Sample records for polyphenol oxidase gene

  1. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  2. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  3. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  5. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  6. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  7. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  8. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.


    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu


    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  9. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central


    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  10. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  11. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  12. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.


    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg−1 chlorophyll × hr−1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  13. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central


    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  14. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  15. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio


    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  16. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua


    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  17. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.


    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  18. Degradation of pentachlorophenol by potato polyphenol oxidase.


    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu


    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  19. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).


    Neves, Valdir Augusto; da Silva, Maraiza Aparecida


    Polyphenol oxidase (E.C. (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  20. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  1. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi


    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  2. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.


    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated

  3. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...

  4. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...

  5. Polyphenol oxidase activity in co-ensiled temperate grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) and its o-diphenol substrates have been shown to effectively decrease proteolytic activity during the ensiling of forages such as red clover. Orchardgrass and smooth bromegrass both contain high levels of PPO activity, but lack appropriate levels of o-diphenols to adequately...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense). Production of o-quinones in red clover inhibits post-har...

  7. Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

  8. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.


    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  9. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.


    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y


    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus. PMID:11302173


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

  11. Antisense downregulation of polyphenol oxidase results in enhanced disease susceptibility.


    Thipyapong, Piyada; Hunt, Michelle D; Steffens, John C


    Polyphenol oxidases (PPOs; EC or EC catalyze the oxidation of phenolics to quinones, highly reactive intermediates whose secondary reactions are responsible for much of the oxidative browning that accompanies plant senescence, wounding, and responses to pathogens. To assess the impact of PPO expression on resistance to Pseudomonas syringae pv. tomato we introduced a chimeric antisense potato PPO cDNA into tomato (Lycopersicon esculentum L.). Oxidation of caffeic acid, the dominant o-diphenolic aglycone of tomato foliage, was decreased ca. 40-fold by antisense expression of PPO. All members of the PPO gene family were downregulated: neither immunoreactive PPO nor PPO-specific mRNA were detectable in the transgenic plants. In addition, the antisense PPO construct suppressed inducible increases in PPO activity. Downregulation of PPO in antisense plants did not affect growth, development, or reproduction of greenhouse-grown plants. However, antisense PPO expression dramatically increased susceptibility to P. syringae expressing the avirulence gene avrPto in both Pto and pto backgrounds. In a compatible (pto) interaction, plants constitutively expressing an antisense PPO construct exhibited a 55-fold increase in bacterial growth, three times larger lesion area, and ten times more lesions cm(-2) than nontransformed plants. In an incompatible (Pto) interaction, antisense PPO plants exhibited 100-fold increases in bacterial growth and ten times more lesions cm(-2) than nontransformed plants. Although it is not clear whether hypersusceptibility of antisense plants is due to low constitutive PPO levels or failure to induce PPO upon infection, these findings suggest a critical role for PPO-catalyzed phenolic oxidation in limiting disease development. As a preliminary effort to understand the role of induced PPO in limiting disease development, we also examined the response of PPO promoter::beta-glucuronidase constructs when plants are challenged with P

  12. Resolution of thylakoid polyphenol oxidase and a protein kinase

    SciTech Connect

    Race, H.L.; Davenport, J.W.; Hind, G.


    The predominant protein kinase activity in octylglucoside (OG) extracts of spinach thylakoids has been attributed to a 64-kDa protein, tp64. Recent work calls into question the relation between tp64 and protein kinase activity, which were fractionated apart using fluid phase IEF and hydroxylapatite chromatography. Hind et al. sequenced tp64 from the cDNA and showed it to be a polyphenol oxidase (PPO) homolog. Its transit peptide indicates a location for the mature protein within the thylakoid lumen, where there is presumably no ATP and where it is remote from the presumed kinase substrates: the stromally exposed regions of integral PS-II membrane proteins. Here the authors suggest that the kinase is a 64-kDa protein distinct from tp64.

  13. Optimization of polyphenol oxidase immobilization in copper alginate beads.


    Kocaturk, Selin; Yagar, Hulya


    Polyphenol oxidase (PPO, EC was isolated from artichoke head (Cynara scolymus L.) by using 0.1 M Tris-HCl buffer (pH 7.0), concentrated by (NH4)2SO4 precipitation, and immobilized in copper-alginate beads. Immobilization yield was determined to be 70%. The cresolase and catecholase activities of enzyme immobilized at optimum immobilization conditions were found to be 13.3 and 670 U g beads min(-1), respectively. Effects of immobilization conditions such as alginate concentration, CaCl2 concentration, amount of loading enzyme, bead size, and amount of beads on enzymatic activity were investigated. Optimum alginate and CuCl2 concentration were found to be 2 % and 3 % (w/v), respectively. Using bead (diameter 3 mm) amount of 0.25 g maximum enzyme activities were observed for both polyphenol activities. The initial concentrations of loading free enzyme were 6.5 U mL(-1) and 5815 U mL(-1) for cresolase activity and catecholase activities, respectively. Beads prepared at optimum immobilization conditions were suitable for up to 8 repeated uses. PMID:20429683

  14. Temperature dependence of the activity of polyphenol peroxidases and polyphenol oxidases in modern and buried soils

    NASA Astrophysics Data System (ADS)

    Yakushev, A. V.; Kuznetsova, I. N.; Blagodatskaya, E. V.; Blagodatsky, S. A.


    Under conditions of the global climate warming, the changes in the reserves of soil humus depend on the temperature sensitivities of polyphenol peroxidases (PPPOs) and polyphenol oxidases (PPOs). They play an important role in lignin decomposition, mineralization, and humus formation. The temperature dependence of the potential enzyme activity in modern and buried soils has been studied during incubation at 10 or 20°C. The experimental results indicate that it depends on the availability of the substrate and the presence of oxygen. The activity of PPOs during incubation in the absence of oxygen for two months decreases by 2-2.5 times, which is balanced by an increase in the activity of PPPOs by 2-3 times. The increase in the incubation temperature to 20°C and the addition of glucose accelerates this transition due to the more abrupt decrease in the activity of PPOs. The preincubation of the soil with glucose doubles the activity of PPPOs but has no significant effect on the activity of PPOs. The different effects of temperature on two groups of the studied oxidases and the possibility of substituting enzymes by those of another type under changing aeration conditions should be taken into consideration in predicting the effect of the climate warming on the mineralization of the soil organic matter. The absence of statistically significant differences in the enzymatic activity between the buried and modern soil horizons indicates the retention by the buried soil of some of its properties (soil memory) and the rapid restoration of high enzymatic activity during the preincubation.

  15. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    NASA Astrophysics Data System (ADS)

    Chung, Si-Yin; Houska, Milan; Reed, Shawndrika


    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens. Since high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts containing caffeic acid were treated with each of the following: (1) HP; (2) HP+PPO; (3) PPO; and (4) none. HP was conducted at 300 and 500 MPa, each for 3 and 10 min, 37 °C. After treatment, SDS-PAGE was performed and allergenic capacity (IgE binding) was determined colorimetrically in inhibition enzyme-linked immunosorbent assay and Western blots, using a pooled plasma from peanut-allergic patients. Data showed that HP alone had no effect on major peanut allergens. However, HP at 500 MPa combined with PPO (HP500/PPO) induced a higher (approximately twofold) reduction of major peanut allergens and IgE binding than PPO alone or HP300/PPO. There was no difference between treatment times. We concluded that HP500/PPO at 3-min enhanced a twofold reduction of the allergenic capacity of peanut extracts, as compared to PPO itself.

  16. cDNA cloning and expression of potato polyphenol oxidase.


    Hunt, M D; Eannetta, N T; Yu, H; Newman, S M; Steffens, J C


    Polyphenol oxidases (PPOs) of plants are copper metalloproteins which catalyze the oxidation of mono- and o-diphenols to o-diquinones. Although PPOs are believed to be primarily responsible for the deleterious browning of many fruit and vegetable crops and are thought to be involved in plant-pest interactions, direct evidence for these roles is lacking. We report the cloning of two PPO cDNAs from Solanum tuberosum leaves. These cDNAs exhibit 97% and 98% sequence similarity at the DNA and deduced amino acid levels, respectively. Putative copper-binding regions of both cDNAs are very similar to those of mammalian, bacterial and Neurospora tyrosinases. Both leaf PPO cDNAs appear to encode polypeptides which are processed to a mature molecular weight of 57,000. In potato leaves, petioles, roots, and flowers, PPO is encoded by ca. 2 kb transcripts. Leaf PPO mRNA is developmentally regulated and only detectable in young foliage. In contrast, the protein profile of immunologically detectable PPO remains constant from the apical node through the eleventh leaf node. PMID:7678763

  17. Polyphenol oxidase as a biochemical seed defense mechanism.


    Fuerst, E Patrick; Okubara, Patricia A; Anderson, James V; Morris, Craig F


    Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO), when wild oat (Avena fatua L.) caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea), non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems. PMID:25540647

  18. Unfolding and refolding of active apple polyphenol oxidase.


    Mari, S; Marquès, L; Breton, F; Karamanos, Y; Macheix, J J


    For the first time, unfolding (6 M guanidine) and refolding of partially proteolysed purified polyphenol oxidase (PPOr) was achieved, with 88% of activity recovered. Optimal refolding conditions consisted in stepwise dialysis of guanidine treated extracts, the dialysis buffers containing 1 M (NH4)2SO4 and 100 microM CuSO4. However, CuSO4 had limited effect on the recovering of PPOr activity, whereas (NH4)2SO4 was essential. Concerning the PPO tertiary structure, denaturing conditions (combinations of boiling and reducing agent) used on SDS-PAGE have shown (i) a compact tertiary structure and (ii) the presence of disulfide bonds in PPOr, accounting for the shift between 27 and 41 kDa, and 41 and 42 kDa, respectively. Resistance to proteolytic cleavage was used to study the conformational changes induced by the denaturing treatments. Folded PPOr was resistant to further proteolysis whereas unfolded PPO was totally digested, indicating the role of tertiary structure of PPOr in the resistance to proteases. PMID:9842726

  19. Polyphenol oxidase as a biochemical seed defense mechanism

    PubMed Central

    Fuerst, E. Patrick; Okubara, Patricia A.; Anderson, James V.; Morris, Craig F.


    Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO), when wild oat (Avena fatua L.) caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea), non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems. PMID:25540647

  20. Inhibition of apple polyphenol oxidase activity by sodium chlorite.


    Lu, Shengmin; Luo, Yaguang; Feng, Hao


    Sodium chlorite (SC) was shown to have strong efficacy both as a sanitizer to reduce microbial growth on produce and as a browning inhibitor on fresh-cut apples in previous experiments. This study was undertaken to investigate the inhibitory effect of SC on polyphenol oxidase (PPO) and the associated mechanisms. The experiment showed that SC had a strong inhibition of apple PPO. The extent of inhibition was influenced by SC concentration and pH. Inhibition was most prominent at pH 4.5, at which approximately 30% of enzyme activity was lost in the presence of 10 mM SC, followed closely by that at pH 4.0 with a 26% reduction in PPO activity. The inhibition mode was determined using Dixon and Lineweaver-Burk plots, which established SC to be a mixed inhibitor of apple PPO for the oxidation of catechol. Preincubation of PPO with 8 mM SC for 8 min caused a maximum of 46% activity reduction compared to noninhibited control. However, preincubation of SC with catechol for 8 min resulted in no additional loss of PPO activity. These findings provide further evidence that the inhibition of PPO activity by SC is due to the inhibition of the enzyme itself rather than removal of the substrate. PMID:19127746

  1. Purification and characterization of polyphenol oxidase from fresh ginseng

    PubMed Central

    Kim, Jae-Joon; Kim, Woo-Yeon


    Polyphenol oxidase (PPO) was purified from fresh ginseng roots using acetone precipitation, carboxymethyl (CM)-Sepharose chromatography, and phenyl-Sepharose chromatography. Two isoenzymes (PPO 1 and PPO 2) were separated using an ion-exchange column with CM-Sepharose. PPO 1 was purified up to 13.2-fold with a 22.6% yield. PPO 2 bound to CM-Sepharose, eluted with NaCl, and was purified up to 22.5-fold with a 17.4% yield. PPO 2 was further chromatographed on phenyl-Sepharose. The molecular weight of the purified PPO 2 from fresh ginseng was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and was about 40 kDa. The optimum temperature and pH were 20℃ and 7.0, respectively, using catechol as a substrate. Pyrogallol showed the highest substrate specificity. The effect of a PPO inhibitor showed that its activity increased slightly in the presence of a low concentration of citric acid. High concentrations of acidic compounds and sulfite agents significantly inhibited purified ginseng PPO 2. PMID:23717165

  2. Characterization of polyphenol oxidase activity in Ataulfo mango.


    Cheema, Summervir; Sommerhalter, Monika


    Crude extracts of Ataulfo exhibited polyphenol oxidase (PPO) activity with pyrogallol, 3-methylcatechol, catechol, gallic acid, and protocatechuic acid. The substrate dependent pH optima ranged from pH 5.4 to 6.4 with Michaelis-Menten constants between 0.84 ± 0.09 and 4.6 ± 0.7 mM measured in MES or phosphate buffers. The use of acetate buffers resulted in larger Michaelis-Menten constants, up to 14.62 ± 2.03 mM. Sodium ascorbate, glutathione, and kojic acid are promising inhibitors to prevent enzymatic browning in Ataulfo. PPO activity increased with ripeness and was always higher in the skin compared to the pulp. Sodium dodecyl sulphate (SDS) enhanced PPO activity, with pulp showing a stronger increase than skin. SDS-PAGE gels stained for catecholase activity showed multiple bands, with the most prominent bands at apparent molecular weights of 53, 112, and 144 kDa. PMID:25308684

  3. Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...

  4. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.


    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo


    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. PMID:23628925

  5. Inhibition of polyphenol oxidases activity by various dipeptides.


    Girelli, Anna M; Mattei, Enrico; Messina, Antonella; Tarola, Anna M


    In an effort to develop natural and nontoxic inhibitors on the activity of mushroom polyphenol oxidase (PPO) the effect of various glycyl-dipeptides (GlyAsp, GlyGly, GlyHis, GlyLeu, GlyLys, GlyPhe, GlyPro, GlyTyr) was investigated. The inhibition study with dihydroxyphenylalanine (DOPA) as substrate is based on separation of the enzymatic reaction components by reversed phase HPLC and the UV detection of the dopachrome formed. The results have evidenced that several of tested dipeptides inhibited PPO activity in the range of 20-40% while GlyPro and GlyLeu had no effect. The study has also permitted the characterization of the following kinetic pattern: a linear-mixed-type mechanism for GlyAsp, GlyGly, GlyLys, and GlyPhe and a hyperbolic-mixed-type for GlyTyr. It was not possible to identify the inhibition mechanism for GlyHis, although it affects PPO activity. In addition the effects of GlyAsp, GlyLys and GlyHis were evaluated for lessening the browning of fresh Golden Delicious apple and Irish White Skinned potato. The effectiveness of such inhibitors was determined by the difference between the colors observed in the dipeptide-treated sample and the controls using the color space CIE-Lab system. The % browning inhibition on potato (20-50%) was greater than of apple (20-30%) by the all tested dipeptides. Only GlyLys presented the significant value of 50%. PMID:15137808

  6. Effects of Transgenic Hybrid Aspen Overexpressing Polyphenol Oxidase on Rhizosphere Diversity▿

    PubMed Central

    Oliver, Kathryn L.; Hamelin, Richard C.; Hintz, William E.


    This study assessed the potential effects of transgenic aspen overexpressing a polyphenol oxidase gene on diversity in rhizosphere communities. Cultivation-independent methods were used to better delineate bacterial and fungal populations associated with transgenic and nontransgenic trees. Gene libraries for the bacterial component of the rhizosphere were established using 16S rRNA and chaperonin-60 (CPN-60) gene sequences, while the fungal community was characterized using 18S rRNA gene sequences. The 16S rRNA gene libraries were dominated by alphaproteobacterial sequences, while the CPN-60 gene libraries were dominated by members of the Bacteroidetes/Chlorobi group. In both the CPN-60 and 16S rRNA libraries, there were differences in only minor components of the bacterial community between transgenic and unmodified trees, and no significant differences in species diversity were observed. Compared to the bacterial gene libraries, greater coverage of the underlying population was achieved with the fungal 18S rRNA libraries. Members of the Zygomycota, Chytridiomycota, Ascomycota, and Basidiomycota were recovered from both libraries. The dominant groups of fungi associated with each tree type were very similar, although there were some qualitative differences in the recovery of less-abundant fungi, likely as a result of the underlying heterogeneity of the fungal population. The methods employed revealed only minor differences between the bacterial and fungal communities associated with transgenic and unmodified trees. PMID:18552195

  7. Functional analysis of polyphenol oxidases by antisense/sense technology.


    Thipyapong, Piyada; Stout, Michael J; Attajarusit, Jutharat


    Polyphenol oxidases (PPOs) catalyze the oxidation of phenolics to quinones, the secondary reactions of which lead to oxidative browning and postharvest losses of many fruits and vegetables. PPOs are ubiquitous in angiosperms, are inducible by both biotic and abiotic stresses, and have been implicated in several physiological processes including plant defense against pathogens and insects, the Mehler reaction, photoreduction of molecular oxygen by PSI, regulation of plastidic oxygen levels, aurone biosynthesis and the phenylpropanoid pathway. Here we review experiments in which the roles of PPO in disease and insect resistance as well as in the Mehler reaction were investigated using transgenic tomato (Lycopersicon esculentum) plants with modified PPO expression levels (suppressed PPO and overexpressing PPO). These transgenic plants showed normal growth, development and reproduction under laboratory, growth chamber and greenhouse conditions. Antisense PPO expression dramatically increased susceptibility while PPO overexpression increased resistance of tomato plants to Pseudomonas syringae. Similarly, PPO-overexpressing transgenic plants showed an increase in resistance to various insects, including common cutworm (Spodoptera litura (F.)), cotton bollworm (Helicoverpa armigera (Hübner)) and beet army worm (Spodoptera exigua (Hübner)), whereas larvae feeding on plants with suppressed PPO activity had higher larval growth rates and consumed more foliage. Similar increases in weight gain, foliage consumption, and survival were also observed with Colorado potato beetles (Leptinotarsa decemlineata (Say)) feeding on antisense PPO transgenic tomatoes. The putative defensive mechanisms conferred by PPO and its interaction with other defense proteins are discussed. In addition, transgenic plants with suppressed PPO exhibited more favorable water relations and decreased photoinhibition compared to nontransformed controls and transgenic plants overexpressing PPO, suggesting

  8. Spinach thylakoid polyphenol oxidase isolation, activation, and properties of the native chloroplast enzyme

    SciTech Connect

    Golbeck, J.H.; Cammarata, K.V.


    Polyphenol oxidase activity (E.C. 1.14,18.1) has been found in two enzyme species isolated from thylakoid membranes of spinach chloroplasts. The proteins were released from the membrane by sonication and purified >900-fold by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzymes appear to be the tetramer and monomer of a subunit with a molecular weight of 42,500 as determined by lithium dodecyl sulfate gel electrophoresis. Sonication releases polyphenol oxidase from the membrane largely in the latent state. In the absence of added fatty acids, the isolated enzyme spontaneously, but slowly, activates with time. Purified polyphenol oxidase utilizes o-diphenols as substrates and shows no detectable levels of monophenol or p-diphenol oxidase activities. Suitable substrates include chlorogenic acid, catechol, caffeic acid, pyrogallol, and dopamine; however, the enzyme is substrate-inhibited by the last four at concentrations near their K/sub m/. A large seasonal variation in polyphenol oxidase activity may result from a decrease in enzyme content rather than inhibition of the enzyme present.

  9. Polyphenol oxidase (PPO) in wheat and wild relatives: molecular evidence for a multigene family.


    Massa, Alicia N; Beecher, Brian; Morris, Craig F


    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid (Triticum monococcum, T. urartu, Aegilops tauschii, and Ae. speltoides), tetraploid (T. turgidum, subspecies dicoccoides and durum) and hexaploid (T. aestivum cultivars Klasic and ID377s) wheat species to gain a better understanding of the structure and organization of PPO genes. DNA fragments were amplified from a highly polymorphic and phylogenetic informative region of the gene. As a result, we obtained highly discriminative sequences. Three distinct PPOs, obtained from the A genome of T. monococcum, provided evidence for gene duplication events (paralogous loci). Furthermore, the number of sequences obtained for bread and durum wheat was higher than the expected number of orthologous loci. Sequence comparison revealed nucleotide and structural diversity, and detected five sequence intron types, all with a common insertion position. This was hypothesized to be homologous to that of intron 2 of previously reported wheat PPOs. A MITE of the Stowaway family accounted for the major difference between the five intervening sequences, and was unique to T. aestivum cv. Klasic. Nucleotide and structural diversity, together with well-resolved phylogenetic trees, provided molecular evidence to support the hypothesis of a PPO multigene family structure and organization. PMID:17468807

  10. Red clover polyphenol oxidase reduces ruminal lipolysis in in vitro batch culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction. It has been shown that the rate of lipolysis and proteolysis differs significantly between red clover genotypes with different levels of polyphenol oxidase (PPO) activity (Lee et al. 2004). Sullivan and Hatfield, (2006) reported the development of genetically modified isolines of red c...

  11. Cloning and characterization of polyphenol oxidase cDNAs of Phytolacca americana.

    PubMed Central

    Joy, R W; Sugiyama, M; Fukuda, H; Komamine, A


    Two cDNA clones encoding polyphenol oxidases were isolated from a cDNA library constructed from a log-phase suspension culture of Phytolacca americana (pokeweed) producing betalains. The clones exhibit 93 and 86% sequence identity at the nucleotide and deduced amino acid levels, respectively. Both clones contain two copper-binding domains characterized by histidine-rich regions, which are found ubiquitously in all polyphenol oxidases/tyrosinases, and a putative third histidine-rich, copper-binding region, which is common to all plant polyphenol oxidases. One of the Phytolacca cDNA deduced amino acid sequences contains the ubiquitous transit peptide for all proteins targeted to the internal lumen of thylakoid membranes of plastids and is considered to be 98 residues in length based on a proposed sequence cleavage site motif. This would produce a processed peptide of approximately 54 kD. In addition to common features of transit peptides, it was found that an additional conserved region for polyphenol oxidases was located between the hydroxy amino acid-rich region and the thylakoid transfer domain. Spatial and temporal expression was investigated by northern blot analysis of total RNA from various organs of Phytolacca plants. Transcripts of the two clones were found to be 2.1 and 2.3 kb, respectively. Both transcripts were present only at substantial levels in ripening, betalain-containing fruit. PMID:7539531

  12. Inheritance of grain polyphenol oxidase (PPO) activity in multiple wheat (Triticum aestivum L.) genetic backgrounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Grain polyphenol oxidase (PPO) activity can cause discoloration of wheat (Triticum aestivum L.) food products. Five crosses (PI 117635/Antelope; Fielder/NW03681; Fielder/Antelope; NW07OR1070/Antelope; NW07OR1066/OR2050272H) were selected to study the genetic inheritance of PPO activity. STS marker...

  13. Effect of high pressure on peanut allergens in the presence of polyphenol oxidase and caffeic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High pressure (HP) enhances enzymatic reactions. Because polyphenol oxidase (PPO) is an enzyme, and reduces IgE binding of peanut allergens in presence of caffeic acid (CA), we postulated that a further reduction in IgE binding can be achieved, using HP together with PPO and CA. Peanut extracts cont...

  14. Tissue Printing to Visualize Polyphenol Oxidase and Peroxidase in Vegetables, Fruits, and Mushrooms

    ERIC Educational Resources Information Center

    Melberg, Amanda R.; Flurkey, William H.; Inlow, Jennifer K.


    A simple tissue-printing procedure to determine the tissue location of the endogenous enzymes polyphenol oxidase and peroxidase in a variety of vegetables, fruits, and mushrooms is described. In tissue printing, cell contents from the surface of a cut section of the tissue are transferred to an adsorptive surface, commonly a nitrocellulose…

  15. Purification of a polyphenol oxidase isoform from potato (Solanum tuberosum) tubers.


    Marri, Costanza; Frazzoli, Alessandra; Hochkoeppler, Alejandro; Poggi, Valeria


    A different expression pattern of polyphenol oxidases has been observed during storage in cultivars of potato (Solanum tuberosum L.) featuring different length of dormancy: a short-dormant cultivar showed, at the end of the dormancy, both the highest polyphenol oxidase activity and the largest number of enzyme isoforms. An isoform of polyphenol oxidase isolated at the end of the physiological dormancy from a short-dormant cultivar has been purified to homogeneity by means of column chromatography on phenyl Sepharose and on Superdex 200. The purification factor has been determined equal to 88, and the molecular mass of the purified isoform has been estimated to be 69 and 340 kDa by SDS polyacrylamide gel electrophoresis and gel filtration on Superdex 200, respectively, indicating this PPO isoform as a multimer. The corresponding zymogram features a diffused single band at the cathodic region of the gel and the pI of this polyphenol oxidase has been calculated equal to 6.5. PMID:12877914

  16. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.


    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria


    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC and EC was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine. PMID:15587701

  17. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) may have multiple functions in tissues, depending on its cellular or tissue localization. We used PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in nitrogen-fixing nodules. In red clov...

  18. Biochemical characteristics and thermal inhibition kinetics of polyphenol oxidase extracted from Thompson seedless grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) was isolated from Thompson seedless grape (Vitis vinifera 'Thompson Seedless') and its biochemical characteristics were studied. Optimum pH and temperature for grape PPO activity were pH 6.0 and 25 degrees C with 10 mM catechol as substrate. The enzyme was heat-stable betwee...

  19. Genetic Characterization of Kernel Polyphenol Oxidases in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity causes undesirable darkening of raw Asian noodles and other wheat products. In this study we investigate the genetic origins and diversity of wheat kernel PPO. PPO was characterized via activity assays, antigenic staining, and Southern blots in Triticum aestivum, T....

  20. Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...

  1. Breeding and Characterization of Hexaploid Wheats with Nil Levels of Grain Polyphenol Oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) is a ubiquitous enzyme in plants, responsible for many browning reactions and reduction of food product quality. In common (bread) wheat, PPO occurs in the external layers of grain, often is carried into flour via milling, and can be responsible for the discoloration of whe...

  2. Genetic characterization kernel polyphenol oxidases in wheat (Triticum spp.) and its cultivated and wild relatives

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC, 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in many tissues of the wheat plant, including the outer layers of wheat kernels. High levels of flour PPO have been associated with diminished end-product...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study evaluated the effects of inhibitors on polyphenol oxidase (PPO) activity, the effect of the PPO inhibitor tropolone on noodle darkening, and the correlation of PPO activity with darkening of alkaline noodles. The PPO inhibitors tropolone and salicylhydroxamic acid (each at 1 'M) reduced k...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: Polyphenol oxidase (PPO) has been shown to reduce both proteolysis and lipolysis in incubated red clover (Lee et al. 2004). However it has not been determined whether rumen microbes can adapt to utilize PPO-protected protein and lipid. This study investigated whether rumen inoculum fro...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidases (PPOs) oxidize o-diphenols to o-quinones, which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense L.). Production of o-quinones in red clover inhibits postharvest proteolysis during the ensiling proces...

  6. Marinomonas mediterranea MMB-1 Transposon Mutagenesis: Isolation of a Multipotent Polyphenol Oxidase Mutant

    PubMed Central

    Solano, Francisco; Lucas-Elío, Patricia; Fernández, Eva; Sanchez-Amat, Antonio


    Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxidase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classical tyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizable by conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encoding kanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant was obtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning and sequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequence shows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. In addition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability. PMID:10850991

  7. Polyphenolic composition, antioxidant activity, and polyphenol oxidase (PPO) activity of quince (Cydonia oblonga Miller) varieties.


    Wojdyło, Aneta; Oszmiański, Jan; Bielicki, Paweł


    Phytochemical profiles (phenolic compounds, L-ascorbic acid, antioxidant and PPO activities) of 13 different quince varieties and 5 genotypes were studied. Polyphenols were identified by LC-PDA-QTof/MS and quantified by UPLC-PDA and UPLC-FL. A total of 26 polyphenolic compounds found in quince tissues were identified and presented: 9 flavan-3-ols ((-)-epicatechin, procyanidin B2, 3 procyanidin dimers and trimers, and 1 tetramer); 8 hydroxycinnamates, derivatives of caffeoylquinic and coumaroylquinic acid; and 9 kaempferol and quercetin derivatives. The content of total polyphenols was between 1709.43 (genotype 'S1') and 3436.56 mg/100 g dry weight ('Leskovač'). Flavan-3-ols, which are the major class of quince polyphenols, represented between 78 and 94% of the total polyphenolic compounds. The activity of PPO enzyme ranged from 709.85 to 1284.59 ΔU/min, and that of L-ascorbic acid ranged from 5.86 to 26.42 mg/100 g. Some quince varieties and their products characterized by a higher content of phenolic compounds may be selected to promote their positive effect on health. PMID:23461298

  8. Polyphenol oxidase in potato. A multigene family that exhibits differential expression patterns.


    Thygesen, P W; Dry, I B; Robinson, S P


    Polyphenol oxidase (PPO) activity in potato (Solanum tuberosum) plants was high in stolons, tubers, roots, and flowers but low in leaves and stems. PPO activity per tuber continued to increase throughout tuber development but was highest on a fresh weight basis in developing tubers. PPO activity was greatest at the tuber exterior, including the skin and cortex tissue 1 to 2 mm beneath the skin. Flowers had high PPO activity throughout development, particularly in the anthers and ovary. Five distinct cDNA clones encoding PPO were isolated from developing tuber RNA. POT32 was the major form expressed in tubers and was found in all parts of the tuber and at all stages of tuber development. It was also expressed in roots but not in photosynthetic tissues. POT33 was expressed in tubers but mainly in the tissue near the skin. POT72 was detected in roots and at low levels in developing tubers. NOR333 was identical with the P2 PPO clone previously isolated from potato leaves (M.D. Hunt, N.T. Eannetta, Y. Haifeng, S.M. Newman, J.C. Steffens [1993] Plant Mol Biol 21: 59-68) and was detected in young leaves and in tissue near the tuber skin but was highly expressed in flowers. The results indicate that PPO is present as a small multigene family in potato and that each gene has a specific temporal and spatial pattern of expression. PMID:7480344

  9. Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria).


    Wang, Jiehua; Constabel, C Peter


    In order to functionally analyze the predicted defensive role of leaf polyphenol oxidase (PPO; EC in Populus, transgenic hybrid aspen (Populus tremula x P. alba) plants overexpressing a hybrid poplar (Populus trichocarpa x P. deltoides) PtdPPO1 gene were constructed. Regenerated transgenic plants showed high PPO enzyme activity, PtdPPO1 mRNA levels and PPO protein accumulation. In leaf disk bioassays, forest tent caterpillar (Malacosoma disstria) larvae feeding on PPO-overexpressing transgenics experienced significantly higher mortality and reduced average weight gain compared to larvae feeding on control leaves. However, this effect was observed only when older egg masses were used and the resulting larvae showed reduced growth and vigor. In choice tests, no effect of PPO overexpression was detected. Although PPO in poplar leaves is latent and requires activation with detergents or trypsin for full enzymatic activity, in caterpillar frass the enzyme was extracted in the fully activated form. This activation correlated with partial proteolytic cleavage, suggesting that PPO latency and activation during digestion could be an adaptive and defense-related feature of poplar PPO. PMID:15309534

  10. Eggplant polyphenol oxidase multigene family: cloning, phylogeny, expression analyses and immunolocalization in response to wounding.


    Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P


    Though polyphenol oxidase (PPO) genes from tomato and potato have been extensively studied, information about PPO genes in eggplant (Solanum melongena) is lacking. The main objective of this study is to understand the structural and functional aspects of eggplant PPO genes. Six eggplant PPO genes (SmePPO1-6) cloned by RACE and genome walking were found to be intronless and correspond to eight eggplant unigenes. Comprehensive sequence analyses indicated that the eggplant PPO genes exhibit considerable variation in the transit peptide regions, copper-binding domains and UTRs, and fall into two distinct structural classes. Further, PPO gene members appear to exist in clusters on eggplant chromosome 8 as seen in the case of tomato and potato PPOs. During normal growth and development, SmePPO1 and 2 are expressed in roots, whereas the transcript levels of all the eggplant PPO genes vary considerably in leaves, flowers and fruits. SmePPO1 was expressed in Escherichia coli as a GST fusion protein, and immunoblot using rabbit polyclonal antiserum to GST-SmePPO1 detected a major protein band (~70 kDa) and a minor band (~67 kDa) in eggplant fruit extract. Tissue printing indicated the predominant presence of PPO in the exocarp and the areas surrounding the seeds in the mesocarp of eggplant fruits. Immunolocalization of PPOs in eggplant infested with shoot-and-fruit borer revealed localization of the PPO at the site of infection in tender shoots and fruits, and further inside the mature tissues. The upregulation of eggplant PPO gene transcripts following mechanical injury shows that all the genes except SmePPO2 are induced in the fruit over 6h. On the contrary, the transcripts of SmePPO2 and PPO3 are not detectable in the stem, and expression seems to be prominent over a 2h period for SmePPO1 and SmePPO4-6. Our results show that eggplant PPO genes are structurally different, and are differentially expressed in various tissues of eggplant indicating their functional diversity

  11. Studies on Polyphenol Content, Activities and Isozymes of Polyphenol Oxidase and Peroxidase During Air-Curing in Three Tobacco Types 1

    PubMed Central

    Sheen, S. J.; Calvert, J.


    The change in polyphenol content in the primed leaves of burley, flue-cured, and Turkish tobaccos during air-curing was related to the activities and isozymes of polyphenol oxidase and peroxidase. The quantity of chlorogenic acid was rapidly reduced during the first week of curing. The decrease in rutin content during curing was less significant, especially when the concentration of chlorogenic acid was high in leaf tissues. This result was further confirmed by in vitro assays with partially purified tobacco polyphenol oxidase. The polyphenol oxidase activity did not differ at any stage of curing in the 3 tobaccos. When the activity was measured by the oxidation of 3,4-dihydroxyphenylalanine it rose rapidly during the first day of curing and then decreased sharply so that in the fully cured leaf only 15% activity remained. The increase in activity was not observed when chlorogenic acid was used as the substrate. A similar level of peroxidase activity was found in the 3 tobaccos before curing. Peroxidase activities increased rapidly during the first 24 hr of curing, declined thereafter, and remained highest in the flue-cured tobacco, less in the Turkish line, and least in the burley at the end of curing process. By polyacrylamide gel block electrophoresis, 10 peroxidase isozyme bands, 2 cationic and 8 anionic, appeared identical in all 3 tobaccos. When catechol replaced benzidine-2 HCl as the electron donor, 1 cationic and 2 anionic peroxidase isozymes did not form. Of interest is that the same 10 peroxidase isozyme bands also exhibited polyphenol oxidase activities when treated with 3,4-dihydroxyphenylalanine or chlorogenic acid. Results suggest that in the crude tobacco leaf extract the peroxidase and polyphenol oxidase may associate as protein complexes, and peroxidase isozymes may differ in electron-donor requirements. Isozyme patterns for both oxidases at various curing intervals differed only quantitatively. Images PMID:16657046

  12. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.


    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo. PMID:26976571

  13. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  14. Pre-heating and polyphenol oxidase inhibition impact on extraction of purple sweet potato anthocyanins.


    de Aguiar Cipriano, Paula; Ekici, Lutfiye; Barnes, Ryan C; Gomes, Carmen; Talcott, Stephen T


    Purple sweet potatoes (PSP) have been used as a natural food colorant with high acylated anthocyanins concentrations. Commercially extracting pigments from PSP can be challenging due to firm texture and high polyphenol oxidase (PPO) content. These studies evaluated hot water immersions (30, 50, 70, and 90°C for 10 min) as pre-heating treatments and addition of PPO inhibitors (citric acid, oxalic acid, and sodium borate) to aqueous extraction solutions to aid pigment recovery. Predominant PSP anthocyanins included acylated cyanidin or peonidin derivatives. Non-pigmented cinnamates acted as oxidase substrates and induced co-oxidation reactions with anthocyanins. Pre-heating PSP significantly increased polyphenolic yields in a temperature-dependent manner, consistent with tissue softening and PPO inactivation. The use of solvent modifiers in the extraction solution associated with heat helped minimize enzyme action and increased polyphenolic recovery. Minimizing the impact of PPO with heat was critical to the extraction and recovery of PSP anthocyanins, suitable for food use. PMID:25766822

  15. Impacts on the metabolome of down-regulating polyphenol oxidase in potato tubers.


    Shepherd, Louise Vida Traill; Alexander, Colin James; Hackett, Christine Anne; McRae, Diane; Sungurtas, Julia Anne; Verrall, Susan Ramsay; Morris, Jennifer Anne; Hedley, Peter Edward; Rockhold, David; Belknap, William; Davies, Howard Vivian


    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes induced over a 48 hour (h) period by tuber wounding (sliced transverse sections) were also assessed using two PPO antisense lines (asPPO) and a wild-type (WT) control. Data were analysed using Principal Components Analysis and Analysis of Variance to assess differences between genotypes and temporal changes post-tuber wounding (by slicing). The levels of 15 metabolites (out of a total of 134 that were detected) differed between the WT and asPPO lines in mature tubers at harvest. A considerably higher number (63) of these metabolites changed significantly over a 48 h period following tuber wounding. For individual metabolites the magnitude of the differences between the WT and asPPO lines at harvest were small compared with the impacts of tuber wounding on metabolite levels. Some of the observed metabolite changes are explicable in terms of pathways known to be affected by wound responses. Whilst some statistically significant interactions (11 metabolites) were observed between line and time after wounding, very few profiles were consistent when comparing the WT with both asPPO lines, and the underlying metabolites appeared to be random in terms of the pathways they occupy. Overall, mechanical damage to tubers has a considerably greater impact on the metabolite profile than any potential unintended effects resulting from the down-regulation of PPO gene expression. PMID:25417184

  16. Ascorbyl palmitate-loaded chitosan nanoparticles: characteristic and polyphenol oxidase inhibitory activity.


    Kim, Mi Kyung; Lee, Ji-Soo; Kim, Kwang Yup; Lee, Hyeon Gyu


    The aim of this study was to produce ascorbyl palmitate (AP)-loaded nanoparticles in order to inhibit polyphenol oxidase (PPO) in bananas. AP-loaded chitosan nanoparticles were prepared using acetic acid and citric acid (denoted as CS/AA and CS/CA nanoparticles, respectively). As the initial AP concentration increases, the particle size significantly decreases, and the zeta potential, entrapment and loading efficiency significantly increases. The PPO inhibitory activity of AP was effectively improved when AP was nano-encapsulated by chitosan compared to no encapsulation. These results suggest that chitosan nano-encapsulation can be used to enhance the PPO inhibitory activity of AP. PMID:23247266

  17. Diphenol activation of the monophenolase and diphenolase activities of field bean (Dolichos lablab) polyphenol oxidase.


    Gowda, Lalitha R; Paul, Beena


    This paper reports a study on the hydroxylation of ferulic acid and tyrosine by field bean (Dolichos lablab) polyphenol oxidase, a reaction that does not take place without the addition of catechol. A lag period similar to the characteristic lag of tyrosinase activity was observed, the length of which decreased with increasing catechol concentration and increased with increasing ferulic acid concentration. The activation constant K(a) of catechol for ferulic acid hydroxylation reaction was 5 mM. The kinetic parameters of field bean polyphenol oxidase toward ferulic acid and tyrosine were evaluated in the presence of catechol. 4-Methyl catechol, L-dihydroxyphenylalanine, pyrogallol, and 2,3,4-trihydroxybenzoic acid, substrates with high binding affinity to field bean polyphenol oxidase, could stimulate this hydroxylation reaction. In contrast, diphenols such as protocatechuic acid, gallic acid, chlorogenic acid, and caffeic acid, which were not substrates for the oxidation reaction, were unable to bring about this activation. It is most likely that only o-diphenols that are substrates for the diphenolase serve as cosubstrates by donating electrons at the active site for the monophenolase activity. The reaction mechanism for this activation is consistent with that proposed for tyrosinase (Sanchez-Ferrer, A.; Rodriguez-Lopez, J. N.; Garcia-Canovas, F.; Garcia-Carmona, F. Biochim. Biophys. Acta 1995, 1247, 1-11). The presence of o-diphenols, viz. catechol, L-dihydroxyphenylalanine, and 4-methyl catechol, is also necessary for the oxidation of the diphenols, caffeic acid, and catechin to their quinones by the field bean polyphenol oxidase. This oxidation reaction occurs immediately with no lag period and does not occur without the addition of diphenol. The kinetic parameters for caffeic acid (K(m) = 0.08 mM, V(max) = 32440 u/mg) in the presence of catechol and the activation constant K(a) of catechol (4.6 mM) for this reaction were enumerated. The absence of a lag

  18. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation☆

    PubMed Central

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette


    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80 kb (cgAUS1) and 1.85 kb (cgAUS2a, 2b), encoding for proteins of 68–69 kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9 kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS–PAGE and shot-gun type nanoUHPLC–ESI-MS/MS. PMID:25109778

  19. Changes in the location of polyphenol oxidase in potato (Solanum tuberosum L.) tuber during cell death in response to impact injury: comparison with wound tissue.


    Partington, J C; Smith, C; Bolwell, G P


    In order to elucidate the nature of the response of potato to impact injury at the biochemical level, changes in the location of the enzyme responsible for the discoloration, polyphenol oxidase, were determined using immunogold location with an antibody specific for potato tuber polyphenol oxidase. Tissue printing revealed that the enzyme was distributed throughout the tuber. Following impact injury, both tissue printing and quantitative electron microscopy indicated that there was no increase in the level of the enzyme although there was subcellular redistribution of polyphenol oxidase. This redistribution was first apparent at 12 h after impact, as determined by the use of confocal immunolocation, and coincided with loss of membrane integrity. These changes were examined in parallel with a number of stress-related parameters in both impact and wound responses. Wounding was accompanied by active gene expression and protein synthesis, leading to metabolic activity and tissue repair. In contrast, the bruising response was characterised by a limited active response and vital-staining methods indicated that after 16 h the tissue undergoes cell death. PMID:9951737

  20. Purification and structural analysis of membrane-bound polyphenol oxidase from Fuji apple.


    Liu, Fang; Zhao, Jin-Hong; Wen, Xin; Ni, Yuan-Ying


    Membrane-bound polyphenol oxidase (mPPO) in Fuji apple (Malus domestica Borkh. cv. Red Fuji) was purified and analyzed with a nanoelectrospray ionization mass spectrometer. The three-dimensional model and binding site of mPPO to 4-methyl catechol were also studied using molecular docking. mPPO was purified 54.41-fold using temperature-induced phase partitioning technique and ion exchange chromatography. mPPO had a molecular weight of 67.3kDa. Even though a significant level of homology was observed between mPPO and the soluble polyphenol oxidase in the copper binding sequence, there was another region, rich in histidine residues, which differed in 13 amino acids. The three-dimensional structure of mPPO consisted of six α-helices, two short β-strands, and ten random coils. The putative substrate-binding pocket contained six polar or charged amino acids, His191, His221, Trp224, Trp228, Phe227, and Val190. Trp224 and Trp228 formed hydrogen bonds with 4-methyl-catechol. PMID:25863612

  1. The Enzymatic Decolorization of Textile Dyes by the Immobilized Polyphenol Oxidase from Quince Leaves

    PubMed Central

    Arabaci, Gulnur; Usluoglu, Ayse


    Water pollution due to release of industrial wastewater has already become a serious problem in almost every industry using dyes to color its products. In this work, polyphenol oxidase enzyme from quince (Cydonia Oblonga) leaves immobilized on calcium alginate beads was used for the successful and effective decolorization of textile industrial effluent. Polyphenol oxidase (PPO) enzyme was extracted from quince (Cydonia Oblonga) leaves and immobilized on calcium alginate beads. The kinetic properties of free and immobilized PPO were determined. Quince leaf PPO enzyme stability was increased after immobilization. The immobilized and free enzymes were employed for the decolorization of textile dyes. The dye solutions were prepared in the concentration of 100 mg/L in distilled water and incubated with free and immobilized quince (Cydonia Oblonga) leaf PPO for one hour. The percent decolorization was calculated by taking untreated dye solution. Immobilized PPO was significantly more effective in decolorizing the dyes as compared to free enzyme. Our results showed that the immobilized quince leaf PPO enzyme could be efficiently used for the removal of synthetic dyes from industrial effluents. PMID:24587743

  2. The enzymatic decolorization of textile dyes by the immobilized polyphenol oxidase from quince leaves.


    Arabaci, Gulnur; Usluoglu, Ayse


    Water pollution due to release of industrial wastewater has already become a serious problem in almost every industry using dyes to color its products. In this work, polyphenol oxidase enzyme from quince (Cydonia Oblonga) leaves immobilized on calcium alginate beads was used for the successful and effective decolorization of textile industrial effluent. Polyphenol oxidase (PPO) enzyme was extracted from quince (Cydonia Oblonga) leaves and immobilized on calcium alginate beads. The kinetic properties of free and immobilized PPO were determined. Quince leaf PPO enzyme stability was increased after immobilization. The immobilized and free enzymes were employed for the decolorization of textile dyes. The dye solutions were prepared in the concentration of 100 mg/L in distilled water and incubated with free and immobilized quince (Cydonia Oblonga) leaf PPO for one hour. The percent decolorization was calculated by taking untreated dye solution. Immobilized PPO was significantly more effective in decolorizing the dyes as compared to free enzyme. Our results showed that the immobilized quince leaf PPO enzyme could be efficiently used for the removal of synthetic dyes from industrial effluents. PMID:24587743

  3. Activation of Polyphenol Oxidase in Dormant Wild Oat Caryopses by a Seed-Decay Isolate of Fusarium avenaceum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Incubation of dormant wild oat (Avena fatua L., isoline M73) caryopses for 1 to 3 days with Fusarium avenaceum seed-decay isolate F.a.1 induced activity of the plant defense enzyme polyphenol oxidase (PPO). Both extracts and leachates obtained from F.a.1-treated caryopses had decreased abundance of ...

  4. Potential of plant polyphenol oxidases in the decolorization and removal of textile and non-textile dyes.


    Khan, Amjad Ali; Husain, Qayyum


    In this study an effort has been made to use plant polyphenol oxidases; potato (Solanum tuberosum) and brinjal (Solanum melongena), for the treatment of various important dyes used in textile and other industries. The ammonium sulphate fractionated enzyme preparations were used to treat a number of dyes under various experimental conditions. Majority of the treated dyes were maximally decolorized at pH 3.0. Some of the dyes were quickly decolorized whereas others were marginally decolorized. The initial first hour was sufficient for the maximum decolorization of dyes. The rate of decolorization was quite slow on long treatment of dyes. Enhancement in the dye decolorization was noticed on increasing the concentration of enzymes. The complex mixtures of dyes were treated with both preparations of polyphenol oxidases in the buffers of varying pH values. Potato polyphenol oxidase was significantly more effective in decolorizing the dyes to higher extent as compared to the enzyme obtained from brinjal polyphenol oxidase. Decolorization of dyes and their mixtures, followed by the formation of an insoluble precipitate, which could be easily removed simply by centrifugation. PMID:17915700

  5. 4-Coumaroyl coenzyme A 3-hydroxylase activity from cell cultures of Lithospermum erythrorhizon and its relationship to polyphenol oxidase.


    Wang, Z X; Li, S M; Löscher, R; Heide, L


    A 4-coumaroyl-CoA 3-hydroxylase activity was purified 4600-fold from cell cultures of Lithospermum erythrorhizon. The enzyme showed a molecular mass of 42,400 +/- 1700 Da in gel chromatography and required ascorbate, NADH, or NADPH as cofactors. 4-Coumaroyl-CoA, 4-coumarate, p-cresol, and several other phenolic substances, but not tyrosine, were accepted as substrates for the hydroxylation. Besides hydroxylase activity, the enzyme showed diphenol oxidase activity. Both activities were inhibited by diethyldithiocarbamate or beta-mercaptoethanol, although at different concentrations. The enzyme showed striking similarity to a 4-coumaroyl-glucose 3-hydroxylase from sweet potato (Ipomoe batatas) roots, which has reportedly been purified to homogeneity and identified as a specific enzyme of chlorogenic acid biosynthesis. Close examination and comparison to a commercially available polyphenol oxidase, however, suggest that the enzyme activities purified from both Lithospermum and sweet potato are polyphenol oxidases rather than specific enzymes of secondary metabolism. PMID:9367532

  6. Immobilization of polyphenol oxidase on chitosan-SiO2 gel for removal of aqueous phenol.


    Shao, Jian; Ge, Huimin; Yang, Yumin


    A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan-SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg/ml, PPO 4 mg/ml and pH 7.0), the activity of immobilized PPO was 1370 U/g and its Km value for catechol was 12 mM at 25 degrees C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized the enzyme with 73 and 58% retention of activity after 10 and 20 days, respectively, at 30 degrees C whereas most of the free enzyme was inactive after 7 days. The efficiency of removing phenol (10 mg phenol/l) by the immobilized PPO was 86%, and about 60% removal efficiency was retained after five recycles. The immobilized PPO may thus be a useful for removing phenolic compounds from industrial waste-waters. PMID:17417695

  7. Purification of polyphenol oxidase free of the storage protein patatin from potato tuber.


    Partington, J C; Bolwell, G P


    Routine protein purification to homogeneity from potato tuber, as from other storage tissues and seeds, is often hindered due to the large amounts of storage protein present. In potato, patatin, the major storage protein of the tuber, often contaminates preparations. The present work describes the purification of polyphenol oxidase (PPO) from the potato tuber (Solanum tuberosum cv Cara) to homogeneity including the critical step of hydrophobic chromatography on Octyl-Sepharose which was sufficient to completely remove patatin. The purified PPO was found to be a doublet of M(r) 60,000 and 69,000 when analysed by SDS-PAGE with a Km 4.3 +/- 0.3 mM for L-dihydroxyphenylalanine. Both bands were found to have similar N-terminal corresponding to PPO isoforms when sequenced. PMID:8783836

  8. Polyphenol oxidase from hybrid poplar. Cloning and expression in response to wounding and herbivory.


    Constabel, C P; Yip, L; Patton, J J; Christopher, M E


    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa x Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests. PMID:10982443

  9. Polyphenol oxidase and peroxidase expression in four pineapple varieties (Ananas comosus L.) after a chilling injury.


    Raimbault, Astrid-Kim; Marie-Alphonsine, Paul-Alex; Horry, Jean-Pierre; Francois-Haugrin, Madlyn; Romuald, Karell; Soler, Alain


    Pineapple internal browning (IB) is a chilling injury that produces enzymatic browning associated with flesh translucency. Pineapple biodiversity allowed the investigation of how polyphenol oxidase (PPO) and peroxidase (POD) activities with their different isoforms are involved in the IB mechanism. Fruits of four varieties that expressed IB symptoms differently, Smooth Cayenne (SCay) and the hybrids MD2, Flhoran 41 (Flh 41), and Flhoran 53 (Flh 53), were stressed by cold. The susceptible varieties showed classical brown spots but different patterns of IB, whereas MD2 and controls showed no IB. Enzymatic activities were measured on fruit protein extracts and PPO and POD isoforms separated on mini-gels (PhastSystem). Only PPO activity was significantly enhanced in the presence of IB. Up to six PPO isoforms were identified in the susceptible varieties. PPO was barely detectable in the nonsusceptible variety MD2 and in controls. The number of PPO isoforms and the total PPO activity after chilling are varietal characteristics. PMID:21133422

  10. Pectin plays an important role on the kinetics properties of polyphenol oxidase from honeydew peach.


    Liu, Liang; Cao, Shaoqian; Yang, Hua; Qi, Xiangyang


    Polyphenol oxidase (PPO) was purified from peach pulp by a three-step column chromatographic procedure. The kinetics properties of the PPO fractions obtained from different purification steps were compared. All the fractions showed high affinities for (+)-catechin and (-)-epicatechin. The optimum pHs and optimum temperatures for all the fractions were the same. However, the fraction that contained pectin was more sensitive to the change of pH, and it had a lower affinity for the substrates and a higher thermostability than the fractions without pectin. In addition, the protein impurities in PPO fractions might have no effect on the properties of PPO. l-Cysteine and glutathione were effective for the inhibition of all the PPO fractions, while NaF inhibited moderately. However, the pectin could reduce the inhibition effects of those inhibitors. PMID:25172677

  11. Study and characterization of polyphenol oxidase from eggplant (Solanum melongena L.).


    Todaro, Aldo; Cavallaro, Rosalinda; Argento, Sergio; Branca, Ferdinando; Spagna, Giovanni


    In this study the catecholase and cresolase activities of eggplant polyphenol oxidase (PPO) were investigated. Enzyme activity was determined by measuring the increase in absorbance using catechol as substrate and 3-methyl-2-benzothiazolinone hydrazone (MBTH) as coupled reagent. The effects of substrate specificity, heat inactivation, temperature, pH, and inhibitors were investigated to understand the enzymatic alteration of ready-to-eat preparations. Browning of vegetables was determined through a colorimeter. Decrease of lightness (L*) and increase of color difference values (ΔE*) were correlated with tissue browning. Antibrowning agents were tested on PPO under the same conditions. The enzyme activity was strongly inhibited by 0.4 M citric acid. Under natural pH conditions, the enzyme was also inhibited by tartaric acid and acetic acid. All of the results were used to understand the best conditions for food transformation (ready-to-eat and grilled eggplant slices). PMID:21942648

  12. A mediated polyphenol oxidase biosensor immobilized by electropolymerization of 1,2-diamino benzene.


    Akyilmaz, Erol; Kozgus, Ozge; Türkmen, Hayati; Cetinkaya, Bekir


    A biosensor based on a partially purified polyphenol oxidase (PPO) enzyme was developed by using electropolymerization of [(2,2'-bipyridine)(chloro)(p-cymene)rutenium(II)]chloride] mediator complex and 1,2-diamino benzene (DAB) on a screen printing Pt electrode (1mm diameter). The electropolymerization was carried out at +0.7V for 45min in phosphate buffer (50mM, pH 7.0) which contained 14.0U/10mL polyphenole oxidase, 200mM DAB and 2.5mM Ru-mediator complex solutions. Measurement is based on the detection of the oxidation current of the Ru-mediator complex that related to the enzymatic reaction catalyzed by PPO at +0.65V. The phosphate buffer (50mM, pH 7.0 containing 0.1M KCl) and 30 degrees C were established as being the optimum working conditions. Under the optimum experimental conditions a linear calibration curve was obtained between 5 and 100microM catechol concentration. The detection limit of the biosensor is 2.385microM. In the characterization studies of the biosensor some parameters such as effect of Ru-mediator types on the biosensor response, substrate specificity, reproducibility and storage stability were studied. From the experiments, the average value (x), standard deviation (SD) and coefficient of variation (CV%) were found to be 48.75microM,+/-1.56microM, and 3.2% respectively for 50microM catechol standard. PMID:19783226

  13. Characterization of a tomato polyphenol oxidase and its role in browning and lycopene content.


    Spagna, Giovanni; Barbagallo, Riccardo N; Chisari, Marco; Branca, Ferdinando


    Polyphenol oxidase (PPO) was extracted from five Sicilian varieties of tomato fruit [Pizzutello, Naomi (Hazera), F1 PS212 (Peto seed), Rosa Maletto, and PO228] and assayed with a method using 3-methylbenzothyazolinone hydrazone (MBTH) as chromophore coupling agent. 3,4-Dihydroxyphenylacetic acid was chosen for tomato PPO activity determination. The tomato PPO had maximum activity at pH 4.8. The pH of juice in ripe fruits is between 4.1 and 4.4, a range in which PPO relative activity is between 74 and 87%. The optimum temperature of activity for tomato PPO was 40 degrees C; the enzyme showed a good relative activity (55% of the maximum) at cold-storage temperature (4 degrees C). PPO retained 82% relative activity at an NaCl concentration of 0.1 M; at higher concentrations the PPO became gradually inactivated. The commercial variety Naomi is more susceptible to enzymatic browning than the local varieties Pizzutello, Rosa Maletto and PO228, due to higher PPO activity levels. This result confirms the suitability of these local tomato varieties to national markets. Results from storage tests seem to relate PPO activity with color changes associated with browning and lycopene degradation, because lycopene is an antioxidant agent that reconstitutes the polyphenols oxidized by the action of PPO. PMID:15769132

  14. Polyphenol oxidases in Physcomitrella: functional PPO1 knockout modulates cytokinin-dependent developmentin the moss Physcomitrella patens

    PubMed Central

    von Schwartzenberg, Klaus


    Polyphenol oxidases (PPOs) are copper-binding enzymes of the plant secondary metabolism that oxidize polyphenols to quinones. Although PPOs are nearly ubiquitous in seed plants, knowledge on their evolution and function in other plant groups is missing. This study reports on the PPO gene family in the moss Physcomitrella patens (Hedw.) B.S.G. asan example for an early divergent plant. The P. patens PPO multigene family comprises 13 paralogues. Phylogenetic analyses suggest that plant PPOs evolved with the colonization of land and that PPO duplications within the monophyletic P. patens paralogue clade occurred after the separation of the moss and seed plant lineages. PPO functionality was demonstrated for recombinant PPO6. P. patens was analysed for phenolic compounds and six substances were detected intracellularly by LC-MS analysis: 4-hydroxybenzoic acid, p-cumaric acid, protocatechuic acid, salicylic acid, caffeic acid, and an ester of caffeic acid. Targeted PPO1 knockout (d|ppo1) plants were generated and plants lacking PPO1 exhibited only ~30% of the wild-type PPO activity in the culture medium, thus suggesting extracellular localization of PPO1, which is in contrast to the mostly plastidic PPO localization in seed plants. Further, d|ppo1 lines formed significantly more gametophores with a reduced areal plant size, which could be related to an increase of endogenously produced cytokinins and indicates an impact of PPO1 on plant development. d|ppo1 plants were less tolerant towards applied 4-methylcatechol compared to the wild type, which suggests a role of extracellular PPO1 in establishing appropriate conditions by the removal of inhibitory extracellular phenolic compounds. PMID:22865913

  15. Control of enzymatic browning in potato (Solanum tuberosum L.) by sense and antisense RNA from tomato polyphenol oxidase.


    Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N


    Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives. PMID:11262007

  16. Polyphenol oxidase and herbivore defense in trembling aspen (Populus tremuloides): cDNA cloning, expression, and potential substrates.


    Haruta, Miyoshi; Pedersen, Jens A.; Constabel, C. Peter


    The biochemical anti-herbivore defense of trembling aspen (Populus tremuloides Michx.) was investigated in a molecular analysis of polyphenol oxidase (PPO; EC A PPO cDNA was isolated from a trembling aspen wounded leaf cDNA library and its nucleotide sequence determined. Southern analysis indicated the presence of two PPO genes in the trembling aspen genome. Expression of PPO was found to be induced after herbivory by forest tent caterpillar, by wounding, and by methyl jasmonate treatment. Wound induction was systemic, and occurred in unwounded leaves on wounded plants. This pattern of expression is consistent with a role of this enzyme in insect defense. A search for potential PPO substrates in ethanolic aspen leaf extracts using electron spin resonance (ESR) found no pre-existing diphenolic compounds. However, following a brief delay and several additions of oxygen, an ESR signal specific for catechol was detected. The source of this catechol was most likely the aspen phenolic glycosides tremulacin or salicortin which decomposed during ESR experiments. This was subsequently confirmed in experiments using pure salicortin. PMID:11473716

  17. Delineating the role of polyphenol oxidase in the darkening of alkaline wheat noodles.


    Fuerst, E Patrick; Anderson, James V; Morris, Craig F


    This study evaluated the effects of inhibitors on polyphenol oxidase (PPO) activity, the effect of the PPO inhibitor tropolone on noodle darkening, and the correlation of PPO activity with darkening of alkaline noodles. The PPO inhibitors tropolone and salicylhydroxamic acid (each at 1 microM) reduced kernel PPO activity by approximately 50% in three hexaploid wheat cultivars but did not inhibit PPO activity in the two very low PPO cultivars, durum Langdon, and the synthetic hexaploid-derived ID580. Tropolone (100 microg/g flour) inhibited alkaline noodle darkening (deltaL*) by 13-25% in the low PPO wheat cultivar, ID377s, and by 39-54% in the high PPO wheat cultivar, Klasic. Alkaline noodle darkening among 502 wheat samples was correlated with kernel PPO activity (r = 0.64). Results substantiate the hypothesis that PPO plays a major role in darkening of alkaline noodles. However, results also indicate that substantial darkening would occur even at zero PPO activity, as measured in the kernel PPO assay. Therefore, darkening of alkaline noodles is probably due to the cultivar-specific level of PPO activity and the presence of at least one additional darkening mechanism. Further investigation is required to identify the phenolic discoloration agent(s) and to determine the potential roles of non-PPO discoloration mechanisms, both enzymatic and nonenzymatic, in wheat products. PMID:16536622

  18. Measurement of polyphenol oxidase activity using optical waveguide lightmode spectroscopy-based immunosensor.


    Kim, Namsoo; Kim, Woo-Yeon


    Polyphenol oxidase (PPO) is an important quality index during food processing involving heat-treatment and sensitive determination of PPO activity has been a critical concern in the food industry. In this study, a new measurement of PPO activity exploiting an optical waveguide lightmode spectroscopy-based immunosensor is presented using a polyclonal anti-PPO antibody that was immobilized in situ to the surface of a 3-aminopropyltriethoxysilane-treated optical grating coupler activated with glutaraldehyde. When analysed with a purified PPO fraction from potato tubers, a linear relationship was found between PPO activities of 0.0005607-560.7U/mL and the sensor responses obtained. The sensor was applicable to measurement of PPO activity in real samples that were prepared from potato tubers, grapes and Kimchi cabbage, and the analytical results were compared with those obtained by a conventional colorimetric assay measuring PPO activity. When tested for long-term stability, the sensor was reusable up to 10th day after preparation. PMID:25236218

  19. Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance.


    Li, Li; Steffens, John C


    Polyphenol oxidases (PPOs; EC or EC catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato ( Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato ( Solanum tuberosum L.) PPO cDNA under control of the cauliflower mosaic virus 35S promoter. The transgenic plants expressed up to 30-fold increases in PPO transcripts and 5- to 10-fold increases in PPO activity and immunodetectable PPO. As expected, these PPO-overexpressing transgenic plants oxidized the endogenous phenolic substrate pool at a higher rate than control plants. Three independent transgenic lines were selected to assess their interaction with the bacterial pathogen Pseudomonas syringae pv. tomato. The PPO-overexpressing tomato plants exhibited a great increase in resistance to P. syringae. Compared with control plants, these transgenic lines showed less severity of disease symptoms, with over 15-fold fewer lesions, and strong inhibition of bacterial growth, with over 100-fold reduction of bacterial population in the infected leaves. These results demonstrate the importance of PPO-mediated phenolic oxidation in restricting plant disease development. PMID:12029473

  20. Potato and mushroom polyphenol oxidase activities are differently modulated by natural plant extracts.


    Kuijpers, Tomas F M; van Herk, Teunie; Vincken, Jean-Paul; Janssen, Renske H; Narh, Deborah L; van Berkel, Willem J H; Gruppen, Harry


    Enzymatic browning is a major quality issue in fruit and vegetable processing and can be counteracted by different natural inhibitors. Often, model systems containing a single polyphenol oxidase (PPO) are used to screen for new inhibitors. To investigate the impact of the source of PPO on the outcome of such screening, this study compared the effect of 60 plant extracts on the activity of PPO from mushroom ( Agaricus bisporus , AbPPO) and PPO from potato ( Solanum tuberosum , StPPO). Some plant extracts had different effects on the two PPOs: an extract that inhibited one PPO could be an activator for the other. As an example of this, the mate ( Ilex paraguariensis ) extract was investigated in more detail. In the presence of mate extract, oxygen consumption by AbPPO was found to be reduced >5-fold compared to a control reaction, whereas that of StPPO was increased >9-fold. RP-UHPLC-MS analysis showed that the mate extract contained a mixture of phenolic compounds and saponins. Upon incubation of mate extract with StPPO, phenolic compounds disappeared completely and saponins remained. Flash chromatography was used to separate saponins and phenolic compounds. It was found that the phenolic fraction was mainly responsible for inhibition of AbPPO and activation of StPPO. Activation of StPPO was probably caused by activation of latent StPPO by chlorogenic acid quinones. PMID:24344979

  1. Purification and characterization of polyphenol oxidase from waste potato peel by aqueous two-phase extraction.


    Niphadkar, Sonali S; Vetal, Mangesh D; Rathod, Virendra K


    Potato peel from food industrial waste is a good source of polyphenol oxidase (PPO). This work illustrates the application of an aqueous two-phase system (ATPS) for the extraction and purification of PPO from potato peel. ATPS was composed of polyethylene glycol (PEG) and potassium phosphate buffer. Effect of different process parameters, namely, PEG, potassium phosphate buffer, NaCl concentration, and pH of the system, on partition coefficient, purification factor, and yield of PPO enzyme were evaluated. Response surface methodology (RSM) was utilized as a statistical tool for the optimization of ATPS. Optimized experimental conditions were found to be PEG1500 17.62% (w/w), potassium phosphate buffer 15.11% (w/w), and NaCl 2.08 mM at pH 7. At optimized condition, maximum partition coefficient, purification factor, and yield were found to be 3.7, 4.5, and 77.8%, respectively. After partial purification of PPO from ATPS, further purification was done by gel chromatography where its purity was increased up to 12.6-fold. The purified PPO enzyme was characterized by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by Km value 3.3 mM, and Vmax value 3333 U/mL, and enzyme stable ranges for temperature and pH of PPO were determined. These results revealed that ATPS would be an attractive option for obtaining purified PPO from waste potato peel. PMID:25036474

  2. Development of hydroxylated naphthylchalcones as polyphenol oxidase inhibitors: Synthesis, biochemistry and molecular docking studies.


    Radhakrishnan, Sini; Shimmon, Ronald; Conn, Costa; Baker, Anthony


    Polyphenol oxidase (Tyrosinase) has received great attention, since it is the key enzyme in melanin biosynthesis. In this study, novel hydroxy naphthylchalcone compounds were synthesized, and their inhibitory effects on mushroom tyrosinase activity were evaluated. The structures of the compounds synthesized were confirmed by (1)H NMR, (13)C NMR, FTIR and HRMS. Two of the compounds synthesized inhibited the diphenolase activity of tyrosinase in a dose dependent manner and exhibited much higher tyrosinase inhibitory activities (IC50 values of 10.4μM and 14.4μM, respectively) than the positive control, kojic acid (IC50: 27.5μM). Kinetic analysis showed that their inhibition was reversible. Both the novel compounds displayed competitive inhibition with their Ki values of 3.8μM and 4.5μM, respectively. Docking results confirmed that the active inhibitors strongly interacted with the mushroom tyrosinase residues. This study suggests hydroxy naphthylchalcone compounds to serve as promising candidates for use as depigmentation agents. PMID:26496408

  3. Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.


    Bravo, Karent; Osorio, Edison


    Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning. PMID:26616939

  4. Characterization of germin-like protein with polyphenol oxidase activity from Satsuma mandarine.


    Cheng, Xi; Huang, Xingjian; Liu, Siyu; Tang, Mi; Hu, Wanfeng; Pan, Siyi


    Polyphenol oxidases (PPOs) catalyzing the oxygen dependent oxidation of phenols to quinones are ubiquitously distributed in plants and are assumed to be involved in plant defense against pests and pathogens. A protein with high PPO activity was identified in Satsuma mandarine, extracted with Tris-HCl buffer, purified by salt precipitation and column chromatography, and characterized by mass spectrometry as germin-like protein (GLP), which belongs to pathogenesis related protein (PR) family. In the present study, the structure and enzymatic properties of GLP were characterized using spectroscopy methods. Based on native PAGE analysis, the molecular weight of GLP was estimated to be 108 kDa and GLP was identified as a pentamer containing five subunits of 22 kDa. The optimum pH and temperature for PPO catalyzing activity of GLP was 6.5 and 65°C, respectively. Kinetic constants were 0.0365 M and 0.0196 M with the substrates catechol and pyrogallol, respectively. The structural characterization of GLP provided better insights into the regions responsible for its PPO activity. PMID:24845377

  5. Tissue printing to visualize polyphenol oxidase and peroxidase in vegetables, fruits, and mushrooms.


    Melberg, Amanda R; Flurkey, William H; Inlow, Jennifer K


    A simple tissue-printing procedure to determine the tissue location of the endogenous enzymes polyphenol oxidase and peroxidase in a variety of vegetables, fruits, and mushrooms is described. In tissue printing, cell contents from the surface of a cut section of the tissue are transferred to an adsorptive surface, commonly a nitrocellulose membrane. Because of the considerable expense of nitrocellulose, our procedure utilizes artists' hot-press watercolor paper as a novel and more economical alternative. Tissue prints are then exposed to an enzyme substrate from which an insoluble, colored product is produced. The appearance of color in specific areas of the print is an indication of the presence of the enzyme in those tissue locations. The experiment is designed to enable students to learn some fundamental concepts about enzymes. It has been used in an introductory-level organic and biochemistry course for nonscience majors, but would also be appropriate for advanced high school students or could be adapted for an upper-level undergraduate biochemistry course. PMID:21567712

  6. Blueberry polyphenol oxidase: Characterization and the kinetics of thermal and high pressure activation and inactivation.


    Terefe, Netsanet Shiferaw; Delon, Antoine; Buckow, Roman; Versteeg, Cornelis


    Partially purified blueberry polyphenol oxidase (PPO) in Mcllvaine buffer (pH=3.6, typical pH of blueberry juice) was subjected to processing at isothermal-isobaric conditions at temperatures from 30 to 80 °C and pressure from 0.1 to 700 MPa. High pressure processing at 30-50 °C at all pressures studied caused irreversible PPO activity increase with a maximum of 6.1 fold increase at 500 MPa and 30 °C. Treatments at mild pressure-mild temperature conditions (0.1-400 MPa, 60 °C) also caused up to 3 fold PPO activity increase. Initial activity increase followed by a decrease occurred at relatively high pressure-mild temperature (400-600 MPa, 60 °C) and mild pressure-high temperature (0.1-400 MPa, 70-80 °C) combinations. At temperatures higher than 76 °C, monotonic decrease in PPO activity occurred at 0.1 MPa and pressures higher than 500 MPa. The activation/inactivation kinetics of the enzyme was successfully modelled assuming consecutive reactions in series with activation followed by inactivation. PMID:26041182

  7. Aberrant Processing of Polyphenol Oxidase in a Variegated Grapevine Mutant 1

    PubMed Central

    Rathjen, Anne H.; Robinson, Simon P.


    Bruce's Sport is a mutant grapevine (Vitis vinifera L.) with green and white variegated fruit derived from the Sultana variety. The white regions of tissue have decreased polyphenol oxidase (PPO) activity resulting in a reduced capacity for browning. Active PPO from Sultana grapes was purified and had an apparent molecular weight of 40,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Western blots indicated that mature Sultana grapes contained a single 40-kilodalton PPO, and young Sultana berries also had small quantities of a 60-kilodalton protein. Bruce's Sport grapes had much less of the 40-kilodalton PPO and greater amounts of the 60-kilodalton band. Protease digestion of Bruce's Sport extracts decreased the proportion of the 60-kilodalton protein and increased the 40-kilodalton band. A cDNA clone of grape PPO was used to probe a northern blot of Sultana and Bruce's Sport RNA and hybridized to a 2.2-kilobase transcript in both grapevines. The level of PPO mRNA was high in the early stages of berry development but then declined. The results suggest that in grapevine the active 40-kilodalton form of PPO is synthesized as a precursor protein of at least 60 kilodaltons, and normal processing is interrupted in Bruce's Sport resulting in the accumulation of the 60-kilodalton inactive preform of PPO. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6 PMID:16669082

  8. Purification and partial biochemical characterization of polyphenol oxidase from mango (Mangifera indica cv. Manila).


    Palma-Orozco, Gisela; Marrufo-Hernández, Norma A; Sampedro, José G; Nájera, Hugo


    Polyphenol oxidase (PPO) is an enzyme widely distributed in the plant kingdom that has been detected in most fruits and vegetables. PPO was extracted and purified from Manila mango (Mangifera indica), and its biochemical properties were studied. PPO was purified 216-fold by hydrophobic interaction and ion exchange chromatography. PPO was purified to homogeneity, and the estimated PPO molecular weight (MW) by SDS-PAGE was ≈31.5 kDa. However, a MW of 65 kDa was determined by gel filtration, indicating a dimeric structure for the native PPO. The isolated PPO showed the highest affinity to pyrogallol (Km = 2.77 mM) followed by 4-methylcatechol (Km = 3.14 mM) and catechol (Km = 15.14 mM). The optimum pH for activity was 6.0. PPO was stable in the temperature range of 20-70 °C. PPO activity was completely inhibited by tropolone, ascorbic acid, sodium metabisulfite, and kojic acid at 0.1 mM. PMID:25211397

  9. Interaction of polyphenol oxidase of Solanum tuberosum with β-cyclodextrin: Process details and applications.


    Singh, Virendra; Jadhav, Swati B; Singhal, Rekha S


    Polysaccharides differing in structure and chemical nature were screened for their ability to bind non-covalently with polyphenol oxidase (PPO) from potato (as a model) and their effect on enzyme activity. All the polysaccharides selected inhibited the PPO but β-cyclodextrin showed maximum inhibition under optimum conditions. Process details for the inhibition of PPO were studied with respect to concentration of β-cyclodextrin, temperature, pH, and time. Higher inhibition constant and lower half life was obtained at 40 °C than at 30 °C in the presence of inhibitor. β-Cyclodextrin showed mixed type of inhibition of PPO. β-Cyclodextrin was further exploited as anti-browning agent in selected fruit juices. It not only showed a significant anti-browning effect on freshly prepared potato juice but was also effective in other fruit juices. Better effect was seen in pineapple, apple and pear as compared to banana, sugarcane and guava fruit juices. PMID:26187193

  10. Purification and characterization of polyphenol oxidase from jackfruit ( Artocarpus heterophyllus ) bulbs.


    Tao, Yi-Ming; Yao, Le-Yi; Qin, Qiu-Yan; Shen, Wang


    Polyphenol oxidase (PPO) from jackfruit bulb was purified through acetone precipitation, ion-exchange column, and gel filtration column. PPO was a dimer with the molecular weight of 130 kDa determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration. The Km was 8.3 and 18.2 mM using catechol and 4-methylcatechol as substrates, respectively. The optimum pH was 7.0 (catechol as the substrate) or 6.5 (4-methylcatechol as the substrate). The optimum temperature was 8 °C. The enzyme was stable below 40 °C. The activation energy (Ea) of heat inactivation was estimated to be 103.30 kJ/mol. The PPO activity was activated by Mn(2+), SDS, Tween-20, Triton X-100, citric acid, and malic acid but inhibited by K(+), Zn(2+), Mg(2+), Ca(2+), Ba(2+), cetyl trimethyl ammonium bromide (CTAB), kojic acid, tropolone, glutathione (GSH), cysteine (Cys), and ascorbic acid (AA). Cys and AA were effective to reduce browning of jackfruit bulbs during the storage at 8 °C for 15 days. PMID:24325285

  11. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    PubMed Central

    Webb, K. Judith; Cookson, Alan; Allison, Gordon; Sullivan, Michael L.; Winters, Ana L.


    Polyphenol oxidase (PPO) may have multiple functions in tissues depending on its cellular or tissue localization. Here we use PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in N2-fixing nodules. In red clover, PPO was not essential for either growth or nodule production, or for nodule function in plants grown under optimal, N-free conditions. However, absence of PPO resulted in a more reduced environment in all tissues, as measured by redox potential, and caused subtle developmental changes in nodules. Leaves and, to a lesser extent nodules, lacking PPO tended to accumulate phenolic compounds. A comparison of nodules of two representative contrasting clones by microscopy revealed that nodules lacking PPO were morphologically and anatomically subtly altered, and that phenolics accumulated in different cells and tissues. Developing nodules lacking PPO were longer, and there were more cell layers within the squashed cell layer (SCL), but the walls of these cells were less thickened and the cells were less squashed. Within the N2-fixing zone, bacteroids appeared more granular and were less tightly packed together, and were similar to developmentally compromised bacteroids elicited by catalase mutant rhizobia reported elsewhere. PMID:25566275

  12. Oxygenation of bisphenol A to quinones by polyphenol oxidase in vegetables.


    Yoshida, Mitsuru; Ono, Hiroshi; Mori, Yoshiko; Chuda, Yoshihiro; Mori, Motoyuki


    To understand conversion of bisphenol A and its related compounds under some chemical and biological environments, oxidation of these compounds was performed. Bisphenol A was oxidized to monoquinone and bisquinone derivatives by Fremy's salt, a radical oxidant; but salcomine and alkali did not catalyze the oxidation by molecular oxygen. Bisphenol A, bisphenol B, and 3,4'-(1-methylethylidene)bisphenol were converted to their monoquinone derivatives in the presence of oxygen and polyphenol oxidase from mushroom at 25 degrees C at pH 6.5. Among crude enzyme solutions of fruits and vegetables, potato, mushroom, eggplant, edible burdock, and yacon showed remarkable oxidative activity on bisphenol A. The highest activity was observed in potato, and the main product obtained by the enzymatic oxygenation was the monoquinone derivative of bisphenol A, accompanied by a small amount of the bisquinone derivative. The oxidation reactions found here will be useful for developing techniques for elimination of phenolic endocrine disrupters from the environment. PMID:12105973

  13. Elucidating Polypharmacological Mechanisms of Polyphenols by Gene Module Profile Analysis

    PubMed Central

    Li, Bin; Xiong, Min; Zhang, Hong-Yu


    Due to the diverse medicinal effects, polyphenols are among the most intensively studied natural products. However, it is a great challenge to elucidate the polypharmacological mechanisms of polyphenols. To address this challenge, we establish a method for identifying multiple targets of chemical agents through analyzing the module profiles of gene expression upon chemical treatments. By using FABIA algorithm, we have performed a biclustering analysis of gene expression profiles derived from Connectivity Map (cMap), and clustered the profiles into 49 gene modules. This allowed us to define a 49 dimensional binary vector to characterize the gene module profiles, by which we can compare the expression profiles for each pair of chemical agents with Tanimoto coefficient. For the agent pairs with similar gene expression profiles, we can predict the target of one agent from the other. Drug target enrichment analysis indicated that this method is efficient to predict the multiple targets of chemical agents. By using this method, we identify 148 targets for 20 polyphenols derived from cMap. A large part of the targets are validated by experimental observations. The results show that the medicinal effects of polyphenols are far beyond their well-known antioxidant activities. This method is also applicable to dissect the polypharmacology of other natural products. PMID:24968267

  14. Elucidating polypharmacological mechanisms of polyphenols by gene module profile analysis.


    Li, Bin; Xiong, Min; Zhang, Hong-Yu


    Due to the diverse medicinal effects, polyphenols are among the most intensively studied natural products. However, it is a great challenge to elucidate the polypharmacological mechanisms of polyphenols. To address this challenge, we establish a method for identifying multiple targets of chemical agents through analyzing the module profiles of gene expression upon chemical treatments. By using FABIA algorithm, we have performed a biclustering analysis of gene expression profiles derived from Connectivity Map (cMap), and clustered the profiles into 49 gene modules. This allowed us to define a 49 dimensional binary vector to characterize the gene module profiles, by which we can compare the expression profiles for each pair of chemical agents with Tanimoto coefficient. For the agent pairs with similar gene expression profiles, we can predict the target of one agent from the other. Drug target enrichment analysis indicated that this method is efficient to predict the multiple targets of chemical agents. By using this method, we identify 148 targets for 20 polyphenols derived from cMap. A large part of the targets are validated by experimental observations. The results show that the medicinal effects of polyphenols are far beyond their well-known antioxidant activities. This method is also applicable to dissect the polypharmacology of other natural products. PMID:24968267

  15. Cloning, Sequencing, Purification, and Crystal Structure of Grenache (Vitis vinifera) Polyphenol Oxidase

    SciTech Connect

    Virador, V.; Reyes Grajeda, J; Blanco-Labra, A; Mendiola-Olaya, E; Smith, G; Moreno, A; Whitaker, J


    The full-length cDNA sequence (P93622{_}VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C2221. The structure was obtained at 2.2 {angstrom} resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and {alpha}, {beta}, and {gamma}) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

  16. Ultrasound-assisted three-phase partitioning of polyphenol oxidase from potato peel (Solanum tuberosum).


    Niphadkar, Sonali S; Rathod, Virendra K


    Conventional three phase partitioning (TPP) and ultrasound assisted three phase partitioning (UATPP) were optimized for achieving the maximum extraction and purification of polyphenol oxidase (PPO) from waste potato peels. Different process parameters such as ammonium sulfate (NH4)2SO4 concentration, crude extract to t-butanol ratio, time, temperature and pH were studied for conventional TPP. Except agitation speed, the similar parameters were also optimized for UATPP. Further additional parameters were also studied for UATPP viz. irradiation time at different frequencies, duty cycle and, rated power in order to obtain the maximum purification factor and recovery of PPO. The optimized conditions for conventional TPP were (NH4)2SO4 0-40% (w/v), extract to t-butanol ratio 1:1 (v/v), time 40 min and pH 7 at 30°C. These conditions provided 6.3 purification factor and 70% recovery of PPO from bottom phase. On the other hand, UATPP gives maximum purification fold of 19.7 with 98.3% recovery under optimized parameters which includes (NH4)2SO4 0-40% (w/v), crude extract to t-butanol ratio 1: 1 (v/v) pH 7, irradiation time 5 min with 25 kHz, duty cycle 40% and rated power 150W at 30°C. UATPP delivers higher purification factor and % recovery of PPO along with reduced operation time from 40 min to 5 min when compared with TPP. SDS PAGE showed partial purification of PPO enzyme with UATPP with molecular weight in the range of 26-36 kDa. Results reveal that UATPP would be an attractive option for the isolation and purification of PPO without need of multiple steps. PMID:26139472

  17. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.


    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano


    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  18. Development and validation of MRM methods to quantify protein isoforms of polyphenol oxidase in loquat fruits.


    Martínez-Márquez, Ascensión; Morante-Carriel, Jaime; Sellés-Marchart, Susana; Martínez-Esteso, María José; Pineda-Lucas, José Luis; Luque, Ignacio; Bru-Martínez, Roque


    Multiple reaction monitoring (MRM) is emerging as a promising technique for the detection and quantification of protein biomarkers in complex biological samples. Compared to Western blotting or enzyme assays, its high sensitivity, specificity, accuracy, assay speed, and sample throughput represent a clear advantage for being the approach of choice for the analysis of proteins. MRM assays are capable of detecting and quantifying proteolytic peptides differing in mass unique to particular proteins, that is, proteotypic peptides, through which different protein isoforms can be distinguished. We have focused on polyphenol oxidase (PPO), a plant conspicuous enzyme encoded by a multigenic family in loquat (Eriobotrya japonica Lindl.) and other related species. PPO is responsible for both the protection of plants from biotic stress as a feeding deterrent for herbivore insects and the enzymatic browning of fruits and vegetables. The latter makes fruit more attractive to seed dispersal agents but is also a major cause of important economic losses in agriculture and food industry. An adequate management of PPO at plant breeding level would maximize the benefits and minimize the disadvantages of this enzyme, but it would require a precise knowledge of the biological role played by each isoform in the plant. Thus, for the functional study of the PPOs, we have cloned and overexpressed fragments of three PPO isoforms from loquat to develop MRM-based methods for the quantification of each isoform. The method was developed using an ion trap instrument and validated in a QQQ instrument. It resulted in the selection of at least two peptides for each isoform that can be monitored by at least three transitions. A combination of SDS-PAGE and MRM lead to detect two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. The method was applied to determine the amount of the PPO2 isoform in protein extracts from fruit samples using

  19. Polyphenol oxidase in leaves: is there any significance to the chloroplastic localization?


    Boeckx, Tinne; Winters, Ana L; Webb, K Judith; Kingston-Smith, Alison H


    Polyphenol oxidase (PPO) catalyses the oxidation of monophenols and/or o-diphenols to o-quinones with the concomitant reduction of oxygen to water which results in protein complexing and the formation of brown melanin pigments. The most frequently suggested role for PPO in plants has been in defence against herbivores and pathogens, based on the physical separation of the chloroplast-localized enzyme from the vacuole-localized substrates. The o-quinone-protein complexes, formed as a consequence of cell damage, may reduce the nutritional value of the tissue and thereby reduce predation but can also participate in the formation of structural barriers against invading pathogens. However, since a sufficient level of compartmentation-based regulation could be accomplished if PPO was targeted to the cytosol, the benefit derived by some plant species in having PPO present in the chloroplast lumen remains an intriguing question. So is there more to the chloroplastic location of PPO? An interaction between PPO activity and photosynthesis has been proposed on more than one occasion but, to date, evidence either for or against direct involvement has been equivocal, and the lack of identified chloroplastic substrates remains an issue. Similarly, PPO has been suggested to have both pro- and anti-oxidant functions. Nevertheless, several independent lines of evidence suggest that PPO responds to environmental conditions and could be involved in the response of plants to abiotic stress. This review highlights our current understanding of the in vivo functions of PPO and considers the potential opportunities it presents for exploitation to increase stress tolerance in food crops. PMID:25873687

  20. Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.


    Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R


    The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed. PMID:20039636

  1. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: A non-animal model for neurochemical studies

    SciTech Connect

    Henderson, H.M.; Eskin, N.A.M.; Pinsky, C.; Bose, R.; Ashique, A.M. )


    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the 'Perov mixture' of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research.

  2. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: a non-animal model for neurochemical studies.


    Henderson, H M; Eskin, N A; Pinsky, C; Bose, R; Ashique, A M


    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the "Perov mixture" of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research. PMID:1435072

  3. Synthesis and theoretical calculations of carbazole substituted chalcone urea derivatives and studies their polyphenol oxidase enzyme activity.


    Nixha, Arleta Rifati; Arslan, Mustafa; Atalay, Yusuf; Gençer, Nahit; Ergün, Adem; Arslan, Oktay


    Synthesis of carbazole substituted chalcone urea derivatives and their polyphenol oxidase enzyme activity effects on the diphenolase activity of banana tyrosinase were evaluated. Tyrosinase has been purified from banana on an affinity gel comprised of Sepharose 4B-L-tyrosine-p-aminobenzoic acid. The results showed that most of the compounds (3,4,5a,5d-h) inhibited and some of them (5c,5i-l) activated the tyrosinase enzyme activity. The molecular calculations were performed using Gaussian software for the synthesized compounds to explain the experimental results. PMID:22803668

  4. Chcanges in Germinability and Activities of Polyphenol Oxidase and Peroxidase in Seeds of Pentaclethramacrophylla During Lowtemperature Treatment

    NASA Astrophysics Data System (ADS)

    Udosen, I. R.; Nkang, A. E.; Sam, S. M.


    Activities of peroxidase (POD) and polyphenol Oxidase (PPO) were investigated in seeds of Pentaclethramacrophylla during low temperature treatment. The seeds from the small-sized fruits (variety A) and those of the big-sized fruits (variety B) showed high germination, with maximum germination values ranging between 60 ñ 90%. Low temperature treatment did not significantly (P< 0.5) affect maximum germination values. Activities of POD and PPO increased initially (2-4 days) but declined with prolonged (6ñ8 days) low temperature treatment.

  5. Decolorization and removal of textile and non-textile dyes from polluted wastewater and dyeing effluent by using potato (Solanum tuberosum) soluble and immobilized polyphenol oxidase.


    Khan, Amjad Ali; Husain, Qayyum


    Celite bound potato polyphenol oxidase preparation was employed for the treatment of wastewater/dye effluent contaminated with reactive textile and non-textile dyes, Reactive Blue 4 and Reactive Orange 86. The maximum decolorization was found at pH 3.0 and 4.0 in case of Reactive Blue 4 and Reactive Orange 86, respectively. Immobilized potato polyphenol oxidase was significantly more effective in decolorizing the individual dye and complex mixtures of dyes as compared to soluble enzyme. The absorption spectra of the treated and untreated dye mixture and dyeing effluent exhibited a marked difference in the absorption value at various wavelengths. The polluted water contaminated with an individual dye or mixtures of dyes treated with soluble and immobilized potato polyphenol oxidase resulted in the remarkable loss in total organic carbon. PMID:16765044

  6. [Effect of abiotic elicitation on the sanguinarine production and polyphenol oxidase activity in the suspension culture of Eschscholtzia californica CHAM].


    Bilka, František; Balážová, Andrea; Bilková, Andrea; Holková, Ivana


    Elicitation of plant in vitro cultures represents a biotechnological tool to improve the production of secondary metabolites. In this study, the effect of AgNO3 and CdCl2 on the sanguinarine production by the suspension culture of Eschscholtzia californica CHAM. was investigated. Elicitors were added to the cultures at the 14th day of subcultivation and their effect on the sanguinarine production was evaluated after a 48 h exposure. AgNO3 at the concentration of 0.075 mmol.l-1 and CdCl2 at the concentration of 4 mmol.l-1 induced a ca. 5.2- and 5.6-multiple increase in sanguinarine synthesis, respectively. This amount represents probably the maximal production, because a further increase in the elicitors concentrations did not increase sanguinarine production. Both abiotic elicitors induced a polyphenol oxidase specific activity increase. Polyphenol oxidase is probably involved in the biosynthesis of sanguinarine at the level of dopamine formation. Dopamine is a precursor of (S)-norcoclaurine, the first intermediate with the benzylisoquinoline structure. PMID:24047145


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme, polyphenol oxidase (PPO), reduces the extent of proteolysis and lipolysis within red clover fed to ruminants with subsequent increases in the efficiency of N utilization and the level of beneficial polyunsaturated fatty acids in their products (meat and milk). It has also been reported t...

  8. Auto-Oxidation of Ortho-Diphenolic Substrate and Deactivation of Polyphenol Oxidases (Catecholase) During Wilting and Post Harvest Damage in Red Clover

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidases (PPO) in red clover convert diphenolic substrate to highly reactive quinones which, through their reaction with proteins, increase the efficiency of N utilization and increase the proportion of beneficial polyunsaturated fatty acids in bovine products (meat and milk). Auto-oxidat...

  9. Extraction of rice bran extract and some factors affecting its inhibition of polyphenol oxidase activity and browning in potato.


    Boonsiripiphat, Kunnikar; Theerakulkait, Chockchai


    The extraction conditions of rice bran extract (RBE), including extraction ratio, extraction time, and extraction temperature, were studied in relation to enzymatic browning inhibition in potato. The inhibitory effect of RBE on potato polyphenol oxidase (PPO) activity and its total phenolic compound content were highest at an extraction ratio of 1:3 (rice bran:water, w/v), extraction time of 30 min, and extraction temperature of 40 degrees C. RBE showed the most inhibitory effect on PPO activity at pH 6.5. However, the inhibitory effect of RBE on potato PPO activity and its total phenolic compound content were decreased at the higher temperature and longer time. PMID:19291577

  10. Two-year comparison of the biochemical properties of polyphenol oxidase from Turkish Alyanak apricot (Prunus armenica L.).


    Ünal, M Ümit; Şener, Aysun


    Polyphenol oxidase (PPO) was extracted and purified from Turkish Alyanak apricot variety and its characteristics were studied in two consecutive years (2008 and 2009). Three isoenzymes (isoenzyme A1, A2 and B) were obtained upon ammonium sulfate fractionation, ion exchange chromatography using DEAE-Toyopearl 650 M and gel filtration chromatography using Sephadex G-100. The isoenzymes exhibited different kinetic properties. Furthermore, year-to-year variability in Km and Vmax values was significant. The pH optimum for enzyme activity was 4.98 for isoenzymes A1 and A2, and 5.8 for isoenzyme B. The isoenzymes A1 and B had optimum temperature at 30 °C in both years whereas isoenzyme A2 had maximum activity at 40 °C in 2008 and 30 °C in 2009. The inactivation kinetics parameters and the effects of inhibitors tested exhibited significant year-to-year variation. PMID:26213033

  11. Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue

    SciTech Connect

    Siriphanich, J.; Kader, A.A.


    An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

  12. Tea polyphenols alleviate high fat and high glucose-induced endothelial hyperpermeability by attenuating ROS production via NADPH oxidase pathway

    PubMed Central


    Background Hyperglycemia-induced endothelial hyperpermeability is crucial to cardiovascular disorders and macro-vascular complications in diabetes mellitus. The objective of this study is to investigate the effects of green tea polyphenols (GTPs) on endothelial hyperpermeability and the role of nicotinamide adenine dinucleotide phosphate (NADPH) pathway. Methods Male Wistar rats fed on a high fat diet (HF) were treated with GTPs (0, 0.8, 1.6, 3.2 g/L in drinking water) for 26 weeks. Bovine aortic endothelial cells (BAECs) were treated with high glucose (HG, 33 mmol/L) and GTPs (0.0, 0.4, or 4 μg/mL) for 24 hours in vitro. The endothelial permeabilities in rat aorta and monolayer BAECs were measured by Evans blue injection method and efflux of fluorescein isothiocyanate (FITC)-dextran, respectively. The reactive oxygen species (ROS) levels in rat aorta and monolayer BAECs were measured by dihydroethidium (DHE) and 2′, 7′-dichloro-fluorescein diacetate (DCFH-DA) fluorescent probe, respectively. Protein levels of NADPH oxidase subunits were determined by Western-blot. Results HF diet-fed increased the endothelial permeability and ROS levels in rat aorta while HG treatments increased the endothelial permeability and ROS levels in cultured BAECs. Co-treatment with GTPs alleviated those changes both in vivo and in vitro. In in vitro studies, GTPs treatments protected against the HG-induced over-expressions of p22phox and p67phox. Diphenylene iodonium chloride (DPI), an inhibitor of NADPH oxidase, alleviated the hyperpermeability induced by HG. Conclusions GTPs could alleviate endothelial hyperpermeabilities in HF diet-fed rat aorta and in HG treated BAECs. The decrease of ROS production resulting from down-regulation of NADPH oxidase contributed to the alleviation of endothelial hyperpermeability. PMID:24580748

  13. Independent Losses of Function in a Polyphenol Oxidase in Rice: Differentiation in Grain Discoloration between Subspecies and the Role of Positive Selection under Domestication[W

    PubMed Central

    Yu, Yanchun; Tang, Tian; Qian, Qian; Wang, Yonghong; Yan, Meixian; Zeng, Dali; Han, Bin; Wu, Chung-I; Shi, Suhua; Li, Jiayang


    Asian rice (Oryza sativa) cultivars originated from wild rice and can be divided into two subspecies by several criteria, one of which is the phenol reaction (PHR) phenotype. Grains of indica cultivars turn brown in a phenol solution that accelerates a similar process that occurs during prolonged storage. By contrast, the grains of japonica do not discolor. This distinction may reflect the divergent domestication of these two subspecies. The PHR is controlled by a single gene, Phr1; here, we report the cloning of Phr1, which encodes a polyphenol oxidase. The Phr1 gene is indeed responsible for the PHR phenotype, as transformation with a functional Phr1 can complement a PHR negative cultivar. Phr1 is defective in all japonica lines but functional in nearly all indica and wild strains. Phylogenetic analysis showed that the defects in Phr1 arose independently three times. The multiple recent origins and rapid spread of phr1 in japonica suggest the action of positive selection, which is further supported by several population genetic tests. This case may hence represent an example of artificial selection driving the differentiation among domesticated varieties. PMID:19033526

  14. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.


    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N


    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  15. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )


    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  16. Comparison of content in phenolic compounds, polyphenol oxidase, and peroxidase in grains of fifty sorghum varieties from burkina faso.


    Dicko, Mamoudou H; Hilhorst, Riet; Gruppen, Harry; Traore, Alfred S; Laane, Colja; van Berkel, Willem J H; Voragen, Alphons G J


    Analysis of fifty sorghum [Sorghum bicolor (L.) Moench] varieties used in Burkina Faso showed that they have different contents of phenolic compounds, peroxidase (POX), and polyphenol oxidase (PPO). Most of the varieties (82%) had a tannin content less than 0.25% (w/w). POX specific activity was higher than the monophenolase and o-diphenolase specific activities of PPO. For POX, there was a diversity of isoforms among varieties. No clear correlation could be made between the quantitative composition of the grain in phenolics, PPO, and POX, and resistance of plant to pathogens. In general, varieties good for a thick porridge preparation ("tô") had low phenolic compounds content and a medium POX activity. From the red varieties, those used for local beer ("dolo") had a high content in phenolic compounds and PPO, and a low POX activity. The variety considered good for couscous had a low POX content. The characteristics might be useful as selection markers for breeding for specific applications. PMID:12059160

  17. Toward an understanding of mechanisms involved in non-polyphenol oxidase (Non-PPO) darkening in yellow alkaline noodles (YAN).


    Asenstorfer, Robert E; Appelbee, Marie J; Kusznir, Christine A; Mares, Daryl J


    Asian noodles prepared from bread wheat flour darken over time due to a combination of polyphenol oxidase (PPO) activity and non-PPO effects. Although the enzymatic mechanism associated with the PPO reaction is well established, the non-PPO component consists of both physical (e.g., changes in surface properties) and chemical reactions. Variations in pH and solvents were used to gain a quantitative estimate of the contribution of physical and chemical components to non-PPO darkening in yellow alkaline noodles (YAN). In a set of five common high-PPO Australian wheat cultivars it was estimated that on average non-PPO darkening accounted for 69% of total darkening, with approximately two-thirds of this due to physical darkening and one-third had a chemical origin. Data from the chemical portion of non-PPO darkening is consistent with the presence of a PPO-like enzyme that oxidizes tyrosine, has a pH maximum of 8.1, and is inhibited by 50% methanol or ethanol but in the noodle is insensitive to PPO inhibitors such as tropolone. Therefore, with low-PPO and PPO-free wheat varieties becoming available, it may be possible to further reduce darkening in YAN by breeding for wheat varieties with low or zero levels of this PPO-like enzyme. PMID:24784975

  18. Structural Diversity in the Dandelion (Taraxacum officinale) Polyphenol Oxidase Family Results in Different Responses to Model Substrates

    PubMed Central

    Dirks-Hofmeister, Mareike E.; Singh, Ratna; Leufken, Christine M.; Inlow, Jennifer K.; Moerschbacher, Bruno M.


    Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure–function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a “selector” for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates. PMID:24918587

  19. Characterization of polyphenol oxidase from the Manzanilla cultivar (Olea europaea pomiformis) and prevention of browning reactions in bruised olive fruits.


    Segovia-Bravo, Kharla A; Jarén-Galan, Manuel; García-García, Pedro; Garrido-Fernandez, Antonio


    The crude extract of the polyphenol oxidase (PPO) enzyme from the Manzanilla cultivar (Olea europaea pomiformis) was obtained, and its properties were characterized. The browning reaction followed a zero-order kinetic model. Its maximum activity was at pH 6.0. This activity was completely inhibited at a pH below 3.0 regardless of temperature; however, in alkaline conditions, pH inhibition depended on temperature and was observed at values above 9.0 and 11.0 at 8 and 25 degrees C, respectively. The thermodynamic parameters of substrate oxidation depended on pH within the range in which activity was observed. The reaction occurred according to an isokinetic system because pH affected the enzymatic reaction rate but not the energy required to carry out the reaction. In the alkaline pH region, browning was due to a combination of enzymatic and nonenzymatic reactions that occurred in parallel. These results correlated well with the browning behavior observed in intentionally bruised fruits at different temperatures and in different storage solutions. The use of a low temperature ( approximately 8 degrees C) was very effective for preventing browning regardless of the cover solution used. PMID:17628073

  20. The effect of ultrasound on particle size, color, viscosity and polyphenol oxidase activity of diluted avocado puree.


    Bi, Xiufang; Hemar, Yacine; Balaban, Murat O; Liao, Xiaojun


    The effect of ultrasound treatment on particle size, color, viscosity, polyphenol oxidase (PPO) activity and microstructure in diluted avocado puree was investigated. The treatments were carried out at 20 kHz (375 W/cm(2)) for 0-10 min. The surface mean diameter (D[3,2]) was reduced to 13.44 μm from an original value of 52.31 μm by ultrasound after 1 min. A higher L(∗) value, ΔE value and lower a(∗) value was observed in ultrasound treated samples. The avocado puree dilution followed pseudoplastic flow behavior, and the viscosity of diluted avocado puree (at 100 s(-1)) after ultrasound treatment for 1 min was 6.0 and 74.4 times higher than the control samples for dilution levels of 1:2 and 1:9, respectively. PPO activity greatly increased under all treatment conditions. A maximum increase of 25.1%, 36.9% and 187.8% in PPO activity was found in samples with dilution ratios of 1:2, 1:5 and 1:9, respectively. The increase in viscosity and measured PPO activity might be related to the decrease in particle size. The microscopy images further confirmed that ultrasound treatment induced disruption of avocado puree structure. PMID:25899308

  1. Comparison of some biochemical properties of artichoke polyphenol oxidase entrapped in alginate-carrageenan and alginate gels.


    Yagar, Hulya; Kocaturk, Selin


    Polyphenol oxidase (PPO, EC. isolated from artichoke (Cynara scolymus) was entrapped within alginate and alginate+ carrageenan beads, and the catecholase and cresolase activities of both entrapped enzymes were determined. Some properties of these immobilized enzymes such as optimum pH and temperature, kinetic parameters (Km and Vmax), thermal, and storage stability were determined and compared to each other. The highest catecholase activity was observed in alginate gel (370 U/g bead) while the highest cresolase activity was in alginate+ carrageenan gel (90 U/g bead). For catecholase and cresolase activities, optimum pHs of alginate and alginate+ carrageenan beads were determined to be 7.0 and 4.0, respectively. Optimum temperatures for catecholase activity were determined to be 40°C for both entrapped enzymes. These values for cresolase activity were 30°C and 20°C, respectively. Immobilized artichoke PPOs greatly preserved their thermal stability which exists anyway. The catalytic efficiency value (Vmax/Km) of the alginate beads is approximately high as two-and-a-half folds of that of alginate+κ-carrageenan beads for cresolase activity. These values were very close for catecholase activity. Immobilized beads saved their both activities after 30 days of storage at 4°C. PMID:23795723

  2. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette


    Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P212121 and P1211 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3121. The crystals of latent cgAUS1 belonged to space group P1211 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na6[TeW6O24] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI). PMID:26057806

  3. Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice

    NASA Astrophysics Data System (ADS)

    Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo


    Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period.

  4. The conformational state of polyphenol oxidase from field bean (Dolichos lablab) upon SDS and acid-pH activation.


    Kanade, Santosh R; Paul, Beena; Rao, A G Appu; Gowda, Lalitha R


    Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase)--a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen--and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1+/-2 to 75.9+/-0.6 A (1 A=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141

  5. Screening, separating, and completely recovering polyphenol oxidases and other biochemicals from sweet potato wastewater in starch production.


    Cheng, Shi; Zhang, Yi-Feng; Zeng, Zhao-Qin; Lin, Jia; Zhang, Ya-Wen; Ni, He; Li, Hai-Hang


    Polyphenol oxidase (PPO) has multiple functions, and the lack of commercially available enzyme sources limits its widespread application in various industries. An accurate PPO assay was developed by HPLC determination of the substrate oxidation. Resources screening indicated that sweet potato (Ipomoea batatas L.) wastewater in starch production has high PPO activity. A procedure was developed for separately recovering PPO, β-amylase, sporamins, and small molecular nutrients (SMNs) from sweet potato wastewater. The wastewater was adjusted to pH 3.5 to precipitate PPO, and then adjusted to 50 % acetone to precipitate β-amylase and further to 80 % acetone to precipitate sporamins. The SMNs were obtained after acetone recovery. Purified powders of 4.3 × 10(5) units of PPO, 4.0 × 10(6) units of β-amylase, 8.70 g sporamins, and 20.2 g SMNs were obtained from the wastewater of 1 kg sweet potato. More than 50 million tons of sweet potato is used for starch production annually around the world. Through this simple procedure, huge amount of biochemical resources can be recovered from the wastewater, which greatly increases the economic value of the crop and saves the environment. PMID:25190667

  6. Concentration dependent effects of commonly used pesticides on activation versus inhibition of the quince (Cydonia Oblonga) polyphenol oxidase.


    Fattouch, Sami; Raboudi-Fattouch, Faten; Ponce, José Vicente Gil; Forment, Josep Vicent; Lukovic, Dunja; Marzouki, Nejib; Vidal, Daniel Ramón


    Polyphenol oxidase (PPO) catalyzes the oxidation of o-diphenols to their respective quinones which undergo autopolymerization and form dark pigments. The interaction of PPO with various substrates and effectors remains the focus of intensive investigations due to the enzyme's key role in pigments biosynthesis including animal melanogenesis and fruit/fungi enzymatic browning. In this study, the effect of a range of commonly used pesticides on the enzyme activity has been evaluated using the purified quince (Cydonia oblonga Miller) PPO. The biochemical analysis showed that, in the presence of high pesticide concentrations, the enzyme was competitively inhibited, particularly with benomyl, carbaryl, deltamethrine and parathion methyl for which inhibition constants (K(i)) were 8.3, 5.7, 12 and 4 microM, respectively. At lower pesticide concentrations (2-10 microM), however, the catecholase activity was significantly activated (p<0.01), suggesting a homotropic behavior of these chemical compounds. Furthermore, the use of in silico structure-based analyses, known as computational docking, highlighted the nature of the PPO-pesticides interactions and confirmed the in vitro observations. Catechol substrate and parathion methyl inhibitor showed lower total energy scores of -120.06 and -117.4 3 kcal mol(-1), indicating that these ligands had higher PPO-binding affinities. The obtained data bring to light new pesticide functional features of great interest in the medicinal, agro-chemical and environmental circles. PMID:20060877

  7. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central


    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  8. Four novel mutations of the coproporphyrinogen III oxidase gene.


    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G


    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  9. Physical-chemical analysis of non-polyphenol oxidase (non-PPO) darkening in yellow alkaline noodles.


    Asenstorfer, Robert E; Appelbee, Marie J; Mares, Daryl J


    Darkening in yellow alkaline noodles (YAN) was measured over 24 h in a high polyphenol oxidase (PPO) bread wheat ( Triticum aestivum L. cv. Tasman) and a very low PPO durum wheat ( Triticum durum cv. Kamilaroi). Over 24 h non-PPO darkening occurred across a range of pH 3.5-10.5, and in Tasman this was overlaid by darkening from PPO activity. The rate of darkening in YAN was separated into two main time periods, 0-4 and 4-24 h. The first 4 h of darkening was further divided into two stages using a composite first-order rate equation. Several specific inhibitors that partially inhibited non-PPO darkening were identified. These inhibitors, as well as the PPO inhibitors SHAM and tropolone, were used to analyze YAN darkening. The rate of the early stage of darkening was not altered by any inhibitors used; however, the magnitude of darkening was reduced by inhibitors specific for non-PPO darkening. Both the rate and extent of non-PPO darkening of the second stage of darkening were decreased in Tasman and Kamilaroi by inhibitors specific for non-PPO darkening, whereas both PPO inhibitors only decreased darkening in Tasman. The second and third stages of darkening showed similar characteristics. The third stage of darkening was examined in YAN made from Kamilaroi over a temperature range from -4 to 65 degrees C. It followed an Arrhenius relationship indicating non-PPO darkening during this stage was nonenzymatic. The inhibitor data suggested that the reactive component(s) was/were present in a reasonably high concentration(s) and that the soluble protein fraction was involved in the non-PPO darkening process. PMID:19469560

  10. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    SciTech Connect

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette


    Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)

  11. The conformational state of polyphenol oxidase from field bean (Dolichos lablab) upon SDS and acid-pH activation

    PubMed Central

    Kanade, Santosh R.; Paul, Beena; Rao, A. G. Appu; Gowda, Lalitha R.


    Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase) – a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen – and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1±2 to 75.9±0.6 Å (1 Å=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141

  12. Characterization of two brassinosteroid C-6 oxidase genes in pea.


    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B


    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  13. Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection

    PubMed Central

    Tejeda, Leslie; Alvarado, Juan Antonio; Dębiec, Magdalena; Peñarrieta, José Mauricio; Cárdenas, Oscar; Alvarez, Maria Teresa; Chawade, Aakash; Nilsson, Lars; Bergenståhl, Björn


    The objective of this study was to evaluate total antioxidant capacity (TAC), total phenolic content (TPH), and the identification of anthocyanidin and polyphenolic compounds in 13 colored potatoes collected from the Andean region of Bolivia, and understand how the chemical composition correlated with the botanical classification and molecular characterization of genes, ans (anthocyanidin synthase) and stan1 (Solanum tuberosum anthocyanidin synthase), associated with the synthesis of anthocyanidins. The results show the existence of a limited correlation between botanical classification, based on morphological identification and polyphenol composition. No association between genetic grouping of the ans and stan genes and botanical classification was found. However, it was possible to identify a correlation between the ans gene clades and the levels of anthocyanidins as well as of other polyphenols. Thus, this result confirms the concept that potato color can be used in the search for high polyphenol potato cultivars. PMID:24804064

  14. Novel Roles for the Polyphenol Oxidase Enzyme in Secondary Metabolism and the Regulation of Cell Death in Walnut1[W][OPEN

    PubMed Central

    Araji, Soha; Grammer, Theresa A.; Gertzen, Ross; Anderson, Stephen D.; Mikulic-Petkovsek, Maja; Veberic, Robert; Phu, My L.; Solar, Anita; Leslie, Charles A.; Dandekar, Abhaya M.; Escobar, Matthew A.


    The enzyme polyphenol oxidase (PPO) catalyzes the oxidation of phenolic compounds into highly reactive quinones. Polymerization of PPO-derived quinones causes the postharvest browning of cut or bruised fruit, but the native physiological functions of PPOs in undamaged, intact plant cells are not well understood. Walnut (Juglans regia) produces a rich array of phenolic compounds and possesses a single PPO enzyme, rendering it an ideal model to study PPO. We generated a series of PPO-silenced transgenic walnut lines that display less than 5% of wild-type PPO activity. Strikingly, the PPO-silenced plants developed spontaneous necrotic lesions on their leaves in the absence of pathogen challenge (i.e. a lesion mimic phenotype). To gain a clearer perspective on the potential functions of PPO and its possible connection to cell death, we compared the leaf transcriptomes and metabolomes of wild-type and PPO-silenced plants. Silencing of PPO caused major alterations in the metabolism of phenolic compounds and their derivatives (e.g. coumaric acid and catechin) and in the expression of phenylpropanoid pathway genes. Several observed metabolic changes point to a direct role for PPO in the metabolism of tyrosine and in the biosynthesis of the hydroxycoumarin esculetin in vivo. In addition, PPO-silenced plants displayed massive (9-fold) increases in the tyrosine-derived metabolite tyramine, whose exogenous application elicits cell death in walnut and several other plant species. Overall, these results suggest that PPO plays a novel and fundamental role in secondary metabolism and acts as an indirect regulator of cell death in walnut. PMID:24449710

  15. Glutathione and cinnamic acid: natural dietary components used in preventing the process of browning by inhibition of Polyphenol Oxidase in apple juice.


    Gacche, R N; Warangkar, S C; Ghole, V S


    Consumer demands for 'freshness' in processed foods has been given increasing attention by food processing industries by searching for minimally processed products. Polyphenol Oxidase (PPO) mediated browning is a major cause of undesirable flavors and nutritional losses in fruit juices. Here the anti-browning efficiency of glutathione (GSH, reduced form) and cinnamic acid (CA) in apple juice is evaluated. It was observed that the rate of the browning reaction could be efficiently delayed using GSH and CA, which act as inhibitors of PPO. Kinetic studies confirm that GSH and CA are non-competitive and competitive inhibitors of PPO respectively. PMID:15449733

  16. Kinetics of inhibition of polyphenol oxidase mediated browning in apple juice by beta-cyclodextrin and L-ascorbate-2-triphosphate.


    Gacche, R N; Zore, G B; Ghole, V S


    Polyphenol Oxidase (PPO) mediated browning in raw fruits and vegetables is a major cause of quality deterioration in fruits and vegetables and derived food products. Here the rate of browning reaction in apple juice treated individually and in combination (1:1) of beta-Cyclodextrin (beta-CD) and L-Ascorbate-2-triphosphate (L-AATP) is described. It was observed that the rate of quinone formation can be minimized using a combination of beta-CD and L-AATP as compared to individual treatment with these agents. Kinetic experiments revealed that both compounds are non-competitive inhibitors of PPO. PMID:12751814

  17. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.


    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming


    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-α-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

  18. Evolution of the primate cytochrome c oxidase subunit II gene.


    Adkins, R M; Honeycutt, R L


    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  19. Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

  20. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation

    PubMed Central

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D. P.


    Monoamine oxidase A gene (MAOA) has earned the nickname “warrior gene” because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as “altruistic” punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  1. Polyphenol Oxidase Containing Sidestreams as Emulsifiers of Rumen Bypass Linseed Oil Emulsions: Interfacial Characterization and Efficacy of Protection against in Vitro Ruminal Biohydrogenation.


    Gadeyne, Frederik; De Neve, Nympha; Vlaeminck, Bruno; Claeys, Erik; Van der Meeren, Paul; Fievez, Veerle


    The low transfer in ruminants of dietary polyunsaturated fatty acids to the milk or peripheral tissues is largely due to ruminal biohydrogenation. Lipids emulsified by a polyphenol oxidase (PPO) rich protein extract of red clover were shown before to be protected against this breakdown after cross-linking with 4-methylcatechol. Protein extracts of 13 other vegetal resources were tested. Surprisingly, the effectiveness to protect emulsified lipids against in vitro ruminal biohydrogenation largely depended on the origin of the extract and its protein concentration but was not related to PPO activity. Moreover, PPO isoforms in vegetal sources, effectively protecting emulsified lipids, were diverse and their presence at the emulsion interface did not seem essential. Potato tuber peels were identified as an interesting biological source of emulsifying proteins and PPO, particularly since protein extracts of industrial potato sidestreams proved to be suitable for the current application. PMID:27111580

  2. Inhibition of potato polyphenol oxidase by anions and activity in various carboxylate buffers (pH 4.8) at constant ionic strength.


    Malkin, B D; Thickman, K R; Markworth, C J; Wilcox, D E; Kull, F J


    The activity of potato polyphenol oxidase (tyrosinase) toward DL-3,4-dihydroxyphenylalanine (K(M) 5.39 mM) was studied using a variety of carboxylate buffers at a common pH and ionic strength. Enzyme activity, greatest in citrate and least in oxalate, correlated with increasing carboxyl concentration and molecular mass. The lower activity in oxalate was attributed to more effective chelation of a copper(II) form of the enzyme by the oxalate dianion. Sodium halide salts inhibited the enzyme. Although there was little difference in inhibition between sodium and potassium salts, the degree and type of inhibition was anion dependent; K(is), values for NaCl and KCl, (competitive inhibitors) were 1.82 and 1.62 mM, whereas Na(2) SO(4) and K(2) SO(4) (mixed inhibitors) had K(is) and K(ii) values in the 250 to 450 mM range. PMID:11342282

  3. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.


    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai


    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ⩽ 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. PMID:26213057

  4. Differences in the activity of superoxide dismutase, polyphenol oxidase and Cu-Zn content in the fruits of Gordal and Manzanilla olive varieties.


    Hornero-Méndez, Dámaso; Gallardo-Guerrero, Lourdes; Jarén-Galán, Manuel; Mínguez-Mosquera, María Isabel


    Activity of the enzymes superoxide dismutase (SOD) and polyphenol oxidase (PPO) as well as Cu-Zn content have been monitored during the thirteen weeks growth of both Gordal and Manzanilla olive variety fruits. These metalloenzymes, with Cu and Zn in the prostetic group, are involved in controlling the redox balance in the chloroplast environment. The results indicated that, under similar phenological and environmental conditions, there are periodic peaks of SOD activity in both varieties, followed by fluctuations in the copper content of the fruit. This was interpreted as a common and simultaneous response to situations of oxidative stress, and this response was more intense in the variety Gordal. The enzyme PPO showed an activity peak at start of growth and then practically disappeared. Thus, its activity cannot be correlated with situations of stress or with changes of Cu and Zn in the fruit. PMID:11926522

  5. Association mapping of grain hardness, polyphenol oxidase, total phenolics, amylose content, and ß-glucan in US barley breeding germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A renewed interest in breeding barley specifically for food end-uses is being driven by increased consumer interest in healthier foods. We conducted association mapping on physicochemical properties of barley that play a role in food quality and processing including, grain hardness, polyphenol oxid...

  6. An ACC Oxidase Gene Essential for Cucumber Carpel Development.


    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen


    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  7. Effect of thermal treatment on secondary structure and conformational change of mushroom polyphenol oxidase (PPO) as food quality related enzyme: A FTIR study.


    Baltacıoğlu, Hande; Bayındırlı, Alev; Severcan, Mete; Severcan, Feride


    In order to understand the conformational changes of polyphenol oxidase (PPO), which is a food quality related enzyme, after thermal treatment, secondary structure changes of the enzyme were analyzed by using Fourier Transform Infrared (FTIR) spectroscopy and compared with the change in enzyme activity in the temperature range of 25-80 °C. Fourier self-deconvolution, neural network (NN) and curve-fitting analysis were applied to the amide I band of FTIR spectra for detail analysis of secondary structure elements. FTIR analysis indicated that PPO is an α-helix dominating enzyme. Detail analysis revealed that, as temperature increased, α-helix and β-sheet decreased, but aggregated β-sheet, turns and random coil increased. The marked changes were noted at 40 °C with the occurrence of new bands due to aggregated β-sheet structures, all of which indicate protein denaturation. These aggregation bands were still observed when the temperature was reduced back to 25 °C, from 70 °C, demonstrating an irreversible change in the structure. PMID:25977025

  8. Impact of high pressure processing on color, bioactive compounds, polyphenol oxidase activity, and microbiological attributes of pumpkin purée.


    González-Cebrino, Francisco; Durán, Rocío; Delgado-Adámez, Jonathan; Contador, Rebeca; Bernabé, Rosario Ramírez


    Physicochemical parameters, bioactive compounds' content (carotenoids and total phenols), total antioxidant activity, and enzymatic activity of polyphenol oxidase (PPO) were evaluated after high pressure processing (HPP) on a pumpkin purée (cv. 'Butternut'). Three pressure levels (400, 500, and 600 MPa) were combined with three holding times (200, 400, and 600 s). The applied treatments reduced the levels of total aerobic mesophilic (TAM), total psychrophilic and psychrotrophic bacteria (TPP), and molds and yeasts (M&Y). All applied treatments did not affect enzymatic activity of PPO. Pressure level increased CIE L* values, which could enhance the lightness perception of high pressure (HP)-treated purées. No differences were found between the untreated and HP-treated purées regarding total phenols and carotenoids content (lutein, α-carotene, and β-carotene) and total antioxidant activity. HPP did not affect most quality parameters and maintained the levels of bioactive compounds. However, it did not achieve the complete inhibition of PPO, which could reduce the shelf-life of the pumpkin purée. PMID:26123635

  9. Enzyme characterisation, isolation and cDNA cloning of polyphenol oxidase in the hearts of palm of three commercially important species.


    Shimizu, Milton Massao; Melo, Geraldo Aclécio; Brombini Dos Santos, Adriana; Bottcher, Alexandra; Cesarino, Igor; Araújo, Pedro; Magalhães Silva Moura, Jullyana Cristina; Mazzafera, Paulo


    Heart of palm (palmito) is the edible part of the apical meristem of palms and is considered a gourmet vegetable. Palmitos from the palms Euterpe edulis (Juçara) and Euterpe oleracea (Açaí) oxidise after harvesting, whereas almost no oxidation is observed in palmitos from Bactris gasipaes (Pupunha). Previous investigations showed that oxidation in Juçara and Açaí was mainly attributable to polyphenol oxidase (PPO; EC activity. In this study, we partially purified PPOs from these three palmitos and analysed them for SDS activation, substrate specificity, inhibition by specific inhibitors, thermal stability, optimum pH and temperature conditions, Km and Ki. In addition, the total phenolic content and chlorogenic acid content were determined. Two partial cDNA sequences were isolated and sequenced from Açaí (EoPPO1) and Juçara (EePPO1). Semi-quantitative RT-PCR expression assays showed that Açaí and Juçara PPOs were strongly expressed in palmitos and weakly expressed in leaves. No amplification was observed for Pupunha samples. The lack of oxidation in the palmito Pupunha might be explained by the low PPO expression, low enzyme activity or the phenolic profile, particularly the low content of chlorogenic acid. PMID:21530289

  10. Real-time evaluation of polyphenol oxidase (PPO) activity in lychee pericarp based on weighted combination of spectral data and image features as determined by fuzzy neural network.


    Yang, Yi-Chao; Sun, Da-Wen; Wang, Nan-Nan; Xie, Anguo


    A novel method of using hyperspectral imaging technique with the weighted combination of spectral data and image features by fuzzy neural network (FNN) was proposed for real-time prediction of polyphenol oxidase (PPO) activity in lychee pericarp. Lychee images were obtained by a hyperspectral reflectance imaging system operating in the range of 400-1000nm. A support vector machine-recursive feature elimination (SVM-RFE) algorithm was applied to eliminating variables with no or little information for the prediction from all bands, resulting in a reduced set of optimal wavelengths. Spectral information at the optimal wavelengths and image color features were then used respectively to develop calibration models for the prediction of PPO in pericarp during storage, and the results of two models were compared. In order to improve the prediction accuracy, a decision strategy was developed based on weighted combination of spectral data and image features, in which the weights were determined by FNN for a better estimation of PPO activity. The results showed that the combined decision model was the best among all of the calibration models, with high R(2) values of 0.9117 and 0.9072 and low RMSEs of 0.45% and 0.459% for calibration and prediction, respectively. These results demonstrate that the proposed weighted combined decision method has great potential for improving model performance. The proposed technique could be used for a better prediction of other internal and external quality attributes of fruits. PMID:25882427

  11. 28-Homobrassinolide Alters Protein Content and Activities of Glutathione-S-Transferase and Polyphenol Oxidase in Raphanus Sativus L. Plants Under Heavy Metal Stress

    PubMed Central

    Sharma, Neha; Hundal, Gurjinder Singh; Sharma, Indu; Bhardwaj, Renu


    Objectives: The application of brassinosteroids (BRs), the plant steroidal hormones, results in an increased tolerance toward stress and thus helps improving the yield of crop plants. The present study was carried out to investigate the effect of 28-homobrassinolide (28-HBL) on the protein content as well as activities of antioxidant enzymes viz., glutathione-s-transferase (GST) and polyphenol oxidase (PPO) in radish plants grown under Cadmium (Cd) and Mercury (Hg) metal stress. Materials and Methods: Shoots of 60 and 90 days old radish plants, grown under Cd and Hg metal stress (0, 0.5, 1.0, 1.5 mM) and given the presowing treatment of 28-HBL (0, 10-7, 10-9, 10-11 M) to seeds for 8 h, were analyzed for protein content and GST and PPO enzyme activities. Results: Protein content showed decrease in plants given Cd and Hg metal treatment alone, while treatment with 28-HBL enhanced the protein content, suggesting its stress protective role. An increase in the activity of antioxidative enzymes was also observed in plants stressed with heavy metals as well as in those supplemented with 28-HBL. Conclusions: In the present investigation, the activity of antioxidative enzymes was found to increase due to metal stress and a further increase was noticed in plants given both metal and 28-HBL treatment, suggesting the stress protective role of 28-HBL via modulating the antioxidative enzymes. PMID:24748734

  12. The control of polyphenol oxidase activity in fruits and vegetables. A study of the interactions between the chemical compounds used and heat treatment.


    Almeida, M E; Nogueira, J N


    Objective of this research was to find alternative methods for the control of polyphenol oxidase (PPO) activity in fruits and vegetables with the purpose of reducing or eliminating the use of SO2 for this purpose. Interactions between the use of ascorbic acid, citric acid, EDTA, sodium metabisulphite and heat treatment (70 degrees C for 2 min) in the control of PPO activity were studied in avocado (var. Fortuna), banana (var. Nanica), apple (var. Ana, Fuji, Gala & Golden), pear (var. D'Agua), peach (var. Réal), potato (var. Bintje), eggplant (var. Super F100), mushroom (Agaricus bisporus) and hearts-of-palm (Euterpe edulis Mart). The results demonstrated that PPO of avocado and eggplant was most resistant to inhibition by the methods used. The least efficient method tested for the control of PPO was the addition of ascorbic acid and EDTA, while the most efficient methods investigated included the use of ascorbic acid, citric acid, sodium metabisulphite and heat treatment. The results indicated that, with the exception of PPO from avocado, the most adequate alternative method to substitute for the use of SO2 in the control of PPO was a combination of ascorbic acid, citric acid and heat treatment. PMID:7659702

  13. Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword

    PubMed Central

    Yang, Han-Yu; Chen, Carton W.


    Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC− strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere. PMID:19826489

  14. Inactivation, aggregation, secondary and tertiary structural changes of germin-like protein in Satsuma mandarine with high polyphenol oxidase activity induced by ultrasonic processing.


    Huang, Nana; Cheng, Xi; Hu, Wanfeng; Pan, Siyi


    The inhibition of Polyphenol oxidase (PPO) in plants has been widely researched for their important roles in browning reaction. A newly found germin-like protein (GLP) with high PPO activity in Satsuma mandarine was inactivated by low-frequency high-intensity ultrasonic (20 kHz) processing. The effects of ultrasound on PPO activity and structure of GLP were investigated using dynamic light scattering (DLS) analysis, transmission electron microscopy (TEM), circular dichroism (CD) spectral measurement and fluorescence spectral measurement. The lowest PPO activity achieved was 27.4% following ultrasonication for 30 min at 400 W. DLS analysis showed ultrasound caused both aggregation and dissociation of GLP particles. TEM images also demonstrated protein aggregation phenomena. CD spectra exhibited a certain number of loss in α-helix structure content. Fluorescence spectra showed remarkable increase in fluorescence intensity with tiny blue-shift following ultrasonication. In conclusion, ultrasound applied in this study induced structural changes of GLP and eventually inactivated PPO activity. PMID:25522206

  15. The expression of lysyl-oxidase gene family members in myeloproliferative neoplasms.


    Tadmor, T; Bejar, J; Attias, D; Mischenko, E; Sabo, E; Neufeld, G; Vadasz, Z


    Myeloproliferative neoplasms (MPNs) are malignant disorders originating from clonal expansion of a single neoplastic stem cell and characteristically show an increase in bone marrow reticulin fibers. Lysyl oxidases (LOXs) are copper-dependent amine oxidases that play a critical role in the biogenesis of connective tissue by crosslinking extracellular matrix proteins, collagen and elastin. Expression of LOX gene family members is increased in disorders associated with increased fibrosis. To evaluate involvement of LOX gene family in various MPNs. In-situ hybridization was used to detect Lysyl-Oxidase family members in bone marrow biopsies from patients with different MPNs. We compared normal bone marrows and those from patients with polycythemia vera, essential thrombocythemia, chronic myeloid leukemia, and primary myelofibrosis (PMF). Serum levels of lysyl-oxidase from patients with PMF and healthy controls were also examined. LOX gene family was not detected in normal bone marrows. All members of the LOX gene family were over expressed in PMF. In other MPNs a differential pattern of expression was observed. Differences in gene expression were statistically significant (P < 0.010). The medianserum LOX levels in normal controls was 28.4 ± 2.5 ng\\ml and 44.6 ± 9.44 ng\\ml in PMF (P = 0.02). The varying pattern of expression of LOX genes may reflect differences in the pathophysiology of bone marrow fibrosis in these MPNs. These observations could be used as the basis for future targeted therapy directed against bone marrow fibrosis. PMID:23494965

  16. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.


    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae


    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  17. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.


    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge


    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  18. Cloning and Characterization of Red Clover Polyphenol Oxidase cDNAs and Expression of Active Protein in Escherichia coli and Transgenic Alfalfa1[w

    PubMed Central

    Sullivan, Michael L.; Hatfield, Ronald D.; Thoma, Sharon L.; Samac, Deborah A.


    Red clover (Trifolium pratense) leaves contain high levels of polyphenol oxidase (PPO) activity and o-diphenol substrates. Wounding of leaves during harvest and ensiling results in browning of leaf tissues from activity of PPO on the o-diphenols. In association with browning, leaf proteins remain undegraded during ensiling, presumably due to PPO-generated o-quinone inhibition of leaf proteases. We cloned three red clover PPO cDNAs, PPO1, PPO2, and PPO3, from a leaf cDNA library. Sequence comparisons among the three red clover PPO clones indicated they are 87% to 90% identical at the nucleotide level (80%–83% amino acid identity). All three encode proteins predicted to localize to the chloroplast thylakoid lumen. RNA-blotting and immunoblotting experiments indicated PPO1 is expressed primarily in young leaves, PPO2 in flowers and petioles, and PPO3 in leaves and possibly flowers. We expressed mature PPO1 in Escherichia coli. A portion of the expressed protein was soluble and functional in an assay for PPO activity. We also expressed the red clover PPO cDNAs under the control of a constitutive promoter in alfalfa (Medicago sativa). The expressed red clover PPO proteins were active in alfalfa extracts as evidenced by o-diphenol-dependant extract browning and quantitative assays of PPO activity. Proteolysis in leaf extracts of alfalfa expressing red clover PPO1 was dramatically reduced in the presence of an o-diphenol compared to controls. Transgenic alfalfa expressing red clover PPO should prove an excellent model system to further characterize the red clover PPO enzymes and PPO-mediated inhibition of postharvest proteolysis in forage plants. PMID:15466227

  19. Binding geometry, stoichiometry, and thermodynamics of cyclomalto-oligosaccharide (cyclodextrin) inclusion complex formation with chlorogenic acid, the major substrate of apple polyphenol oxidase.


    Irwin, P L; Pfeffer, P E; Doner, L W; Sapers, G M; Brewster, J D; Nagahashi, G; Hicks, K B


    The inclusion complexes of cyclomaltohexaose (alpha-CD), cyclomaltoheptaose (beta-CD), cyclomaltooctaose (gamma-CD), and polymerized beta-CD (beta-CDn) with chlorogenic acid (CA), the major substrate of apple fruit polyphenol oxidase (PPO), were studied with regard to pH, ionic strength, and temperature in model buffer systems and apple juice. The thermodynamics of CD.CA inclusion complex formation, which were studied in solution using UV spectrophotometry, displayed enthalpy-entropy compensation typical of processes driven by solvation phenomena. We also found that the apparent association constants (K) of the CD.CA equilibrium were relatively insensitive to pH for beta-CD, compared to alpha- and gamma-CDs, but were subject to substantial enhancement at low ionic strengths. The beta-CD.CA inclusion complex was also characterized for binding geometry and stoichiometry at 9.4 T and 25 degrees C in 0.05 M Na phosphate buffer by 1H NMR spectroscopy. A 1:1 stoichiometric ratio for the complex was found using the method of continuous variations. 1H Spin-lattice relaxation and chemical-shift data indicate that the phenolic ring of CA docks within the cavity of beta-CD. The Ks for beta-, alpha-, and gamma-CD determined in apple juice, which contains a mixture of PPO substrates, were found to correlate with PPO activity-related data. Apple juice, treated with beta-CDn, did not brown until CA was added back. These latter findings strongly argue that the mechanism for inhibition of juice browning with cyclodextrins was mainly due to the binding of PPO substrates and not some other means such as enzyme inactivation via sequestration of Cu2+ by CDs. PMID:8194069

  20. Effect of the polycation nature on the structure of layer-by-layer electrostatically self-assembled multilayers of polyphenol oxidase.


    Forzani, Erica S; Teijelo, Manuel López; Nart, Francisco; Calvo, Ernesto J; Solís, Velia M


    Self-assembled multilayers comprised of alternate layers of polyphenol oxidase (PPO) and poly(allylamine) (PAH) or PPO and poly(diallyldimethylamine) (PDDA), deposited on a 3-mercaptopropanesulfonic acid (MPS)-modified gold surface, were studied "in-situ" (under water) by means of ellipsometry and quartz crystal microbalance (QCM), and "ex-situ" (in open air) by ellipsometry and fourier transform infrared reflection-absorption spectroscopy (FT-IRRAS). Optical ellipsometric properties of (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) multilayers were obtained at two wavelengths, employing an isotropic single-layer model with the substrate parameters measured after thiol adsorption. Film thickness as well as ellipsometric mass values based on the de Feijter equation were also evaluated. The quartz crystal impedance analysis showed that self-assembled multilayers behaved as acoustically thin films, and therefore, the shifts observed in the film inductive impedance parameter were interpreted in terms of gravimetric mass. The enzyme mass up-take in each adsorption step was determined on PAH or on PDDA topmost layer. A comparative study between the ellipsometric thickness and acoustic mass values allowed us to obtain average values of "apparent" densities of (2.1 +/- 0.1) and (2.4 +/- 0.1) g cm(-3) for (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) multilayers, respectively. The content of water included in the open polymer-enzyme structure was evaluated by comparison of QCM and ellipsometric mass values. FT-IRRAS spectra of each layer in (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) films were recorded, and the intensity ratio of the amide bands was evaluated to obtain information about layer-by-layer enzyme conformation. An enzyme/polycation distribution model for (PAH)(n)(PPO)(n)and (PDDA)(n)(PPO)(n) multilayer structures is presented on the basis of combined ellipsometric, QCM, and FT-IRRAS results. PMID:12857067

  1. Polyphenols from Chilean Propolis and Pinocembrin Reduce MMP-9 Gene Expression and Activity in Activated Macrophages

    PubMed Central

    Saavedra, Nicolás; Cuevas, Alejandro; Cavalcante, Marcela F.; Dörr, Felipe A.; Saavedra, Kathleen; Zambrano, Tomás; Abdalla, Dulcineia S. P.; Salazar, Luis A.


    Polyphenols from diverse sources have shown anti-inflammatory activity. In the context of atherosclerosis, macrophages play important roles including matrix metalloproteinases synthesis involved in degradation of matrix extracellular components affecting the atherosclerotic plaque stability. We prepared a propolis extract and pinocembrin in ethanol solution. Propolis extract was chemically characterized using LC-MS. The effect of treatments on gene expression and proteolytic activity was measured in vitro using murine macrophages activated with LPS. Cellular toxicity associated with both treatments and the vehicle was determined using MTT and apoptosis/necrosis detection assays. MMP-9 gene expression and proteolytic activity were measured using qPCR and zymography, respectively. Thirty-two compounds were identified in the propolis extract, including pinocembrin among its major components. Treatment with either ethanolic extract of propolis or pinocembrin inhibits MMP-9 gene expression in a dose-dependent manner. Similarly, an inhibitory effect was observed in proteolytic activity. However, the effect showed by ethanolic extract of propolis was higher than the effect of pinocembrin, suggesting that MMP-9 inhibition results from a joint contribution between the components of the extract. These data suggest a potential role of polyphenols from Chilean propolis in the control of extracellular matrix degradation in atherosclerotic plaques. PMID:27119082

  2. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel


    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  3. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.


    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  4. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  5. Polyphenol-rich black chokeberry (Aronia melanocarpa) extract regulates the expression of genes critical for intestinal cholesterol flux in Caco-2 cells.


    Kim, Bohkyung; Park, Youngki; Wegner, Casey J; Bolling, Bradley W; Lee, Jiyoung


    Black chokeberry (Aronia melanocarpa) is a rich source of polyphenols. The hypolipidemic effects of polyphenol-rich black chokeberry extract (CBE) have been reported, but underlying mechanisms have not been well characterized. We investigated the effect of CBE on the expression of genes involved in intestinal lipid metabolism. Caco-2 cells were incubated with 50 or 100 μg/ml of CBE for 24 h for quantitative realtime polymerase chain reaction analysis. Expression of genes for cholesterol synthesis (3-hydroxy-3-methylglutaryl coenzyme A reductase and sterol regulatory element binding protein 2), apical cholesterol uptake (Niemann-Pick C1 Like 1 and scavenger receptor class B Type 1) and basolateral cholesterol efflux [ATP-binding cassette transporter A1 (ABCA1)] was significantly decreased by CBE compared with control. Western blot analysis confirmed that CBE inhibited expression of these proteins. In contrast, CBE markedly induced mRNA and/or protein levels of ABCG5 and ABCG8 that mediate apical cholesterol efflux to the intestinal lumen. Furthermore, CBE significantly increased mRNA and protein levels of low-density lipoprotein (LDL) receptor, and cellular LDL uptake. Expression of genes involved in lipid metabolism and lipoprotein assembly, including sterol regulatory element-binding protein 1c, fatty acid synthase and acyl-CoA oxidase 1, was significantly decreased by CBE in a dose-dependent manner. Concomitantly, CBE significantly increased sirtuin 1, 3 and 5 mRNA levels, while it decreased SIRT-2. Our data suggest that hypolipidemic effects of CBE may be attributed, at least in part, to increased apical efflux of LDL-derived cholesterol and to decreased chylomicron formation in the intestine; and specific isoforms of SIRT may play an important role in this process. PMID:23517916

  6. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji


    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  7. Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene.


    Niki, T; Nishijima, T; Nakayama, M; Hisamatsu, T; Oyama-Okubo, N; Yamazaki, H; Hedden, P; Lange, T; Mander, L N; Koshioka, M


    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-Omega). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T(2) generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T(2) generation, indicating that the transgene was stable and dominant. The endogenous levels of GA(1) and GA(4) were reduced in the dwarfs, whereas large amounts of GA(17) and GA(25), which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  8. Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

  9. Variation of the Phytochemical Constituents and Antioxidant Activities of Zingiber officinale var. rubrum Theilade Associated with Different Drying Methods and Polyphenol Oxidase Activity.


    Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah


    The effects of different drying methods (freeze drying, vacuum oven drying, and shade drying) on the phytochemical constituents associated with the antioxidant activities of Z. officinale var. rubrum Theilade were evaluated to determine the optimal drying process for these rhizomes. Total flavonoid content (TFC), total phenolic content (TPC), and polyphenol oxidase (PPO) activity were measured using the spectrophotometric method. Individual phenolic acids and flavonoids, 6- and 8-gingerol and shogaol were identified by ultra-high performance liquid chromatography method. Ferric reducing antioxidant potential (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays were used for the evaluation of antioxidant activities. The highest reduction in moisture content was observed after freeze drying (82.97%), followed by vacuum oven drying (80.43%) and shade drying (72.65%). The highest TPC, TFC, and 6- and 8-shogaol contents were observed in samples dried by the vacuum oven drying method compared to other drying methods. The highest content of 6- and 8-gingerol was observed after freeze drying, followed by vacuum oven drying and shade drying methods. Fresh samples had the highest PPO activity and lowest content of flavonoid and phenolic acid compounds compared to dried samples. Rhizomes dried by the vacuum oven drying method represent the highest DPPH (52.9%) and FRAP activities (566.5 μM of Fe (II)/g DM), followed by freeze drying (48.3% and 527.1 μM of Fe (II)/g DM, respectively) and shade drying methods (37.64% and 471.8 μM of Fe (II)/g DM, respectively) with IC50 values of 27.2, 29.1, and 34.8 μg/mL, respectively. Negative and significant correlations were observed between PPO and antioxidant activity of rhizomes. Vacuum oven dried rhizomes can be utilized as an ingredient for the development of value-added food products as they contain high contents of phytochemicals with valuable antioxidant potential. PMID:27322227

  10. The effect of high polyphenol oxidase grass silage on metabolism of polyunsaturated fatty acids and nitrogen across the rumen of beef steers.


    Lee, M R F; Theobald, V J; Gordon, N; Leyland, M; Tweed, J K S; Fychan, R; Scollan, N D


    Polyphenol oxidase (PPO) activity in red clover (Trifolium pratense) has been reported to reduce both proteolysis and lipolysis, resulting in greater N use efficiency and protection of PUFA across the rumen. Although high levels of PPO have been reported in grasses such as cocksfoot (orchard grass; Dactylis glomerata), no in vivo research has determined whether grass PPO elicits the same response as red clover PPO. To test the hypothesis that silage ensiled from grass with high levels of PPO protects N and PUFA across the rumen, 6 steers with ruminal and duodenal cannulas were offered cocksfoot silage (CO; high-PPO grass), perennial ryegrass silage (PR; Lolium perenne; low-PPO grass), or red clover silage (RC; high-PPO control) at 16 g DM/kg BW daily with the experiment consisting of two 3 × 3 Latin squares with 21-d periods, consisting of 12 d of diet adaptation, 6 d of duodenal marker infusion, 2 d of duodenal sampling, and 1 d of ruminal sampling. All silages were well preserved, with DM of 34.4, 55.3, and 45.4% for CO, PR, and RC. Activity of PPO in silages was low due to deactivation but was greater in CO than either PR or RC (0.15 vs. 0.05 and 0.08 μkatal/g DM). Protein-bound phenol (mg/g DM) as a measure of the degree of oxidation and an indication of PPO protection was greatest for RC (15.9) but comparable for PR (10.1) and CO (12.2). Biohydrogenation of C18 PUFA was significantly lower on RC compared to the 2 grass silages with CO greater than PR. Despite lower levels of total fatty acid intake and subsequent duodenal flow, CO resulted in greater levels of phytanic acid and total branched and odd chain fatty acids in duodenal digesta than RC or PR. Ruminal ammonia concentration was greatest for RC, with no difference between the grasses. Duodenal flow of microbial N and efficiency of microbial protein synthesis were lowest for CO and comparable for RC and PR. The CO (high-grass PPO) did not result in elevated levels of C18 PUFA escaping the rumen or

  11. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.


    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  12. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James


    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  13. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple

    PubMed Central

    Verdu, Cindy F.; Guyot, Sylvain; Childebrand, Nicolas; Bahut, Muriel; Celton, Jean-Marc; Gaillard, Sylvain; Lasserre-Zuber, Pauline; Troggio, Michela; Guilet, David; Laurens, François


    Polyphenols have favorable antioxidant potential on human health suggesting that their high content is responsible for the beneficial effects of apple consumption. They control the quality of ciders as they predominantly account for astringency, bitterness, color and aroma. In this study, we identified QTLs controlling phenolic compound concentrations and the average polymerization degree of flavanols in a cider apple progeny. Thirty-two compounds belonging to five groups of phenolic compounds were identified and quantified by reversed phase liquid chromatography on both fruit extract and juice, over three years. The average polymerization degree of flavanols was estimated in fruit by phloroglucinolysis coupled to HPLC. Parental maps were built using SSR and SNP markers and used for the QTL analysis. Sixty-nine and 72 QTLs were detected on 14 and 11 linkage groups of the female and male maps, respectively. A majority of the QTLs identified in this study are specific to this population, while others are consistent with previous studies. This study presents for the first time in apple, QTLs for the mean polymerization degree of procyanidins, for which the mechanisms involved remains unknown to this day. Identification of candidate genes underlying major QTLs was then performed in silico and permitted the identification of 18 enzymes of the polyphenol pathway and six transcription factors involved in the apple anthocyanin regulation. New markers were designed from sequences of the most interesting candidate genes in order to confirm their co-localization with underlying QTLs by genetic mapping. Finally, the potential use of these QTLs in breeding programs is discussed. PMID:25271925

  14. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.


    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim


    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  15. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim


    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  16. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.


    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W


    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  17. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.


    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N


    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  18. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.


    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  19. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  20. Green Tea Polyphenols Reduce Body Weight in Rats by Modulating Obesity-Related Genes

    PubMed Central

    Lu, Chuanwen; Zhu, Wenbin; Shen, Chwan-Li; Gao, Weimin


    Beneficial effects of green tea polyphenols (GTP) against obesity have been reported, however, the mechanism of this protection is not clear. Therefore, the objective of this study was to identify GTP-targeted genes in obesity using the high-fat-diet-induced obese rat model. A total of three groups (n = 12/group) of Sprague Dawley (SD) female rats were tested, including the control group (rats fed with low-fat diet), the HF group (rats fed with high-fat diet), and the HF+GTP group (rats fed with high-fat diet and GTP in drinking water). The HF group increased body weight as compared to the control group. Supplementation of GTP in the drinking water in the HF+GTP group reduced body weight as compared to the HF group. RNA from liver samples was extracted for gene expression analysis. A total of eighty-four genes related to obesity were analyzed using PCR array. Compared to the rats in the control group, the rats in the HF group had the expression levels of 12 genes with significant changes, including 3 orexigenic genes (Agrp, Ghrl, and Nr3c1); 7 anorectic genes (Apoa4, Cntf, Ghr, IL-1β, Ins1, Lepr, and Sort); and 2 genes that relate to energy expenditure (Adcyap1r1 and Adrb1). Intriguingly, the HF+GTP group restored the expression levels of these genes in the high-fat-induced obese rats. The protein expression levels of IL-1β and IL-6 in the serum samples from the control, HF, and HF+GTP groups confirmed the results of gene expression. Furthermore, the protein expression levels of superoxide dismutase-1 (SOD1) and catechol-O-methyltransferase (COMT) also showed GTP-regulated protective changes in this obese rat model. Collectively, this study revealed the beneficial effects of GTP on body weight via regulating obesity-related genes, anti-inflammation, anti-oxidant capacity, and estrogen-related actions in high-fat-induced obese rats. PMID:22715380

  1. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin


    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng


    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  3. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T


    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  4. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.


    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing


    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  5. Characterization of Rice NADPH Oxidase Genes and Their Expression under Various Environmental Conditions

    PubMed Central

    Wang, Gang-Feng; Li, Wen-Qiang; Li, Wen-Yan; Wu, Guo-Li; Zhou, Cong-Yi; Chen, Kun-Ming


    Plasma membrane NADPH oxidases (Noxs) are key producers of reactive oxygen species under both normal and stress conditions in plants. We demonstrate that at least eleven genes in the genome of rice (Oryza sativa L.) were predicted to encode Nox proteins, including nine genes (OsNox1–9) that encode typical Noxs and two that encode ancient Nox forms (ferric reduction oxidase 1 and 7, OsFRO1 and OsFRO7). Phylogenetic analysis divided the Noxs from nine plant species into six subfamilies, with rice Nox genes distributed among subfamilies I to V. Gene expression analysis using semi-quantitative RT-PCR and real-time qRT-PCR indicated that the expression of rice Nox genes depends on organs and environmental conditions. Exogenous calcium strongly stimulated the expression of OsNox3, OsNox5, OsNox7, and OsNox8, but depressed the expression of OsFRO1. Drought stress substantially upregulated the expression of OsNox1–3, OsNox5, OsNox9, and OsFRO1, but downregulated OsNox6. High temperature upregulated OsNox5–9, but significantly downregulated OsNox1–3 and OsFRO1. NaCl treatment increased the expression of OsNox2, OsNox8, OsFRO1, and OsFRO7, but decreased that of OsNox1, OsNox3, OsNox5, and OsNox6. These results suggest that the expression profiles of rice Nox genes have unique stress-response characteristics, reflecting their related but distinct functions in response to different environmental stresses. PMID:23629674

  6. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.


    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui


    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  7. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.


    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S


    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  8. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.


    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire


    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  9. Transcriptional response of genes involved in cell defense system in human cells stressed by H2O2 and pre-treated with (Tunisian) Rhamnus alaternus extracts: combination with polyphenolic compounds and classic in vitro assays.


    Ammar, Rebai Ben; Bouhlel, Ines; Valenti, Kita; Sghaier, Mohamed Ben; Kilani, Soumaya; Mariotte, Anne-Marie; Dijoux-Franca, Marie-Geneviève; Laporte, François; Ghedira, Kamel; Chekir-Ghedira, Leila


    The ability of three Rhamnus alaternus leaves extracts on antigenotoxic and gene expression level effects was respectively investigated in a bacterial assay system, i.e. the SOS chromotest with Escherichia coli PQ37 and in human K562 lymphoblast cell line. Total oligomers flavonoids (TOF) enriched, methanol and ethyl acetate extracts were prepared from powdered R. alaternus leaves and characterized quantitatively for the presence of polyphenolic compounds. We explored the response to oxidative stress using the transcriptional profile of genes in K562 cells stressed with H2O2 after incubation with plant extracts. For this purpose, we used a cDNA microarrays containing 82 genes related to cell defense, essentially represented by antioxidant and DNA repair genes. Analysis revealed that SOD1, AOE 372, TXN genes involved in the antioxidant defense system and XPC, LIG4, POLD2, PCNA genes implied in the DNA repair system were among the most expressed ones in the presence of the tested extracts. These results were in accordance with those obtained when we tested the antigenotoxic and antioxidant effects of the same extracts with, respectively the SOS chromotest and the xanthine/xanthine oxidase enzymatic assay system. The effect of the tested extracts on SOS response induced by both Aflatoxin B1 (AFB1: 10 microg/assay) and nifuroxazide (20 microg/assay) showed that the TOF extract exhibited the highest antimutagenic level towards the indirect mutagen AFB1. Whereas ethyl acetate extract showed the highest antimutagenic effect towards the direct mutagen, nifuroxazide. None of the tested extracts induced mutagenic activity. However all the tested extracts exhibited xanthine oxidase inhibiting and superoxide anions scavenging effects. R. alaternus extracts contain compounds with significant antioxidant and antigenotoxic activities. These compounds modulate gene expression as detected by using cDNA arrays. PMID:17512922

  10. Identification of a nitroalkane oxidase gene: naoA related to the growth of Streptomyces ansochromogenes.


    Li, Yanhua; Zhang, Jihui; Tan, Huarong


    naoA, encoding a nitroalkane oxidase that can catalyze toxic nitroalkanes to their corresponding aldehydes or ketones and hydrogen peroxide, was cloned from Streptomyces ansochromogenes, but its function related to the growth of Streptomyces is unknown. naoA was disrupted by the insertion of a kanamycin-resistance gene; the resulting strain can grow earlier than a wild-type strain under the same conditions. It was shown that naoA disruption accelerated growth of the naoA-disruption mutant, which could restore its phenotype and morphology as a wild-type strain by complementation of a single copy number of naoA inserted into the chromosome. The introduction of an extra copy of naoA into the wild-type strain resulted in delayed growth. The result suggested that naoA is an important gene related to the growth of S. ansochromogenes. PMID:18810541

  11. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M


    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  12. The acute impact of polyphenols from Hibiscus sabdariffa in metabolic homeostasis: an approach combining metabolomics and gene-expression analyses.


    Beltrán-Debón, Raúl; Rodríguez-Gallego, Esther; Fernández-Arroyo, Salvador; Senan-Campos, Oriol; Massucci, Francesco A; Hernández-Aguilera, Anna; Sales-Pardo, Marta; Guimerà, Roger; Camps, Jordi; Menendez, Javier A; Joven, Jorge


    We explored the acute multifunctional effects of polyphenols from Hibiscus sabdariffa in humans to assess possible consequences on the host's health. The expected dynamic response was studied using a combination of transcriptomics and metabolomics to integrate specific functional pathways through network-based methods and to generate hypotheses established by acute metabolic effects and/or modifications in the expression of relevant genes. Data were obtained from healthy male volunteers after 3 hours of ingestion of an aqueous Hibiscus sabdariffa extract. The data were compared with data obtained prior to the ingestion, and the overall findings suggest that these particular polyphenols had a simultaneous role in mitochondrial function, energy homeostasis and protection of the cardiovascular system. These findings suggest beneficial actions in inflammation, endothelial dysfunction, and oxidation, which are interrelated mechanisms. Among other effects, the activation of the heme oxygenase-biliverdin reductase axis, the systemic inhibition of the renin-angiotensin system, the inhibition of the angiotensin-converting enzyme, and several actions mirroring those of the peroxisome proliferator-activated receptor agonists further support this notion. We also found concordant findings in the serum of the participants, which include a decrease in cortisol levels and a significant increase in the active vasodilator metabolite of bradykinin (des-Arg(9)-bradykinin). Therefore, our data support the view that polyphenols from Hibiscus sabdariffa play a regulatory role in metabolic health and in the maintenance of blood pressure, thus implying a multi-faceted impact in metabolic and cardiovascular diseases. PMID:26234931

  13. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan


    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  15. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.


    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L


    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  16. Bigenomic transcriptional regulation of all thirteen cytochrome c oxidase subunit genes by specificity protein 1

    PubMed Central

    Dhar, Shilpa S.; Johar, Kaid; Wong-Riley, Margaret T. T.


    Cytochrome c oxidase (COX) is one of only four known bigenomic proteins, with three mitochondria-encoded subunits and 10 nucleus-encoded ones derived from nine different chromosomes. The mechanism of regulating this multi-subunit, bigenomic enzyme is not fully understood. We hypothesize that specificity protein 1 (Sp1) functionally regulates the 10 nucleus-encoded COX subunit genes directly and the three mitochondrial COX subunit genes indirectly by regulating mitochondrial transcription factors A and B (TFAM, TFB1M and TFB2M) in neurons. By means of in silico analysis, electrophoretic mobility shift and supershift assays, chromatin immunoprecipitation, RNA interference and over-expression experiments, the present study documents that Sp1 is a critical regulator of all 13 COX subunit genes in neurons. This regulation is intimately associated with neuronal activity. Silencing of Sp1 prevented the upregulation of all COX subunits by KCl, and over-expressing Sp1 rescued all COX subunits from being downregulated by tetrodotoxin. Thus, Sp1 and our previously described nuclear respiratory factors 1 and 2 are the three key regulators of all 13 COX subunit genes in neurons. The binding sites for Sp1 on all 10 nucleus-encoded COX subunits, TFAM, TFB1M and TFB2M are highly conserved among mice, rats and humans. PMID:23516108

  17. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.


    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M


    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  18. cDNA cloning and gene expression of ascorbate oxidase in tobacco.


    Kato, N; Esaka, M


    A cDNA clone for ascorbate oxidase (AAO) has been isolated from a cDNA library of tobacco (Nicotiana tabacum) cells. The identity of the amino acid sequence deduced from tobacco AAO cDNA to that from pumpkin AAO cDNA was 68%, which was much lower than the identity (80%) between pumpkin and cucumber AAO. AAO activity in tobacco cells was much lower than that in pumpkin cells, whereas the immunoreactive protein in tobacco cells was more abundant than that in pumpkin cells. We suppose that AAO protein in tobacco cells may be less active than that in pumpkin cells. Genomic Southern blotting suggested that AAO in tobacco was encoded by a single-copy gene. Nothern blotting revealed that mRNA of AAO was highly expressed in young and growing tissues of tobacco plant. PMID:8624413

  19. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )


    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  20. Cinnamon polyphenol extract regulates tristetraprolin and related gene expression in mouse adipocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamon (Cinnamomum verum) has been widely used in spices, flavoring agents, and preservatives. Cinnamon polyphenol extract (CPE) may be important in the alleviation of chronic diseases, but the molecular evidence is not substantial. Tristetraprolin (TTP) family proteins have anti-inflammatory ef...

  1. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron


    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ω-hydroxy fatty acids to ω-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ω-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ω-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  2. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.


    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad


    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  3. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad


    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  4. Indirect determination of sulfite using a polyphenol oxidase biosensor based on a glassy carbon electrode modified with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film.


    Sartori, Elen Romão; Vicentini, Fernando Campanhã; Fatibello-Filho, Orlando


    The modification of a glassy carbon electrode with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film for the development of a biosensor is proposed. This approach provides an efficient method used to immobilize polyphenol oxidase (PPO) obtained from the crude extract of sweet potato (Ipomoea batatas (L.) Lam.). The principle of the analytical method is based on the inhibitory effect of sulfite on the activity of PPO, in the reduction reaction of o-quinone to catechol and/or the reaction of o-quinone with sulfite. Under the optimum experimental conditions using the differential pulse voltammetry technique, the analytical curve obtained was linear in the concentration of sulfite in the range from 0.5 to 22 μmol L(-1) with a detection limit of 0.4 μmol L(-1). The biosensor was applied for the determination of sulfite in white and red wine samples with results in close agreement with those results obtained using a reference iodometric method (at a 95% confidence level). PMID:22099673

  5. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.


    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury


    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  6. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.


    Vanlerberghe, G. C.; McLntosh, L.


    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  7. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central


    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  8. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen


    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  9. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.


    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  10. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.


    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  11. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.


    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  12. The Involvement of Gibberellin 20-Oxidase Genes in Phytochrome-Regulated Petiole Elongation of Arabidopsis

    PubMed Central

    Hisamatsu, Tamotsu; King, Rod W.; Helliwell, Chris A.; Koshioka, Masaji


    Long day (LD) exposure of rosette plants causes rapid stem/petiole elongation, a more vertical growth habit, and flowering; all changes are suggestive of a role for the gibberellin (GA) plant growth regulators. For Arabidopsis (Arabidopsis thaliana) L. (Heynh), we show that enhancement of petiole elongation by a far-red (FR)-rich LD is mimicked by a brief (10 min) end-of-day (EOD) FR exposure in short day (SD). The EOD response shows red (R)/FR photoreversibility and is not affected in a phytochrome (PHY) A mutant so it is mediated by PHYB and related PHYs. FR photoconversion of PHYB to an inactive form activates a signaling pathway, leading to increased GA biosynthesis. Of 10 GA biosynthetic genes, expression of the 20-oxidase, AtGA20ox2, responded most to FR (up to a 40-fold increase within 3 h). AtGA20ox1 also responded but to a lesser extent. Stimulation of petiole elongation by EOD FR is reduced in a transgenic AtGA20ox2 hairpin gene silencing line. By contrast, it was only in SD that a T-DNA insertional mutant of AtGA20ox1 (ga5-3) showed reduced response. Circadian entrainment to a daytime pattern provides an explanation for the SD expression of AtGA20ox1. Conversely, the strong EOD/LD FR responses of AtGA20ox2 may reflect its independence of circadian regulation. While FR acting via PHYB increases expression of AtGA20ox2, other GA biosynthetic genes are known to respond to R rather than FR light and/or to other PHYs. Thus, there must be different signal transduction pathways, one at least showing a positive response to active PHYB and another showing a negative response. PMID:15923331

  13. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.


    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  14. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis.


    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu


    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  15. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M


    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  16. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.


    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina


    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date. PMID:26675451



    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy


    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  18. Molecular cloning and heterologous expression of the gene encoding dihydrogeodin oxidase, a multicopper blue enzyme from Aspergillus terreus.


    Huang, K X; Fujii, I; Ebizuka, Y; Gomi, K; Sankawa, U


    Aspergillus terreus dihydrogeodin oxidase (DHGO) is an enzyme catalyzing the stereospecific phenol oxidative coupling reaction converting dihydrogeodin to (+)- geodin. We previously reported the purification of DHGO from A. terreus and raised polyclonal antibody against DHGO. From the first cDNA library constructed in lambda gt11 using mRNA from 3-day-old mycelium of A. terreus, four clones were identified using anti-DHGO antibody, but all contained partial cDNA inserts around 280 base pairs. This cDNA fragment was used as a probe to clone the genomic DNA and cDNA for dihydrogeodin oxidase from A. terreus. The sequence of the cloned DHGO genomic DNA and cDNA predicted that the DHGO polypeptide consists of 605 amino acids showing significant homology with multicopper blue proteins such as laccase and ascorbate oxidase. Four potential copper binding domains exist in DHGO polypeptide. The DHGO gene consists of seven exons separated by six short introns. Expression of the DHGO gene in Aspergillus nidulans under the starch or maltose-inducible Taka-amylase A promoter as an active enzyme established the functional identity of the gene. Also, introduction of the genomic DNA for DHGO into Penicillium frequentans led to the production of DHGO polypeptide as judged by Western blot analysis. PMID:7665560

  19. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central


    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  20. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.


    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O


    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants. PMID:27315932

  1. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.


    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E


    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70°C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  2. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie


    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  3. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho


    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  4. Characterization and Functional Analysis of the poxB Gene, Which Encodes Pyruvate Oxidase in Lactobacillus plantarum

    PubMed Central

    Lorquet, Frédérique; Goffin, Philippe; Muscariello, Lidia; Baudry, Jean-Bernard; Ladero, Victor; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal


    The pyruvate oxidase gene (poxB) from Lactobacillus plantarum Lp80 was cloned and characterized. Northern blot and primer extension analyses revealed that transcription of poxB is monocistronic and under the control of a vegetative promoter. poxB mRNA expression was strongly induced by aeration and was repressed by glucose. Moreover, Northern blotting performed at different stages of growth showed that poxB expression is maximal in the early stationary phase when glucose is exhausted. Primer extension and in vivo footprint analyses revealed that glucose repression of poxB is mediated by CcpA binding to the cre site identified in the promoter region. The functional role of the PoxB enzyme was studied by using gene overexpression and knockout in order to evaluate its implications for acetate production. Constitutive overproduction of PoxB in L. plantarum revealed the predominant role of pyruvate oxidase in the control of acetate production under aerobic conditions. The ΔpoxB mutant strain exhibited a moderate (20 to 25%) decrease in acetate production when it was grown on glucose as the carbon source, and residual pyruvate oxidase activity that was between 20 and 85% of the wild-type activity was observed with glucose limitation (0.2% glucose). In contrast, when the organism was grown on maltose, the poxB mutation resulted in a large (60 to 80%) decrease in acetate production. In agreement with the latter observation, the level of residual pyruvate oxidase activity with maltose limitation (0.2% maltose) was less than 10% of the wild-type level of activity. PMID:15175288

  5. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.


    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P


    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  6. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R


    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  7. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.


    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P


    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  8. Blueberry polyphenols attenuate kainic acid-induced decrements in cognition and alter inflammatory gene expression in rat hippocampus

    PubMed Central

    Shukitt-Hale, Barbara; Lau, Francis C.; Carey, Amanda N.; Galli, Rachel L.; Spangler, Edward L.; Ingram, Donald K.; Joseph, James A.


    Cognitive impairment in age-related neurodegenerative diseases such as Alzheimer's disease may be partly due to long-term exposure and increased susceptibility to inflammatory insults. In the current study, we investigated whether polyphenols in blueberries can reduce the deleterious effects of inflammation induced by central administration of kainic acid by altering the expression of genes associated with inflammation. To this end, 4-month-old male Fischer-344 (F344) rats were fed a control, 0.015% piroxicam (an NSAID) or 2% blueberry diet for 8 weeks before either Ringer's buffer or kainic acid was bilaterally micro-infused into the hippocampus. Two weeks later, following behavioral evaluation, the rats were killed and total RNA from the hippocampus was extracted and used in real-time quantitative RT-PCR (qRT-PCR) to analyze the expression of inflammation-related genes. Kainic acid had deleterious effects on cognitive behavior as kainic acid-injected rats on the control diet exhibited increased latencies to find a hidden platform in the Morris water maze compared to Ringer's buffer-injected rats and utilized non-spatial strategies during probe trials. The blueberry diet, and to a lesser degree the piroxicam diet, was able to improve cognitive performance. Immunohistochemical analyses of OX-6 expression revealed that kainic acid produced an inflammatory response by increasing the OX-6 positive areas in the hippocampus of kainic acid-injected rats. Kainic acid up-regulated the expression of the inflammatory cytokines IL-1β and TNF-α, the neurotrophic factor IGF-1, and the transcription factor NF-κB. Blueberry and piroxicam supplementations were found to attenuate the kainic acid-induced increase in the expression of IL-1β, TNF-α, and NF-κB, while only blueberry was able to augment the increased IGF-1 expression. These results indicate that blueberry polyphenols attenuate learning impairments following neurotoxic insult and exert anti-inflammatory actions

  9. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko


    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  10. DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.


    Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K


    The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054

  11. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L


    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  12. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.


    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  13. Black tea polyphenols: a mechanistic treatise.


    Butt, M S; Imran, A; Sharif, M K; Ahmad, Rabia Shabir; Xiao, Hang; Imran, M; Rsool, H A


    Dietary interventions are among the emerging trends to curtail physiological malfunctioning like cancer, diabetes, cardiac complications, etc. The essence of phytonutrients has developed the concept of nutraceuticals at the junction of diet health linkages. In this context, theaflavin & thearubigins are the oxidized derivatives of black tea catechins during fermentation having nutraceutical potential owing to esterification of hydroxyl ring with digallate esters. Theaflavin may influence activation of transcription factors such as NFnB or AP-1 that ultimately hinder the formation of nitric oxide expression gene. Likewise, black tea contains a unique amino acid theanine acts as neurotransmitter owing to its ability to cross the blood-brain barrier. Moreover, it boasts immunity by enhancing the disease-fighting ability of gamma delta T cells. Theaflavin & thearubigins act as safeguard against oxidative stress thereby effective in the cardiac functioning. The mechanistic approach of these antioxidants is likely to be associated with inhibition of redox sensitive transcription factors & pro-oxidant enzymes such as xanthine oxidase or nitric oxide synthase. However, their involvement in antioxidative enzyme induction as in glutathione-S-transferases is also well documented. They act as curative agent against numerous pathological disorders by disrupting the electron chain thus inhibiting the progression of certain ailments. Black tea polyphenols established themselves as strong antioxidants due to their standard one-electron potential, and their vitality is dependent on the concentration of polyphenols and pH for their inclusive execution. Present review is an attempt to enrich the readers regarding the health promoting aspects of black tea polyphenols. Concomitantly, it needs core attention of researchers for the exploitations of black tea flavanols as an important dietary constituent for the vulnerable segment. PMID:24499118

  14. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David


    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  15. Hereditary Coproporphyria Associated with the Q306X Mutation in the Coproporphyrin Oxidase Gene Presenting with Acute Ataxia

    PubMed Central

    Jiménez-Jiménez, Félix Javier; Agúndez, José A. G.; Martínez, Carmen; Navacerrada, Francisco; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Alonso-Navarro, Hortensia; García-Martín, Elena


    Background Hereditary coproporphyria (HCPO) is a low-penetrance, autosomal dominant, acute hepatic porphyria characterized by the overproduction and excretion of coproporphyrin. The most common neurological manifestations of this entity include peripheral, predominantly motor dysfunction, and central nervous system dysfunction. Ataxia associated with HCPO has not been reported previously. The aim of this article is to report a patient with HCPO presenting with acute ataxia. Case Report We describe a 44-year-old patient presenting clinically with acute ataxia who was diagnosed with HCPO; mutations were analyzed in the coproporphyrin-oxidase III (CPOX) gene in the patient and in six asymptomatic first-degree relatives. Discussion The patient was heterozygous for a mutation causing the amino acid exchange Q306X in the CPOX gene. No relatives carried the same or another mutation in the CPOX gene. HCPO should be considered in the differential diagnosis for patients presenting with ataxia. PMID:24156084

  16. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.


    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry


    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion. PMID:24265769

  17. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.


    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo


    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  18. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.


    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  19. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ω-hydroxy fatty acids in Yarrowia lipolytica.


    Gatter, Michael; Förster, André; Bär, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Ježková, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthäus, Falk; Barth, Gerold


    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y. lipolytica H222ΔP which is lacking β-oxidation. Resulting transformants were tested for their ability to accumulate ω-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ω-oxidation, led only to a slightly increased accumulation of ω-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y. lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ω-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ω-hydroxy fatty acids with the help of the nonconventional yeast Y. lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  20. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan


    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  1. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.


    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  2. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.


    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  3. Diversity of laccase-like multicopper oxidase genes in Morchellaceae: identification of genes potentially involved in extracellular activities related to plant litter decay.


    Kellner, Harald; Luis, Patricia; Buscot, François


    Despite the important role played by soil-inhabiting ascomycetes in plant litter decay processes, studies on the diversity and function of their laccase-like multicopper oxidase (LMCO) genes are scarce. In the present work, the LMCO gene diversity in 15 strains representing nine Morchellaceae and one Discinaceae species was evaluated by PCR. One to six different genes were found within the species, representing 26 different sequence types. Cluster analysis revealed LMCO genes belonging to four main gene families encoding different protein classes (Class I-IV). To identify the genes related to extracellular activities and potentially involved in litter decay processes, liquid cultures were induced by different aromatic compounds. Morchella conica and Verpa conica showed the strongest LMCO activity enhancement in the presence of the naturally occurring phenolic compound guaiacol, and their expressed LMCO genes were identified by sequencing. Only genes belonging to the gene families encoding the Class II and III proteins were expressed. Both genes (Class II and III) of the mycorrhizal-like strain M. conica were exclusively expressed in the presence of guaiacol. In contrast to the saprotrophic strain V. conica, the gene encoding the Class III protein was constitutively expressed as it was also found in control cultures without guaiacol. PMID:17466024


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ensiling is a popular method for preserving forages for animal production systems in the humid regions of the U.S. and Europe. A major problem in silage production is the extensive protein degradation that occurs during the ensiling process, resulting in economic losses of $110 million per year (U.S...

  5. Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization

    PubMed Central

    Qi, Jing; Li, Gui-Qin; Dong, Zhen; Zhou, Wei


    To explore the subcellular localization of Polyphenol oxidase (PPO) from Pyrus bretschneideri, the 1779 bp cDNA of PPO gene excluding the termination codon TAA was cloned and fused with GFP to construct a binary vector pBI121-PPO-GFP. Then, the binary vector was transformed into Nicotiana tabacum by the tumefanciens-mediated method. Using confocal laser scanning microscopy, green fluorescent signals were localized in chloroplasts of the transformed Nicotiana tabacum cell, suggesting that the Polyphenol oxidase from Pyrus bretschneideri was a chloroplast protein. PMID:27158362

  6. Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization.


    Qi, Jing; Li, Gui-Qin; Dong, Zhen; Zhou, Wei


    To explore the subcellular localization of Polyphenol oxidase (PPO) from Pyrus bretschneideri, the 1779 bp cDNA of PPO gene excluding the termination codon TAA was cloned and fused with GFP to construct a binary vector pBI121-PPO-GFP. Then, the binary vector was transformed into Nicotiana tabacum by the tumefanciens-mediated method. Using confocal laser scanning microscopy, green fluorescent signals were localized in chloroplasts of the transformed Nicotiana tabacum cell, suggesting that the Polyphenol oxidase from Pyrus bretschneideri was a chloroplast protein. PMID:27158362

  7. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.


    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  8. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  9. The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.


    Nawathean, P; Maslov, D A


    By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs. PMID:10975258

  10. Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission

    PubMed Central

    Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei


    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  12. Nitric oxide mediated amelioration of arsenic toxicity which alters the alternative oxidase (Aox1) gene expression in Hordeum vulgare L.


    Shukla, Pratiksha; Singh, Shalini; Dubey, Pragyan; Singh, Aradhana; Singh, A K


    The role of nitric oxide (NO) as a key molecule in the signal transduction pathway of a biotic stress response has already been described. Recent studies indicate that it also participate in the signaling of abiotic stresses. In the present study, we showed the altered expression of stress responsive gene alternative oxidase (Aox1) in seedlings of barley (Hordeum vulgare L.) in response to arsenic toxicity. Arsenic toxicity decreased the germination percentage, biomass, chlorophyll and carotenoid content whereas, arsenic toxicity enhanced the MDA content and proline content in a dose dependent manner. Other enzyme activities like catalase and superoxide dismutase increased with the increase in concentrations but it fell down at higher concentration of arsenic. Pretreatment of nitric oxide results in the enhanced expression of alternative oxidase which showed the adaptation of alternative pathway during the arsenic stress and it also enhances the growth ability and adaptability towards the arsenic stress. The results support the conclusion that nitric oxide ameliorates the arsenic toxicity not only at the level of antioxidant defense but also by affecting other mechanism of detoxification. PMID:26036416

  13. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre


    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit PMID:24383965

  14. Characterization and expression of a new class of zinc finger protein that binds to silencer region of ascorbate oxidase gene.


    Kisu, Y; Ono, T; Shimofurutani, N; Suzuki, M; Esaka, M


    A unique A/T-rich sequence (5'-AAAAAGTAAAAA-GTAAAAAAGTAAAAAG-3), referred to as the AGTA repeat, is found in the silencer region of the pumpkin ascorbate oxidase gene. A cDNA for protein (AOBP) that binds to the AGTA repeat was isolated from pumpkin by the southwestern method. The AOBP protein has a new class of zinc/DNA-binding domain named Dof/MOA domain that is highly conserved in many plant proteins and is significantly related to those of steroid hormone receptors and GATA1. Gel retardation analysis indicated that AOBP bound to the AGTA repeat through the Dof/MOA domain. Metal chelators, 1,10-phenanthroline and EDTA, specifically inhibited the DNA binding of AOBP, indicating that metal coordination plays an important role in DNA binding of AOBP. Thus, the Dof/MOA domain acts as a zinc/DNA-binding domain in AOBP. Gel retardation analysis with mutated oligonucleotides suggested that the Dof/MOA domain recognized the AGTA core sequence. AOBP mRNA was expressed in mature tissues of pumpkin, but was expressed only in small amounts or was not expressed in growing tissues. Furthermore, the expression was auxin-independent. The expression pattern of AOBP and that of ascorbate oxidase did not show a positive correlation. PMID:9871365

  15. Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin.

    PubMed Central

    Terao, M; Kurosaki, M; Demontis, S; Zanotta, S; Garattini, E


    Aldehyde oxidase (AO) is a molybdo-flavo enzyme involved in the metabolism of various endogenous and exogenous N-heterocyclic compounds of pharmacological and toxicological importance. The enzyme is the product of a gene which is implicated in the aetio-pathogenesis of familial recessive amyotrophic lateral sclerosis. Here, we report the cloning and structural characterization of the human AO gene. AO is a single copy gene approximately 85 kb long with 35 transcribed exons. The transcription-initiation site and the sequence of the 5'-flanking region, containing several putative regulatory elements, were determined. The 5'-flanking region contains a functional promoter, as assessed by appropriate reporter constructs in transient transfection experiments. Comparison of the AO gene structure shows conservation of the position and type of exon/intron junctions relative to those observed in the gene coding for another molybdo-flavoprotein, i.e. xanthine oxidoreductase (XOR). As the two genes code for proteins with a high level of amino acid identity, our results strongly suggest that the AO and XOR genetic loci arose as the consequence of a duplication event. Southern blot analysis conducted on genomic DNA from various animal species with specific cDNA probes indicates that the AO gene is less conserved than the XOR gene during evolution. PMID:9601067

  16. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H


    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  17. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).


    Wang, Wei; Liu, Ji-Hong


    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  18. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.


    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  19. The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA.


    Xu, Fenghao; Morin, Charles; Mitchell, Grant; Ackerley, Cameron; Robinson, Brian H


    Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354-->Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [(35)S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

  20. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.


    Rathinam, T; Gadde, U; Chapman, H D


    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  1. Molecular characterization of fire ants, Solenopsis spp., from Brazil based on analysis of mtDNA gene cytochrome oxidase I.


    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa


    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  2. Molecular Characterization of Fire Ants, Solenopsis spp., from Brazil Based on Analysis of mtDNA Gene Cytochrome Oxidase I

    PubMed Central

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa


    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  3. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.


    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto


    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  4. Effects of hydrogen sulfide on alternative pathway respiration and induction of alternative oxidase gene expression in rice suspension cells.


    Xiao, Man; Ma, Jun; Li, Hongyu; Jin, Han; Feng, Hanqing


    The toxic effects of H2S on plants are well documented. However, the molecular mechanisms reponsible for inhibition of plants by H2S are still not completely understood. We determined the effects of NaHS in the range of 0.5-10 mM on the growth of rice suspension culture cells, as well as on the expression of the alternative oxidase (AOX) gene. AOX is the terminal oxidase of the alternative pathway (AP) and exists in plant mitochondria. The results showed that H2S treatment enhanced the AP activity. During the process of H2S treatment for 4 h, the AP activity increased dramatically and achieved the peak value at a concentration of 2 mM NaHS. Then it declined at higher concentrations of NaHS (5-10 mM) and maintained a steady level. The AOX1 gene transcript level also showed a similar change as the AP activity. Interestingly, different NaHS concentrations seemed to have different effects on the expression of AOX1a, AOX1b, and AOX1c. The induction of AOX expression by low concentrations of NaHS was inferred through a reactive oxygen species (ROS)-independent pathway. At the same time, rice cells grown in culture were very sensitive to H2S, different H2S concentrations induced an increase in the cell viability. These results indicate that the H2S-induced AOX induction might play a role in inhibiting the ROS production and have an influence on cell viability. PMID:20737915

  5. Preexposure to Olive Oil Polyphenols Extract Increases Oxidative Load and Improves Liver Mass Restoration after Hepatectomy in Mice via Stress-Sensitive Genes

    PubMed Central

    Marinić, Jelena; Broznić, Dalibor; Milin, Čedomila


    Polyphenols can act as oxidants in some conditions, inducing redox-sensitive genes. We investigated the effect of preexposure to the olive oil polyphenols extract (PFE) on time-dependent changes in the hepatic oxidative state in a model of liver regeneration—a process in which oxidative stress associated with the metabolic overload accounts for the early events that contribute to the onset of liver self-repair. Liver regeneration was induced by one-third hepatectomy in mice. Prior to hepatectomy, mice were intraperitoneally given either PFE (50 mg/kg body weight) or saline for seven consecutive days, while respective controls received vehicle alone. Redox state-regulating enzymes and thiol proteins along with the mRNA levels of Nrf2 gene and its targets γ-glutamylcysteine synthetase and heme oxygenase-1 were determined at different time intervals after hepatectomy. The liver mass restoration was calculated to assess hepatic regeneration. The resulting data demonstrate the effectiveness of preexposure to PFE in stimulating liver regeneration in a model of a small tissue loss which may be ascribed to the transient increase in oxidant load during the first hours after hepatectomy and associated induction of stress response gene-profiles under the control of Nrf2. PMID:26925195

  6. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  7. Blueberry polyphenols attenuate kainic acid-induced decrements in cognition and alter inflammatory gene expression in rat hippocampus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cognitive impairment in age-related neurodegenerative diseases such as Alzheimer's disease may be partly due to long-term exposure and increased susceptibility to inflammatory insults. In the current study we investigated whether polyphenols in blueberries (BBs) can reduce the deleterious effects o...

  8. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.


    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M


    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  9. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.


    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K


    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed. PMID:10945344

  10. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo


    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  11. Mutations of the SCO1 Gene in Mitochondrial Cytochrome c Oxidase Deficiency with Neonatal-Onset Hepatic Failure and Encephalopathy

    PubMed Central

    Valnot, Isabelle; Osmond, Sandrine; Gigarel, Nadine; Mehaye, Blandine; Amiel, Jeanne; Cormier-Daire, Valérie; Munnich, Arnold; Bonnefont, Jean-Paul; Rustin, Pierre; Rötig, Agnès


    Cytochrome c oxidase (COX) catalyzes both electron transfer from cytochrome c to molecular oxygen and the concomitant vectorial proton pumping across the inner mitochondrial membrane. Studying a large family with multiple cases of neonatal ketoacidotic comas and isolated COX deficiency, we have mapped the disease locus to chromosome 17p13.1, in a region encompassing two candidate genes involved in COX assembly—namely, SCO1 and COX10. Mutation screening revealed compound heterozygosity for SCO1 gene mutations in the patients. The mutated allele, inherited from the father, harbored a 2-bp frameshift deletion (ΔGA; nt 363–364) resulting in both a premature stop codon and a highly unstable mRNA. The maternally inherited mutation (C520T) changed a highly conserved proline into a leucine in the protein (P174L). This proline, adjacent to the CxxxC copper-binding domain of SCO1, is likely to play a crucial role in the tridimentional structure of the domain. Interestingly, the clinical presentation of SCO1-deficient patients markedly differs from that of patients harboring mutations in other COX assembly and/or maturation genes. PMID:11013136

  12. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang


    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  13. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.


    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru


    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli. PMID:26369789

  14. Dual gene defects involving delta-aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient.


    Akagi, Reiko; Inoue, Rikako; Muranaka, Shikibu; Tahara, Tsuyoshi; Taketani, Shigeru; Anderson, Karl E; Phillips, John D; Sassa, Shigeru


    Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary delta-aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835-->C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild-type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36-->G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level. PMID:16398658

  15. Reduction of coproporphyrinogen oxidase level by antisense RNA synthesis leads to deregulated gene expression of plastid proteins and affects the oxidative defense system.

    PubMed Central

    Kruse, E; Mock, H P; Grimm, B


    A full-length cDNA sequence encoding coproporphyrinogen oxidase was inserted in inverse orientation behind a CaMV promoter and transferred to tobacco (Nicotiana tabacum) by standard transformation techniques. Transformants showed reduced coproporphyrinogen oxidase activity and accumulation of photosensitive coproporphyrin(ogen), indicating antisense RNA expression. An inverse correlation was observed between the level of coproporphyrinogen oxidase and transformant phenotype. The latter is characterized by a broad range of growth retardation and necrosis, indicating oxidative leaf damage. Coproporphyrinogen is an apparent chromophore and its excitation finally leads to the production of reactive oxygen. Evidence is presented that indicates a direct correlation between the accumulation of non-metabolized coproporphyrinogen and oxidative damage to cellular structural components. Enzymatic and non-enzymatic antioxidants were investigated. Whereas superoxide dismutase activity increased in transgenic plants, catalase and ascorbate peroxidase activity remained constant. Tocopherol, rather than carotene or zeaxanthin, seemed to be involved in detoxification, indicating the putative localization and allocation of coproporphyrinogen. Expression of coproporphyrinogen oxidase antisense RNA did not significantly influence the level of other enzymes in the chlorophyll metabolic pathway, but deregulated gene expression of nuclear encoded plastid proteins. Accumulation of coproporphyrinogen and/or the resulting effects, such as oxidative stress, impairs a plastid/nuclear signal which may adapt gene expression to the plastid state. Images PMID:7641690

  16. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].


    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A


    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  17. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.


    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai


    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

  18. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min


    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  19. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan


    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  20. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.


    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie


    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols. PMID:26305170

  1. Anti-necrosis potential of polyphenols against snake venoms.


    Leanpolchareanchai, Jiraporn; Pithayanukul, Pimolpan; Bavovada, Rapepol


    Polyphenols from the extracts of Areca catechu L. and Quercus infectoria Oliv. inhibited phospholipase A(2), proteases, hyaluronidase and L-amino acid oxidase of Naja naja kaouthia Lesson (NK) and Calloselasma rhodostoma Kuhl (CR) venoms by in vitro tests. Both extracts inhibited the hemorrhagic activity of CR venom and the dermonecrotic activity of NK venom by in vivo tests. The inhibitory activity of plant polyphenols against local tissue necrosis induced by snake venoms may be caused by inhibition of inflammatory reactions, hemorrhage, and necrosis. The result implies the therapeutic potential of plant polyphenols against necrosis in snakebite victims. PMID:19874222

  2. Elevated Transcription of the Gene QSOX1 Encoding Quiescin Q6 Sulfhydryl Oxidase 1 in Breast Cancer

    PubMed Central

    Soloviev, Mikhail; Esteves, Michelle P.; Amiri, Fakhria; Crompton, Mark R.; Rider, Christopher C.


    The q arm of chromosome 1 is frequently amplified at the gene level in breast cancer. Since the significance of this is unclear we investigated whether 1q genes are overexpressed in this disease. The cDNA levels of 1q-located genes were analysed in a search for overexpressed genes. 26 genes mapping to the 1q arm show highly significant (P≤0.01) overexpression of transcripts in breast cancer compared to normal breast tissue. Amongst those showing the highest levels of overexpression in both expressed sequence tag (EST) and serial analysis of gene expression (SAGE) databases was enzyme quiescin Q6 sulfhydryl oxidase 1 (QSOX1). We investigated QSOX1 cDNA derived from T47D breast carcinoma cells by RT-PCR and 3′-RACE PCR and identified a novel extended form of QSOX1 transcript, containing a long 3′UTR, nearly double the size of the previously reported QSOX1 cDNA, and confirmed its 3′ end nucleotide sequence using RACE-PCR. We also used quantitative real-time PCR to analyse a panel of cDNAs derived from 50 clinically-graded normal and malignant breast tissue samples for the expression of QSOX1 mRNAs. QSOX1 transcription was elevated in an increasing proportion in the grade 2 and grade 3 tumours (graded according to the Nottingham prognostic index), with 10 of the 15 grade 3 tumours (67%) examined exceeding the normal range. There was a significant correlation between relative transcript level and clinical grade (P≤0.01) for all qPCR primer sets tested. QSOX1 mRNA levels, based on SAGE expression data, did not correlate with either Estrogen Receptor (ER) or Epidermal Growth Factor Receptor 2 (ErbB-2 or HER2/neu) expression. Our data indicate that QSOX1 is a potential new prognostic marker which may prove of use in the staging of breast tumours and the stratification of breast cancer patients. PMID:23460839

  3. Molecular characterization of Echinococcus granulosus from Peru by sequencing of the mitochondrial cytochrome C oxidase subunit 1 gene.


    Sánchez, Elizabeth; Cáceres, Omar; Náquira, César; Garcia, David; Patiño, Gladys; Silvia, Herrera; Volotão, Aline C; Fernandes, Octavio


    Echinococcus granulosus, the etiologic agent of cystic echinococcosis (CE) in humans and other animal species, is distributed worldwide. Ten intra-specific variants, or genotypes (G1-G10), have been defined based on genetic diversity. To determine the genotypes present in endemic areas of Peru, samples were collected from cattle (44), sheep (41) and humans (14) from Junín, Puno Huancavelica, Cusco, Arequipa and Ayacucho. DNA was extracted from protoscolex and/or germinal layers derived from 99 E. granulosus isolates and used as templates to amplify the mitochondrial cytochrome C oxidase subunit 1 gene. The resulting polymerase chain reaction products were sequenced and further examined by sequence analysis. All isolates, independent of the host, exhibited the G1 genotype. Phylogenetic analysis showed that three isolates from Ayacucho shared the same cluster with microvariant G1(4). The G1 genotype is considered the most widespread and infectious form of E. granulosus worldwide and our results confirm that the same patterns apply to this country. Therefore, these findings should be taken into consideration in developing prevention strategies and control programs for CE in Peru. PMID:20944997

  4. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.


    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K


    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma. PMID:21921941

  5. Mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): avenues for potential implications.


    Traversa, Donato; Costanzo, Francesca; Iorio, Raffaella; Aroch, Itamar; Lavy, Eran


    Canine spirocercosis is a life-threatening parasitosis caused by Spirocerca lupi (Nematoda, Spirurida) that is presently emerging in several countries. This study characterised an informative region within the mitochondrial (mtDNA) gene encoding for the cytochrome c oxidase subunit 1 (cox1) of S. lupi by Polymerase Chain Reaction (PCR)-coupled sequencing. Specimens from five different countries in Europe, Asia and Africa were examined and two different sequence variants of cox1 (i.e. haplotypes) were determined, displaying nucleotidic variation at 6 of 689 positions. All of these positions were invariable among all the parasite individuals from Europe (haplotype 1) and among the African and Asian individuals (haplotype 2), but differed between Europe and Asia/Africa. The S. lupi cox1 sequences were consistent with those of other common Spirurida previously reported at both nucleotidic and phylogenetic levels. This study provides molecular information essential for identification of the nematode, irrespective of its life cycle stage. Crucial implications for the specific molecular diagnosis of clinical spirocercosis and investigation of the evolution, population genetics, ecology and epidemiology of S. lupi are discussed. PMID:17428608

  6. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs.


    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos


    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5' homology arm (HA) of 8 kb and 3'HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3'HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  7. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos


    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  8. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  9. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.


    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  10. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.


    Martins, C; Fontes, L R; Bueno, O C; Martins, V G


    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul). PMID:20924414

  11. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.


    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  12. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.


    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M


    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  13. Species delimitation and phylogenetic relationships of Chinese Leishmania isolates reexamined using kinetoplast cytochrome oxidase II gene sequences.


    Cao, De-Ping; Guo, Xian-Guang; Chen, Da-Li; Chen, Jian-Ping


    Leishmaniasis is a geographically widespread disease caused by protozoan parasites belonging to the genus Leishmania and transmitted by certain species of sand fly. This disease still remains endemic in China, especially in the west and northwest frontier regions. A recent ITS1 phylogeny of Chinese Leishmania isolates has challenged some aspects for their traditional taxonomy and cladistic hypotheses of their phylogeny. However, disagreement with respect to relationships within Chinese Leishmania isolates highlights the need for additional data and analyses. Here, we test the phylogenetic relationships among Chinese isolates and their relatives by analyzing kinetoplast cytochrome oxidase II (COII) gene sequences, including 14 Chinese isolates and three isolates from other countries plus 17 sequences retrieved from GenBank. The COII gene might have experienced little substitution saturation, and its evolutionary process was likely to have been stationary, reversible, and homogeneous. Both neighbor-joining and Bayesian analyses reveal a moderately supported group comprising ten newly determined isolates, which is closely related to Leishmania tarentolae and Endotrypanum monterogeii. In combination with genetic distance analysis as well as Bayesian hypothesis testing, this further corroborates the occurrence of an undescribed species of Leishmania. Our results also suggest that (1) isolate MHOM/CN/93/GS7 and isolate IPHL/CN/77/XJ771 are Leishmania donovani; (2) isolate MHOM/CN/84/JS1 is Leishmania tropica; (3) the status referring to an isolate MRHO/CN/62/GS-GER20 from a great gerbil in Gansu, China, as Leishmania gerbilli, formerly based on multilocus enzyme electrophoresis, is recognized; and (4) E. monterogeii is nested within the genus Leishmania, resulting in a paraphyletic Leishmania. In addition, the results of this study enrich our understanding of the heterogeneity and relationships of Chinese Leishmania isolates. PMID:21221640

  14. Secretory expression and purification of Aspergillus niger glucose oxidase in Saccharomyces cerevisiae mutant deficient in PMR1 gene.


    Ko, Ji-Hyun; Hahm, Moon Sun; Kang, Hyun Ah; Nam, Soo Wan; Chung, Bong Hyun


    The gene encoding glucose oxidase (GOD) from Aspergillus niger was expressed as a secretory product in the yeast Saccharomyces cerevisiae. Six consecutive histidine residues were fused to the C-terminus of GOD to facilitate purification. The recombinant GOD-His(6) secreted by S. cerevisiae migrated as a broad diffuse band on SDS-PAGE, with an apparent molecular weight higher than that in natural A. niger GOD. To investigate the effects of hyperglycosylation on the secretion efficiency and enzyme properties, GOD-His(6) was expressed and secreted in a S. cerevisiae mutant in which the PMR1 gene encoding Ca(++)-ATPase was disrupted. The pmr1 null mutant strain secreted an amount of GOD-His(6) per unit cell mass higher than that in the wild-type strain. In contrast to the hyperglycosylated GOD-His(6) secreted in the wild-type strain, the pmr1 mutant strain secreted GOD-His(6) in a homogeneous form with a protein band pattern similar to that in natural A. niger GOD, based on SDS-PAGE. The hyperglycosylated and pmr1Delta mutant-derived GOD-His(6) enzymes were purified to homogeneity by immobilized metal ion-affinity chromatography and their specific activities and stabilities were compared. The specific activity of the pmr1Delta mutant-derived GOD-His(6) on a protein basis was very similar to that of the hyperglycosylated GOD-His(6), although its pH and thermal stabilities were lower than those of the hyperglycosylated GOD-His(6). PMID:12182830

  15. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations.


    Kovářová, Nikola; Cížková Vrbacká, Alena; Pecina, Petr; Stránecký, Viktor; Pronicka, Ewa; Kmoch, Stanislav; Houštěk, Josef


    The loss of Surf1 protein leads to a severe COX deficiency manifested as a fatal neurodegenerative disorder, the Leigh syndrome (LS(COX)). Surf1 appears to be involved in the early step of COX assembly but its function remains unknown. The aim of the study was to find out how SURF1 gene mutations influence expression of OXPHOS and other pro-mitochondrial genes and to further characterize the altered COX assembly. Analysis of fibroblast cell lines from 9 patients with SURF1 mutations revealed a 70% decrease of the COX complex content to be associated with 32-54% upregulation of respiratory chain complexes I, III and V and accumulation of Cox5a subunit. Whole genome expression profiling showed a general decrease of transcriptional activity in LS(COX) cells and indicated that the adaptive changes in OXPHOS complexes are due to a posttranscriptional compensatory mechanism. Electrophoretic and WB analysis showed that in mitochondria of LS(COX) cells compared to controls, the assembled COX is present entirely in a supercomplex form, as I-III₂-IV supercomplex but not as larger supercomplexes. The lack of COX also caused an accumulation of I-III₂ supercomplex. The accumulated Cox5a was mainly present as a free subunit. We have found out that the major COX assembly subcomplexes accumulated due to SURF1 mutations range in size between approximately 85-140kDa. In addition to the originally proposed S2 intermediate they might also represent Cox1-containing complexes lacking other COX subunits. Unlike the assembled COX, subcomplexes are unable to associate with complexes I and III. PMID:22465034

  16. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )


    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  17. A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio.


    Hernández-Romero, Diana; Sanchez-Amat, Antonio; Solano, Francisco


    The sequencing of the genome of Ralstonia solanacearum[Salanoubat M, Genin S, Artiguenave F, et al. (2002) Nature 415, 497-502] revealed several genes that putatively code for polyphenol oxidases (PPOs). This soil-borne pathogenic bacterium withers a wide range of plants. We detected the expression of two PPO genes (accession numbers NP_518458 and NP_519622) with high similarity to tyrosinases, both containing the six conserved histidines required to bind the pair of type-3 copper ions at the active site. Generation of null mutants in those genes by homologous recombination mutagenesis and protein purification allowed us to correlate each gene with its enzymatic activity. In contrast with all tyrosinases so far studied, the enzyme NP_518458 shows higher monophenolase than o-diphenolase activity and its initial activity does not depend on the presence of l-dopa cofactor. On the other hand, protein NP_519622 is an enzyme with a clear preference to oxidize o-diphenols and only residual monophenolase activity, behaving as a catechol oxidase. These catalytic characteristics are discussed in relation to two other characteristics apart from the six conserved histidines. One is the putative presence of a seventh histidine which interacts with the carboxy group on the substrate and controls the preference for carboxylated and decarboxylated substrates. The second is the size of the residue isosteric with the aromatic F261 reported in sweet potato catechol oxidase which acts as a gate to control accessibility to CuA at the active site. PMID:16403014

  18. The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.


    Altamura, N; Capitanio, N; Bonnefoy, N; Papa, S; Dujardin, G


    The nuclear gene OXA1 was first isolated in Saccharomyces cerevisiae and found to be required at a post-translational step in cytochrome c oxidase biogenesis, probably at the level of assembly. Mutations in OXA1 lead to a complete respiratory deficiency. The protein Oxa1p is conserved through evolution and a human homolog has been isolated by functional complementation of a yeast oxa1- mutant. In order to further our understanding of the role of Oxa1p, we have constructed two yeast strains in which the OXA1 open reading frame was almost totally deleted. Cytochrome spectra and enzymatic activity measurements show the absence of heme aa3 and of a cytochrome c oxido-reductase activity and dramatic decrease of the oligomycin sensitive ATPase activity. Analysis of the respiratory complexes in non-denaturing gels reveals that Oxa1p is necessary for the correct assembly of the cytochrome c oxidase and the ATP synthase complex. PMID:8612730

  19. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.


    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  20. CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice.


    Wang, Qiang; Hillwig, Matthew L; Peters, Reuben J


    Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochrome P450 (CYP) mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNA interference double knock-down of this pair of closely related CYPs reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which was ultimately achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al, and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al, and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene-derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  1. Effects of water blanching on polyphenol reaction kinetics and quality of cocoa beans

    NASA Astrophysics Data System (ADS)

    Menon, A. S.; Hii, C. L.; Law, C. L.; Suzannah, S.; Djaeni, M.


    Several studies have been reported on the potential health benefits of cocoa polyphenols. However, drying has an inhibitory effect on the substantial recovery of cocoa polyphenols. This is majorly because of the high degradation of polyphenol compounds as well as the enhanced activity of polyphenol oxidases; a pre-cursor for browning of polyphenols during drying. Pre-treatment technique such as water blanching (80° and 90°C for 5 min, 10 min and 15 min exposure times respectively) can inactivate the polyphenol oxidases enzyme and promote high percent of the polyphenol recovery in dried cocoa bean. The degradation kinetics of cocoa polyphenols during hot water blanching are analyzed; The rate constant for the polyphenol degradation after blanching was found to be ranging from 0.0208 to 0.0340 /min. The results for dried fresh cocoa beans showed an optimal level of polyphenol recovery (118 mg GAE/g) when blanched at 90°C for 5 minutes duration. The antioxidant activity is also analyzed using DPPH scavenging assay.

  2. Why Polyphenols have Promiscuous Actions? An Investigation by Chemical Bioinformatics.


    Tang, Guang-Yan


    Despite their diverse pharmacological effects, polyphenols are poor for use as drugs, which have been traditionally ascribed to their low bioavailability. However, Baell and co-workers recently proposed that the redox potential of polyphenols also plays an important role in this, because redox reactions bring promiscuous actions on various protein targets and thus produce non-specific pharmacological effects. To investigate whether the redox reactivity behaves as a critical factor in polyphenol promiscuity, we performed a chemical bioinformatics analysis on the structure-activity relationships of twenty polyphenols. It was found that the gene expression profiles of human cell lines induced by polyphenols were not correlated with the presence or not of redox moieties in the polyphenols, but significantly correlated with their molecular structures. Therefore, it is concluded that the promiscuous actions of polyphenols are likely to result from their inherent structural features rather than their redox potential. PMID:27319142

  3. Wound-induced deposition of polyphenols in transgenic plants overexpressing peroxidase

    SciTech Connect

    Lagrimini, L.M. )


    Tobacco (Nicotiana tabacum) plants transformed with a chimeric tobacco anionic peroxidase gene have previously been shown to synthesize high levels of peroxidase in all tissues throughout the plant. One of several distinguishable phenotypes of transformed plants is the rapid browning of pith tissue upon wounding. Pith tissue from plants expressing high levels of peroxidase browned within 24 hours of wounding, while tissue from control plants did not brown as late as 7 days after wounding. A correlation between peroxidase activity and wound-induced browning was observed, whereas no relationship between polyphenol oxidase activity and browning was found. The purified tobacco anionic peroxidase was subjected to kinetic analysis with substrates which resemble the precursors of lignin or polyphenolic acid. The purified enzyme was found to readily polymerize phenolic acids in the presence of H{sub 2}O{sub 2} via a modified ping-pong mechanism. The percentage of lignin and lignin-related polymers in cell walls was nearly twofold greater in pith tissue isolated from peroxidase-overproducer plants compared to control plants. Lignin deposition in wounded pith tissue from control plants closely followed the induction of peroxidase activity. However, wound-induced lignification occurred 24 to 48 hours sooner in plants overexpressing the anionic peroxidase. This suggests that the availability of peroxidase rather than substrate may delay polyphenol deposition in wounded tissue.

  4. Impact of Dietary Polyphenols on Carbohydrate Metabolism

    PubMed Central

    Hanhineva, Kati; Törrönen, Riitta; Bondia-Pons, Isabel; Pekkinen, Jenna; Kolehmainen, Marjukka; Mykkänen, Hannu; Poutanen, Kaisa


    Polyphenols, including flavonoids, phenolic acids, proanthocyanidins and resveratrol, are a large and heterogeneous group of phytochemicals in plant-based foods, such as tea, coffee, wine, cocoa, cereal grains, soy, fruits and berries. Growing evidence indicates that various dietary polyphenols may influence carbohydrate metabolism at many levels. In animal models and a limited number of human studies carried out so far, polyphenols and foods or beverages rich in polyphenols have attenuated postprandial glycemic responses and fasting hyperglycemia, and improved acute insulin secretion and insulin sensitivity. The possible mechanisms include inhibition of carbohydrate digestion and glucose absorption in the intestine, stimulation of insulin secretion from the pancreatic β–cells, modulation of glucose release from the liver, activation of insulin receptors and glucose uptake in the insulin-sensitive tissues, and modulation of intracellular signalling pathways and gene expression. The positive effects of polyphenols on glucose homeostasis observed in a large number of in vitro and animal models are supported by epidemiological evidence on polyphenol-rich diets. To confirm the implications of polyphenol consumption for prevention of insulin resistance, metabolic syndrome and eventually type 2 diabetes, human trials with well-defined diets, controlled study designs and clinically relevant end-points together with holistic approaches e.g., systems biology profiling technologies are needed. PMID:20480025

  5. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.


    Sell, Simone; Hehl, Reinhard


    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  6. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.


    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei


    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties. PMID:15115779

  7. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T


    Urate oxidase, or uricase (EC, is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  8. Abscisic Acid and LATERAL ROOT ORGAN DEFECTIVE/NUMEROUS INFECTIONS AND POLYPHENOLICS Modulate Root Elongation via Reactive Oxygen Species in Medicago truncatula1[W][OPEN

    PubMed Central

    Zhang, Chang; Bousquet, Amanda; Harris, Jeanne M.


    Abscisic acid (ABA) modulates root growth in plants grown under normal and stress conditions and can rescue the root growth defects of the Medicago truncatula lateral root-organ defective (latd) mutant. Here, we demonstrate that reactive oxygen species (ROS) function downstream of ABA in the regulation of root growth by controlling cell elongation. We also show that the MtLATD/NUMEROUS INFECTIONS AND POLYPHENOLICS (NIP) nitrate transporter is required for ROS homeostasis and cell elongation in roots and that this balance is perturbed in latd mutants, leading to an excess of superoxide and hydrogen peroxide and a corresponding decrease in cell elongation. We found that expression of the superoxide-generating NADPH oxidase genes, MtRbohA and MtRbohC (for respiratory burst oxidase homologs), is increased in latd roots and that inhibition of NADPH oxidase activity pharmacologically can both reduce latd root ROS levels and increase cell length, implicating NADPH oxidase function in latd root growth defects. Finally, we demonstrate that ABA treatment alleviates ectopic ROS accumulation in latd roots, restores MtRbohC expression to wild-type levels, and promotes an increase in cell length. Reducing the expression of MtRbohC using RNA interference leads to increased root elongation in both wild-type and latd roots. These results reveal a mechanism by which the MtLATD/NIP nitrate transporter and ABA modulate root elongation via superoxide generation by the MtRbohC NADPH oxidase. PMID:25192698

  9. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.


    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W


    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  10. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.


    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  11. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.


    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  12. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.


    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu


    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  13. The sequence divergence in cytochrome C oxidase I gene of Culex quinquefasciatus mosquito and its comparison with four other Culex species.


    Tahir, Hafiz Muhammad; Kanwal, Naila; Mehwish


    The genetic diversity of Culex quinquefasciatus mosquito based on the standard barcode region of cytochrome C oxidase I (COI) gene fragment was studied in the present study. The COI gene sequences of Cx. quinquefasciatus were also compared with four other species of Genus Culex (i.e. Cx. tritaeniorhynchus, Cx. fuscocephala, Cx. pipiens, and Cx. theileri). Our data set included sequences of Culex mosquitoes from 16 different countries of world. The average intraspecific and interspecific divergences recorded were 0.67% and 8.27%, respectively. The clades for five species were clearly separated except Cx. quinquefasciatus and Cx. pipiens. It is concluded that the DNA barcoding is effective and reliable tool for the identification of selected Culex species but create little problem in case of sister species. PMID:26258502

  14. Polyphenols and Glycemic Control

    PubMed Central

    Kim, Yoona; Keogh, Jennifer B.; Clifton, Peter M.


    Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1), stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5′ adenosine monophosphate-activated protein kinase (AMPK), modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols. PMID:26742071

  15. Polyphenols and Glycemic Control.


    Kim, Yoona; Keogh, Jennifer B; Clifton, Peter M


    Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1), stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5' adenosine monophosphate-activated protein kinase (AMPK), modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols. PMID:26742071

  16. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.


    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing


    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function. PMID:24890187

  17. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  18. Effect of herbal polyphenols on atherogenic transcriptome.


    Kaul, Deepak; Shukla, Akshay R; Sikand, Kavleen; Dhawan, Veena


    The ancient Indian system of medicine supports the antiatherogenic properties of some herbs. The crosstalk amongst the genes coding for LDLR, LXRalpha, PPARs (alpha,gamma), CD-36 and c-myc may be important in atherogenesis because these genes control lipid metabolism, cytokine production and cellular activity within the arterial wall. Hence, we attempted for the first time to explore whether or not the polyphenols extracted from medicinal herbs had any effect on the transcription of these genes. Normal human mononuclear cells were cultured in the presence of polyphenols (and their HPLC purified sub-fractions) extracted from Green tea (Camellia sinensis), Neem (Azadirachta indica) and Tulsi (Ocimum sanctum). Transcriptional expression of these genes was measured by using RT-PCR and SCION IMAGE analysis software. These polyphenolic extracts were found to have the inherent capacity to inhibit the transcriptional expression of genes having direct involvement in atherogenic process. On the basis of these results, we propose for the first time that HPLC purified polyphenolic fraction IV of Tulsi may have a profound antiatherogenic effect. PMID:16180103

  19. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.


    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake


    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  20. Decreased shoot stature and grain alpha-amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat.


    Appleford, Nigel E J; Wilkinson, Mark D; Ma, Qian; Evans, Daniel J; Stone, Marlon C; Pearce, Stephen P; Powers, Stephen J; Thomas, Stephen G; Jones, Huw D; Phillips, Andrew L; Hedden, Peter; Lenton, John R


    Ectopic expression of a gibberellin 2-oxidase gene (PcGA2ox1) decreased the content of bioactive gibberellins (GAs) in transgenic wheat, producing a range of dwarf plants with different degrees of severity. In at least one case, a single transformation event gave rise to T(1) plants with different degrees of dwarfism, the phenotypes being stably inherited over at least four generations. The dwarf phenotype, which included dark-green leaves, increased tillering and, in severe cases, a prostrate growth habit, was replicated by the application of a GA biosynthesis inhibitor to the wild type. Ear rachis length, grain set, and grain size were also decreased in the wheat transformants, compared with an azygous (null) line. The extent of post-germination alpha-amylase production in grains reflected the severity of the shoot phenotype of the transformants and both developmental processes were restored to normal by the application of gibberellic acid (GA(3)). Expression of two GA biosynthesis genes (TaGA20ox1 and TaGA3ox2) was up-regulated, and that of two alpha-amylase gene families (alpha-Amy1 and alpha-Amy2) down regulated, in scutella of semi-dwarf lines, compared with controls. The marked decline in transcript abundance of both alpha-amylase gene families in aleurone was associated with a decreased content of bioactive GAs in grains of the semi-dwarf lines. PMID:17916639

  1. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.


    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing


    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  2. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.


    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua


    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step. PMID:26287950

  3. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.


    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio


    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  4. In Vitro and in Vivo Antitumoral Effects of Combinations of Polyphenols, or Polyphenols and Anticancer Drugs: Perspectives on Cancer Treatment

    PubMed Central

    Fantini, Massimo; Benvenuto, Monica; Masuelli, Laura; Frajese, Giovanni Vanni; Tresoldi, Ilaria; Modesti, Andrea; Bei, Roberto


    Carcinogenesis is a multistep process triggered by genetic alterations that activate different signal transduction pathways and cause the progressive transformation of a normal cell into a cancer cell. Polyphenols, compounds ubiquitously expressed in plants, have anti-inflammatory, antimicrobial, antiviral, anticancer, and immunomodulatory properties, all of which are beneficial to human health. Due to their ability to modulate the activity of multiple targets involved in carcinogenesis through direct interaction or modulation of gene expression, polyphenols can be employed to inhibit the growth of cancer cells. However, the main problem related to the use of polyphenols as anticancer agents is their poor bioavailability, which might hinder the in vivo effects of the single compound. In fact, polyphenols have a poor absorption and biodistribution, but also a fast metabolism and excretion in the human body. The poor bioavailability of a polyphenol will affect the effective dose delivered to cancer cells. One way to counteract this drawback could be combination treatment with different polyphenols or with polyphenols and other anti-cancer drugs, which can lead to more effective antitumor effects than treatment using only one of the compounds. This report reviews current knowledge on the anticancer effects of combinations of polyphenols or polyphenols and anticancer drugs, with a focus on their ability to modulate multiple signaling transduction pathways involved in cancer. PMID:25918934

  5. [Genetic variation and differentiation of wood mice from the genus Sylvaemus inferred from sequencing of the cytochrome oxidase subunit 1 gene fragment].


    Bogdanov, A S; Stakheev, V V; Zykov, A E; Iakimenko, V V; Mal'kova, M G


    To ascertain intra- and interspecific differentiation patterns of some Sylvaemus wood mice species (S. uralensis, S. sylvaticus, S. ponticus, S. flavicollis, and S. fulvipectus), sequence variation of the mitochondrial cytochrome oxidase subunit I gene (COI) fragment (654 bp) was analyzed and the data obtained using several molecular genetic markers were compared. Distinct isolation of all Sylvaemus species (including closely related allopatric S. flavicollis and S. ponticus), as well as of the European and Asian races of pygmy wood mouse S. uralensis at the COI gene was demonstrated. However, genetic differences of the Sylvaemus species were 1.5 times and more higher than the distance (D) between the races of S. uralenciis. This finding provides no ample grounds to treat the latter as the independent species. The only specimen of Pamir-Alay subspecies S. uralensis pallipes examined showed closest relatedness to to the Asian race, although was rather distant from it (D = 0.038). No reliable isolation of the eastern European and southern European chromosomal forms, representing the European race of S. uralensis, as well as of their presumptive hybrids from the outskirts of the city of Sal'sk, Rostov region, at the COI gene was revealed. A hybrid origin of the populations of pygmy wood mouse from the outskirts of the Talapker railway station, Novovarshavsky district, Omsk region, was confirmed. In preliminary studies, based on karyotypic characters, these populations were diagnosed as distant hybrids of the eastern European chromosomal form and the Asian race. In yellow-necked wood mouse S. flavicollis from the territory of Russia and Ukraine, weak differentiation into northern and southern lineages (with mean genetic distance between them of 0.020) was observed. Considerably different relative genetic distances between the races of S. uralensis and the S. flavicollis--S. ponticus species pair, inferred from the mitochondrial cytochrome oxidase and cytochrome b gene

  6. Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    PubMed Central


    Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

  7. Polyphenols and gastrointestinal diseases

    PubMed Central

    Dryden, Gerald W.; Song, Ming; McClain, Craig


    Purpose of review This article will review the role of polyphenols in gastrointestinal diseases. Ingested polyphenols are concentrated in the gastrointestinal tract and are not well absorbed into the rest of the body. Thus, the high luminal concentrations achieved support a potential for therapeutic uses in the gastrointestinal tract. Additionally, there is great interest from the general public in complementary and alternative medicine. Recent findings Dietary polyphenols are a major source of antioxidants consumed by humans. Polyphenols possess not only antioxidant properties but also antiviral, antibacterial, antiinflammatory and anticarcinogenic effects, as well as the ability to modulate certain signaling pathways such as nuclear factor-κB activation. Green tea polyphenols have been shown to have efficacy in various models of inflammatory bowel disease. Silymarin, or milk thistle, is hepatoprotective against many forms of experimental liver injury and is widely used in human liver diseases, such as hepatitis C and alcoholic cirrhosis, with an excellent safety profile (but with unclear efficacy). Summary Substantial in-vitro and animal studies support the beneficial effects of polyphenols in many gastrointestinal diseases. Well designed multicenter trials in humans, such as those called for in the 2005 National Institutes of Health Requests for Applications for Silymarin Centers, will be critical for defining the safety, appropriate dosing and therapeutic efficacy of such agents. PMID:16462174

  8. Prevention of benzene-induced genotoxicity in bone marrow and lung cells: superiority of polyphenolic acetates to polyphenols.


    Kumar, Ajit; Sushama, Anupam; Rohil, Vishwajeet; Manral, Sushma; Gangopadhyay, Sukanya; Prasad, Ashok K; Raj, Hanumantharao G; Parmar, Virender S


    Previous investigations carried out in our laboratory have highlighted that 7,8-diacetoxy-4-methylcoumarin demonstrates a mechanism-based inhibition of cytochrome P450 (Cyt-P450) activities such as microsome-mediated aflatoxin B1 (AFB1) epoxidation, dealkylation of alkylated resorufin, and toxicokinetics of benzene. 7,8-Diacetoxy-4-methylcoumarin, quercetin pentaacetate, and ellagic acid peracetate were also found to be effective in giving the protection of AFB1-induced genotoxicity in rat's bone marrow and lung cells possibly due to acetylation of Cyt-P450 apoprotein mediated by acetoxy drug: protein transacetylase. Later, this transacetylase was identified as calreticulin, and the acetyltransferase function of calreticulin was appropriately termed calreticulin transacetylase. In this communication, we have focused on the superiority of several classes of polyphenolic acetates to polyphenols in the modification of Cyt-P450-linked mixed function oxidases (MFOs) such as 7-ethoxyresorufin O-deethylase (EROD) and pentoxyresorufin O-dealkylase (PROD). Special attention has also been focused on benzene-induced genotoxicity in bone marrow and lung cells. Results clearly indicated that polyphenolic acetates demonstrated time-dependent inhibition of Cyt-P450-linked MFOs, while parent polyphenols failed to demonstrate the same. Polyphenolic acetates were found to be more superior to polyphenols in preventing benzene-induced micronuclei formation. The pattern of inhibition of Cyt-P450-dependent MFOs and benzene-induced micronuclei formation by polyphenolic acetates was found in tune with their specificities to calreticulin transacetylase. These results further substantiated that inhibition of Cyt-P450-linked MFOs and benzene-induced genotoxicity in bone marrow and lung cells by polyphenolic acetates are mediated by the action of calreticulin transacetylase that catalyzes the acetylation of concerned proteins. PMID:21267547

  9. Green tea polyphenol extract regulates the expression of genes involved in glucose uptake and insulin signaling in rats fed a high fructose diet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Green tea has anti-diabetic and anti-obesity activities, but the molecular mechanisms of these effects have not been fully understood. Quantitative real-time PCR was used to investigate the relative expression levels and the effects of a polyphenol extract green tea (1 and 2 g solid extract/kg diet)...

  10. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  11. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.


    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  12. Gene expressions and metabolomic research on the effects of polyphenols from the involucres of Castanea mollissima Blume on heat-stressed broilers chicks.


    Xiong, Y; Dong, S; Zhao, X; Guo, K J; Gasco, Laura; Zoccarato, Ivo


    To study the effects of polyphenolic extract from involucres of Castanea mollissima Blume ( PICB: ), a novel approach using gene expression by real time polymerase chain reaction ( REAL-TIME PCR: ) coupled with metabolomic profiling technique was established to explain the mechanism of PICB on heat-stressed broiler chicks. Four thousand 28-day-old male Arbor Acres (AA) broilers were randomly assigned to 5 groups (4 replicates / group, 20 chicks / replicate), in which group 1 was normal control group fed with basic ration; groups 2, 3, 4, and 5 were fed with the basic ration with a supplementation of 0.2% Vitamin C ( VC: ), or 0.2%, 0.3%, or 0.4% of PICB respectively. After 1 wk of adaptation, heat stress was applied for 7 consecutive days. On d 3 and d 7 of heat stress, the chicks were sacrificed and sampled. The mRNA expression of heat stress protein 70 (HSP70), glutathione peroxidase ( GSH-PX: ), ornithine decarboxylase ( ODC: ), epidermal growth factor ( EGF: ) and epidermal growth factor receptor ( EGFR: ) were detected by real-time PCR using samples from jejunum mucosa. The serum and jejunum mucosa metabolomic profiles of PICB group showing best antioxidative effects and control group at d 3 were studied using the method of the gas chromatography - time of flight mass spectrometry ( GT-TOF-MS: ), followed by principal component analysis and partial least squares-discriminate analysis. Potential biomarkers were found using Student's t-test. The results showed mRNA expressions of HSP70, GSH-Px, ODC, EGF, and EGFR were altered by the supplementation of PICB. PICB exhibited antioxidative and growth promoting effects, and 0.3% PICB supplementation level exhibited the best. Three metabolites in the serum and 5 in the jejunum mucosa were identified as potential biomarkers. They were considered to be in accordance with antioxidative and growth promoting effects of PICB, which involved in the energy metabolism (sorbitol, palmitic acid), carbohydrate metabolism, amino

  13. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.


    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  14. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  15. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.


    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L


    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  16. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.


    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A


    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  17. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.


    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa


    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants. PMID:22009051

  18. Managing hypertension by polyphenols.


    Fernández-Arroyo, Salvador; Camps, Jordi; Menendez, Javier A; Joven, Jorge


    Some polyphenols, obtained from plants of broad use, induce a favorable endothelial response in hypertension and beneficial effects in the management of other metabolic cardiovascular risks. Previous studies in our laboratories using the calyces of Hibiscus sabdariffa as a source of polyphenols show that significant effects on hypertension are noticeable in humans only when provided in high amounts. Available data are suggestive in animal models and ex vivo experiments, but data in humans are difficult to acquire. Additionally, and despite the low bioavailability of polyphenols, intervention studies provide evidence for the protective effects of secondary plant metabolites. Assumptions on public health benefits are limited by the lack of scientific knowledge, robust data derived from large randomized clinical trials, and an accurate assessment of the bioactive components provided by common foodstuff. Because it is likely that clinical effects are the result of multiple interactions among different polyphenols rather than the isolated action of unique compounds, to provide polyphenol-rich botanical extracts as dietary supplements is a suggestive option. Unfortunately, the lack of patent perspectives for the pharmaceutical industries and the high cost of production and release for alimentary industries will hamper the performance of the necessary clinical trials. Here we briefly discuss whether and how such limitations may complicate the extensive use of plant-derived products in the management of hypertension and which steps are the necessary to deal with the predictable complexity in a possible clinical practice. PMID:25714729

  19. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul


    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  20. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J


    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  1. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.


    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul


    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  2. Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    PubMed Central


    Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

  3. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.


    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  4. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  5. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu


    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  6. Increased tolerance to oxidative stress in transgenic tobacco expressing a wheat oxalate oxidase gene via induction of antioxidant enzymes is mediated by H2O2.


    Wan, Xiaoqing; Tan, Jiali; Lu, Shaoyun; Lin, Chuyu; Hu, Yihong; Guo, Zhenfei


    Hydrogen peroxide (H(2)O(2)) plays a key role in the regulation of plant responses to various environmental stresses and modulates the expression of related genes including those encoding antioxidant enzymes. A wheat oxalate oxidase (OxO) gene was transformed and expressed in tobacco for production of H(2)O(2). The transgenic plants exhibited enhanced OxO activities and H(2)O(2) concentrations, which was blocked by inhibitors of OxO. The transgenic plants showed increased tolerance to methyl viologen (MV) or high light-induced oxidative stress in both short-time and long-time tests by measuring their maximal photochemical efficiency of PSII (F(v)/F(m)), ion leakage and malondialdehyde. Higher activities and transcripts of antioxidant enzymes (superoxide dismutase, catalase, ascorbate peroxidase and glutathione reductase) were observed in the transgenic plants compared to their wild-type controls under normal growth conditions. Pretreatments with inhibitors of OxO and scavenger of H(2)O(2) blocked the increase of tolerance to MV-induced or high light-induced oxidative stress, as well as the induction of antioxidant enzyme activities. Pretreatments with H(2)O(2) increased tolerance to oxidative stresses and antioxidant enzyme activities. It is suggested that H(2)O(2) produced by OxO in the transgenic tobacco plants triggers the signaling pathways to upregulate expressions of antioxidant enzyme genes, which in turn results in the increase of tolerance to MV-induced and high light-induced oxidative stresses. PMID:19508366

  7. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.


    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A


    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  8. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.


    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu


    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  9. Constitutive co-suppression of the GA 20-oxidase1 gene in tomato leads to severe defects in vegetative and reproductive development.


    Olimpieri, Irene; Caccia, Riccardo; Picarella, Maurizio Enea; Pucci, Anna; Santangelo, Enrico; Soressi, Gian Piero; Mazzucato, Andrea


    To dissect the role of gibberellins in tomato development, we have constitutively down-regulated the gene GA 20-oxidase1 (GA20ox1). Plants co-suppressed for GA20ox1 (referred to as CO-6 plants) showed vegetative defects typical of GA deficiency such as darker and mis-shaped leaves and dwarfism. CO-6 plants flowered as the controls, although their flowers had subtle defects in the pedicel and in organ insertion. Analysis of male development revealed defects before, during and after meiosis, and a final pollen viability of 22%. The development of female organs and gametes appeared normal. Pollination experiments indicated that the pollen produced by CO-6 plants was able to fertilize control ovaries, but the analysis of the progeny showed that the construct was not transmitted. Ovaries of CO-6 plants showed high fruit set and normal fruit development when pollinated with control pollen. However these fruits were completely seedless due to a stenospermocarpic behaviour that was evidenced by callose layering in the endothelium between 7 and 15 days after pollination. We conclude that GA20ox1 in tomato exerts specific developmental roles that are not redundantly shared with other members of this gene family. For reproductive male development, silencing of this gene is detrimental for pollen production and either gametophytically lethal or severely hampering seed germination. In the pistil, the co-suppression construct does not affect the progamic phase, nor fruit set and growth, but it interferes with seed development after fertilization leading to seed abortion. PMID:21421397

  10. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A


    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  11. Partial purification of coriolus versicolor's extracellular polyphenol oxidase (PPO)

    SciTech Connect

    Moore, N.L.; Dashek, W.V. )


    Coriolus versicolor, a white-rot basidiomycete, secretes ligno-celluloytic enzymes. Because these are valuable to paper-pulp agricultural industries, trials are in progress to substrate induce these enzymes enhance their secretions. Reported are attempts to develop an extracellular PPO (o-diphenols to 0-diquinones) purification protocol applicable to [open quote]batch-cultured[close quote] C. versicolor. Whereas dialysis (MW [open quote]cut-off[close quote], 14,000) of 13 day growth medium (GM) resulted in 2.17 fold PPO spc. act. increase, dialysis plus a 0-30% (NH[sub 4])[sub 2]SO[sub 4] [open quote]cut[close quote] yielded a 3.27 fold enhancement. Subsequent GM chromatography on DEAE CM-Sephadexes revealed that PPO exchanged with DEAE's counterion without enhancing spc. act. Gel filtration of GM commercial PPOs on G-150 resulted in similar elutions indicating a substitute for ion exchange chromatography. Time-dependent fungal growth in liquid medium followed by viscometry utilizing CMC revealed a GM endocellulase 2 days after inoculation an activity rise to day 12. Filteration of Onozuka cellulase on G-150 yielded an elution profile similar to those of GM authentic PPO's compounding C. versicolor's PPO purification. SDS-PAGE of dialyzed GM revealed 4 proteins, one of which was removed by the (NH[sub 4])[sub 2]SO[sub 4]. The m[sub TS] of commercial Sigma's PPO Onozuka cellulase were 0.76 0.59, respectively, for comparison to C. versicolor's PPO. Affinity, hydroxylapatite hydrophobic interaction chromatographies may yield a single SDS-PAGE PPO band.

  12. Regulation of the Alternative Oxidase Aox1 Gene in Chlamydomonas reinhardtii. Role of the Nitrogen Source on the Expression of a Reporter Gene under the Control of the Aox1 Promoter1

    PubMed Central

    Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F.


    In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (−253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

  13. Nrf2 transcriptional derepression from Keap1 by dietary polyphenols.


    Bayele, Henry K; Debnam, Edward S; Srai, Kaila S


    The liver expresses batteries of cytoprotective genes that confer cellular resistance to oxidative stress and xenobiotic toxins, and protection against cancer and other stress-related diseases. These genes are mainly regulated by Nrf2, making this transcription factor a target for small molecule discovery to treat such diseases. In this report, we identified dietary polyphenolic antioxidants that not only activated these genes but also relieved Nrf2 repression by Keap1, a Cul3-dependent ubiquitin ligase adaptor protein that mediates its degradation. Analysis of postprandial liver RNA revealed a marked activation of both genes by all test polyphenols compared with controls. Nrf2 inhibition by RNA interference reduced polyphenol effects on its target gene expression. Our data suggest that polyphenols may induce cellular defense genes by derepressing Nrf2 inhibition by Keap1. We posit that this ability to derepress Nrf2 and reactivate its target genes may underlie the protection conferred by polyphenols against oxidative stress-related diseases. PMID:26655811

  14. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom


    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  15. New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyworm (Lepidoptera: Noctuidae) populations in the southeastern United States.


    Nagoshi, Rod N; Meagher, Robert L; Adamczyk, John J; Braman, S Kristine; Brandenburg, Rick L; Nuessly, Gregg


    Several restriction sites in the cytochrome oxidase I gene of fall armyworm, Spodoptera frugiperda (J.E. Smith), were identified by sequence analysis as potentially being specific to one of the two host strains. Strain specificity was demonstrated for populations in Florida, Texas, Mississippi, Georgia, and North Carolina, with an AciI and SacI site specific to the rice (Oryjza spp.)-strain and a BsmI and HinfI site joining an already characterized MspI site as diagnostic of the corn (Zea mays L.)-strain. All four of these sites can be detected by digestion of a single 568-bp polymerase chain reaction-amplified fragment, but the use of two enzymes in separate digests was found to provide accurate and rapid determination of strain identity. The effectiveness of this method was demonstrated by the analysis of almost 200 adult and larval specimens from the Mississippi delta region. The results indicated that the corn-strain is likely to be the primary strain infesting cotton (Gossypium spp.) and that an unexpected outbreak of fall armyworm on the ornamental tree Paulownia tomentosa (Thunb.) Sieb. & Zucc. ex Steud. was due almost entirely to the rice-strain. PMID:16813297

  16. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.


    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N


    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  17. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren


    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  18. Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons

    PubMed Central

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.


    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

  19. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.


    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom


    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  20. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi


    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  1. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.


    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  2. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  3. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.


    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  4. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.


    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  5. Silencing of the HvCKX1 gene decreases the cytokinin oxidase/dehydrogenase level in barley and leads to higher plant productivity.


    Zalewski, Wojciech; Galuszka, Petr; Gasparis, Sebastian; Orczyk, Wacław; Nadolska-Orczyk, Anna


    Stable RNA interference-based technology was used to silence the expression of the HvCKX1 gene in barley and the TaCKX1 gene in wheat and triticale. The silencing cassettes containing the fragments of these genes in the sense and antisense orientations were cloned into the pMCG161 binary vector and used for Agrobacterium-based transformation. Out of the five cultivars representing the three studied species, transgenic plants were obtained from one barley cultivar Golden Promise, one wheat cultivar Kontesa, and one triticale cultivar Wanad. Almost 80% of 52 regenerated lines of Golden Promise exhibited significantly decreased cytokinin oxidase/dehydrogenase (CKX) enzyme activity in bulked samples of their T(1) roots. There was a positive correlation between the enzyme activity and the plant productivity, expressed as the yield, the number of seeds per plant, and the 1000 grain weight. Additionally, these traits were associated with a greater root mass. Lower CKX activity led to a higher plant yield and root weight. This higher plant productivity and altered plant architecture were maintained in a population of segregating T(1) plants. The levels of HvCKX1 transcript accumulation were measured in various tissues of Golden Promise and Scarlett non-transgenic barley plants in order to choose the most appropriate plant organs to study the expression and/or silencing of the gene in those transgenic lines. The highest levels of the HvCKX1 transcript were detected in spikes 0 days after pollination (0 DAP), 7 DAP, and 14 DAP, and in the seedling roots. The analysis of HvCKX1 gene expression and CKX enzyme activity and the evaluation of the phenotype were performed in the progeny of seven selected transgenic T(1) lines. The relative expression of HvCKX1 measured in the spikes 0 DAP and 14 DAP, respectively, ranged from 0.52+/-0.04 to 1.15+/-0.26 and from 0.47+/-0.07 to 0.89+/-0.15. The lowest relative values were obtained for the enzyme activity in the spikes at 0 DAP

  6. Polyphenols, Inflammation, and Cardiovascular Disease

    PubMed Central

    Tangney, Christy; Rasmussen, Heather E.


    Polyphenols are compounds found in foods such as tea, coffee, cocoa, olive oil, and red wine and have been studied to determine if their intake may modify cardiovascular disease (CVD) risk. Historically, biologic actions of polyphenols have been attributed to antioxidant activities, but recent evidence suggests that immunomodulatory and vasodilatory properties of polyphenols may also contribute to CVD risk reduction. These properties will be discussed, and recent epidemiological evidence and intervention trials will be reviewed. Further identification of polyphenols in foods and accurate assessment of exposures through measurement of biomarkers (i.e., polyphenol metabolites) could provide the needed impetus to examine the impact of polyphenol-rich foods on CVD intermediate outcomes (especially those signifying chronic inflammation) and hard endpoints among high risk patients. Although we have mechanistic insight into how polyphenols may function in CVD risk reduction, further research is needed before definitive recommendations for consumption can be made. PMID:23512608

  7. Molecular Phylogeny of Nematodes (Oxyurida: Travassosinematidae) from Orthoptera (Gryllotalpidae) Inferred by Mitochondrial Cytochrome C Oxidase Subunit 1 Gene

    PubMed Central

    Singh, Neetu; Chaudhary, Anshu; Singh, Hridaya Shanker


    In this study, we sequenced mt Cox 1 gene sequences of five nematode spp. that were infective to arthropod, Gryllotalpa africana. The nematode belongs to Thelastomatoidea, a group of pinworms that parasitizes only invertebrates. Currently, in India spp. of this group are distinguished mainly on the basis of morphological characters that present possible confusions. Therefore, we identified the species through morphological and genetic analysis. We selected mt Cox 1 gene region to show their phylogenetic position with closely related spp. and confirmed their molecular validation. The present findings are important to confirm the phylogenetic position and relationship among five nematode spp. and avoid misidentification regarding their validation, as it is more necessary in that case when many species harbours the same host. PMID:26339150

  8. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.


    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi


    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  9. Polyphenols in disease: from diet to supplements.


    Rodrigo, Ramon; Libuy, Matias; Feliu, Felipe; Hasson, Daniel


    Polyphenols are a structural class of natural and synthetic, organic chemicals characterized mainly by the presence of phenol structural units. Numerous epidemiological and experimental studies have strongly suggested their beneficial effects for human health. This view is supported by their biological activities, which are associated with chemical and biochemical properties, including the ability to act as antioxidants, their antineoplastic effect and the regulation of gene expression in chronic degenerative diseases. These mechanisms of action could account for their preventive and therapeutic uses in human subjects. Moreover, in some therapeutic uses, such as antineoplastic effect, a prooxidant therapeutic action has been suggested. In the diet, numerous compounds could participate in the beneficial properties, and this likely could result in synergistic effects because the whole effect is better than the separately action of each compound. However, the pharmacokinetic and pharmacodynamic properties of these bioactive micronutrients are yet to be further characterized. More research is required to fully establish the therapeutic use of polyphenols against human disease. Based on biological and pharmacological properties of polyphenols both as diet components and supplements, the objective of this work is to show an updated version about the role that polyphenols could play in several chronic diseases such as hypertension, diabetes mellitus, cancer and neurodegenerative disorders. PMID:25312616

  10. Cacao polyphenols ameliorate autoimmune myocarditis in mice.


    Zempo, Hirofumi; Suzuki, Jun-Ichi; Watanabe, Ryo; Wakayama, Kouji; Kumagai, Hidetoshi; Ikeda, Yuichi; Akazawa, Hiroshi; Komuro, Issei; Isobe, Mitsuaki


    Myocarditis is a clinically severe disease; however, no effective treatment has been established. The aim of this study was to determine whether cacao bean (Theobroma cacao) polyphenols ameliorate autoimmune myocarditis. We used an experimental autoimmune myocarditis (EAM) model in Balb/c mice. Mice with induced EAM were treated with a cacao polyphenol extract (CPE, n=12) or vehicle (n=12). On day 21, hearts were harvested and analyzed. Elevated heart weight to body weight and fibrotic area ratios as well as high cardiac cell infiltration were observed in the vehicle-treated EAM mice. However, these increases were significantly suppressed in the CPE-treated mice. Reverse transcriptase-PCR revealed that mRNA expressions of interleukin (Il)-1β, Il-6, E-selectin, vascular cell adhesion molecule-1 and collagen type 1 were lower in the CPE group compared with the vehicle group. The mRNA expressions of nicotinamide adenine dinucleotide phosphate-oxidase (Nox)2 and Nox4 were increased in the vehicle-treated EAM hearts, although CPE treatment did not significantly suppress the transcription levels. However, compared with vehicle treatment of EAM hearts, CPE treatment significantly suppressed hydrogen peroxide concentrations. Cardiac myeloperoxidase activity, the intensity of dihydroethidium staining and the phosphorylation of nuclear factor-κB p65 were also lower in the CPE group compared with the vehicle group. Our data suggest that CPE ameliorates EAM in mice. CPE is a promising dietary supplement to suppress cardiovascular inflammation and oxidative stress. PMID:26657007

  11. Physiologic responses and gene diversity indicate olive alternative oxidase as a potential source for markers involved in efficient adventitious root induction.


    Santos Macedo, Elisete; Cardoso, Hélia G; Hernández, Alejandro; Peixe, Augusto A; Polidoros, Alexios; Ferreira, Alexandre; Cordeiro, António; Arnholdt-Schmitt, Birgit


    Olive (Olea europaea L.) trees are mainly propagated by adventitious rooting of semi-hardwood cuttings. However, efficient commercial propagation of valuable olive tree cultivars or landraces by semi-hardwood cuttings can often be restricted by a low rooting capacity. We hypothesize that root induction is a plant cell reaction linked to oxidative stress and that activity of stress-induced alternative oxidase (AOX) is importantly involved in adventitious rooting. To identify AOX as a source for potential functional marker sequences that may assist tree breeding, genetic variability has to be demonstrated that can affect gene regulation. The paper presents an applied, multidisciplinary research approach demonstrating first indications of an important relationship between AOX activity and differential adventitious rooting in semi-hardwood cuttings. Root induction in the easy-to-root Portuguese cultivar 'Cobrançosa' could be significantly reduced by treatment with salicyl-hydroxamic acid, an inhibitor of AOX activity. On the contrary, treatment with H2O2 or pyruvate, both known to induce AOX activity, increased the degree of rooting. Recently, identification of several O. europaea (Oe) AOX gene sequences has been reported from our group. Here we present for the first time partial sequences of OeAOX2. To search for polymorphisms inside of OeAOX genes, partial OeAOX2 sequences from the cultivars 'Galega vulgar', 'Cobrançosa' and 'Picual' were cloned from genomic DNA and cDNA, including exon, intron and 3'-untranslated regions (3'-UTRs) sequences. The data revealed polymorphic sites in several regions of OeAOX2. The 3'-UTR was the most important source for polymorphisms showing 5.7% of variability. Variability in the exon region accounted 3.4 and 2% in the intron. Further, analysis performed at the cDNA from microshoots of 'Galega vulgar' revealed transcript length variation for the 3'-UTR of OeAOX2 ranging between 76 and 301 bp. The identified polymorphisms and 3'-UTR

  12. The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Agúndez, José A. G.; Ayuso, Pedro; Cornejo-García, José A.; Blanca, Miguel; Torres, María J.; Doña, Inmaculada; Salas, María; Blanca-López, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, José J.; Fernández, Javier; Martínez, Carmen; García-Martín, Elena


    Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR  = 1.7 (95% CI  = 1.3–2.1; Pc  = 0.0003) with a gene-dose effect (P = 0.0001). The association was replicated in two populations from different geographic areas (Pc  = 0.008 and Pc  = 0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

  13. Contingency tests of neutrality using intra/interspecific gene trees: the rejection of neutrality for the evolution of the mitochondrial cytochrome oxidase II gene in the hominoid primates.


    Templeton, A R


    Contingency tests of neutrality are performed using mitochondrial cytochrome oxidase II (COII) DNA sequences from hominoid primates, including humans. An intra-/interspecific haplotype tree is estimated, including a statistical assessment of ambiguities in tree topology and branch lengths. Four functional mutational categories are considered: silent and replacement substitutions in the transmembrane portion of the COII molecule, and silent and replacement substitutions in the cytosolic portion. Three tree topological mutational categories are used: intraspecific tips, intraspecific interiors, and interspecific fixed mutations. A full contingency analysis is performed, followed by nested contingency analyses. The analyses indicate that replacement mutations in the cytosolic portion are deleterious, and replacement mutations in the transmembrane portion and silent mutations throughout tend to be neutral. These conclusions are robust to ambiguities in tree topology and branch lengths. These inferences would have been impossible with an analysis that only contrasts silent and replacement vs. polymorphic and fixed. Also, intraspecific interior mutations have similar evolutionary dynamics to fixed mutations, so pooling tip and interior mutations into a single "polymorphic" class reduces power. Finally, the detected deleterious selection causes lowered inbreeding effective sizes, so arguments for small effective sizes in recent human evolutionary history based upon mitochondrial DNA may be invalid. PMID:8913766

  14. Polyphenols in whole rice grain: genetic diversity and health benefits.


    Shao, Yafang; Bao, Jinsong


    Polyphenols, such as phenolic acid, anthocyanin and proanthocyanidins, have both nutraceutical properties and functional significance for human health. Identification of polyphenolic compounds and investigation of their genetic basis among diverse rice genotypes provides the basis for the improvement of the nutraceutical properties of whole rice grain. This review focuses on current information on the identification, genetic diversity, formation and distribution patterns of the phenolic acid, anthocyanin, and proanthocyanidins in whole rice grain. The genetic analysis of polyphenol content and antioxidant capacity allows the identification of several candidate genes or quantitative trait loci (QTL) responsible for polyphenol variation, which may be useful in improvement of these phytochemicals by breeding. Future challenges such as how to mitigate the effects of climate change while improving nutraceutical properties in whole grain, and how to use new technology to develop new rice high in nutraceutical properties are also presented. PMID:25766805

  15. Polyphenols from Eriosema tuberosum.


    Ma, W G; Fuzzati, N; Li, Q S; Yang, C R; Stoeckli-Evans, H; Hostettmann, K


    A dichloromethane extract of the roots of Eriosema tuberosum exhibited antifungal activity against Cladosporium cucumerinum and Candida albicans using TLC bioautography. Bioassay-directed fractionation led to the isolation of four new compounds, eriosemaones A-D, together with a known compound, flemichin-D, as the active constituents. Three inactive polyphenols were also isolated after methylation, together with one new chromone, eriosematin. Structures were determined by spectroscopic analysis and from chemical evidence. PMID:7662271

  16. A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA)


    Dassa, J; Fsihi, H; Marck, C; Dion, M; Kieffer-Bontemps, M; Boquet, P L


    The Escherichia coli acid phosphatase gene appA is expressed in response to oxygen deprivation and is positively controlled by the product of appR (katF) which encodes a putative new sigma transcription-initiation factor. However, transcription of appA from its nearest promoter (P1) did not account for total pH 2.5 acid phosphatase expression and was not subject to regulation. The cloned region upstream of appA was extended and analyzed by insertions of transposon TnphoA and by fusions with lacZ. It contains two new genes, appC and appB, which both encode extracytoplasmic proteins. appC and appB are expressed from a promoter (P2) lying just upstream of appC. Both genes are regulated by oxygen, as is appA, and by appR gene product exactly as previously shown for appA. Analysis of the nucleotide sequence and of the origins of transcription have confirmed that the P2-appC-appB- (ORFX)-P1-appA region is organized on the chromosome as an operon transcribed clockwise from P2 and that P1 is a minor promoter for appA alone. Genes appC and appB encode proteins of Mr 58,133 and 42,377, respectively, which have the characteristics of integral membrane proteins. The deduced amino acid sequences of appC and appB show 60% and 57% homology, respectively, with subunits I and II of the E. coli cytochrome d oxidase (encoded by genes cydA and cydB). The notion that the AppC and AppB proteins constitute a new cytochrome oxidase or a new oxygen-detoxifying system is supported by the observation of enhanced sensitivity to oxygen of mutants lacking all three genes, cyo (cytochrome o oxidase), cyd (cytochrome d oxidase) and appB, compared to that of cyo cyd double mutants. PMID:1658595

  17. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.


    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L


    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  18. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.


    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  19. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  20. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.


    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  1. Polyphenols, fungal enzymes, and the fate of organic nitrogen in a Californian pygmy forest

    NASA Astrophysics Data System (ADS)

    Slessarev, E.


    Polyphenols are a diverse family of plant secondary compounds which may influence litter decay and soil nutrient turnover. The "short circuit" hypothesis for polyphenol function proposes that polyphenolic compounds provision plants with nitrogen in nutrient-poor soils by facilitating the accumulation of organic nitrogen in soil humus. By binding peptides, polyphenols may sequester nitrogen in a bank of recalcitrant organic matter, granting competitive advantage to plants with the mycorrhizal fungi most capable of recapturing the tightly bound organic nitrogen. Specifically, fungi may retrieve nitrogen from polyphenol-peptide complexes with an extracellular enzyme, polyphenol oxidase (PPO). In order to evaluate the "short circuit" hypothesis, I measured soil PPO activity during four seasons in the Mendocino "ecological staircase," a soil age-gradient consisting of a series of wave-cut terraces along stretches of the northern California coast. Stunted, pygmy-forest plants growing in the nutrient-poor soils of the older marine terraces produce more polyphenols than their con-specifics on nutrient-rich younger terraces, potentially influencing PPO facilitated nitrogen cycling. I found that PPO activity reached its maximum in the younger terrace forest during the spring, achieving levels nearly twice as high as those observed on the younger terrace in other seasons and in the older terrace forest year-round. In both terraces, PPO activity was greatest in the organic humus at the soil surface, decreasing dramatically in the lower mineral horizon. When PPO activity reached its maximum in the younger terrace, I found that soil polyphenol content positively correlated (Rsq=0.63) with enzyme activity, suggesting that polyphenols might induce enzyme production. However, in the tannin-rich soil of the pygmy forest on the older terrace, enzyme activity remained low, and was most strongly correlated with soil moisture. The results do not support the hypothesis that nutrient

  2. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.


    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr


    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  3. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou


    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  4. Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA

    PubMed Central

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.


    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

  5. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre


    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  6. Aronia melanocarpa (chokeberry) polyphenol-rich extract improves antioxidant function and reduces total plasma cholesterol in apolipoprotein E knockout mice.


    Kim, Bohkyung; Ku, Chai Siah; Pham, Tho X; Park, Youngki; Martin, Derek A; Xie, Liyang; Taheri, Rod; Lee, Jiyoung; Bolling, Bradley W


    We hypothesized that a polyphenol-rich chokeberry extract (CBE) would modulate hepatic lipid metabolism and improve antioxidant function in apolipoprotein E knockout (apoE(-/-)) mice. ApoE(-/-) mice were fed diets containing 15% fat with 0.2% cholesterol alone or supplemented with 0.005% or 0.05% CBE for 4 weeks. CBE polyphenol content was determined by the total phenols, 4-dimethylaminocinnamaldehyde, and ultra high-performance liquid chromatography-mass spectrometry methods. The 0.05% CBE diet provided mice with mean daily doses of 1.2 mg gallic acid equivalents of total phenols, 0.19 mg anthocyanins, 0.17 mg phenolic acids, 0.06 mg proanthocyanidins (as catechin-equivalents), and 0.02 mg flavonols. The 0.05% CBE group had 12% less plasma total cholesterol concentrations than the control. Despite the hypocholesterolemic effect of CBE, hepatic mRNA levels of low-density lipoprotein receptor, hydroxyl-3-methylglutaryl coenzyme A reductase and cholesterol 7α-hydroxylase in CBE-fed mice were not significantly different from controls. Dietary CBE did not alter hepatic lipid content or the hepatic expression of genes involved in lipogenesis and fatty acid β-oxidation such as fatty acid synthase, carnitine palmitoyltransferase 1 and acyl-CoA oxidase. Plasma paraoxonase and catalase activities were significantly increased in mice fed 0.05% CBE. Both CBE diets increased hepatic glutathione peroxidase (GPx) activity but the 0.05% CBE group had 24% less proximal intestine GPx activity relative to controls. Thus, dietary CBE lowered total cholesterol and improved plasma and hepatic antioxidant function at nutritionally-relevant doses in apoE(-/-) mice. Furthermore, the CBE cholesterol-lowering mechanism in apoE(-/-) mice was independent of hepatic expression of genes involved in cholesterol metabolism. PMID:23684442

  7. Effect of Natural Polyphenols on CYP Metabolism: Implications for Diseases.


    Korobkova, Ekaterina A


    Cytochromes P450 (CYPs) are a large group of hemeproteins located on mitochondrial membranes or the endoplasmic reticulum. They play a crucial role in the metabolism of endogenous and exogenous molecules. The activity of CYP is associated with a number of factors including redox potential, protein conformation, the accessibility of the active site by substrates, and others. This activity may be potentially modulated by a variety of small molecules. Extensive experimental data collected over the past decade point at the active role of natural polyphenols in modulating the catalytic activity of CYP. Polyphenols are widespread micronutrients present in human diets of plant origin and in medicinal herbs. These compounds may alter the activity of CYP either via direct interactions with the enzymes or by affecting CYP gene expression. The polyphenol-CYP interactions may significantly alter the pharmacokinetics of drugs and thus influence the effectiveness of chemical therapies used in the treatment of different types of cancers, diabetes, obesity, and cardiovascular diseases (CVD). CYPs are involved in the oxidation and activation of external carcinogenic agents, in which case the inhibition of the CYP activity is beneficial for health. CYPs also support detoxification processes. In this case, it is the upregulation of CYP genes that would be favorable for the organism. A CYP enzyme aromatase catalyzes the formation of estrone and estradiol from their precursors. CYPs also catalyze multiple reactions leading to the oxidation of estrogen. Estrogen signaling and oxidative metabolism of estrogen are associated with the development of cancer. Thus, polyphenol-mediated modulation of the CYP's activity also plays a vital role in estrogen carcinogenesis. The aim of the present review is to summarize the data collected over the last five to six years on the following topics: (1) the mechanisms of the interactions of CYP with food constituents that occur via the direct binding of

  8. Modulation of miRNA Expression by Dietary Polyphenols in apoE Deficient Mice: A New Mechanism of the Action of Polyphenols

    PubMed Central

    Milenkovic, Dragan; Deval, Christiane; Gouranton, Erwan; Landrier, Jean-François; Scalbert, Augustin; Morand, Christine; Mazur, Andrzej


    Background Polyphenols are the most abundant antioxidants in the human diet and are widespread constituents of fruits and beverages, such as tea, coffee or wine. Epidemiological, clinical and animal studies support a role of polyphenols in the prevention of various diseases, such as cardiovascular diseases, cancers or neurodegenerative diseases. Recent findings suggest that polyphenols could interact with cellular signaling cascades regulating the activity of transcription factors and consequently affecting the expression of genes. However, the impact of polyphenol on the expression of microRNA, small non-coding RNAs, has not yet been studied. The aim of this study was to investigate the impact of dietary supplementation with polyphenols at nutritional doses on miRNA expression in the livers of apolipoprotein E-deficient mice (apoE−/−) jointly with mRNA expression profiling. Methodology/Principal Findings Using microarrays, we measured the global miRNA expression in the livers of wild-type (C57B6/J) mice or apoE−/− mice fed diets supplemented with one of nine different polyphenols or a control diet. This analysis revealed that knock-out of the apoE gene induced significant modulation in the expression of miRNA. Moreover, changes in miRNA expression were observed after polyphenol supplementation, and five miRNAs (mmu-miR-291b-5p, mmu-miR-296-5p, mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*) were identified as being commonly modulated by these polyphenols. We also observed that these polyphenols counteracted the modulation of miRNA expression induced by apoE mutation. Pathway analyses on these five miRNA-target genes revealed common pathways, some of which were also identified from a pathway analysis on mRNA profiles. Conclusion This in vivo study demonstrated for the first time that polyphenols at nutritional doses modulate the expression of miRNA in the liver. Even if structurally different, all polyphenols induced a similar miRNA expression profile

  9. Effect of Rol Genes on Polyphenols Biosynthesis in Artemisia annua and Their Effect on Antioxidant and Cytotoxic Potential of the Plant.


    Dilshad, Erum; Zafar, Sara; Ismail, Hammad; Waheed, Mohammad Tahir; Cusido, Rosa Maria; Palazon, Javier; Mirza, Bushra


    Flavonoids are famous for their antioxidant capacity and redox potential. They can combat with cell aging, lipid peroxidation, and cancer. In the present study, Artemisia annua hybrid (Hyb8001r) was subjected to qualitative and quantitative analysis of flavonoids through HPLC. Rol genes transgenics of A. annua were also evaluated for an increase in their flavonoid content along with an increase in antioxidant and cytotoxic potential. This was also correlated with the expression level of flavonoids biosynthetic pathway genes as determined by real-time qPCR. Phenylalanine ammonia-lyase and chalcone synthase genes were found to be significantly more highly expressed in rol B (four to sixfold) and rol C transgenics (3.8-5.5-fold) than the wild-type plant. Flavonoids detected in the wild-type A. annua through HPLC include rutin (0.31 mg/g DW), quercetin (0.01 mg/g DW), isoquercetin (0.107 mg/g DW) and caffeic acid (0.03 mg/g DW). Transgenics of the rol B gene showed up to threefold increase in rutin and caffeic acid, sixfold increase in isoquercetin, and fourfold increase in quercetin. Whereas, in the case of transgenics of rol C gene, threefold increase in rutin and quercetin, 5 fold increase in isoquercetin, and 2.6-fold increase in caffeic acid was followed. Total phenolics and flavonoids content was also found to be increased in rol B (1.5-fold) and rol C (1.4-fold) transgenics as compared to the wild-type plant along with increased free radical scavenging activity. Similarly, the cytotoxic potential of rol gene transgenics against MCF7, HeLA, and HePG2 cancer cell lines was found to be significantly enhanced than the wild-type plant of A. annua. Current findings support the fact that rol genes can alter the secondary metabolism and phytochemical level of the plant. They increased the flavonoids content of A. annua by altering the expression level of flavonoids biosynthetic pathway genes. Increased flavonoid content also enhanced the antioxidant and cytotoxic

  10. Potential Role of Polyphenols in the Prevention of Cardiovascular Diseases: Molecular Bases.


    Gormaz, Juan Guillermo; Valls, Nicolas; Sotomayor, Camilo; Turner, Thomas; Rodrigo, Ramón


    Cardiovascular diseases (CVD) are the leading cause of mortality worldwide. It is widely accepted that oxidative stress plays a key role in their development and progression; hence oxidative damage might be abrogated by antioxidants. Polyphenols are phytochemicals showing extensively studied antioxidant properties in-vivo. Most representative sources of these compounds include fruits, greens, nuts, herbs, cocoa, tea and coffee. Epidemiological evidence suggests an association between the consumption of polyphenol-rich vegetables and the reduction of cardiovascular disease prevalence. This fact could be related to the anti-inflammatory, antithrombotic and vasodilatory effects of polyphenols. Even though these biological effects could be mainly attributed to the antioxidant activity of polyphenols, other pharmacological mechanisms should also be considered. The latter could comprise direct anti-inflammatory effects, modulation of intracellular signaling and gene expression, improvement of nitric oxide homeostasis, as well as platelet antiaggregation. However, it is noticeable that protocols of interventions to evaluate the properties of polyphenols have failed to show the same positive results reported from observational studies. At present, a controversy exists regarding the actual effectiveness of polyphenols in preventing cardiovascular diseases. Therefore, an improvement of the available knowledge about polyphenol pharmacokinetics, together with a better understanding of the mechanisms of action of these compounds, could be of great benefit. Thus, a rational support for the development of interventional designs could provide reliable evidence on the actual role of polyphenols in CVD prevention. PMID:26630919

  11. Dmp53, basket and drICE gene knockdown and polyphenol gallic acid increase life span and locomotor activity in a Drosophila Parkinson’s disease model

    PubMed Central

    Ortega-Arellano, Hector Flavio; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos


    Understanding the mechanism(s) by which dopaminergic (DAergic) neurons are eroded in Parkinson’s disease (PD) is critical for effective therapeutic strategies. By using the binary tyrosine hydroxylase (TH)-Gal4/UAS-X RNAi Drosophila melanogaster system, we report that Dmp53, basket and drICE gene knockdown in dopaminergic neurons prolong life span (p < 0.05; log-rank test) and locomotor activity (p < 0.05; χ2 test) in D. melanogaster lines chronically exposed to (1 mM) paraquat (PQ, oxidative stress (OS) generator) compared to untreated transgenic fly lines. Likewise, knockdown flies displayed higher climbing performance than control flies. Amazingly, gallic acid (GA) significantly protected DAergic neurons, ameliorated life span, and climbing abilities in knockdown fly lines treated with PQ compared to flies treated with PQ only. Therefore, silencing specific gene(s) involved in neuronal death might constitute an excellent tool to study the response of DAergic neurons to OS stimuli. We propose that a therapy with antioxidants and selectively “switching off” death genes in DAergic neurons could provide a means for pre-clinical PD individuals to significantly ameliorate their disease condition. PMID:24385865

  12. Fluorescence quenching study of quercetin interaction with bovine milk xanthine oxidase

    NASA Astrophysics Data System (ADS)

    Rasoulzadeh, Farzaneh; Jabary, Hamideh Nadjarpour; Naseri, Abdolhossein; Rashidi, Mohammad-Reza


    Quercetin is a natural flavonoid with many important therapeutic properties. The interaction of this polyphenolic compound bovine milk xanthine oxidase as one of its major target proteins was studied using fluorescence quenching method for the first time. It was found that the fluorescence quenching of xanthine oxidase occurs through a static mechanism. The results revealed the presence of a single binding site on xanthine oxidase with the binding constant value equals to 1.153 × 10 4 l mol -1 at 310 K and pH 7.4. The thermodynamic parameters were also calculated at different temperatures. The enthalpy and entropy changes were found as -10.661 kJ mol -1 and +43.321 J mol -1 K -1 indicating that both hydrogen binding and hydrophobic are involved in the interaction of this polyphenolic natural compound with xanthine oxidase. The results may provide a ground for further studies with different flavonoids to find a safe alternative for allopurinol, the only xanthine oxidase inhibitor with clinical application.

  13. Natural Polyphenols in Cancer Chemoresistance.


    Hussain, Saad A; Sulaiman, Amal A; Balch, Curt; Chauhan, Harsh; Alhadidi, Qasim M; Tiwari, Amit K


    Resistance to chemotherapy remains a major impediment to the management of most types of cancer. Both intrinsic and acquired drug resistance are mediated by several cellular and molecular mechanisms, including alternative growth-signaling pathways unaffected by specific therapies, alterations in the tumor microenvironment (e.g., hypoxia and angiogenesis), and active transport of drugs out of the cell. Epidemiological studies have validated an inverse correlation between the consumption of dietary polyphenols and the risk of cancer, which has been attributed to polyphenol antioxidant capacity and their potential to inhibit activation of procarcinogens, cancer cell proliferation, metastasis, and angiogenesis, and inhibition or downregulation of active drug efflux transporters. Moreover, polyphenols can induce apoptosis in cancer cells and modulate immune responses and inflammatory cascades. Augmentation of the efficacy of chemotherapy and prevention of multidrug resistance are other important effects of dietary polyphenols that deserve further research, especially after the discovery of tight "crosstalk" between aberrant growth signaling and metabolic dysfunction in cancer cells. In this review, we cover what is currently known about the role of natural polyphenolic compounds in overcoming cancer drug resistance mediated by diverse primary and secondary resistance mechanisms. PMID:27366999

  14. Water stress induces changes in polyphenol profile and antioxidant capacity in poplar plants (Populus spp.).


    Popović, B M; Štajner, D; Ždero-Pavlović, R; Tumbas-Šaponjac, V; Čanadanović-Brunet, J; Orlović, S


    This paper is aimed to characterize young poplar plants under the influence of water stress provoked by polyethileneglycol 6000 (PEG 6000). Three polar genotypes (M1, B229, and PE19/66) were grown in hydroponics and subjected to 100 and 200 mOsm PEG 6000 during six days. Polyphenol characterization, two enzymatic markers and antioxidant capacity in leaves and roots were investigated in stressed plants. Total phenol content, ferric reducing antioxidant capacity (FRAP) and DPPH antiradical power (DPPH ARP) were determined for estimating total antioxidant capacity. Polyphenol oxidase (PPO) and phenylalanine ammonia lyase (PAL) were determined as enzymatic markers. Polyphenol characterization of poplar samples was performed by HPLC-PDA analysis. All results were subjected to correlation analysis and principal component analysis (PCA). Inspite of the decrease of total phenol content in investigated genotypes, as well as total antioxidant capacity, some of polyphenols were affected by stress like flavonoids chrysin, myricetine, kaempferol and isoferulic acid in roots of B229 genotype (Populus deltoides). Genotype B229 also showed the increase of antioxidant capacity and PAL activity in root and leaves under stress what could be the indicator of the adaptability of poplar plants to water stress. Significant positive correlations were obtained between PAL, antioxidant capacity as well as phenolic acids among themselves. Chemometric evaluation showed close interdependence between flavonoids, FRAP, DPPH antiradical power and both investigated enzymes of polyphenol metabolism, PAL and PPO. PMID:27116372

  15. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.


    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao


    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  16. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.


    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi


    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  17. Proximate and polyphenolic characterization of cranberry pomace

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The proximate composition and identification and quantification of polyphenolic compounds in dried cranberry pomace were determined. Proximate analysis was conducted based on AOAC methods for moisture, protein, fat, and ash. Total carbohydrates were determined by the difference method. Polyphenolic ...

  18. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.


    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon


    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. PMID:25980806

  19. Alzheimer's Disease, Drosophila melanogaster and Polyphenols.


    Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos


    Alzheimer's disease (AD) is an insidious neurological disorder that affects memory, one of the human brain's main cognitive functions. Around 5.2 million Americans currently have AD, and the number threatens to climb to 7 million by 2020. Our native country, Colombia, is no exception with an estimated 260,000 individuals to be affected by AD in 2020. A large, genetically-isolated community in Antioquia, Colombia, with early-onset familial Alzheimer's disease due to a presenilin-1 mutation is ideally suited for the study of molecular mechanisms of AD, and hence accelerate the discovery of new or alternative treatment approaches. In this regard, polyphenols--also known as polyhydroxyphenols--have shown antioxidant activity, gene regulation, metal chelator and anti-amyloidogenic aggregation effects. However, further in vitro and in vivo investigations are warranted to validate their use in clinical trials. Drosophila melanogaster is increasingly being used as a valid in vivo model of AD. Here, we summarise data published within the past 16 years (1998-2014) on the molecular biology of AD and the use of polyphenols in the fly to understand the molecular actions and feasibility of these compounds in the treatment of AD. PMID:26092625

  20. Polyphenols: a nutraceutical approach against diseases.


    Gollucke, Andréa P B; Peres, Rogério C; Odair A; Ribeiro, Daniel A


    Polyphenols are abundant in red grapes and in their derived products, amongst other natural food sources. These compounds are associated with the prevention of diseases caused by oxidative stress. The present review discusses the action of grape polyphenols against diseases and the new polyphenol-rich products developed to be used as nutraceuticals. Grape polyphenols demonstrated effects such as maintenance of endothelial function, increase in antioxidant capacity and protection against LDL oxidation. Recent patents regarding polyphenols show a tendency to use a right-on-target approach and the new patented products are aiming at preventing and treating specific diseases. PMID:24294942

  1. Regulation of cyclooxygenase-2 and cytosolic phospholipase A2 gene expression by lipopolysaccharide through the RNA-binding protein HuR: involvement of NADPH oxidase, reactive oxygen species and mitogen-activated protein kinases

    PubMed Central

    Lin, Wei-Ning; Lin, Chih-Chung; Cheng, Hsin-Yi; Yang, Chuen-Mao


    BACKGROUND AND PURPOSE Lipopolysaccharide (LPS)-induced expression of cyclooxygenase-2 (COX-2) and cytosolic phospholipase A2 (cPLA2) has been implicated in several respiratory diseases. HuR is known to enhance the expression of genes by binding to 3′-untranslated region (3′-UTR) of mRNA and stabilizing mRNA. However, the exact mechanisms by which HuR affects the stability of mRNA and modulates LPS-induced COX-2 and cPLA2 expression in human tracheal smooth muscle cells (HTSMCs) are not known. EXPERIMENTAL APPROACH The expression of prostaglandin E2 (PGE2) was measured by ELISA, and pro-inflammatory proteins were determined by use of a promoter assay, PCR or Western blot analysis. Overexpression of siRNAs to knock down the target components was used to manipulate the expression of HuR. Release of reactive oxygen species (ROS) was detected by fluorescence dye. The activation of signalling components was assessed by comparing phosphorylation levels, localization of protein kinases or coimmunoprecipitation assay. KEY RESULTS LPS induced COX-2 and cPLA2 expression via post-translational regulation of mRNA stabilization, which were attenuated by transfection with HuR siRNA in HTSMCs. In addition, LPS-stimulated NADPH oxidase activation and ROS generation were attenuated by the NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and apocynin (APO). Generation of ROS induced phosphorylation of p42/p44 mitogen-activated protein kinase (MAPK), p38 MAPK and JNK1/2, which was attenuated by DPI and APO and the ROS scavenger N-acetylcysteine. CONCLUSIONS AND IMPLICATIONS These results suggested that in HTSMCs, LPS-induced COX-2 and cPLA2 expression is mediated through NADPH oxidase/ROS-dependent MAPKs associated with HuR accumulation in the cytoplasm. Activated MAPKs may regulate the nucleocytoplasmic shuttling of HuR, and thus induce the cytoplasmic accumulation of HuR. PMID:21391979

  2. Unique metabolites protect earthworms against plant polyphenols

    PubMed Central

    Liebeke, Manuel; Strittmatter, Nicole; Fearn, Sarah; Morgan, A. John; Kille, Peter; Fuchser, Jens; Wallis, David; Palchykov, Vitalii; Robertson, Jeremy; Lahive, Elma; Spurgeon, David J.; McPhail, David; Takáts, Zoltán; Bundy, Jacob G.


    All higher plants produce polyphenols, for defence against above-ground herbivory. These polyphenols also influence the soil micro- and macro-fauna that break down plant leaf litter. Polyphenols therefore indirectly affect the fluxes of soil nutrients and, ultimately, carbon turnover and ecosystem functioning in soils. It is unknown how earthworms, the major component of animal biomass in many soils, cope with high-polyphenol diets. Here, we show that earthworms possess a class of unique surface-active metabolites in their gut, which we term ‘drilodefensins'. These compounds counteract the inhibitory effects of polyphenols on earthworm gut enzymes, and high-polyphenol diets increase drilodefensin concentrations in both laboratory and field populations. This shows that drilodefensins protect earthworms from the harmful effects of ingested polyphenols. We have identified the key mechanism for adaptation to a dietary challenge in an animal group that has a major role in organic matter recycling in soils worldwide. PMID:26241769

  3. Unique metabolites protect earthworms against plant polyphenols.


    Liebeke, Manuel; Strittmatter, Nicole; Fearn, Sarah; Morgan, A John; Kille, Peter; Fuchser, Jens; Wallis, David; Palchykov, Vitalii; Robertson, Jeremy; Lahive, Elma; Spurgeon, David J; McPhail, David; Takáts, Zoltán; Bundy, Jacob G


    All higher plants produce polyphenols, for defence against above-ground herbivory. These polyphenols also influence the soil micro- and macro-fauna that break down plant leaf litter. Polyphenols therefore indirectly affect the fluxes of soil nutrients and, ultimately, carbon turnover and ecosystem functioning in soils. It is unknown how earthworms, the major component of animal biomass in many soils, cope with high-polyphenol diets. Here, we show that earthworms possess a class of unique surface-active metabolites in their gut, which we term 'drilodefensins'. These compounds counteract the inhibitory effects of polyphenols on earthworm gut enzymes, and high-polyphenol diets increase drilodefensin concentrations in both laboratory and field populations. This shows that drilodefensins protect earthworms from the harmful effects of ingested polyphenols. We have identified the key mechanism for adaptation to a dietary challenge in an animal group that has a major role in organic matter recycling in soils worldwide. PMID:26241769

  4. De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: A genomics approach to personalized medicine

    PubMed Central

    O’Leary, Ryan E.; Shih, Jean C.; Hyland, Keith; Kramer, Nancy; Asher, Y. Jane Tavyev; Graham, John M.


    Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4–6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient’s cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet

  5. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.


    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  6. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  7. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.


    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio


    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  8. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya


    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  9. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population

    PubMed Central

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande


    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  10. Two novel mutations and coexistence of the 991C>T and the 1339C>T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria.


    Wiman, Asa; Floderus, Ylva; Harper, Pauline


    Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPOgene in nine Swedish families with HCP. Exon 1 of the CPO gene of the nine probands was analyzed directly by sequencing, and exons 2-7 were screened by denaturating gradient gel electrophoresis, followed by sequencing of exons showing abnormal band pattern. Mutations were detected in five of the nine families. In two of these families, the novel mutations 623C>T (S208F, exon 2) and 982C>T (R328C, exon 5) were identified, respectively. In the affected members of the other three families, the previously reported mutations 991C>T (R331W, exon 5) and 1339C>T (R447C, exon 7) were shown to coexist on one allele. The present study contributes 2 novel mutations to the 34 that have been previously reported to cause HCP. In addition, this is the first report on patients carrying two HCP-coupled mutations on one allele. PMID:12181641

  11. Coupling of energy metabolism and synaptic transmission at the transcriptional level: Role of nuclear respiratory factor 1 in regulating both cytochrome c oxidase and NMDA glutamate receptor subunit genes

    PubMed Central

    Dhar, Shilpa S.; Wong-Riley, Margaret T. T.


    Neuronal activity and energy metabolism are tightly coupled processes. Regions high in neuronal activity, especially of the glutamatergic type, have high levels of cytochrome c oxidase (COX). Perturbations in neuronal activity affect the expressions of COX and glutamatergic N-methyl-D-aspartate receptor subunit 1 (NR1). The present study sought to test our hypothesis that the coupling extends to the transcriptional level, whereby NR1 and possibly other NR subunits and COX are co-regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), which regulates all COX subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutations, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Grin 1 (NR1), Grin 2b (NR2b) and COX subunit genes, but not of Grin2a and Grin3a genes. These transcripts were up-regulated by KCl and down-regulated by TTX in cultured primary neurons. However, silencing of NRF-1 with small interference RNA blocked the up-regulation of Grin1, Grin2b, and COX induced by KCl, and over-expression of NRF-1 rescued these transcripts that were suppressed by TTX. NRF-1 binding sites on Grin1 and Grin2b genes are also highly conserved among mice, rats, and humans. Thus, NRF-1 is an essential transcription factor critical in the co-regulation of NR1, NR2b, and COX, and coupling exists at the transcriptional level to ensure coordinated expressions of proteins important for synaptic transmission and energy metabolism. PMID:19144849

  12. Purification and spectroscopic studies on catechol oxidase from lemon balm (Melissa officinalis).


    Rompel, Annette; Büldt-Karentzopoulos, Klaudia; Molitor, Christian; Krebs, Bernt


    A catechol oxidase from lemon balm (Melissa officinalis) moCO which only catalyzes the oxidation of catechols to quinones without hydroxylating tyrosine was purified. The molecular mass of the M. officinalis enzyme of 39,370 Da was obtained by MALDI mass spectrometry and the isoelectric point was determined to be 3.4. Addition of 2 eq. H(2)O(2) to the enzyme leads to oxy catechol oxidase. In the UV/Vis spectrum two new absorption bands occur at 343 nm (ε=8510 M(-1)cm(-1)) and 580 nm (ε=580 M(-1)cm(-1)) due to O(2)(2-)Cu (II) charge transfer transitions in accordance with the oxy forms of other type 3 copper proteins. The N-terminal sequence has been determined by Edman degradation to NPVQAPELDKCGTAT, exhibiting a proline at the second and sixth position conserved in other polyphenol oxidases. PMID:22727580

  13. NADPH oxidases in the arbuscular mycorrhizal symbiosis.


    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa


    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  14. The Mechanisms of Inhibition of Advanced Glycation End Products Formation through Polyphenols in Hyperglycemic Condition.


    Khangholi, Shahpour; Majid, Fadzilah Adibah Abdul; Berwary, Najat Jabbar Ahmed; Ahmad, Farediah; Aziz, Ramlan Bin Abd


    Glycation, the non-enzymatic binding of glucose to free amino groups of an amino acid, yields irreversible heterogeneous compounds known as advanced glycation end products. Those products play a significant role in diabetic complications. In the present article we briefly discuss the contribution of advanced glycation end products to the pathogenesis of diabetic complications, such as atherosclerosis, diabetic retinopathy, nephropathy, neuropathy, and wound healing. Then we mention the various mechanisms by which polyphenols inhibit the formation of advanced glycation end products. Finally, recent supporting documents are presented to clarify the inhibitory effects of polyphenols on the formation of advanced glycation end products. Phytochemicals apply several antiglycation mechanisms, including glucose metabolism, amelioration of oxidative stress, scavenging of dicarbonyl species, and up/down-regulation of gene expression. To utilize polyphenols in order to remedy diabetic complications, we must explore, examine and clarify the action mechanisms of the components of polyphenols. PMID:26550791

  15. Polyphenols protect against protein glycoxidation.


    Sadowska-Bartosz, Izabela; Galiniak, Sabina; Bartosz, Grzegorz


    Glycoxidation belongs to posttranslational protein modifications which underlie pathological sequelae of diabetes and other diseases, and contribute to aging. Search for efficient inhibitors of glycoxidation is therefore of considerable importance. We studied the effect of various polyphenols on the glycoxidation of bovine serum albumin (90 uM) incubated in vitro with glucose, fructose or ribose (100mM) for 6 days in 0.1M phosphate buffer, pH 7.4. Polyphenols have multiple biological actions including antioxidant activity and chelation of transition metal ions. The extent of glycoxidation was evaluated using fluorimetic parameters reflecting formation of Advanced Glycoxidation End Products (AGEs: 325/440nm), dityrosine (330/415nm), formylkynurenine (325/434nm) and kynurenine (365/480nm) and confirmed by estimation of AGEs using an ELISA kit. The results confirmed reliability of easily measurable fluorimetric parameters such as AGEs, dityrosine and formylkynurenine level for estimation of the extent of glycoxidation.All the polyphenols used (caffeic acid, ferulic acid, gallic acid, genistein, naringin, propyl gallate, quercitrin and rutin) decreased the extent of albumin glycoxidation. The extent of protection varied for different sugars (e. g. 1mM genistein: 24.4±1.7 for glucose, 44.5±0.2 for fructose 51.4±0.3 for ribose) The sequence of protective effect was: ferulic acid>caffeic acid>propyl gallate>naringin>quercitrin>genistein for glucose, caffeic acid>ferulic acid>propyl gallate>genistein>quercitrin>rutin>naringin for fructose and genistein>ferulic acid>caffeic acid>rutin>propyl gallate>naringin>quercitrin>gallic acid. These results confirm that polyphenols, natural components of human diet, protect against protein glycation in a model in vitro system. This study was performed within the framework of COSTCM1001 action and was sponsored by Grant 2011/01/M/N23-02065 of the National Science Center of Poland. PMID:26461390

  16. Polyphenols from wolfberry and their bioactivities.


    Zhou, Zheng-Qun; Xiao, Jia; Fan, Hong-Xia; Yu, Yang; He, Rong-Rong; Feng, Xiao-Lin; Kurihara, Hiroshi; So, Kwok-Fai; Yao, Xin-Sheng; Gao, Hao


    Nine new phenylpropanoids, one new coumarin, and 43 known polyphenols were isolated from wolfberry. Their structures were determined by spectroscopic analyses, chemical methods, and comparison of NMR data. Polyphenols, an important type of natural products, are notable constituents in wolfberry. 53 polyphenols, including 28 phenylpropanoids, four coumarins, eight lignans, five flavonoids, three isoflavonoids, two chlorogenic acid derivatives, and three other constituents, were identified from wolfberry. Lignans and isoflavonoids were firstly reported from wolfberry. 22 known polyphenols were the first isolates from the genus Lycium. This research presents a systematic study on wolfberry polyphenols, including their bioactivities. All these compounds exhibited oxygen radical absorbance capacity (ORAC), and some compounds displayed DPPH radical scavenging activity. One compound had acetylcholinesterase inhibitory activity. The discovery of new polyphenols and their bioactivities is beneficial for understanding the scientific basis of the effects of wolfberry. PMID:27507521

  17. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.


    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu


    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  18. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.


    Papagianni, Maria; Avramidis, Nicholaos


    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

  19. Bioavailability of the polyphenols: status and controversies.


    D'Archivio, Massimo; Filesi, Carmelina; Varì, Rosaria; Scazzocchio, Beatrice; Masella, Roberta


    The current interest in polyphenols has been driven primarily by epidemiological studies. However, to establish conclusive evidence for the effectiveness of dietary polyphenols in disease prevention, it is useful to better define the bioavailability of the polyphenols, so that their biological activity can be evaluated. The bioavailability appears to differ greatly among the various phenolic compounds, and the most abundant ones in our diet are not necessarily those that have the best bioavailability profile. In the present review, we focus on the factors influencing the bioavailability of the polyphenols. Moreover, a critical overview on the difficulties and the controversies of the studies on the bioavailability is discussed. PMID:20480022

  20. Bioavailability of the Polyphenols: Status and Controversies

    PubMed Central

    D’Archivio, Massimo; Filesi, Carmelina; Varì, Rosaria; Scazzocchio, Beatrice; Masella, Roberta


    The current interest in polyphenols has been driven primarily by epidemiological studies. However, to establish conclusive evidence for the effectiveness of dietary polyphenols in disease prevention, it is useful to better define the bioavailability of the polyphenols, so that their biological activity can be evaluated. The bioavailability appears to differ greatly among the various phenolic compounds, and the most abundant ones in our diet are not necessarily those that have the best bioavailability profile. In the present review, we focus on the factors influencing the bioavailability of the polyphenols. Moreover, a critical overview on the difficulties and the controversies of the studies on the bioavailability is discussed. PMID:20480022

  1. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi


    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  2. Transcriptional coupling of synaptic transmission and energy metabolism: Role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons

    PubMed Central

    Dhar, Shilpa S.; Liang, Huan Ling; Wong-Riley, Margaret T. T.


    SUMMARY Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts downregulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level. PMID:19615412

  3. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.


    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa


    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  4. Overexpression of a GmCnx1 gene enhanced activity of nitrate reductase and aldehyde oxidase, and boosted mosaic virus resistance in soybean.


    Zhou, Zheng; He, Hongli; Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao


    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g(-1) h(-1) and 30 pmol L(-1), respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  5. Effect of rosemary polyphenols on human colon cancer cells: transcriptomic profiling and functional enrichment analysis.


    Valdés, Alberto; García-Cañas, Virginia; Rocamora-Reverte, Lourdes; Gómez-Martínez, Angeles; Ferragut, José Antonio; Cifuentes, Alejandro


    In this work, the effect of rosemary extracts rich on polyphenols obtained using pressurized fluids was investigated on the gene expression of human SW480 and HT29 colon cancer cells. The application of transcriptomic profiling and functional enrichment analysis was done via two computational approaches, Ingenuity Pathway Analysis and Gene Set Enrichment Analysis. These two approaches were used for functional enrichment analysis as a previous step for a reliable interpretation of the data obtained from microarray analysis. Reverse transcription quantitative-PCR was used to confirm relative changes in mRNA levels of selected genes from microarrays. The selection of genes was based on their expression change, adjusted p value, and known biological function. According to genome-wide transcriptomics analysis, rosemary polyphenols altered the expression of ~4 % of the genes covered by the Affymetrix Human Gene 1.0ST chip in both colon cancer cells. However, only ~18 % of the differentially expressed genes were common to both cell lines, indicating markedly different expression profiles in response to the treatment. Differences in induction of G2/M arrest observed by rosemary polyphenols in the two colon adenocarcinoma cell lines suggest that the extract may be differentially effective against tumors with specific mutational pattern. From our results, it is also concluded that rosemary polyphenols induced a low degree of apoptosis indicating that other multiple signaling pathways may contribute to colon cancer cell death. PMID:22923011

  6. Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).


    Gjerde, Bjørn


    Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37 bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080 bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491 bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100 % identical at cytb and shared 99.3 % identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full

  7. Polyphenols as enzyme inhibitors in different degraded peat soils: Implication for microbial metabolism in rewetted peatlands

    NASA Astrophysics Data System (ADS)

    Zak, Dominik; Roth, Cyril; Gelbrecht, Jörg; Fenner, Nathalie; Reuter, Hendrik


    Recently, more than 30,000 ha of drained minerotrophic peatlands (= fens) in NE Germany were rewetted to restore their ecological functions. Due to an extended drainage history, a re-establishment of their original state is not expected in the short-term. Elevated concentrations of dissolved organic carbon, ammonium and phosphate have been measured in the soil porewater of the upper degraded peat layers of rewetted fens at levels of one to three orders higher than the values in pristine systems; an indicator of increased microbial activity in the upper degraded soil layers. On the other hand there is evidence that the substrate availability within the degraded peat layer is lowered since the organic matter has formerly been subject to intense decomposition over the decades of drainage and intense agricultural use of the areas. Previously however, it was suggested that inhibition of hydrolytic enzymes by polyphenolic substances is suspended during aeration of peat soils mainly due to the decomposition of the inhibiting polyphenols by oxidising enzymes such as phenol oxidase. Accordingly we hypothesised a lack of enzyme inhibiting polyphenols in degraded peat soils of rewetted fens compared to less decomposed peat of more natural fens. We collected both peat samples at the soil surface (0-20 cm) and fresh roots of dominating vascular plants and mosses (as peat parent material) from five formerly drained rewetted sites and five more natural sites of NE Germany and NW Poland. Less decomposed peat and living roots were used to obtain an internal standard for polyphenol analysis and to run enzyme inhibition tests. For all samples we determined the total phenolic contents and in addition we distinguished between the contents of hydrolysable and condensed tannic substances. From a methodical perspective the advantage of internal standards compared to the commercially available standards cyanidin chloride and tannic acid became apparent. Quantification with cyanidin or

  8. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric


    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  9. Molecular phylogeny of the subfamily Gerbillinae (Muridae, Rodentia) with emphasis on species living in the Xinjiang-Uygur Autonomous Region of China and based on the mitochondrial cytochrome b and cytochrome c oxidase subunit II genes.


    Ito, Mamoru; Jiang, Wei; Sato, Jun J; Zhen, Qiang; Jiao, Wei; Goto, Kazuo; Sato, Hiroshi; Ishiwata, Kenji; Oku, Yuzaburo; Chai, June-Jie; Kamiya, Haruo


    Rodents belonging to the subfamily Gerbillinae and living in the Xinjiang-Uygur autonomous region of China were collected in field surveys between 2001 and 2003. We found four Meriones species, including M. chengi M. liycus, M. meridianus, and M. tamariscinus, as well as related species from different genera, Rhombomys opimus and Brachiones przewaliskii For phylogenetic analyses of these gerbilline species, DNA sequences of parts of the mitochondrial cytochrome b (Cytb) and cytochrome c oxidase subunit II (COII) genes were examined with the neighbor Joining, maximum parsimony, maximum likelihood, and Bayesian inference methods. Our phylogenetic analyses suggest that the genus Meriones is not monophyletic and place M. tamaricinus as the sister taxon to a clade comprising Brachiones, Psammomys, Rhombomys, and the other Meriones species. The remaining Meriones species separate into three lineages: M. meridianus (including M. chengi), Meriones unguiculatus, and a clade that includes multiple Meriones species originating from Asia, the Middle East, and Africa. The phylogenetic relationships among the genera Brachines, Meriones, Psammomys, and Rhombomys remain ambiguous, probably due to the saturation of mutations that occurs in fast-evolving mitochondrial DNA. In addition, intraspecific variation was observed for M. meridianus, and this mostly correlated with collection localities, i.e., the northern and southern parts of the Xinjiang region. This variation corresponded to interspecific levels of divergence among other lineages of Meriones. Interestingly, no differences were observed in either the Cytb or COII gene sequences isolated from M. chengi collected from the Turfan Basin in the north and those from M. meridianus in the south, suggesting that M. chengi may be a synonym of M. meridianus. PMID:20192696

  10. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il


    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  11. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G


    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  12. Characterization of polyphenolic metabolites in grape hybrids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The composition and content of polyphenolic compounds in the berries of 48 hybrid grapes (Vitis) were characterized for two consecutive years. A total of 48 polyphenolic compounds including 28 anthocyanins, 2 hydroxybenzoic acids, 6 hydroxycinnamic derivatives, 6 flavonols and 6 flavanols were ident...

  13. Bioavailability of Polyphenol Liposomes: A Challenge Ahead

    PubMed Central

    Mignet, Nathalie; Seguin, Johanne; Chabot, Guy G.


    Dietary polyphenols, including flavonoids, have long been recognized as a source of important molecules involved in the prevention of several diseases, including cancer. However, because of their poor bioavailability, polyphenols remain difficult to be employed clinically. Over the past few years, a renewed interest has been devoted to the use of liposomes as carriers aimed at increasing the bioavailability and, hence, the therapeutic benefits of polyphenols. In this paper, we review the causes of the poor bioavailability of polyphenols and concentrate on their liposomal formulations, which offer a means of improving their pharmacokinetics and pharmacodynamics. The problems linked to their development and their potential therapeutic advantages are reviewed. Future directions for liposomal polyphenol development are suggested. PMID:24300518

  14. A Review of Polyphenolics in Oak Woods

    PubMed Central

    Zhang, Bo; Cai, Jian; Duan, Chang-Qing; Reeves, Malcolm J.; He, Fei


    Polyphenolics, which are ubiquitous in plants, currently are among the most studied phytochemicals because of their perceptible chemical properties and antioxidant activity. Oak barrels and their alternatives, which are widely used in winemaking nowadays, contribute polyphenolics to wines and are thought to play crucial roles in the development of wines during aging. This study summarizes the detailed information of polyphenolics in oak woods and their products by examining their structures and discussing their chemical reactions during wine aging. This paper evaluates the most recent developments in polyphenolic chemistry by summarizing their extraction, separation, and their identification by the use of chromatographic and spectral techniques. In addition, this paper also introduces polyphenol bioactive ingredients in other plant foods. PMID:25826529

  15. Polyphenols as active ingredients for cosmetic products.


    Zillich, O V; Schweiggert-Weisz, U; Eisner, P; Kerscher, M


    Polyphenols are secondary plant metabolites with antioxidant, anti-inflammatory and anti-microbial activity. They are ubiquitously distributed in the plant kingdom; high amounts contain, for example, green tea and grape seeds. Polyphenolic extracts are attractive ingredients for cosmetics and pharmacy due to their beneficial biological properties. This review summarizes the effects of polyphenols in the context of anti-ageing activity. We have explored in vitro studies, which investigate antioxidant activity, inhibition of dermal proteases and photoprotective activity, mostly studied using dermal fibroblasts or epidermal keratinocytes cell lines. Possible negative effects of polyphenols were also discussed. Further, some physicochemical aspects, namely the possible interactions with emulsifiers and the influence of the cosmetic formulation on the skin delivery, were reported. Finally, few clinical studies, which cover the anti-ageing action of polyphenols on the skin after topical application, were reviewed. PMID:25712493

  16. HypC, the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  17. Induction of nodD Gene in a Betarhizobium Isolate, Cupriavidus sp. of Mimosa pudica, by Root Nodule Phenolic Acids.


    Mandal, Santi M; Chakraborty, Dipjyoti; Dutta, Suhrid R; Ghosh, Ananta K; Pati, Bikas R; Korpole, Suresh; Paul, Debarati


    A range of phenolic acids, viz., p-coumaric acid, 4-hydroxybenzaldehyde, 4-hydroxybenzoic acid, protocatechuic acid, caffeic acid, ferulic acid, and cinnamic acid have been isolated and identified by LC-MS analysis in the roots and root nodules of Mimosa pudica. The effects of identified phenolic acids on the regulation of nodulation (nod) genes have been evaluated in a betarhizobium isolate of M. pudica root nodule. Protocatechuic acid and p-hydroxybenzoic acid were most effective in inducing nod gene, whereas caffeic acid had no significant effect. Phenylalanine ammonia lyase, peroxidase, and polyphenol oxidase activities were estimated, indicating regulation and metabolism of phenolic acids in root nodules. These results showed that nodD gene expression of betarhizobium is regulated by simple phenolic acids such as protocatechuic acid and p-hydroxybenzoic acid present in host root nodule and sustains nodule organogenesis. PMID:26897126

  18. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonçalves, Sérgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre


    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  19. Effect of dietary polyphenols on K562 leukemia cells: a Foodomics approach.


    Valdés, Alberto; Simó, Carolina; Ibáñez, Clara; Rocamora-Reverte, Lourdes; Ferragut, José Antonio; García-Cañas, Virginia; Cifuentes, Alejandro


    In this work, a global Foodomics strategy has been applied to study the antiproliferative effect of dietary polyphenols from rosemary on two human leukemia lines, one showing a drug-sensitive phenotype (K562), and another exhibiting a drug-resistant phenotype (K562/R). To this aim, whole-transcriptome microarray together with an MS-based nontargeted analytical approach (via CE-TOF MS and UPLC-TOF MS) have been employed to carry out transcriptomics and metabolomics analyses, respectively. Functional enrichment analysis was done using ingenuity pathway analysis (IPA) software as a previous step for a reliable interpretation of transcriptomic and metabolomic profiles. Rosemary polyphenols altered the expression of approximately 1% of the genes covered by the whole transcriptome microarray in both leukemia cell lines. Overall, differences in the transcriptional induction of a number of genes encoding phase II detoxifying and antioxidant genes, as well as differences in the metabolic profiles observed in the two leukemia cell lines suggest that rosemary polyphenols may exert a differential chemopreventive effect in leukemia cells with different phenotypes. IPA predictions on transcription factor analysis highlighted inhibition of Myc transcription factor function by rosemary polyphenols, which may explain the observed antiproliferative effect of rosemary extract in the leukemia cells. Metabolomics analysis suggested that rosemary polyphenols affected differently the intracellular levels of some metabolites in two leukemia cell sublines. Integration of data obtained from transcriptomics and metabolomics platforms was attempted by overlaying datasets on canonical (defined) metabolic pathways using IPA software. This strategy enabled the identification of several differentially expressed genes in the metabolic pathways modulated by rosemary polyphenols providing more evidences on the effect of these compounds. PMID:22887152

  20. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).


    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E


    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  1. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia


    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  2. Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)

    PubMed Central

    Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.


    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3´ COI), the Barcode region in the five prime end of the COI (5´ COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3´ COI depicted six highly supported molecular lineages (A–F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5´ COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3´ COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  3. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.


    Kang, J-H; Park, J-Y; Choi, T-J


    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  4. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.


    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun


    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population. PMID:26394200

  5. Encapsulation of Natural Polyphenolic Compounds; a Review

    PubMed Central

    Munin, Aude; Edwards-Lévy, Florence


    Natural polyphenols are valuable compounds possessing scavenging properties towards radical oxygen species, and complexing properties towards proteins. These abilities make polyphenols interesting for the treatment of various diseases like inflammation or cancer, but also for anti-ageing purposes in cosmetic formulations, or for nutraceutical applications. Unfortunately, these properties are also responsible for a lack in long-term stability, making these natural compounds very sensitive to light and heat. Moreover, polyphenols often present a poor biodisponibility mainly due to low water solubility. Lastly, many of these molecules possess a very astringent and bitter taste, which limits their use in food or in oral medications. To circumvent these drawbacks, delivery systems have been developed, and among them, encapsulation would appear to be a promising approach. Many encapsulation methods are described in the literature, among which some have been successfully applied to plant polyphenols. In this review, after a general presentation of the large chemical family of plant polyphenols and of their main chemical and biological properties, encapsulation processes applied to polyphenols are classified into physical, physico-chemical, chemical methods, and other connected stabilization methods. After a brief description of each encapsulation process, their applications to polyphenol encapsulation for pharmaceutical, food or cosmetological purposes are presented. PMID:24309309

  6. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Styła, K.; Szajdak, L.


    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci

  7. Wine Polyphenols: Potential Agents in Neuroprotection

    PubMed Central

    Basli, Abdelkader; Soulet, Stéphanie; Chaher, Nassima; Mérillon, Jean-Michel; Chibane, Mohamed; Monti, Jean-Pierre; Richard, Tristan


    There are numerous studies indicating that a moderate consumption of red wine provides certain health benefits, such as the protection against neurodegenerative diseases. This protective effect is most likely due to the presence of phenolic compounds in wine. Wine polyphenolic compounds are well known for the antioxidant properties. Oxidative stress is involved in many forms of cellular and molecular deterioration. This damage can lead to cell death and various neurodegenerative disorders, such as Parkinson's or Alzheimer's diseases. Extensive investigations have been undertaken to determine the neuroprotective effects of wine-related polyphenols. In this review we present the neuroprotective abilities of the major classes of wine-related polyphenols. PMID:22829964

  8. Polyphenolic Antioxidants and Neuronal Regeneration.


    Ataie, Amin; Shadifar, Mohammad; Ataee, Ramin


    Many studies indicate that oxidative stress is involved in the pathophysiology of neurodegenerative diseases. Oxidative stress can induce neuronal damages, modulate intracellular signaling and ultimately leads to neuronal death by apoptosis or necrosis. To review antioxidants preventive effects on oxidative stress and neurodegenerative diseases we accumulated data from international medical journals and academic informations' sites. According to many studies, antioxidants could reduce toxic neuronal damages and many studies confirmed the efficacy of polyphenol antioxidants in fruits and vegetables to reduce neuronal death and to diminish oxidative stress. This systematic review showed the antioxidant activities of phytochemicals which play as natural neuroprotectives with low adverse effects against some neurodegenerative diseases as Parkinson or Alzheimer diseases. PMID:27303602

  9. Polyphenolic Antioxidants and Neuronal Regeneration

    PubMed Central

    Ataie, Amin; Shadifar, Mohammad; Ataee, Ramin


    Many studies indicate that oxidative stress is involved in the pathophysiology of neurodegenerative diseases. Oxidative stress can induce neuronal damages, modulate intracellular signaling and ultimately leads to neuronal death by apoptosis or necrosis. To review antioxidants preventive effects on oxidative stress and neurodegenerative diseases we accumulated data from international medical journals and academic informations’ sites. According to many studies, antioxidants could reduce toxic neuronal damages and many studies confirmed the efficacy of polyphenol antioxidants in fruits and vegetables to reduce neuronal death and to diminish oxidative stress. This systematic review showed the antioxidant activities of phytochemicals which play as natural neuroprotectives with low adverse effects against some neurodegenerative diseases as Parkinson or Alzheimer diseases. PMID:27303602

  10. High polyphenol, low probiotic diet for weight loss because of intestinal microbiota interaction.


    Rastmanesh, Reza


    The relative proportion of Bacteroidetes to Firmicutes is decreased in obese people. This imbalance in gut microbiota generates signals controlling the expression of genes by the epithelial intestinal cells. Both dairy and non-dairy probiotics increase body weight, reportedly through Lactobacillus species growth in the gut. On the other hand, daily intake of some fruits and drinks such as three apples or three pears or grapefruit, or green tea, which all are rich in polyphenols, can significantly reduce body weight in obese people. Metabolism of polyphenols by microbiota involves the cleavage of glycosidic linkages. Glycans, which are the product of glycosidic cleavage, are necessary for survival of the intestinal microbiota as a nutrient foundation. There are two pivotal points: (i) Firmicutes possess a disproportionately smaller number of glycan-degrading enzymes than Bacteroidetes, (ii) Firmicutes are more repressed than the Bacteroidetes by phenolic compounds' antimicrobial properties. The Bacteroidetes community prevails following dietary polyphenol intake and its fermentation to phenolic compounds, due to having more glycan-degrading enzymes, so this may thus be a mechanism by which dietary polyphenols exert their weight lowering effect. I suggest that future studies utilize clone libraries and fingerprinting techniques enabling identification of the composition and community structure of the microbiota, and dot blot hybridization or fluorescent in situ hybridization to analyze abundance of particular taxa in obese and individuals. A supplementation with polyphenols with high bioavailability in obese individuals with higher Firmicutes/Bacteroides community ratio phenotype, when associated to a probiotic restricted diet, is proposed for weight loss; this hypothesis could have relevant implication in planning a successful dietary regimen and/or neutraceutical/pharmaceutical preparations for achieving and maintaining a normal body weight in obese individuals

  11. Tannin (Polyphenol) Stability in Aqueous Solutions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding the chemical stability of tannins (polyphenolics) in soils is critical to understanding their biological activities and fate. We examined the stability of chemically defined tannins in aqueous solutions under conditions simulating natural and laboratory conditions. We evaluated tanni...

  12. Protection of Dietary Polyphenols against Oral Cancer

    PubMed Central

    Ding, Yijian; Yao, Hua; Yao, Yanan; Yenwong Fai, Leonard; Zhang, Zhuo


    Oral cancer represents a health burden worldwide with approximate 275,000 new cases diagnosed annually. Its poor prognosis is due to local tumor invasion and frequent lymph node metastasis. Better understanding and development of novel treatments and chemo-preventive approaches for the preventive and therapeutic intervention of this type of cancer are necessary. Recent development of dietary polyphenols as cancer preventives and therapeutic agents is of great interest due to their antioxidant and anti-carcinogenic activities. Polyphenols may inhibit carcinogenesis in the stage of initiation, promotion, or progression. In particular, dietary polyphenols decrease incidence of carcinomas and exert protection against oral cancer by induction of cell death and inhibition of tumor growth, invasion, and metastasis. In this review, we discuss current progress of dietary polyphenols against oral cancers in vitro, in vivo, and at population levels. PMID:23771133

  13. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu


    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  14. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.


    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu


    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25061821

  15. Peanut protein structure, polyphenol content and immune response to peanut proteins in vivo are modulated by laccase.


    Mihajlovic, L; Radosavljevic, J; Nordlund, E; Krstic, M; Bohn, T; Smit, J; Buchert, J; Cirkovic Velickovic, T


    Food texture can be improved by enzyme-mediated covalent cross-linking of different food components, such as proteins and carbohydrates. Cross-linking changes the biological and immunological properties of proteins and may change the sensitizing potential of food allergens. In this study we applied a microbial polyphenol oxidase, laccase, to cross-link peanut proteins. The size and morphology of the obtained cross-linked proteins were analyzed by electrophoresis and electron microscopy. Structural changes in proteins were analyzed by CD spectroscopy and by using specific antibodies to major peanut allergens. The bioavailability of peanut proteins was analyzed using a Caco-2 epithelial cell model. The in vivo sensitizing potential of laccase-treated peanut proteins was analyzed using a mouse model of food allergy. Finally, peanut polyphenols were analyzed by UHPLC-MS/MS, before and after the enzymatic reaction with laccase. Laccase treatment of peanut proteins yielded a covalently cross-linked material, with the modified tertiary structure of peanut proteins, improved bioavailability of Ara h 2 (by 70 fold, p < 0.05) and modulated allergic immune response in vivo. The modulation of the immune response was related to the increased production of IgG2a antibodies 11 fold (p < 0.05) and reduced IL-13 secretion in in vitro cultured splenocytes 7 fold (p < 0.05). Analysis of the peanut polyphenol content and profile by HPLC-MS/MS revealed that laccase treatment depleted the peanut extract of polyphenol compounds leaving mostly isorhamnetin derivatives and procyanidin dimer B-type in detectable amounts. Treatment of complex food extracts rich in polyphenols with laccase results in both protein cross-linking and modification of polyphenol compounds. These extensively cross-linked proteins have unchanged potency to induce allergic sensitization in vivo, but certain immunomodulatory changes were observed. PMID:27138276

  16. Coupling in cytochrome c oxidase

    PubMed Central

    Kessler, R. J.; Blondin, G. A.; Zande, H. Vande; Haworth, R. A.; Green, D. E.


    Cytochrome c oxidase (ferrocytochrome c: oxygen oxidoreductase; EC can be resolved into an electron transfer complex (ETC) and an ionophore transfer complex (ITC). Coupling requires an interaction between the moving electron in the ETC and a moving, positively charged ionophore-cation adduct in the ITC. The duplex character of cytochrome oxidase facilitates this interaction. The ITC mediates cyclical cation transport. It can be replaced as the coupling partner by the combination of valinomycin and nigericin in the presence of K+ when cytochrome oxidase is incorporated into liposomes containing acidic phospholipids or by the combination of lipid cytochrome c and bile acids in an ITC-resolved preparation of the ETC. Respiratory control can be induced by incorporating cytochrome oxidase into vesicles of unfractionated whole mitochondrial lipid. The activity of the ITC is suppressed by such incorporation and this suppression leads to the emergence of respiratory control. The ionophoroproteins of the ITC can be extracted into organic solvents; some 50% of the total protein of cytochrome oxidase is extractable. The release of free ionophore is achieved by tryptic digestion of the ionophoroprotein. Preliminary to this release the ionophoroprotein is degraded to an ionophoropeptide. Electrogenic ionophores, as well as uncoupler, are liberated by such proteolysis. The ITC contains a set of ionophoroproteins imbedded in a matrix of phospholipid. Images PMID:198794

  17. Polyphenols: skin photoprotection and inhibition of photocarcinogenesis.


    Afaq, F; Katiyar, S K


    Polyphenols are a large family of naturally occurring plant products and are widely distributed in plant foods, such as, fruits, vegetables, nuts, flowers, bark and seeds, etc. These polyphenols contribute to the beneficial health effects of dietary products. Clinical and epidemiological studies suggest that exposure of the skin to environmental factors/pollutants, such as solar ultraviolet (UV) radiation induce harmful effects and leads to various skin diseases including the risk of melanoma and non-melanoma skin cancers. The incidence of non-melanoma skin cancer, comprising of squamous cell carcinoma and basal cell carcinoma, is a significant public health concern world-wide. Exposure of the skin to solar UV radiation results in inflammation, oxidative stress, DNA damage, dysregulation of cellular signaling pathways and immunosuppression thereby resulting in skin cancer. The regular intake of natural plant products, especially polyphenols, which are widely present in fruits, vegetables, dry legumes and beverages have gained considerable attention as protective agents against the adverse effects of UV radiation. In this article, we first discussed the impact of polyphenols on human health based on their structure-activity relationship and bioavailability. We then discussed in detail the photoprotective effects of some selected polyphenols on UV-induced skin inflammation, proliferation, immunosuppression, DNA damage and dysregulation of important cellular signaling pathways and their implications in skin cancer management. The selected polyphenols include: green tea polyphenols, pomegranate fruit extract, grape seed proanthocyanidins, resveratrol, silymarin, genistein and delphinidin. The new information on the mechanisms of action of these polyphenols supports their potential use in skin photoprotection and prevention of photocarcinogenesis in humans. PMID:22070679

  18. Polyphenols: Skin Photoprotection and Inhibition of Photocarcinogenesis

    PubMed Central

    Afaq, Farrukh; Katiyar, Santosh K.


    Polyphenols are a large family of naturally occurring plant products and are widely distributed in plant foods, such as, fruits, vegetables, nuts, flowers, bark and seeds, etc. These polyphenols contribute to the beneficial health effects of dietary products. Clinical and epidemiological studies suggest that exposure of the skin to environmental factors/pollutants, such as solar ultraviolet (UV) radiation induce harmful effects and leads to various skin diseases including the risk of melanoma and non-melanoma skin cancers. The incidence of non-melanoma skin cancer, comprising of squamous cell carcinoma and basal cell carcinoma, is a significant public health concern world-wide. Exposure of the skin to solar UV radiation results in inflammation, oxidative stress, DNA damage, dysregulation of cellular signaling pathways and immunosuppression thereby resulting in skin cancer. The regular intake of natural plant products, especially polyphenols, which are widely present in fruits, vegetables, dry legumes and beverages have gained considerable attention as protective agents against the adverse effects of UV radiation. In this article, we first discussed the impact of polyphenols on human health based on their structure-activity relationship and bioavailability. We then discussed in detail the photoprotective effects of some selected polyphenols on UV-induced skin inflammation, proliferation, immunosuppression, DNA damage and dysregulation of important cellular signaling pathways and their implications in skin cancer management. The selected polyphenols include: green tea polyphenols, pomegranate fruit extract, grape seed proanthocyanidins, resveratrol, silymarin, genistein and delphinidin. The new information on the mechanisms of action of these polyphenols supports their potential use in skin photoprotection and prevention of photocarcinogenesis in humans. PMID:22070679

  19. Modulation of neurotrophic signaling pathways by polyphenols

    PubMed Central

    Moosavi, Fatemeh; Hosseini, Razieh; Saso, Luciano; Firuzi, Omidreza


    Polyphenols are an important class of phytochemicals, and several lines of evidence have demonstrated their beneficial effects in the context of a number of pathologies including neurodegenerative disorders such as Alzheimer’s and Parkinson’s disease. In this report, we review the studies on the effects of polyphenols on neuronal survival, growth, proliferation and differentiation, and the signaling pathways involved in these neurotrophic actions. Several polyphenols including flavonoids such as baicalein, daidzein, luteolin, and nobiletin as well as nonflavonoid polyphenols such as auraptene, carnosic acid, curcuminoids, and hydroxycinnamic acid derivatives including caffeic acid phentyl ester enhance neuronal survival and promote neurite outgrowth in vitro, a hallmark of neuronal differentiation. Assessment of underlying mechanisms, especially in PC12 neuronal-like cells, reveals that direct agonistic effect on tropomyosin receptor kinase (Trk) receptors, the main receptors of neurotrophic factors including nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) explains the action of few polyphenols such as 7,8-dihydroxyflavone. However, several other polyphenolic compounds activate extracellular signal-regulated kinase (ERK) and phosphoinositide 3-kinase (PI3K)/Akt pathways. Increased expression of neurotrophic factors in vitro and in vivo is the mechanism of neurotrophic action of flavonoids such as scutellarin, daidzein, genistein, and fisetin, while compounds like apigenin and ferulic acid increase cyclic adenosine monophosphate response element-binding protein (CREB) phosphorylation. Finally, the antioxidant activity of polyphenols reflected in the activation of Nrf2 pathway and the consequent upregulation of detoxification enzymes such as heme oxygenase-1 as well as the contribution of these effects to the neurotrophic activity have also been discussed. In conclusion, a better understanding of the neurotrophic effects of polyphenols and

  20. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.


    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  1. Antioxidant and cytoprotective properties of partridgeberry polyphenols.


    Bhullar, Khushwant S; Rupasinghe, H P Vasantha


    Partridgeberry (Vaccinium vitis-idaea) is a polyphenol-rich berry of the Ericaceous family, grown in Newfoundland and Labrador province of Canada. The aims of this study were to identify extraction solvents for the maximum recovery of polyphenols, to establish fractionation technique for isolation of major sub-classes of polyphenols, and to evaluate antioxidant and cytoprotective properties of the partridgeberry polyphenol preparations. The acidified 70% acetone was identified as the ideal solvent for the maximum recovery of polyphenols from partridgeberry. Further, aqueous two-phase extraction, column chromatography and UPLC-MS/MS were employed to produce three partridgeberry polyphenol fractions, rich in either, anthocyanins, flavan-3-ols or flavonols. All the three PPF were potent antioxidants and displayed cytoprotective activity through the activation of nuclear factor erythroid 2-related factor 2 pathway, scavenging of reactive oxygen species, and inhibition of cellular death. The current study suggests that partridgeberry has numerous potential health implications in both prevention and amelioration of various diseases involving oxidative stress. PMID:25172753

  2. Polyphenols: Multipotent Therapeutic Agents in Neurodegenerative Diseases

    PubMed Central

    Bhullar, Khushwant S.; Rupasinghe, H. P. Vasantha


    Aging leads to numerous transitions in brain physiology including synaptic dysfunction and disturbances in cognition and memory. With a few clinically relevant drugs, a substantial portion of aging population at risk for age-related neurodegenerative disorders require nutritional intervention. Dietary intake of polyphenols is known to attenuate oxidative stress and reduce the risk for related neurodegenerative diseases such as Alzheimer's disease (AD), stroke, multiple sclerosis (MS), Parkinson's disease (PD), and Huntington's disease (HD). Polyphenols exhibit strong potential to address the etiology of neurological disorders as they attenuate their complex physiology by modulating several therapeutic targets at once. Firstly, we review the advances in the therapeutic role of polyphenols in cell and animal models of AD, PD, MS, and HD and activation of drug targets for controlling pathological manifestations. Secondly, we present principle pathways in which polyphenol intake translates into therapeutic outcomes. In particular, signaling pathways like PPAR, Nrf2, STAT, HIF, and MAPK along with modulation of immune response by polyphenols are discussed. Although current polyphenol researches have limited impact on clinical practice, they have strong evidence and testable hypothesis to contribute clinical advances and drug discovery towards age-related neurological disorders. PMID:23840922

  3. Use of Polyphenolic Compounds in Dermatologic Oncology.


    Costa, Adilson; Bonner, Michael Yi; Arbiser, Jack L


    Polyphenols are a widely used class of compounds in dermatology. While phenol itself, the most basic member of the phenol family, is chemically synthesized, most polyphenolic compounds are found in plants and form part of their defense mechanism against decomposition. Polyphenolic compounds, which include phenolic acids, flavonoids, stilbenes, and lignans, play an integral role in preventing the attack on plants by bacteria and fungi, as well as serving as cross-links in plant polymers. There is also mounting evidence that polyphenolic compounds play an important role in human health as well. One of the most important benefits, which puts them in the spotlight of current studies, is their antitumor profile. Some of these polyphenolic compounds have already presented promising results in either in vitro or in vivo studies for non-melanoma skin cancer and melanoma. These compounds act on several biomolecular pathways including cell division cycle arrest, autophagy, and apoptosis. Indeed, such natural compounds may be of potential for both preventive and therapeutic fields of cancer. This review evaluates the existing scientific literature in order to provide support for new research opportunities using polyphenolic compounds in oncodermatology. PMID:27164914

  4. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping


    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  5. Isolation and characterization of ellagitannins as the major polyphenolic components of Longan (Dimocarpus longan Lour) seeds.


    Sudjaroen, Yuttana; Hull, William E; Erben, Gerhard; Würtele, Gerd; Changbumrung, Supranee; Ulrich, Cornelia M; Owen, Robert W


    Longan (Dimocarpus longan Lour, syn. Euphoria longan Lam.) represents an important fruit in Northern Thailand and has significant economic impact. The fruit is either consumed fresh or as commercially prepared dried and canned products. The canning industry in Thailand produces considerable quantities of waste products, in particular Longan seeds. Because these seeds may be an exploitable source of natural phenolic antioxidants, it was of interest to identify, purify and quantitate the major potential antioxidant phenolics contained therein. The polyphenolic fraction from ground Longan seeds was obtained by extraction with methanol after delipidation with hexane. The hexane extract contained predominantly long-chain fatty acids with major contributions from palmitic (35%) and oleic (28%) acids. The polyphenolic fraction (80.90 g/kg dry weight) was dominated by ellagic acid (25.84 g/kg) and the known ellagitannins corilagin (13.31 g/kg), chebulagic acid (13.06 g/kg), ellagic acid 4-O-α-l-arabinofuranoside (9.93 g/kg), isomallotinic acid (8.56 g/kg) and geraniin (5.79 g/kg). Structure elucidation was performed with mass spectrometry and complete assignment of (1)H and (13)C NMR signals. The methanol extracts exhibited strong antioxidant capacities with an IC(50) of 154 μg/ml for reactive oxygen species attack on salicylic acid and 78 μg/ml for inhibition of xanthine oxidase in the hypoxanthine/xanthine oxidase assay. The extracts were less effective in the 2-deoxyguanosine assay (IC(50)=2.46 mg/ml), indicating that gallates along with ellagic acid and its congeners exert their potential antioxidant effects predominantly by precipitation of proteins such as xanthine oxidase. This was confirmed for the pure compounds gallic acid, methyl gallate, ellagic acid and corilagin. PMID:22277734

  6. Polyphenol metabolism provides a screening tool for beneficial effects of Onobrychis viciifolia (sainfoin).


    Thill, Jana; Regos, Ionela; Farag, Mohamed A; Ahmad, Asma F; Kusek, Justyna; Castro, Ana; Schlangen, Karin; Carbonero, Christine Hayot; Gadjev, Ilya Z; Smith, Lydia M J; Halbwirth, Heidi; Treutter, Dieter; Stich, Karl


    Onobrychis viciifolia (sainfoin) is a traditional fodder legume showing multiple benefits for the environment, animal health and productivity but weaker agronomic performance in comparison to other legumes. Benefits can be mainly ascribed to the presence of polyphenols. The polyphenol metabolism in O. viciifolia was studied at the level of gene expression, enzyme activity, polyphenol accumulation and antioxidant activity. A screening of 37 accessions regarding each of these characters showed a huge variability between individual samples. Principal component analysis revealed that flavonols and flavan 3-ols are the most relevant variables for discrimination of the accessions. The determination of the activities of dihydroflavonol 4-reductase and flavonol synthase provides a suitable screening tool for the estimation of the ratio of flavonols to flavan 3-ols and can be used for the selection of samples from those varieties that have a specific optimal ratio of these compounds for further breeding. PMID:22818525

  7. Modulation of Immune Function by Polyphenols: Possible Contribution of Epigenetic Factors

    PubMed Central

    Cuevas, Alejandro; Saavedra, Nicolás; Salazar, Luis A.; Abdalla, Dulcineia S. P.


    Several biological activities have been described for polyphenolic compounds, including a modulator effect on the immune system. The effects of these biologically active compounds on the immune system are associated to processes as differentiation and activation of immune cells. Among the mechanisms associated to immune regulation are epigenetic modifications as DNA methylation of regulatory sequences, histone modifications and posttranscriptional repression by microRNAs that influences the gene expression of key players involved in the immune response. Considering that polyphenols are able to regulate the immune function and has been also demonstrated an effect on epigenetic mechanisms, it is possible to hypothesize that there exists a mediator role of epigenetic mechanisms in the modulation of the immune response by polyphenols. PMID:23812304

  8. Bioconversion of tea polyphenols to bioactive theabrownins by Aspergillus fumigatus.


    Wang, Qiuping; Gong, Jiashun; Chisti, Yusuf; Sirisansaneeyakul, Sarote


    Theabrownins (TB) are water-soluble phenolic compounds associated with the various health benefits of Pu-erh tea, a post-fermented Chinese dark tea. This work reports on the production of theabrownins from infusions of sun-dried green tea leaves using a pure culture of Aspergillus fumigatus isolated from a solid-state Pu-erh tea fermentation. A theabrownins yield of 158 g kg(-1) sun-dried green tea leaves was obtained in 6 days at 45 °C in an aerobic fermentation. In a 2 l fermenter, the yield of theabrownins was 151 g kg(-1) sun-dried green tea leaves in 48 h of aerobic culture (45 °C, 1 vvm aeration rate, 250 rpm agitation speed). Extracellular polyphenol oxidase and peroxidase of A. fumigatus contributed to this bioconversion. Repeated batch fermentation process was used for producing theabrownins but was less productive than the batch process. PMID:25214210

  9. Molecular mechanisms underlying the potential antiobesity-related diseases effect of cocoa polyphenols.


    Ali, Faisal; Ismail, Amin; Kersten, Sander


    Obesity and related metabolic diseases (e.g., type 2 diabetes, cardiovascular diseases, and hypertension) are the most prevailing nutrition-related issues in the world. An emerging feature of obesity is their relationship with chronic inflammation that begins in white adipose tissue and eventually becomes systemic. One potential dietary strategy to reduce glucose intolerance and inflammation is consumption of polyphenol-rich cocoa-like cocoa or their by-products. In vitro as well as in vivo data indicate that cocoa polyphenols (CPs) may exhibit antioxidant and anti-inflammatory properties. Polyphenols commonly found in cocoa have been reported to regulate lipid metabolism via inducing metabolic gene expression or activating transcription factors that regulate the expression of numerous genes, many of which play an important role in energy metabolism. Currently, several molecular targets (e.g., nuclear factor Kappa B, activated protein-1, peroxisome proliferator-activated receptors, liver X receptors, and adiponectin gene) have been identified, which may explain potential beneficial obesity-associated diseases effects of CPs. Further studies have been performed regarding the protective effects of CPs against metabolic diseases by suppressing transcription factors that antagonize lipid accumulation. Thus, polyphenols-rich cocoa products may diminish obesity-mediated metabolic diseases by multiple mechanisms, thereby attenuating chronic inflammation. PMID:24259381

  10. Oxidase-peroxidase enzymes of Datura innoxia. Oxidation of formylphenylacetic acid ethyl ester.

    PubMed Central

    Kalyanaraman, V S; Mahadevan, S; Kumar, S A


    An enzyme system from Datura innoxia roots oxidizing formylphenylacetic acid ethyl ester was purified 38-fold by conventional methods such as (NH4)2SO4 fractionation, negative adsorption on alumina Cy gel and chromatography on DEAE-cellulose. The purified enzyme was shown to catalyse the stoicheiometric oxidation of formylphenylacetic acid ethyl ester to benzoylformic acid ethyl ester and formic acid, utilizing molecular O2. Substrate analogues such as phenylacetaldehyde and phenylpyruvate were oxidized at a very low rate, and formylphenylacetonitrile was an inhilating agents, cyanide, thiol compounds and ascorbic acid. This enzyme was identical with an oxidase-peroxidase isoenzyme. Another oxidase-peroxidase isoenzyme which separated on DEAE-chromatography also showed formylphenylacetic acid ethyl ester oxidase activity, albeit to a lesser extent. The properties of the two isoenzymes of the oxidase were compared and shown to differ in their oxidation and peroxidation properties. The oxidation of formylphenylacetic acid ethyl ester was also catalysed by horseradish peroxidase. The Datura isoenzymes exhibited typical haemoprotein spectra. The oxidation of formylphenylacetic acid ethyl ester was different from other peroxidase-catalysed reactions in not being activated by either Mn2+ or monophenols. The oxidation was inhibited by several mono- and poly-phenols and by catalase. A reaction mechanism for the oxidation is proposed. PMID:997

  11. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.


    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes


    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  12. Protoporphyrinogen Ox