphenols and ellagic acid, quercetin, as well as resveratrol specifically in IBD with an emphasis on cellular mechanisms and pharmaceutical aspects. Scientific research confirmed that dietary polyphenols possess both protective and therapeutic effects in the management of IBD mediated via down-regulation of inflammatory cytokines and enzymes, enhancing antioxidant defense, and suppressing inflammatory pathways and their cellular signaling mechanisms. Further preclinical and clinical studies are needed in order to understand safety, bioavailability and bioefficacy of dietary polyphenols in IBD patients.
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
Metabolic fate of polyphenols in the human superorganism
van Duynhoven, John; Vaughan, Elaine E.; Jacobs, Doris M.; Kemperman, Robèr A.; van Velzen, Ewoud J. J.; Gross, Gabriele; Roger, Laure C.; Possemiers, Sam; Smilde, Age K.; Doré, Joël; Westerhuis, Johan A.; Van de Wiele, Tom
2011-01-01
Dietary polyphenols are components of many foods such as tea, fruit, and vegetables and are associated with several beneficial health effects although, so far, largely based on epidemiological studies. The intact forms of complex dietary polyphenols have limited bioavailability, with low circulating levels in plasma. A major part of the polyphenols persists in the colon, where the resident microbiota produce metabolites that can undergo further metabolism upon entering systemic circulation. Unraveling the complex metabolic fate of polyphenols in this human superorganism requires joint deployment of in vitro and humanized mouse models and human intervention trials. Within these systems, the variation in diversity and functionality of the colonic microbiota can increasingly be captured by rapidly developing microbiomics and metabolomics technologies. Furthermore, metabolomics is coming to grips with the large biological variation superimposed on relatively subtle effects of dietary interventions. In particular when metabolomics is deployed in conjunction with a longitudinal study design, quantitative nutrikinetic signatures can be obtained. These signatures can be used to define nutritional phenotypes with different kinetic characteristics for the bioconversion capacity for polyphenols. Bottom-up as well as top-down approaches need to be pursued to link gut microbial diversity to functionality in nutritional phenotypes and, ultimately, to bioactivity of polyphenols. This approach will pave the way for personalization of nutrition based on gut microbial functionality of individuals or populations. PMID:20615997
Polyphenols produced during red wine ageing.
Brouillard, R; George, F; Fougerousse, A
1997-01-01
Over the past few years, it has been accepted that a moderate red wine consumption is a factor beneficial to human health. Indeed, people of France and Italy, the two major wine-producing European countries, eat a lot of fatty foods but suffer less from fatal heart strokes than people in North-America or in the northern regions of Europe, where wine is not consumed on a regular basis. For a time, ethanol was thought to be the "good" chemical species hiding behind what is known as the "French paradox". Researchers now have turned their investigations towards a family of natural substances called "polyphenols", which are only found in plants and are abundant in grapes. It is well known that these molecules behave as radical scavengers and antioxidants, and it has been demonstrated that they can protect cholesterol in the LDL species from oxidation, a process thought to be at the origin of many fatal heart attacks. However, taken one by one, it remains difficult to demonstrate which are the best polyphenols as far as their antioxidant activities are concerned. The main obstacle in that kind of research is not the design of the chemical and biological tests themselves, but surprisingly enough, the limited access to chemically pure and structurally elucidated polyphenolic compounds. In this article, particular attention will be paid to polyphenols of red wine made from Vitis vinifera cultivars. With respect to the "French paradox", we address the following question: are wine polyphenolic compounds identical to those found in grapes (skin, pulp and seed), or are there biochemical modifications specifically taking place on the native flavonoids when a wine ages? Indeed, structural changes occur during wine conservation, and one of the most studied of those changes concerns red wine colour evolution, called "wine ageing". As a wine ages, it has been demonstrated that the initially present grape pigments slowly turn into new more stable red pigments. That phenomenon goes on
Estimated Dietary Polyphenol Intake and Major Food and Beverage Sources among Elderly Japanese.
Taguchi, Chie; Fukushima, Yoichi; Kishimoto, Yoshimi; Suzuki-Sugihara, Norie; Saita, Emi; Takahashi, Yoshinari; Kondo, Kazuo
2015-12-09
Estimating polyphenol intake contributes to the understanding of polyphenols' health benefits. However, information about human polyphenol intake is scarce, especially in the elderly. This study aimed to estimate the dietary intake and major sources of polyphenols and to determine whether there is any relationship between polyphenol intake and micronutrient intake in healthy elderly Japanese. First, 610 subjects (569 men, 41 women; aged 67.3 ± 6.1 years) completed food frequency questionnaires. We then calculated their total polyphenol intake using our polyphenol content database. Their average total polyphenol intake was 1492 ± 665 mg/day, the greatest part of which was provided by beverages (79.1%). The daily polyphenol intake differed largely among individuals (183-4854 mg/day), also attributable mostly to beverage consumption. Coffee (43.2%) and green tea (26.6%) were the major sources of total polyphenol; the top 20 food items accounted for >90%. The polyphenol intake did not strongly correlate with the intake of any micronutrient, suggesting that polyphenols may exert health benefits independently of nutritional intake. The polyphenol intake in this elderly population was slightly higher than previous data in Japanese adults, and beverages such as coffee and green tea contributed highly to the intake.
Solari-Godiño, A; Pérez-Jiménez, J; Saura-Calixto, F; Borderías, A J; Moreno, H M
2017-12-01
The aim of this study was to evaluate technological and antioxidant properties, including in vitro bioaccessibility of polyphenols, conferred on raw anchovy mince by the addition of polyphenol-rich grape pomace dietary fibre at different concentrations. For this purpose, headed and gutted anchovy was heat-flayed, deboned and mixed with 0%, 2%, 3%, 4% grape pomace dietary fibre. A significant increase (P<0.05) in the concentration of polyphenols and associated antioxidant capacity was detected when grape pomace dietary fibre was incorporated in a proportion of at least 2% of the final mixture. In vitro digestion showed that the higher the grape pomace dietary fibre content, the higher was the proportion of polyphenols reaching the large intestine. Additionally, it was observed that the ABTS (2,2'-azino-bis(3-ethylbenzo-thiazoline-6-sulfonic acid) assay seems to be more suitable for evaluating antioxidant capacity in this kind of samples than FRAP (Ferric Reducing Antioxidant Power) assay. Technological properties such as mechanical and water holding, as well as sensory scores, indicated excellent qualities and acceptability of all samples. Hence, given the good acceptance of these samples, it should be feasible to make fish products based on mince anchovy as a means of increasing dietary intake of polyphenols with antioxidant capacity, especially considering the high concentration of polyphenols bioaccessible in the large intestine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Targeting NADPH oxidases in vascular pharmacology
Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J
2012-01-01
Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935
Quantum dots as optical labels for ultrasensitive detection of polyphenols.
Akshath, Uchangi Satyaprasad; Shubha, Likitha R; Bhatt, Praveena; Thakur, Munna Singh
2014-07-15
Considering the fact that polyphenols have versatile activity in-vivo, its detection and quantification is very much important for a healthy diet. Laccase enzyme can convert polyphenols to yield mono/polyquinones which can quench Quantum dots fluorescence. This phenomenon of charge transfer from quinones to QDs was exploited as optical labels to detect polyphenols. CdTe QD may undergo dipolar interaction with quinones as a result of broad spectral absorption due to multiple excitonic states resulting from quantum confinement effects. Thus, "turn-off" fluorescence method was applied for ultrasensitive detection of polyphenols by using laccase. We observed proportionate quenching of QDs fluorescence with respect to polyphenol concentration in the range of 100 µg to 1 ng/mL. Also, quenching of the photoluminescence was highly efficient and stable and could detect individual and total polyphenols with high sensitivity (LOD-1 ng/mL). Moreover, proposed method was highly efficient than any other reported methods in terms of sensitivity, specificity and selectivity. Therefore, a novel optical sensor was developed for the detection of polyphenols at a sensitive level based on the charge transfer mechanism. Copyright © 2014 Elsevier B.V. All rights reserved.
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
Ingredient Consistency of Commercially Available Polyphenol and Tocopherol Nutraceuticals
Remsberg, Connie M.; Good, Renee L.; Davies, Neal M.
2010-01-01
Label claims of vitamin E succinate and polyphenolic nutraceuticals are assessed. A validated HPLC method was utilized to assess vitamin E succinate products. Three novel LC/MS methods were used to assess the polyphenols, pterostilbene, phloretin, and myricetin, in dietary supplements. The amount of vitamin E succinate varied from 0-130% of the stated label content with two products containing vitamin E acetate rather than vitamin E succinate. Expected polyphenols were found in 7 of the 8 supplement products. None of the polyphenol supplements contained content within 100-120% of label claims. The present study indicates a lack of uniformity in nutraceutical products. PMID:27721342
Nana, Fernand W.; Hilou, Adama; Millogo, Jeanne F.; Nacoulma, Odile G.
2012-01-01
This paper describes a preliminary assessment of the nutraceutical value of Amaranthus cruentus (A. cruentus) and Amaranthus hybridus (A. hybridus), two food plant species found in Burkina Faso. Hydroacetonic (HAE), methanolic (ME), and aqueous extracts (AE) from the aerial parts were screened for in vitro antioxidant and xanthine oxidase inhibitory activities. Phytochemical analyses revealed the presence of polyphenols, tannins, flavonoids, steroids, terpenoids, saponins and betalains. Hydroacetonic extracts have shown the most diversity for secondary metabolites. The TLC analyses of flavonoids from HAE extracts showed the presence of rutin and other unidentified compounds. The phenolic compound contents of the HAE, ME and AE extracts were determined using the Folin–Ciocalteu method and ranged from 7.55 to 10.18 mg Gallic acid equivalent GAE/100 mg. Tannins, flavonoids, and flavonols ranged from 2.83 to 10.17 mg tannic acid equivalent (TAE)/100 mg, 0.37 to 7.06 mg quercetin equivalent (QE) /100 mg, and 0.09 to 1.31 mg QE/100 mg, respectively. The betacyanin contents were 40.42 and 6.35 mg Amaranthin Equivalent/100 g aerial parts (dry weight) in A. cruentus and A. hybridus, respectively. Free-radical scavenging activity expressed as IC50 (DPPH method) and iron reducing power (FRAP method) ranged from 56 to 423 µg/mL and from 2.26 to 2.56 mmol AAE/g, respectively. Xanthine oxidase inhibitory activities of extracts of A. cruentus and A. hybridus were 3.18% and 38.22%, respectively. The A. hybridus extract showed the best antioxidant and xanthine oxidase inhibition activities. The results indicated that the phytochemical contents of the two species justify their traditional uses as nutraceutical food plants. PMID:24281664
Tresserra-Rimbau, Anna; Guasch-Ferré, Marta; Salas-Salvadó, Jordi; Toledo, Estefanía; Corella, Dolores; Castañer, Olga; Guo, Xiaohui; Gómez-Gracia, Enrique; Lapetra, José; Arós, Fernando; Fiol, Miquel; Ros, Emili; Serra-Majem, Lluis; Pintó, Xavier; Fitó, Montserrat; Babio, Nancy; Martínez-González, Miguel A; Sorli, Jose V; López-Sabater, M Carmen; Estruch, Ramón; Lamuela-Raventós, Rosa M
2016-03-09
Higher consumption of some polyphenols has been associated with a reduced risk of diabetes. However, no studies have evaluated the relation between all polyphenol subclasses and the incidence of diabetes. We aimed to prospectively examine the associations between the intake of total polyphenols and different groups of polyphenols (flavonoids, phenolic acids, stilbenes, lignans, and others) on the risk of incident diabetes in the PREDIMED (Prevención con Dieta Mediterránea) trial. This was an observational cohort analysis of the nondiabetic participants in the PREDIMED trial. This study was a multicenter, controlled, randomized, parallel-group feeding trial to assess the effects of either a Mediterranean diet that was supplemented with extra-virgin olive oil or nuts or advice to adhere to a low-fat control diet on cardiovascular outcomes in elderly men and women at high cardiovascular disease risk. From the 7447 randomly assigned participants, 3430 were selected because they were free of diabetes at baseline and filled out the food-frequency questionnaires (FFQs). Polyphenol intake was calculated by matching food consumption data from repeated FFQs with the Phenol-Explorer database on the polyphenol content of each reported food. HRs and 95% CIs for diabetes according to tertiles of polyphenol intake were estimated with the use of time-dependent Cox proportional hazards models. Over a mean of 5.51 y of follow-up (18,900 person-years), there were 314 new cases of diabetes. After multivariable adjustment, we observed a 28% reduction in new-onset diabetes in the highest compared with the lowest tertile of total polyphenol intake (HR: 0.72; 95% CI: 0.52, 0.99; P-trend = 0.05). The intake of subclasses of polyphenols also was inversely associated with diabetes risk, including for total flavonoids (HR: 0.67; 95% CI: 0.48, 0.93; P-trend = 0.02), stilbenes (HR: 0.57; 95% CI: 0.38, 0.84; P-trend = 0.003), dihydroflavonols (HR: 0.59; 95% CI: 0.40, 0.88; P-trend = 0
Osakabe, N; Sanbongi, C; Yamagishi, M; Takizawa, T; Osawa, T
1998-08-01
The antiulcer activity of cacao liquor water-soluble crude polyphenols (CWSP) was examined. CWSP, alpha-tocopherol, sucralfate (500 mg/kg), and cimetidine (250 mg/kg) were orally administered to male SD rats 30 minutes before ethanol treatment. 5 ml/kg of ethanol given intragastrically caused lesions in mucosa of the glandular stomach. CWSP caused a reduction of such hemorrhagic lesions as well as cimetidine and sucralfate which are typical antiulcer drugs, but alpha-tocopherol was less effective. Thiobarbituric acid reactive substances in gastric mucosa significantly increased with ethanol administration. CWSP treatment significantly reduced this change. The administration of ethanol extensively increased myeloperoxidase (MPO) but not xanthine oxidase (XOD) activity. CWSP reduced the activities of both enzymes; they were considered the main sources of oxygen radicals. According to an in vitro study, CWSP directly reducted XOD but not MPO. These results suggest that the antiulcer mechanism of CWSP was not only radical scavenging but also modulation of leukocyte function.
Poyau, A; Buchet, K; Godinot, C
1999-12-03
The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.
Biomarkers of Dietary Polyphenols in Cancer Studies: Current Evidence and Beyond.
Wang, Jincheng; Tang, Lili; Wang, Jia-Sheng
2015-01-01
Polyphenols, commonly contained in fruits and vegetables, have long been associated with a protective role against multiple diseases and adverse health effects. Generally, in vitro and animal experiments have provided strong positive evidence, whereas evidence from in vivo and human epidemiological studies is not strong enough. Most epidemiological studies to date use food frequency questionnaire based dietary intake estimations, which inevitably incur imprecision. Biomarkers of polyphenol have the potential to complement and enhance current studies. This review performed a literature search of all epidemiological studies or controlled clinical/intervention trials which employed biomarkers of exposure for polyphenols to help assess their anticarcinogenic role, using studies on green tea polyphenols as a study model. Currently, studies on this topic are still limited; breast cancer and prostate cancer were the only widely studied cancer types. Isoflavone is the only widely studied polyphenol. In addition to associations between polyphenols and cancer risks, factors such as host genetic susceptibility, epigenetic modification, and gut microbiome patterns may also impact on the protective roles of polyphenols. More evidence should be collected by utilizing biomarkers of exposure for polyphenols in future epidemiological studies before a clear conclusion can be made.
[Study on adsorption of tea polyphenol and caffine with polyamide resin].
Tang, Ke-wen; Zhou, Chun-shan; Zhong, Shi-an; Zhu, Jie-ding
2003-02-01
The performance of adsorption of tea polyphenol and caffine with polyamide resin was investigated. The results obtained by spectrophotometry and HPLC show that the ability of adsorption of tea polyphenol with polyamide is stronger than that of caffine, in which hydrogen bond plays a very important role. The adsorption amount of caffine is 2.65 mg.g-1 with 7.5% adsorption ratio when 100 mL of 0.71 g.L-1 caffine is adsorbed on polyamide resine, but the adsorption amount of tea polyphenol is up to 148.13 mg.g-1 with 85% adsorption ratio when 700 mL of 1.98 g.L-1 tea polyphenol is adsorbed on polyamide resine. The dilution ratios of caffine and tea polyphenol are 74% and 90%, respectively, when they are diluted by 85% alcohol. The static adsorptions of caffine and tea polyphenol on polyamide resine reach equilibrium quickly in 80 min, and the plots of adsorption kinetics are nearly linear. Tea polyphenol and caffine are successfully separated on polyamide resine, and the obtained product contains more than 96% of tea polyphenol and 80% of EGCC with caffine less than 2.8%.
Estimated Dietary Polyphenol Intake and Major Food and Beverage Sources among Elderly Japanese
Taguchi, Chie; Fukushima, Yoichi; Kishimoto, Yoshimi; Suzuki-Sugihara, Norie; Saita, Emi; Takahashi, Yoshinari; Kondo, Kazuo
2015-01-01
Estimating polyphenol intake contributes to the understanding of polyphenols’ health benefits. However, information about human polyphenol intake is scarce, especially in the elderly. This study aimed to estimate the dietary intake and major sources of polyphenols and to determine whether there is any relationship between polyphenol intake and micronutrient intake in healthy elderly Japanese. First, 610 subjects (569 men, 41 women; aged 67.3 ± 6.1 years) completed food frequency questionnaires. We then calculated their total polyphenol intake using our polyphenol content database. Their average total polyphenol intake was 1492 ± 665 mg/day, the greatest part of which was provided by beverages (79.1%). The daily polyphenol intake differed largely among individuals (183–4854 mg/day), also attributable mostly to beverage consumption. Coffee (43.2%) and green tea (26.6%) were the major sources of total polyphenol; the top 20 food items accounted for >90%. The polyphenol intake did not strongly correlate with the intake of any micronutrient, suggesting that polyphenols may exert health benefits independently of nutritional intake. The polyphenol intake in this elderly population was slightly higher than previous data in Japanese adults, and beverages such as coffee and green tea contributed highly to the intake. PMID:26690212
Aroma changes of black tea prepared from methyl jasmonate treated tea plants*
Shi, Jiang; Wang, Li; Ma, Cheng-ying; Lv, Hai-peng; Chen, Zong-mao; Lin, Zhi
2014-01-01
Methyl jasmonate (MeJA) was widely applied in promoting food quality. Aroma is one of the key indicators in judging the quality of tea. This study examined the effect of exogenous MeJA treatment on tea aroma. The aroma components in black tea prepared from MeJA-treated fresh tea leaves were extracted using headspace solid-phase microextraction (HS-SPME) and were analyzed using gas chromatography-mass spectrometry (GC-MS) and GC-olfactometry (GC-O). Forty-five volatile compounds were identified. The results revealed that the MeJA-treated black tea had higher levels of terpene alcohols and hexenyl esters than the untreated tea. Moreover, several newly components, including copaene, cubenol, and indole, were induced by the MeJA treatment. The activities of polyphenol oxidase and β-glucosidase in fresh tea leaves changed after the MeJA treatment. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the gene expression levels of polyphenol oxidase and β-primeverosidase were upregulated by two and three folds, respectively, by the MeJA treatment (P<0.01); however, the gene expression of β-glucosidase was downregulated to a half level. In general, the aroma quality of the MeJA-treated black tea was clearly improved. PMID:24711352
Nishitani, Goh; Yoshida, Masaki
2018-06-01
This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
Characterization of tea polyphenols as potential environment-friendly fire retardants
NASA Astrophysics Data System (ADS)
Yao, Fengqi; Zhai, Chunjie; Wang, Haihui; Tao, Junjun
2018-02-01
In this work we investigated the oxidation properties of tea polyphenols and their potential as the fire retardants. Two types of tea polyphenols were adopted, which were extracted from red tea and green tea leaves, respectively. Their macroscopic performance during pyrolysis and oxidation at elevated temperatures were examined by using a heating furnace. Mass change, heat evolution and gas products of tea polyphenols during heating in air were also monitored by using a thermo-gravimetric analyzer (TGA) integrated with a differential scanning calorimeter (DSC) in conjunction with online Fourier Transform Infrared Spectroscopy (FTIR) and mass spectroscopy (MS). A tea polyphenol sample first becomes a brown semi-fluid after heating, and gradually turns into highly-porous black chars with significantly expanded volume. By raising the temperature to ∼550 °C at a rate of 10 °C/min, the mass of a sample reduces by nearly 70% to form a large quantity of inert gases that are mainly composed of H2O and CO2. It was found that the aerial oxidation products of tea polyphenols in the solid phase possess good heat insulation property; meanwhile, the substantial release of a lot of water and its evaporation during oxidation of tea polyphenols removes a large amount of heat from a sample located in a heating environment. The heat insulation of tea polyphenols may withstand up to 550 °C. The present work confirms tea polyphenols as potential superior and environment-friendly fire retardants.
Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan
2012-01-01
Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598
Efficient sorption of polyphenols to soybean flour enables natural fortification of foods
Roopchand, Diana E.; Grace, Mary H.; Kuhn, Peter; Cheng, Diana M.; Plundrich, Nathalie; Poulev, Alexander; Howell, Amy; Fridlender, Bertold; Lila, Mary Ann; Raskin, Ilya
2013-01-01
The present study demonstrated that defatted soybean flour (DSF) can sorb polyphenols from blueberry and cranberry juices while separating them from sugars. Depending on DSF concentration and juice dilution, the concentration of blueberry anthocyanins and total polyphenols sorbed to DSF ranged from 2 – 22 mg/g and 10 – 95 mg/g, respectively while the concentration of anthocyanins and proanthocyanidins in cranberry polyphenol-enriched DSF ranged from 2.5 – 17 mg/g and 21 – 101 mg/g, respectively. Blueberry polyphenols present in one serving of fresh blueberries (73g) were delivered in just 1.4 g of blueberry polyphenol-enriched DSF. Similarly, one gram of cranberry polyphenol-enriched DSF delivered the amount of proanthocyanidins available in three 240 ml servings of cranberry juice cocktail. The concentration of blueberry anthocyanins and total polyphenols eluted from DSF remained constant after 22 weeks of incubation at 37°C, demonstrating the high stability of the polyphenol-DSF matrix. LC-MS analysis of eluates confirmed DSF retained major cranberry and blueberry polyphenols remained intact. Blueberry polyphenol-enriched DSF exhibited significant hypoglycemic activities in C57bl/6J mice, and cranberry polyphenol-enriched DSF showed anti-microbial and anti-UTI activities in vitro, confirming its efficacy. The described sorption process provides a means to create protein-rich food ingredients containing concentrated plant bioactives without excess sugars, fats and water that can be incorporated in a variety of scientifically validated functional foods and dietary supplements. PMID:23950619
Efficient sorption of polyphenols to soybean flour enables natural fortification of foods.
Roopchand, Diana E; Grace, Mary H; Kuhn, Peter; Cheng, Diana M; Plundrich, Nathalie; Poulev, Alexander; Howell, Amy; Fridlender, Bertold; Lila, Mary Ann; Raskin, Ilya
2012-04-15
The present study demonstrated that defatted soybean flour (DSF) can sorb polyphenols from blueberry and cranberry juices while separating them from sugars. Depending on DSF concentration and juice dilution, the concentration of blueberry anthocyanins and total polyphenols sorbed to DSF ranged from 2 - 22 mg/g and 10 - 95 mg/g, respectively while the concentration of anthocyanins and proanthocyanidins in cranberry polyphenol-enriched DSF ranged from 2.5 - 17 mg/g and 21 - 101 mg/g, respectively. Blueberry polyphenols present in one serving of fresh blueberries (73g) were delivered in just 1.4 g of blueberry polyphenol-enriched DSF. Similarly, one gram of cranberry polyphenol-enriched DSF delivered the amount of proanthocyanidins available in three 240 ml servings of cranberry juice cocktail. The concentration of blueberry anthocyanins and total polyphenols eluted from DSF remained constant after 22 weeks of incubation at 37°C, demonstrating the high stability of the polyphenol-DSF matrix. LC-MS analysis of eluates confirmed DSF retained major cranberry and blueberry polyphenols remained intact. Blueberry polyphenol-enriched DSF exhibited significant hypoglycemic activities in C57bl/6J mice, and cranberry polyphenol-enriched DSF showed anti-microbial and anti-UTI activities in vitro, confirming its efficacy. The described sorption process provides a means to create protein-rich food ingredients containing concentrated plant bioactives without excess sugars, fats and water that can be incorporated in a variety of scientifically validated functional foods and dietary supplements.
He, Yan; Cui, Jiankun; Lee, James C-M; Ding, Shinghua; Chalimoniuk, Malgorzata; Simonyi, Agnes; Sun, Albert Y; Gu, Zezong; Weisman∥, Gary A; Gibson Wood, W; Sun, Grace Y
2011-01-01
Excessive production of Aβ (amyloid β-peptide) has been shown to play an important role in the pathogenesis of AD (Alzheimer's disease). Although not yet well understood, aggregation of Aβ is known to cause toxicity to neurons. Our recent study demonstrated the ability for oligomeric Aβ to stimulate the production of ROS (reactive oxygen species) in neurons through an NMDA (N-methyl-d-aspartate)-dependent pathway. However, whether prolonged exposure of neurons to aggregated Aβ is associated with impairment of NMDA receptor function has not been extensively investigated. In the present study, we show that prolonged exposure of primary cortical neurons to Aβ oligomers caused mitochondrial dysfunction, an attenuation of NMDA receptor-mediated Ca2+ influx and inhibition of NMDA-induced AA (arachidonic acid) release. Mitochondrial dysfunction and the decrease in NMDA receptor activity due to oligomeric Aβ are associated with an increase in ROS production. Gp91ds-tat, a specific peptide inhibitor of NADPH oxidase, and Mn(III)-tetrakis(4-benzoic acid)-porphyrin chloride, an ROS scavenger, effectively abrogated Aβ-induced ROS production. Furthermore, Aβ-induced mitochondrial dysfunction, impairment of NMDA Ca2+ influx and ROS production were prevented by pre-treatment of neurons with EGCG [(−)-epigallocatechin-3-gallate], a major polyphenolic component of green tea. Taken together, these results support a role for NADPH oxidase-mediated ROS production in the cytotoxic effects of Aβ, and demonstrate the therapeutic potential of EGCG and other dietary polyphenols in delaying onset or retarding the progression of AD. PMID:21434871
Mazauric, Jean-Paul; Salmon, Jean-Michel
2006-05-31
In the first part of this work, the analysis of the polyphenolic compounds remaining in the wine after different contact times with yeast lees during simulation of red wine aging was undertaken. To achieve a more precise view of the wine polyphenols adsorbed on lees during red wine aging and to establish a clear balance between adsorbed and remnant polyphenol compounds, the specific analysis of the chemical composition of the adsorbed polyphenolic compounds (condensed tannins and anthocyanins) after their partial desorbtion from yeast lees by denaturation treatments was realized in the second part of the study. The total recovery of polyphenol compounds from yeast lees was not complete, since a rather important part of the initial wine colored polyphenols, especially those with a dominant blue color component, remained strongly adsorbed on yeast lees, as monitored by color tristimulus and reflectance spectra measurements. All anthocyanins were recovered at a rather high percentage (about 62%), and it was demonstrated that they were not adsorbed in relation with their sole polarity. Very few monomeric phenolic compounds were extracted from yeast lees. With the use of drastic denaturing treatments, the total recovery of condensed tannins reached 83%. Such tannins extracted from yeast lees exhibited very high polymeric size and a rather high percentage of galloylated residues by comparison with initial wine tannins, indicating that nonpolar tannins were preferentially desorbed from yeast lees by the extraction treatments.
Polyphenols as Modulators of Aquaporin Family in Health and Disease.
Fiorentini, Diana; Zambonin, Laura; Dalla Sega, Francesco Vieceli; Hrelia, Silvana
2015-01-01
Polyphenols are bioactive molecules widely distributed in fruits, vegetables, cereals, and beverages. Polyphenols in food sources are extensively studied for their role in the maintenance of human health and in the protection against development of chronic/degenerative diseases. Polyphenols act mainly as antioxidant molecules, protecting cell constituents against oxidative damage. The enormous number of polyphenolic compounds leads to huge different mechanisms of action not fully understood. Recently, some evidence is emerging about the role of polyphenols, such as curcumin, pinocembrin, resveratrol, and quercetin, in modulating the activity of some aquaporin (AQP) isoforms. AQPs are integral, small hydrophobic water channel proteins, extensively expressed in many organs and tissues, whose major function is to facilitate the transport of water or glycerol over cell plasma membranes. Here we summarize AQP physiological functions and report emerging evidence on the implication of these proteins in a number of pathophysiological processes. In particular, this review offers an overview about the role of AQPs in brain, eye, skin diseases, and metabolic syndrome, focusing on the ability of polyphenols to modulate AQP expression. This original analysis can contribute to elucidating some peculiar effects exerted by polyphenols and can lead to the development of an innovative potential preventive/therapeutic strategy.
Phytochemical analysis of ten varieties of pawpaw (Asimina triloba [L.] Dunal) fruit pulp.
Brannan, Robert G; Peters, Trisha; Talcott, Stephen T
2015-02-01
Pawpaw (Asimina triloba [L.] Dunal) is a tree fruit with the potential to become a high-value fruit crop, however, its rapid perishability is a significant obstacle. The objective was to determine the phytochemical content and quality characteristics of pawpaw pulp from ten varieties. This study reports for the first time the mass spectral characterization of phenolic acids and flavonoids of pawpaw, which indicated that the predominant polyphenolic compounds were three phenolic acids, protocatechuic acid hexoside, p-coumaroyl hexoside, and 5-O-p-coumaroylquinic acid, and flavonols, particularly (-)-epicatechin, B-type procyanidin dimers and trimers. The relationship between the polyphenolics identified in the current study and future work on polyphenolic oxidase activity will help the process of assessing whether pawpaws should be selected based on potential health benefits, i.e. high polyphenolic content, or increased shelf life in the form of decreased browning that may be afforded pawpaws containing low polyphenolic levels via decreased action of polyphenol oxidase. Copyright © 2014 Elsevier Ltd. All rights reserved.
The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.
Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul
2008-05-01
The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.
Plant-Derived Polyphenols Interact with Staphylococcal Enterotoxin A and Inhibit Toxin Activity
Shimamura, Yuko; Aoki, Natsumi; Sugiyama, Yuka; Tanaka, Takashi; Murata, Masatsune; Masuda, Shuichi
2016-01-01
This study was performed to investigate the inhibitory effects of 16 different plant-derived polyphenols on the toxicity of staphylococcal enterotoxin A (SEA). Plant-derived polyphenols were incubated with the cultured Staphylococcus aureus C-29 to investigate the effects of these samples on SEA produced from C-29 using Western blot analysis. Twelve polyphenols (0.1–0.5 mg/mL) inhibited the interaction between the anti-SEA antibody and SEA. We examined whether the polyphenols could directly interact with SEA after incubation of these test samples with SEA. As a result, 8 polyphenols (0.25 mg/mL) significantly decreased SEA protein levels. In addition, the polyphenols that interacted with SEA inactivated the toxin activity of splenocyte proliferation induced by SEA. Polyphenols that exerted inhibitory effects on SEA toxic activity had a tendency to interact with SEA. In particular, polyphenol compounds with 1 or 2 hexahydroxydiphenoyl groups and/or a galloyl group, such as eugeniin, castalagin, punicalagin, pedunculagin, corilagin and geraniin, strongly interacted with SEA and inhibited toxin activity at a low concentration. These polyphenols may be used to prevent S. aureus infection and staphylococcal food poisoning. PMID:27272505
Plant-Derived Polyphenols Interact with Staphylococcal Enterotoxin A and Inhibit Toxin Activity.
Shimamura, Yuko; Aoki, Natsumi; Sugiyama, Yuka; Tanaka, Takashi; Murata, Masatsune; Masuda, Shuichi
2016-01-01
This study was performed to investigate the inhibitory effects of 16 different plant-derived polyphenols on the toxicity of staphylococcal enterotoxin A (SEA). Plant-derived polyphenols were incubated with the cultured Staphylococcus aureus C-29 to investigate the effects of these samples on SEA produced from C-29 using Western blot analysis. Twelve polyphenols (0.1-0.5 mg/mL) inhibited the interaction between the anti-SEA antibody and SEA. We examined whether the polyphenols could directly interact with SEA after incubation of these test samples with SEA. As a result, 8 polyphenols (0.25 mg/mL) significantly decreased SEA protein levels. In addition, the polyphenols that interacted with SEA inactivated the toxin activity of splenocyte proliferation induced by SEA. Polyphenols that exerted inhibitory effects on SEA toxic activity had a tendency to interact with SEA. In particular, polyphenol compounds with 1 or 2 hexahydroxydiphenoyl groups and/or a galloyl group, such as eugeniin, castalagin, punicalagin, pedunculagin, corilagin and geraniin, strongly interacted with SEA and inhibited toxin activity at a low concentration. These polyphenols may be used to prevent S. aureus infection and staphylococcal food poisoning.
Irondi, Emmanuel Anyachukwu; Agboola, Samson Olalekan; Oboh, Ganiyu; Boligon, Aline Augusti; Athayde, Margareth Linde; Shode, Francis O
2016-01-01
Elevated uric acid level, an index of gout resulting from the over-activity of xanthine oxidase (XO), increases the risk of developing hypertension. However, research has shown that plant-derived inhibitors of XO and angiotensin 1-converting enzyme (ACE), two enzymes implicated in gout and hypertension, respectively, can prevent or ameliorate both diseases, without noticeable side effects. Hence, this study characterized the polyphenolics composition of guava leaves extract and evaluated its inhibitory effect on XO and ACE in vitro. The polyphenolics (flavonoids and phenolic acids) were characterized using high-performance liquid chromatography (HPLC) coupled with diode array detection (DAD). The XO, ACE, and Fe(2+)-induced lipid peroxidation inhibitory activities, and free radicals (2,2-diphenylpicrylhydrazyl [DPPH]* and 2,2´-azino-bis-3-ethylbenzthiazoline-6-sulphonic [ABTS]*(+)) scavenging activities of the extract were determined using spectrophotometric methods. Flavonoids were present in the extract in the order of quercetin > kaempferol > catechin > quercitrin > rutin > luteolin > epicatechin; while phenolic acids were in the order of caffeic acid > chlorogenic acid > gallic acids. The extract effectively inhibited XO, ACE and Fe(2+)-induced lipid peroxidation in a dose-dependent manner; having half-maximal inhibitory concentrations (IC50) of 38.24 ± 2.32 μg/mL, 21.06 ± 2.04 μg/mL and 27.52 ± 1.72 μg/mL against XO, ACE and Fe(2+)-induced lipid peroxidation, respectively. The extract also strongly scavenged DPPH* and ABTS*(+). Guava leaves extract could serve as functional food for managing gout and hypertension and attenuating the oxidative stress associated with both diseases.
NADPH Oxidases in Vascular Pathology
Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta
2014-01-01
Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474
Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela
2017-02-01
Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.
Mazauric, Jean-Paul; Salmon, Jean-Michel
2005-07-13
Wine aging on yeast lees is a traditional enological practice used during the manufacture of wines. This technique has increased in popularity in recent years for the aging of red wines. Although wine polyphenols interact with yeast lees to a limited extent, such interactions have a large effect on the reactivity toward oxygen of wine polyphenolic compounds and yeast lees. Various domains of the yeast cell wall are protected by wine polyphenols from the action of extracellular hydrolytic enzymatic activities. Polysaccharides released during autolysis are thought to exert a significant effect on the sensory qualities of wine. We studied the chemical composition of polyphenolic compounds remaining in solution or adsorbed on yeast lees after various contact times during the simulation of wine aging. The analysis of the remnant polyphenols in the wine indicated that wine polyphenols adsorption on yeast lees follows biphasic kinetics. An initial and rapid fixation is followed by a slow, constant, and saturating fixation that reaches its maximum after about 1 week. Only very few monomeric phenolic compounds remained adsorbed on yeast lees, and no preferential adsorption of low or high polymeric size tannins occurred. The remnant condensed tannins in the wine contained fewer epigallocatechin units than the initial tannins, indicating that polar condensed tannins were preferentially adsorbed on yeast lees. Conversely, the efficiency of anthocyanin adsorption on yeast lees was unrelated to its polarity.
A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family
Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina
2017-01-01
ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of
Avallone, Sylvie; Guiraud, Joseph-Pierre; Brillouet, Jean-Marc; Teisson, Claude
2003-08-01
Penicillium funiculosum Thom. was consistently isolated from pineapple-infected fruitlet (black spots). Polyphenol oxidase, peroxidase, and laccase activities were determined in extracts from contiguous and infected fruitlets. Healthy fruitlets showed a rather high level of polyphenol oxidase (optimum pH 7.0), and this activity was tremendously increased (X 10) in contiguous infected fruitlets. Furthermore, infected fruitlets also exhibited laccase activity (optimum pH 4.0), while peroxidase was rather constant in both fruitlets. Browning reactions were attributed to qualitative and quantitative modifications of the enzymatic equipment (polyphenol oxidase and laccase) (p < 0.0001). In infected fruiltets, sucrose and L-malic acid were present at significantly lower amounts than in healthy ones, likely owing to fungal metabolism (p < 0.0001), whereas cell wall material was three times higher, which could be viewed as a defense mechanism to limit expansion of the mycelium.
Olive polyphenol effects in a mouse model of chronic ethanol addiction.
Carito, Valentina; Ceccanti, Mauro; Cestari, Vincenzo; Natella, Fausta; Bello, Cristiano; Coccurello, Roberto; Mancinelli, Rosanna; Fiore, Marco
2017-01-01
Alcohol addiction elicits oxidative imbalance and it is well known that polyphenols possess antioxidant properties. We investigated whether or not polyphenols could confer a protective potential against alcohol-induced oxidative stress. We administered (per os) for two months 20 mg/kg of olive polyphenols containing mostly hydroxytyrosol in alcoholic adult male mice. Hydroxytyrosol metabolites as hydroxytyrosol sulfate 1 and hydroxytyrosol sulfate 2 were found in the serum of mice administered with polyphenols with the highest amount in animals treated with both polyphenols and alcohol. Oxidative stress was evaluated by FORT (free oxygen radical test) and FORD (free oxygen radical defense) tests. Alcoholic mice showed a worse oxidative status than nonalcoholic mice (higher FORT and lower FORD) but polyphenol supplementation partially counteracted the alcohol pro-oxidant effects, as evidenced by FORT. A better understanding of the antioxidant protection provided by polyphenols might be of primary interest for drug discovery and dietary-based prevention of the damage associated with chronic alcohol abuse. Copyright © 2016 Elsevier Inc. All rights reserved.
Production of plant-derived polyphenols in microorganisms: current state and perspectives.
Milke, Lars; Aschenbrenner, Jennifer; Marienhagen, Jan; Kallscheuer, Nicolai
2018-02-01
Plants synthesize several thousand different polyphenols of which many have the potential to aid in preventing or treating cancer, cardiovascular, and neurodegenerative diseases. However, plants usually contain complex polyphenol mixtures impeding access to individual compounds in larger quantities. In contrast, functional integration of biosynthetic plant polyphenol pathways into microorganisms allows for the production of individual polyphenols as chemically distinct compounds, which can be synthesized in large amounts and can be more easily isolated. Over the last decade, microbial synthesis of many plant polyphenols could be achieved, and along the way, many decisive bottlenecks in the endogenous microbial host metabolism as well as in the heterologous plant pathways could be identified. In this review, we present recent advancements in metabolic engineering of microorganisms for the production of plant polyphenols and discuss how current challenges could be addressed in the future.
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-02-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto
2018-04-01
Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
Dietary polyphenols and colorectal cancer risk: The Fukuoka colorectal cancer study
Wang, Zhen-Jie; Ohnaka, Keizo; Morita, Makiko; Toyomura, Kengo; Kono, Suminori; Ueki, Takashi; Tanaka, Masao; Kakeji, Yoshihiro; Maehara, Yoshihiko; Okamura, Takeshi; Ikejiri, Koji; Futami, Kitaroh; Maekawa, Takafumi; Yasunami, Yohichi; Takenaka, Kenji; Ichimiya, Hitoshi; Terasaka, Reiji
2013-01-01
AIM: To investigate the associations between dietary intake of polyphenols and colorectal cancer. METHODS: The study subjects were derived from the Fukuoka colorectal cancer study, a community-based case-control study. The study subjects were 816 cases of colorectal cancer and 815 community-based controls. The consumption of 148 food items was assessed by a computer-assisted interview. We used the consumption of 97 food items to estimate dietary intakes of total, tea and coffee polyphenols. The Phenol-Explorer database was used for 92 food items. Of the 5 foods which were not listed in the Phenol-Explorer Database, polyphenol contents of 3 foods (sweet potatoes, satoimo and daikon) were based on a Japanese study and 2 foods (soybeans and fried potatoes) were estimated by ORAC-based polyphenol contents in the United States Department of Agriculture Database. Odds ratios (OR) and 95%CI of colorectal cancer risk according to quintile categories of intake were obtained by using logistic regression models with adjustment for age, sex, residential area, parental history of colorectal cancer, smoking, alcohol consumption, body mass index 10 years before, type of job, leisure-time physical activity and dietary intakes of calcium and n-3 polyunsaturated fatty acids. RESULTS: There was no measurable difference in total or tea polyphenol intake between cases and controls, but intake of coffee polyphenols was lower in cases than in controls. The multivariate-adjusted OR of colorectal cancer according to quintile categories of coffee polyphenols (from the first to top quintile) were 1.00 (referent), 0.81 (95%CI: 0.60-1.10), 0.65 (95%CI: 0.47-0.89), 0.65 (95%CI: 0.46-0.89) and 0.82 (95%CI: 0.60-1.10), respectively (Ptrend = 0.07). Similar, but less pronounced, decreases in the OR were also noted for the third and fourth quintiles of total polyphenol intake. Tea polyphenols and non-coffee polyphenols showed no association with colorectal cancer risk. The site-specific analysis
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus
Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric
2016-01-01
ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these
Potential role of naturally derived polyphenols and their nanotechnology delivery in cancer.
Khushnud, Tasnima; Mousa, Shaker A
2013-09-01
Polyphenols are natural compounds found in plants, fruits, chocolate, and beverages such as tea and wine. To date, the majority of polyphenol research shows them to have anticancer activity in cell lines and animal models. Some human clinical trials also indicate possible anticancer benefits are associated with polyphenols. A problem with polyphenols is their short half-life and low bioavailability; thus the use of nanoparticles to enhance their delivery is a new research field. A Pubmed search was conducted to find in vitro, in vivo, and human clinical trials done within the past 10 years involving the use of polyphenols against different cancer types, and for studies done within the past 5 years on the use of nanoparticles to enhance polyphenol delivery. Based on the studies found, it is observed that polyphenols may be a potential alternative or additive therapy against cancer, and the use of nanoparticles to enhance their delivery to tumors is a promising approach. However, further human clinical trials are necessary to better understand the use of polyphenols as well as their nanoparticle-mediated delivery.
Intestinal Absorption and Antioxidant Activity of Grape Pomace Polyphenols
Marin, Daniela Eliza; Pelmus, Rodica Stefania; Habeanu, Mihaela; Rotar, Mircea Catalin; Gras, Mihail Alexandru; Pistol, Gina Cecilia; Taranu, Ionelia
2018-01-01
The absorption and antioxidant activity of polyphenols from grape pomace (GP) are important aspects of its valorization as a feed additive in the diet of weaned piglets. This study aimed to evaluate the presence of polyphenols from GP both in vitro in IPEC cells and in vivo in the duodenum and colon of piglets fed with diets containing or not 5% GP and also to compare and correlate the aspects of their in vitro and in vivo absorption. Total polyphenolic content (TPC) and antioxidant status (TAS, CAT, SOD and GPx enzyme activity, and lipid peroxidation-TBARS level) were assessed in duodenum and colon of piglets fed or not a diet with 5% GP. The results of UV-Vis spectroscopy demonstrated that in cellular and extracellular medium the GP polyphenols were oxidized (between λmax = 276 nm and λmax = 627.0 nm) with the formation of o-quinones and dimers. LC-MS analysis indicated a procyanidin trimer possibly C2, and a procyanidin dimer as the major polyphenols identified in GP, 12.8% of the procyanidin trimer and 23% of the procyanidin dimer respectively being also found in the compound feed. Procyanidin trimer C2 is the compound accumulated in duodenum, 73% of it being found in the colon of control piglets, and 62.5% in the colon of GP piglets. Correlations exist between the in vitro and in vivo investigations regarding the qualitative evaluation of GP polyphenols in the cells (λmax at 287.1 nm) and in the gut (λmax at 287.5 nm), as oxidated metabolic products. Beside the presence of polyphenols metabolites this study shows also the presence of the unmetabolized procyanidin trimers in duodenum and colon tissue, an important point in evaluating the benefic actions of these molecules at intestinal level. Moreover the in vivo study shows that a 5% GP in piglet’s diet increased the total antioxidant status (TAS) and decreased lipid peroxidantion (TBARS) in both duodenum and colon, and increased SOD activity in duodenum and CAT and GPx activity in colon. These
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.
Processing of polyphenolic composites with supercritical fluid anti-solvent technology
NASA Astrophysics Data System (ADS)
Kurniawansyah, Firman; Mammucari, Raffaella; Foster, Neil R.
2017-05-01
Polyphenols have been developed, primarily exploiting their robust antioxidant properties, for medical and food applications. In spite of their advantages, polyphenolic compounds have drawbacks from their natural characteristics of being poorly soluble in aqueous solutions, thermo-labile and low oral bioavailaibility. In this article, strategy of processing with supercritical fluid (SCF) anti-solvent to improve the shortcomings is overviewed. Information obtained from the existing studies commonly confirms SCF technology applicability to produce composites of polyphenols with various morphology, size distributions and crystallinity. The application of SCF technology also enables to develop polyphenolic composites for alternative drug delivery such as in the pulmonary administrations.
Dietary intake of polyphenols and major food sources in an institutionalised elderly population.
González, S; Fernández, M; Cuervo, A; Lasheras, C
2014-04-01
Polyphenols are bioactive compounds widely found in fruit, vegetables and beverages of plant origin. Epidemiological studies have suggested an association between polyphenol intake and health; antioxidant, anti-inflammatory, anti-carcinogenic and other bioactivities may contribute to these beneficially protective effects. To date, most epidemiological studies describing polyphenol intake have been limited by the information available in nutrient databases. The present study aimed to determine the total and individual polyphenol intake among institutionalised elderly people living in Asturias (North of Spain) and to identify the major dietary sources of polyphenol classes and subclasses. The study sample comprised 304 subjects with a mean age of 73.2 years for men and 76.8 years for women. Dietary intake was assessed by means of a food frequency questionnaire. Phenol content was estimated from the Phenol-Explorer database, as developed at the French National Institute for Agricultural Research. The contribution of each food to the total and subgroup intake of polyphenols was calculated as a percentage. Except for flavonones, total polyphenol intake, groups and subgroups, was higher in men than women. The main polyphenol groups contributing to total polyphenol intake were flavonoids (62%) and phenolic acids (35.5%). We identified red wine, coffee, apples, oranges and green beans as the major food sources providing total polyphenol intake. Flavonoid and lignan intake was lower for those aged >80 years. Smoking habit, red wine consumption, physical activity and a Mediterranean diet score were associated with a greater polyphenol intake. The present study provides information on polyphenol intake in an elderly Mediterranean population with a level of detail that has not been achieved previously. The identification of age and lifestyle factors associated with the intake of polyphenols may be useful in future studies regarding polyphenols. © 2013 The Authors Journal
Interactions of polyphenols with carbohydrates, lipids and proteins.
Jakobek, Lidija
2015-05-15
Polyphenols are secondary metabolites in plants, investigated intensively because of their potential positive effects on human health. Their bioavailability and mechanism of positive effects have been studied, in vitro and in vivo. Lately, a high number of studies takes into account the interactions of polyphenols with compounds present in foods, like carbohydrates, proteins or lipids, because these food constituents can have significant effects on the activity of phenolic compounds. This paper reviews the interactions between phenolic compounds and lipids, carbohydrates and proteins and their impact on polyphenol activity. Copyright © 2014 Elsevier Ltd. All rights reserved.
[Polyphenolic composition of the leaf of bilberry].
Fraisse, D; Carnat, A; Lamaison, J L
1996-01-01
Dried leaves of 14 harvested batches and one batch from commercial origine of Vaccinium myrtillus L present a similar polyphenolic pattern. The mean levels of the harvested batches and the levels of the commercial batch were respectively: total polyphenol compounds 12.98 and 10.62%, tannins 7.84 and 7.43%, total flavonoid compounds 2.98 and 2.20% (spectrophotometry), 1.41 and 1.16% (HPLC), quercetin 3-glucuronide 1.02 and 0.83%, hyperoside 0.22 and 0.16%, chlorogenic acid 3.66 and 1.58%. The levels were higher in young leaves and lower in old leaves. A specific chromatographic profile of the flavonoid compounds and a determination method of the tannin or the total polyphenol content were proposed in a standardization purpose.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Mechanisms of Body Weight Reduction by Black Tea Polyphenols.
Pan, Haibo; Gao, Ying; Tu, Youying
2016-12-07
Obesity is one of the most common nutritional diseases worldwide. This disease causes health problems, such as dyslipidemia, hyperglycemia, hypertension and inflammation. There are drugs used to inhibit obesity. However, they have serious side effects outweighing their beneficial effects. Black tea, commonly referred to as "fermented tea", has shown a positive effect on reducing body weight in animal models. Black tea polyphenols are the major components in black tea which reduce body weight. Black tea polyphenols are more effective than green tea polyphenols. Black tea polyphenols exert a positive effect on inhibiting obesity involving in two major mechanisms: (i) inhibiting lipid and saccharide digestion, absorption and intake, thus reducing calorie intake; and (ii) promoting lipid metabolism by activating AMP-activated protein kinase to attenuate lipogenesis and enhance lipolysis, and decreasing lipid accumulation by inhibiting the differentiation and proliferation of preadipocytes; (iii) blocking the pathological processes of obesity and comorbidities of obesity by reducing oxidative stress. Epidemiological studies of the health relevance between anti-obesity and black tea polyphenols consumption remain to be further investigated.
Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin
2017-01-01
The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330
Radioprotective properties of apple polyphenols: an in vitro study.
Chaudhary, Pankaj; Shukla, Sandeep Kumar; Kumar, I Prem; Namita, I; Afrin, Farhat; Sharma, Rakesh Kumar
2006-08-01
Present study was undertaken to evaluate the radioprotective ability of total polyphenols extracted from edible portion (epicarp and mesocarp) of apple. Prior administration of apple polyphenols to murine thymocytes significantly countered radiation induced DNA damage (evaluated by alkaline halo assay) and cell death (trypan blue exclusion method) in a dose dependent manner maximally at a concentration of 2 and 0.2 mg/ml respectively. Apple polyphenols in a dose dependent fashion inhibited both radiation or Fenton reaction mediated 2-deoxyribose (2-DR) degradation indicating its ability to scavenge hydroxyl radicals and this activity was found to be unaltered in presence of simulated gastric juice. Similarly apple polyphenols in a dose dependent fashion scavenged DPPH radicals (maximum 69% at 1 mg/ml), superoxide anions (maximum 88% at 2 mg/ml), reduced Fe(3 +) to Fe(2 +) (maximum at 1 mg/ml) and inhibited Fenton reaction mediated lipid peroxidation (maximum 66% at 1.5 mg/ml) further establishing its antioxidative properties. Studies carried out with plasmid DNA revealed the ability of apple polyphenols to inhibit radiation induced single as well as double strand breaks. The results clearly indicate that apple polyphenols have significant potential to protect cellular system from radiation induced damage and ability to scavenge free radicals might be playing an important role in its radioprotective manifestation.
Blueberry polyphenols increase lifespan and thermotolerance in Caenorhabditis elegans
Wilson, Mark A; Shukitt-Hale, Barbara; Kalt, Wilhelmina; Ingram, Donald K; Joseph, James A; Wolkow, Catherine A
2006-01-01
Summary The beneficial effects of polyphenol compounds in fruits and vegetables are mainly extrapolated from in vitro studies or short-term dietary supplementation studies. Due to cost and duration, relatively little is known about whether dietary polyphenols are beneficial in whole animals, particularly with respect to aging. To address this question, we examined the effects of blueberry polyphenols on lifespan and aging of the nematode, Caenorhabditis elegans, a useful organism for such a study. We report that a complex mixture of blue-berry polyphenols increased lifespan and slowed aging-related declines in C. elegans. We also found that these benefits did not just reflect antioxidant activity in these compounds. For instance, blueberry treatment increased survival during acute heat stress, but was not protective against acute oxidative stress. The blueberry extract consists of three major fractions that all contain antioxidant activity. However, only one fraction, enriched in proanthocyanidin compounds, increased C. elegans lifespan and thermotolerance. To further determine how polyphenols prolonged C. elegans lifespan, we analyzed the genetic requirements for these effects. Prolonged lifespan from this treatment required the presence of a CaMKII pathway that mediates osmotic stress resistance, though not other pathways that affect stress resistance and longevity. In conclusion, polyphenolic compounds in blueberries had robust and reproducible benefits during aging that were separable from antioxidant effects. PMID:16441844
Using polyphenol derivatives to prevent muscle wasting.
Francaux, Marc; Deldicque, Louise
2018-05-01
To highlight recent evidence for the ability of polyphenols and their derivatives to reduce muscle wasting in different pathological states. From January 2016 to August 2017, four articles dealt with the effects of polyphenols on muscle wasting, which were all carried out in mice. The four studies found that polyphenols reduced muscle mass loss associated with cancer cachexia, acute inflammation or sciatic nerve section. One study even showed that muscle mass was totally preserved when rutin was added to the diet of mice undergoing cancer cachexia. The beneficial effects of polyphenols on muscle wasting were mainly due to a reduction in the activation of the nuclear factor-kappa B pathway, a lower oxidative stress level and a better mitochondrial function. In addition, urolithin B was found to have a testosterone-like effect and to favorably regulate muscle protein balance. During the last 20 months, additional data have been collected about the beneficial effects of rutin, curcumin, quercetin, ellagitanins and urolithin B to limit the loss of muscle mass associated with several pathological states. However, currently, scientific evidence lacks for their use as nutraceuticals in human.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
A Survey of Modulation of Gut Microbiota by Dietary Polyphenols
Dueñas, Montserrat; Muñoz-González, Irene; Cueva, Carolina; Jiménez-Girón, Ana; Sánchez-Patán, Fernando; Santos-Buelga, Celestino; Moreno-Arribas, M. Victoria; Bartolomé, Begoña
2015-01-01
Dietary polyphenols present in a broad range of plant foods have been related to beneficial health effects. This review aims to update the current information about the modulation of the gut microbiota by dietary phenolic compounds, from a perspective based on the experimental approaches used. After referring to general aspects of gut microbiota and dietary polyphenols, studies related to this topic are presented according to their experimental design: batch culture fermentations, gastrointestinal simulators, animal model studies, and human intervention studies. In general, studies evidence that dietary polyphenols may contribute to the maintenance of intestinal health by preserving the gut microbial balance through the stimulation of the growth of beneficial bacteria (i.e., lactobacilli and bifidobacteria) and the inhibition of pathogenic bacteria, exerting prebiotic-like effects. Combination of in vitro and in vivo models could help to understand the underlying mechanisms in the polyphenols-microbiota-host triangle and elucidate the implications of polyphenols on human health. From a technological point of view, supplementation with rich-polyphenolic stuffs (phenolic extracts, phenolic-enriched fractions, etc.) could be an effective option to improve health benefits of functional foods such as the case of dairy fermented foods. PMID:25793210
Polyphenol profiles of French cider apple varieties (Malus domestica sp.).
Sanoner, P; Guyot, S; Marnet, N; Molle, D; Drilleau, J P
1999-12-01
The cortex of 14 French apple varieties (12 cider and 2 juice varieties), one English cider variety, and one dessert apple (i.e., Golden Delicious) were studied for their polyphenol composition. Total polyphenols were assayed by the Folin-Ciocalteu method, and the precise polyphenolic composition (monomeric catechins, proanthocyanidins, hydroxycinnamic acids, and dihydrochalcones) was obtained by HPLC following thiolysis. ESI-MS and ESI-MS/MS analyses showed that chlorogenic acid and p-coumaroylquinic acid were methylated under the conditions of thiolysis. Depending on the variety, the global polyphenol concentration varied from 1 to 7 g per kilogram of fresh cortex. Cider varieties globally showed a higher polyphenol concentration than the dessert apple Golden Delicious, bitter varieties being the more concentrated. The proportion of the polyphenol classes varied greatly from one cultivar to another. For all varieties, procyanidins were always the predominant class. They were mainly constituted of (-)-epicatechin units with a small proportion of (+)-catechin as a terminal unit. The average degree of polymerization ranged between 4.2 and 7.5 depending upon the variety with an exception for the sharp varieties Guillevic and Avrolles which showed significant concentrations of procyanidins with DPn of 40 and 50, respectively.
Antioxidant and prooxidant effects of polyphenol compounds on copper-mediated DNA damage.
Perron, Nathan R; García, Carla R; Pinzón, Julio R; Chaur, Manuel N; Brumaghim, Julia L
2011-05-01
Inhibition of copper-mediated DNA damage has been determined for several polyphenol compounds. The 50% inhibition concentration values (IC(50)) for most of the tested polyphenols are between 8 and 480 μM for copper-mediated DNA damage prevention. Although most tested polyphenols were antioxidants under these conditions, they generally inhibited Cu(I)-mediated DNA damage less effectively than Fe(II)-mediated damage, and some polyphenols also displayed prooxidant activity. Because semiquinone radicals and hydroxyl radical adducts were detected by EPR spectroscopy in solutions of polyphenols, Cu(I), and H(2)O(2), it is likely that weak polyphenol-Cu(I) interactions permit a redox-cycling mechanism, whereby the necessary reactants to cause DNA damage (Cu(I), H(2)O(2), and reducing agents) are regenerated. The polyphenol compounds that prevent copper-mediated DNA damage likely follow a radical scavenging pathway as determined by EPR spectroscopy. Copyright © 2011 Elsevier Inc. All rights reserved.
SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE
Hirsch, James G.
1953-01-01
Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805
Stabilizing Off-pathway Oligomers by Polyphenol Nanoassemblies for IAPP Aggregation Inhibition
NASA Astrophysics Data System (ADS)
Nedumpully-Govindan, Praveen; Kakinen, Aleksandr; Pilkington, Emily H.; Davis, Thomas P.; Chun Ke, Pu; Ding, Feng
2016-01-01
Experimental studies have shown that many naturally occurring polyphenols have inhibitory effect on the aggregation of several proteins. Here, we use discrete molecular dynamics (DMD) simulations and high-throughput dynamic light scattering (DLS) experiments to study the anti-aggregation effects of two polyphenols, curcumin and resveratrol, on the aggregation of islet amyloid polypeptide (IAPP or amylin). Our DMD simulations suggest that the aggregation inhibition is caused by stabilization of small molecular weight IAPP off-pathway oligomers by the polyphenols. Our analysis indicates that IAPP-polyphenol hydrogen bonds and π-π stacking combined with hydrophobic interactions are responsible for the stabilization of oligomers. The presence of small oligomers is confirmed with DLS measurements in which nanometer-sized oligomers are found to be stable for up to 7.5 hours, the time frame within which IAPP aggregates in the absence of polyphenols. Our study offers a general anti-aggregation mechanism for polyphenols, and further provides a computational framework for the future design of anti-amyloid aggregation therapeutics.
USDA-ARS?s Scientific Manuscript database
In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...
Polyphenols Beyond Barriers: A Glimpse into the Brain
Figueira, Inês; Menezes, Regina; Macedo, Diana; Costa, Inês; Nunes dos Santos, Cláudia
2017-01-01
Background Ageing can be simply defined as the process of becoming older, which is genetically determined but also environmentally modulated. With the continuous increase of life expectancy, quality of life during ageing has become one of the biggest challenges of developed countries. The quest for a healthy ageing has led to the extensive study of plant polyphenols with the aim to prevent age-associated deterioration and diseases, including neurodegenerative diseases. The world of polyphenols has fascinated researchers over the past decades, and in vitro, cell-based, animal and human studies have attempted to unravel the mechanisms behind dietary polyphenols neuroprotection. Methods In this review, we compiled some of the extensive and ever-growing research in the field, highlighting some of the most recent trends in the area. Results The main findings regarding polypolyphenols neuroprotective potential performed using in vitro, cellular and animal studies, as well as human trials are covered in this review. Concepts like bioavailability, polyphenols biotransformation, transport of dietary polyphenols across barriers, including the blood-brain barrier, are here explored. Conclusion The diversity and holistic properties of polypolyphenol present them as an attractive alternative for the treatment of multifactorial diseases, where a multitude of cellular pathways are disrupted. The underlying mechanisms of polypolyphenols for nutrition or therapeutic applications must be further consolidated, however there is strong evidence of their beneficial impact on brain function during ageing. Nevertheless, only the tip of the iceberg of nutritional and pharmacological potential of dietary polyphenols is hitherto understood and further research needs to be done to fill the gaps in pursuing a healthy ageing. PMID:27784225
Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen
2013-01-01
The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873
[Simultaneous extraction of tea-polyphenols and caffeine from green tea].
Hai, L; Sun, H; Li, Z
1998-05-01
Tea-polyphenols and caffeine were extracted simultaneously from green tea. The factors influencing on the process of impregnation and extraction were studied. The result indicated that the content of tea-polyphenols and caffeine in tea was increased with the duration of extraction and decreased with the frequency of extraction. The authors discuss the effect of pH on the precipition of calcium-tea-polyphenols.
Physical and antibacterial properties of edible films formulated with apple skin polyphenols.
Du, W-X; Olsen, C W; Avena-Bustillos, R J; Friedman, M; McHugh, T H
2011-03-01
Fruit and vegetable skins have polyphenolic compounds, terpenes, and phenols with antimicrobial and antioxidant activity. These flavoring plant essential oil components are generally regarded as safe. Edible films made from fruits or vegetables containing apple skin polyphenols have the potential to be used commercially to protect food against contamination by pathogenic bacteria. The main objective of this study was to evaluate physical properties as well as antimicrobial activities against Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella enterica of apple skin polyphenols at 0% to 10% (w/w) concentrations in apple puree film-forming solutions formulated into edible films. Commercial apple skin polyphenol powder had a water activity of 0.44 and high total soluble phenolic compounds and antioxidant capacity (995.3 mg chlorogenic acid/100 g and 14.4 mg Trolox/g, respectively). Antimicrobial activities of edible film containing apple skin polyphenols were determined by the overlay method. Apple edible film with apple skin polyphenols was highly effective against L. monocytogenes. The minimum concentration need to inactive L. monocytogenes was 1.5%. However, apple skin polyphenols did not show any antimicrobial effect against E. coli O157:H7 and S. enterica even at 10% level. The presence of apple skin polyphenols reduced water vapor permeability of films. Apple skin polyphenols increased elongation of films and darkened the color of films. The results of the present study show that apple skin polyphenols can be used to prepare apple-based antimicrobial edible films with good physical properties for food applications by direct contact.
Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J
2015-01-01
Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other
Polyphenol-enriched berry extracts naturally modulate reactive proteins in model foods.
Lila, Mary Ann; Schneider, Maggie; Devlin, Amy; Plundrich, Nathalie; Laster, Scott; Foegeding, E Allen
2017-12-13
Healthy foods like polyphenol-rich berries and high quality edible proteins are in demand in today's functional food marketplace, but it can be difficult to formulate convenient food products with physiologically-relevant amounts of these ingredients and still maintain product quality. In part, this is because proteins can interact with other food ingredients and precipitate destabilizing events, which can disrupt food structure and diminish shelf life. Proteins in foods can also interact with human receptors to provoke adverse consequences such as allergies. When proteins and polyphenols were pre-aggregated into stable colloidal particles prior to use as ingredients, highly palatable food formulations (with reduced astringency of polyphenols) could be prepared, and the overall structural properties of food formulations were significantly improved. All of the nutritive and phytoactive benefits of the proteins and concentrated polyphenols remained highly bioavailable, but the protein molecules in the particle matrix did not self-aggregate into networks or react with other food ingredients. Both the drainage half-life (a marker of structural stability) and the yield stress (resistance to flow) of model foams made with the protein-polyphenol particles were increased in a dose-dependent manner. Of high significance in this complexation process, the reactive allergenic epitopes of certain proteins were effectively blunted by binding with polyphenols, attenuating the allergenicity of the food proteins. Porcine macrophages produced TNF-α proinflammatory cytokine when provoked with whey protein, but, this response was blocked completely when the cells were stimulated with particles that complexed whey protein with cinnamon-derived polyphenols. Cytokine and chemokine production characteristic of allergic reactions were blocked by the polyphenols, allowing for the potential creation of hypoallergenic protein-berry polyphenol enriched foods.
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra
2013-01-01
Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573
Cytoprotective Polyphenols Against Chronological Skin Aging and Cutaneous Photodamage.
Davinelli, Sergio; Bertoglio, Juan Carlos; Polimeni, Ascanio; Scapagnini, Giovanni
2018-01-01
Skin aging is a complex biological process influenced by a combination of intrinsic and extrinsic factors, leading to cumulative alterations of skin structure, function and appearance. Polyphenols, which are secondary plant metabolites, represent one of the largest classes of compounds used in dermatology and nutricosmetics to combat skin aging. The main objective is to provide an overview of the existing literature linking skin aging and the ability of polyphenols as regulatory elements able to maintain skin homeostasis. In this review, we discuss recent progress in understanding the molecular bases of skin aging, with specific emphasis on some well known and extensively studied polyphenols which have significant anti-aging influences and photoprotective effects. Although no relevant clinical data exist and standard delivery systems have not been established, promising results have been obtained in many in vitro and animal models. A wide variety of polyphenols may minimize mechanisms underlying the functional manifestations of photoaging and chronological skin aging. Polyphenols exert their influence mostly through their antioxidant and anti-inflammatory effects, thereby abrogating collagen degradation and/or increasing procollagen synthesis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
A Critical Appraisal of Solubility Enhancement Techniques of Polyphenols
Kaur, Harkiran; Kaur, Gurpreet
2014-01-01
Polyphenols constitute a family of natural substances distributed widely in plant kingdom. These are produced as secondary metabolites by plants and so far 8000 representatives of this family have been identified. Recently, there is an increased interest in the polyphenols because of the evidence of their role in prevention of degenerative diseases such as neurodegenerative diseases, cancer, and cardiovascular diseases. Although a large number of drugs are available in the market for treatment of these diseases, however, the emphasis these days is on the exploitation of natural principles derived from plants. Most polyphenols show low in vivo bioavailability thus limiting their application for oral drug delivery. This low bioavailability could be associated with low aqueous solubility, first pass effect, metabolism in GIT, or irreversible binding to cellular DNA and proteins. Therefore, there is a need to devise strategies to improve oral bioavailability of polyphenols. Various approaches like nanosizing, self-microemulsifying drug delivery systems (SMEDDS), microencapsulation, complexation, and solid dispersion can be used to increase the bioavailability. This paper will highlight the various methods that have been employed till date for the solubility enhancement of various polyphenols so that a suitable drug delivery system can be formulated. PMID:26556188
Haematological and biochemical effects of polyphenolics in animal models.
Gnanamani, Arumugam; Sudha, Munusamy; Deepa, G; Sudha, M; Deivanai, K; Sadulla, S
2008-07-01
Polyphenols of natural and synthetic origin are exploited in tanning sector to convert putrescible skin/hide to non-putrescible leather. However, only 30-40% of the inputs have been taken up for processing, the remaining is released as unspent. The existing conventional wastewater treatment systems are inefficient in removing or degrading these unspent polyphenols and thus detrimental to ecosystem. The present study demonstrates the evaluation of impact of both synthetic and natural polyphenols on biochemical and haematological properties of blood and serum in animal models. The results reveal that concentrations of polyphenols play a major role. At higher concentrations, irrespective of their nature, there was a marked change in the lipid profile (81% reduction), followed by insignificant change in glucose levels, RBC and WBC counts and other haematological parameters. At lower concentrations, no significant changes in the above said properties were observed.
Physiological activity of irradiated green tea polyphenol on the human skin.
An, Bong-Jeun; Kwak, Jae-Hoon; Son, Jun-Ho; Park, Jung-Mi; Lee, Jin-Young; Park, Tae Soon; Kim, So-Yeun; Kim, Yeoung-Sun; Jo, Cheorun; Byun, Myung-Woo
2005-01-01
Physiological activity of irradiated green tea polyphenol on the human skin was investigated for further industrial application. The green tea polyphenol was separated and irradiated at 40 kGy by y-ray. For an anti-wrinkle effect, the collagenase inhibition effect was higher in the irradiated sample (65.3%) than that of the non-irradiated control (56.8%) at 200 ppm of the concentration (p < 0.05). Collagen biosynthesis rates using a human fibroblast were 19.4% and 16.3% in the irradiated and the non-irradiated polyphenols, respectively. The tyrosinase inhibition effect, which is related to the skin-whitening effect, showed a 45.2% and 42.9% in the irradiated and the non-irradiated polyphenols, respectively, at a 100 ppm level. A higher than 90% growth inhibition on skin cancer cells (SK-MEL-2 and G361) was demonstrated in both the irradiated and the non-irradiated polyphenols. Thus, the irradiation of green tea polyphenol did not change and even increased its anti-wrinkle, skin-whitening and anticancer effects on the human skin. The results indicated that irradiated green tea polyphenol can be used as a natural ingredient with excellent physiological functions for the human skin through cosmetic or food composition.
Biochemical analysis and in vivo hypoglycemic activity of a grape polyphenol-soybean flour complex.
Roopchand, Diana E; Kuhn, Peter; Poulev, Alexander; Oren, Andrew; Lila, Mary Ann; Fridlender, Bertold; Raskin, Ilya
2012-09-12
Defatted soybean flour (DSF) can efficiently sorb, concentrate, and stabilize polyphenols, but not sugars, from Concord grape juice, to yield grape polyphenol-enriched DSF. Sorption of grape polyphenols to DSF particles was dependent on the ratio of DSF and grape juice concentrate used, but not time of mixing or pH. Depending on ratios of starting materials, 1 g of grape polyphenol-enriched DSF contained 1.6-10.4 mg of anthocyanins, 7.5-93.1 mg of proanthocyanidins, and 20.5-144.5 mg of total polyphenols. LC-MS analysis of grape juice samples before and after addition and removal of DSF and eluate from grape polyphenol-enriched DSF confirmed that a broad range of grape compounds were sorbed to the DSF matrix. Finally, grape polyphenol-enriched DSF was able to significantly lower blood glucose levels in hyperglycemic C57BL/6J mice. The data indicate that grape polyphenol-enriched DSF can provide a high-protein, low-sugar ingredient for delivery of concentrated grape polyphenolics.
Gatineau, Eva; Capel, Frédéric; Dardevet, Dominique; David, Jérémie; Pouyet, Corinne; Polakof, Sergio; Mosoni, Laurent
2018-04-10
High-sugar intake and senescence share common deleterious effects, in particular in liver, but combination of these two factors was little studied. Our aims were to examine the effect of a high-sucrose diet in liver of old rats and also the potential benefices of a polyphenol/micronutrient supplementation. Four groups of 22-month-old male rats fed during 5 months with a diet containing either 13 or 62% sucrose, supplemented or not with rutin, vitamin E, A, D, selenium, and zinc were compared. We measured liver macronutrient composition, glycation/oxidative stress, enzyme activities (lipogenesis, β-oxidation, fructokinase), gene expression (enzymes and transcription factors), in vivo protein synthesis rates and plasma parameters. Sucrose induced an increase in plasma and liver lipid content, and a stimulation of liver protein synthesis rates. Gene expression was little changed by sucrose, with lower levels for LXR-α and LXR-β. Polyphenol/micronutrient supplementation tended to limit liver triglyceride infiltration through variations in fatty acid synthase, acyl coA oxidase, and possibly ATP-citrate lyase activities. In conclusion, despite differences in enzymatic regulations, and blunted responses of gene expression, high-sucrose diet was still able to induce a marked increase in liver lipid content in old animals. However, it probably attenuated the positive impact of polyphenol/micronutrients.
Differential protective effects of red wine polyphenol extracts (RWEs) on colon carcinogenesis.
Mazué, Frédéric; Delmas, Dominique; Murillo, Genoveva; Saleiro, Diana; Limagne, Emeric; Latruffe, Norbert
2014-04-01
Various epidemiological studies have shown that a regular and moderate consumption of red wine is correlated with a decreased relative risk of developing coronary heart disease and cancer. These health benefits are commonly attributed to high contents of polyphenols, particularly resveratrol, representing important sources of antioxidants. However, resveratrol does not seem to be the only bioactive compound present in the wine which contains numerous other polyphenols. The present study investigates the efficiency of red wine extracts (RWEs), containing different polyphenols, on colon cancer cell proliferation in vitro and on colonic aberrant crypt foci (ACF) in vivo. Proliferation, cell cycle analysis and incidence of ACF were monitored to examine the effects of RWEs. RWEs derived from a long vinification process exhibit superior anti-proliferative activity in colon cancer cells and prevent the appearance of ACF in mice. Interestingly, quercetin and resveratrol, representing two major bio-active polyphenols, exhibit synergistic anti-proliferative effects. These data suggest that the efficacy of RWEs on colon carcinogenesis may depend on the polyphenolic content, synergistic interaction of bio-active polyphenols and modulation of cellular uptake of polyphenols.
Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer
2013-10-01
Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal
Uchiyama, Hironobu; Uehara, Kaori; Nagashima, Takayuki; Nakata, Akifumi; Sato, Keisuke; Mihara, Yoshihiro; Komatsu, Ken-Ich; Takanari, Jun; Shimizu, Shigeomi; Wakame, Koji
2016-07-01
Oligonol® (OLG) is a low-molecular-weight lychee fruit polyphenol mainly containing catechin-type monomers and oligomers of proanthocyanidins. Dietary OLG supplementation reportedly improves lipid metabolism disorder and lowers the visceral fat level in animal and human studies. Thus, we investigated the mechanism behind the protective and beneficial effects of OLG on a Western diet (WD)-induced metabolic syndrome (MetS) of a murine model. Using the C57BL/6J mouse for the MetS model, mice were divided into three groups: control (normal diet: ND), Western diet (WD) and WD + 0.5% OLG (OLG) groups. The WD group was fed a high-calorie (high fructose plus high fat) diet for 12 weeks to develop MetS. At week 12, all mice were sacrificed and the blood and liver were obtained for histological and biological examinations and RNA sequencing (RNA-Seq). Body weight, liver weight, plasma triglycerides (TG), total cholesterol (T-Cho) and alanine aminotransferase (ATS) levels of both OLG groups were significantly lower than those of the WD group. On histological examination of the liver, the area of fatty deposits was shown to be suppressed by OLG administration. Expression gene analysis in the liver of WD- versus OLG-fed mice by RNA-Seq showed that 464/45,706 genes exhibited a significant change of expression (corrected p-value <0.05, absolute value of fold change (FC) ≥2). Gene network analysis showed that genes related to hepatic steatosis, liver inflammation and tumor invasion were inactivated in the OLG group. In particular, the lipid metabolism-related genes Lpin1, Adig and Cidea were regulated by OLG administration. OLG may function to suppress MetS and the progression of geriatric diseases in WD-fed mice by regulating the expression of lipid metabolism, inflammation and tumor-related genes in the liver. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Irondi, Emmanuel Anyachukwu; Agboola, Samson Olalekan; Oboh, Ganiyu; Boligon, Aline Augusti; Athayde, Margareth Linde; Shode, Francis O.
2016-01-01
Background/Aim: Elevated uric acid level, an index of gout resulting from the over-activity of xanthine oxidase (XO), increases the risk of developing hypertension. However, research has shown that plant-derived inhibitors of XO and angiotensin 1-converting enzyme (ACE), two enzymes implicated in gout and hypertension, respectively, can prevent or ameliorate both diseases, without noticeable side effects. Hence, this study characterized the polyphenolics composition of guava leaves extract and evaluated its inhibitory effect on XO and ACE in vitro. Materials and Methods: The polyphenolics (flavonoids and phenolic acids) were characterized using high-performance liquid chromatography (HPLC) coupled with diode array detection (DAD). The XO, ACE, and Fe2+-induced lipid peroxidation inhibitory activities, and free radicals (2,2-diphenylpicrylhydrazyl [DPPH]* and 2,2´-azino-bis-3-ethylbenzthiazoline-6-sulphonic [ABTS]*+) scavenging activities of the extract were determined using spectrophotometric methods. Results: Flavonoids were present in the extract in the order of quercetin > kaempferol > catechin > quercitrin > rutin > luteolin > epicatechin; while phenolic acids were in the order of caffeic acid > chlorogenic acid > gallic acids. The extract effectively inhibited XO, ACE and Fe2+-induced lipid peroxidation in a dose-dependent manner; having half-maximal inhibitory concentrations (IC50) of 38.24 ± 2.32 μg/mL, 21.06 ± 2.04 μg/mL and 27.52 ± 1.72 μg/mL against XO, ACE and Fe2+-induced lipid peroxidation, respectively. The extract also strongly scavenged DPPH* and ABTS*+. Conclusion: Guava leaves extract could serve as functional food for managing gout and hypertension and attenuating the oxidative stress associated with both diseases. PMID:27104032
Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere
2009-10-01
Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.
Pietan, Lucas L.; Spradling, Theresa A.
2016-01-01
In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589
Polyphenol intake and mortality risk: a re-analysis of the PREDIMED trial
2014-01-01
Background Polyphenols may lower the risk of cardiovascular disease (CVD) and other chronic diseases due to their antioxidant and anti-inflammatory properties, as well as their beneficial effects on blood pressure, lipids and insulin resistance. However, no previous epidemiological studies have evaluated the relationship between the intake of total polyphenols intake and polyphenol subclasses with overall mortality. Our aim was to evaluate whether polyphenol intake is associated with all-cause mortality in subjects at high cardiovascular risk. Methods We used data from the PREDIMED study, a 7,447-participant, parallel-group, randomized, multicenter, controlled five-year feeding trial aimed at assessing the effects of the Mediterranean Diet in primary prevention of cardiovascular disease. Polyphenol intake was calculated by matching food consumption data from repeated food frequency questionnaires (FFQ) with the Phenol-Explorer database on the polyphenol content of each reported food. Hazard ratios (HR) and 95% confidence intervals (CI) between polyphenol intake and mortality were estimated using time-dependent Cox proportional hazard models. Results Over an average of 4.8 years of follow-up, we observed 327 deaths. After multivariate adjustment, we found a 37% relative reduction in all-cause mortality comparing the highest versus the lowest quintiles of total polyphenol intake (hazard ratio (HR) = 0.63; 95% CI 0.41 to 0.97; P for trend = 0.12). Among the polyphenol subclasses, stilbenes and lignans were significantly associated with reduced all-cause mortality (HR =0.48; 95% CI 0.25 to 0.91; P for trend = 0.04 and HR = 0.60; 95% CI 0.37 to 0.97; P for trend = 0.03, respectively), with no significant associations apparent in the rest (flavonoids or phenolic acids). Conclusions Among high-risk subjects, those who reported a high polyphenol intake, especially of stilbenes and lignans, showed a reduced risk of overall mortality compared to those
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Anti-Oxidative Polyphenolic Compounds of Cocoa.
Nabavi, Seyed F; Sureda, Antoni; Daglia, Maria; Rezaei, Parizad; Nabavi, Seyed M
2015-01-01
Oxidative stress plays a key role in the pathogenesis of different serious chronic diseases such as cancer, diabetes, cardiovascular and neurodegenerative disorders, etc. Recent research has been focused on the beneficial role of dietary antioxidants against oxidative stress both under in vitro and in vivo conditions. Theobroma cacao L. (cacao tree) is an evergreen tree which is native to South America. It is a plant of great economic importance and its seeds are commonly used to produce cocoa powder and chocolate. In addition to its uses in food industry, cocoa is a rich source of polyphenolic antioxidants. There is a plethora of in vitro and in vivo studies that report cocoa antioxidant capacity. The protective activity of cocoa seems to be due to its phytochemical constituents, especially catechins. However, bioavailability of cocoa polyphenolic constituents following oral administration is very low (nanomolar concentrations). In the present paper, we critically reviewed the available literature on the antioxidant and free radical scavenging activities of cocoa and its polyphenolic constituents. In addition to these, we provide brief information about cultivation, phytochemistry, bioavailability and clinical impacts of cocoa.
Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae
2007-07-01
Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-01-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906
Septembre-Malaterre, Axelle; Le Sage, Fanny; Hatia, Sarah; Catan, Aurélie; Janci, Laurent; Gonthier, Marie-Paule
2016-07-08
Plant polyphenols may exert beneficial action against obesity-related oxidative stress and inflammation which promote insulin resistance. This study evaluated the effect of polyphenols extracted from French Curcuma longa on 3T3-L1 adipose cells exposed to H2 O2 -mediated oxidative stress. We found that Curcuma longa extract exhibited high amounts of curcuminoids identified as curcumin, demethoxycurcumin, and bisdemethoxycurcumin, which exerted free radical-scavenging activities. Curcuma longa polyphenols improved insulin-mediated lipid accumulation and upregulated peroxisome proliferator-activated receptor-gamma gene expression and adiponectin secretion which decreased in H2 O2 -treated cells. Curcuminoids attenuated H2 O2 -enhanced production of pro-inflammatory molecules such as interleukin-6, tumor necrosis factor-alpha, monocyte chemoattractant protein-1, and nuclear factor κappa B. Moreover, they reduced intracellular levels of reactive oxygen species elevated by H2 O2 and modulated the expression of genes encoding superoxide dismutase and catalase antioxidant enzymes. Collectively, these findings highlight that Curcuma longa polyphenols protect adipose cells against oxidative stress and may improve obesity-related metabolic disorders. © 2016 BioFactors, 42(4):418-430, 2016. © 2016 International Union of Biochemistry and Molecular Biology.
Content of polyphenol compound in mangrove and macroalga extracts
NASA Astrophysics Data System (ADS)
Takarina, N. D.; Patria, M. P.
2017-07-01
Polyphenol or phenolic are compounds containing one or more hydroxyl group of the aromatic ring [1]. These compounds have some activities like antibacterial, antiseptic, and antioxidants. Natural resources like mangrove and macroalga were known containing these compounds. The purpose of the research was to investigate polyphenol content in mangrove and macroalga. Materials used in this research were mangrove (Avicennia sp.) leaves and the whole part of macroalga (Caulerpa racemosa). Samples were dried for 5 days then macerated in order to get an extract. Maceration were done using methanol for 48 hours (first) and 24 hours (second) continously. Polyphenol content was determined using phytochemical screening on both extracts. The quantitative test was carried out to determine catechin and tannin as polyphenol compound. The result showed that catechin was observed in both extracts while tannin in mangrove extract only. According to quantitative test, mangrove has a higher content of catechin and tannin which were 12.37-13.44 % compared to macroalga which was 2.57-4.58 %. Those indicated that both materials can be the source of polyphenol compound with higher content on mangrove. Moreover, according to this result, these resources can be utilized for advanced studies and human needs like medical drug.
Plant polyphenols and their anti-cariogenic properties: a review.
Ferrazzano, Gianmaria F; Amato, Ivana; Ingenito, Aniello; Zarrelli, Armando; Pinto, Gabriele; Pollio, Antonino
2011-02-11
Polyphenols constitute one of the most common groups of substances in plants. Polyphenolic compounds have been reported to have a wide range of biological activities, many of which are related to their conventional antioxidant action; however, increasing scientific knowledge has highlighted their potential activity in preventing oral disease, including the prevention of tooth decay. The aim of this review is to show the emerging findings on the anti-cariogenic properties of polyphenols, which have been obtained from several in vitro studies investigating the effects of these bioactive molecules against Streptococcus mutans, as well as in vivo studies. The analysis of the literature supports the anti-bacterial role of polyphenols on cariogenic streptococci, suggesting (1) a direct effect against S. mutans; (2) an interaction with microbial membrane proteins inhibiting the adherence of bacterial cells to the tooth surface; and (3) the inhibition of glucosyl transferase and amylase. However, more studies, particularly in vivo and in situ, are necessary to establish conclusive evidence for the effectiveness and the clinical applications of these compounds in the prevention of dental caries. It is essential to better determine the nature and distribution of these compounds in our diet and to identify which of the hundreds of existing polyphenols are likely to provide the greatest effects.
Effects of resveratrol and other polyphenols in hepatic steatosis
Aguirre, Leixuri; Portillo, Maria Puy; Hijona, Elizabeth; Bujanda, Luis
2014-01-01
Non-alcoholic fatty liver disease covers a wide spectrum of liver pathologies which range from simple steatosis to non-alcoholic steatohepatitis. Polyphenols are members of a very large family of plant-derived compounds that can have beneficial effects on human health, and thus their study has become an increasingly important area of human nutrition research. The aim of the present review is to compile published data concerning the effects of both isolated polyphenols as well as polyphenol extracts, on hepatocyte and liver fat accumulation under different steatosis-inducing conditions. The results reported clearly show that this group of biomolecules is able to reduce fat accumulation, but further studies are needed to establish the optimal dose and treatment period length. With regard to the potential mechanisms of action, there is a good consensus. The anti-lipidogenic effect of polyphenols is mainly due to reduced fatty acid and triacylglycerol synthesis, increased in fatty acid oxidation, and reduced of oxidative stress and inflammation. As a general conclusion, it can be stated that polyphenols are biomolecules which produce hepatoprotective effects. To date, these beneficial effects have been demonstrated in cultured cells and animal models. Thus, studies performed in humans are needed before these molecules can be considered as truly useful tools in the prevention of liver steatosis. PMID:24966607
Bioavailable Citrus sinensis Extract: Polyphenolic Composition and Biological Activity.
Pepe, Giacomo; Pagano, Francesco; Adesso, Simona; Sommella, Eduardo; Ostacolo, Carmine; Manfra, Michele; Chieppa, Marcello; Sala, Marina; Russo, Mariateresa; Marzocco, Stefania; Campiglia, Pietro
2017-04-15
Citrus plants contain large amounts of flavonoids with beneficial effects on human health. In the present study, the antioxidant and anti-inflammatory potential of bioavailable polyphenols from Citrus sinensis was evaluated in vitro and ex vivo, using the murine macrophages cell line J774A.1 and primary peritoneal macrophages. Following simulated gastro-intestinal digestion, the in vitro bioavailability of Citrus sinensis polyphenolic extract was assessed using the human cell line Caco-2 grown as monolayers on a transwell membrane. Data demonstrated a relative permeation of its compounds (8.3%). Thus, the antioxidant and anti-inflammatory effect of polyphenolic Citrus sinensis fraction (Cs) was compared to the bioavailable one (CsB). Results revealed that Citrus extract were able to reduce macrophages pro-inflammatory mediators, including nitric oxide, iNOS, COX-2 and different cytokines. Moreover, the effect of Citrus sinensis polyphenols was associated with antioxidant effects, such as a reduction of reactive oxygen species (ROS) and heme-oxygenase-1 (HO-1) increased expression. Our results provide evidence that the bioavailable polyphenolic constituents of the Citrus sinensis extract accumulate prevalently at intestinal level and could reach systemic circulation exerting their effect. The bioavailable fraction showed a higher anti-inflammatory and antioxidant potential compared to the initial extract, thus highlighting its potential nutraceutical value.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less
Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E
2014-01-01
Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.