Science.gov

Sample records for polyphenol oxidase gene

  1. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  2. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  3. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  4. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  5. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  6. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  7. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  8. Activation of polyphenol oxidase of chloroplasts.

    PubMed

    Tolbert, N E

    1973-02-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or -18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density.Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles x mg(-1) chlorophyll x hr(-1). Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes.Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  9. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  10. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  11. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit.

  12. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  13. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  14. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  15. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  16. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  17. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.

    PubMed

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-09-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley.

  18. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  19. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated

  20. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...

  1. Polyphenol oxidase activity in co-ensiled temperate grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) and its o-diphenol substrates have been shown to effectively decrease proteolytic activity during the ensiling of forages such as red clover. Orchardgrass and smooth bromegrass both contain high levels of PPO activity, but lack appropriate levels of o-diphenols to adequately...

  2. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...

  3. CHARACTERISTICS OF POLYPHENOL OXIDASES FROM RED CLOVER (TRIFOLIUM PRATENSE)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense). Production of o-quinones in red clover inhibits post-har...

  4. Immunoblot analyses of the elicited Sanguinaria canadensis enzyme, dihydrobenzophenanthridine oxidase: evidence for resolution from a polyphenol oxidase isozyme.

    PubMed

    Ignatov, A; Neuman, M C; Barg, R; Krueger, R J; Coscia, C J

    1997-11-15

    In our initial purification of dihydrobenzophenanthridine oxidase from Sanguinaria canadensis plant cell cultures, we reported that our most purified preparations contained a major band at 77 kDa and minor lower Mr bands. Here we present evidence on highly purified dihydrobenzophenanthridine oxidase from elicited S. canadensis cultures to indicate that this enzyme is the 77-kDa protein and that lower Mr bands include an isozyme(s) of the polyphenol oxidase family that copurifies with it. An antibody raised against the 77-kDa protein and an anti-polyphenol oxidase antibody that recognizes a 70-kDa band were used to monitor chromatographic fractions by immunoblot analysis of the oxidases. Oxidase-containing eluates from DEAE-Sephadex, CM, and HiTrap blue were compared to corresponding flow-through fractions. Bands at 77 and 88 kDa were detected with anti-dihydrobenzophenanthridine oxidase antibody in eluates displaying high dihydrobenzophenanthridine oxidase activity. Polyphenol oxidase specific activity and immunoreactivity partitioned both in flow-through and eluate fractions of the CM and HiTrap columns. Estimation of the dihydrobenzophenanthridine oxidase and polyphenol oxidase specific activities for each step showed increasing enrichment of alkaloidal enzyme accompanied by variable dihydrobenzophenanthridine oxidase/polyphenol oxidase activity ratios. Taken together these observations indicate that the dihydrobenzophenanthridine and polyphenol oxidases have Mr values of 77 and 70 kDa, respectively, and the two enzymes are different entities.

  5. Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

  6. Genetic mapping of polyphenol oxidase in tetraploid wheat.

    PubMed

    Simeone, Rosanna; Pasqualone, Antonella; Clodoveo, Maria Lisa; Blanco, Antonio

    2002-01-01

    Pasta colour is one of the main factors influencing pasta quality. It is the product of a desirable yellow component, an undesirable brown component and, under some drying conditions, a red component. The brown colour depends on enzymatic and chemical factors. Polyphenol oxidase (PPO; E.C. 1.14.18.1) is one of the enzymatic factors. It is mainly localised in the peripheral part of the wheat kernel, and is involved in the oxidation of endogenous wheat phenolic compounds resulting in the production of highly coloured products. Therefore, a knowledge of the genetic control of PPO activity could enable the developing of better strategies in breeding programs to reduce pasta darkening. The aim of this study was to map the gene(s) affecting PPO activity using a set of recombinant inbred (RI) lines, derived from a cross between Triticum turgidum L. var. durum cultivar Messapia and the accession MG4343 of Triticum turgidum L. var. dicoccoides. After performing linkage analysis, the gene for high PPO activity was mapped on the long arm of the chromosome 2A and its characteristic was found highly associated to the RFLP marker Xutv1427-2A, with a value of LOD equal to 29.84. The identification of molecular markers linked to loci controlling the PPO activity may potentially accelerate wheat breeding since the selection of plants can be carried out by genotype rather than phenotype.

  7. Genetic mapping of polyphenol oxidase in tetraploid wheat.

    PubMed

    Simeone, Rosanna; Pasqualone, Antonella; Clodoveo, Maria Lisa; Blanco, Antonio

    2002-01-01

    Pasta colour is one of the main factors influencing pasta quality. It is the product of a desirable yellow component, an undesirable brown component and, under some drying conditions, a red component. The brown colour depends on enzymatic and chemical factors. Polyphenol oxidase (PPO; E.C. 1.14.18.1) is one of the enzymatic factors. It is mainly localised in the peripheral part of the wheat kernel, and is involved in the oxidation of endogenous wheat phenolic compounds resulting in the production of highly coloured products. Therefore, a knowledge of the genetic control of PPO activity could enable the developing of better strategies in breeding programs to reduce pasta darkening. The aim of this study was to map the gene(s) affecting PPO activity using a set of recombinant inbred (RI) lines, derived from a cross between Triticum turgidum L. var. durum cultivar Messapia and the accession MG4343 of Triticum turgidum L. var. dicoccoides. After performing linkage analysis, the gene for high PPO activity was mapped on the long arm of the chromosome 2A and its characteristic was found highly associated to the RFLP marker Xutv1427-2A, with a value of LOD equal to 29.84. The identification of molecular markers linked to loci controlling the PPO activity may potentially accelerate wheat breeding since the selection of plants can be carried out by genotype rather than phenotype. PMID:12378236

  8. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  9. Polyphenol oxidase and peroxidase in fruits and vegetables.

    PubMed

    Vámos-Vigyázó, L

    1981-01-01

    Polyphenol oxidases and peroxidases are among the most studied enzymes in fruits and vegetables. Owing to the deleterious effects of discoloration and off-flavor formation induced by their actions, these enzymes have not ceased to be a matter of concern to food technologists, while their versatility as catalyst and their diversity as protein present a challenge to the biochemist. This article gives an account on the present state of knowledge in this field. The occurrence of polyphenol oxidases and peroxidases in food and food raw materials, and their role and importance in food processing are briefly outlined. Results of biochemical research including catalytic properties, substrate specificity, susceptibility towards pH and temperature, action of inhibitors, isolation, purification, and characteristics of the enzymes are given, with special emphasis on recent achievements based on high resolution separation and isoenzyme techniques. Finally, the behavior of polyphenol oxidase and peroxidase in selected major groups of fruits and vegetables is discussed. Some contradictions found in the literature are pointed out and some questions that have not been given the necessary attention by researchers so far are mentioned.

  10. Import, targeting, and processing of a plant polyphenol oxidase.

    PubMed Central

    Sommer, A; Ne'eman, E; Steffens, J C; Mayer, A M; Harel, E

    1994-01-01

    A tomato (Lycopersicon esculentum L.) gene encoding a precursor of polyphenol oxidase (PPO) was transcribed and translated in vitro. The import, targeting, and processing of the [35S]methionine-labeled precursor protein (pPPO) were studied in isolated chloroplasts. The protein was routed to the thylakoid lumen in two steps. The 67-kD precursor was first imported into the stroma in an ATP-dependent step. It was processed to a 62-kD intermediate by a stromal peptidase. Translocation into the lumen was light dependent and involved processing of the 62-kD to the 59-kD mature form. The mature polypeptide was soluble in the lumen and not bound to thylakoids. This two-step targeting pattern was observed in plastids from a variety of plants including pea (Pisum sativum L.), tomato, and maize (Zea mays L.). The ratio between the intermediate and mature forms observed depended on the plant species, leaf age, growth conditions, and illumination regime to which the plants had been subjected. Cu2+ was not required for pPPO import or processing. Furthermore, low concentrations of Cu2+ (1-5 microM) markedly inhibited the first import step. Tentoxin specifically inhibited pPPO import, leaving the precursor bound to the envelope membrane. The two-step routing of pPPO into chloroplasts, typical of thylakoid lumen proteins, is consistent with the two-domain structure of the transit peptide and appears to be a feature of all plant PPO genes isolated so far. No evidence was found for unorthodox routing mechanisms, which have been suggested to be involved in the import of plant PPOs. The two-step routing may account for some of the multiplicity of PPO observed in vivo. PMID:7972497

  11. Import, targeting, and processing of a plant polyphenol oxidase.

    PubMed

    Sommer, A; Ne'eman, E; Steffens, J C; Mayer, A M; Harel, E

    1994-08-01

    A tomato (Lycopersicon esculentum L.) gene encoding a precursor of polyphenol oxidase (PPO) was transcribed and translated in vitro. The import, targeting, and processing of the [35S]methionine-labeled precursor protein (pPPO) were studied in isolated chloroplasts. The protein was routed to the thylakoid lumen in two steps. The 67-kD precursor was first imported into the stroma in an ATP-dependent step. It was processed to a 62-kD intermediate by a stromal peptidase. Translocation into the lumen was light dependent and involved processing of the 62-kD to the 59-kD mature form. The mature polypeptide was soluble in the lumen and not bound to thylakoids. This two-step targeting pattern was observed in plastids from a variety of plants including pea (Pisum sativum L.), tomato, and maize (Zea mays L.). The ratio between the intermediate and mature forms observed depended on the plant species, leaf age, growth conditions, and illumination regime to which the plants had been subjected. Cu2+ was not required for pPPO import or processing. Furthermore, low concentrations of Cu2+ (1-5 microM) markedly inhibited the first import step. Tentoxin specifically inhibited pPPO import, leaving the precursor bound to the envelope membrane. The two-step routing of pPPO into chloroplasts, typical of thylakoid lumen proteins, is consistent with the two-domain structure of the transit peptide and appears to be a feature of all plant PPO genes isolated so far. No evidence was found for unorthodox routing mechanisms, which have been suggested to be involved in the import of plant PPOs. The two-step routing may account for some of the multiplicity of PPO observed in vivo. PMID:7972497

  12. Molecular cloning and characterisation of banana fruit polyphenol oxidase.

    PubMed

    Gooding, P S; Bird, C; Robinson, S P

    2001-09-01

    Polyphenol oxidase (PPO; EC 1.10.3.2) is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.

  13. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

    PubMed

    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

    2001-02-01

    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.

  14. Antisense downregulation of polyphenol oxidase results in enhanced disease susceptibility.

    PubMed

    Thipyapong, Piyada; Hunt, Michelle D; Steffens, John C

    2004-11-01

    Polyphenol oxidases (PPOs; EC 1.14.18.1 or EC 1.10.3.2) catalyze the oxidation of phenolics to quinones, highly reactive intermediates whose secondary reactions are responsible for much of the oxidative browning that accompanies plant senescence, wounding, and responses to pathogens. To assess the impact of PPO expression on resistance to Pseudomonas syringae pv. tomato we introduced a chimeric antisense potato PPO cDNA into tomato (Lycopersicon esculentum L.). Oxidation of caffeic acid, the dominant o-diphenolic aglycone of tomato foliage, was decreased ca. 40-fold by antisense expression of PPO. All members of the PPO gene family were downregulated: neither immunoreactive PPO nor PPO-specific mRNA were detectable in the transgenic plants. In addition, the antisense PPO construct suppressed inducible increases in PPO activity. Downregulation of PPO in antisense plants did not affect growth, development, or reproduction of greenhouse-grown plants. However, antisense PPO expression dramatically increased susceptibility to P. syringae expressing the avirulence gene avrPto in both Pto and pto backgrounds. In a compatible (pto) interaction, plants constitutively expressing an antisense PPO construct exhibited a 55-fold increase in bacterial growth, three times larger lesion area, and ten times more lesions cm(-2) than nontransformed plants. In an incompatible (Pto) interaction, antisense PPO plants exhibited 100-fold increases in bacterial growth and ten times more lesions cm(-2) than nontransformed plants. Although it is not clear whether hypersusceptibility of antisense plants is due to low constitutive PPO levels or failure to induce PPO upon infection, these findings suggest a critical role for PPO-catalyzed phenolic oxidation in limiting disease development. As a preliminary effort to understand the role of induced PPO in limiting disease development, we also examined the response of PPO promoter::beta-glucuronidase constructs when plants are challenged with P

  15. Resolution of thylakoid polyphenol oxidase and a protein kinase

    SciTech Connect

    Race, H.L.; Davenport, J.W.; Hind, G.

    1995-12-31

    The predominant protein kinase activity in octylglucoside (OG) extracts of spinach thylakoids has been attributed to a 64-kDa protein, tp64. Recent work calls into question the relation between tp64 and protein kinase activity, which were fractionated apart using fluid phase IEF and hydroxylapatite chromatography. Hind et al. sequenced tp64 from the cDNA and showed it to be a polyphenol oxidase (PPO) homolog. Its transit peptide indicates a location for the mature protein within the thylakoid lumen, where there is presumably no ATP and where it is remote from the presumed kinase substrates: the stromally exposed regions of integral PS-II membrane proteins. Here the authors suggest that the kinase is a 64-kDa protein distinct from tp64.

  16. Partial characterization of polyphenol oxidase activity in raspberry fruits.

    PubMed

    González, E M; de Ancos, B; Cano, M P

    1999-10-01

    A partial characterization of polyphenol oxidase (PPO) activity in raspberry fruits is described. Two early cultivars harvested in May/June (Heritage and Autumm Bliss) and two late cultivars harvested in October-November (Ceva and Rubi) were analyzed for PPO activity. Stable and highly active PPO extracts were obtained using insoluble poly(vinylpyrrolidone) (PVP) and Triton X-100 in sodium phosphate, pH 7.0 buffer. Polyacrylamide gel electrophoresis of raspberry extracts under nondenaturing conditions resolved in one band (R(f)()(1) = 0.25). Raspberry PPO activity has pH optima of 8.0 and 5.5, both with catechol (0.1 M). Maximum activity was with D-catechin (catecholase activity), followed by p-coumaric acid (cresolase activity). Heritage raspberry also showed PPO activity toward 4-methylcatechol. Ceva and Autumm Bliss raspberries showed the higher PPO activity using catechol as substrate.

  17. Partial purification and characterization of polyphenol oxidase from persimmon.

    PubMed

    Navarro, José L; Tárrega, Amparo; Sentandreu, Miguel A; Sentandreu, Enrique

    2014-08-15

    Activity of polyphenol oxidase (PPO) from "Rojo Brillante" persimmon (Diospyros kaki L.) fruits was characterized. Crude extracts were used for characterization of enzyme activity and stability at different temperatures (60, 70 and 80 °C), pHs (from 3.5 to 7.5) and substrate concentrations (catechol from 0 to 0.5M). Maximum enzyme activity was reached at pH 5.5 and 55 °C. Enzyme stability was higher than PPO activities found in other natural sources, since above pH 5.5 the minimum time needed to achieve an enzyme inactivation of 90% was 70 min at 80 °C. However, at pH 4.0 the enzyme stability decreased, reaching inactivation levels above 90% after 10 min even at 60 °C. Thus it was concluded that acidification can circumvent browning problems caused by PPO activity. Moreover, polyacrylamide gel electrophoresis of the enriched extract revealed the presence of at least four bands with strong oxidase activity, suggesting the existence of different PPO isoforms.

  18. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.

    PubMed

    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria

    2004-08-01

    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC 1.10.3.1 and EC 1.14.18.1) was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine.

  19. Temperature dependence of the activity of polyphenol peroxidases and polyphenol oxidases in modern and buried soils

    NASA Astrophysics Data System (ADS)

    Yakushev, A. V.; Kuznetsova, I. N.; Blagodatskaya, E. V.; Blagodatsky, S. A.

    2014-05-01

    Under conditions of the global climate warming, the changes in the reserves of soil humus depend on the temperature sensitivities of polyphenol peroxidases (PPPOs) and polyphenol oxidases (PPOs). They play an important role in lignin decomposition, mineralization, and humus formation. The temperature dependence of the potential enzyme activity in modern and buried soils has been studied during incubation at 10 or 20°C. The experimental results indicate that it depends on the availability of the substrate and the presence of oxygen. The activity of PPOs during incubation in the absence of oxygen for two months decreases by 2-2.5 times, which is balanced by an increase in the activity of PPPOs by 2-3 times. The increase in the incubation temperature to 20°C and the addition of glucose accelerates this transition due to the more abrupt decrease in the activity of PPOs. The preincubation of the soil with glucose doubles the activity of PPPOs but has no significant effect on the activity of PPOs. The different effects of temperature on two groups of the studied oxidases and the possibility of substituting enzymes by those of another type under changing aeration conditions should be taken into consideration in predicting the effect of the climate warming on the mineralization of the soil organic matter. The absence of statistically significant differences in the enzymatic activity between the buried and modern soil horizons indicates the retention by the buried soil of some of its properties (soil memory) and the rapid restoration of high enzymatic activity during the preincubation.

  20. Characterization of polyphenol oxidase activity in Ataulfo mango.

    PubMed

    Cheema, Summervir; Sommerhalter, Monika

    2015-03-15

    Crude extracts of Ataulfo exhibited polyphenol oxidase (PPO) activity with pyrogallol, 3-methylcatechol, catechol, gallic acid, and protocatechuic acid. The substrate dependent pH optima ranged from pH 5.4 to 6.4 with Michaelis-Menten constants between 0.84 ± 0.09 and 4.6 ± 0.7 mM measured in MES or phosphate buffers. The use of acetate buffers resulted in larger Michaelis-Menten constants, up to 14.62 ± 2.03 mM. Sodium ascorbate, glutathione, and kojic acid are promising inhibitors to prevent enzymatic browning in Ataulfo. PPO activity increased with ripeness and was always higher in the skin compared to the pulp. Sodium dodecyl sulphate (SDS) enhanced PPO activity, with pulp showing a stronger increase than skin. SDS-PAGE gels stained for catecholase activity showed multiple bands, with the most prominent bands at apparent molecular weights of 53, 112, and 144 kDa.

  1. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    NASA Astrophysics Data System (ADS)

    Chung, Si-Yin; Houska, Milan; Reed, Shawndrika

    2013-12-01

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens. Since high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts containing caffeic acid were treated with each of the following: (1) HP; (2) HP+PPO; (3) PPO; and (4) none. HP was conducted at 300 and 500 MPa, each for 3 and 10 min, 37 °C. After treatment, SDS-PAGE was performed and allergenic capacity (IgE binding) was determined colorimetrically in inhibition enzyme-linked immunosorbent assay and Western blots, using a pooled plasma from peanut-allergic patients. Data showed that HP alone had no effect on major peanut allergens. However, HP at 500 MPa combined with PPO (HP500/PPO) induced a higher (approximately twofold) reduction of major peanut allergens and IgE binding than PPO alone or HP300/PPO. There was no difference between treatment times. We concluded that HP500/PPO at 3-min enhanced a twofold reduction of the allergenic capacity of peanut extracts, as compared to PPO itself.

  2. Substrate inhibition competes with halide inhibition in polyphenol oxidase.

    PubMed

    Lim, Giselle Grace Fernando; Imura, Yuki; Yoshimura, Etsuro

    2012-10-01

    Polyphenol oxidase (PPO) is a ubiquitous enzyme important in the food industry. Although PPO activity followed Michaelis-Menten kinetics at catechol concentrations of up to 1 mM, it slowly decreased at catechol concentrations above 2 mM. This result indicated that in addition to the active site (site A), the enzyme possesses a second catechol-binding site (site B) that exerts an inhibitory effect on PPO activity. Halides inhibit PPO activity in such a way that substrate inhibition is lessened when halide concentration is increased. Furthermore, elevated concentrations of catechol diminished the degree of inhibition by halides. These findings suggest that halides also bind to site B to inhibit PPO activity. A steady-state kinetic analysis demonstrated that the dissociation constant between catechol and PPO depended on the binding of halides to site B. The dissociation constants were greatest when chloride bound to the site. Bromide and iodide yielded lower dissociation constants, in that order. These data indicate that the binding of halide to site B modulated the structure of site A, thereby exerting an inhibitory effect.

  3. Purification and characterization of polyphenol oxidase from rape flower.

    PubMed

    Sun, Han-Ju; Wang, Jing; Tao, Xue-Ming; Shi, Juan; Huang, Mei-Ying; Chen, Zhe

    2012-01-25

    The purification and partial enzymology characteristics of polyphenol oxidase (PPO) from rape flower were studied. After preliminary treatments, the crude enzyme solution was in turn purified with ammonium sulfate, dialysis, and Sephadex G-75 gel chromatography. The optimal conditions and stability of PPO were examined at different pH values and temperatures. Subsequently, PPO was also characterized by substrate (catechol) concentrations, inhibitors, kinetic parameters, and molecular weight. Results showed that the optimal pH for PPO activity was 5.5 in the presence of catechol and that PPO was relatively stable at pH 3.5-5.5. PPO was moderately stable at temperatures from 60 to 70 °C, whereas it was easily denatured at 80-90 °C. Ethylenediaminetetraacetic acid, sodium chloride, and calcium chloride had little inhibitive effects on PPO, whereas citric acid, sodium sulfite, and ascorbic acid had strongly inhibitive effects. The Michaelis-Menten constant (K(m)) and maximal reaction velocity (V(max)) of PPO were 0.767 mol/L and 0.519 Ab/min/mL of the crude PPO solution, respectively. PPO was finally purified to homogeneity with a purification factor of 4.41-fold and a recovery of 12.41%. Its molecular weight was 60.4 kDa, indicating that the PPO is a dimer. The data obtained in this research may help to prevent the enzymatic browning of rape flower during its storage and processing.

  4. Polyphenol oxidase as a biochemical seed defense mechanism

    PubMed Central

    Fuerst, E. Patrick; Okubara, Patricia A.; Anderson, James V.; Morris, Craig F.

    2014-01-01

    Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO), when wild oat (Avena fatua L.) caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea), non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems. PMID:25540647

  5. Polyphenol oxidases from latex of Hevea brasiliensis: purification and characterization.

    PubMed

    Wititsuwannakul, Dhirayos; Chareonthiphakorn, Nopphakaew; Pace, Mario; Wititsuwannakul, Rapepun

    2002-09-01

    Polyphenol oxidase (PPO) was isolated from the B-serum obtained after repetitive freeze-thawing of the bottom fraction isolated from ultracentrifuged fresh latex. The B-serum was subjected to acetone precipitation and CM-Sepharose chromatography, affording two PPOs, PPO-I and PPO-II, which, upon SDS-PAGE, were 32 and 34 kDa, respectively. Both PPOs possessed the same pI (9.2), optimum pH (7) and optimum temperature (35-45 degrees C). They are stable up to 60 degrees C and active at broad pH ranges from 4-9. The K(m) values of PPO-I for dopamine, L-dopa and catechol as substrates are 2.08, 8.33 and 9.09 mM, while those for PPO-II are 2.12, 4.76 and 7.14 mM, respectively. Among various PPO inhibitors tested, 4-hexylresorcinol was the most potent. Anionic detergents were among the most effective activators of the enzymes, while cationic and nonionic detergents showed little and no effect on the PPO activities, respectively. PMID:12169303

  6. cDNA cloning and expression of potato polyphenol oxidase.

    PubMed

    Hunt, M D; Eannetta, N T; Yu, H; Newman, S M; Steffens, J C

    1993-01-01

    Polyphenol oxidases (PPOs) of plants are copper metalloproteins which catalyze the oxidation of mono- and o-diphenols to o-diquinones. Although PPOs are believed to be primarily responsible for the deleterious browning of many fruit and vegetable crops and are thought to be involved in plant-pest interactions, direct evidence for these roles is lacking. We report the cloning of two PPO cDNAs from Solanum tuberosum leaves. These cDNAs exhibit 97% and 98% sequence similarity at the DNA and deduced amino acid levels, respectively. Putative copper-binding regions of both cDNAs are very similar to those of mammalian, bacterial and Neurospora tyrosinases. Both leaf PPO cDNAs appear to encode polypeptides which are processed to a mature molecular weight of 57,000. In potato leaves, petioles, roots, and flowers, PPO is encoded by ca. 2 kb transcripts. Leaf PPO mRNA is developmentally regulated and only detectable in young foliage. In contrast, the protein profile of immunologically detectable PPO remains constant from the apical node through the eleventh leaf node. PMID:7678763

  7. Characterization of polyphenol oxidase activity in Ataulfo mango.

    PubMed

    Cheema, Summervir; Sommerhalter, Monika

    2015-03-15

    Crude extracts of Ataulfo exhibited polyphenol oxidase (PPO) activity with pyrogallol, 3-methylcatechol, catechol, gallic acid, and protocatechuic acid. The substrate dependent pH optima ranged from pH 5.4 to 6.4 with Michaelis-Menten constants between 0.84 ± 0.09 and 4.6 ± 0.7 mM measured in MES or phosphate buffers. The use of acetate buffers resulted in larger Michaelis-Menten constants, up to 14.62 ± 2.03 mM. Sodium ascorbate, glutathione, and kojic acid are promising inhibitors to prevent enzymatic browning in Ataulfo. PPO activity increased with ripeness and was always higher in the skin compared to the pulp. Sodium dodecyl sulphate (SDS) enhanced PPO activity, with pulp showing a stronger increase than skin. SDS-PAGE gels stained for catecholase activity showed multiple bands, with the most prominent bands at apparent molecular weights of 53, 112, and 144 kDa. PMID:25308684

  8. Inhibition of apple polyphenol oxidase activity by sodium chlorite.

    PubMed

    Lu, Shengmin; Luo, Yaguang; Feng, Hao

    2006-05-17

    Sodium chlorite (SC) was shown to have strong efficacy both as a sanitizer to reduce microbial growth on produce and as a browning inhibitor on fresh-cut apples in previous experiments. This study was undertaken to investigate the inhibitory effect of SC on polyphenol oxidase (PPO) and the associated mechanisms. The experiment showed that SC had a strong inhibition of apple PPO. The extent of inhibition was influenced by SC concentration and pH. Inhibition was most prominent at pH 4.5, at which approximately 30% of enzyme activity was lost in the presence of 10 mM SC, followed closely by that at pH 4.0 with a 26% reduction in PPO activity. The inhibition mode was determined using Dixon and Lineweaver-Burk plots, which established SC to be a mixed inhibitor of apple PPO for the oxidation of catechol. Preincubation of PPO with 8 mM SC for 8 min caused a maximum of 46% activity reduction compared to noninhibited control. However, preincubation of SC with catechol for 8 min resulted in no additional loss of PPO activity. These findings provide further evidence that the inhibition of PPO activity by SC is due to the inhibition of the enzyme itself rather than removal of the substrate.

  9. Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...

  10. Inhibition of polyphenol oxidases activity by various dipeptides.

    PubMed

    Girelli, Anna M; Mattei, Enrico; Messina, Antonella; Tarola, Anna M

    2004-05-19

    In an effort to develop natural and nontoxic inhibitors on the activity of mushroom polyphenol oxidase (PPO) the effect of various glycyl-dipeptides (GlyAsp, GlyGly, GlyHis, GlyLeu, GlyLys, GlyPhe, GlyPro, GlyTyr) was investigated. The inhibition study with dihydroxyphenylalanine (DOPA) as substrate is based on separation of the enzymatic reaction components by reversed phase HPLC and the UV detection of the dopachrome formed. The results have evidenced that several of tested dipeptides inhibited PPO activity in the range of 20-40% while GlyPro and GlyLeu had no effect. The study has also permitted the characterization of the following kinetic pattern: a linear-mixed-type mechanism for GlyAsp, GlyGly, GlyLys, and GlyPhe and a hyperbolic-mixed-type for GlyTyr. It was not possible to identify the inhibition mechanism for GlyHis, although it affects PPO activity. In addition the effects of GlyAsp, GlyLys and GlyHis were evaluated for lessening the browning of fresh Golden Delicious apple and Irish White Skinned potato. The effectiveness of such inhibitors was determined by the difference between the colors observed in the dipeptide-treated sample and the controls using the color space CIE-Lab system. The % browning inhibition on potato (20-50%) was greater than of apple (20-30%) by the all tested dipeptides. Only GlyLys presented the significant value of 50%.

  11. Inhibition of polyphenol oxidases activity by various dipeptides.

    PubMed

    Girelli, Anna M; Mattei, Enrico; Messina, Antonella; Tarola, Anna M

    2004-05-19

    In an effort to develop natural and nontoxic inhibitors on the activity of mushroom polyphenol oxidase (PPO) the effect of various glycyl-dipeptides (GlyAsp, GlyGly, GlyHis, GlyLeu, GlyLys, GlyPhe, GlyPro, GlyTyr) was investigated. The inhibition study with dihydroxyphenylalanine (DOPA) as substrate is based on separation of the enzymatic reaction components by reversed phase HPLC and the UV detection of the dopachrome formed. The results have evidenced that several of tested dipeptides inhibited PPO activity in the range of 20-40% while GlyPro and GlyLeu had no effect. The study has also permitted the characterization of the following kinetic pattern: a linear-mixed-type mechanism for GlyAsp, GlyGly, GlyLys, and GlyPhe and a hyperbolic-mixed-type for GlyTyr. It was not possible to identify the inhibition mechanism for GlyHis, although it affects PPO activity. In addition the effects of GlyAsp, GlyLys and GlyHis were evaluated for lessening the browning of fresh Golden Delicious apple and Irish White Skinned potato. The effectiveness of such inhibitors was determined by the difference between the colors observed in the dipeptide-treated sample and the controls using the color space CIE-Lab system. The % browning inhibition on potato (20-50%) was greater than of apple (20-30%) by the all tested dipeptides. Only GlyLys presented the significant value of 50%. PMID:15137808

  12. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. PMID:23628925

  13. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke.

  14. Functional analysis of polyphenol oxidases by antisense/sense technology.

    PubMed

    Thipyapong, Piyada; Stout, Michael J; Attajarusit, Jutharat

    2007-01-01

    Polyphenol oxidases (PPOs) catalyze the oxidation of phenolics to quinones, the secondary reactions of which lead to oxidative browning and postharvest losses of many fruits and vegetables. PPOs are ubiquitous in angiosperms, are inducible by both biotic and abiotic stresses, and have been implicated in several physiological processes including plant defense against pathogens and insects, the Mehler reaction, photoreduction of molecular oxygen by PSI, regulation of plastidic oxygen levels, aurone biosynthesis and the phenylpropanoid pathway. Here we review experiments in which the roles of PPO in disease and insect resistance as well as in the Mehler reaction were investigated using transgenic tomato (Lycopersicon esculentum) plants with modified PPO expression levels (suppressed PPO and overexpressing PPO). These transgenic plants showed normal growth, development and reproduction under laboratory, growth chamber and greenhouse conditions. Antisense PPO expression dramatically increased susceptibility while PPO overexpression increased resistance of tomato plants to Pseudomonas syringae. Similarly, PPO-overexpressing transgenic plants showed an increase in resistance to various insects, including common cutworm (Spodoptera litura (F.)), cotton bollworm (Helicoverpa armigera (Hübner)) and beet army worm (Spodoptera exigua (Hübner)), whereas larvae feeding on plants with suppressed PPO activity had higher larval growth rates and consumed more foliage. Similar increases in weight gain, foliage consumption, and survival were also observed with Colorado potato beetles (Leptinotarsa decemlineata (Say)) feeding on antisense PPO transgenic tomatoes. The putative defensive mechanisms conferred by PPO and its interaction with other defense proteins are discussed. In addition, transgenic plants with suppressed PPO exhibited more favorable water relations and decreased photoinhibition compared to nontransformed controls and transgenic plants overexpressing PPO, suggesting

  15. Effects of Transgenic Hybrid Aspen Overexpressing Polyphenol Oxidase on Rhizosphere Diversity▿

    PubMed Central

    Oliver, Kathryn L.; Hamelin, Richard C.; Hintz, William E.

    2008-01-01

    This study assessed the potential effects of transgenic aspen overexpressing a polyphenol oxidase gene on diversity in rhizosphere communities. Cultivation-independent methods were used to better delineate bacterial and fungal populations associated with transgenic and nontransgenic trees. Gene libraries for the bacterial component of the rhizosphere were established using 16S rRNA and chaperonin-60 (CPN-60) gene sequences, while the fungal community was characterized using 18S rRNA gene sequences. The 16S rRNA gene libraries were dominated by alphaproteobacterial sequences, while the CPN-60 gene libraries were dominated by members of the Bacteroidetes/Chlorobi group. In both the CPN-60 and 16S rRNA libraries, there were differences in only minor components of the bacterial community between transgenic and unmodified trees, and no significant differences in species diversity were observed. Compared to the bacterial gene libraries, greater coverage of the underlying population was achieved with the fungal 18S rRNA libraries. Members of the Zygomycota, Chytridiomycota, Ascomycota, and Basidiomycota were recovered from both libraries. The dominant groups of fungi associated with each tree type were very similar, although there were some qualitative differences in the recovery of less-abundant fungi, likely as a result of the underlying heterogeneity of the fungal population. The methods employed revealed only minor differences between the bacterial and fungal communities associated with transgenic and unmodified trees. PMID:18552195

  16. Spinach thylakoid polyphenol oxidase isolation, activation, and properties of the native chloroplast enzyme

    SciTech Connect

    Golbeck, J.H.; Cammarata, K.V.

    1981-05-01

    Polyphenol oxidase activity (E.C. 1.14,18.1) has been found in two enzyme species isolated from thylakoid membranes of spinach chloroplasts. The proteins were released from the membrane by sonication and purified >900-fold by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzymes appear to be the tetramer and monomer of a subunit with a molecular weight of 42,500 as determined by lithium dodecyl sulfate gel electrophoresis. Sonication releases polyphenol oxidase from the membrane largely in the latent state. In the absence of added fatty acids, the isolated enzyme spontaneously, but slowly, activates with time. Purified polyphenol oxidase utilizes o-diphenols as substrates and shows no detectable levels of monophenol or p-diphenol oxidase activities. Suitable substrates include chlorogenic acid, catechol, caffeic acid, pyrogallol, and dopamine; however, the enzyme is substrate-inhibited by the last four at concentrations near their K/sub m/. A large seasonal variation in polyphenol oxidase activity may result from a decrease in enzyme content rather than inhibition of the enzyme present.

  17. Polyphenol oxidase (PPO) in wheat and wild relatives: molecular evidence for a multigene family.

    PubMed

    Massa, Alicia N; Beecher, Brian; Morris, Craig F

    2007-05-01

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid (Triticum monococcum, T. urartu, Aegilops tauschii, and Ae. speltoides), tetraploid (T. turgidum, subspecies dicoccoides and durum) and hexaploid (T. aestivum cultivars Klasic and ID377s) wheat species to gain a better understanding of the structure and organization of PPO genes. DNA fragments were amplified from a highly polymorphic and phylogenetic informative region of the gene. As a result, we obtained highly discriminative sequences. Three distinct PPOs, obtained from the A genome of T. monococcum, provided evidence for gene duplication events (paralogous loci). Furthermore, the number of sequences obtained for bread and durum wheat was higher than the expected number of orthologous loci. Sequence comparison revealed nucleotide and structural diversity, and detected five sequence intron types, all with a common insertion position. This was hypothesized to be homologous to that of intron 2 of previously reported wheat PPOs. A MITE of the Stowaway family accounted for the major difference between the five intervening sequences, and was unique to T. aestivum cv. Klasic. Nucleotide and structural diversity, together with well-resolved phylogenetic trees, provided molecular evidence to support the hypothesis of a PPO multigene family structure and organization. PMID:17468807

  18. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

  19. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) may have multiple functions in tissues, depending on its cellular or tissue localization. We used PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in nitrogen-fixing nodules. In red clov...

  20. Inheritance of grain polyphenol oxidase (PPO) activity in multiple wheat (Triticum aestivum L.) genetic backgrounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Grain polyphenol oxidase (PPO) activity can cause discoloration of wheat (Triticum aestivum L.) food products. Five crosses (PI 117635/Antelope; Fielder/NW03681; Fielder/Antelope; NW07OR1070/Antelope; NW07OR1066/OR2050272H) were selected to study the genetic inheritance of PPO activity. STS marker...

  1. Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...

  2. Effect of high pressure on peanut allergens in the presence of polyphenol oxidase and caffeic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High pressure (HP) enhances enzymatic reactions. Because polyphenol oxidase (PPO) is an enzyme, and reduces IgE binding of peanut allergens in presence of caffeic acid (CA), we postulated that a further reduction in IgE binding can be achieved, using HP together with PPO and CA. Peanut extracts cont...

  3. Purification of a polyphenol oxidase isoform from potato (Solanum tuberosum) tubers.

    PubMed

    Marri, Costanza; Frazzoli, Alessandra; Hochkoeppler, Alejandro; Poggi, Valeria

    2003-08-01

    A different expression pattern of polyphenol oxidases has been observed during storage in cultivars of potato (Solanum tuberosum L.) featuring different length of dormancy: a short-dormant cultivar showed, at the end of the dormancy, both the highest polyphenol oxidase activity and the largest number of enzyme isoforms. An isoform of polyphenol oxidase isolated at the end of the physiological dormancy from a short-dormant cultivar has been purified to homogeneity by means of column chromatography on phenyl Sepharose and on Superdex 200. The purification factor has been determined equal to 88, and the molecular mass of the purified isoform has been estimated to be 69 and 340 kDa by SDS polyacrylamide gel electrophoresis and gel filtration on Superdex 200, respectively, indicating this PPO isoform as a multimer. The corresponding zymogram features a diffused single band at the cathodic region of the gel and the pI of this polyphenol oxidase has been calculated equal to 6.5. PMID:12877914

  4. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.

    PubMed

    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria

    2004-08-01

    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC 1.10.3.1 and EC 1.14.18.1) was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine. PMID:15587701

  5. Tissue Printing to Visualize Polyphenol Oxidase and Peroxidase in Vegetables, Fruits, and Mushrooms

    ERIC Educational Resources Information Center

    Melberg, Amanda R.; Flurkey, William H.; Inlow, Jennifer K.

    2009-01-01

    A simple tissue-printing procedure to determine the tissue location of the endogenous enzymes polyphenol oxidase and peroxidase in a variety of vegetables, fruits, and mushrooms is described. In tissue printing, cell contents from the surface of a cut section of the tissue are transferred to an adsorptive surface, commonly a nitrocellulose…

  6. Biochemical characteristics and thermal inhibition kinetics of polyphenol oxidase extracted from Thompson seedless grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) was isolated from Thompson seedless grape (Vitis vinifera 'Thompson Seedless') and its biochemical characteristics were studied. Optimum pH and temperature for grape PPO activity were pH 6.0 and 25 degrees C with 10 mM catechol as substrate. The enzyme was heat-stable betwee...

  7. THREE POLYPHENOL OXIDASES FROM RED CLOVER (TRIFOLIUM PRATENSE) DIFFER IN ENZYMATIC ACTIVITIES AND ACTIVATION PROPERTIES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidases (PPOs) oxidize o-diphenols to o-quinones, which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense L.). Production of o-quinones in red clover inhibits postharvest proteolysis during the ensiling proces...

  8. Tomato polyphenol oxidase B is spatially and temporally regulated during development and in response to ethylene.

    PubMed

    Newman, Sally M; Tantasawat, Piyada; Steffens, John C

    2011-01-01

    Plant polyphenol oxidases (PPOs) are ubiquitous plastid-localized enzymes. A precise analysis of PPO function in plants has been complicated by the presence of several family members with immunological cross reactivity. Previously we reported the isolation of genomic clones coding for the seven members of the tomato (Solanum lycopersicum) PPO family (A, A', B, C, D, E, and F). Here we report the complex spatial and temporal expression of one of the members, PPO B. The PPO B promoter was sequenced and subjected to homology analysis. Sequence similarities were found to nucleotide sequences of genes encoding enzymes/proteins active in the following systems: phenylpropanoid biosynthesis, signal transduction and responsiveness to hormones and stresses, fruit and seed proteins/enzymes, and photosynthesis. Chimeric gene fusions were constructed linking PPO B 5' flanking regions to the reporter gene, b-glucuronidase (GUS). The resultant transgenic plants were histochemically analyzed for GUS activity in various vegetative and reproductive tissues, and evaluated for PPO B responsiveness to ethylene induction. It was shown that PPO B expression was tissue specific, developmentally regulated, ethylene induced, and localized predominantly to mitotic or apoptotic tissues. PMID:21224781

  9. Activation of defense mechanism in wheat by polyphenol oxidase from aphid saliva.

    PubMed

    Ma, Rui; Chen, Ju-Lian; Cheng, Deng-Fa; Sun, Jing-Rui

    2010-02-24

    The saliva of two cereal aphids, Sitobion avenae and Schizaphis graminum in third-instar nymphs, was collected after 24 h of feeding by 30 aphids, separately, on artificial diet sachets, and the salivary enzymes were determined. The result showed that polyphenol oxidase (PPO) existed in the saliva of both aphid species, and the enzymatic activities were 6.2 x 10(-3) U/g for S. avenae and 2.37 x 10(-1) U/g for S. graminum, revealing a 38-fold higher activity in the saliva of S. graminum than in the saliva of S. avenae. It was speculated that the higher PPO activity in S. graminum saliva was a contributing factor to the light yellow spot left on the feeding site of the wheat leaf by S. graminum; no such spot was left by S. avenae. After treatment of a wheat seedling with the saliva of S. avenae and S. graminum and PPO at the concentration of aphid saliva, transcript profiling data showed that aphid saliva and PPO significantly induced expression of the genes aos and fps. Because genes aos and fps encode the key enzymes in the defense signal pathways jasmonic acid and terpene signal pathways, respectively, it was deduced that PPO from aphid saliva, as the main elicitor, triggers an appropriate defense response in wheat through jasmonic acid and terpene signal pathways. PMID:20112908

  10. Polyphenolic composition, antioxidant activity, and polyphenol oxidase (PPO) activity of quince (Cydonia oblonga Miller) varieties.

    PubMed

    Wojdyło, Aneta; Oszmiański, Jan; Bielicki, Paweł

    2013-03-20

    Phytochemical profiles (phenolic compounds, L-ascorbic acid, antioxidant and PPO activities) of 13 different quince varieties and 5 genotypes were studied. Polyphenols were identified by LC-PDA-QTof/MS and quantified by UPLC-PDA and UPLC-FL. A total of 26 polyphenolic compounds found in quince tissues were identified and presented: 9 flavan-3-ols ((-)-epicatechin, procyanidin B2, 3 procyanidin dimers and trimers, and 1 tetramer); 8 hydroxycinnamates, derivatives of caffeoylquinic and coumaroylquinic acid; and 9 kaempferol and quercetin derivatives. The content of total polyphenols was between 1709.43 (genotype 'S1') and 3436.56 mg/100 g dry weight ('Leskovač'). Flavan-3-ols, which are the major class of quince polyphenols, represented between 78 and 94% of the total polyphenolic compounds. The activity of PPO enzyme ranged from 709.85 to 1284.59 ΔU/min, and that of L-ascorbic acid ranged from 5.86 to 26.42 mg/100 g. Some quince varieties and their products characterized by a higher content of phenolic compounds may be selected to promote their positive effect on health.

  11. Application of mesoporous silica materials for the immobilization of polyphenol oxidase.

    PubMed

    Corell Escuin, Paula; García-Bennett, Alfonso; Ros-Lis, Jose Vicente; Argüelles Foix, Angel; Andrés, Ana

    2017-02-15

    The ability of a number of mesoporous silica materials (SBA-15, SBA-3, and MCM-48) to immobilize polyphenol oxidase (PPO) at different pH has been tested. Pore size and volume are the structural characteristics with higher influence on the PPO immobilization. Mesoropous material SBA-15 adsorbs a larger quantity of PPO at pH 4.00 and offers an inhibition of enzymatic activity close the 50% in apple extracts. PMID:27664646

  12. Application of mesoporous silica materials for the immobilization of polyphenol oxidase.

    PubMed

    Corell Escuin, Paula; García-Bennett, Alfonso; Ros-Lis, Jose Vicente; Argüelles Foix, Angel; Andrés, Ana

    2017-02-15

    The ability of a number of mesoporous silica materials (SBA-15, SBA-3, and MCM-48) to immobilize polyphenol oxidase (PPO) at different pH has been tested. Pore size and volume are the structural characteristics with higher influence on the PPO immobilization. Mesoropous material SBA-15 adsorbs a larger quantity of PPO at pH 4.00 and offers an inhibition of enzymatic activity close the 50% in apple extracts.

  13. Polyphenol oxidase in potato. A multigene family that exhibits differential expression patterns.

    PubMed

    Thygesen, P W; Dry, I B; Robinson, S P

    1995-10-01

    Polyphenol oxidase (PPO) activity in potato (Solanum tuberosum) plants was high in stolons, tubers, roots, and flowers but low in leaves and stems. PPO activity per tuber continued to increase throughout tuber development but was highest on a fresh weight basis in developing tubers. PPO activity was greatest at the tuber exterior, including the skin and cortex tissue 1 to 2 mm beneath the skin. Flowers had high PPO activity throughout development, particularly in the anthers and ovary. Five distinct cDNA clones encoding PPO were isolated from developing tuber RNA. POT32 was the major form expressed in tubers and was found in all parts of the tuber and at all stages of tuber development. It was also expressed in roots but not in photosynthetic tissues. POT33 was expressed in tubers but mainly in the tissue near the skin. POT72 was detected in roots and at low levels in developing tubers. NOR333 was identical with the P2 PPO clone previously isolated from potato leaves (M.D. Hunt, N.T. Eannetta, Y. Haifeng, S.M. Newman, J.C. Steffens [1993] Plant Mol Biol 21: 59-68) and was detected in young leaves and in tissue near the tuber skin but was highly expressed in flowers. The results indicate that PPO is present as a small multigene family in potato and that each gene has a specific temporal and spatial pattern of expression. PMID:7480344

  14. Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria).

    PubMed

    Wang, Jiehua; Constabel, C Peter

    2004-11-01

    In order to functionally analyze the predicted defensive role of leaf polyphenol oxidase (PPO; EC 1.10.3.1) in Populus, transgenic hybrid aspen (Populus tremula x P. alba) plants overexpressing a hybrid poplar (Populus trichocarpa x P. deltoides) PtdPPO1 gene were constructed. Regenerated transgenic plants showed high PPO enzyme activity, PtdPPO1 mRNA levels and PPO protein accumulation. In leaf disk bioassays, forest tent caterpillar (Malacosoma disstria) larvae feeding on PPO-overexpressing transgenics experienced significantly higher mortality and reduced average weight gain compared to larvae feeding on control leaves. However, this effect was observed only when older egg masses were used and the resulting larvae showed reduced growth and vigor. In choice tests, no effect of PPO overexpression was detected. Although PPO in poplar leaves is latent and requires activation with detergents or trypsin for full enzymatic activity, in caterpillar frass the enzyme was extracted in the fully activated form. This activation correlated with partial proteolytic cleavage, suggesting that PPO latency and activation during digestion could be an adaptive and defense-related feature of poplar PPO.

  15. Eggplant polyphenol oxidase multigene family: cloning, phylogeny, expression analyses and immunolocalization in response to wounding.

    PubMed

    Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P

    2011-12-01

    Though polyphenol oxidase (PPO) genes from tomato and potato have been extensively studied, information about PPO genes in eggplant (Solanum melongena) is lacking. The main objective of this study is to understand the structural and functional aspects of eggplant PPO genes. Six eggplant PPO genes (SmePPO1-6) cloned by RACE and genome walking were found to be intronless and correspond to eight eggplant unigenes. Comprehensive sequence analyses indicated that the eggplant PPO genes exhibit considerable variation in the transit peptide regions, copper-binding domains and UTRs, and fall into two distinct structural classes. Further, PPO gene members appear to exist in clusters on eggplant chromosome 8 as seen in the case of tomato and potato PPOs. During normal growth and development, SmePPO1 and 2 are expressed in roots, whereas the transcript levels of all the eggplant PPO genes vary considerably in leaves, flowers and fruits. SmePPO1 was expressed in Escherichia coli as a GST fusion protein, and immunoblot using rabbit polyclonal antiserum to GST-SmePPO1 detected a major protein band (~70 kDa) and a minor band (~67 kDa) in eggplant fruit extract. Tissue printing indicated the predominant presence of PPO in the exocarp and the areas surrounding the seeds in the mesocarp of eggplant fruits. Immunolocalization of PPOs in eggplant infested with shoot-and-fruit borer revealed localization of the PPO at the site of infection in tender shoots and fruits, and further inside the mature tissues. The upregulation of eggplant PPO gene transcripts following mechanical injury shows that all the genes except SmePPO2 are induced in the fruit over 6h. On the contrary, the transcripts of SmePPO2 and PPO3 are not detectable in the stem, and expression seems to be prominent over a 2h period for SmePPO1 and SmePPO4-6. Our results show that eggplant PPO genes are structurally different, and are differentially expressed in various tissues of eggplant indicating their functional diversity

  16. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.

    PubMed

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2016-03-29

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo.

  17. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.

    PubMed

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2016-03-29

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo. PMID:26976571

  18. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard

    2016-01-01

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  19. Pre-heating and polyphenol oxidase inhibition impact on extraction of purple sweet potato anthocyanins.

    PubMed

    de Aguiar Cipriano, Paula; Ekici, Lutfiye; Barnes, Ryan C; Gomes, Carmen; Talcott, Stephen T

    2015-08-01

    Purple sweet potatoes (PSP) have been used as a natural food colorant with high acylated anthocyanins concentrations. Commercially extracting pigments from PSP can be challenging due to firm texture and high polyphenol oxidase (PPO) content. These studies evaluated hot water immersions (30, 50, 70, and 90°C for 10 min) as pre-heating treatments and addition of PPO inhibitors (citric acid, oxalic acid, and sodium borate) to aqueous extraction solutions to aid pigment recovery. Predominant PSP anthocyanins included acylated cyanidin or peonidin derivatives. Non-pigmented cinnamates acted as oxidase substrates and induced co-oxidation reactions with anthocyanins. Pre-heating PSP significantly increased polyphenolic yields in a temperature-dependent manner, consistent with tissue softening and PPO inactivation. The use of solvent modifiers in the extraction solution associated with heat helped minimize enzyme action and increased polyphenolic recovery. Minimizing the impact of PPO with heat was critical to the extraction and recovery of PSP anthocyanins, suitable for food use. PMID:25766822

  20. Pre-heating and polyphenol oxidase inhibition impact on extraction of purple sweet potato anthocyanins.

    PubMed

    de Aguiar Cipriano, Paula; Ekici, Lutfiye; Barnes, Ryan C; Gomes, Carmen; Talcott, Stephen T

    2015-08-01

    Purple sweet potatoes (PSP) have been used as a natural food colorant with high acylated anthocyanins concentrations. Commercially extracting pigments from PSP can be challenging due to firm texture and high polyphenol oxidase (PPO) content. These studies evaluated hot water immersions (30, 50, 70, and 90°C for 10 min) as pre-heating treatments and addition of PPO inhibitors (citric acid, oxalic acid, and sodium borate) to aqueous extraction solutions to aid pigment recovery. Predominant PSP anthocyanins included acylated cyanidin or peonidin derivatives. Non-pigmented cinnamates acted as oxidase substrates and induced co-oxidation reactions with anthocyanins. Pre-heating PSP significantly increased polyphenolic yields in a temperature-dependent manner, consistent with tissue softening and PPO inactivation. The use of solvent modifiers in the extraction solution associated with heat helped minimize enzyme action and increased polyphenolic recovery. Minimizing the impact of PPO with heat was critical to the extraction and recovery of PSP anthocyanins, suitable for food use.

  1. Impacts on the metabolome of down-regulating polyphenol oxidase in potato tubers.

    PubMed

    Shepherd, Louise Vida Traill; Alexander, Colin James; Hackett, Christine Anne; McRae, Diane; Sungurtas, Julia Anne; Verrall, Susan Ramsay; Morris, Jennifer Anne; Hedley, Peter Edward; Rockhold, David; Belknap, William; Davies, Howard Vivian

    2015-06-01

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes induced over a 48 hour (h) period by tuber wounding (sliced transverse sections) were also assessed using two PPO antisense lines (asPPO) and a wild-type (WT) control. Data were analysed using Principal Components Analysis and Analysis of Variance to assess differences between genotypes and temporal changes post-tuber wounding (by slicing). The levels of 15 metabolites (out of a total of 134 that were detected) differed between the WT and asPPO lines in mature tubers at harvest. A considerably higher number (63) of these metabolites changed significantly over a 48 h period following tuber wounding. For individual metabolites the magnitude of the differences between the WT and asPPO lines at harvest were small compared with the impacts of tuber wounding on metabolite levels. Some of the observed metabolite changes are explicable in terms of pathways known to be affected by wound responses. Whilst some statistically significant interactions (11 metabolites) were observed between line and time after wounding, very few profiles were consistent when comparing the WT with both asPPO lines, and the underlying metabolites appeared to be random in terms of the pathways they occupy. Overall, mechanical damage to tubers has a considerably greater impact on the metabolite profile than any potential unintended effects resulting from the down-regulation of PPO gene expression.

  2. Impacts on the metabolome of down-regulating polyphenol oxidase in potato tubers.

    PubMed

    Shepherd, Louise Vida Traill; Alexander, Colin James; Hackett, Christine Anne; McRae, Diane; Sungurtas, Julia Anne; Verrall, Susan Ramsay; Morris, Jennifer Anne; Hedley, Peter Edward; Rockhold, David; Belknap, William; Davies, Howard Vivian

    2015-06-01

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes induced over a 48 hour (h) period by tuber wounding (sliced transverse sections) were also assessed using two PPO antisense lines (asPPO) and a wild-type (WT) control. Data were analysed using Principal Components Analysis and Analysis of Variance to assess differences between genotypes and temporal changes post-tuber wounding (by slicing). The levels of 15 metabolites (out of a total of 134 that were detected) differed between the WT and asPPO lines in mature tubers at harvest. A considerably higher number (63) of these metabolites changed significantly over a 48 h period following tuber wounding. For individual metabolites the magnitude of the differences between the WT and asPPO lines at harvest were small compared with the impacts of tuber wounding on metabolite levels. Some of the observed metabolite changes are explicable in terms of pathways known to be affected by wound responses. Whilst some statistically significant interactions (11 metabolites) were observed between line and time after wounding, very few profiles were consistent when comparing the WT with both asPPO lines, and the underlying metabolites appeared to be random in terms of the pathways they occupy. Overall, mechanical damage to tubers has a considerably greater impact on the metabolite profile than any potential unintended effects resulting from the down-regulation of PPO gene expression. PMID:25417184

  3. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation.

    PubMed

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette

    2014-09-17

    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80kb (cgAUS1) and 1.85kb (cgAUS2a, 2b), encoding for proteins of 68-69kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS-PAGE and shot-gun type nanoUHPLC-ESI-MS/MS.

  4. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation☆

    PubMed Central

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette

    2014-01-01

    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80 kb (cgAUS1) and 1.85 kb (cgAUS2a, 2b), encoding for proteins of 68–69 kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9 kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS–PAGE and shot-gun type nanoUHPLC–ESI-MS/MS. PMID:25109778

  5. Characterization of polyphenol oxidase and peroxidase and influence on browning of cold stored strawberry fruit.

    PubMed

    Chisari, Marco; Barbagallo, Riccardo N; Spagna, Giovanni

    2007-05-01

    Polyphenol oxidase and peroxidase were extracted from two different varieties of strawberry fruit (Fragaria x ananassa D, cv. 'Elsanta' and Fragaria vesca L, cv. 'Madame Moutot') and characterized using reliable spectrophotometric methods. In all cases, the enzymes followed Michaelis-Menten kinetics, showing different values of peroxidase kinetics parameters between the two cultivars: Km = 50.68 +/- 2.42 mM ('Elsanta') and 18.18 +/- 8.79 mM ('Madame Moutot') mM and Vmax = 0.14 +/- 0.03 U/g ('Elsanta') and 0.05 +/- 0.01 U/g ('Madame Moutot'). The physiological pH of fruit at the red ripe stage negatively affected the expression of both oxidases, except polyphenol oxidase from 'Madame Moutot' that showed the highest residual activity (68% of the maximum). Peroxidase from both cultivars was much more thermolable as compared with PPO, losing over 60% of relative activity already after 60 min of incubation at 40 degrees C. The POD activation energy was much lower than the PPO activation energy (DeltaE = 97.5 and 57.8 kJ mol-1 for 'Elsanta' and 'Madame Moutot', respectively). Results obtained from d-glucose and d-fructose inhibition tests evidenced a decreasing course of PPO and POD activities from both cultivars as the sugar concentration in the assay medium increased. Changes in CIE L*, a*, b*, chroma, and hue angle values were taken as a browning index of the samples during storage at 4 degrees C. A decrease in L* was evident in both cultivars but more marked in 'Elsanta'. PPO and POD activities from cv. 'Elsanta' were very well-correlated with the parameter L* (r2=0.86 and 0.89, respectively) and hue angle (r2=0.85 and 0.93, respectively). According to these results, the browning of the fruit seemed to be in relation to both oxidase activities.

  6. Characterization of polyphenol oxidase and peroxidase and influence on browning of cold stored strawberry fruit.

    PubMed

    Chisari, Marco; Barbagallo, Riccardo N; Spagna, Giovanni

    2007-05-01

    Polyphenol oxidase and peroxidase were extracted from two different varieties of strawberry fruit (Fragaria x ananassa D, cv. 'Elsanta' and Fragaria vesca L, cv. 'Madame Moutot') and characterized using reliable spectrophotometric methods. In all cases, the enzymes followed Michaelis-Menten kinetics, showing different values of peroxidase kinetics parameters between the two cultivars: Km = 50.68 +/- 2.42 mM ('Elsanta') and 18.18 +/- 8.79 mM ('Madame Moutot') mM and Vmax = 0.14 +/- 0.03 U/g ('Elsanta') and 0.05 +/- 0.01 U/g ('Madame Moutot'). The physiological pH of fruit at the red ripe stage negatively affected the expression of both oxidases, except polyphenol oxidase from 'Madame Moutot' that showed the highest residual activity (68% of the maximum). Peroxidase from both cultivars was much more thermolable as compared with PPO, losing over 60% of relative activity already after 60 min of incubation at 40 degrees C. The POD activation energy was much lower than the PPO activation energy (DeltaE = 97.5 and 57.8 kJ mol-1 for 'Elsanta' and 'Madame Moutot', respectively). Results obtained from d-glucose and d-fructose inhibition tests evidenced a decreasing course of PPO and POD activities from both cultivars as the sugar concentration in the assay medium increased. Changes in CIE L*, a*, b*, chroma, and hue angle values were taken as a browning index of the samples during storage at 4 degrees C. A decrease in L* was evident in both cultivars but more marked in 'Elsanta'. PPO and POD activities from cv. 'Elsanta' were very well-correlated with the parameter L* (r2=0.86 and 0.89, respectively) and hue angle (r2=0.85 and 0.93, respectively). According to these results, the browning of the fruit seemed to be in relation to both oxidase activities. PMID:17407312

  7. Changes in the location of polyphenol oxidase in potato (Solanum tuberosum L.) tuber during cell death in response to impact injury: comparison with wound tissue.

    PubMed

    Partington, J C; Smith, C; Bolwell, G P

    1999-01-01

    In order to elucidate the nature of the response of potato to impact injury at the biochemical level, changes in the location of the enzyme responsible for the discoloration, polyphenol oxidase, were determined using immunogold location with an antibody specific for potato tuber polyphenol oxidase. Tissue printing revealed that the enzyme was distributed throughout the tuber. Following impact injury, both tissue printing and quantitative electron microscopy indicated that there was no increase in the level of the enzyme although there was subcellular redistribution of polyphenol oxidase. This redistribution was first apparent at 12 h after impact, as determined by the use of confocal immunolocation, and coincided with loss of membrane integrity. These changes were examined in parallel with a number of stress-related parameters in both impact and wound responses. Wounding was accompanied by active gene expression and protein synthesis, leading to metabolic activity and tissue repair. In contrast, the bruising response was characterised by a limited active response and vital-staining methods indicated that after 16 h the tissue undergoes cell death. PMID:9951737

  8. ALTERNATIVE OXIDASE: From Gene to Function.

    PubMed

    Vanlerberghe, Greg C.; McIntosh, Lee

    1997-06-01

    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP.

  9. The enzymatic decolorization of textile dyes by the immobilized polyphenol oxidase from quince leaves.

    PubMed

    Arabaci, Gulnur; Usluoglu, Ayse

    2014-01-01

    Water pollution due to release of industrial wastewater has already become a serious problem in almost every industry using dyes to color its products. In this work, polyphenol oxidase enzyme from quince (Cydonia Oblonga) leaves immobilized on calcium alginate beads was used for the successful and effective decolorization of textile industrial effluent. Polyphenol oxidase (PPO) enzyme was extracted from quince (Cydonia Oblonga) leaves and immobilized on calcium alginate beads. The kinetic properties of free and immobilized PPO were determined. Quince leaf PPO enzyme stability was increased after immobilization. The immobilized and free enzymes were employed for the decolorization of textile dyes. The dye solutions were prepared in the concentration of 100 mg/L in distilled water and incubated with free and immobilized quince (Cydonia Oblonga) leaf PPO for one hour. The percent decolorization was calculated by taking untreated dye solution. Immobilized PPO was significantly more effective in decolorizing the dyes as compared to free enzyme. Our results showed that the immobilized quince leaf PPO enzyme could be efficiently used for the removal of synthetic dyes from industrial effluents.

  10. Purification and structural analysis of membrane-bound polyphenol oxidase from Fuji apple.

    PubMed

    Liu, Fang; Zhao, Jin-Hong; Wen, Xin; Ni, Yuan-Ying

    2015-09-15

    Membrane-bound polyphenol oxidase (mPPO) in Fuji apple (Malus domestica Borkh. cv. Red Fuji) was purified and analyzed with a nanoelectrospray ionization mass spectrometer. The three-dimensional model and binding site of mPPO to 4-methyl catechol were also studied using molecular docking. mPPO was purified 54.41-fold using temperature-induced phase partitioning technique and ion exchange chromatography. mPPO had a molecular weight of 67.3kDa. Even though a significant level of homology was observed between mPPO and the soluble polyphenol oxidase in the copper binding sequence, there was another region, rich in histidine residues, which differed in 13 amino acids. The three-dimensional structure of mPPO consisted of six α-helices, two short β-strands, and ten random coils. The putative substrate-binding pocket contained six polar or charged amino acids, His191, His221, Trp224, Trp228, Phe227, and Val190. Trp224 and Trp228 formed hydrogen bonds with 4-methyl-catechol.

  11. pH-induced kinetic co-operativity of a thylakoid-bound polyphenol oxidase.

    PubMed Central

    Valero, E; García-Carmona, F

    1992-01-01

    A study of the catecholase activity of a latent plant polyphenol oxidase, extracted and purified from the chloroplast membranes of grapes (Vitis vinifera cv. Airen), revealed for the first time a lag phase above pH 5.0, whereas a steady-state rate was reached immediately when pH values were lower, thus suggesting the hysteretic nature of the enzyme. During steady state, the enzyme showed negative co-operativity concomitant with the presence of the lag period, and followed classical Michaelis-Menten kinetics under more acid pH conditions. Statistical analysis of these data showed a minimal value for the extreme Hill coefficient of 0.54 at pH 6.0. This kinetic behaviour of polyphenol oxidase has been interpreted in terms of the pH-induced 'slow' transition mechanism reported by Ricard, Noat & Nari [(1984) Eur. J. Biochem. 145, 311-317] in which the conformational change does not affect the active site of the enzyme. Images Fig. 4. PMID:1530593

  12. The Enzymatic Decolorization of Textile Dyes by the Immobilized Polyphenol Oxidase from Quince Leaves

    PubMed Central

    Arabaci, Gulnur; Usluoglu, Ayse

    2014-01-01

    Water pollution due to release of industrial wastewater has already become a serious problem in almost every industry using dyes to color its products. In this work, polyphenol oxidase enzyme from quince (Cydonia Oblonga) leaves immobilized on calcium alginate beads was used for the successful and effective decolorization of textile industrial effluent. Polyphenol oxidase (PPO) enzyme was extracted from quince (Cydonia Oblonga) leaves and immobilized on calcium alginate beads. The kinetic properties of free and immobilized PPO were determined. Quince leaf PPO enzyme stability was increased after immobilization. The immobilized and free enzymes were employed for the decolorization of textile dyes. The dye solutions were prepared in the concentration of 100 mg/L in distilled water and incubated with free and immobilized quince (Cydonia Oblonga) leaf PPO for one hour. The percent decolorization was calculated by taking untreated dye solution. Immobilized PPO was significantly more effective in decolorizing the dyes as compared to free enzyme. Our results showed that the immobilized quince leaf PPO enzyme could be efficiently used for the removal of synthetic dyes from industrial effluents. PMID:24587743

  13. Extra virgin olive oil rich in polyphenols modulates VEGF-induced angiogenic responses by preventing NADPH oxidase activity and expression.

    PubMed

    Calabriso, Nadia; Massaro, Marika; Scoditti, Egeria; D'Amore, Simona; Gnoni, Antonio; Pellegrino, Mariangela; Storelli, Carlo; De Caterina, Raffaele; Palasciano, Giuseppe; Carluccio, Maria Annunziata

    2016-02-01

    Previous studies have shown the antiinflammatory, antioxidant and antiangiogenic properties by pure olive oil polyphenols; however, the effects of olive oil phenolic fraction on the inflammatory angiogenesis are unknown. In this study, we investigated the effects of the phenolic fraction (olive oil polyphenolic extract, OOPE) from extra virgin olive oil and related circulating metabolites on the VEGF-induced angiogenic responses and NADPH oxidase activity and expression in human cultured endothelial cells. We found that OOPE (1-10 μg/ml), at concentrations achievable nutritionally, significantly reduced, in a concentration-dependent manner, the VEGF-induced cell migration, invasiveness and tube-like structure formation through the inhibition of MMP-2 and MMP-9. OOPE significantly (P<0.05) reduced VEGF-induced intracellular reactive oxygen species by modulating NADPH oxidase activity, p47phox membrane translocation and the expression of Nox2 and Nox4. Moreover, the treatment of endothelial cells with serum obtained 4 h after acute intake of extra virgin olive oil, with high polyphenol content, decreased VEGF-induced NADPH oxidase activity and Nox4 expression, as well as, MMP-9 expression, as compared with fasting control serum. Overall, native polyphenols and serum metabolites of extra virgin olive oil rich in polyphenols are able to lower the VEGF-induced angiogenic responses by preventing endothelial NADPH oxidase activity and decreasing the expression of selective NADPH oxidase subunits. Our results provide an alternative mechanism by which the consumption of olive oil rich in polyphenols may account for a reduction of oxidative stress inflammatory-related sequelae associated with chronic degenerative diseases.

  14. Potential of plant polyphenol oxidases in the decolorization and removal of textile and non-textile dyes.

    PubMed

    Khan, Amjad Ali; Husain, Qayyum

    2007-01-01

    In this study an effort has been made to use plant polyphenol oxidases; potato (Solanum tuberosum) and brinjal (Solanum melongena), for the treatment of various important dyes used in textile and other industries. The ammonium sulphate fractionated enzyme preparations were used to treat a number of dyes under various experimental conditions. Majority of the treated dyes were maximally decolorized at pH 3.0. Some of the dyes were quickly decolorized whereas others were marginally decolorized. The initial first hour was sufficient for the maximum decolorization of dyes. The rate of decolorization was quite slow on long treatment of dyes. Enhancement in the dye decolorization was noticed on increasing the concentration of enzymes. The complex mixtures of dyes were treated with both preparations of polyphenol oxidases in the buffers of varying pH values. Potato polyphenol oxidase was significantly more effective in decolorizing the dyes to higher extent as compared to the enzyme obtained from brinjal polyphenol oxidase. Decolorization of dyes and their mixtures, followed by the formation of an insoluble precipitate, which could be easily removed simply by centrifugation.

  15. Potential of plant polyphenol oxidases in the decolorization and removal of textile and non-textile dyes.

    PubMed

    Khan, Amjad Ali; Husain, Qayyum

    2007-01-01

    In this study an effort has been made to use plant polyphenol oxidases; potato (Solanum tuberosum) and brinjal (Solanum melongena), for the treatment of various important dyes used in textile and other industries. The ammonium sulphate fractionated enzyme preparations were used to treat a number of dyes under various experimental conditions. Majority of the treated dyes were maximally decolorized at pH 3.0. Some of the dyes were quickly decolorized whereas others were marginally decolorized. The initial first hour was sufficient for the maximum decolorization of dyes. The rate of decolorization was quite slow on long treatment of dyes. Enhancement in the dye decolorization was noticed on increasing the concentration of enzymes. The complex mixtures of dyes were treated with both preparations of polyphenol oxidases in the buffers of varying pH values. Potato polyphenol oxidase was significantly more effective in decolorizing the dyes to higher extent as compared to the enzyme obtained from brinjal polyphenol oxidase. Decolorization of dyes and their mixtures, followed by the formation of an insoluble precipitate, which could be easily removed simply by centrifugation. PMID:17915700

  16. 4-Coumaroyl coenzyme A 3-hydroxylase activity from cell cultures of Lithospermum erythrorhizon and its relationship to polyphenol oxidase.

    PubMed

    Wang, Z X; Li, S M; Löscher, R; Heide, L

    1997-11-15

    A 4-coumaroyl-CoA 3-hydroxylase activity was purified 4600-fold from cell cultures of Lithospermum erythrorhizon. The enzyme showed a molecular mass of 42,400 +/- 1700 Da in gel chromatography and required ascorbate, NADH, or NADPH as cofactors. 4-Coumaroyl-CoA, 4-coumarate, p-cresol, and several other phenolic substances, but not tyrosine, were accepted as substrates for the hydroxylation. Besides hydroxylase activity, the enzyme showed diphenol oxidase activity. Both activities were inhibited by diethyldithiocarbamate or beta-mercaptoethanol, although at different concentrations. The enzyme showed striking similarity to a 4-coumaroyl-glucose 3-hydroxylase from sweet potato (Ipomoe batatas) roots, which has reportedly been purified to homogeneity and identified as a specific enzyme of chlorogenic acid biosynthesis. Close examination and comparison to a commercially available polyphenol oxidase, however, suggest that the enzyme activities purified from both Lithospermum and sweet potato are polyphenol oxidases rather than specific enzymes of secondary metabolism. PMID:9367532

  17. Polyphenol Oxidase from Hybrid Poplar. Cloning and Expression in Response to Wounding and Herbivory1

    PubMed Central

    Constabel, C. Peter; Yip, Lynn; Patton, Joseph J.; Christopher, Mary E.

    2000-01-01

    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa × Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests. PMID:10982443

  18. Pectin plays an important role on the kinetics properties of polyphenol oxidase from honeydew peach.

    PubMed

    Liu, Liang; Cao, Shaoqian; Yang, Hua; Qi, Xiangyang

    2015-02-01

    Polyphenol oxidase (PPO) was purified from peach pulp by a three-step column chromatographic procedure. The kinetics properties of the PPO fractions obtained from different purification steps were compared. All the fractions showed high affinities for (+)-catechin and (-)-epicatechin. The optimum pHs and optimum temperatures for all the fractions were the same. However, the fraction that contained pectin was more sensitive to the change of pH, and it had a lower affinity for the substrates and a higher thermostability than the fractions without pectin. In addition, the protein impurities in PPO fractions might have no effect on the properties of PPO. l-Cysteine and glutathione were effective for the inhibition of all the PPO fractions, while NaF inhibited moderately. However, the pectin could reduce the inhibition effects of those inhibitors.

  19. Interaction of polyphenol oxidase of Solanum tuberosum with β-cyclodextrin: Process details and applications.

    PubMed

    Singh, Virendra; Jadhav, Swati B; Singhal, Rekha S

    2015-09-01

    Polysaccharides differing in structure and chemical nature were screened for their ability to bind non-covalently with polyphenol oxidase (PPO) from potato (as a model) and their effect on enzyme activity. All the polysaccharides selected inhibited the PPO but β-cyclodextrin showed maximum inhibition under optimum conditions. Process details for the inhibition of PPO were studied with respect to concentration of β-cyclodextrin, temperature, pH, and time. Higher inhibition constant and lower half life was obtained at 40 °C than at 30 °C in the presence of inhibitor. β-Cyclodextrin showed mixed type of inhibition of PPO. β-Cyclodextrin was further exploited as anti-browning agent in selected fruit juices. It not only showed a significant anti-browning effect on freshly prepared potato juice but was also effective in other fruit juices. Better effect was seen in pineapple, apple and pear as compared to banana, sugarcane and guava fruit juices.

  20. Purification and characterisation of polyphenol oxidase (PPO) from eggplant (Solanum melongena).

    PubMed

    Mishra, Bibhuti B; Gautam, Satyendra; Sharma, Arun

    2012-10-15

    Eggplant (Solanum melongena) is a very rich source of polyphenol oxidase (PPO), which negatively affects its quality upon cutting and postharvest processing due to enzymatic browning. PPO inhibitors, from natural or synthetic sources, are used to tackle this problem. One isoform of PPO was 259-fold purified using standard chromatographic procedures. The PPO was found to be a 112 kDa homodimer. The enzyme showed very low K(m) (0.34 mM) and high catalytic efficiency (3.3×10(6)) with 4-methyl catechol. The substrate specificity was in the order: 4-methyl catechol>tert-butylcatechol>dihydrocaffeic acid>pyrocatechol. Cysteine hydrochloride, potassium metabilsulphite, ascorbic acid, erythorbic acid, resorcylic acid and kojic acid showed competitive inhibition, whereas, citric acid and sodium azide showed mixed inhibition of PPO activity. Cysteine hydrochloride was found to be an excellent inhibitor with the low inhibitor constant of 1.8 μM.

  1. Immobilization of polyphenol oxidase on chitosan-SiO2 gel for removal of aqueous phenol.

    PubMed

    Shao, Jian; Ge, Huimin; Yang, Yumin

    2007-06-01

    A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan-SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg/ml, PPO 4 mg/ml and pH 7.0), the activity of immobilized PPO was 1370 U/g and its Km value for catechol was 12 mM at 25 degrees C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized the enzyme with 73 and 58% retention of activity after 10 and 20 days, respectively, at 30 degrees C whereas most of the free enzyme was inactive after 7 days. The efficiency of removing phenol (10 mg phenol/l) by the immobilized PPO was 86%, and about 60% removal efficiency was retained after five recycles. The immobilized PPO may thus be a useful for removing phenolic compounds from industrial waste-waters. PMID:17417695

  2. Purification of polyphenol oxidase free of the storage protein patatin from potato tuber.

    PubMed

    Partington, J C; Bolwell, G P

    1996-08-01

    Routine protein purification to homogeneity from potato tuber, as from other storage tissues and seeds, is often hindered due to the large amounts of storage protein present. In potato, patatin, the major storage protein of the tuber, often contaminates preparations. The present work describes the purification of polyphenol oxidase (PPO) from the potato tuber (Solanum tuberosum cv Cara) to homogeneity including the critical step of hydrophobic chromatography on Octyl-Sepharose which was sufficient to completely remove patatin. The purified PPO was found to be a doublet of M(r) 60,000 and 69,000 when analysed by SDS-PAGE with a Km 4.3 +/- 0.3 mM for L-dihydroxyphenylalanine. Both bands were found to have similar N-terminal corresponding to PPO isoforms when sequenced. PMID:8783836

  3. Polyphenol oxidase and peroxidase expression in four pineapple varieties (Ananas comosus L.) after a chilling injury.

    PubMed

    Raimbault, Astrid-Kim; Marie-Alphonsine, Paul-Alex; Horry, Jean-Pierre; Francois-Haugrin, Madlyn; Romuald, Karell; Soler, Alain

    2011-01-12

    Pineapple internal browning (IB) is a chilling injury that produces enzymatic browning associated with flesh translucency. Pineapple biodiversity allowed the investigation of how polyphenol oxidase (PPO) and peroxidase (POD) activities with their different isoforms are involved in the IB mechanism. Fruits of four varieties that expressed IB symptoms differently, Smooth Cayenne (SCay) and the hybrids MD2, Flhoran 41 (Flh 41), and Flhoran 53 (Flh 53), were stressed by cold. The susceptible varieties showed classical brown spots but different patterns of IB, whereas MD2 and controls showed no IB. Enzymatic activities were measured on fruit protein extracts and PPO and POD isoforms separated on mini-gels (PhastSystem). Only PPO activity was significantly enhanced in the presence of IB. Up to six PPO isoforms were identified in the susceptible varieties. PPO was barely detectable in the nonsusceptible variety MD2 and in controls. The number of PPO isoforms and the total PPO activity after chilling are varietal characteristics. PMID:21133422

  4. Polyphenol oxidase and peroxidase expression in four pineapple varieties (Ananas comosus L.) after a chilling injury.

    PubMed

    Raimbault, Astrid-Kim; Marie-Alphonsine, Paul-Alex; Horry, Jean-Pierre; Francois-Haugrin, Madlyn; Romuald, Karell; Soler, Alain

    2011-01-12

    Pineapple internal browning (IB) is a chilling injury that produces enzymatic browning associated with flesh translucency. Pineapple biodiversity allowed the investigation of how polyphenol oxidase (PPO) and peroxidase (POD) activities with their different isoforms are involved in the IB mechanism. Fruits of four varieties that expressed IB symptoms differently, Smooth Cayenne (SCay) and the hybrids MD2, Flhoran 41 (Flh 41), and Flhoran 53 (Flh 53), were stressed by cold. The susceptible varieties showed classical brown spots but different patterns of IB, whereas MD2 and controls showed no IB. Enzymatic activities were measured on fruit protein extracts and PPO and POD isoforms separated on mini-gels (PhastSystem). Only PPO activity was significantly enhanced in the presence of IB. Up to six PPO isoforms were identified in the susceptible varieties. PPO was barely detectable in the nonsusceptible variety MD2 and in controls. The number of PPO isoforms and the total PPO activity after chilling are varietal characteristics.

  5. Polyphenol oxidase from hybrid poplar. Cloning and expression in response to wounding and herbivory.

    PubMed

    Constabel, C P; Yip, L; Patton, J J; Christopher, M E

    2000-09-01

    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa x Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests.

  6. Study and characterization of polyphenol oxidase from eggplant (Solanum melongena L.).

    PubMed

    Todaro, Aldo; Cavallaro, Rosalinda; Argento, Sergio; Branca, Ferdinando; Spagna, Giovanni

    2011-10-26

    In this study the catecholase and cresolase activities of eggplant polyphenol oxidase (PPO) were investigated. Enzyme activity was determined by measuring the increase in absorbance using catechol as substrate and 3-methyl-2-benzothiazolinone hydrazone (MBTH) as coupled reagent. The effects of substrate specificity, heat inactivation, temperature, pH, and inhibitors were investigated to understand the enzymatic alteration of ready-to-eat preparations. Browning of vegetables was determined through a colorimeter. Decrease of lightness (L*) and increase of color difference values (ΔE*) were correlated with tissue browning. Antibrowning agents were tested on PPO under the same conditions. The enzyme activity was strongly inhibited by 0.4 M citric acid. Under natural pH conditions, the enzyme was also inhibited by tartaric acid and acetic acid. All of the results were used to understand the best conditions for food transformation (ready-to-eat and grilled eggplant slices). PMID:21942648

  7. Study and characterization of polyphenol oxidase from eggplant (Solanum melongena L.).

    PubMed

    Todaro, Aldo; Cavallaro, Rosalinda; Argento, Sergio; Branca, Ferdinando; Spagna, Giovanni

    2011-10-26

    In this study the catecholase and cresolase activities of eggplant polyphenol oxidase (PPO) were investigated. Enzyme activity was determined by measuring the increase in absorbance using catechol as substrate and 3-methyl-2-benzothiazolinone hydrazone (MBTH) as coupled reagent. The effects of substrate specificity, heat inactivation, temperature, pH, and inhibitors were investigated to understand the enzymatic alteration of ready-to-eat preparations. Browning of vegetables was determined through a colorimeter. Decrease of lightness (L*) and increase of color difference values (ΔE*) were correlated with tissue browning. Antibrowning agents were tested on PPO under the same conditions. The enzyme activity was strongly inhibited by 0.4 M citric acid. Under natural pH conditions, the enzyme was also inhibited by tartaric acid and acetic acid. All of the results were used to understand the best conditions for food transformation (ready-to-eat and grilled eggplant slices).

  8. Purification and characterisation of polyphenol oxidase (PPO) from eggplant (Solanum melongena).

    PubMed

    Mishra, Bibhuti B; Gautam, Satyendra; Sharma, Arun

    2012-10-15

    Eggplant (Solanum melongena) is a very rich source of polyphenol oxidase (PPO), which negatively affects its quality upon cutting and postharvest processing due to enzymatic browning. PPO inhibitors, from natural or synthetic sources, are used to tackle this problem. One isoform of PPO was 259-fold purified using standard chromatographic procedures. The PPO was found to be a 112 kDa homodimer. The enzyme showed very low K(m) (0.34 mM) and high catalytic efficiency (3.3×10(6)) with 4-methyl catechol. The substrate specificity was in the order: 4-methyl catechol>tert-butylcatechol>dihydrocaffeic acid>pyrocatechol. Cysteine hydrochloride, potassium metabilsulphite, ascorbic acid, erythorbic acid, resorcylic acid and kojic acid showed competitive inhibition, whereas, citric acid and sodium azide showed mixed inhibition of PPO activity. Cysteine hydrochloride was found to be an excellent inhibitor with the low inhibitor constant of 1.8 μM. PMID:23442630

  9. The FT-IR spectrometric analysis of the changes of polyphenol oxidase II secondary structure

    NASA Astrophysics Data System (ADS)

    Shi, Chunhua; Dai, Ya; Liu, Qingliang; Xie, Yongshu; Xu, Xiaolong

    2003-01-01

    Polyphenol oxidase II is a novel protein purified from tobacco, which acts as a key role in plant defense system. From the analysis of FT-IR spectrums, Fourier self-deconvolution (FSD) spectrums and second-derivative spectrums of PPO II at different pH and peroxide PPO II adduct, the secondary structure fractions are analyzed. PPO II at low pH (pH=3.0) and peroxide PPO II adduct almost keep the same secondary structure of native PPO II. The percentages of β-turn and random coil increase rapidly and the percentages of α-helix and anti-parallel β-sheet decrease rapidly at high pH (pH=10.0) comparing with that of native PPO II. All these conclusions are proved by the secondary structure calculations of circular dichroism spectrums in different states.

  10. Enzymatic characterization and functional groups of polyphenol oxidase from the pupae of blowfly (Sarcophaga bullata).

    PubMed

    Wang, Qin; Chen, Qing-Xi; Huang, Xiao-Hong; Ke, Li-Na; Shi, Yan; Wang, Jun

    2004-08-01

    Polyphenol oxidase (EC 1.14.18.1) was purified from the pupae of blowfly (Sarcophaga bullata) by a procedure involving ammonium sulfate fractionation and chromatography on DEAE-cellulose and Sephadex G-100. Kinetic characteristics of the enzyme were determined using L-DOPA as substrate. The specific activity of the enzyme was 770 U/mg, and the Michaelis constant (Km) was 1.5 +/- 0.1 mM (pH 6.8, 30 degrees C). Activity was maximal at 40 degrees C, pH 6.5. Chemical modification experiments demonstrated that cysteine and tryptophan residues are essential and arginine residues are not essential to the enzyme function. The enzyme is inhibited by quercetin with an IC50 of 0.20 +/- 0.06 mM. The inhibition is of competitive type, and the inhibition constant was determined to be 88 micro M.

  11. Inactivation kinetics of polyphenol oxidase from pupae of blowfly (Sarcophaga bullata) in the dimethyl sulfoxide solution.

    PubMed

    Chen, Chao-Qi; Li, Zhi-Cong; Pan, Zhi-Zhen; Zhu, Yu-Jing; Yan, Ruo-Rong; Wang, Qin; Yan, Jiang-Hua; Chen, Qing-Xi

    2010-04-01

    The effects of dimethyl sulfoxide (DMSO) on the activity of polyphenol oxidase (PPO, EC 1.14.18.1) from blowfly pupae for the oxidation of L-3,4-dihydroxyphenylalanine were studied. The results showed that low concentrations of DMSO could lead to reversible inactivation to the enzyme. The IC(50) value, the inactivator concentration leading to 50% activity lost, was estimated to be 2.35 M. Inactivation of the enzyme by DMSO was classified as mixed type. The kinetics of inactivation of PPO from blowfly pupae in the low concentrations of DMSO solution was studied using the kinetic method of the substrate reaction. The rate constants of inactivation were determined. The results show that k(+0) was much larger than k'(+0), indicating that the free enzyme molecule was more fragile than the enzyme-substrate complex in the DMSO solution. It was suggested that the presence of the substrate offers marked protection of this enzyme against inactivation by DMSO.

  12. A mediated polyphenol oxidase biosensor immobilized by electropolymerization of 1,2-diamino benzene.

    PubMed

    Akyilmaz, Erol; Kozgus, Ozge; Türkmen, Hayati; Cetinkaya, Bekir

    2010-06-01

    A biosensor based on a partially purified polyphenol oxidase (PPO) enzyme was developed by using electropolymerization of [(2,2'-bipyridine)(chloro)(p-cymene)rutenium(II)]chloride] mediator complex and 1,2-diamino benzene (DAB) on a screen printing Pt electrode (1mm diameter). The electropolymerization was carried out at +0.7V for 45min in phosphate buffer (50mM, pH 7.0) which contained 14.0U/10mL polyphenole oxidase, 200mM DAB and 2.5mM Ru-mediator complex solutions. Measurement is based on the detection of the oxidation current of the Ru-mediator complex that related to the enzymatic reaction catalyzed by PPO at +0.65V. The phosphate buffer (50mM, pH 7.0 containing 0.1M KCl) and 30 degrees C were established as being the optimum working conditions. Under the optimum experimental conditions a linear calibration curve was obtained between 5 and 100microM catechol concentration. The detection limit of the biosensor is 2.385microM. In the characterization studies of the biosensor some parameters such as effect of Ru-mediator types on the biosensor response, substrate specificity, reproducibility and storage stability were studied. From the experiments, the average value (x), standard deviation (SD) and coefficient of variation (CV%) were found to be 48.75microM,+/-1.56microM, and 3.2% respectively for 50microM catechol standard. PMID:19783226

  13. Characterization of a tomato polyphenol oxidase and its role in browning and lycopene content.

    PubMed

    Spagna, Giovanni; Barbagallo, Riccardo N; Chisari, Marco; Branca, Ferdinando

    2005-03-23

    Polyphenol oxidase (PPO) was extracted from five Sicilian varieties of tomato fruit [Pizzutello, Naomi (Hazera), F1 PS212 (Peto seed), Rosa Maletto, and PO228] and assayed with a method using 3-methylbenzothyazolinone hydrazone (MBTH) as chromophore coupling agent. 3,4-Dihydroxyphenylacetic acid was chosen for tomato PPO activity determination. The tomato PPO had maximum activity at pH 4.8. The pH of juice in ripe fruits is between 4.1 and 4.4, a range in which PPO relative activity is between 74 and 87%. The optimum temperature of activity for tomato PPO was 40 degrees C; the enzyme showed a good relative activity (55% of the maximum) at cold-storage temperature (4 degrees C). PPO retained 82% relative activity at an NaCl concentration of 0.1 M; at higher concentrations the PPO became gradually inactivated. The commercial variety Naomi is more susceptible to enzymatic browning than the local varieties Pizzutello, Rosa Maletto and PO228, due to higher PPO activity levels. This result confirms the suitability of these local tomato varieties to national markets. Results from storage tests seem to relate PPO activity with color changes associated with browning and lycopene degradation, because lycopene is an antioxidant agent that reconstitutes the polyphenols oxidized by the action of PPO.

  14. Purification and characterization of polyphenol oxidase from cauliflower (Brassica oleracea L.).

    PubMed

    Rahman, Andi Nur Faidah; Ohta, Mayumi; Nakatani, Kazuya; Hayashi, Nobuyuki; Fujita, Shuji

    2012-04-11

    Polyphenol oxidase (PPO) of cauliflower was purified to 282-fold with a recovery rate of 8.1%, using phloroglucinol as a substrate. The enzyme appeared as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The estimated molecular weight of the enzyme was 60 and 54 kDa by SDS-PAGE and gel filtration, respectively. The purified enzyme, called phloroglucinol oxidase (PhO), oxidized phloroglucinol (K(m) = 3.3 mM) and phloroglucinolcarboxylic acid. The enzyme also had peroxidase (POD) activity. At the final step, the activity of purified cauliflower POD was 110-fold with a recovery rate of 3.2%. The PhO and POD showed the highest activity at pH 8.0 and 4.0 and were stable in the pH range of 3.0-11.0 and 5.0-8.0 at 5 °C for 20 h, respectively. The optimum temperature was 55 °C for PhO and 20 °C for POD. The most effective inhibitor for PhO was sodium diethyldithiocarbamate at 10 mM (IC(50) = 0.64 and K(i) = 0.15 mM), and the most effective inhibitor for POD was potassium cyanide at 1.0 mM (IC(50) = 0.03 and K(i) = 29 μM).

  15. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.

    PubMed

    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A

    2003-12-18

    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  16. Polyphenol oxidases in Physcomitrella: functional PPO1 knockout modulates cytokinin-dependent development in the moss Physcomitrella patens.

    PubMed

    Richter, Hanna; Lieberei, Reinhard; Strnad, Miroslav; Novák, Ondrej; Gruz, Jiri; Rensing, Stefan A; von Schwartzenberg, Klaus

    2012-09-01

    Polyphenol oxidases (PPOs) are copper-binding enzymes of the plant secondary metabolism that oxidize polyphenols to quinones. Although PPOs are nearly ubiquitous in seed plants, knowledge on their evolution and function in other plant groups is missing. This study reports on the PPO gene family in the moss Physcomitrella patens (Hedw.) B.S.G. asan example for an early divergent plant. The P. patens PPO multigene family comprises 13 paralogues. Phylogenetic analyses suggest that plant PPOs evolved with the colonization of land and that PPO duplications within the monophyletic P. patens paralogue clade occurred after the separation of the moss and seed plant lineages. PPO functionality was demonstrated for recombinant PPO6. P. patens was analysed for phenolic compounds and six substances were detected intracellularly by LC-MS analysis: 4-hydroxybenzoic acid, p-cumaric acid, protocatechuic acid, salicylic acid, caffeic acid, and an ester of caffeic acid. Targeted PPO1 knockout (d|ppo1) plants were generated and plants lacking PPO1 exhibited only ~30% of the wild-type PPO activity in the culture medium, thus suggesting extracellular localization of PPO1, which is in contrast to the mostly plastidic PPO localization in seed plants. Further, d|ppo1 lines formed significantly more gametophores with a reduced areal plant size, which could be related to an increase of endogenously produced cytokinins and indicates an impact of PPO1 on plant development. d|ppo1 plants were less tolerant towards applied 4-methylcatechol compared to the wild type, which suggests a role of extracellular PPO1 in establishing appropriate conditions by the removal of inhibitory extracellular phenolic compounds. PMID:22865913

  17. Polyphenol oxidases in Physcomitrella: functional PPO1 knockout modulates cytokinin-dependent developmentin the moss Physcomitrella patens

    PubMed Central

    von Schwartzenberg, Klaus

    2012-01-01

    Polyphenol oxidases (PPOs) are copper-binding enzymes of the plant secondary metabolism that oxidize polyphenols to quinones. Although PPOs are nearly ubiquitous in seed plants, knowledge on their evolution and function in other plant groups is missing. This study reports on the PPO gene family in the moss Physcomitrella patens (Hedw.) B.S.G. asan example for an early divergent plant. The P. patens PPO multigene family comprises 13 paralogues. Phylogenetic analyses suggest that plant PPOs evolved with the colonization of land and that PPO duplications within the monophyletic P. patens paralogue clade occurred after the separation of the moss and seed plant lineages. PPO functionality was demonstrated for recombinant PPO6. P. patens was analysed for phenolic compounds and six substances were detected intracellularly by LC-MS analysis: 4-hydroxybenzoic acid, p-cumaric acid, protocatechuic acid, salicylic acid, caffeic acid, and an ester of caffeic acid. Targeted PPO1 knockout (d|ppo1) plants were generated and plants lacking PPO1 exhibited only ~30% of the wild-type PPO activity in the culture medium, thus suggesting extracellular localization of PPO1, which is in contrast to the mostly plastidic PPO localization in seed plants. Further, d|ppo1 lines formed significantly more gametophores with a reduced areal plant size, which could be related to an increase of endogenously produced cytokinins and indicates an impact of PPO1 on plant development. d|ppo1 plants were less tolerant towards applied 4-methylcatechol compared to the wild type, which suggests a role of extracellular PPO1 in establishing appropriate conditions by the removal of inhibitory extracellular phenolic compounds. PMID:22865913

  18. ISOLATION AND PROPERTIES OF POLYPHENOL OXIDASE FROM BASIDIOCARPS OF Lactarius pergamenus Fr. (Fr.) FUNGI.

    PubMed

    Tsivinska, M V; Antonyuk, V O; Stoika, R S

    2015-01-01

    Fresh juice of basidiocarps of Lactarius pergamenus Fr. (Fr.) fungi was subjected to ion exchange chromatography with used DEAE-toyopearl and CM-cellulose columns, as well as preparative electrophoresis in 7.5% polyacrylamide gels (pH 8.6). Three isoforms of polyphenol oxidase (PPO) were discovered and two isoforms (1-l and 1-2) were purified with a release of protein 0.42 mg/kg and 0.15 mg/kg of basidiocarps, respectively. These isoforms differ in the mobility at disc-electrophoresis in 7.5% PAGE in alkaline buffer system (pH 8.6). Specfic activity of isoform 1-2 is 4.8 times higher than that of the isoforms 1-1. The molecular weight determination by gel chromatography on the Toyopearl HW-55 demonstrated that both isoforms 1-1 and 1-2 have the same 64 ± 2 kDa molecular mass. Electrophoresis in 15% PAGE in the presence of sodium dodecylsulphate and β-mercaptoethanol revealed one band with molecular mass of 64 ± 1 kDa which suggests the presence of one polypeptide chain in the molecule ofthe enzyme. The enzyme has demonstrated the highest activity at pH 6.0 and temperature +10 °C, and at +70 °C the enzyme was inactivated. The PPO activity was the highest in young mushrooms and it decreased with their age and positively correlated with the content ofthe milky juice. Ortho-aminophenol was most effective among all the tested substrates to determine the activity of PPO (o-, m- and p-aminophenol, catechol, tyrosine, resorcinol, phloroglucinol) and its relative activity was 129% of the activity of catechol. Ascorbic acid was the most effective inhibitor of the polyphenol oxidase activity which was completely blocked at 1 mM concentration, whereas the same concentration of thiourea and sodium sulphite decreased the enzymatic activity by 40-45%. The PPO in L. pergamenus fungi basidiocarps was mainly localized in the mushroom milky juice where its high activity may be associated with protection of basidiocarps against various pathogens.

  19. ISOLATION AND PROPERTIES OF POLYPHENOL OXIDASE FROM BASIDIOCARPS OF Lactarius pergamenus Fr. (Fr.) FUNGI.

    PubMed

    Tsivinska, M V; Antonyuk, V O; Stoika, R S

    2015-01-01

    Fresh juice of basidiocarps of Lactarius pergamenus Fr. (Fr.) fungi was subjected to ion exchange chromatography with used DEAE-toyopearl and CM-cellulose columns, as well as preparative electrophoresis in 7.5% polyacrylamide gels (pH 8.6). Three isoforms of polyphenol oxidase (PPO) were discovered and two isoforms (1-l and 1-2) were purified with a release of protein 0.42 mg/kg and 0.15 mg/kg of basidiocarps, respectively. These isoforms differ in the mobility at disc-electrophoresis in 7.5% PAGE in alkaline buffer system (pH 8.6). Specfic activity of isoform 1-2 is 4.8 times higher than that of the isoforms 1-1. The molecular weight determination by gel chromatography on the Toyopearl HW-55 demonstrated that both isoforms 1-1 and 1-2 have the same 64 ± 2 kDa molecular mass. Electrophoresis in 15% PAGE in the presence of sodium dodecylsulphate and β-mercaptoethanol revealed one band with molecular mass of 64 ± 1 kDa which suggests the presence of one polypeptide chain in the molecule ofthe enzyme. The enzyme has demonstrated the highest activity at pH 6.0 and temperature +10 °C, and at +70 °C the enzyme was inactivated. The PPO activity was the highest in young mushrooms and it decreased with their age and positively correlated with the content ofthe milky juice. Ortho-aminophenol was most effective among all the tested substrates to determine the activity of PPO (o-, m- and p-aminophenol, catechol, tyrosine, resorcinol, phloroglucinol) and its relative activity was 129% of the activity of catechol. Ascorbic acid was the most effective inhibitor of the polyphenol oxidase activity which was completely blocked at 1 mM concentration, whereas the same concentration of thiourea and sodium sulphite decreased the enzymatic activity by 40-45%. The PPO in L. pergamenus fungi basidiocarps was mainly localized in the mushroom milky juice where its high activity may be associated with protection of basidiocarps against various pathogens. PMID:26255339

  20. Control of enzymatic browning in potato (Solanum tuberosum L.) by sense and antisense RNA from tomato polyphenol oxidase.

    PubMed

    Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N

    2001-02-01

    Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives.

  1. Control of enzymatic browning in potato (Solanum tuberosum L.) by sense and antisense RNA from tomato polyphenol oxidase.

    PubMed

    Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N

    2001-02-01

    Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives. PMID:11262007

  2. Polyphenol oxidase and herbivore defense in trembling aspen (Populus tremuloides): cDNA cloning, expression, and potential substrates.

    PubMed

    Haruta, Miyoshi; Pedersen, Jens A.; Constabel, C. Peter

    2001-08-01

    The biochemical anti-herbivore defense of trembling aspen (Populus tremuloides Michx.) was investigated in a molecular analysis of polyphenol oxidase (PPO; EC 1.10.3.2). A PPO cDNA was isolated from a trembling aspen wounded leaf cDNA library and its nucleotide sequence determined. Southern analysis indicated the presence of two PPO genes in the trembling aspen genome. Expression of PPO was found to be induced after herbivory by forest tent caterpillar, by wounding, and by methyl jasmonate treatment. Wound induction was systemic, and occurred in unwounded leaves on wounded plants. This pattern of expression is consistent with a role of this enzyme in insect defense. A search for potential PPO substrates in ethanolic aspen leaf extracts using electron spin resonance (ESR) found no pre-existing diphenolic compounds. However, following a brief delay and several additions of oxygen, an ESR signal specific for catechol was detected. The source of this catechol was most likely the aspen phenolic glycosides tremulacin or salicortin which decomposed during ESR experiments. This was subsequently confirmed in experiments using pure salicortin.

  3. Site-directed mutagenesis of a tetrameric dandelion polyphenol oxidase (PPO-6) reveals the site of subunit interaction.

    PubMed

    Dirks-Hofmeister, Mareike E; Inlow, Jennifer K; Moerschbacher, Bruno M

    2012-09-01

    Polyphenol oxidases (PPOs) catalyze the oxidation of ortho-diphenols to the corresponding quinones (EC 1.10.3.1). In plants PPOs appear in gene families, and the corresponding isoenzymes are located to the thylakoid lumen of chloroplasts. Although plant PPOs are often discussed with regard to their role in defense reactions, a common physiological function has not yet been defined. We analyzed a tetrameric PPO isoenzyme (PPO-6) from dandelion (Taraxacum officinale) heterologously expressed in Escherichia coli, and found it to display cooperativity in catalysis, a phenomenon that has rarely been shown for plant PPOs previously. The identification of a surface-exposed cysteine (197) through molecular modeling followed by site-directed mutagenesis proved this amino acid residue to stabilize the tetramer via a disulfide linkage. The C197S-mutein still forms a tetrameric structure but shows impaired enzymatic efficiency and cooperativity and a reduction in stability. These findings indicate that oligomerization may be a physiological requirement for PPO-6 stability and function in vivo and raise new questions regarding distinct functions for specific PPO isoenzymes in plants.

  4. Browning in Annona cherimola fruit: role of polyphenol oxidase and characterization of a coding sequence of the enzyme.

    PubMed

    Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo

    2007-10-31

    Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role.

  5. Browning in Annona cherimola fruit: role of polyphenol oxidase and characterization of a coding sequence of the enzyme.

    PubMed

    Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo

    2007-10-31

    Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role. PMID:17907770

  6. Partial purification of polyphenol oxidase from Chinese cabbage Brassica rapa L.

    PubMed

    Nagai, T; Suzuki, N

    2001-08-01

    Polyphenol oxidase (PPO) was purified and characterized from Chinese cabbage by ammonium sulfate precipitation and DEAE-Toyopearl 650M column chromatography. Substrate staining of the crude protein extract showed the presence of three isozymic forms of this enzyme. The molecular weight of the purified enzyme was estimated to be approximately 65 kDa by gel filtration on Toyopearl HW-55F. On SDS-PAGE analysis, this enzyme was composed of a subunit molecular weight of 65 kDa. The optimum pH was 5.0, and this enzyme was stable at pH 6.0 but was unstable below pH 4.0 or above pH 7.0. The optimum temperature was 40 degrees C. Heat inactivation studies showed temperatures >40 degrees C resulted in loss of enzyme activity. PPO showed activity to catechol, pyrogallol, and dopamine (K(m) and V(max) values were 682.5 mM and 67.6 OD/min for catechol, 15.4 mM and 14.1 OD/min for pyrogallol, and 62.0 mM and 14.9 OD/min for dopamine, respectively). The most effective inhibitor was 2-mercaptoethanol, followed in decreasing order by ascorbic acid, glutathione, and L-cysteine. The enzyme activity of the preparation was maintained for 2 days at 4 degrees C but showed a sudden decreased after 3 days.

  7. Decolorization of the textile dyes using purified banana pulp polyphenol oxidase.

    PubMed

    Jadhav, Umesh U; Dawkar, Vishal V; Jadhav, Mital U; Govindwar, Sanjay P

    2011-04-01

    Polyphenol oxidase (PPO) purified using DEAE-cellulose and Biogel P-100 column chromatography from banana pulp showed 12.72-fold activity and 2.49% yield. The optimum temperature and pH were found to be 30 degrees C and 7.0, respectively for its activity. Catechol was found to be a suitable substrate for banana pulp PPO that showed V(max), 0.041 mM min(-1) and K(m), 1.6 mM. The enzyme activity was inhibited by sodium metabisulfite, citric acid, cysteine, and beta-mercaptoethanol at 10 mM concentration. The purified enzyme could decolorize (90%) Direct Red 5B (160 microg mL(-1)) dye within 48 h and Direct Blue GLL (400 microg mL(-1)) dye up to 85% within 90 h. The GC-MS analysis indicated the presence of 4-hydroxy-benzenesulfonic acid and Naphthalene-1,2,3,6-tetraol in the degradation products of Direct Red 5B, and 5-(4-Diazenyl-naphthalene-1-ylazo)-8-hydroxy-naphthalene-2-sulfonic acid and 2-(4-Diazenyl-naphthalene-1-ylazo)-benzenesulfonic acid in the degradation products of Direct Blue GLL.

  8. Measurement of polyphenol oxidase activity using optical waveguide lightmode spectroscopy-based immunosensor.

    PubMed

    Kim, Namsoo; Kim, Woo-Yeon

    2015-02-15

    Polyphenol oxidase (PPO) is an important quality index during food processing involving heat-treatment and sensitive determination of PPO activity has been a critical concern in the food industry. In this study, a new measurement of PPO activity exploiting an optical waveguide lightmode spectroscopy-based immunosensor is presented using a polyclonal anti-PPO antibody that was immobilized in situ to the surface of a 3-aminopropyltriethoxysilane-treated optical grating coupler activated with glutaraldehyde. When analysed with a purified PPO fraction from potato tubers, a linear relationship was found between PPO activities of 0.0005607-560.7U/mL and the sensor responses obtained. The sensor was applicable to measurement of PPO activity in real samples that were prepared from potato tubers, grapes and Kimchi cabbage, and the analytical results were compared with those obtained by a conventional colorimetric assay measuring PPO activity. When tested for long-term stability, the sensor was reusable up to 10th day after preparation.

  9. Polyphenol oxidase activity and antioxidant properties of Yomra apple (Malus communis L.) from Turkey.

    PubMed

    Can, Zehra; Dincer, Barbaros; Sahin, Huseyin; Baltas, Nimet; Yildiz, Oktay; Kolayli, Sevgi

    2014-12-01

    In this study, firstly, antioxidant and polyphenol oxidase (PPO) properties of Yomra apple were investigated. Seventeen phenolic constituents were measured by reverse phase-high-performance liquid chromatography (RP-HPLC). Total phenolic compounds (TPCs), ferric reducing antioxidant power (FRAP) and 2, 2-diphenyl-1-picrylhydrazyl radical (DPPH) scavenging activities were performed to measure antioxidant capacity. Some kinetic parameters (Km, Vmax), and inhibition behaviors against five different substrates were measured in the crude extract. Catechin and chlorogenic acid were found as the major components in the methanolic extract, while ferulic acid, caffeic acid, p-hydroxybenzoic acid, quercetin and p-coumaric acid were small quantities. Km values ranged from 0.70 to 10.10 mM in the substrates, and also 3-(4-hydroxyphenyl) propanoic acid (HPPA) and L-DOPA showed the highest affinity. The inhibition constant of Ki were ranged from 0.05 to 14.90 mM against sodium metabisulphite, ascorbic acid, sodium azide and benzoic acid, while ascorbic acid and sodium metabisulphite were the best inhibitors.

  10. Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.

    PubMed

    Bravo, Karent; Osorio, Edison

    2016-04-15

    Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning.

  11. Development of hydroxylated naphthylchalcones as polyphenol oxidase inhibitors: Synthesis, biochemistry and molecular docking studies.

    PubMed

    Radhakrishnan, Sini; Shimmon, Ronald; Conn, Costa; Baker, Anthony

    2015-12-01

    Polyphenol oxidase (Tyrosinase) has received great attention, since it is the key enzyme in melanin biosynthesis. In this study, novel hydroxy naphthylchalcone compounds were synthesized, and their inhibitory effects on mushroom tyrosinase activity were evaluated. The structures of the compounds synthesized were confirmed by (1)H NMR, (13)C NMR, FTIR and HRMS. Two of the compounds synthesized inhibited the diphenolase activity of tyrosinase in a dose dependent manner and exhibited much higher tyrosinase inhibitory activities (IC50 values of 10.4μM and 14.4μM, respectively) than the positive control, kojic acid (IC50: 27.5μM). Kinetic analysis showed that their inhibition was reversible. Both the novel compounds displayed competitive inhibition with their Ki values of 3.8μM and 4.5μM, respectively. Docking results confirmed that the active inhibitors strongly interacted with the mushroom tyrosinase residues. This study suggests hydroxy naphthylchalcone compounds to serve as promising candidates for use as depigmentation agents.

  12. Purification and characterization of polyphenol oxidase from waste potato peel by aqueous two-phase extraction.

    PubMed

    Niphadkar, Sonali S; Vetal, Mangesh D; Rathod, Virendra K

    2015-01-01

    Potato peel from food industrial waste is a good source of polyphenol oxidase (PPO). This work illustrates the application of an aqueous two-phase system (ATPS) for the extraction and purification of PPO from potato peel. ATPS was composed of polyethylene glycol (PEG) and potassium phosphate buffer. Effect of different process parameters, namely, PEG, potassium phosphate buffer, NaCl concentration, and pH of the system, on partition coefficient, purification factor, and yield of PPO enzyme were evaluated. Response surface methodology (RSM) was utilized as a statistical tool for the optimization of ATPS. Optimized experimental conditions were found to be PEG1500 17.62% (w/w), potassium phosphate buffer 15.11% (w/w), and NaCl 2.08 mM at pH 7. At optimized condition, maximum partition coefficient, purification factor, and yield were found to be 3.7, 4.5, and 77.8%, respectively. After partial purification of PPO from ATPS, further purification was done by gel chromatography where its purity was increased up to 12.6-fold. The purified PPO enzyme was characterized by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by Km value 3.3 mM, and Vmax value 3333 U/mL, and enzyme stable ranges for temperature and pH of PPO were determined. These results revealed that ATPS would be an attractive option for obtaining purified PPO from waste potato peel.

  13. Purification and partial biochemical characterization of polyphenol oxidase from mamey (Pouteria sapota).

    PubMed

    Palma-Orozco, Gisela; Ortiz-Moreno, Alicia; Dorantes-Alvarez, Lidia; Sampedro, José G; Nájera, Hugo

    2011-01-01

    While a long shelf life for fruit products is highly desired, enzymatic browning is the main cause of quality loss in fruits and is therefore a main problem for the food industry. In this study polyphenol oxidase (PPO), the main enzyme responsible for browning was isolated from mamey fruit (Pouteria sapota) and characterized biochemically. Two isoenzymes (PPO 1 and PPO 2) were obtained upon ammonium sulfate precipitation and hydrophobic and ion exchange chromatography; PPO 1 was purified up to 6.6-fold with 0.28% yield, while PPO 2 could not be characterized as enzyme activity was completely lost after 24 h of storage. PPO 1 molecular weight was estimated to be 16.1 and 18 kDa by gel filtration and SDS-PAGE, respectively, indicating that the native state of the PPO 1 is a monomer. The optimum pH for PPO 1 activity was 7. The PPO 1 was determined to be maximum thermally stable up to 35°C. Kinetic constants for PPO 1 were K(m)=44 mM and K(m)=1.3 mM using catechol and pyrogallol as substrate, respectively. The best substrates for PPO 1 were pyrogallol, 4-methylcatechol and catechol, while ascorbic acid and sodium metabisulfite were the most effective inhibitors.

  14. Polyphenol oxidase activity as a potential intrinsic index of adequate thermal pasteurization of apple cider.

    PubMed

    Chen, L; Ingham, B H; Ingham, S C

    2004-05-01

    In response to increasing concerns about microbial safety of apple cider, the U.S. Food and Drug Administration has mandated treatment of cider sufficient for a 5-log reduction of the target pathogen. Pasteurization has been suggested as the treatment most likely to achieve a 5-log reduction, with Escherichia coli O157:H7 as the target pathogen. Regulators and processors need a reliable method for verifying pasteurization, and apple cider polyphenol oxidase (PPO) activity was studied as a potential intrinsic index for thermal pasteurization. The effect of pasteurization conditions and apple cider properties on PPO activity and survival of three pathogens (E. coli O157:H7, Salmonella, and Listeria monocytogenes) was studied using a Box-Behnken response surface design. Factors considered in the design were pasteurization conditions, i.e., hold temperature (60, 68, and 76 degrees C), preheat time (10, 20, 30 s), and hold time (0, 15, 30 s), pH, and sugar content ((o)Brix) of apple cider. Response surface contour plots were constructed to illustrate the effect of these factors on PPO activity and pathogen survival. Reduction in PPO activity of at least 50% was equivalent to a 5-log reduction in E. coli O157:H7 or L. monocytogenes for cider at pH 3.7 and 12.5 (o)Brix. Further studies, however, are needed to verify the relationship between PPO activity and pathogen reduction in cider with various pH and (o)Brix values.

  15. Delineating the role of polyphenol oxidase in the darkening of alkaline wheat noodles.

    PubMed

    Fuerst, E Patrick; Anderson, James V; Morris, Craig F

    2006-03-22

    This study evaluated the effects of inhibitors on polyphenol oxidase (PPO) activity, the effect of the PPO inhibitor tropolone on noodle darkening, and the correlation of PPO activity with darkening of alkaline noodles. The PPO inhibitors tropolone and salicylhydroxamic acid (each at 1 microM) reduced kernel PPO activity by approximately 50% in three hexaploid wheat cultivars but did not inhibit PPO activity in the two very low PPO cultivars, durum Langdon, and the synthetic hexaploid-derived ID580. Tropolone (100 microg/g flour) inhibited alkaline noodle darkening (deltaL*) by 13-25% in the low PPO wheat cultivar, ID377s, and by 39-54% in the high PPO wheat cultivar, Klasic. Alkaline noodle darkening among 502 wheat samples was correlated with kernel PPO activity (r = 0.64). Results substantiate the hypothesis that PPO plays a major role in darkening of alkaline noodles. However, results also indicate that substantial darkening would occur even at zero PPO activity, as measured in the kernel PPO assay. Therefore, darkening of alkaline noodles is probably due to the cultivar-specific level of PPO activity and the presence of at least one additional darkening mechanism. Further investigation is required to identify the phenolic discoloration agent(s) and to determine the potential roles of non-PPO discoloration mechanisms, both enzymatic and nonenzymatic, in wheat products.

  16. Purification and partial characterization of polyphenol oxidase from the flower buds of Lonicera japonica Thunb.

    PubMed

    Liu, Na-na; Liu, Wei; Wang, Dai-jie; Zhou, Yi-bin; Lin, Xiao-jing; Wang, Xiao; Li, Sheng-bo

    2013-05-01

    The purification and partial enzymology characteristics of polyphenol oxidase from Lonicera japonica (LjPPO) were studied in this paper. The crude enzyme solution was purified in turn by ammonium sulfate, dialysis, and DEAE-cellulose ion-exchange chromatography after preliminary treatments. Purification resulted in 31-fold enrichment and its molecular weight was estimated to be ~49 kDa exhibited on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The pH for optimal conditions of LjPPO was 7.5, and the temperature was 25 °C, in addition, the inhibitive effects of inhibitors were enhanced positively with increasing of the concentration. Moreover, crude enzyme solution showed diphenolase activity toward catechol, l-dopa and chlorogenic acid rather than monophenolase and triphenolase activity, and the best substrate was catechol because of the highest V(max)/K(m) value. However, the oxidation of diphenol related to browning significantly, so the data obtained in this research provided theoretical basis for the prevention of enzymatic browning of L. japonica during processing.

  17. Purification and characterization of polyphenol oxidase from jackfruit ( Artocarpus heterophyllus ) bulbs.

    PubMed

    Tao, Yi-Ming; Yao, Le-Yi; Qin, Qiu-Yan; Shen, Wang

    2013-12-26

    Polyphenol oxidase (PPO) from jackfruit bulb was purified through acetone precipitation, ion-exchange column, and gel filtration column. PPO was a dimer with the molecular weight of 130 kDa determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration. The Km was 8.3 and 18.2 mM using catechol and 4-methylcatechol as substrates, respectively. The optimum pH was 7.0 (catechol as the substrate) or 6.5 (4-methylcatechol as the substrate). The optimum temperature was 8 °C. The enzyme was stable below 40 °C. The activation energy (Ea) of heat inactivation was estimated to be 103.30 kJ/mol. The PPO activity was activated by Mn(2+), SDS, Tween-20, Triton X-100, citric acid, and malic acid but inhibited by K(+), Zn(2+), Mg(2+), Ca(2+), Ba(2+), cetyl trimethyl ammonium bromide (CTAB), kojic acid, tropolone, glutathione (GSH), cysteine (Cys), and ascorbic acid (AA). Cys and AA were effective to reduce browning of jackfruit bulbs during the storage at 8 °C for 15 days.

  18. Potato and mushroom polyphenol oxidase activities are differently modulated by natural plant extracts.

    PubMed

    Kuijpers, Tomas F M; van Herk, Teunie; Vincken, Jean-Paul; Janssen, Renske H; Narh, Deborah L; van Berkel, Willem J H; Gruppen, Harry

    2014-01-01

    Enzymatic browning is a major quality issue in fruit and vegetable processing and can be counteracted by different natural inhibitors. Often, model systems containing a single polyphenol oxidase (PPO) are used to screen for new inhibitors. To investigate the impact of the source of PPO on the outcome of such screening, this study compared the effect of 60 plant extracts on the activity of PPO from mushroom ( Agaricus bisporus , AbPPO) and PPO from potato ( Solanum tuberosum , StPPO). Some plant extracts had different effects on the two PPOs: an extract that inhibited one PPO could be an activator for the other. As an example of this, the mate ( Ilex paraguariensis ) extract was investigated in more detail. In the presence of mate extract, oxygen consumption by AbPPO was found to be reduced >5-fold compared to a control reaction, whereas that of StPPO was increased >9-fold. RP-UHPLC-MS analysis showed that the mate extract contained a mixture of phenolic compounds and saponins. Upon incubation of mate extract with StPPO, phenolic compounds disappeared completely and saponins remained. Flash chromatography was used to separate saponins and phenolic compounds. It was found that the phenolic fraction was mainly responsible for inhibition of AbPPO and activation of StPPO. Activation of StPPO was probably caused by activation of latent StPPO by chlorogenic acid quinones.

  19. Defense-related polyphenol oxidase from Hevea brasiliensis cell suspension: purification and characterization.

    PubMed

    Muhamad, Nisaporn; Chirapongsatonkul, Nion; Churngchow, Nunta

    2012-05-01

    Polyphenol oxidase (PPO) was examined from the extract of leaf, seed, and cell suspension of Hevea brasiliensis, a rubber plant. The defense-related isozyme from Hevea cell suspension induced by culture filtrate of Phytophthora palmivora or by agitation stress was isolated through anion exchange and affinity chromatography, respectively. A 104-purification fold, migrated as a single band of 70 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis of PPO, was obtained after further purified by the preparative gel electrophoresis. Based on reaction with catechol and dopamine but not with p-cresol and guaiacol, it is a diphenol-type PPO. The values of V(max)/K(m) ratio indicated that catechol was the most specific substrate. The optimal activity of the purified PPO was observed at pH 6.0. The PPO activity was retained at pH 4.0-10.0 and temperature 10-60 °C. The inhibitors which completely inhibited the activity were ascorbic acid, dithiothreitol, and β-mercaptoethanol while sodium azide was a poor inhibitor. The PPO obtained from Hevea cell suspension possesses high specific activity and is stable at wide range of pH and temperature. It is therefore suitable for extreme condition uses and may lead to an alternative source of PPO in various industrial applications. PMID:22532343

  20. Measurement of polyphenol oxidase activity using optical waveguide lightmode spectroscopy-based immunosensor.

    PubMed

    Kim, Namsoo; Kim, Woo-Yeon

    2015-02-15

    Polyphenol oxidase (PPO) is an important quality index during food processing involving heat-treatment and sensitive determination of PPO activity has been a critical concern in the food industry. In this study, a new measurement of PPO activity exploiting an optical waveguide lightmode spectroscopy-based immunosensor is presented using a polyclonal anti-PPO antibody that was immobilized in situ to the surface of a 3-aminopropyltriethoxysilane-treated optical grating coupler activated with glutaraldehyde. When analysed with a purified PPO fraction from potato tubers, a linear relationship was found between PPO activities of 0.0005607-560.7U/mL and the sensor responses obtained. The sensor was applicable to measurement of PPO activity in real samples that were prepared from potato tubers, grapes and Kimchi cabbage, and the analytical results were compared with those obtained by a conventional colorimetric assay measuring PPO activity. When tested for long-term stability, the sensor was reusable up to 10th day after preparation. PMID:25236218

  1. Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance.

    PubMed

    Li, Li; Steffens, John C

    2002-06-01

    Polyphenol oxidases (PPOs; EC 1.10.3.2 or EC 1.14.18.1) catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato ( Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato ( Solanum tuberosum L.) PPO cDNA under control of the cauliflower mosaic virus 35S promoter. The transgenic plants expressed up to 30-fold increases in PPO transcripts and 5- to 10-fold increases in PPO activity and immunodetectable PPO. As expected, these PPO-overexpressing transgenic plants oxidized the endogenous phenolic substrate pool at a higher rate than control plants. Three independent transgenic lines were selected to assess their interaction with the bacterial pathogen Pseudomonas syringae pv. tomato. The PPO-overexpressing tomato plants exhibited a great increase in resistance to P. syringae. Compared with control plants, these transgenic lines showed less severity of disease symptoms, with over 15-fold fewer lesions, and strong inhibition of bacterial growth, with over 100-fold reduction of bacterial population in the infected leaves. These results demonstrate the importance of PPO-mediated phenolic oxidation in restricting plant disease development. PMID:12029473

  2. Purification and characterization of polyphenol oxidase from waste potato peel by aqueous two-phase extraction.

    PubMed

    Niphadkar, Sonali S; Vetal, Mangesh D; Rathod, Virendra K

    2015-01-01

    Potato peel from food industrial waste is a good source of polyphenol oxidase (PPO). This work illustrates the application of an aqueous two-phase system (ATPS) for the extraction and purification of PPO from potato peel. ATPS was composed of polyethylene glycol (PEG) and potassium phosphate buffer. Effect of different process parameters, namely, PEG, potassium phosphate buffer, NaCl concentration, and pH of the system, on partition coefficient, purification factor, and yield of PPO enzyme were evaluated. Response surface methodology (RSM) was utilized as a statistical tool for the optimization of ATPS. Optimized experimental conditions were found to be PEG1500 17.62% (w/w), potassium phosphate buffer 15.11% (w/w), and NaCl 2.08 mM at pH 7. At optimized condition, maximum partition coefficient, purification factor, and yield were found to be 3.7, 4.5, and 77.8%, respectively. After partial purification of PPO from ATPS, further purification was done by gel chromatography where its purity was increased up to 12.6-fold. The purified PPO enzyme was characterized by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by Km value 3.3 mM, and Vmax value 3333 U/mL, and enzyme stable ranges for temperature and pH of PPO were determined. These results revealed that ATPS would be an attractive option for obtaining purified PPO from waste potato peel. PMID:25036474

  3. Interaction of polyphenol oxidase of Solanum tuberosum with β-cyclodextrin: Process details and applications.

    PubMed

    Singh, Virendra; Jadhav, Swati B; Singhal, Rekha S

    2015-09-01

    Polysaccharides differing in structure and chemical nature were screened for their ability to bind non-covalently with polyphenol oxidase (PPO) from potato (as a model) and their effect on enzyme activity. All the polysaccharides selected inhibited the PPO but β-cyclodextrin showed maximum inhibition under optimum conditions. Process details for the inhibition of PPO were studied with respect to concentration of β-cyclodextrin, temperature, pH, and time. Higher inhibition constant and lower half life was obtained at 40 °C than at 30 °C in the presence of inhibitor. β-Cyclodextrin showed mixed type of inhibition of PPO. β-Cyclodextrin was further exploited as anti-browning agent in selected fruit juices. It not only showed a significant anti-browning effect on freshly prepared potato juice but was also effective in other fruit juices. Better effect was seen in pineapple, apple and pear as compared to banana, sugarcane and guava fruit juices. PMID:26187193

  4. Development of hydroxylated naphthylchalcones as polyphenol oxidase inhibitors: Synthesis, biochemistry and molecular docking studies.

    PubMed

    Radhakrishnan, Sini; Shimmon, Ronald; Conn, Costa; Baker, Anthony

    2015-12-01

    Polyphenol oxidase (Tyrosinase) has received great attention, since it is the key enzyme in melanin biosynthesis. In this study, novel hydroxy naphthylchalcone compounds were synthesized, and their inhibitory effects on mushroom tyrosinase activity were evaluated. The structures of the compounds synthesized were confirmed by (1)H NMR, (13)C NMR, FTIR and HRMS. Two of the compounds synthesized inhibited the diphenolase activity of tyrosinase in a dose dependent manner and exhibited much higher tyrosinase inhibitory activities (IC50 values of 10.4μM and 14.4μM, respectively) than the positive control, kojic acid (IC50: 27.5μM). Kinetic analysis showed that their inhibition was reversible. Both the novel compounds displayed competitive inhibition with their Ki values of 3.8μM and 4.5μM, respectively. Docking results confirmed that the active inhibitors strongly interacted with the mushroom tyrosinase residues. This study suggests hydroxy naphthylchalcone compounds to serve as promising candidates for use as depigmentation agents. PMID:26496408

  5. Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.

    PubMed

    Bravo, Karent; Osorio, Edison

    2016-04-15

    Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning. PMID:26616939

  6. The inactivation kinetics of polyphenol oxidase in mushroom (Agaricus bisporus) during thermal and thermosonic treatments.

    PubMed

    Cheng, X-f; Zhang, M; Adhikari, B

    2013-03-01

    The effect of thermal and thermosonic treatments on the inactivation kinetics of polyphenol oxidase (PPO) in mushroom (Agaricus bisporus) was studied in 55-75°C temperature range. In both the processes, the inactivation kinetics of PPO followed a first-order kinetics (R(2)=0.941-0.989). The D values during thermal inactivation varied from 112±8.4min to 1.2±0.07min while they varied from 57.8±6.1min to 0.88±0.05min during thermosonic inactivation at the same temperature range. The activation energy during thermal inactivation was found to be 214±17kJ/mol, while it was 183±32kJ/mol during thermosonic inactivation. The inactivating effect of combined ultrasound and heat was found to synergistically enhance the inactivation kinetics of PPO. The D values of PPO decreased by 1.3-3 times during thermosonic inactivation compared to the D values of PPO during thermal inactivation at the temperature range. Therefore, thermosonication can be further developed as an alternative to "hot break" process of mushroom.

  7. Oxygenation of bisphenol A to quinones by polyphenol oxidase in vegetables.

    PubMed

    Yoshida, Mitsuru; Ono, Hiroshi; Mori, Yoshiko; Chuda, Yoshihiro; Mori, Motoyuki

    2002-07-17

    To understand conversion of bisphenol A and its related compounds under some chemical and biological environments, oxidation of these compounds was performed. Bisphenol A was oxidized to monoquinone and bisquinone derivatives by Fremy's salt, a radical oxidant; but salcomine and alkali did not catalyze the oxidation by molecular oxygen. Bisphenol A, bisphenol B, and 3,4'-(1-methylethylidene)bisphenol were converted to their monoquinone derivatives in the presence of oxygen and polyphenol oxidase from mushroom at 25 degrees C at pH 6.5. Among crude enzyme solutions of fruits and vegetables, potato, mushroom, eggplant, edible burdock, and yacon showed remarkable oxidative activity on bisphenol A. The highest activity was observed in potato, and the main product obtained by the enzymatic oxygenation was the monoquinone derivative of bisphenol A, accompanied by a small amount of the bisquinone derivative. The oxidation reactions found here will be useful for developing techniques for elimination of phenolic endocrine disrupters from the environment. PMID:12105973

  8. [Study on the interaction of cystine and polyphenol oxidase from nicotian tobaccum].

    PubMed

    Xiao, Hou-rong; Xu, Xiao-long; Xie, Yong-shu; Zhang, Yan-ge; Peng, Dun-geng; Liu, Qing-liang

    2004-12-01

    The interaction of cystine and polyphenol oxidase (PPO) from nicotian tobaccum has been studied. The results show that cystine has an inhibitory effect on the enzymatic activity, the mechanism of which might be that the thiolether in cystine coordinates with Cu2+ in the active site of PPO, and the inactivation constant value of PPO by cystine is 0.633 min(-1), while the substrates or the products inhibit their combination. Cystine can also be combined with the products of enzymatic reaction to form a colourless compound. Cystine can inhibit the enzymatic activity completely when the molar ratio of cystine to PPO approaches 16,000:1. The effect of cystine on the fluorescence changes with the molar ratio of cystine to the PPO. However, when the molar ratio gets to 75:1, cystine has no longer the effect on either the fluorescence spectra or the synchronous spectra. Microenvironment of trp residue in PPO is more hydrophobic than that of free trp in water. PMID:15828342

  9. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    PubMed Central

    Webb, K. Judith; Cookson, Alan; Allison, Gordon; Sullivan, Michael L.; Winters, Ana L.

    2014-01-01

    Polyphenol oxidase (PPO) may have multiple functions in tissues depending on its cellular or tissue localization. Here we use PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in N2-fixing nodules. In red clover, PPO was not essential for either growth or nodule production, or for nodule function in plants grown under optimal, N-free conditions. However, absence of PPO resulted in a more reduced environment in all tissues, as measured by redox potential, and caused subtle developmental changes in nodules. Leaves and, to a lesser extent nodules, lacking PPO tended to accumulate phenolic compounds. A comparison of nodules of two representative contrasting clones by microscopy revealed that nodules lacking PPO were morphologically and anatomically subtly altered, and that phenolics accumulated in different cells and tissues. Developing nodules lacking PPO were longer, and there were more cell layers within the squashed cell layer (SCL), but the walls of these cells were less thickened and the cells were less squashed. Within the N2-fixing zone, bacteroids appeared more granular and were less tightly packed together, and were similar to developmentally compromised bacteroids elicited by catalase mutant rhizobia reported elsewhere. PMID:25566275

  10. Potato and mushroom polyphenol oxidase activities are differently modulated by natural plant extracts.

    PubMed

    Kuijpers, Tomas F M; van Herk, Teunie; Vincken, Jean-Paul; Janssen, Renske H; Narh, Deborah L; van Berkel, Willem J H; Gruppen, Harry

    2014-01-01

    Enzymatic browning is a major quality issue in fruit and vegetable processing and can be counteracted by different natural inhibitors. Often, model systems containing a single polyphenol oxidase (PPO) are used to screen for new inhibitors. To investigate the impact of the source of PPO on the outcome of such screening, this study compared the effect of 60 plant extracts on the activity of PPO from mushroom ( Agaricus bisporus , AbPPO) and PPO from potato ( Solanum tuberosum , StPPO). Some plant extracts had different effects on the two PPOs: an extract that inhibited one PPO could be an activator for the other. As an example of this, the mate ( Ilex paraguariensis ) extract was investigated in more detail. In the presence of mate extract, oxygen consumption by AbPPO was found to be reduced >5-fold compared to a control reaction, whereas that of StPPO was increased >9-fold. RP-UHPLC-MS analysis showed that the mate extract contained a mixture of phenolic compounds and saponins. Upon incubation of mate extract with StPPO, phenolic compounds disappeared completely and saponins remained. Flash chromatography was used to separate saponins and phenolic compounds. It was found that the phenolic fraction was mainly responsible for inhibition of AbPPO and activation of StPPO. Activation of StPPO was probably caused by activation of latent StPPO by chlorogenic acid quinones. PMID:24344979

  11. Purification and partial biochemical characterization of polyphenol oxidase from mango (Mangifera indica cv. Manila).

    PubMed

    Palma-Orozco, Gisela; Marrufo-Hernández, Norma A; Sampedro, José G; Nájera, Hugo

    2014-10-01

    Polyphenol oxidase (PPO) is an enzyme widely distributed in the plant kingdom that has been detected in most fruits and vegetables. PPO was extracted and purified from Manila mango (Mangifera indica), and its biochemical properties were studied. PPO was purified 216-fold by hydrophobic interaction and ion exchange chromatography. PPO was purified to homogeneity, and the estimated PPO molecular weight (MW) by SDS-PAGE was ≈31.5 kDa. However, a MW of 65 kDa was determined by gel filtration, indicating a dimeric structure for the native PPO. The isolated PPO showed the highest affinity to pyrogallol (Km = 2.77 mM) followed by 4-methylcatechol (Km = 3.14 mM) and catechol (Km = 15.14 mM). The optimum pH for activity was 6.0. PPO was stable in the temperature range of 20-70 °C. PPO activity was completely inhibited by tropolone, ascorbic acid, sodium metabisulfite, and kojic acid at 0.1 mM. PMID:25211397

  12. Blueberry polyphenol oxidase: Characterization and the kinetics of thermal and high pressure activation and inactivation.

    PubMed

    Terefe, Netsanet Shiferaw; Delon, Antoine; Buckow, Roman; Versteeg, Cornelis

    2015-12-01

    Partially purified blueberry polyphenol oxidase (PPO) in Mcllvaine buffer (pH=3.6, typical pH of blueberry juice) was subjected to processing at isothermal-isobaric conditions at temperatures from 30 to 80 °C and pressure from 0.1 to 700 MPa. High pressure processing at 30-50 °C at all pressures studied caused irreversible PPO activity increase with a maximum of 6.1 fold increase at 500 MPa and 30 °C. Treatments at mild pressure-mild temperature conditions (0.1-400 MPa, 60 °C) also caused up to 3 fold PPO activity increase. Initial activity increase followed by a decrease occurred at relatively high pressure-mild temperature (400-600 MPa, 60 °C) and mild pressure-high temperature (0.1-400 MPa, 70-80 °C) combinations. At temperatures higher than 76 °C, monotonic decrease in PPO activity occurred at 0.1 MPa and pressures higher than 500 MPa. The activation/inactivation kinetics of the enzyme was successfully modelled assuming consecutive reactions in series with activation followed by inactivation.

  13. Purification and partial biochemical characterization of polyphenol oxidase from mango (Mangifera indica cv. Manila).

    PubMed

    Palma-Orozco, Gisela; Marrufo-Hernández, Norma A; Sampedro, José G; Nájera, Hugo

    2014-10-01

    Polyphenol oxidase (PPO) is an enzyme widely distributed in the plant kingdom that has been detected in most fruits and vegetables. PPO was extracted and purified from Manila mango (Mangifera indica), and its biochemical properties were studied. PPO was purified 216-fold by hydrophobic interaction and ion exchange chromatography. PPO was purified to homogeneity, and the estimated PPO molecular weight (MW) by SDS-PAGE was ≈31.5 kDa. However, a MW of 65 kDa was determined by gel filtration, indicating a dimeric structure for the native PPO. The isolated PPO showed the highest affinity to pyrogallol (Km = 2.77 mM) followed by 4-methylcatechol (Km = 3.14 mM) and catechol (Km = 15.14 mM). The optimum pH for activity was 6.0. PPO was stable in the temperature range of 20-70 °C. PPO activity was completely inhibited by tropolone, ascorbic acid, sodium metabisulfite, and kojic acid at 0.1 mM.

  14. Polyphenol oxidase in leaves: is there any significance to the chloroplastic localization?

    PubMed

    Boeckx, Tinne; Winters, Ana L; Webb, K Judith; Kingston-Smith, Alison H

    2015-06-01

    Polyphenol oxidase (PPO) catalyses the oxidation of monophenols and/or o-diphenols to o-quinones with the concomitant reduction of oxygen to water which results in protein complexing and the formation of brown melanin pigments. The most frequently suggested role for PPO in plants has been in defence against herbivores and pathogens, based on the physical separation of the chloroplast-localized enzyme from the vacuole-localized substrates. The o-quinone-protein complexes, formed as a consequence of cell damage, may reduce the nutritional value of the tissue and thereby reduce predation but can also participate in the formation of structural barriers against invading pathogens. However, since a sufficient level of compartmentation-based regulation could be accomplished if PPO was targeted to the cytosol, the benefit derived by some plant species in having PPO present in the chloroplast lumen remains an intriguing question. So is there more to the chloroplastic location of PPO? An interaction between PPO activity and photosynthesis has been proposed on more than one occasion but, to date, evidence either for or against direct involvement has been equivocal, and the lack of identified chloroplastic substrates remains an issue. Similarly, PPO has been suggested to have both pro- and anti-oxidant functions. Nevertheless, several independent lines of evidence suggest that PPO responds to environmental conditions and could be involved in the response of plants to abiotic stress. This review highlights our current understanding of the in vivo functions of PPO and considers the potential opportunities it presents for exploitation to increase stress tolerance in food crops.

  15. Development and validation of MRM methods to quantify protein isoforms of polyphenol oxidase in loquat fruits.

    PubMed

    Martínez-Márquez, Ascensión; Morante-Carriel, Jaime; Sellés-Marchart, Susana; Martínez-Esteso, María José; Pineda-Lucas, José Luis; Luque, Ignacio; Bru-Martínez, Roque

    2013-12-01

    Multiple reaction monitoring (MRM) is emerging as a promising technique for the detection and quantification of protein biomarkers in complex biological samples. Compared to Western blotting or enzyme assays, its high sensitivity, specificity, accuracy, assay speed, and sample throughput represent a clear advantage for being the approach of choice for the analysis of proteins. MRM assays are capable of detecting and quantifying proteolytic peptides differing in mass unique to particular proteins, that is, proteotypic peptides, through which different protein isoforms can be distinguished. We have focused on polyphenol oxidase (PPO), a plant conspicuous enzyme encoded by a multigenic family in loquat (Eriobotrya japonica Lindl.) and other related species. PPO is responsible for both the protection of plants from biotic stress as a feeding deterrent for herbivore insects and the enzymatic browning of fruits and vegetables. The latter makes fruit more attractive to seed dispersal agents but is also a major cause of important economic losses in agriculture and food industry. An adequate management of PPO at plant breeding level would maximize the benefits and minimize the disadvantages of this enzyme, but it would require a precise knowledge of the biological role played by each isoform in the plant. Thus, for the functional study of the PPOs, we have cloned and overexpressed fragments of three PPO isoforms from loquat to develop MRM-based methods for the quantification of each isoform. The method was developed using an ion trap instrument and validated in a QQQ instrument. It resulted in the selection of at least two peptides for each isoform that can be monitored by at least three transitions. A combination of SDS-PAGE and MRM lead to detect two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. The method was applied to determine the amount of the PPO2 isoform in protein extracts from fruit samples using

  16. In situ inactivation of polyphenol oxidase in mamey fruit (Pouteria sapota) by microwave treatment.

    PubMed

    Palma-Orozco, Gisela; Sampedro, José G; Ortiz-Moreno, Alicia; Nájera, Hugo

    2012-04-01

    Polyphenol oxidase (PPO) is the enzyme responsible for quality loss in most fruits and vegetables. Quality loss is mainly because of oxidative chemical reactions which generate the darkening of tissues. Mamey fruit (Pouteria sapota) after harvesting suffers a rapid quality decay trough activation of PPO. However, PPO may be inactivated in situ by chemical or thermal treatment. In food processing, microwave treatment (MT) has been used recently as an alternative for PPO inactivation. In this study, it was observed that mamey fruit pulp subjected to a gently MT resulted in a higher PPO activity as the generated heat induced in situ the increase in PPO activity. In contrast, PPO was completely inactivated after long MT by using a high microwave power. Temperature in mamey pulp after MT reached a maximum of 79 °C; although PPO was active up to 60 °C. PPO was completely inactivated when conventional blanching treatment was performed but required a higher temperature (92 °C/300 s). The optimum energy intensity (E(opt)) for PPO inactivation by MT was 0.51 kJ/g or 937 W/165 s. Under this condition, the remaining PPO activity was inversely proportional to energy intensity (E). Interestingly, MT resulted in a negligible damage in microstructure of mamey pulp, although blanching treatment resulted in large damaging effects on tissue organization and shape. Therefore, MT is proposed as an effective way to completely inactivate PPO without causing any significant damage to fruit tissues and shape; as preservation of color, flavor, and taste would be favored.

  17. Ultrasound-assisted three-phase partitioning of polyphenol oxidase from potato peel (Solanum tuberosum).

    PubMed

    Niphadkar, Sonali S; Rathod, Virendra K

    2015-01-01

    Conventional three phase partitioning (TPP) and ultrasound assisted three phase partitioning (UATPP) were optimized for achieving the maximum extraction and purification of polyphenol oxidase (PPO) from waste potato peels. Different process parameters such as ammonium sulfate (NH4)2SO4 concentration, crude extract to t-butanol ratio, time, temperature and pH were studied for conventional TPP. Except agitation speed, the similar parameters were also optimized for UATPP. Further additional parameters were also studied for UATPP viz. irradiation time at different frequencies, duty cycle and, rated power in order to obtain the maximum purification factor and recovery of PPO. The optimized conditions for conventional TPP were (NH4)2SO4 0-40% (w/v), extract to t-butanol ratio 1:1 (v/v), time 40 min and pH 7 at 30°C. These conditions provided 6.3 purification factor and 70% recovery of PPO from bottom phase. On the other hand, UATPP gives maximum purification fold of 19.7 with 98.3% recovery under optimized parameters which includes (NH4)2SO4 0-40% (w/v), crude extract to t-butanol ratio 1: 1 (v/v) pH 7, irradiation time 5 min with 25 kHz, duty cycle 40% and rated power 150W at 30°C. UATPP delivers higher purification factor and % recovery of PPO along with reduced operation time from 40 min to 5 min when compared with TPP. SDS PAGE showed partial purification of PPO enzyme with UATPP with molecular weight in the range of 26-36 kDa. Results reveal that UATPP would be an attractive option for the isolation and purification of PPO without need of multiple steps. PMID:26139472

  18. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.

    PubMed

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano

    2016-07-01

    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  19. Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

    PubMed

    Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

    2010-01-27

    The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed. PMID:20039636

  20. Quaternary ammonium functionalized clay film electrodes modified with polyphenol oxidase for the sensitive detection of catechol.

    PubMed

    Mbouguen, Justin Kemmegne; Ngameni, Emmanuel; Walcarius, Alain

    2007-09-30

    Naturally occurring Cameroonian smectite clay has been grafted with trimethylpropylammonium (TMPA) groups and the resulting organoclay has been deposited onto a glassy carbon electrode surface as a suitable immobilization matrix for polyphenol oxidase (PPO). High sensitivity of the electrochemical device to catechol biosensing can be achieved when the enzyme was impregnated within the organoclay film subsequent to its deposition due to favorable electrostatic interaction between PPO and the TMPA-clay layer. The bioelectrode preparation method was also compatible with the use of a mediator (i.e., ferrocene) and the best performance was obtained with a three-layer configuration made of glassy carbon coated with a first layer of ferrocene (Fc), which was then covered with the PPO-impregnated TMPA-clay layer, and finally overcoated with an enzyme-free TMPA-clay film acting as a protecting overlayer to avoid leaching of the biomolecule in solution. The electrochemical behavior of the modified film electrodes was first characterized by cyclic voltammetry and, then, they were evaluated for the amperometric biosensing of the model analyte catechol in batch conditions and in flow injection analysis. Various experimental parameters likely to influence the biosensor response have been investigated, including the electrode preparation mode (composition configuration, thickness), the usefulness of a mediator, the operating potential and pH of the medium, as well as the advantageous features of the TMPA-clay in comparison to related film electrodes based on non-functionalized clays. The organoclay was found to provide a favorable environment to enzyme activity and the multilayer configuration of the film electrode to provide a biosensor with good characteristics, such as an extended linear range for catechol detection (2 x 10(-8) to 1.2 x 10(-5)M) and a detection limit in the nanomolar range (9 x 10(-9)M). PMID:17537626

  1. Polyphenol oxidase in leaves: is there any significance to the chloroplastic localization?

    PubMed

    Boeckx, Tinne; Winters, Ana L; Webb, K Judith; Kingston-Smith, Alison H

    2015-06-01

    Polyphenol oxidase (PPO) catalyses the oxidation of monophenols and/or o-diphenols to o-quinones with the concomitant reduction of oxygen to water which results in protein complexing and the formation of brown melanin pigments. The most frequently suggested role for PPO in plants has been in defence against herbivores and pathogens, based on the physical separation of the chloroplast-localized enzyme from the vacuole-localized substrates. The o-quinone-protein complexes, formed as a consequence of cell damage, may reduce the nutritional value of the tissue and thereby reduce predation but can also participate in the formation of structural barriers against invading pathogens. However, since a sufficient level of compartmentation-based regulation could be accomplished if PPO was targeted to the cytosol, the benefit derived by some plant species in having PPO present in the chloroplast lumen remains an intriguing question. So is there more to the chloroplastic location of PPO? An interaction between PPO activity and photosynthesis has been proposed on more than one occasion but, to date, evidence either for or against direct involvement has been equivocal, and the lack of identified chloroplastic substrates remains an issue. Similarly, PPO has been suggested to have both pro- and anti-oxidant functions. Nevertheless, several independent lines of evidence suggest that PPO responds to environmental conditions and could be involved in the response of plants to abiotic stress. This review highlights our current understanding of the in vivo functions of PPO and considers the potential opportunities it presents for exploitation to increase stress tolerance in food crops. PMID:25873687

  2. Development and validation of MRM methods to quantify protein isoforms of polyphenol oxidase in loquat fruits.

    PubMed

    Martínez-Márquez, Ascensión; Morante-Carriel, Jaime; Sellés-Marchart, Susana; Martínez-Esteso, María José; Pineda-Lucas, José Luis; Luque, Ignacio; Bru-Martínez, Roque

    2013-12-01

    Multiple reaction monitoring (MRM) is emerging as a promising technique for the detection and quantification of protein biomarkers in complex biological samples. Compared to Western blotting or enzyme assays, its high sensitivity, specificity, accuracy, assay speed, and sample throughput represent a clear advantage for being the approach of choice for the analysis of proteins. MRM assays are capable of detecting and quantifying proteolytic peptides differing in mass unique to particular proteins, that is, proteotypic peptides, through which different protein isoforms can be distinguished. We have focused on polyphenol oxidase (PPO), a plant conspicuous enzyme encoded by a multigenic family in loquat (Eriobotrya japonica Lindl.) and other related species. PPO is responsible for both the protection of plants from biotic stress as a feeding deterrent for herbivore insects and the enzymatic browning of fruits and vegetables. The latter makes fruit more attractive to seed dispersal agents but is also a major cause of important economic losses in agriculture and food industry. An adequate management of PPO at plant breeding level would maximize the benefits and minimize the disadvantages of this enzyme, but it would require a precise knowledge of the biological role played by each isoform in the plant. Thus, for the functional study of the PPOs, we have cloned and overexpressed fragments of three PPO isoforms from loquat to develop MRM-based methods for the quantification of each isoform. The method was developed using an ion trap instrument and validated in a QQQ instrument. It resulted in the selection of at least two peptides for each isoform that can be monitored by at least three transitions. A combination of SDS-PAGE and MRM lead to detect two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. The method was applied to determine the amount of the PPO2 isoform in protein extracts from fruit samples using

  3. Cloning, Sequencing, Purification, and Crystal Structure of Grenache (Vitis vinifera) Polyphenol Oxidase

    SciTech Connect

    Virador, V.; Reyes Grajeda, J; Blanco-Labra, A; Mendiola-Olaya, E; Smith, G; Moreno, A; Whitaker, J

    2010-01-01

    The full-length cDNA sequence (P93622{_}VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C2221. The structure was obtained at 2.2 {angstrom} resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and {alpha}, {beta}, and {gamma}) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

  4. Ultrasound-assisted three-phase partitioning of polyphenol oxidase from potato peel (Solanum tuberosum).

    PubMed

    Niphadkar, Sonali S; Rathod, Virendra K

    2015-01-01

    Conventional three phase partitioning (TPP) and ultrasound assisted three phase partitioning (UATPP) were optimized for achieving the maximum extraction and purification of polyphenol oxidase (PPO) from waste potato peels. Different process parameters such as ammonium sulfate (NH4)2SO4 concentration, crude extract to t-butanol ratio, time, temperature and pH were studied for conventional TPP. Except agitation speed, the similar parameters were also optimized for UATPP. Further additional parameters were also studied for UATPP viz. irradiation time at different frequencies, duty cycle and, rated power in order to obtain the maximum purification factor and recovery of PPO. The optimized conditions for conventional TPP were (NH4)2SO4 0-40% (w/v), extract to t-butanol ratio 1:1 (v/v), time 40 min and pH 7 at 30°C. These conditions provided 6.3 purification factor and 70% recovery of PPO from bottom phase. On the other hand, UATPP gives maximum purification fold of 19.7 with 98.3% recovery under optimized parameters which includes (NH4)2SO4 0-40% (w/v), crude extract to t-butanol ratio 1: 1 (v/v) pH 7, irradiation time 5 min with 25 kHz, duty cycle 40% and rated power 150W at 30°C. UATPP delivers higher purification factor and % recovery of PPO along with reduced operation time from 40 min to 5 min when compared with TPP. SDS PAGE showed partial purification of PPO enzyme with UATPP with molecular weight in the range of 26-36 kDa. Results reveal that UATPP would be an attractive option for the isolation and purification of PPO without need of multiple steps.

  5. Novel roles for the polyphenol oxidase enzyme in secondary metabolism and the regulation of cell death in walnut.

    PubMed

    Araji, Soha; Grammer, Theresa A; Gertzen, Ross; Anderson, Stephen D; Mikulic-Petkovsek, Maja; Veberic, Robert; Phu, My L; Solar, Anita; Leslie, Charles A; Dandekar, Abhaya M; Escobar, Matthew A

    2014-03-01

    The enzyme polyphenol oxidase (PPO) catalyzes the oxidation of phenolic compounds into highly reactive quinones. Polymerization of PPO-derived quinones causes the postharvest browning of cut or bruised fruit, but the native physiological functions of PPOs in undamaged, intact plant cells are not well understood. Walnut (Juglans regia) produces a rich array of phenolic compounds and possesses a single PPO enzyme, rendering it an ideal model to study PPO. We generated a series of PPO-silenced transgenic walnut lines that display less than 5% of wild-type PPO activity. Strikingly, the PPO-silenced plants developed spontaneous necrotic lesions on their leaves in the absence of pathogen challenge (i.e. a lesion mimic phenotype). To gain a clearer perspective on the potential functions of PPO and its possible connection to cell death, we compared the leaf transcriptomes and metabolomes of wild-type and PPO-silenced plants. Silencing of PPO caused major alterations in the metabolism of phenolic compounds and their derivatives (e.g. coumaric acid and catechin) and in the expression of phenylpropanoid pathway genes. Several observed metabolic changes point to a direct role for PPO in the metabolism of tyrosine and in the biosynthesis of the hydroxycoumarin esculetin in vivo. In addition, PPO-silenced plants displayed massive (9-fold) increases in the tyrosine-derived metabolite tyramine, whose exogenous application elicits cell death in walnut and several other plant species. Overall, these results suggest that PPO plays a novel and fundamental role in secondary metabolism and acts as an indirect regulator of cell death in walnut.

  6. Chcanges in Germinability and Activities of Polyphenol Oxidase and Peroxidase in Seeds of Pentaclethramacrophylla During Lowtemperature Treatment

    NASA Astrophysics Data System (ADS)

    Udosen, I. R.; Nkang, A. E.; Sam, S. M.

    2012-07-01

    Activities of peroxidase (POD) and polyphenol Oxidase (PPO) were investigated in seeds of Pentaclethramacrophylla during low temperature treatment. The seeds from the small-sized fruits (variety A) and those of the big-sized fruits (variety B) showed high germination, with maximum germination values ranging between 60 ñ 90%. Low temperature treatment did not significantly (P< 0.5) affect maximum germination values. Activities of POD and PPO increased initially (2-4 days) but declined with prolonged (6ñ8 days) low temperature treatment.

  7. Extraction of rice bran extract and some factors affecting its inhibition of polyphenol oxidase activity and browning in potato.

    PubMed

    Boonsiripiphat, Kunnikar; Theerakulkait, Chockchai

    2009-01-01

    The extraction conditions of rice bran extract (RBE), including extraction ratio, extraction time, and extraction temperature, were studied in relation to enzymatic browning inhibition in potato. The inhibitory effect of RBE on potato polyphenol oxidase (PPO) activity and its total phenolic compound content were highest at an extraction ratio of 1:3 (rice bran:water, w/v), extraction time of 30 min, and extraction temperature of 40 degrees C. RBE showed the most inhibitory effect on PPO activity at pH 6.5. However, the inhibitory effect of RBE on potato PPO activity and its total phenolic compound content were decreased at the higher temperature and longer time.

  8. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: a non-animal model for neurochemical studies.

    PubMed

    Henderson, H M; Eskin, N A; Pinsky, C; Bose, R; Ashique, A M

    1992-01-01

    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the "Perov mixture" of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research. PMID:1435072

  9. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: A non-animal model for neurochemical studies

    SciTech Connect

    Henderson, H.M.; Eskin, N.A.M.; Pinsky, C.; Bose, R.; Ashique, A.M. )

    1992-01-01

    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the 'Perov mixture' of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research.

  10. Decolorization and removal of textile and non-textile dyes from polluted wastewater and dyeing effluent by using potato (Solanum tuberosum) soluble and immobilized polyphenol oxidase.

    PubMed

    Khan, Amjad Ali; Husain, Qayyum

    2007-03-01

    Celite bound potato polyphenol oxidase preparation was employed for the treatment of wastewater/dye effluent contaminated with reactive textile and non-textile dyes, Reactive Blue 4 and Reactive Orange 86. The maximum decolorization was found at pH 3.0 and 4.0 in case of Reactive Blue 4 and Reactive Orange 86, respectively. Immobilized potato polyphenol oxidase was significantly more effective in decolorizing the individual dye and complex mixtures of dyes as compared to soluble enzyme. The absorption spectra of the treated and untreated dye mixture and dyeing effluent exhibited a marked difference in the absorption value at various wavelengths. The polluted water contaminated with an individual dye or mixtures of dyes treated with soluble and immobilized potato polyphenol oxidase resulted in the remarkable loss in total organic carbon.

  11. Decolorization and removal of textile and non-textile dyes from polluted wastewater and dyeing effluent by using potato (Solanum tuberosum) soluble and immobilized polyphenol oxidase.

    PubMed

    Khan, Amjad Ali; Husain, Qayyum

    2007-03-01

    Celite bound potato polyphenol oxidase preparation was employed for the treatment of wastewater/dye effluent contaminated with reactive textile and non-textile dyes, Reactive Blue 4 and Reactive Orange 86. The maximum decolorization was found at pH 3.0 and 4.0 in case of Reactive Blue 4 and Reactive Orange 86, respectively. Immobilized potato polyphenol oxidase was significantly more effective in decolorizing the individual dye and complex mixtures of dyes as compared to soluble enzyme. The absorption spectra of the treated and untreated dye mixture and dyeing effluent exhibited a marked difference in the absorption value at various wavelengths. The polluted water contaminated with an individual dye or mixtures of dyes treated with soluble and immobilized potato polyphenol oxidase resulted in the remarkable loss in total organic carbon. PMID:16765044

  12. Polyphenols decreased liver NADPH oxidase activity, increased muscle mitochondrial biogenesis and decreased gastrocnemius age-dependent autophagy in aged rats.

    PubMed

    Laurent, Caroline; Chabi, Beatrice; Fouret, Gilles; Py, Guillaume; Sairafi, Badie; Elong, Cecile; Gaillet, Sylvie; Cristol, Jean Paul; Coudray, Charles; Feillet-Coudray, Christine

    2012-09-01

    This study explored major systems of reactive oxygen species (ROS) production and their consequences on oxidative stress, mitochondriogenesis and muscle metabolism in aged rats, and evaluated the efficiency of 30-day oral supplementation with a moderate dose of a red grape polyphenol extract (RGPE) on these parameters. In the liver of aged rats, NADPH oxidase activity was increased and mitochondrial respiratory chain complex activities were altered, while xanthine oxidase activity remained unchanged. In muscles, only mitochondrial activity was modified with aging. The oral intake of RGPE decreased liver NADPH oxidase activity in the aged rats without affecting global oxidative stress, suggesting that NADPH oxidase was probably not the dominant detrimental source of production of O(2)·(-) in the liver. Interestingly, RGPE supplementation increased mitochondrial biogenesis and improved antioxidant status in the gastrocnemius of aged rats, while it had no significant effect in soleus. RGPE supplementation also decreased age-dependent autophagy in gastrocnemius of aged rats. These results extended existing findings on the beneficial effects of RGPE on mitochondriogenesis and muscle metabolism in aged rats.

  13. Elucidating Polypharmacological Mechanisms of Polyphenols by Gene Module Profile Analysis

    PubMed Central

    Li, Bin; Xiong, Min; Zhang, Hong-Yu

    2014-01-01

    Due to the diverse medicinal effects, polyphenols are among the most intensively studied natural products. However, it is a great challenge to elucidate the polypharmacological mechanisms of polyphenols. To address this challenge, we establish a method for identifying multiple targets of chemical agents through analyzing the module profiles of gene expression upon chemical treatments. By using FABIA algorithm, we have performed a biclustering analysis of gene expression profiles derived from Connectivity Map (cMap), and clustered the profiles into 49 gene modules. This allowed us to define a 49 dimensional binary vector to characterize the gene module profiles, by which we can compare the expression profiles for each pair of chemical agents with Tanimoto coefficient. For the agent pairs with similar gene expression profiles, we can predict the target of one agent from the other. Drug target enrichment analysis indicated that this method is efficient to predict the multiple targets of chemical agents. By using this method, we identify 148 targets for 20 polyphenols derived from cMap. A large part of the targets are validated by experimental observations. The results show that the medicinal effects of polyphenols are far beyond their well-known antioxidant activities. This method is also applicable to dissect the polypharmacology of other natural products. PMID:24968267

  14. Characterization and role of polyphenol oxidase and peroxidase in browning of fresh-cut melon.

    PubMed

    Chisari, Marco; Barbagallo, Riccardo N; Spagna, Giovanni

    2008-01-01

    Polyphenol oxidase (PPO) and peroxidase (POD) were extracted from two different varieties of melon ( Cucumis melo L. cantalupensis cv. Charentais and C. melo L. inodorus cv. Amarillo) and characterized using reliable spectrophotometric methods. In both cases the enzymes followed Michaelis-Menten kinetics, showing different values of kinetics parameters between the two cultivars: K m = 7.18 +/- 0.70 mM ('Charentais') and 6.66 +/- 0.20 mM ('Amarillo') mM; V max = 7.93 +/- 0.35 units/min ('Charentais') and 13.82 +/- 0.37 units/min ('Amarillo'), relative to PPO; K m = 24.0 +/- 2.10 mM ('Charentais') and 5.05 +/- 0.19 mM ('Amarillo') mM; V max = 344.83 +/- 10.32 units/min ('Charentais') and 80.64 +/- 2.01 units/min ('Amarillo'), relative to POD. Optimum pH for PPO was 7.0 for 'Charentais' and 7.5 for 'Amarillo, whereas it was 4.5 for both cultivars relative to POD. Melon PPO had maximum activity at 60 degrees C in both 'Charentais' and 'Amarillo' cultivars, whereas POD maximum activity was found at 45 degrees C in 'Charentais' and at 25 degrees C in 'Amarillo'. POD from both cultivars showed higher thermolability compared with PPO, losing >90% of relative activity after only 5 min of incubation at 70 degrees C. POD's activation energy was much higher than that of PPO (Delta E (#) = 86.3 and 160.6 kJ mol (-1) for 'Charentais' and 'Amarillo', respectively). PPO and POD activities from both cultivars showed a decreasing pattern as sugar concentration in the assay medium increased, except in POD extract from 'Charentais', which maintained its activity in the presence of high d-glucose concentration (up to 5 M). Changes in L*, a*, b*, chroma, and hue angle values were chosen to describe the browning development in the samples during storage at 5 degrees C. A slight decrease in L* value and a more marked reduction of a* value were noted in both cultivars above all at the end of storage period. POD activity during storage at 5 degrees C was highly correlated with changes of

  15. Characterization and role of polyphenol oxidase and peroxidase in browning of fresh-cut melon.

    PubMed

    Chisari, Marco; Barbagallo, Riccardo N; Spagna, Giovanni

    2008-01-01

    Polyphenol oxidase (PPO) and peroxidase (POD) were extracted from two different varieties of melon ( Cucumis melo L. cantalupensis cv. Charentais and C. melo L. inodorus cv. Amarillo) and characterized using reliable spectrophotometric methods. In both cases the enzymes followed Michaelis-Menten kinetics, showing different values of kinetics parameters between the two cultivars: K m = 7.18 +/- 0.70 mM ('Charentais') and 6.66 +/- 0.20 mM ('Amarillo') mM; V max = 7.93 +/- 0.35 units/min ('Charentais') and 13.82 +/- 0.37 units/min ('Amarillo'), relative to PPO; K m = 24.0 +/- 2.10 mM ('Charentais') and 5.05 +/- 0.19 mM ('Amarillo') mM; V max = 344.83 +/- 10.32 units/min ('Charentais') and 80.64 +/- 2.01 units/min ('Amarillo'), relative to POD. Optimum pH for PPO was 7.0 for 'Charentais' and 7.5 for 'Amarillo, whereas it was 4.5 for both cultivars relative to POD. Melon PPO had maximum activity at 60 degrees C in both 'Charentais' and 'Amarillo' cultivars, whereas POD maximum activity was found at 45 degrees C in 'Charentais' and at 25 degrees C in 'Amarillo'. POD from both cultivars showed higher thermolability compared with PPO, losing >90% of relative activity after only 5 min of incubation at 70 degrees C. POD's activation energy was much higher than that of PPO (Delta E (#) = 86.3 and 160.6 kJ mol (-1) for 'Charentais' and 'Amarillo', respectively). PPO and POD activities from both cultivars showed a decreasing pattern as sugar concentration in the assay medium increased, except in POD extract from 'Charentais', which maintained its activity in the presence of high d-glucose concentration (up to 5 M). Changes in L*, a*, b*, chroma, and hue angle values were chosen to describe the browning development in the samples during storage at 5 degrees C. A slight decrease in L* value and a more marked reduction of a* value were noted in both cultivars above all at the end of storage period. POD activity during storage at 5 degrees C was highly correlated with changes of

  16. Protection of polyunsaturated oils against ruminal biohydrogenation and oxidation during storage using a polyphenol oxidase containing extract from red clover.

    PubMed

    Gadeyne, F; Van Ranst, G; Vlaeminck, B; Vossen, E; Van der Meeren, P; Fievez, V

    2015-03-15

    Polyunsaturated fatty acid (PUFA) are to a large extent subject to biohydrogenation in a ruminal environment, which results to the healthy value of these PUFA being lost upon dietary addition to ruminants. PUFA are also prone to lipid oxidation upon storage. Therefore, it was tested whether emulsions could be protected against in vitro ruminal biohydrogenation and oxidation during storage by using protein extracts rich in polyphenol oxidase, an enzyme responsible for browning of plant tissues. PUFA rich emulsions were made with a protein extract from red clover (Trifolium pratense L.) before adding a synthetic diphenol (4-methylcatechol) to induce protection. Results after in vitro incubation confirmed the hypothesis and indicated the potential to prevent PUFA in linseed or fish oil from ruminal biohydrogenation and oxidation during storage through addition of 4-methylcatechol to the emulsions. Protection depended on the amount of oil present and protein concentrations in the emulsions. Protection efficiency increased with increasing the amounts of diphenol present in the emulsion per unit interfacial surface area. It is suggested that protection is caused by an effective encapsulation by cross-linking of the protein layer at the emulsion interface. For the first time, a method is described to protect PUFA using an enzyme abundantly available in nature, polyphenol oxidase, in combination with 4-methylcatechol.

  17. Antioxidant activities and xanthine oxidase inhibitory effects of extracts and main polyphenolic compounds obtained from Geranium sibiricum L.

    PubMed

    Wu, Nan; Zu, Yuangang; Fu, Yujie; Kong, Yu; Zhao, Jintong; Li, Xiaojuan; Li, Ji; Wink, Michael; Efferth, Thomas

    2010-04-28

    The antioxidant capacity and xanthine oxidase inhibitory effects of extracts and main polyphenolic compounds of Geranium sibiricum were studied in the present work. The antioxidant capacity was evaluated by ferric reducing antioxidant power, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging, superoxide radical scavenging, nitric oxide scavenging, beta-carotene-linoleic acid bleaching, and reducing power assays. Among the extracts and four fractions, the ethyl acetate fraction showed the highest phenolic content (425.36 +/- 9.70 mg of gallic acid equivalent/g extracts) and the best antioxidant activity. The IC(50) values of the ethyl acetate fraction were 0.93, 3.32, 2.06, 2.66, and 1.64 microg/mL in the DPPH radical scavenging, superoxide radical scavenging, nitric oxide scavenging, beta-carotene-linoleic acid bleaching, and reducing power assays, respectively. Of the polyphenolic compounds separated from the ethyl acetate fraction, geraniin showed a higher activity than corilagin and gallic acid. The IC(50) values ranged from 0.87 to 2.53 microM, which were even lower than the positive control (except for allopurinol). All test samples except for the petroleum ether fraction showed xanthine oxidase inhibitory effects. We conclude that G. sibiricum represents a valuable natural antioxidant source and is potentially applicable in the healthy food industry.

  18. Characterization and purification of polyphenol oxidase from artichoke (Cynara scolymus L.).

    PubMed

    Dogan, Serap; Turan, Yusuf; Ertürk, Hatibe; Arslan, Oktay

    2005-02-01

    In this study, the polyphenol oxidase (PPO) of artichoke (Cynara scolymus L.) was first purified by a combination of (NH(4))(2)SO(4) precipitation, dialysis, and a Sepharose 4B-L-tyrosine-p-aminobenzoic acid affinity column. At the end of purification, 43-fold purification was achieved. The purified enzyme migrated as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Polyacrylamide gel electrophoresis indicated that PPO had a 57 kDa molecular mass. Second, the contents of total phenolic and protein of artichoke head extracts were determined. The total phenolic content of artichoke head was determined spectrophotometrically according to the Folin-Ciocalteu procedure and was found to be 425 mg 100 g(-1) on a fresh weight basis. Protein content was determined according to Bradford method. Third, the effects of substrate specificity, pH, temperature, and heat inactivation were investigated on the activity of PPO purified from artichoke. The enzyme showed activity to 4-methylcatechol, pyrogallol, catechol, and L-dopa. No activity was detected toward L-tyrosine, resorsinol, and p-cresol. According to V(max)/K(m) values, 4-methylcatechol (1393 EU min(-1) mM(-1)) was the best substrate, followed by pyrogallol (1220 EU min(-1) mM(-1)), catechol (697 EU min(-1) mM(-1)), and L-dopa (102 EU min(-1) mM(-1)). The optimum pH values for PPO were 5.0, 8.0, and 7.0 using 4-methylcatechol, pyrogallol, and catechol as substrate, respectively. It was found that optimum temperatures were dependent on the substrates studied. The enzyme activity decreased due to heat denaturation of the enzyme with increasing temperature and inactivation time for 4-methylcatechol and pyrogallol substrates. However, all inactivation experiments for catechol showed that the activity of artichoke PPO increased with mild heating, reached a maximum, and then decreased with time. Finally, inhibition of artichoke PPO was investigated with inhibitors such as L-cysteine, EDTA, ascorbic

  19. Silencing and heterologous expression of ppo-2 indicate a specific function of a single polyphenol oxidase isoform in resistance of dandelion (Taraxacum officinale) against Pseudomonas syringae pv. tomato.

    PubMed

    Richter, Carolin; Dirks, Mareike E; Gronover, Christian Schulze; Prüfer, Dirk; Moerschbacher, Bruno M

    2012-02-01

    Dandelion (Taraxacum officinale) possesses an unusually high degree of disease resistance. As this plant exhibits high polyphenol oxidase (PPO) activity and PPO have been implicated in resistance against pests and pathogens, we analyzed the potential involvement of five PPO isoenzymes in the resistance of dandelion against Botrytis cinerea and Pseudomonas syringae pv. tomato. Only one PPO (ppo-2) was induced during infection, and ppo-2 promoter and β-glucuronidase marker gene fusions revealed strong induction of the gene surrounding lesions induced by B. cinerea. Specific RNAi silencing reduced ppo-2 expression only, and concomitantly increased plant susceptibility to P. syringae pv. tomato. At 4 days postinoculation, P. syringae pv. tomato populations were strongly increased in the ppo-2 RNAi lines compared with wild-type plants. When the dandelion ppo-2 gene was expressed in Arabidopsis thaliana, a plant having no PPO gene, active protein was formed and protein extracts of the transgenic plants exhibited substrate-dependent antimicrobial activity against P. syringae pv. tomato. These results clearly indicate a strong contribution of a specific, single PPO isoform to disease resistance. Therefore, we propose that specific PPO isoenzymes be included in a new family of pathogenesis-related (PR) proteins.

  20. Two-year comparison of the biochemical properties of polyphenol oxidase from Turkish Alyanak apricot (Prunus armenica L.).

    PubMed

    Ünal, M Ümit; Şener, Aysun

    2016-01-01

    Polyphenol oxidase (PPO) was extracted and purified from Turkish Alyanak apricot variety and its characteristics were studied in two consecutive years (2008 and 2009). Three isoenzymes (isoenzyme A1, A2 and B) were obtained upon ammonium sulfate fractionation, ion exchange chromatography using DEAE-Toyopearl 650 M and gel filtration chromatography using Sephadex G-100. The isoenzymes exhibited different kinetic properties. Furthermore, year-to-year variability in Km and Vmax values was significant. The pH optimum for enzyme activity was 4.98 for isoenzymes A1 and A2, and 5.8 for isoenzyme B. The isoenzymes A1 and B had optimum temperature at 30 °C in both years whereas isoenzyme A2 had maximum activity at 40 °C in 2008 and 30 °C in 2009. The inactivation kinetics parameters and the effects of inhibitors tested exhibited significant year-to-year variation.

  1. Extraction of rice bran extract and some factors affecting its inhibition of polyphenol oxidase activity and browning in potato.

    PubMed

    Boonsiripiphat, Kunnikar; Theerakulkait, Chockchai

    2009-01-01

    The extraction conditions of rice bran extract (RBE), including extraction ratio, extraction time, and extraction temperature, were studied in relation to enzymatic browning inhibition in potato. The inhibitory effect of RBE on potato polyphenol oxidase (PPO) activity and its total phenolic compound content were highest at an extraction ratio of 1:3 (rice bran:water, w/v), extraction time of 30 min, and extraction temperature of 40 degrees C. RBE showed the most inhibitory effect on PPO activity at pH 6.5. However, the inhibitory effect of RBE on potato PPO activity and its total phenolic compound content were decreased at the higher temperature and longer time. PMID:19291577

  2. Free phenolics and polyphenol oxidase (PPO): the factors affecting post-cut browning in eggplant (Solanum melongena).

    PubMed

    Mishra, Bibhuti Bhusan; Gautam, Satyendra; Sharma, Arun

    2013-08-15

    Polyphenol oxidase (PPO) catalyses oxidation of phenolics, which results in instant but differential browning in many cut fruits and vegetables, including eggplant. Eight cultivars of eggplant were characterised by their PPO specific activity, phenolic content, browning index, and PPO polymorphism. In fresh eggplant, browning was found to be dependent on both the phenolic content and PPO specific activity, whereas, total phenolic content played a major role in browning of stored fruits. Interestingly, although browning index increased in stored eggplant fruits, PPO activity reduced in four out of eight cultivars studied. Phenolic level was found to increase in all these cultivars during storage. Although a significant level of homology was observed in PPO nucleotide and conceptually translated protein sequence, two cultivars, which displayed highest PPO specific activity, differed in the 38 amino acid stretch in the peptide region 301-338.

  3. Salicylic acid inhibits enzymatic browning of fresh-cut Chinese chestnut (Castanea mollissima) by competitively inhibiting polyphenol oxidase.

    PubMed

    Zhou, Dan; Li, Lin; Wu, Yanwen; Fan, Junfeng; Ouyang, Jie

    2015-03-15

    The inhibitory effect and associated mechanisms of salicylic acid (SA) on the browning of fresh-cut Chinese chestnut were investigated. Shelled and sliced chestnuts were immersed in different concentrations of an SA solution, and the browning of the chestnut surface and interior were inhibited. The activities of polyphenol oxidase (PPO) and peroxidase (POD) extracted from chestnuts were measured in the presence and absence of SA. SA at concentrations higher than 0.3g/L delayed chestnut browning by significantly inhibiting the PPO activity (P<0.01), and the POD activity was not significantly affected (P>0.05). The binding and inhibition modes of SA with PPO and POD, determined by AUTODOCK 4.2 and Lineweaver-Burk plots, respectively, established SA as a competitive inhibitor of PPO. PMID:25308637

  4. Isolation and characterization of polyphenol oxidase from Sardinian poisonous and non-poisonous chemotypes of Ferula communis (L.).

    PubMed

    Zucca, Paolo; Sanjust, Enrico; Loi, Martina; Sollai, Francesca; Ballero, Mauro; Pintus, Manuela; Rescigno, Antonio

    2013-06-01

    Ferula communis (L.), a plant belonging to Apiaceae, is widely present in Sardinia, Italy. Currently, interest in F. communis focuses on the presence of two chemotypes in the wild. One chemotype is poisonous to animals, whereas the other chemotype is non-poisonous. Polyphenol oxidase (PPO) has been extracted and partially purified from the two chemotypes of F. communis. The biochemical characterization of the enzymes showed significant differences. In particular, while the two PPOs were not able to use 6- and 7-hydroxycoumarin as substrates, they showed distinct specificity for 6,7- and 7,8-dihydroxycoumarin. Significant differences in the enzyme behavior towards common PPO inhibitors were also observed. In addition, activation energy and activation energy for denaturation were determined, showing significant differences between FP-PPO and FNP-PPO, particularly for denaturation kinetics. The possible roles of the two PPOs in determining differences in composition and toxicity of the two F. communis chemotypes are also discussed.

  5. Two-year comparison of the biochemical properties of polyphenol oxidase from Turkish Alyanak apricot (Prunus armenica L.).

    PubMed

    Ünal, M Ümit; Şener, Aysun

    2016-01-01

    Polyphenol oxidase (PPO) was extracted and purified from Turkish Alyanak apricot variety and its characteristics were studied in two consecutive years (2008 and 2009). Three isoenzymes (isoenzyme A1, A2 and B) were obtained upon ammonium sulfate fractionation, ion exchange chromatography using DEAE-Toyopearl 650 M and gel filtration chromatography using Sephadex G-100. The isoenzymes exhibited different kinetic properties. Furthermore, year-to-year variability in Km and Vmax values was significant. The pH optimum for enzyme activity was 4.98 for isoenzymes A1 and A2, and 5.8 for isoenzyme B. The isoenzymes A1 and B had optimum temperature at 30 °C in both years whereas isoenzyme A2 had maximum activity at 40 °C in 2008 and 30 °C in 2009. The inactivation kinetics parameters and the effects of inhibitors tested exhibited significant year-to-year variation. PMID:26213033

  6. Salicylic acid inhibits enzymatic browning of fresh-cut Chinese chestnut (Castanea mollissima) by competitively inhibiting polyphenol oxidase.

    PubMed

    Zhou, Dan; Li, Lin; Wu, Yanwen; Fan, Junfeng; Ouyang, Jie

    2015-03-15

    The inhibitory effect and associated mechanisms of salicylic acid (SA) on the browning of fresh-cut Chinese chestnut were investigated. Shelled and sliced chestnuts were immersed in different concentrations of an SA solution, and the browning of the chestnut surface and interior were inhibited. The activities of polyphenol oxidase (PPO) and peroxidase (POD) extracted from chestnuts were measured in the presence and absence of SA. SA at concentrations higher than 0.3g/L delayed chestnut browning by significantly inhibiting the PPO activity (P<0.01), and the POD activity was not significantly affected (P>0.05). The binding and inhibition modes of SA with PPO and POD, determined by AUTODOCK 4.2 and Lineweaver-Burk plots, respectively, established SA as a competitive inhibitor of PPO.

  7. Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue

    SciTech Connect

    Siriphanich, J.; Kader, A.A.

    1985-01-01

    An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

  8. Dose rate effect of gamma irradiation on phenolic compounds, polyphenol oxidase, and browning of mushrooms (Agaricus bisporus).

    PubMed

    Beaulieu, M; D'Aprano, M B; Lacroix, M

    1999-07-01

    To enhance the shelf life of edible mature mushrooms, Agaricus bisporus, 2 kGy ionizing treatments were applied at two different dose rates: 4.5 kGy/h (I(-)) and 32 kGy/h (I(+)). Both I(+) and I(-) showed a 2 and 4 day shelf-life enhancement compared to the control (C). Before day 9, no significant difference (p>0.05) in L value was detected in irradiated mushrooms. However, after day 9, the highest observed L value (whiteness) was obtained for the mushrooms irradiated in I(-). Analyses of phenolic compounds revealed that mushrooms in I(-) contained more phenols than I(+) and C, the latter containing the lower level of phenols. The fluctuation of the precursors of glutaminyl-4-hydroxyaniline (GHB) was less in I(-) than in I(+). The polyphenol oxidase (PPO) activities of irradiated mushrooms, analyzed via catechol oxidase, dopa oxidase, and tyrosine hydroxylase substrates, were found to be significantly lowered (p = 0.05) compared to C, with a further decrease in I(+). Analyses of the enzymes indicated that PPO activity was lower in I(+), contrasting with its lower phenols concentration. The observation of mushrooms' cellular membranes, by electronic microscopy, revealed a better preserved integrity in I(-) than in I(+). It is thus assumed that the browning effect observed in I(+) was caused by both the decompartmentation of vacuolar phenol and the entry of molecular oxygen into the cell cytoplasm. The synergetic effect of the residual active PPO and the molecular oxygen, in contact with the phenols, allowed an increased oxidation rate and, therefore, a more pronounced browning I(+) than in I(-).

  9. Independent Losses of Function in a Polyphenol Oxidase in Rice: Differentiation in Grain Discoloration between Subspecies and the Role of Positive Selection under Domestication[W

    PubMed Central

    Yu, Yanchun; Tang, Tian; Qian, Qian; Wang, Yonghong; Yan, Meixian; Zeng, Dali; Han, Bin; Wu, Chung-I; Shi, Suhua; Li, Jiayang

    2008-01-01

    Asian rice (Oryza sativa) cultivars originated from wild rice and can be divided into two subspecies by several criteria, one of which is the phenol reaction (PHR) phenotype. Grains of indica cultivars turn brown in a phenol solution that accelerates a similar process that occurs during prolonged storage. By contrast, the grains of japonica do not discolor. This distinction may reflect the divergent domestication of these two subspecies. The PHR is controlled by a single gene, Phr1; here, we report the cloning of Phr1, which encodes a polyphenol oxidase. The Phr1 gene is indeed responsible for the PHR phenotype, as transformation with a functional Phr1 can complement a PHR negative cultivar. Phr1 is defective in all japonica lines but functional in nearly all indica and wild strains. Phylogenetic analysis showed that the defects in Phr1 arose independently three times. The multiple recent origins and rapid spread of phr1 in japonica suggest the action of positive selection, which is further supported by several population genetic tests. This case may hence represent an example of artificial selection driving the differentiation among domesticated varieties. PMID:19033526

  10. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  11. Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T

    PubMed Central

    Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong

    2016-01-01

    Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324

  12. Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine.

    PubMed

    Böyükbayram, A Elif; Kiralp, Senem; Toppare, Levent; Yağci, Yusuf

    2006-10-01

    Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique. Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO) into conducting copolymers prepared by electropolymerization of pyrrole with thiophene capped polytetrahydrofuran. Kinetic parameters, maximum reaction rate (V(max)) and Michaelis-Menten constant (K(m)) and optimum conditions regarding temperature and pH were determined for the immobilized enzyme. Operational stability and shelf-life of the enzyme electrodes were investigated. Enzyme electrodes of polyphenol oxidase were used to determine the amount of phenolic compounds in two brands of Turkish red wines and found very useful owing to their high kinetic parameters and wide pH working range.

  13. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2015-01-01

    Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P212121 and P1211 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3121. The crystals of latent cgAUS1 belonged to space group P1211 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na6[TeW6O24] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI). PMID:26057806

  14. Structural diversity in the dandelion (Taraxacum officinale) polyphenol oxidase family results in different responses to model substrates.

    PubMed

    Dirks-Hofmeister, Mareike E; Singh, Ratna; Leufken, Christine M; Inlow, Jennifer K; Moerschbacher, Bruno M

    2014-01-01

    Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure-function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a "selector" for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates. PMID:24918587

  15. Comparison of some biochemical properties of artichoke polyphenol oxidase entrapped in alginate-carrageenan and alginate gels.

    PubMed

    Yagar, Hulya; Kocaturk, Selin

    2014-08-01

    Polyphenol oxidase (PPO, EC.1.14.18.1) isolated from artichoke (Cynara scolymus) was entrapped within alginate and alginate+ carrageenan beads, and the catecholase and cresolase activities of both entrapped enzymes were determined. Some properties of these immobilized enzymes such as optimum pH and temperature, kinetic parameters (Km and Vmax), thermal, and storage stability were determined and compared to each other. The highest catecholase activity was observed in alginate gel (370 U/g bead) while the highest cresolase activity was in alginate+ carrageenan gel (90 U/g bead). For catecholase and cresolase activities, optimum pHs of alginate and alginate+ carrageenan beads were determined to be 7.0 and 4.0, respectively. Optimum temperatures for catecholase activity were determined to be 40°C for both entrapped enzymes. These values for cresolase activity were 30°C and 20°C, respectively. Immobilized artichoke PPOs greatly preserved their thermal stability which exists anyway. The catalytic efficiency value (Vmax/Km) of the alginate beads is approximately high as two-and-a-half folds of that of alginate+κ-carrageenan beads for cresolase activity. These values were very close for catecholase activity. Immobilized beads saved their both activities after 30 days of storage at 4°C. PMID:23795723

  16. Comparison of membrane-bound and soluble polyphenol oxidase in Fuji apple (Malus domestica Borkh. cv. Red Fuji).

    PubMed

    Liu, Fang; Zhao, Jin-Hong; Gan, Zhi-Lin; Ni, Yuan-Ying

    2015-04-15

    This study compared membrane-bound with soluble polyphenol oxidase (mPPO and sPPO, respectively) from Fuji apple. Purified mPPO and partially purified sPPO were used. mPPO was purified by temperature-induced phase partitioning and ion exchange chromatography. The specific activity of mPPO was 34.12× higher than that of sPPO. mPPO was more stable than sPPO at pH 5.0-8.5. Although mPPO was more easily inactivated at 25-55 °C, it is still more active than sPPO in this temperature range. The optimum substrate of mPPO was 4-methyl catechol, followed by catechol. L-cysteine had the highest inhibitory effects on mPPO followed by ascorbic acid and glutathione. Surprisingly, EDTA increased mPPO activity. The results revealed that purified mPPO is a dimer with a molecular weight of approximately 67 kDa.

  17. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora.

    PubMed

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2015-06-01

    Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2(1)2(1)2(1) and P12(1)1 and diffracted to ∼ 1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3(1)21. The crystals of latent cgAUS1 belonged to space group P12(1)1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na6[TeW6O24] within the liquid-liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI).

  18. Prediction of polyphenol oxidase activity using visible near-infrared hyperspectral imaging on mushroom (Agaricus bisporus) caps.

    PubMed

    Gaston, Edurne; Frías, Jesús M; Cullen, Patrick J; O'Donnell, Colm P; Gowen, Aoife A

    2010-05-26

    Physical stress (i.e., bruising) during harvesting, handling, and transportation triggers enzymatic discoloration of mushrooms, a common and detrimental phenomenon largely mediated by polyphenol oxidase (PPO) enzymes. Hyperspectral imaging (HSI) is a nondestructive technique that combines imaging and spectroscopy to obtain information from a sample. The objective of this study was to assess the ability of HSI to predict the activity of PPO on mushroom caps. Hyperspectral images of mushrooms subjected to various damage treatments were taken, followed by enzyme extraction and PPO activity measurement. Principal component regression (PCR) models (each with three PCs) built on raw reflectance and multiple scatter-corrected (MSC) reflectance data were found to be the best modeling approach. Prediction maps showed that the MSC model allowed for compensation of spectral differences due to sample curvature and surface irregularities. Results reveal the possibility of developing a sensor that could rapidly identify mushrooms with a higher likelihood to develop enzymatic browning, hence aiding produce management decision makers in the industry.

  19. The role of polyphenol oxidase and peroxidase in the browning of water caltrop pericarp during heat treatment.

    PubMed

    Ciou, Jhih-Ying; Lin, Hsin-Hung; Chiang, Po-Yuan; Wang, Chiun-C; Charles, Albert Linton

    2011-07-15

    The mechanism of browning involving enzymatic browning was investigated in the pericarp of water caltrop, an Asian vegetable popular for its taste and medicinal properties. Polyphenol oxidase (PPO) and peroxidase (POD) activities were determined in pericarp at various times and temperatures. Water caltrop consisted of 44.22% moisture content, 37.23% crude fibre, and 2.63% crude protein. PPO and POD activities dropped from 62 and 38units/g sample, respectively, as water temperature was increased from 30 to 80°C. Optimum pH and temperature for PPO activity was at pH 5.0, 25-45°C, and POD activity peaked at 60°C. High PPO and POD activities at 40-50°C resulted in degradation of phenolic compounds, which led to increased aggregation of browning pigments and discolouration (lower L-values) of the pericarp. Enzymatic browning was determined as the major factor in the browning discolouration of heat-treated water caltrop pericarp.

  20. Regurgitant derived from the tea geometrid Ectropis obliqua suppresses wound-induced polyphenol oxidases activity in tea plants.

    PubMed

    Yang, Zi-Wei; Duan, Xiao-Na; Jin, Shan; Li, Xi-Wang; Chen, Zong-Mao; Ren, Bing-Zhong; Sun, Xiao-Ling

    2013-06-01

    Polyphenol oxidases (PPOs) have been reported to play an important role in protecting plants from attack by herbivores. However, little is known about their role in tea. Here, we investigated the effect of PPOs on interactions between tea plants and the tea geometrid Ectropis obliqua, one of the most important insect pests of tea. Jasmonic acid (JA) treatment resulted in increases in PPO activity, and the effect of JA was dose dependent. Ectropis obliqua caterpillars grew and developed more slowly on JA-treated tea plants than on control plants, and larval weight gains depended on the JA dosage. Artificial diet complemented with PPOs reduced the growth and survival rate of E. obliqua caterpillars, and there was a negative relationship between PPO level and larval growth and survival. Unlike mechanical wounding, which is an effective inducer of tea plant PPO activity, wounding plus the herbivore regurgitant or herbivore infestation suppressed the wound-induced PPO activities, especially at 4 days after treatment. These results suggest that PPOs are an important anti-herbivore factor in tea plants, defending them against E. obliqua larvae, and that E. obliqua larvae have evolved to elude the tea plant's defense by inhibiting the production of PPOs.

  1. Concentration dependent effects of commonly used pesticides on activation versus inhibition of the quince (Cydonia Oblonga) polyphenol oxidase.

    PubMed

    Fattouch, Sami; Raboudi-Fattouch, Faten; Ponce, José Vicente Gil; Forment, Josep Vicent; Lukovic, Dunja; Marzouki, Nejib; Vidal, Daniel Ramón

    2010-03-01

    Polyphenol oxidase (PPO) catalyzes the oxidation of o-diphenols to their respective quinones which undergo autopolymerization and form dark pigments. The interaction of PPO with various substrates and effectors remains the focus of intensive investigations due to the enzyme's key role in pigments biosynthesis including animal melanogenesis and fruit/fungi enzymatic browning. In this study, the effect of a range of commonly used pesticides on the enzyme activity has been evaluated using the purified quince (Cydonia oblonga Miller) PPO. The biochemical analysis showed that, in the presence of high pesticide concentrations, the enzyme was competitively inhibited, particularly with benomyl, carbaryl, deltamethrine and parathion methyl for which inhibition constants (K(i)) were 8.3, 5.7, 12 and 4 microM, respectively. At lower pesticide concentrations (2-10 microM), however, the catecholase activity was significantly activated (p<0.01), suggesting a homotropic behavior of these chemical compounds. Furthermore, the use of in silico structure-based analyses, known as computational docking, highlighted the nature of the PPO-pesticides interactions and confirmed the in vitro observations. Catechol substrate and parathion methyl inhibitor showed lower total energy scores of -120.06 and -117.4 3 kcal mol(-1), indicating that these ligands had higher PPO-binding affinities. The obtained data bring to light new pesticide functional features of great interest in the medicinal, agro-chemical and environmental circles.

  2. Characterization of polyphenol oxidase from the Manzanilla cultivar (Olea europaea pomiformis) and prevention of browning reactions in bruised olive fruits.

    PubMed

    Segovia-Bravo, Kharla A; Jarén-Galan, Manuel; García-García, Pedro; Garrido-Fernandez, Antonio

    2007-08-01

    The crude extract of the polyphenol oxidase (PPO) enzyme from the Manzanilla cultivar (Olea europaea pomiformis) was obtained, and its properties were characterized. The browning reaction followed a zero-order kinetic model. Its maximum activity was at pH 6.0. This activity was completely inhibited at a pH below 3.0 regardless of temperature; however, in alkaline conditions, pH inhibition depended on temperature and was observed at values above 9.0 and 11.0 at 8 and 25 degrees C, respectively. The thermodynamic parameters of substrate oxidation depended on pH within the range in which activity was observed. The reaction occurred according to an isokinetic system because pH affected the enzymatic reaction rate but not the energy required to carry out the reaction. In the alkaline pH region, browning was due to a combination of enzymatic and nonenzymatic reactions that occurred in parallel. These results correlated well with the browning behavior observed in intentionally bruised fruits at different temperatures and in different storage solutions. The use of a low temperature ( approximately 8 degrees C) was very effective for preventing browning regardless of the cover solution used.

  3. Low-density lipoprotein antioxidant activity of phenolic compounds and polyphenol oxidase activity in selected clingstone peach cultivars.

    PubMed

    Chang, S; Tan, C; Frankel, E N; Barrett, D M

    2000-02-01

    The antioxidant potential of eight clingstone peach cultivars was investigated by determining phenolic compounds and inhibition of low-density lipoprotein (LDL) oxidation. Cultivars low in polyphenol oxidase (PPO) were also selected to minimize enzymatic browning. Inhibition of LDL oxidation varied from 17.0 to 37.1% in peach flesh extract, from 15.2 to 49.8% in whole peach extract, and from 18.2 to 48.1% in peel extract. Total phenols were 432.8-768.1 mg/kg in flesh extract, 483.3-803.0 mg/kg in whole extract, and 910.9-1922.9 mg/kg in peel extract. The correlation coefficient between relative LDL antioxidant activity and concentration of total phenols was 0.76. Peel PPO activity was higher than flesh activity in most cultivars. The lowest PPO and specific activities were found in the Walgant cultivar, followed by Kakamas and 18-8-23. These three cultivars combine the desirable characteristics of strong antioxidant activity, low PPO activity, and lower susceptibility to browning reactions.

  4. The conformational state of polyphenol oxidase from field bean (Dolichos lablab) upon SDS and acid-pH activation.

    PubMed

    Kanade, Santosh R; Paul, Beena; Rao, A G Appu; Gowda, Lalitha R

    2006-05-01

    Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase)--a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen--and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1+/-2 to 75.9+/-0.6 A (1 A=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141

  5. Screening, separating, and completely recovering polyphenol oxidases and other biochemicals from sweet potato wastewater in starch production.

    PubMed

    Cheng, Shi; Zhang, Yi-Feng; Zeng, Zhao-Qin; Lin, Jia; Zhang, Ya-Wen; Ni, He; Li, Hai-Hang

    2015-02-01

    Polyphenol oxidase (PPO) has multiple functions, and the lack of commercially available enzyme sources limits its widespread application in various industries. An accurate PPO assay was developed by HPLC determination of the substrate oxidation. Resources screening indicated that sweet potato (Ipomoea batatas L.) wastewater in starch production has high PPO activity. A procedure was developed for separately recovering PPO, β-amylase, sporamins, and small molecular nutrients (SMNs) from sweet potato wastewater. The wastewater was adjusted to pH 3.5 to precipitate PPO, and then adjusted to 50 % acetone to precipitate β-amylase and further to 80 % acetone to precipitate sporamins. The SMNs were obtained after acetone recovery. Purified powders of 4.3 × 10(5) units of PPO, 4.0 × 10(6) units of β-amylase, 8.70 g sporamins, and 20.2 g SMNs were obtained from the wastewater of 1 kg sweet potato. More than 50 million tons of sweet potato is used for starch production annually around the world. Through this simple procedure, huge amount of biochemical resources can be recovered from the wastewater, which greatly increases the economic value of the crop and saves the environment. PMID:25190667

  6. The effect of ultrasound on particle size, color, viscosity and polyphenol oxidase activity of diluted avocado puree.

    PubMed

    Bi, Xiufang; Hemar, Yacine; Balaban, Murat O; Liao, Xiaojun

    2015-11-01

    The effect of ultrasound treatment on particle size, color, viscosity, polyphenol oxidase (PPO) activity and microstructure in diluted avocado puree was investigated. The treatments were carried out at 20 kHz (375 W/cm(2)) for 0-10 min. The surface mean diameter (D[3,2]) was reduced to 13.44 μm from an original value of 52.31 μm by ultrasound after 1 min. A higher L(∗) value, ΔE value and lower a(∗) value was observed in ultrasound treated samples. The avocado puree dilution followed pseudoplastic flow behavior, and the viscosity of diluted avocado puree (at 100 s(-1)) after ultrasound treatment for 1 min was 6.0 and 74.4 times higher than the control samples for dilution levels of 1:2 and 1:9, respectively. PPO activity greatly increased under all treatment conditions. A maximum increase of 25.1%, 36.9% and 187.8% in PPO activity was found in samples with dilution ratios of 1:2, 1:5 and 1:9, respectively. The increase in viscosity and measured PPO activity might be related to the decrease in particle size. The microscopy images further confirmed that ultrasound treatment induced disruption of avocado puree structure. PMID:25899308

  7. Fast apple (Malus x domestica) and tobacco (Nicotiana tobacum) leaf polyphenol oxidase activity assay for screening transgenic plants.

    PubMed

    Broothaerts, W; McPherson, J; Li, B; Randall, E; Lane, W D; Wiersma, P A

    2000-12-01

    A spectrophotometric assay method for the analysis of polyphenol oxidase (PPO), in apple and tobacco leaves, has been optimized to increase efficiency in the screening of large numbers of transgenic plants. Crude protein extracts from leaf punches were prepared in a FastPrep homogenizer. The addition of Triton X-100 during extraction resulted in 44 and 74% increases in the PPO activity recovered, from apple and tobacco, respectively. The enzyme kinetics differed markedly between apple and tobacco. Apple leaf PPO was isolated in a latent state and was activated by the addition of SDS. In contrast, tobacco PPO activity was inhibited by SDS, particularly at acidic pH. Apple PPO showed a pronounced pH optimum around pH 6, whereas the pH profile for tobacco PPO was much flatter, with a broad optimum around pH 4. The calculated Km' value for apple PPO, using 4-methylcatechol as substrate, was 8.1, and for tobacco the Km was 4.3. The PPO reaction was strongly inhibited by tropolone, a Cu competitor, and restored by the addition of Cu2+. Several factors affecting variability in leaf PPO activity levels in plants are discussed. PMID:11141262

  8. Kinetics and thermodynamics of the thermal inactivation of polyphenol oxidase in an aqueous extract from Agaricus bisporus.

    PubMed

    Gouzi, Hicham; Depagne, Christophe; Coradin, Thibaud

    2012-01-11

    The kinetics and thermodynamics of the thermal inactivation of polyphenol oxidase (PPO) in an aqueous extract from mushroom Agaricus bisporus (J.E. Lange) Imbach was studied, using pyrocatechol as a substrate. Optimal conditions for enzymatic studies were determined to be pH 7.0 and 35-40 °C. The kinetics of PPO-catalyzed oxidation of pyrocatechol followed the Haldane model with an optimum substrate concentration of 20 mM. Thermal inactivation of PPO was examined in more detail between 50 and 73 °C and in relation to exposure time. Obtained monophasic kinetics were adequately described by a first-order model, with significant inactivation occurring with increasing temperature (less than 10% preserved activity after 6 min at 65 °C). Arrhenius plot determination and calculated thermodynamic parameters suggest that the PPO in aqueous extract from Agaricus bisporus mushroom is a structurally robust yet temperature-sensitive biocatalyst whose inactivation process is mainly entropy-driven.

  9. Structural Diversity in the Dandelion (Taraxacum officinale) Polyphenol Oxidase Family Results in Different Responses to Model Substrates

    PubMed Central

    Dirks-Hofmeister, Mareike E.; Singh, Ratna; Leufken, Christine M.; Inlow, Jennifer K.; Moerschbacher, Bruno M.

    2014-01-01

    Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure–function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a “selector” for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates. PMID:24918587

  10. Characterization of polyphenol oxidase from the Manzanilla cultivar (Olea europaea pomiformis) and prevention of browning reactions in bruised olive fruits.

    PubMed

    Segovia-Bravo, Kharla A; Jarén-Galan, Manuel; García-García, Pedro; Garrido-Fernandez, Antonio

    2007-08-01

    The crude extract of the polyphenol oxidase (PPO) enzyme from the Manzanilla cultivar (Olea europaea pomiformis) was obtained, and its properties were characterized. The browning reaction followed a zero-order kinetic model. Its maximum activity was at pH 6.0. This activity was completely inhibited at a pH below 3.0 regardless of temperature; however, in alkaline conditions, pH inhibition depended on temperature and was observed at values above 9.0 and 11.0 at 8 and 25 degrees C, respectively. The thermodynamic parameters of substrate oxidation depended on pH within the range in which activity was observed. The reaction occurred according to an isokinetic system because pH affected the enzymatic reaction rate but not the energy required to carry out the reaction. In the alkaline pH region, browning was due to a combination of enzymatic and nonenzymatic reactions that occurred in parallel. These results correlated well with the browning behavior observed in intentionally bruised fruits at different temperatures and in different storage solutions. The use of a low temperature ( approximately 8 degrees C) was very effective for preventing browning regardless of the cover solution used. PMID:17628073

  11. Structural diversity in the dandelion (Taraxacum officinale) polyphenol oxidase family results in different responses to model substrates.

    PubMed

    Dirks-Hofmeister, Mareike E; Singh, Ratna; Leufken, Christine M; Inlow, Jennifer K; Moerschbacher, Bruno M

    2014-01-01

    Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure-function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a "selector" for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates.

  12. Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice

    NASA Astrophysics Data System (ADS)

    Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo

    2007-07-01

    Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period.

  13. The effect of ultrasound on particle size, color, viscosity and polyphenol oxidase activity of diluted avocado puree.

    PubMed

    Bi, Xiufang; Hemar, Yacine; Balaban, Murat O; Liao, Xiaojun

    2015-11-01

    The effect of ultrasound treatment on particle size, color, viscosity, polyphenol oxidase (PPO) activity and microstructure in diluted avocado puree was investigated. The treatments were carried out at 20 kHz (375 W/cm(2)) for 0-10 min. The surface mean diameter (D[3,2]) was reduced to 13.44 μm from an original value of 52.31 μm by ultrasound after 1 min. A higher L(∗) value, ΔE value and lower a(∗) value was observed in ultrasound treated samples. The avocado puree dilution followed pseudoplastic flow behavior, and the viscosity of diluted avocado puree (at 100 s(-1)) after ultrasound treatment for 1 min was 6.0 and 74.4 times higher than the control samples for dilution levels of 1:2 and 1:9, respectively. PPO activity greatly increased under all treatment conditions. A maximum increase of 25.1%, 36.9% and 187.8% in PPO activity was found in samples with dilution ratios of 1:2, 1:5 and 1:9, respectively. The increase in viscosity and measured PPO activity might be related to the decrease in particle size. The microscopy images further confirmed that ultrasound treatment induced disruption of avocado puree structure.

  14. Removal of bisphenol derivatives through quinone oxidation by polyphenol oxidase and subsequent quinone adsorption on chitosan in the heterogeneous system.

    PubMed

    Kimura, Yuji; Takahashi, Ayumi; Kashiwada, Ayumi; Yamada, Kazunori

    2015-01-01

    In this study, the combined use of a biopolymer chitosan and an oxidoreductase polyphenol oxidase (PPO) was systematically investigated for the removal of bisphenol derivatives from aqueous medium. The process parameters, such as the pH value, temperature, and PPO concentration, were estimated to conduct the enzymatic quinone oxidation of bisphenol derivatives by as little enzyme as possible. Bisphenol derivatives effectively underwent PPO-catalysed quinone oxidation without H2O2 unlike other oxidoreductases, such as peroxidase and tyrosinase, and the optimum conditions were determined to be pH 7.0 and 40°C for bisphenol B, bisphenol E, bisphenol O, and bisphenol Z; pH 7.0 and 30°C for bisphenol C and bisphenol F; and pH 8.0 and 40°C for bisphenol T. They were completely removed through adsorption of enzymatically generated quinone derivatives on chitosan beads or chitosan powders. Quinone adsorption on chitosan beads or chitosan powders in the heterogeneous system was found to be a more effective procedure than generation of aggregates in the homogeneous system with chitosan solution. The removal time was shortened by increasing the amount of chitosan beads or decreasing the size of the chitosan powders.

  15. Comparison of some biochemical properties of artichoke polyphenol oxidase entrapped in alginate-carrageenan and alginate gels.

    PubMed

    Yagar, Hulya; Kocaturk, Selin

    2014-08-01

    Polyphenol oxidase (PPO, EC.1.14.18.1) isolated from artichoke (Cynara scolymus) was entrapped within alginate and alginate+ carrageenan beads, and the catecholase and cresolase activities of both entrapped enzymes were determined. Some properties of these immobilized enzymes such as optimum pH and temperature, kinetic parameters (Km and Vmax), thermal, and storage stability were determined and compared to each other. The highest catecholase activity was observed in alginate gel (370 U/g bead) while the highest cresolase activity was in alginate+ carrageenan gel (90 U/g bead). For catecholase and cresolase activities, optimum pHs of alginate and alginate+ carrageenan beads were determined to be 7.0 and 4.0, respectively. Optimum temperatures for catecholase activity were determined to be 40°C for both entrapped enzymes. These values for cresolase activity were 30°C and 20°C, respectively. Immobilized artichoke PPOs greatly preserved their thermal stability which exists anyway. The catalytic efficiency value (Vmax/Km) of the alginate beads is approximately high as two-and-a-half folds of that of alginate+κ-carrageenan beads for cresolase activity. These values were very close for catecholase activity. Immobilized beads saved their both activities after 30 days of storage at 4°C.

  16. The walnut (Juglans regia) genome sequence reveals diversity in genes coding for the biosynthesis of non-structural polyphenols.

    PubMed

    Martínez-García, Pedro J; Crepeau, Marc W; Puiu, Daniela; Gonzalez-Ibeas, Daniel; Whalen, Jeanne; Stevens, Kristian A; Paul, Robin; Butterfield, Timothy S; Britton, Monica T; Reagan, Russell L; Chakraborty, Sandeep; Walawage, Sriema L; Vasquez-Gross, Hans A; Cardeno, Charis; Famula, Randi A; Pratt, Kevin; Kuruganti, Sowmya; Aradhya, Mallikarjuna K; Leslie, Charles A; Dandekar, Abhaya M; Salzberg, Steven L; Wegrzyn, Jill L; Langley, Charles H; Neale, David B

    2016-09-01

    The Persian walnut (Juglans regia L.), a diploid species native to the mountainous regions of Central Asia, is the major walnut species cultivated for nut production and is one of the most widespread tree nut species in the world. The high nutritional value of J. regia nuts is associated with a rich array of polyphenolic compounds, whose complete biosynthetic pathways are still unknown. A J. regia genome sequence was obtained from the cultivar 'Chandler' to discover target genes and additional unknown genes. The 667-Mbp genome was assembled using two different methods (SOAPdenovo2 and MaSuRCA), with an N50 scaffold size of 464 955 bp (based on a genome size of 606 Mbp), 221 640 contigs and a GC content of 37%. Annotation with MAKER-P and other genomic resources yielded 32 498 gene models. Previous studies in walnut relying on tissue-specific methods have only identified a single polyphenol oxidase (PPO) gene (JrPPO1). Enabled by the J. regia genome sequence, a second homolog of PPO (JrPPO2) was discovered. In addition, about 130 genes in the large gallate 1-β-glucosyltransferase (GGT) superfamily were detected. Specifically, two genes, JrGGT1 and JrGGT2, were significantly homologous to the GGT from Quercus robur (QrGGT), which is involved in the synthesis of 1-O-galloyl-β-d-glucose, a precursor for the synthesis of hydrolysable tannins. The reference genome for J. regia provides meaningful insight into the complex pathways required for the synthesis of polyphenols. The walnut genome sequence provides important tools and methods to accelerate breeding and to facilitate the genetic dissection of complex traits.

  17. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  18. Limited impact of elevated levels of polyphenol oxidase on tree-feeding caterpillars: assessing individual plant defenses with transgenic poplar.

    PubMed

    Barbehenn, Raymond V; Jones, Christopher P; Yip, Lynn; Tran, Lan; Constabel, C Peter

    2007-11-01

    Polyphenol oxidase (PPO) is commonly believed to function as an effective antiherbivore defense in plants. PPO is induced in plants following herbivory, and insect performance is often negatively correlated with PPO levels. However, induced defenses create numerous changes in plants, and very little work has been done to test the direct effects of PPO on insect herbivores separately from other changes. This study examined the impacts of high levels of PPO on the performance of two species of tree-feeding caterpillars (Lymantria dispar and Orgyia leucostigma) on poplar. Transgenic PPO-overexpressing poplar (Populus tremula x Populus alba) was used as a source of elevated-PPO leaves, thereby controlling for the multiple effects of induction. In addition, the impacts of treating poplar foliage with high levels of purified mushroom PPO were examined on the two caterpillar species. Contrary to expectation, in several cases increased PPO levels had no significant effect on insect consumption or growth rates. Although one of the mechanisms by which PPO is believed to impact herbivores is via increased oxidative stress, the ingestion of large amounts of PPO had little or no effect on semiquinone radical and oxidized protein levels in the gut contents of lymantriid caterpillars. PPO activity in caterpillars is likely limited by the low oxygen and high ascorbate levels commonly found in their gut contents. This study questions whether induced PPO functions as an effective post-ingestive defense against tree-feeding caterpillars, and indicates that controlled, mechanistic studies are needed in other plant-herbivore systems to test for a direct effect of PPO on insect performance.

  19. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    SciTech Connect

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2015-05-22

    Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)

  20. Isolation of a latent polyphenol oxidase from loquat fruit (Eriobotrya japonica Lindl.): kinetic characterization and comparison with the active form.

    PubMed

    Sellés-Marchart, Susana; Casado-Vela, Juan; Bru-Martínez, Roque

    2006-02-15

    Polyphenol oxidase (PPO) has been extracted from both soluble and particulate fractions of loquat fruit (Eriobotrya japonica Lindl. cv. Algerie). The soluble PPO (20% of total activity) was partially purified 3.3-fold after ammonium sulfate fractionation being in its active state. The particulate PPO fraction (80% of total activity) was purified to homogeneity in a latent form being activable by sodium dodecyl sulfate (SDS). The enzyme was purified 40.0-fold with a total yield of 15.3% after extraction by phase partitioning in Triton X-114 followed by three chromatographic steps. The molecular weight was estimated to be about 59.2 and 61.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration chromatography, respectively, indicating that latent PPO is a monomer. Latent PPO catalyzed the oxidation of chlorogenic acid (CA) at a rate 50-fold faster than that of 4-tert-butylcatechol (TBC) but the soluble active counterpart only twice. Both PPOs exhibited similar Km values for TBC but Km for CA was 5-fold higher for the latent than for the active soluble PPO. Other kinetic characteristics, including sensitivity to inhibitors, substrate specificity, thermal stability, temperature, and pH profiles, were quite different between both PPOs. These results provide strong evidences that the soluble active and the particulate latent are different forms of PPO in loquat fruit flesh. The results suggest that the major PPO form for the oxidation of CA, leading to enzymatic browning under physiological conditions, is the latent one.

  1. The conformational state of polyphenol oxidase from field bean (Dolichos lablab) upon SDS and acid-pH activation

    PubMed Central

    Kanade, Santosh R.; Paul, Beena; Rao, A. G. Appu; Gowda, Lalitha R.

    2006-01-01

    Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase) – a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen – and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1±2 to 75.9±0.6 Å (1 Å=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141

  2. Novel Roles for the Polyphenol Oxidase Enzyme in Secondary Metabolism and the Regulation of Cell Death in Walnut1[W][OPEN

    PubMed Central

    Araji, Soha; Grammer, Theresa A.; Gertzen, Ross; Anderson, Stephen D.; Mikulic-Petkovsek, Maja; Veberic, Robert; Phu, My L.; Solar, Anita; Leslie, Charles A.; Dandekar, Abhaya M.; Escobar, Matthew A.

    2014-01-01

    The enzyme polyphenol oxidase (PPO) catalyzes the oxidation of phenolic compounds into highly reactive quinones. Polymerization of PPO-derived quinones causes the postharvest browning of cut or bruised fruit, but the native physiological functions of PPOs in undamaged, intact plant cells are not well understood. Walnut (Juglans regia) produces a rich array of phenolic compounds and possesses a single PPO enzyme, rendering it an ideal model to study PPO. We generated a series of PPO-silenced transgenic walnut lines that display less than 5% of wild-type PPO activity. Strikingly, the PPO-silenced plants developed spontaneous necrotic lesions on their leaves in the absence of pathogen challenge (i.e. a lesion mimic phenotype). To gain a clearer perspective on the potential functions of PPO and its possible connection to cell death, we compared the leaf transcriptomes and metabolomes of wild-type and PPO-silenced plants. Silencing of PPO caused major alterations in the metabolism of phenolic compounds and their derivatives (e.g. coumaric acid and catechin) and in the expression of phenylpropanoid pathway genes. Several observed metabolic changes point to a direct role for PPO in the metabolism of tyrosine and in the biosynthesis of the hydroxycoumarin esculetin in vivo. In addition, PPO-silenced plants displayed massive (9-fold) increases in the tyrosine-derived metabolite tyramine, whose exogenous application elicits cell death in walnut and several other plant species. Overall, these results suggest that PPO plays a novel and fundamental role in secondary metabolism and acts as an indirect regulator of cell death in walnut. PMID:24449710

  3. Site-directed mutagenesis around the CuA site of a polyphenol oxidase from Coreopsis grandiflora (cgAUS1).

    PubMed

    Kaintz, Cornelia; Mayer, Rupert L; Jirsa, Franz; Halbwirth, Heidi; Rompel, Annette

    2015-03-24

    Aurone synthase from Coreopsis grandiflora (cgAUS1), catalyzing conversion of butein to sulfuretin in a type-3 copper center, is a rare example of a polyphenol oxidase involved in anabolism. Site-directed mutagenesis around the CuA site of AUS1 was performed, and recombinant enzymes were analyzed by mass spectrometry. Replacement of the coordinating CuA histidines with alanine resulted in the presence of a single copper and loss of diphenolase activity. The thioether bridge-building cysteine and a phenylalanine over the CuA site, exchanged to alanine, have no influence on copper content but appear to play an important role in substrate binding.

  4. Glutathione and cinnamic acid: natural dietary components used in preventing the process of browning by inhibition of Polyphenol Oxidase in apple juice.

    PubMed

    Gacche, R N; Warangkar, S C; Ghole, V S

    2004-04-01

    Consumer demands for 'freshness' in processed foods has been given increasing attention by food processing industries by searching for minimally processed products. Polyphenol Oxidase (PPO) mediated browning is a major cause of undesirable flavors and nutritional losses in fruit juices. Here the anti-browning efficiency of glutathione (GSH, reduced form) and cinnamic acid (CA) in apple juice is evaluated. It was observed that the rate of the browning reaction could be efficiently delayed using GSH and CA, which act as inhibitors of PPO. Kinetic studies confirm that GSH and CA are non-competitive and competitive inhibitors of PPO respectively.

  5. Kinetics of inhibition of polyphenol oxidase mediated browning in apple juice by beta-cyclodextrin and L-ascorbate-2-triphosphate.

    PubMed

    Gacche, R N; Zore, G B; Ghole, V S

    2003-02-01

    Polyphenol Oxidase (PPO) mediated browning in raw fruits and vegetables is a major cause of quality deterioration in fruits and vegetables and derived food products. Here the rate of browning reaction in apple juice treated individually and in combination (1:1) of beta-Cyclodextrin (beta-CD) and L-Ascorbate-2-triphosphate (L-AATP) is described. It was observed that the rate of quinone formation can be minimized using a combination of beta-CD and L-AATP as compared to individual treatment with these agents. Kinetic experiments revealed that both compounds are non-competitive inhibitors of PPO.

  6. Lysyl Oxidase (Lox) Gene Deficiency Affects Osteoblastic Phenotype

    PubMed Central

    Pischon, N.; Mäki, J. M.; Weisshaupt, P.; Heng, N.; Palamakumbura, A. H.; N'Guessan, P.; Ding, A.; Radlanski, R.; Renz, H.; Bronckers, T. A. L. J. J.; Myllyharju, J.; Kielbassa, A.; Kleber, B. M.; Bernimoulin, J.-P.; Trackman, P.C.

    2010-01-01

    Lysyl oxidase (LOX) catalyzes cross-linking of elastin and collagen, which is essential for structural integrity and function of bone tissue. The present study examined the role of Lox gene deficiency for the osteoblast phenotype in primary calvarial osteoblasts from E18.5 Lox knockout (Lox-/-) and wild type (wt) (C57 BL/6) mice. Next to Lox gene depletion, mRNA expression of Lox isoforms, LOXL1-4, was significantly down-regulated in Lox-/- bone tissue. A significant decrease of DNA synthesis of Lox-/- osteoblasts compared to wt was found. Early stages of osteoblastic apoptosis studied by Annexin-V binding as well as later stages of DNA fragmentation were not affected. However, mineral nodule formation and osteoblastic differentiation were markedly decreased, as revealed by significant down-regulation of osteoblastic markers, type I collagen, BSP and Runx2/Cbfa1. PMID:19458888

  7. Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection

    PubMed Central

    Tejeda, Leslie; Alvarado, Juan Antonio; Dębiec, Magdalena; Peñarrieta, José Mauricio; Cárdenas, Oscar; Alvarez, Maria Teresa; Chawade, Aakash; Nilsson, Lars; Bergenståhl, Björn

    2014-01-01

    The objective of this study was to evaluate total antioxidant capacity (TAC), total phenolic content (TPH), and the identification of anthocyanidin and polyphenolic compounds in 13 colored potatoes collected from the Andean region of Bolivia, and understand how the chemical composition correlated with the botanical classification and molecular characterization of genes, ans (anthocyanidin synthase) and stan1 (Solanum tuberosum anthocyanidin synthase), associated with the synthesis of anthocyanidins. The results show the existence of a limited correlation between botanical classification, based on morphological identification and polyphenol composition. No association between genetic grouping of the ans and stan genes and botanical classification was found. However, it was possible to identify a correlation between the ans gene clades and the levels of anthocyanidins as well as of other polyphenols. Thus, this result confirms the concept that potato color can be used in the search for high polyphenol potato cultivars. PMID:24804064

  8. Control of skin colour and polyphenol oxidase activity in santol fruit by dipping in organic acid solution.

    PubMed

    Benjawan, Chutichudet; Chutichudet, P

    2009-06-01

    This laboratory experiment was carried out at the Department of Agricultural Technology, Mahasarakham University, Northeast Thailand during July and August 2008. The experiment aimed to determine an effective natural organic acid that would delay the unattractive skin browning of santol fruit, while at the same time not damaging the quality of the fruit. The experiment included a study of the fruit's polyphenol oxidase (PPO) activity, phenolic content and quinone content, as they relate to colour and a study of total soluble solid content, pH, titratable acidity and vitamin C content as they relate to fruit quality. A Completely Randomized Design (CRD) with four replications was used. Each replication consisted of 10 fruits. Santol fruit was harvested at 145 days after full bloom and dipped for 30 min in aqueous solutions of two organic acids that were used as treatments, i.e., 0% for T1 (control), 5% citric acid for T2, 5% ascorbic acid for T3, 10% citric acid for T4 and 10% ascorbic acid for T5 and stored at room temperature (28 degrees C, 90% R.H.) to investigate the effect of the acid on fruit weight, skin colour, PPO activity and other internal parameters. The results showed that the most appropriate anti-browning agent for santol fruit was found with T2. It gave the highest mean values, 57.37 and 55.95, of brightness (L*) at 4 and 10 Days After Storage (DAS), respectively. In addition, PPO activity of flesh tissue was lowest for T2 with mean values of 0.0078 to 0.0092 by 0 and 300 S, respectively. The phenolic content in the flesh tissue significantly increased with an increase in numbers ofDAS, whereas the reverse was found with the pH level in the fruits. They were lowest for T2, with mean values of 6.00, by 10 DAS. There were no significant differences among the treatments in any of the measured Total Soluble Solids (TSS), Titratable Acidity (TA) and vitamin C content.

  9. Polyphenol oxidase and its relationship with oleuropein concentration in fruits and leaves of olive (Olea europaea) cv. 'Picual' trees during fruit ripening.

    PubMed

    Ortega-García, Francisca; Blanco, Santos; Peinado, M Angeles; Peragón, Juan

    2008-01-01

    Oleuropein, the main phenolic compound of olive fruit, has important antioxidant properties that are responsible for some of the nutritional properties of fruits and the defence mechanism of leaves. Polyphenol oxidase (PPO) activity changes during fruit ripening in many plants. We studied the kinetics and molecular properties of PPO in fruits and leaves of olive (Olea europaea L.) cv. 'Picual' trees and the relationship between PPO and oleuropein concentration during fruit ripening. Polyphenol oxidase showed hyperbolic kinetics in fruits and leaves. Significant increases in PPO specific activity, V(max), K(m )and catalytic efficiency occurred during fruit ripening. Based on SDS-PAGE under partially denaturing conditions and in-gel staining with DL-3,4-dihydroxyphenylalanine, PPO activity was found in one major protein of 55 and 50 kDA in fruits and leaves, respectively. During the last stages of fruit maturation, a second 36 kDa protein was observed in fruits but not in leaves, indicating that this protein could serve as a marker of the final phase of fruit maturation. Under fully denaturing conditions, only one 27.7 kDa immunoreactive band was detected in fruits. Both the amount of PPO activity and the amount of PPO protein increased significantly during fruit maturation. Immunohistochemical studies indicated that PPO is located in the epidermis, parenchyma and companion vascular cells of leaves as well as in the epidermis of fruit. During fruit maturation, oleuropein concentration measured by HPLC significantly decreased in fruits and increased in leaves.

  10. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.

    PubMed

    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

    2012-10-15

    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-α-glucosidase activities among sun-, air-, and freeze-dried leaves.

  11. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.

    PubMed

    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

    2012-10-15

    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-α-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

  12. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  13. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.

    PubMed

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P

    2009-02-17

    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions.

  14. Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

  15. The pea gene NA encodes ent-kaurenoic acid oxidase.

    PubMed

    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2003-01-01

    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  16. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  17. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  18. Polyphenol Oxidase Containing Sidestreams as Emulsifiers of Rumen Bypass Linseed Oil Emulsions: Interfacial Characterization and Efficacy of Protection against in Vitro Ruminal Biohydrogenation.

    PubMed

    Gadeyne, Frederik; De Neve, Nympha; Vlaeminck, Bruno; Claeys, Erik; Van der Meeren, Paul; Fievez, Veerle

    2016-05-18

    The low transfer in ruminants of dietary polyunsaturated fatty acids to the milk or peripheral tissues is largely due to ruminal biohydrogenation. Lipids emulsified by a polyphenol oxidase (PPO) rich protein extract of red clover were shown before to be protected against this breakdown after cross-linking with 4-methylcatechol. Protein extracts of 13 other vegetal resources were tested. Surprisingly, the effectiveness to protect emulsified lipids against in vitro ruminal biohydrogenation largely depended on the origin of the extract and its protein concentration but was not related to PPO activity. Moreover, PPO isoforms in vegetal sources, effectively protecting emulsified lipids, were diverse and their presence at the emulsion interface did not seem essential. Potato tuber peels were identified as an interesting biological source of emulsifying proteins and PPO, particularly since protein extracts of industrial potato sidestreams proved to be suitable for the current application. PMID:27111580

  19. Polyphenol Oxidase Containing Sidestreams as Emulsifiers of Rumen Bypass Linseed Oil Emulsions: Interfacial Characterization and Efficacy of Protection against in Vitro Ruminal Biohydrogenation.

    PubMed

    Gadeyne, Frederik; De Neve, Nympha; Vlaeminck, Bruno; Claeys, Erik; Van der Meeren, Paul; Fievez, Veerle

    2016-05-18

    The low transfer in ruminants of dietary polyunsaturated fatty acids to the milk or peripheral tissues is largely due to ruminal biohydrogenation. Lipids emulsified by a polyphenol oxidase (PPO) rich protein extract of red clover were shown before to be protected against this breakdown after cross-linking with 4-methylcatechol. Protein extracts of 13 other vegetal resources were tested. Surprisingly, the effectiveness to protect emulsified lipids against in vitro ruminal biohydrogenation largely depended on the origin of the extract and its protein concentration but was not related to PPO activity. Moreover, PPO isoforms in vegetal sources, effectively protecting emulsified lipids, were diverse and their presence at the emulsion interface did not seem essential. Potato tuber peels were identified as an interesting biological source of emulsifying proteins and PPO, particularly since protein extracts of industrial potato sidestreams proved to be suitable for the current application.

  20. Selected biochemical properties of polyphenol oxidase in butter lettuce leaves (Lactuca sativa L. var. capitata) elicited with dl-β-amino-n-butyric acid.

    PubMed

    Złotek, Urszula; Gawlik-Dziki, Urszula

    2015-02-01

    The study concentrated on changes in certain biochemical parameters of polyphenol oxidase (PPO) from lettuce leaves caused by dl-β-amino-n-butyric acid (BABA) elicitation. PPO from control plants demonstrated the highest affinity toward catechol, whereas PPO from BABA-elicited lettuce showed the highest affinity to 4-methylcatechol. The optimum temperature for enzymes from control plants was 35°C, whereas from plants elicited with 1mM BABA this was 25°C. PPO from plants elicited with BABA was also more sensitive to the tested inhibitors than PPO from control plants. l-Cysteine was the most effective inhibitor. Native gel stained for PPO activity in control samples showed two isoforms. However, in BABA-treated lettuce three bands visualising PPO activity were observed. The information obtained in this study will be valuable for the development of treatment technology and storage conditions to control undesirable browning reactions in elicited lettuce.

  1. Diversity and relationships in key traits for functional and apparent quality in a collection of eggplant: fruit phenolics content, antioxidant activity, polyphenol oxidase activity, and browning.

    PubMed

    Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime

    2013-09-18

    Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality.

  2. Inactivation, aggregation, secondary and tertiary structural changes of germin-like protein in Satsuma mandarine with high polyphenol oxidase activity induced by ultrasonic processing.

    PubMed

    Huang, Nana; Cheng, Xi; Hu, Wanfeng; Pan, Siyi

    2015-02-01

    The inhibition of Polyphenol oxidase (PPO) in plants has been widely researched for their important roles in browning reaction. A newly found germin-like protein (GLP) with high PPO activity in Satsuma mandarine was inactivated by low-frequency high-intensity ultrasonic (20 kHz) processing. The effects of ultrasound on PPO activity and structure of GLP were investigated using dynamic light scattering (DLS) analysis, transmission electron microscopy (TEM), circular dichroism (CD) spectral measurement and fluorescence spectral measurement. The lowest PPO activity achieved was 27.4% following ultrasonication for 30 min at 400 W. DLS analysis showed ultrasound caused both aggregation and dissociation of GLP particles. TEM images also demonstrated protein aggregation phenomena. CD spectra exhibited a certain number of loss in α-helix structure content. Fluorescence spectra showed remarkable increase in fluorescence intensity with tiny blue-shift following ultrasonication. In conclusion, ultrasound applied in this study induced structural changes of GLP and eventually inactivated PPO activity.

  3. A kinetic study of irreversible enzyme inhibition by an inhibitor that is rendered unstable by enzymic catalysis. The inhibition of polyphenol oxidase by L-cysteine.

    PubMed Central

    Valero, E; Varón, R; García-Carmona, F

    1991-01-01

    A kinetic study of the irreversible inhibition of an enzyme by an inhibitor that is depleted in the medium by its reaction with the product of enzymic analysis was made. The model is illustrated by the study of the inhibition of catecholase activity of polyphenol oxidase by L-cysteine. The inhibition is characterized by an initial lag period followed by a concomitant decrease in enzymic activity expressed when the steady state is reached, both kinetic parameters being modulated by enzyme, substrate and inhibitor concentrations. There is no analytical solution to the non-linear differential-equation system that describes the kinetics of the reaction, and so computer simulations of this dynamic behaviour are presented. The results obtained show that the system here studied presents kinetic co-operativity for a target enzyme that follows the simple Michaelis-Menten mechanism in its action on the substrate. PMID:1908225

  4. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.

    PubMed

    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai

    2016-01-01

    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ⩽ 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid.

  5. Inhibition of potato polyphenol oxidase by anions and activity in various carboxylate buffers (pH 4.8) at constant ionic strength.

    PubMed

    Malkin, B D; Thickman, K R; Markworth, C J; Wilcox, D E; Kull, F J

    2001-01-01

    The activity of potato polyphenol oxidase (tyrosinase) toward DL-3,4-dihydroxyphenylalanine (K(M) 5.39 mM) was studied using a variety of carboxylate buffers at a common pH and ionic strength. Enzyme activity, greatest in citrate and least in oxalate, correlated with increasing carboxyl concentration and molecular mass. The lower activity in oxalate was attributed to more effective chelation of a copper(II) form of the enzyme by the oxalate dianion. Sodium halide salts inhibited the enzyme. Although there was little difference in inhibition between sodium and potassium salts, the degree and type of inhibition was anion dependent; K(is), values for NaCl and KCl, (competitive inhibitors) were 1.82 and 1.62 mM, whereas Na(2) SO(4) and K(2) SO(4) (mixed inhibitors) had K(is) and K(ii) values in the 250 to 450 mM range. PMID:11342282

  6. Composition, physicochemical properties and thermal inactivation kinetics of polyphenol oxidase and peroxidase from coconut (Cocos nucifera) water obtained from immature, mature and overly-mature coconut.

    PubMed

    Tan, Thuan-Chew; Cheng, Lai-Hoong; Bhat, Rajeev; Rusul, Gulam; Easa, Azhar Mat

    2014-01-01

    Composition, physicochemical properties and enzyme inactivation kinetics of coconut water were compared between immature (IMC), mature (MC) and overly-mature coconuts (OMC). Among the samples studied, pH, turbidity and mineral contents for OMC water was the highest, whereas water volume, titratable acidity, total soluble solids and total phenolics content for OMC water were the lowest. Maturity was found to affect sugar contents. Sucrose content was found to increase with maturity, and the reverse trend was observed for fructose and glucose. Enzyme activity assessment showed that polyphenol oxidase (PPO) in all samples was more heat resistant than peroxidase (POD). Compared to IMC and MC, PPO and POD from OMC water showed the lowest thermal resistance, with D83.3°C=243.9s (z=27.9°C), and D83.3°C=129.9s (z=19.5°C), respectively.

  7. Polyphenol oxidase activity from three sicilian artichoke [ Cynara cardunculus L. Var. scolymus L. (Fiori)] cultivars: studies and technological application on minimally processed production.

    PubMed

    Todaro, Aldo; Peluso, Orazio; Catalano, Anna Eghle; Mauromicale, Giovanni; Spagna, Giovanni

    2010-02-10

    Several papers helped with the development of more methods to control browning, or study thermal polyphenol oxidase (PPO) inactivation, but did not provide any solutions to technological process problems and food process improvement. Artichokes [ Cynara cardunculus L. var. scolymus L. (Fiori)] are susceptible to browning; this alteration could affect and reduce the suitability for its use, fresh or processed. Within this study, the catecholase and cresolase activities of PPO from three different Sicilian artichokes cultivar were characterized with regard to substrate specificity and enzyme kinetics, optimum pH and temperature, temperature and pH stability, and inhibitor test; all of the results were used for technological purposes, particularly to optimize minimally processed productions (ready-to-eat and cook-chilled artichokes).

  8. Selected biochemical properties of polyphenol oxidase in butter lettuce leaves (Lactuca sativa L. var. capitata) elicited with dl-β-amino-n-butyric acid.

    PubMed

    Złotek, Urszula; Gawlik-Dziki, Urszula

    2015-02-01

    The study concentrated on changes in certain biochemical parameters of polyphenol oxidase (PPO) from lettuce leaves caused by dl-β-amino-n-butyric acid (BABA) elicitation. PPO from control plants demonstrated the highest affinity toward catechol, whereas PPO from BABA-elicited lettuce showed the highest affinity to 4-methylcatechol. The optimum temperature for enzymes from control plants was 35°C, whereas from plants elicited with 1mM BABA this was 25°C. PPO from plants elicited with BABA was also more sensitive to the tested inhibitors than PPO from control plants. l-Cysteine was the most effective inhibitor. Native gel stained for PPO activity in control samples showed two isoforms. However, in BABA-treated lettuce three bands visualising PPO activity were observed. The information obtained in this study will be valuable for the development of treatment technology and storage conditions to control undesirable browning reactions in elicited lettuce. PMID:25172730

  9. Differences in the activity of superoxide dismutase, polyphenol oxidase and Cu-Zn content in the fruits of Gordal and Manzanilla olive varieties.

    PubMed

    Hornero-Méndez, Dámaso; Gallardo-Guerrero, Lourdes; Jarén-Galán, Manuel; Mínguez-Mosquera, María Isabel

    2002-01-01

    Activity of the enzymes superoxide dismutase (SOD) and polyphenol oxidase (PPO) as well as Cu-Zn content have been monitored during the thirteen weeks growth of both Gordal and Manzanilla olive variety fruits. These metalloenzymes, with Cu and Zn in the prostetic group, are involved in controlling the redox balance in the chloroplast environment. The results indicated that, under similar phenological and environmental conditions, there are periodic peaks of SOD activity in both varieties, followed by fluctuations in the copper content of the fruit. This was interpreted as a common and simultaneous response to situations of oxidative stress, and this response was more intense in the variety Gordal. The enzyme PPO showed an activity peak at start of growth and then practically disappeared. Thus, its activity cannot be correlated with situations of stress or with changes of Cu and Zn in the fruit. PMID:11926522

  10. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.

    PubMed

    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai

    2016-01-01

    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ⩽ 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. PMID:26213057

  11. Site-directed mutagenesis around the CuA site of a polyphenol oxidase from Coreopsis grandiflora (cgAUS1)

    PubMed Central

    Kaintz, Cornelia; Mayer, Rupert L.; Jirsa, Franz; Halbwirth, Heidi; Rompel, Annette

    2015-01-01

    Aurone synthase from Coreopsis grandiflora (cgAUS1), catalyzing conversion of butein to sulfuretin in a type-3 copper center, is a rare example of a polyphenol oxidase involved in anabolism. Site-directed mutagenesis around the CuA site of AUS1 was performed, and recombinant enzymes were analyzed by mass spectrometry. Replacement of the coordinating CuA histidines with alanine resulted in the presence of a single copper and loss of diphenolase activity. The thioether bridge-building cysteine and a phenylalanine over the CuA site, exchanged to alanine, have no influence on copper content but appear to play an important role in substrate binding. PMID:25697959

  12. Association mapping of grain hardness, polyphenol oxidase, total phenolics, amylose content, and ß-glucan in US barley breeding germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A renewed interest in breeding barley specifically for food end-uses is being driven by increased consumer interest in healthier foods. We conducted association mapping on physicochemical properties of barley that play a role in food quality and processing including, grain hardness, polyphenol oxid...

  13. Overexpression of NADH oxidase gene from Deinococcus geothermalis in Escherichia coli.

    PubMed

    Kazuya, Sase; Tomomi, Iwasaki; Hatsune, Karasaki; Masahide, Ishikawa

    2013-12-01

    When using stable enzyme genes from a thermophile to create a biosensor in Escherichia coli, it is vital that these genes be overexpressed in order to provide a sufficient supply of enzymes. In this study, overexpression of the NADH oxidase (Nox) gene from the thermophile Deinococcus geothermalis was successfully achieved with the aim of creating a stable biosensor active at room temperatures. To do so, modification of 10 nucleotides, GAAATTAACT, upstream of the start codon of the Nox gene was necessary.

  14. Impact of high pressure processing on color, bioactive compounds, polyphenol oxidase activity, and microbiological attributes of pumpkin purée.

    PubMed

    González-Cebrino, Francisco; Durán, Rocío; Delgado-Adámez, Jonathan; Contador, Rebeca; Bernabé, Rosario Ramírez

    2016-04-01

    Physicochemical parameters, bioactive compounds' content (carotenoids and total phenols), total antioxidant activity, and enzymatic activity of polyphenol oxidase (PPO) were evaluated after high pressure processing (HPP) on a pumpkin purée (cv. 'Butternut'). Three pressure levels (400, 500, and 600 MPa) were combined with three holding times (200, 400, and 600 s). The applied treatments reduced the levels of total aerobic mesophilic (TAM), total psychrophilic and psychrotrophic bacteria (TPP), and molds and yeasts (M&Y). All applied treatments did not affect enzymatic activity of PPO. Pressure level increased CIE L* values, which could enhance the lightness perception of high pressure (HP)-treated purées. No differences were found between the untreated and HP-treated purées regarding total phenols and carotenoids content (lutein, α-carotene, and β-carotene) and total antioxidant activity. HPP did not affect most quality parameters and maintained the levels of bioactive compounds. However, it did not achieve the complete inhibition of PPO, which could reduce the shelf-life of the pumpkin purée.

  15. Real-time evaluation of polyphenol oxidase (PPO) activity in lychee pericarp based on weighted combination of spectral data and image features as determined by fuzzy neural network.

    PubMed

    Yang, Yi-Chao; Sun, Da-Wen; Wang, Nan-Nan; Xie, Anguo

    2015-07-01

    A novel method of using hyperspectral imaging technique with the weighted combination of spectral data and image features by fuzzy neural network (FNN) was proposed for real-time prediction of polyphenol oxidase (PPO) activity in lychee pericarp. Lychee images were obtained by a hyperspectral reflectance imaging system operating in the range of 400-1000nm. A support vector machine-recursive feature elimination (SVM-RFE) algorithm was applied to eliminating variables with no or little information for the prediction from all bands, resulting in a reduced set of optimal wavelengths. Spectral information at the optimal wavelengths and image color features were then used respectively to develop calibration models for the prediction of PPO in pericarp during storage, and the results of two models were compared. In order to improve the prediction accuracy, a decision strategy was developed based on weighted combination of spectral data and image features, in which the weights were determined by FNN for a better estimation of PPO activity. The results showed that the combined decision model was the best among all of the calibration models, with high R(2) values of 0.9117 and 0.9072 and low RMSEs of 0.45% and 0.459% for calibration and prediction, respectively. These results demonstrate that the proposed weighted combined decision method has great potential for improving model performance. The proposed technique could be used for a better prediction of other internal and external quality attributes of fruits.

  16. 1-Methylcyclopropene interactions with diphenylamine on diphenylamine degradation, alpha-farnesene and conjugated trienol concentrations, and polyphenol oxidase and peroxidase activities in apple fruit.

    PubMed

    Apollo Arquiza, J M R; Hay, Anthony G; Nock, Jacqueline F; Watkins, Christopher B

    2005-09-21

    1-Methylcyclopropene (1-MCP) is a new technology that is applied commercially to inhibit ethylene action in apple fruit, but its interactions with existing technologies such as diphenylamine (DPA) for control of superficial scald development in fruit during and after storage is unknown. To investigate possible interactions between 1-MCP and DPA, Delicious apples were untreated or treated with 2 g L(-1) DPA, and then with or without 1 microL L(-1) 1-MCP. Ethylene production and respiration rates of fruit were measured immediately following treatment, and fruit was stored at 0.5 degrees C for 12 weeks. Internal ethylene concentrations (IEC), alpha-farnesene and conjugated trienol (CTol) concentrations, activities of peroxidase and polyphenol oxidase (PPO), and DPA levels in the skin of the fruit were measured at intervals during storage. 1-MCP reduced the rate of DPA loss from peel tissue so that by 12 weeks of storage concentrations of the chemical were 25% higher than in untreated fruit. 1-MCP, with and without DPA, markedly inhibited ethylene production and respiration rates, maintained low IEC and alpha-farnesene and CTol concentrations, while DPA had little effect on these factors except inhibition of CTol accumulation. Treatment effects on peroxidase and PPO activities were inconsistent.

  17. Polyphenol oxidase activity, color changes, and dehydration in table grape rachis during development and storage as affected by n-(2-chloro-4-pyridyl)-n-phenylurea.

    PubMed

    Carvajal-Millán, E; Carvallo, T; Orozco, J A; Martínez, M A; Tapia, I; Guerrero, V M; Rascón-Chu, A; Llamas, J; Gardea, A A

    2001-02-01

    Flame Seedless grapes were sprayed with N-(2-chloro-4-pyridyl)-N-phenylurea (CPPU) at 0, 2.5, and 5.0 ppm to develop rachis resistant to browning and dehydration. Rachis polyphenol oxidase (PPO) activity was determined during cluster development. Cluster components were weighed at commercial (CM), and physiological maturity (PM). PPO activity, rachis color changes (L and a), and cluster weight loss were evaluated at 0 degrees C for 8, 16, 32, and 56 days. CPPU-treated rachis had a decrease of 36% in PPO activity and a week delay in peak activity. At PM, dry weight of CPPU-treated rachis increased by 3 g. Postharvest rachis PPO activity declined with CPPU application, and color changes followed the same pattern for CM and PM. After 32 days of storage, L and a in lateral branches were significantly superior in CPPU treatments. Weight losses below 2.1% were significantly lowest in CPPU-treated clusters for 16 days of storage regardless of cluster maturity.

  18. Browning prevention by ascorbic acid and 4-hexylresorcinol: different mechanisms of action on polyphenol oxidase in the presence and in the absence of substrates.

    PubMed

    Arias, E; González, J; Peiró, J M; Oria, R; Lopez-Buesa, P

    2007-11-01

    We have investigated the mechanism of action of 4-hexylresorcinol (4-HR) and ascorbic acid (AA) on the polyphenol oxidase (PPO) catalyzed oxidation of phenolic substrates. Incubation of PPO with 4-HR diminishes strongly PPO activity. This effect can be erroneously interpreted, due to the high affinity of 4-HR for PPO, as irreversible inactivation of PPO. However, PPO activity can be recovered by dialysis after incubation with 4-HR. 4-hexylresorcinol is a canonical enzyme inhibitor that binds preferentially to the oxy form of PPO. It is a mixed-type inhibitor, because it influences both apparent V(max) (1.26 compared with 0.4 units in the absence and presence of 4-HR, respectively) and K(m) values (0.28 mM compared with 0.97 mM in the absence and in the presence of 4-HR, respectively) of PPO. AA can prevent browning by 2 different mechanisms: In the absence of PPO substrates it inactivates PPO irreversibly, probably through binding to its active site, preferentially in its oxy form. In the presence of PPO substrates, AA reduces PPO oxidized reaction products, which results in a lag phase when measuring PPO activity by monitoring dark product formation but not when monitoring O(2) consumption. The simultaneous use of both 4-HR and AA on PPO results in additive prevention of browning.

  19. Effect of thermal treatment on secondary structure and conformational change of mushroom polyphenol oxidase (PPO) as food quality related enzyme: A FTIR study.

    PubMed

    Baltacıoğlu, Hande; Bayındırlı, Alev; Severcan, Mete; Severcan, Feride

    2015-11-15

    In order to understand the conformational changes of polyphenol oxidase (PPO), which is a food quality related enzyme, after thermal treatment, secondary structure changes of the enzyme were analyzed by using Fourier Transform Infrared (FTIR) spectroscopy and compared with the change in enzyme activity in the temperature range of 25-80 °C. Fourier self-deconvolution, neural network (NN) and curve-fitting analysis were applied to the amide I band of FTIR spectra for detail analysis of secondary structure elements. FTIR analysis indicated that PPO is an α-helix dominating enzyme. Detail analysis revealed that, as temperature increased, α-helix and β-sheet decreased, but aggregated β-sheet, turns and random coil increased. The marked changes were noted at 40 °C with the occurrence of new bands due to aggregated β-sheet structures, all of which indicate protein denaturation. These aggregation bands were still observed when the temperature was reduced back to 25 °C, from 70 °C, demonstrating an irreversible change in the structure.

  20. The control of polyphenol oxidase activity in fruits and vegetables. A study of the interactions between the chemical compounds used and heat treatment.

    PubMed

    Almeida, M E; Nogueira, J N

    1995-04-01

    Objective of this research was to find alternative methods for the control of polyphenol oxidase (PPO) activity in fruits and vegetables with the purpose of reducing or eliminating the use of SO2 for this purpose. Interactions between the use of ascorbic acid, citric acid, EDTA, sodium metabisulphite and heat treatment (70 degrees C for 2 min) in the control of PPO activity were studied in avocado (var. Fortuna), banana (var. Nanica), apple (var. Ana, Fuji, Gala & Golden), pear (var. D'Agua), peach (var. Réal), potato (var. Bintje), eggplant (var. Super F100), mushroom (Agaricus bisporus) and hearts-of-palm (Euterpe edulis Mart). The results demonstrated that PPO of avocado and eggplant was most resistant to inhibition by the methods used. The least efficient method tested for the control of PPO was the addition of ascorbic acid and EDTA, while the most efficient methods investigated included the use of ascorbic acid, citric acid, sodium metabisulphite and heat treatment. The results indicated that, with the exception of PPO from avocado, the most adequate alternative method to substitute for the use of SO2 in the control of PPO was a combination of ascorbic acid, citric acid and heat treatment. PMID:7659702

  1. Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword

    PubMed Central

    Yang, Han-Yu; Chen, Carton W.

    2009-01-01

    Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC− strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere. PMID:19826489

  2. Enzyme characterisation, isolation and cDNA cloning of polyphenol oxidase in the hearts of palm of three commercially important species.

    PubMed

    Shimizu, Milton Massao; Melo, Geraldo Aclécio; Brombini Dos Santos, Adriana; Bottcher, Alexandra; Cesarino, Igor; Araújo, Pedro; Magalhães Silva Moura, Jullyana Cristina; Mazzafera, Paulo

    2011-09-01

    Heart of palm (palmito) is the edible part of the apical meristem of palms and is considered a gourmet vegetable. Palmitos from the palms Euterpe edulis (Juçara) and Euterpe oleracea (Açaí) oxidise after harvesting, whereas almost no oxidation is observed in palmitos from Bactris gasipaes (Pupunha). Previous investigations showed that oxidation in Juçara and Açaí was mainly attributable to polyphenol oxidase (PPO; EC 1.14.18.1) activity. In this study, we partially purified PPOs from these three palmitos and analysed them for SDS activation, substrate specificity, inhibition by specific inhibitors, thermal stability, optimum pH and temperature conditions, Km and Ki. In addition, the total phenolic content and chlorogenic acid content were determined. Two partial cDNA sequences were isolated and sequenced from Açaí (EoPPO1) and Juçara (EePPO1). Semi-quantitative RT-PCR expression assays showed that Açaí and Juçara PPOs were strongly expressed in palmitos and weakly expressed in leaves. No amplification was observed for Pupunha samples. The lack of oxidation in the palmito Pupunha might be explained by the low PPO expression, low enzyme activity or the phenolic profile, particularly the low content of chlorogenic acid. PMID:21530289

  3. Enzyme characterisation, isolation and cDNA cloning of polyphenol oxidase in the hearts of palm of three commercially important species.

    PubMed

    Shimizu, Milton Massao; Melo, Geraldo Aclécio; Brombini Dos Santos, Adriana; Bottcher, Alexandra; Cesarino, Igor; Araújo, Pedro; Magalhães Silva Moura, Jullyana Cristina; Mazzafera, Paulo

    2011-09-01

    Heart of palm (palmito) is the edible part of the apical meristem of palms and is considered a gourmet vegetable. Palmitos from the palms Euterpe edulis (Juçara) and Euterpe oleracea (Açaí) oxidise after harvesting, whereas almost no oxidation is observed in palmitos from Bactris gasipaes (Pupunha). Previous investigations showed that oxidation in Juçara and Açaí was mainly attributable to polyphenol oxidase (PPO; EC 1.14.18.1) activity. In this study, we partially purified PPOs from these three palmitos and analysed them for SDS activation, substrate specificity, inhibition by specific inhibitors, thermal stability, optimum pH and temperature conditions, Km and Ki. In addition, the total phenolic content and chlorogenic acid content were determined. Two partial cDNA sequences were isolated and sequenced from Açaí (EoPPO1) and Juçara (EePPO1). Semi-quantitative RT-PCR expression assays showed that Açaí and Juçara PPOs were strongly expressed in palmitos and weakly expressed in leaves. No amplification was observed for Pupunha samples. The lack of oxidation in the palmito Pupunha might be explained by the low PPO expression, low enzyme activity or the phenolic profile, particularly the low content of chlorogenic acid.

  4. Use of experimental design methodology to prepare Maillard reaction products from glucose and cysteine inhibitors of polyphenol oxidase from eggplant (Solanum melongena).

    PubMed

    Cheriot, Sophie C; Billaud, Catherine; Nicolas, Jacques

    2006-07-12

    Polyphenol oxidase (PPO) from eggplant was extracted and partially purified by a two-step fractionation-precipitation using ammonium sulfate and phenylsepharose hydrophobic interaction chromatography. The eggplant PPO extract was characterized concerning its kinetic properties. Optimal conditions to obtain Maillard reaction products (MRPs) with a maximal inhibitory potency (IP) toward PPO activity were determined using the surface response methodology and a four-factor and five-level experimental design. The MRPs were prepared from cysteine (0.25 M) and glucose (0-1 M), at several initial pH values (2-6) and at differing heating times (3-19 h) and temperatures (95-115 degrees C). The maximal IP was obtained after heating a model system of glucose/cysteine (1/0.25 M) at pH 2 for 3 h 20 min at 115 degrees C. The soluble part of this MRP, called MRP(IPmax), was a noncompetitive inhibitor toward eggplant PPO. The IP of MRP(IPmax) on PPO activity was very potent as compared to that displayed by benzoic, p-coumaric, and t-cinnamic acids, as well as sorbic acid and 4-hexylresorcinol. The activity of preincubated PPO at 0 degrees C with MRP(IPmax) was only slightly restored after dialysis or gel filtration.

  5. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity.

  6. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development.

  7. Sodium iron EDTA and ascorbic acid, but not polyphenol oxidase treatment, counteract the strong inhibitory effect of polyphenols from brown sorghum on the absorption of fortification iron in young women.

    PubMed

    Cercamondi, Colin I; Egli, Ines M; Zeder, Christophe; Hurrell, Richard F

    2014-02-01

    In addition to phytate, polyphenols (PP) might contribute to low Fe bioavailability from sorghum-based foods. To investigate the inhibitory effects of sorghum PP on Fe absorption and the potential enhancing effects of ascorbic acid (AA), NaFeEDTA and the PP oxidase enzyme laccase, we carried out three Fe absorption studies in fifty young women consuming dephytinised Fe-fortified test meals based on white and brown sorghum varieties with different PP concentrations. Fe absorption was measured as the incorporation of stable Fe isotopes into erythrocytes. In study 1, Fe absorption from meals with 17 mg PP (8·5%) was higher than that from meals with 73 mg PP (3·2%) and 167 mg PP (2·7%; P< 0·001). Fe absorption from meals containing 73 and 167 mg PP did not differ (P= 0·9). In study 2, Fe absorption from NaFeEDTA-fortified meals (167 mg PP) was higher than that from the same meals fortified with FeSO₄ (4·6 v. 2·7%; P< 0·001), but still it was lower than that from FeSO₄-fortified meals with 17 mg PP (10·7%; P< 0·001). In study 3, laccase treatment decreased the levels of PP from 167 to 42 mg, but it did not improve absorption compared with that from meals with 167 mg PP (4·8 v. 4·6%; P= 0·4), whereas adding AA increased absorption to 13·6% (P< 0·001). These findings suggest that PP from brown sorghum contribute to low Fe bioavailability from sorghum foods and that AA and, to a lesser extent, NaFeEDTA, but not laccase, have the potential to overcome the inhibitory effect of PP and improve Fe absorption from sorghum foods.

  8. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  9. Production and Characterization of a Monoclonal Antibody Raised Against Surface Antigens from Mycelium of Gaeumannomyces graminis var. tritici: Evidence for an Extracellular Polyphenol Oxidase.

    PubMed

    Thornton, C R; Dewey, F M; Gilligan, C A

    1997-01-01

    ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L

  10. QTL and candidate gene mapping for polyphenolic composition in apple fruit

    PubMed Central

    2012-01-01

    Background The polyphenolic products of the phenylpropanoid pathway, including proanthocyanidins, anthocyanins and flavonols, possess antioxidant properties that may provide health benefits. To investigate the genetic architecture of control of their biosynthesis in apple fruit, various polyphenolic compounds were quantified in progeny from a 'Royal Gala' × 'Braeburn' apple population segregating for antioxidant content, using ultra high performance liquid chromatography of extracts derived from fruit cortex and skin. Results Construction of genetic maps for 'Royal Gala' and 'Braeburn' enabled detection of 79 quantitative trait loci (QTL) for content of 17 fruit polyphenolic compounds. Seven QTL clusters were stable across two years of harvest and included QTLs for content of flavanols, flavonols, anthocyanins and hydroxycinnamic acids. Alignment of the parental genetic maps with the apple whole genome sequence in silico enabled screening for co-segregation with the QTLs of a range of candidate genes coding for enzymes in the polyphenolic biosynthetic pathway. This co-location was confirmed by genetic mapping of markers derived from the gene sequences. Leucoanthocyanidin reductase (LAR1) co-located with a QTL cluster for the fruit flavanols catechin, epicatechin, procyanidin dimer and five unknown procyanidin oligomers identified near the top of linkage group (LG) 16, while hydroxy cinnamate/quinate transferase (HCT/HQT) co-located with a QTL for chlorogenic acid concentration mapping near the bottom of LG 17. Conclusion We conclude that LAR1 and HCT/HQT are likely to influence the concentration of these compounds in apple fruit and provide useful allele-specific markers for marker assisted selection of trees bearing fruit with healthy attributes. PMID:22269060

  11. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities.

    PubMed

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-06-15

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1-4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Po(lpo)) and aldehyde oxidase-1 (Aldox-1(n1)) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Po(lpo)-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Po(lpo) allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1(n1) phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays.

  12. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-01-01

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1–4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  13. Variation of the Phytochemical Constituents and Antioxidant Activities of Zingiber officinale var. rubrum Theilade Associated with Different Drying Methods and Polyphenol Oxidase Activity.

    PubMed

    Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah

    2016-06-17

    The effects of different drying methods (freeze drying, vacuum oven drying, and shade drying) on the phytochemical constituents associated with the antioxidant activities of Z. officinale var. rubrum Theilade were evaluated to determine the optimal drying process for these rhizomes. Total flavonoid content (TFC), total phenolic content (TPC), and polyphenol oxidase (PPO) activity were measured using the spectrophotometric method. Individual phenolic acids and flavonoids, 6- and 8-gingerol and shogaol were identified by ultra-high performance liquid chromatography method. Ferric reducing antioxidant potential (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays were used for the evaluation of antioxidant activities. The highest reduction in moisture content was observed after freeze drying (82.97%), followed by vacuum oven drying (80.43%) and shade drying (72.65%). The highest TPC, TFC, and 6- and 8-shogaol contents were observed in samples dried by the vacuum oven drying method compared to other drying methods. The highest content of 6- and 8-gingerol was observed after freeze drying, followed by vacuum oven drying and shade drying methods. Fresh samples had the highest PPO activity and lowest content of flavonoid and phenolic acid compounds compared to dried samples. Rhizomes dried by the vacuum oven drying method represent the highest DPPH (52.9%) and FRAP activities (566.5 μM of Fe (II)/g DM), followed by freeze drying (48.3% and 527.1 μM of Fe (II)/g DM, respectively) and shade drying methods (37.64% and 471.8 μM of Fe (II)/g DM, respectively) with IC50 values of 27.2, 29.1, and 34.8 μg/mL, respectively. Negative and significant correlations were observed between PPO and antioxidant activity of rhizomes. Vacuum oven dried rhizomes can be utilized as an ingredient for the development of value-added food products as they contain high contents of phytochemicals with valuable antioxidant potential.

  14. Consistency of polyphenol oxidase (PPO) thermostability in ripening apricots (Prunus armeniaca L.): evidence for the presence of thermostable PPO forming and destabilizing mechanisms in apricots.

    PubMed

    Yemenicioğlu, Ahmet; Cemeroğlu, Bekir

    2003-04-01

    Destabilization of thermostable polyphenol oxidase (TS-PPO) during the ripening of peaches has been previously shown (Yemenicioğlu, A.; Cemeroğlu, B. Tr. J. Agric. For. 1998, 22, 261-265). This work studied the effect of ripening on thermal stability of apricot PPO for three different cultivars. Kabaaşi cultivar contained thermolabile PPO, whereas TS-PPO appeared in Hacihaliloğlu and Cataloğlu cultivars. The TS-PPO showed biphasic inactivation curves, and its D and z values between 60 and 90 degrees C varied in the ranges of 357-1.12 min and 11.9-12.7 degrees C, respectively. In Hacihaliloğlu cultivar the TS-PPO was very consistent and existed at all stages of ripening, whereas in Cataloğlu cultivar it appeared only at the half-ripe stage. The loss of consistent TS-PPO in Hacihaliloğlu apricots after partial purification by acetone precipitation and DEAE-cellulose chromatography suggested the non-covalent nature of its stabilization. The main purified fractions (F1 and F2) showed monophasic inactivation curves with similar thermal inactivation parameters (z(F1) = 10.4 degrees C, z(F2) = 10.1 degrees C). However, their kinetic properties against catechol (K(mF1) = 61 mM, K(mF2) = 122.7 mM) and substrate specificities were considerably different. The results of this study showed the presence of TS-PPO forming and destabilizing mechanisms in apricots. Further studies are needed for the solution of these mechanisms and to develop some new strategies that may be utilized by molecular techniques for a planned production of apricot cultivars provided with heat labile but normal PPO activity.

  15. Cloning and Characterization of Red Clover Polyphenol Oxidase cDNAs and Expression of Active Protein in Escherichia coli and Transgenic Alfalfa1[w

    PubMed Central

    Sullivan, Michael L.; Hatfield, Ronald D.; Thoma, Sharon L.; Samac, Deborah A.

    2004-01-01

    Red clover (Trifolium pratense) leaves contain high levels of polyphenol oxidase (PPO) activity and o-diphenol substrates. Wounding of leaves during harvest and ensiling results in browning of leaf tissues from activity of PPO on the o-diphenols. In association with browning, leaf proteins remain undegraded during ensiling, presumably due to PPO-generated o-quinone inhibition of leaf proteases. We cloned three red clover PPO cDNAs, PPO1, PPO2, and PPO3, from a leaf cDNA library. Sequence comparisons among the three red clover PPO clones indicated they are 87% to 90% identical at the nucleotide level (80%–83% amino acid identity). All three encode proteins predicted to localize to the chloroplast thylakoid lumen. RNA-blotting and immunoblotting experiments indicated PPO1 is expressed primarily in young leaves, PPO2 in flowers and petioles, and PPO3 in leaves and possibly flowers. We expressed mature PPO1 in Escherichia coli. A portion of the expressed protein was soluble and functional in an assay for PPO activity. We also expressed the red clover PPO cDNAs under the control of a constitutive promoter in alfalfa (Medicago sativa). The expressed red clover PPO proteins were active in alfalfa extracts as evidenced by o-diphenol-dependant extract browning and quantitative assays of PPO activity. Proteolysis in leaf extracts of alfalfa expressing red clover PPO1 was dramatically reduced in the presence of an o-diphenol compared to controls. Transgenic alfalfa expressing red clover PPO should prove an excellent model system to further characterize the red clover PPO enzymes and PPO-mediated inhibition of postharvest proteolysis in forage plants. PMID:15466227

  16. Removal of naphthols and analogues by the combined use of an oxidoreductase polyphenol oxidase and a biopolymer chitosan from aqueous solutions.

    PubMed

    Kimura, Yuji; Gotoh, Asahi; Shinozaki, Fumiyoshi; Kashiwada, Ayumi; Yamada, Kazunori

    2014-01-01

    In this study, the combined use of an amino group-containing polymer chitosan and an oxidoreductase polyphenol oxidase (PPO) was applied to the removal of naphthols and dihydroxynaphthalenes (DHNs) from aqueous solutions. The process parameters, such as the pH value, temperature and enzyme dose, were discussed for PPO-catalysed oxidation of 1-naphthol. The optimum conditions of enzymatic oxidation of 1-naphthol were determined to be pH 8.0 and 40 °C. Under the optimum conditions, PPO-catalysed oxidation of 1-naphthol increased with an increase in the enzyme dose. Quinone derivatives enzymatically generated were chemisorbed on chitosan beads and the initial velocity of PPO-catalysed oxidation increased with an increase in the amount of added chitosan beads. A specific initial velocity of 0.0675 μmol/U·min was obtained in the PPO concentration range below 200 U/cm³ and 1-naphthol was completely removed within 24 h by quinone adsorption on chitosan beads (0.20 cm³/cm³) at a PPO concentration of 100 U/cm³. The removal time was shortened by increasing the enzyme dose or the amount of added chitosan beads. 2-Naphthol was also completely removed at an initial concentration of 0.05 mM or less by prolonging the reaction time, since PPO-catalysed oxidation of 2-naphthol was much slower than that of 1-naphthol. In addition, this procedure was also applied to the removal of DHNs. These results revealed that the procedure constructed in this study was an effective technique to remove naphthols and DHNs from the aqueous medium.

  17. Binding geometry, stoichiometry, and thermodynamics of cyclomalto-oligosaccharide (cyclodextrin) inclusion complex formation with chlorogenic acid, the major substrate of apple polyphenol oxidase.

    PubMed

    Irwin, P L; Pfeffer, P E; Doner, L W; Sapers, G M; Brewster, J D; Nagahashi, G; Hicks, K B

    1994-03-18

    The inclusion complexes of cyclomaltohexaose (alpha-CD), cyclomaltoheptaose (beta-CD), cyclomaltooctaose (gamma-CD), and polymerized beta-CD (beta-CDn) with chlorogenic acid (CA), the major substrate of apple fruit polyphenol oxidase (PPO), were studied with regard to pH, ionic strength, and temperature in model buffer systems and apple juice. The thermodynamics of CD.CA inclusion complex formation, which were studied in solution using UV spectrophotometry, displayed enthalpy-entropy compensation typical of processes driven by solvation phenomena. We also found that the apparent association constants (K) of the CD.CA equilibrium were relatively insensitive to pH for beta-CD, compared to alpha- and gamma-CDs, but were subject to substantial enhancement at low ionic strengths. The beta-CD.CA inclusion complex was also characterized for binding geometry and stoichiometry at 9.4 T and 25 degrees C in 0.05 M Na phosphate buffer by 1H NMR spectroscopy. A 1:1 stoichiometric ratio for the complex was found using the method of continuous variations. 1H Spin-lattice relaxation and chemical-shift data indicate that the phenolic ring of CA docks within the cavity of beta-CD. The Ks for beta-, alpha-, and gamma-CD determined in apple juice, which contains a mixture of PPO substrates, were found to correlate with PPO activity-related data. Apple juice, treated with beta-CDn, did not brown until CA was added back. These latter findings strongly argue that the mechanism for inhibition of juice browning with cyclodextrins was mainly due to the binding of PPO substrates and not some other means such as enzyme inactivation via sequestration of Cu2+ by CDs. PMID:8194069

  18. Structure and evolution of vertebrate aldehyde oxidases: from gene duplication to gene suppression.

    PubMed

    Kurosaki, Mami; Bolis, Marco; Fratelli, Maddalena; Barzago, Maria Monica; Pattini, Linda; Perretta, Gemma; Terao, Mineko; Garattini, Enrico

    2013-05-01

    Aldehyde oxidases (AOXs) and xanthine dehydrogenases (XDHs) belong to the family of molybdo-flavoenzymes. Although AOXs are not identifiable in fungi, these enzymes are represented in certain protists and the majority of plants and vertebrates. The physiological functions and substrates of AOXs are unknown. Nevertheless, AOXs are major drug metabolizing enzymes, oxidizing a wide range of aromatic aldehydes and heterocyclic compounds of medical/toxicological importance. Using genome sequencing data, we predict the structures of AOX genes and pseudogenes, reconstructing their evolution. Fishes are the most primitive organisms with an AOX gene (AOXα), originating from the duplication of an ancestral XDH. Further evolution of fishes resulted in the duplication of AOXα into AOXβ and successive pseudogenization of AOXα. AOXβ is maintained in amphibians and it is the likely precursors of reptilian, avian, and mammalian AOX1. Amphibian AOXγ is a duplication of AOXβ and the likely ancestor of reptilian and avian AOX2, which, in turn, gave rise to mammalian AOX3L1. Subsequent gene duplications generated the two mammalian genes, AOX3 and AOX4. The evolution of mammalian AOX genes is dominated by pseudogenization and deletion events. Our analysis is relevant from a structural point of view, as it provides information on the residues characterizing the three domains of each mammalian AOX isoenzyme. We cloned the cDNAs encoding the AOX proteins of guinea pig and cynomolgus monkeys, two unique species as to the evolution of this enzyme family. We identify chimeric RNAs from the human AOX3 and AOX3L1 pseudogenes with potential to encode a novel microRNA.

  19. Polyphenols from Chilean Propolis and Pinocembrin Reduce MMP-9 Gene Expression and Activity in Activated Macrophages

    PubMed Central

    Saavedra, Nicolás; Cuevas, Alejandro; Cavalcante, Marcela F.; Dörr, Felipe A.; Saavedra, Kathleen; Zambrano, Tomás; Abdalla, Dulcineia S. P.; Salazar, Luis A.

    2016-01-01

    Polyphenols from diverse sources have shown anti-inflammatory activity. In the context of atherosclerosis, macrophages play important roles including matrix metalloproteinases synthesis involved in degradation of matrix extracellular components affecting the atherosclerotic plaque stability. We prepared a propolis extract and pinocembrin in ethanol solution. Propolis extract was chemically characterized using LC-MS. The effect of treatments on gene expression and proteolytic activity was measured in vitro using murine macrophages activated with LPS. Cellular toxicity associated with both treatments and the vehicle was determined using MTT and apoptosis/necrosis detection assays. MMP-9 gene expression and proteolytic activity were measured using qPCR and zymography, respectively. Thirty-two compounds were identified in the propolis extract, including pinocembrin among its major components. Treatment with either ethanolic extract of propolis or pinocembrin inhibits MMP-9 gene expression in a dose-dependent manner. Similarly, an inhibitory effect was observed in proteolytic activity. However, the effect showed by ethanolic extract of propolis was higher than the effect of pinocembrin, suggesting that MMP-9 inhibition results from a joint contribution between the components of the extract. These data suggest a potential role of polyphenols from Chilean propolis in the control of extracellular matrix degradation in atherosclerotic plaques. PMID:27119082

  20. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  1. Polyphenol-rich black chokeberry (Aronia melanocarpa) extract regulates the expression of genes critical for intestinal cholesterol flux in Caco-2 cells.

    PubMed

    Kim, Bohkyung; Park, Youngki; Wegner, Casey J; Bolling, Bradley W; Lee, Jiyoung

    2013-09-01

    Black chokeberry (Aronia melanocarpa) is a rich source of polyphenols. The hypolipidemic effects of polyphenol-rich black chokeberry extract (CBE) have been reported, but underlying mechanisms have not been well characterized. We investigated the effect of CBE on the expression of genes involved in intestinal lipid metabolism. Caco-2 cells were incubated with 50 or 100 μg/ml of CBE for 24 h for quantitative realtime polymerase chain reaction analysis. Expression of genes for cholesterol synthesis (3-hydroxy-3-methylglutaryl coenzyme A reductase and sterol regulatory element binding protein 2), apical cholesterol uptake (Niemann-Pick C1 Like 1 and scavenger receptor class B Type 1) and basolateral cholesterol efflux [ATP-binding cassette transporter A1 (ABCA1)] was significantly decreased by CBE compared with control. Western blot analysis confirmed that CBE inhibited expression of these proteins. In contrast, CBE markedly induced mRNA and/or protein levels of ABCG5 and ABCG8 that mediate apical cholesterol efflux to the intestinal lumen. Furthermore, CBE significantly increased mRNA and protein levels of low-density lipoprotein (LDL) receptor, and cellular LDL uptake. Expression of genes involved in lipid metabolism and lipoprotein assembly, including sterol regulatory element-binding protein 1c, fatty acid synthase and acyl-CoA oxidase 1, was significantly decreased by CBE in a dose-dependent manner. Concomitantly, CBE significantly increased sirtuin 1, 3 and 5 mRNA levels, while it decreased SIRT-2. Our data suggest that hypolipidemic effects of CBE may be attributed, at least in part, to increased apical efflux of LDL-derived cholesterol and to decreased chylomicron formation in the intestine; and specific isoforms of SIRT may play an important role in this process.

  2. The effect of high polyphenol oxidase grass silage on metabolism of polyunsaturated fatty acids and nitrogen across the rumen of beef steers.

    PubMed

    Lee, M R F; Theobald, V J; Gordon, N; Leyland, M; Tweed, J K S; Fychan, R; Scollan, N D

    2014-11-01

    Polyphenol oxidase (PPO) activity in red clover (Trifolium pratense) has been reported to reduce both proteolysis and lipolysis, resulting in greater N use efficiency and protection of PUFA across the rumen. Although high levels of PPO have been reported in grasses such as cocksfoot (orchard grass; Dactylis glomerata), no in vivo research has determined whether grass PPO elicits the same response as red clover PPO. To test the hypothesis that silage ensiled from grass with high levels of PPO protects N and PUFA across the rumen, 6 steers with ruminal and duodenal cannulas were offered cocksfoot silage (CO; high-PPO grass), perennial ryegrass silage (PR; Lolium perenne; low-PPO grass), or red clover silage (RC; high-PPO control) at 16 g DM/kg BW daily with the experiment consisting of two 3 × 3 Latin squares with 21-d periods, consisting of 12 d of diet adaptation, 6 d of duodenal marker infusion, 2 d of duodenal sampling, and 1 d of ruminal sampling. All silages were well preserved, with DM of 34.4, 55.3, and 45.4% for CO, PR, and RC. Activity of PPO in silages was low due to deactivation but was greater in CO than either PR or RC (0.15 vs. 0.05 and 0.08 μkatal/g DM). Protein-bound phenol (mg/g DM) as a measure of the degree of oxidation and an indication of PPO protection was greatest for RC (15.9) but comparable for PR (10.1) and CO (12.2). Biohydrogenation of C18 PUFA was significantly lower on RC compared to the 2 grass silages with CO greater than PR. Despite lower levels of total fatty acid intake and subsequent duodenal flow, CO resulted in greater levels of phytanic acid and total branched and odd chain fatty acids in duodenal digesta than RC or PR. Ruminal ammonia concentration was greatest for RC, with no difference between the grasses. Duodenal flow of microbial N and efficiency of microbial protein synthesis were lowest for CO and comparable for RC and PR. The CO (high-grass PPO) did not result in elevated levels of C18 PUFA escaping the rumen or

  3. The effect of high polyphenol oxidase grass silage on metabolism of polyunsaturated fatty acids and nitrogen across the rumen of beef steers.

    PubMed

    Lee, M R F; Theobald, V J; Gordon, N; Leyland, M; Tweed, J K S; Fychan, R; Scollan, N D

    2014-11-01

    Polyphenol oxidase (PPO) activity in red clover (Trifolium pratense) has been reported to reduce both proteolysis and lipolysis, resulting in greater N use efficiency and protection of PUFA across the rumen. Although high levels of PPO have been reported in grasses such as cocksfoot (orchard grass; Dactylis glomerata), no in vivo research has determined whether grass PPO elicits the same response as red clover PPO. To test the hypothesis that silage ensiled from grass with high levels of PPO protects N and PUFA across the rumen, 6 steers with ruminal and duodenal cannulas were offered cocksfoot silage (CO; high-PPO grass), perennial ryegrass silage (PR; Lolium perenne; low-PPO grass), or red clover silage (RC; high-PPO control) at 16 g DM/kg BW daily with the experiment consisting of two 3 × 3 Latin squares with 21-d periods, consisting of 12 d of diet adaptation, 6 d of duodenal marker infusion, 2 d of duodenal sampling, and 1 d of ruminal sampling. All silages were well preserved, with DM of 34.4, 55.3, and 45.4% for CO, PR, and RC. Activity of PPO in silages was low due to deactivation but was greater in CO than either PR or RC (0.15 vs. 0.05 and 0.08 μkatal/g DM). Protein-bound phenol (mg/g DM) as a measure of the degree of oxidation and an indication of PPO protection was greatest for RC (15.9) but comparable for PR (10.1) and CO (12.2). Biohydrogenation of C18 PUFA was significantly lower on RC compared to the 2 grass silages with CO greater than PR. Despite lower levels of total fatty acid intake and subsequent duodenal flow, CO resulted in greater levels of phytanic acid and total branched and odd chain fatty acids in duodenal digesta than RC or PR. Ruminal ammonia concentration was greatest for RC, with no difference between the grasses. Duodenal flow of microbial N and efficiency of microbial protein synthesis were lowest for CO and comparable for RC and PR. The CO (high-grass PPO) did not result in elevated levels of C18 PUFA escaping the rumen or

  4. Variation of the Phytochemical Constituents and Antioxidant Activities of Zingiber officinale var. rubrum Theilade Associated with Different Drying Methods and Polyphenol Oxidase Activity.

    PubMed

    Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah

    2016-01-01

    The effects of different drying methods (freeze drying, vacuum oven drying, and shade drying) on the phytochemical constituents associated with the antioxidant activities of Z. officinale var. rubrum Theilade were evaluated to determine the optimal drying process for these rhizomes. Total flavonoid content (TFC), total phenolic content (TPC), and polyphenol oxidase (PPO) activity were measured using the spectrophotometric method. Individual phenolic acids and flavonoids, 6- and 8-gingerol and shogaol were identified by ultra-high performance liquid chromatography method. Ferric reducing antioxidant potential (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays were used for the evaluation of antioxidant activities. The highest reduction in moisture content was observed after freeze drying (82.97%), followed by vacuum oven drying (80.43%) and shade drying (72.65%). The highest TPC, TFC, and 6- and 8-shogaol contents were observed in samples dried by the vacuum oven drying method compared to other drying methods. The highest content of 6- and 8-gingerol was observed after freeze drying, followed by vacuum oven drying and shade drying methods. Fresh samples had the highest PPO activity and lowest content of flavonoid and phenolic acid compounds compared to dried samples. Rhizomes dried by the vacuum oven drying method represent the highest DPPH (52.9%) and FRAP activities (566.5 μM of Fe (II)/g DM), followed by freeze drying (48.3% and 527.1 μM of Fe (II)/g DM, respectively) and shade drying methods (37.64% and 471.8 μM of Fe (II)/g DM, respectively) with IC50 values of 27.2, 29.1, and 34.8 μg/mL, respectively. Negative and significant correlations were observed between PPO and antioxidant activity of rhizomes. Vacuum oven dried rhizomes can be utilized as an ingredient for the development of value-added food products as they contain high contents of phytochemicals with valuable antioxidant potential. PMID:27322227

  5. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  6. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  7. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  8. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.

    PubMed

    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen

    2012-10-01

    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  9. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple

    PubMed Central

    Verdu, Cindy F.; Guyot, Sylvain; Childebrand, Nicolas; Bahut, Muriel; Celton, Jean-Marc; Gaillard, Sylvain; Lasserre-Zuber, Pauline; Troggio, Michela; Guilet, David; Laurens, François

    2014-01-01

    Polyphenols have favorable antioxidant potential on human health suggesting that their high content is responsible for the beneficial effects of apple consumption. They control the quality of ciders as they predominantly account for astringency, bitterness, color and aroma. In this study, we identified QTLs controlling phenolic compound concentrations and the average polymerization degree of flavanols in a cider apple progeny. Thirty-two compounds belonging to five groups of phenolic compounds were identified and quantified by reversed phase liquid chromatography on both fruit extract and juice, over three years. The average polymerization degree of flavanols was estimated in fruit by phloroglucinolysis coupled to HPLC. Parental maps were built using SSR and SNP markers and used for the QTL analysis. Sixty-nine and 72 QTLs were detected on 14 and 11 linkage groups of the female and male maps, respectively. A majority of the QTLs identified in this study are specific to this population, while others are consistent with previous studies. This study presents for the first time in apple, QTLs for the mean polymerization degree of procyanidins, for which the mechanisms involved remains unknown to this day. Identification of candidate genes underlying major QTLs was then performed in silico and permitted the identification of 18 enzymes of the polyphenol pathway and six transcription factors involved in the apple anthocyanin regulation. New markers were designed from sequences of the most interesting candidate genes in order to confirm their co-localization with underlying QTLs by genetic mapping. Finally, the potential use of these QTLs in breeding programs is discussed. PMID:25271925

  10. QTL analysis and candidate gene mapping for the polyphenol content in cider apple.

    PubMed

    Verdu, Cindy F; Guyot, Sylvain; Childebrand, Nicolas; Bahut, Muriel; Celton, Jean-Marc; Gaillard, Sylvain; Lasserre-Zuber, Pauline; Troggio, Michela; Guilet, David; Laurens, François

    2014-01-01

    Polyphenols have favorable antioxidant potential on human health suggesting that their high content is responsible for the beneficial effects of apple consumption. They control the quality of ciders as they predominantly account for astringency, bitterness, color and aroma. In this study, we identified QTLs controlling phenolic compound concentrations and the average polymerization degree of flavanols in a cider apple progeny. Thirty-two compounds belonging to five groups of phenolic compounds were identified and quantified by reversed phase liquid chromatography on both fruit extract and juice, over three years. The average polymerization degree of flavanols was estimated in fruit by phloroglucinolysis coupled to HPLC. Parental maps were built using SSR and SNP markers and used for the QTL analysis. Sixty-nine and 72 QTLs were detected on 14 and 11 linkage groups of the female and male maps, respectively. A majority of the QTLs identified in this study are specific to this population, while others are consistent with previous studies. This study presents for the first time in apple, QTLs for the mean polymerization degree of procyanidins, for which the mechanisms involved remains unknown to this day. Identification of candidate genes underlying major QTLs was then performed in silico and permitted the identification of 18 enzymes of the polyphenol pathway and six transcription factors involved in the apple anthocyanin regulation. New markers were designed from sequences of the most interesting candidate genes in order to confirm their co-localization with underlying QTLs by genetic mapping. Finally, the potential use of these QTLs in breeding programs is discussed. PMID:25271925

  11. Phylogenetic positions of insectivora in eutheria inferred from mitochondrial cytochrome c oxidase subunit II gene.

    PubMed

    Onuma, M; Kusakabe, T; Kusakabe, S

    1998-02-01

    For the elucidation of the phylogenetic position of insectivora in eutheria, we have sequenced the cytochrome c oxidase subunit II (COII) gene of mitochondria for three insectivoran species [musk screw (Suncus murinus), shrew mole (Urotrichus talpoides), Japanese mole (Mogera wogura)] and analyzed these amino acid sequences with neighbor-joining (NJ) method and maximum likelihood (ML) method. NJ analysis shows polyphyly of Insectivora and Chiroptera. Assuming that each of Primates, Ferungulata, Chiroptera, Insectivora and Rodentia is a monophyletic group, ML analysis suggests that Chiroptera is a sister group of Insectivora and that Ferungulata is the closest outgroup to the (Insectivora and Chiroptera) clade.

  12. Green Tea Polyphenols Reduce Body Weight in Rats by Modulating Obesity-Related Genes

    PubMed Central

    Lu, Chuanwen; Zhu, Wenbin; Shen, Chwan-Li; Gao, Weimin

    2012-01-01

    Beneficial effects of green tea polyphenols (GTP) against obesity have been reported, however, the mechanism of this protection is not clear. Therefore, the objective of this study was to identify GTP-targeted genes in obesity using the high-fat-diet-induced obese rat model. A total of three groups (n = 12/group) of Sprague Dawley (SD) female rats were tested, including the control group (rats fed with low-fat diet), the HF group (rats fed with high-fat diet), and the HF+GTP group (rats fed with high-fat diet and GTP in drinking water). The HF group increased body weight as compared to the control group. Supplementation of GTP in the drinking water in the HF+GTP group reduced body weight as compared to the HF group. RNA from liver samples was extracted for gene expression analysis. A total of eighty-four genes related to obesity were analyzed using PCR array. Compared to the rats in the control group, the rats in the HF group had the expression levels of 12 genes with significant changes, including 3 orexigenic genes (Agrp, Ghrl, and Nr3c1); 7 anorectic genes (Apoa4, Cntf, Ghr, IL-1β, Ins1, Lepr, and Sort); and 2 genes that relate to energy expenditure (Adcyap1r1 and Adrb1). Intriguingly, the HF+GTP group restored the expression levels of these genes in the high-fat-induced obese rats. The protein expression levels of IL-1β and IL-6 in the serum samples from the control, HF, and HF+GTP groups confirmed the results of gene expression. Furthermore, the protein expression levels of superoxide dismutase-1 (SOD1) and catechol-O-methyltransferase (COMT) also showed GTP-regulated protective changes in this obese rat model. Collectively, this study revealed the beneficial effects of GTP on body weight via regulating obesity-related genes, anti-inflammation, anti-oxidant capacity, and estrogen-related actions in high-fat-induced obese rats. PMID:22715380

  13. Green tea polyphenols reduce body weight in rats by modulating obesity-related genes.

    PubMed

    Lu, Chuanwen; Zhu, Wenbin; Shen, Chwan-Li; Gao, Weimin

    2012-01-01

    Beneficial effects of green tea polyphenols (GTP) against obesity have been reported, however, the mechanism of this protection is not clear. Therefore, the objective of this study was to identify GTP-targeted genes in obesity using the high-fat-diet-induced obese rat model. A total of three groups (n = 12/group) of Sprague Dawley (SD) female rats were tested, including the control group (rats fed with low-fat diet), the HF group (rats fed with high-fat diet), and the HF+GTP group (rats fed with high-fat diet and GTP in drinking water). The HF group increased body weight as compared to the control group. Supplementation of GTP in the drinking water in the HF+GTP group reduced body weight as compared to the HF group. RNA from liver samples was extracted for gene expression analysis. A total of eighty-four genes related to obesity were analyzed using PCR array. Compared to the rats in the control group, the rats in the HF group had the expression levels of 12 genes with significant changes, including 3 orexigenic genes (Agrp, Ghrl, and Nr3c1); 7 anorectic genes (Apoa4, Cntf, Ghr, IL-1β, Ins1, Lepr, and Sort); and 2 genes that relate to energy expenditure (Adcyap1r1 and Adrb1). Intriguingly, the HF+GTP group restored the expression levels of these genes in the high-fat-induced obese rats. The protein expression levels of IL-1β and IL-6 in the serum samples from the control, HF, and HF+GTP groups confirmed the results of gene expression. Furthermore, the protein expression levels of superoxide dismutase-1 (SOD1) and catechol-O-methyltransferase (COMT) also showed GTP-regulated protective changes in this obese rat model. Collectively, this study revealed the beneficial effects of GTP on body weight via regulating obesity-related genes, anti-inflammation, anti-oxidant capacity, and estrogen-related actions in high-fat-induced obese rats.

  14. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions.

  15. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies.

    PubMed

    Lunt, D H; Zhang, D X; Szymura, J M; Hewitt, G M

    1996-08-01

    Insect mitochondrial cytochrome oxidase I (COI) genes are used as a model to examine the within-gene heterogeneity of evolutionary rate and its implications for evolutionary analyses. The complete sequence (1537 bp) of the meadow grasshopper (Chorthippus parallelus) COI gene has been determined, and compared with eight other insect COI genes at both the DNA and amino acid sequence levels. This reveals that different regions evolve at different rates, and the patterns of sequence variability seems associated with functional constraints on the protein. The COOH-terminal was found to be significantly more variable than internal loops (I), external loops (E), transmembrane helices (M) or the NH2 terminal. The central region of COI (M5-M8) has lower levels of sequence variability, which is related to several important functional domains in this region. Highly conserved primers which amplify regions of different variabilities have been designed to cover the entire insect COI gene. These primers have been shown to amplify COI in a wide range of species, representing all the major insect groups; some even in an arachnid. Implications of the observed evolutionary pattern for phylogenetic analysis are discussed, with particular regard to the choice of regions of suitable variability for specific phylogenetic projects.

  16. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  18. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression.

  19. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression. PMID:24594397

  20. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings.

    PubMed

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-07-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-alpha1, -alpha2, -gamma1, and -delta, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-gamma1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-gamma 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PA(PLD) signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity.

  1. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  2. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  3. Phylogenetic relationships among onychophora from Australasia inferred from the mitochondrial cytochrome oxidase subunit I gene.

    PubMed

    Gleeson, D M; Rowell, D M; Tait, N N; Briscoe, D A; Higgins, A V

    1998-10-01

    Nucleotide sequence variation in a region of the mitochondrial cytochrome oxidase subunit I (COI) gene (456 bp) was examined for 26 onychophorans representing 15 genera of the family Peripatopsidae from Australasia. Sequence analysis revealed high intergeneric COI sequence divergence (up to 20.6% corrected) but low amino acid substitution rates, with high levels of transitional saturation evident. Among unambiguously alignable sequences, parsimony and distance analyses revealed a broadly congruent tree topology, robust to various algorithms and statistical analysis. There are two major groupings. One, largely unresolved, consists entirely of Australian mainland taxa. The other, for which there is convincing support, includes all of the New Zealand and Tasmanian taxa together with one mainland Australian species. In respect of the two major groupings, this topology is consistent with previous morphologically based phylogenies and provides further evidence for an ancient radiation within the mainland Australian Onychophora. The biogeographic implications of the close affinities revealed between the Tasmanian and New Zealand taxa are discussed.

  4. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  5. Collection of mitochondrial cytochrome oxidase I gene sequences from Rhipicephalus ticks from various geographic locations around the world

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the origin of the cattle tick, Rhipicephalus microplus, will be helpful to the effort to find biological control agents. Molecular phylogenetics can assist in this determination. Thus, we sequenced and assembled partial gene sequences from the mitochondrial cytochrome oxidase I coding r...

  6. Changes in polyphenols and expression levels of related genes in 'Duke' blueberries stored under high CO2 levels.

    PubMed

    Harb, Jamil; Saleh, Omar; Kittemann, Dominikus; Neuwald, Daniel Alexandre; Hoffmann, Thomas; Reski, Ralf; Schwab, Wilfried

    2014-07-30

    Blueberries are highly perishable fruits, and consequently, storage under high CO2 and low O2 levels is recommended to preserve the highly appreciated polyphenols. However, high CO2 levels might be detrimental for certain cultivars. The aim of this study was to investigate the impact of storage conditions on various quality parameters, including polyphenol composition in 'Duke' berries. Results show that storage under 18 kPa CO2, coupled with 3 kPa O2, resulted in accelerated softening of berries, which was accompanied by lower levels compared to other conditions of hexosides and arabinosides of malvidin, petunidin, cyanidine, and delphinidin. However, this storage condition had no negative impact on chlorogenic acid levels. Expression data of key polyphenol-biosynthesis genes showed higher expression levels of all investigated genes at harvest time compared to all storage conditions. Of particular importance is the expression level of chalcone synthase (VcCHS), which is severely affected by storage at 18 kPa CO2.

  7. Transcriptional response of genes involved in cell defense system in human cells stressed by H2O2 and pre-treated with (Tunisian) Rhamnus alaternus extracts: combination with polyphenolic compounds and classic in vitro assays.

    PubMed

    Ammar, Rebai Ben; Bouhlel, Ines; Valenti, Kita; Sghaier, Mohamed Ben; Kilani, Soumaya; Mariotte, Anne-Marie; Dijoux-Franca, Marie-Geneviève; Laporte, François; Ghedira, Kamel; Chekir-Ghedira, Leila

    2007-07-20

    The ability of three Rhamnus alaternus leaves extracts on antigenotoxic and gene expression level effects was respectively investigated in a bacterial assay system, i.e. the SOS chromotest with Escherichia coli PQ37 and in human K562 lymphoblast cell line. Total oligomers flavonoids (TOF) enriched, methanol and ethyl acetate extracts were prepared from powdered R. alaternus leaves and characterized quantitatively for the presence of polyphenolic compounds. We explored the response to oxidative stress using the transcriptional profile of genes in K562 cells stressed with H2O2 after incubation with plant extracts. For this purpose, we used a cDNA microarrays containing 82 genes related to cell defense, essentially represented by antioxidant and DNA repair genes. Analysis revealed that SOD1, AOE 372, TXN genes involved in the antioxidant defense system and XPC, LIG4, POLD2, PCNA genes implied in the DNA repair system were among the most expressed ones in the presence of the tested extracts. These results were in accordance with those obtained when we tested the antigenotoxic and antioxidant effects of the same extracts with, respectively the SOS chromotest and the xanthine/xanthine oxidase enzymatic assay system. The effect of the tested extracts on SOS response induced by both Aflatoxin B1 (AFB1: 10 microg/assay) and nifuroxazide (20 microg/assay) showed that the TOF extract exhibited the highest antimutagenic level towards the indirect mutagen AFB1. Whereas ethyl acetate extract showed the highest antimutagenic effect towards the direct mutagen, nifuroxazide. None of the tested extracts induced mutagenic activity. However all the tested extracts exhibited xanthine oxidase inhibiting and superoxide anions scavenging effects. R. alaternus extracts contain compounds with significant antioxidant and antigenotoxic activities. These compounds modulate gene expression as detected by using cDNA arrays. PMID:17512922

  8. Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.

    PubMed

    García-Martínez, J L; López-Diaz, I; Sánchez-Beltrán, M J; Phillips, A L; Ward, D A; Gaskin, P; Hedden, P

    1997-04-01

    PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv 15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by demonstrating that fusion proteins expressed in Escherichia coli exhibited GA 20-oxidase activity, converting [14C]GA12 to [14C]GA9. The intermediates in this three-step reaction, GA15 and GA24, were also identified as products. The expression proteins from three of the clones (Ps27-12, Pv15-11 and Pv73-1) were also shown to convert GA53 to GA20, as effectively as they did GA12. On the basis of transcript levels measured by northern blot analysis, the pea GA 20-oxidase gene is most highly expressed in young leaves, fully expanded internodes, very young seeds (until 4 days after anthesis) and expanding pods (from 3 days after anthesis at least until day 6). Expression in pods from 3-day-old unpollinated ovaries is higher than in those from pollinated ovaries. Treatment of unpollinated ovaries with GA3 to induce parthenocarpic fruit-set severely reduced the amount of GA 20-oxidase mRNA, whereas treatment with 2,4-D, although inducing fruit-set, did not reduce the levels of these transcripts. Plant decapitation above an unpollinated ovary resulted in very high levels of GA 20-oxidase mRNA in the pod. The three GA 20-oxidase genes from French bean showed very different patterns of expression: Pv 15-1 was expressed in the roots, young leaves, and developing seeds, but most highly in immature cotyledons, while Pv73-1 has a similar expression pattern to Ps27-12, with transcripts found only in young seeds and young leaves, where it was particularly abundant. Transcripts corresponding to Pv85-26 were detected in developing seeds, and just traces in the young leaves. Southern blot analysis

  9. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  10. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong

    2016-01-01

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  11. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.

    PubMed

    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong

    2016-09-18

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  12. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  13. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.

    PubMed

    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong

    2016-09-18

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans.

  14. The acute impact of polyphenols from Hibiscus sabdariffa in metabolic homeostasis: an approach combining metabolomics and gene-expression analyses.

    PubMed

    Beltrán-Debón, Raúl; Rodríguez-Gallego, Esther; Fernández-Arroyo, Salvador; Senan-Campos, Oriol; Massucci, Francesco A; Hernández-Aguilera, Anna; Sales-Pardo, Marta; Guimerà, Roger; Camps, Jordi; Menendez, Javier A; Joven, Jorge

    2015-09-01

    We explored the acute multifunctional effects of polyphenols from Hibiscus sabdariffa in humans to assess possible consequences on the host's health. The expected dynamic response was studied using a combination of transcriptomics and metabolomics to integrate specific functional pathways through network-based methods and to generate hypotheses established by acute metabolic effects and/or modifications in the expression of relevant genes. Data were obtained from healthy male volunteers after 3 hours of ingestion of an aqueous Hibiscus sabdariffa extract. The data were compared with data obtained prior to the ingestion, and the overall findings suggest that these particular polyphenols had a simultaneous role in mitochondrial function, energy homeostasis and protection of the cardiovascular system. These findings suggest beneficial actions in inflammation, endothelial dysfunction, and oxidation, which are interrelated mechanisms. Among other effects, the activation of the heme oxygenase-biliverdin reductase axis, the systemic inhibition of the renin-angiotensin system, the inhibition of the angiotensin-converting enzyme, and several actions mirroring those of the peroxisome proliferator-activated receptor agonists further support this notion. We also found concordant findings in the serum of the participants, which include a decrease in cortisol levels and a significant increase in the active vasodilator metabolite of bradykinin (des-Arg(9)-bradykinin). Therefore, our data support the view that polyphenols from Hibiscus sabdariffa play a regulatory role in metabolic health and in the maintenance of blood pressure, thus implying a multi-faceted impact in metabolic and cardiovascular diseases. PMID:26234931

  15. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )

    1991-11-01

    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  16. Monoamine oxidase A gene DNA hypomethylation - a risk factor for panic disorder?

    PubMed

    Domschke, Katharina; Tidow, Nicola; Kuithan, Henriette; Schwarte, Kathrin; Klauke, Benedikt; Ambrée, Oliver; Reif, Andreas; Schmidt, Hartmut; Arolt, Volker; Kersting, Anette; Zwanzger, Peter; Deckert, Jürgen

    2012-10-01

    The monoamine oxidase A (MAOA) gene has been suggested as a prime candidate in the pathogenesis of panic disorder. In the present study, DNA methylation patterns in the MAOA regulatory and exon 1/intron 1 region were investigated for association with panic disorder with particular attention to possible effects of gender and environmental factors. Sixty-five patients with panic disorder (44 females, 21 males) and 65 healthy controls were analysed for DNA methylation status at 42 MAOA CpG sites via direct sequencing of sodium bisulfate treated DNA extracted from blood cells. The occurrence of recent positive and negative life events was ascertained. Male subjects showed no or only very minor methylation with some evidence for relative hypomethylation at one CpG site in intron 1 in patients compared to controls. Female patients exhibited significantly lower methylation than healthy controls at 10 MAOA CpG sites in the promoter as well as in exon/intron 1, with significance surviving correction for multiple testing at four CpG sites (p≤0.001). Furthermore, in female subjects the occurrence of negative life events was associated with relatively decreased methylation, while positive life events were associated with increased methylation. The present pilot data suggest a potential role of MAOA gene hypomethylation in the pathogenesis of panic disorder particularly in female patients, possibly mediating a detrimental influence of negative life events. Future studies are warranted to replicate the present finding in independent samples, preferably in a longitudinal design.

  17. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    PubMed

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  18. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  19. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  20. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  1. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed Central

    Vanlerberghe, G. C.; McLntosh, L.

    1996-01-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  2. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  3. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  4. Improvement of growth, fruit weight and early blight disease protection of tomato plants by rhizosphere bacteria is correlated with their beneficial traits and induced biosynthesis of antioxidant peroxidase and polyphenol oxidase.

    PubMed

    Narendra Babu, Anupama; Jogaiah, Sudisha; Ito, Shin-Ichi; Kestur Nagaraj, Amruthesh; Tran, Lam-Son Phan

    2015-02-01

    Five plant growth promoting rhizobacteria (PGPRs) of different genera, newly isolated from healthy tomato rhizosphere, were characterized with phosphate solubilizing and root colonizing ability. Treatment with these isolates recorded a significant increase in seed germination and seedling vigor as well as tomato growth and fruit weight which might be partly attributed to the ability of the PGPRs to produce IAA and enhance nutrient uptake and chlorophyll content in treated plants. More importantly, a strong protection against early blight disease was observed in PGPR-pretreated tomato plants infected with Alternaria solani which is in accordance with the presence of siderophores, HCN, chitinase and glucanase in the isolated PGPRs. Additionally, a significantly enhanced accumulation of antioxidant peroxidase (POX) and polyphenol oxidase (PPO) enzymes was observed in the PGPR-pretreated plants with or without pathogen infection in comparison with water or pathogen control. Notably, the highest increase in POX and PPO accumulations was recorded in tomato plants raised from seeds primed with TN_Vel-35 strain. A significant upregulation of POX and PPO in tomato plants subjected to similar treatment with TN_Vel-35 versus respective control was also noticed, further strengthening that the PGPR-induced POX and PPO biosyntheses also contribute to PGPR-mediated protection against early blight disease in tomato plants. PMID:25575992

  5. Indirect determination of sulfite using a polyphenol oxidase biosensor based on a glassy carbon electrode modified with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film.

    PubMed

    Sartori, Elen Romão; Vicentini, Fernando Campanhã; Fatibello-Filho, Orlando

    2011-12-15

    The modification of a glassy carbon electrode with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film for the development of a biosensor is proposed. This approach provides an efficient method used to immobilize polyphenol oxidase (PPO) obtained from the crude extract of sweet potato (Ipomoea batatas (L.) Lam.). The principle of the analytical method is based on the inhibitory effect of sulfite on the activity of PPO, in the reduction reaction of o-quinone to catechol and/or the reaction of o-quinone with sulfite. Under the optimum experimental conditions using the differential pulse voltammetry technique, the analytical curve obtained was linear in the concentration of sulfite in the range from 0.5 to 22 μmol L(-1) with a detection limit of 0.4 μmol L(-1). The biosensor was applied for the determination of sulfite in white and red wine samples with results in close agreement with those results obtained using a reference iodometric method (at a 95% confidence level). PMID:22099673

  6. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  7. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks.

  8. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  9. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-10-01

    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  10. Cinnamon polyphenol extract regulates tristetraprolin and related gene expression in mouse adipocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamon (Cinnamomum verum) has been widely used in spices, flavoring agents, and preservatives. Cinnamon polyphenol extract (CPE) may be important in the alleviation of chronic diseases, but the molecular evidence is not substantial. Tristetraprolin (TTP) family proteins have anti-inflammatory ef...

  11. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand.

  12. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  13. Cortical Enlargement in Autism is Associated With a Functional VNTR in the Monoamine Oxidase A Gene

    PubMed Central

    Davis, Lea K.; Hazlett, Heather C.; Librant, Amy L.; Nopoulos, Peggy; Sheffield, Val C.; Piven, Joesph; Wassink, Thomas H.

    2009-01-01

    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that “low activity” alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the “low activity” allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2–3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the “low activity” allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the “low activity” allele in a separate sample of 114 affected sib pairfamilies. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the “low activity” genotype and the larger brain volumes in our sample. PMID:18361446

  14. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  15. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  16. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  17. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  18. Identification, cloning and expression of Pseudomonas aeruginosa Ps-x putative urate oxidase gene in Escherichia coli.

    PubMed

    Saeed, Hesham M; Abdel-Fattah, Yasser R; Berekaa, Mahmoud M; Gohar, Yousry M; Elbaz, Mohamed A

    2004-01-01

    In a previous study we reported for the first time the isolation and characterization ofurate oxidase enzyme from Pseudomonas aeruginosa. In this work we isolated and cloned a 1.350 kilobase DNA fragment that encode a putative urate oxidase gene from the genomic library of P. aeruginosa Ps-x. The nucleotide sequence of the cloned DNA insert revealed an open reading frame that encodes a protein of a molecular weight of 54.0 kDa. The cloned DNA fragment showed an uricolytic activity when expressed in E. coli DH5alpha. Surprisingly, the nucleotide sequence of the cloned gene showed more than 99% identity to the gene encoding hypothetical protein of P. aeruginosa PAO1. Moreover, the sequence of the cloned gene was closely similar to the corresponding uricase gene of Cellulomonas flavigena (44% similarity), but showed lower similarity values to that of Bacillus sp. BT-90 (24% similarity), Candida utilis (24% similarity). Interestingly, the isolated uricase gene showed closer similarity to uricase from yeast-like symbiotic fungi Beauveria bassiana (35%), Tolypocladium inflatum (29%), Paecilomyces tenuipes (27%) and Cerataphis fransseni (24%).

  19. The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species -- Calliphora vicina and Calliphora vomitoria.

    PubMed

    Ames, Carole; Turner, Bryan; Daniel, Barbara

    2006-12-20

    Traditionally identification of forensically important insects has been carried out based upon morphological differences between species. However insect evidence found at a crime scene may on occasion be difficult to distinguish by morphological techniques and under these circumstances another method of accurate identification is required. This work utilises a cytochrome oxidase I partial mitochondrial gene region (COI) to distinguish the two of the main UK blowfly species -- Calliphora vicina (Robineau Desvoidy) and Calliphora vomitoria (Linnaeus) (Diptera:Calliphoridae). Seventeen interspecific differences in COI sequence were located. Use of the restriction enzyme SfcI on this gene region provides a simple method for distinguishing between C. vicina and C. vomitoria.

  20. NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.

    PubMed

    Kwak, June M; Mori, Izumi C; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L; Bloom, Rachel E; Bodde, Sara; Jones, Jonathan D G; Schroeder, Julian I

    2003-06-01

    Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca(2+) increases and ABA- activation of plasma membrane Ca(2+)-permeable channels in guard cells. Exogenous H(2)O(2) rescues both Ca(2+) channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction.

  1. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  2. Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

    PubMed Central

    Clary, D O; Wolstenholme, D R

    1983-01-01

    Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

  3. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  4. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  5. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M

    1997-01-01

    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship

  6. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells.

    PubMed

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-01

    Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1kd cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1kd cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H2O2) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H2O2 among AOX1kd cells confirmed production of H2O2 in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H2O2.

  7. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  8. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  9. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  10. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.

    PubMed

    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

    2013-01-01

    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion.

  11. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  12. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses.

  13. The effect of dietary polyphenols on the epigenetic regulation of gene expression in MCF7 breast cancer cells.

    PubMed

    Paluszczak, Jarosław; Krajka-Kuźniak, Violetta; Baer-Dubowska, Wanda

    2010-02-01

    The CpG island methylator phenotype is characterized by DNA hypermethylation in the promoters of several suppressor genes associated with the inactivation of various pathways involved in tumorigenesis. DNA methylation is catalyzed by specific DNA methyltransferases (DNMTs). Dietary phytochemicals particularly catechol-containing polyphenols were shown to inhibit these enzymes and reactivate epigenetically silenced genes. The aim of this study was to evaluate the effect of a wide range of dietary phytochemicals on the activity and expression of DNMTs in human breast cancer MCF7 cell line and their effect on DNA and histone H3 methylation. All phytochemicals inhibited the DNA methyltransferase activity with betanin being the weakest while rosmarinic and ellagic acids were the most potent modulators (up to 88% inhibition). While decitabine led to a partial demethylation and reactivation of the genes, none of the tested phytochemicals affected the methylation pattern or the expression of RASSF1A, GSTP1 or HIN1 in MCF7 cells. The global methylation of histone H3 was not affected by any of the tested phytochemicals or decitabine. The results of our study may suggest that non-nucleoside agents are not likely to be effective epigenetic modulators, in our experimental model at least. However, a long-term exposure to these chemicals in diet might potentially lead to an effect, which can be sufficient for cancer chemoprevention.

  14. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  15. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  16. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.

    1999-01-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  17. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  18. Blueberry polyphenols attenuate kainic acid-induced decrements in cognition and alter inflammatory gene expression in rat hippocampus

    PubMed Central

    Shukitt-Hale, Barbara; Lau, Francis C.; Carey, Amanda N.; Galli, Rachel L.; Spangler, Edward L.; Ingram, Donald K.; Joseph, James A.

    2016-01-01

    Cognitive impairment in age-related neurodegenerative diseases such as Alzheimer's disease may be partly due to long-term exposure and increased susceptibility to inflammatory insults. In the current study, we investigated whether polyphenols in blueberries can reduce the deleterious effects of inflammation induced by central administration of kainic acid by altering the expression of genes associated with inflammation. To this end, 4-month-old male Fischer-344 (F344) rats were fed a control, 0.015% piroxicam (an NSAID) or 2% blueberry diet for 8 weeks before either Ringer's buffer or kainic acid was bilaterally micro-infused into the hippocampus. Two weeks later, following behavioral evaluation, the rats were killed and total RNA from the hippocampus was extracted and used in real-time quantitative RT-PCR (qRT-PCR) to analyze the expression of inflammation-related genes. Kainic acid had deleterious effects on cognitive behavior as kainic acid-injected rats on the control diet exhibited increased latencies to find a hidden platform in the Morris water maze compared to Ringer's buffer-injected rats and utilized non-spatial strategies during probe trials. The blueberry diet, and to a lesser degree the piroxicam diet, was able to improve cognitive performance. Immunohistochemical analyses of OX-6 expression revealed that kainic acid produced an inflammatory response by increasing the OX-6 positive areas in the hippocampus of kainic acid-injected rats. Kainic acid up-regulated the expression of the inflammatory cytokines IL-1β and TNF-α, the neurotrophic factor IGF-1, and the transcription factor NF-κB. Blueberry and piroxicam supplementations were found to attenuate the kainic acid-induced increase in the expression of IL-1β, TNF-α, and NF-κB, while only blueberry was able to augment the increased IGF-1 expression. These results indicate that blueberry polyphenols attenuate learning impairments following neurotoxic insult and exert anti-inflammatory actions

  19. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.

    2001-01-01

    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  20. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  1. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  2. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  3. [Influence of polymorphism's of endothelial nitric oxide synthase gene and polymorphism of NADPH oxidase gene on development of complications of arterial hypertension].

    PubMed

    Kuznetsova, T Iu; Gavrilov, D V; Dudanov, I P; Makarevich, P I; Balatskiĭ, A V; Samokhodskaia, L M; Parfenova, E V

    2008-01-01

    The aim of the study was to analyze the prevalence of polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene in patients with arterial hypertension (AH) and their influence on AH complications. The study included 272 AH patients, average age 50,7 years. The following analyses were performed: clinical analysis of the blood, general analysis of the urine, lipid spectrum, plasma electrolytes, creatinine, glucose, electrocardiography, echocardioscopy, examination of eye vessels, ultrasound examination of the carotid arteries, determination of microalbuminuria. The polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene were detected with two methods: polymerase chain reaction and restrictase reaction. The control group for Glu298Asp polymorphism detection included 102 healthy Russian donors aged 18 to 50 years. Genotypes prevalence in AH patients was as follows: GG 58,8%, GA 32,3%, AA 8,9%, and CC 48,2%, CT 44,9%, TT 6.9%. In the control group: GG 53%, GA 36%, AA 11% and CC 42%, CT 54%, TT 4%. These polymorphisms did not affect the incidence of complications, such as obliterating atherosclerosis of the lower extremity vessels, ischemic heart disease, and acute insufficiency of cerebral circulation, chronic heart failure, left ventricular hypertrophy, microalbuminuria, carotid arteries atherosclerosis. PMID:18429753

  4. Black tea polyphenols: a mechanistic treatise.

    PubMed

    Butt, M S; Imran, A; Sharif, M K; Ahmad, Rabia Shabir; Xiao, Hang; Imran, M; Rsool, H A

    2014-01-01

    Dietary interventions are among the emerging trends to curtail physiological malfunctioning like cancer, diabetes, cardiac complications, etc. The essence of phytonutrients has developed the concept of nutraceuticals at the junction of diet health linkages. In this context, theaflavin & thearubigins are the oxidized derivatives of black tea catechins during fermentation having nutraceutical potential owing to esterification of hydroxyl ring with digallate esters. Theaflavin may influence activation of transcription factors such as NFnB or AP-1 that ultimately hinder the formation of nitric oxide expression gene. Likewise, black tea contains a unique amino acid theanine acts as neurotransmitter owing to its ability to cross the blood-brain barrier. Moreover, it boasts immunity by enhancing the disease-fighting ability of gamma delta T cells. Theaflavin & thearubigins act as safeguard against oxidative stress thereby effective in the cardiac functioning. The mechanistic approach of these antioxidants is likely to be associated with inhibition of redox sensitive transcription factors & pro-oxidant enzymes such as xanthine oxidase or nitric oxide synthase. However, their involvement in antioxidative enzyme induction as in glutathione-S-transferases is also well documented. They act as curative agent against numerous pathological disorders by disrupting the electron chain thus inhibiting the progression of certain ailments. Black tea polyphenols established themselves as strong antioxidants due to their standard one-electron potential, and their vitality is dependent on the concentration of polyphenols and pH for their inclusive execution. Present review is an attempt to enrich the readers regarding the health promoting aspects of black tea polyphenols. Concomitantly, it needs core attention of researchers for the exploitations of black tea flavanols as an important dietary constituent for the vulnerable segment.

  5. Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

    PubMed

    Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

    2003-10-01

    Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels. PMID:14561072

  6. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  7. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-01

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae.

  8. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-01

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. PMID:27421668

  9. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

    2004-01-01

    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

  10. The LOXL2 gene encodes a new lysyl oxidase-like protein and is expressed at high levels in reproductive tissues.

    PubMed

    Jourdan-Le Saux, C; Tronecker, H; Bogic, L; Bryant-Greenwood, G D; Boyd, C D; Csiszar, K

    1999-04-30

    We have reported in this paper the complete cDNA sequence, gene structure, and tissue-specific expression of LOXL2, a new amine oxidase and a member of an emerging family of human lysyl oxidases. The predicted amino acid sequence, from several overlapping cDNA clones isolated from placenta and spleen cDNA libraries, shared extensive sequence homology with the conserved copper-binding and catalytic domains of both lysyl oxidase (LOX) and the lysyl oxidase-like (LOXL) protein. These conserved domains are encoded by five consecutive exons within the LOX, LOXL, and LOXL2 genes that also maintained exon-intron structure conservation. In contrast, six exons encoding the amino-terminal domains diverged both in sequence and structure. Exon 1 of the LOXL2 gene does not encode a signal sequence that is present in LOX and LOXL, suggesting a different processing and intracellular localization for this new protein. Expression of the LOXL2 gene was detected in almost all tissues with the highest steady state mRNA levels in the reproductive tissues, placenta, uterus and prostate. In situ hybridization identified placental syncytial and cytotrophoblasts responsible for the synthesis of LOXL2 mRNA and demonstrated a spatial and temporal expression pattern unique to the LOXL2 gene.

  11. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future.

  12. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  13. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  14. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase.

    PubMed

    Andjelković, Ana; Kemppainen, Kia K; Jacobs, Howard T

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  15. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  16. Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization.

    PubMed

    Qi, Jing; Li, Gui-Qin; Dong, Zhen; Zhou, Wei

    2016-01-01

    To explore the subcellular localization of Polyphenol oxidase (PPO) from Pyrus bretschneideri, the 1779 bp cDNA of PPO gene excluding the termination codon TAA was cloned and fused with GFP to construct a binary vector pBI121-PPO-GFP. Then, the binary vector was transformed into Nicotiana tabacum by the tumefanciens-mediated method. Using confocal laser scanning microscopy, green fluorescent signals were localized in chloroplasts of the transformed Nicotiana tabacum cell, suggesting that the Polyphenol oxidase from Pyrus bretschneideri was a chloroplast protein. PMID:27158362

  17. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  18. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  19. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.

    PubMed

    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M

    2003-01-01

    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants.

  20. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit.

  1. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  2. Green tea polyphenols as potent enhancers of glucocorticoid-induced mouse mammary tumor virus gene expression.

    PubMed

    Abe, I; Umehara, K; Morita, R; Nemoto, K; Degawa, M; Noguchi, H

    2001-02-16

    The effect of natural and synthetic galloyl esters on glucocorticoid-induced gene expression was evaluated by using rat fibroblast 3Y1 cells stably transfected with a luciferase reporter gene under the transcriptional regulation of the mouse mammary tumor virus promoter. The glucocorticoid-induced gene transcription was strongly suppressed by synthetic alkyl esters; n-dodecyl gallate showed the most potent inhibition (66% inhibition at 10 microM), which was far more potent than that of crude tannic acid. n-Octyl and n-cetyl gallate also showed good inhibition, while gallic acid itself was not so active, suggesting that the presence of hydrophobic side chain is important for the suppressive effect. On the other hand, surprisingly, green tea gallocatechins, (-)-epigallocatechin-3-O-gallate and theasinensin A, potently enhanced the promoter activity (182 and 247% activity at 1 microM, respectively). The regulation of the level of the glucocorticoid-induced gene expression by the antioxidative gallates is of great interest from a therapeutic point of view.

  3. The genetic basis of "Scarsdale Gourmet Diet" variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed

    Frank, J; Poh-Fitzpatrick, M B; King, L E; Christiano, A M

    1998-08-01

    The porphyrias are disorders of porphyrin or porphyrin-precursor metabolism that result from inherited or acquired aberrations in the control of the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial reduction in the activity of protoporphyrinogen oxidase (PPO), and recently, mutations in the PPO gene on chromosome 1q22-23 have been described. Our purpose was to identify the underlying genetic lesion in a severely affected patient with VP and to detect the silent mutation carriers in her family. The disease in this patient was precipitated by carbohydrate restriction as outlined in the "Scarsdale Gourmet Diet". Our mutation detection and confirmation strategy included PCR, automated sequencing, and restriction enzyme digestion. We identified a missense mutation in the patient and five family members. The mutation consisted of a previously unreported C-to-T transition in exon 5 of the PPO gene, resulting in the substitution of arginine by cysteine, designated R152C. This arginine residue is evolutionarily highly conserved in humans, mice, bacteria, yeast, and plants, indicating the importance of this residue in PPO. Our study established that a missense mutation in the PPO gene was the underlying mutation in this patient with VP and explained the occurrence of the phenotype in this family.

  4. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  5. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  6. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  7. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells.

    PubMed

    Zong, Wen; Jiang, Yan; Zhao, Jing; Zhang, Jian; Gao, Jian-gang

    2015-10-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  8. A versatile and efficient markerless gene disruption system for Acidithiobacillus thiooxidans: application for characterizing a copper tolerance related multicopper oxidase gene.

    PubMed

    Wen, Qing; Liu, Xiangmei; Wang, Huiyan; Lin, Jianqun

    2014-11-01

    The acidophilic bioleaching bacteria can usually survive in high concentrations of copper ions because of their special living environment. However, little is known about the copper homeostatic mechanisms of Acidithiobacillus thiooxidans, an important member of bioleaching bacteria. Here, a putative multicopper oxidase gene (cueO) was detected from the draft genome of A. thiooxidans ATCC 19377. The transcriptional level of cueO in response to 10 mM CuSO₄was upregulated 25.01 ± 2.59 folds. The response of P(cueO) to copper was also detected and might be stimulated by a putative CueR protein. Then, by using the counter-selectable marker lacZ and enhancing the expression of endonuclease I-SceI with tac promoter, a modified markerless gene disruption system was developed and the cueO gene disruption mutant (ΔcueO) of A. thiooxidans was successfully constructed with a markedly improved second homologous recombination frequency of 0.28 ± 0.048. The ΔcueO mutant was more sensitive to external copper and nearly completely lost the phenoloxidase activity; however, the activity could be restored after complementing the cueO gene. All results suggest the close relation of cueO gene to copper tolerance in A. thiooxidans. In addition, the developed efficient markerless gene knockout method can also be introduced into other Acidithiobacillus strains.

  9. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli.

  10. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.

    2013-01-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  11. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans.

    PubMed

    Dlugos, Andrea M; Palmer, Abraham A; de Wit, Harriet

    2009-10-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression.

  12. Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in Saccharomyces cerevisiae.

    PubMed Central

    Bonnefoy, N; Kermorgant, M; Groudinsky, O; Minet, M; Slonimski, P P; Dujardin, G

    1994-01-01

    The yeast nuclear gene OXA1 is essential for cytochrome oxidase assembly, so that a null mutation in the OXA1 gene leads to complete respiratory deficiency. We have cloned by genetic selection a human OXA1 (OXA1Hs) cDNA that complements the respiratory defect of yeast oxa1 mutants. The deduced sequence of the human protein shares 33% identity with the yeast OXA1 protein. The OXA1Hs cDNA corresponds to a single and relatively highly expressed gene. Oxygen consumption measurements and cytochrome absorption spectra show that replacement of the yeast protein with the human homolog leads to the correct assembly of cytochrome oxidase, suggesting that the proteins play essentially the same role in both organisms. Images PMID:7991568

  13. The NADPH Oxidase Subunit NOX4 Is a New Target Gene of the Hypoxia-inducible Factor-1

    PubMed Central

    Diebold, Isabel; Petry, Andreas; Hess, John

    2010-01-01

    NADPH oxidases are important sources of reactive oxygen species (ROS), possibly contributing to various disorders associated with enhanced proliferation. NOX4 appears to be involved in vascular signaling and may contribute to the response to hypoxia. However, the exact mechanisms controlling NOX4 levels under hypoxia are not resolved. We found that hypoxia rapidly enhanced NOX4 mRNA and protein levels in pulmonary artery smooth-muscle cells (PASMCs) as well as in pulmonary vessels from mice exposed to hypoxia. This response was dependent on the hypoxia-inducible transcription factor HIF-1α because overexpression of HIF-1α increased NOX4 expression, whereas HIF-1α depletion prevented this response. Mutation of a putative hypoxia-responsive element in the NOX4 promoter abolished hypoxic and HIF-1α–induced activation of the NOX4 promoter. Chromatin immunoprecipitation confirmed HIF-1α binding to the NOX4 gene. Induction of NOX4 by HIF-1α contributed to maintain ROS levels after hypoxia and hypoxia-induced proliferation of PASMCs. These findings show that NOX4 is a new target gene of HIF-1α involved in the response to hypoxia. Together with our previous findings that NOX4 mediates HIF-1α induction under normoxia, these data suggest an important role of the signaling axis between NOX4 and HIF-1α in various cardiovascular disorders under hypoxic and also nonhypoxic conditions. PMID:20427574

  14. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

    PubMed

    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

    2006-11-01

    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

  15. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  16. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  17. NAD(P)H oxidase p22phox gene C242T polymorphism, nitric oxide production, salt sensitivity and cardiovascular risk factors in Hispanics.

    PubMed

    Castejon, A M; Bracero, J; Hoffmann, I S; Alfieri, A B; Cubeddu, L X

    2006-10-01

    Mutations in the NAD(P)H oxidase gene may be associated with abnormal superoxide generation, nitric oxide (NO) availability and cardiovascular diseases. We investigated the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism, and its possible association with blood pressure, NO production, salt sensitivity and cardiovascular risk factors in Hispanics. Genotype frequencies were as follows: CC, 52.9%; CT, 40.3%; and TT, 6.8%. There were no significant differences in systolic blood pressure, diastolic blood pressure, age, weight, fasting and post-load glucose levels, LDL and HDL cholesterol, triglyceride and urinary albumin levels in subjects with CC, CT or the TT genotypes. Presence of the T allele was associated with increased salt sensitivity in women, but not in men. NO metabolite excretion was markedly decreased both in women and men with the TT genotype (CC: 868+/-79 micromol/day; CT: 839+/-75 micromol/day; TT: 534+/-78 micromol/day; P<0.05). In conclusion, the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism in Venezuelans was comparable to that of Caucasians, but different from that of Chinese and Japanese. Although the T allele was not associated with cardiovascular risk factors, hyperinsulinaemia or hypertension, in women, it appeared to be a genetic susceptibility factor for salt sensitivity. Both in women and men, the p22phox gene may play a role in the genetic control of NO levels.

  18. NADPH Oxidase-derived Reactive Oxygen Species Increases Expression of Monocyte Chemotactic Factor Genes in Cultured Adipocytes*

    PubMed Central

    Han, Chang Yeop; Umemoto, Tomio; Omer, Mohamed; Den Hartigh, Laura J.; Chiba, Tsuyoshi; LeBoeuf, Renee; Buller, Carolyn L.; Sweet, Ian R.; Pennathur, Subramaniam; Abel, E. Dale; Chait, Alan

    2012-01-01

    Excess glucose and free fatty acids delivered to adipose tissue causes local inflammation, which contributes to insulin resistance. Glucose and palmitate generate reactive oxygen species (ROS) in adipocytes, leading to monocyte chemotactic factor gene expression. Docosahexaenoate (DHA) has the opposite effect. In this study, we evaluated the potential sources of ROS in the presence of excess nutrients. Differentiated 3T3-L1 adipocytes were exposed to palmitate and DHA (250 μm) in either 5 or 25 mm glucose to evaluate the relative roles of mitochondrial electron transport and NADPH oxidases (NOX) as sources of ROS. Excess glucose and palmitate did not increase mitochondrial oxidative phosphorylation. However, glucose exposure increased glycolysis. Of the NOX family members, only NOX4 was expressed in adipocytes. Moreover, its activity was increased by excess glucose and palmitate and decreased by DHA. Silencing NOX4 inhibited palmitate- and glucose-stimulated ROS generation and monocyte chemotactic factor gene expression. NADPH, a substrate for NOX, and pentose phosphate pathway activity increased with glucose but not palmitate and decreased with DHA exposure. Inhibition of the pentose phosphate pathway by glucose-6-phosphate dehydrogenase inhibitors and siRNA suppressed ROS generation and monocyte chemotactic factor gene expression induced by both glucose and palmitate. Finally, both high glucose and palmitate induced NOX4 translocation into lipid rafts, effects that were blocked by DHA. Excess glucose and palmitate generate ROS via NOX4 rather than by mitochondrial oxidation in cultured adipocytes. NOX4 is regulated by both NADPH generated in the PPP and translocation of NOX4 into lipid rafts, leading to expression of monocyte chemotactic factors. PMID:22287546

  19. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.

    PubMed

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

    2013-07-01

    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms.

  20. Preexposure to Olive Oil Polyphenols Extract Increases Oxidative Load and Improves Liver Mass Restoration after Hepatectomy in Mice via Stress-Sensitive Genes

    PubMed Central

    Marinić, Jelena; Broznić, Dalibor; Milin, Čedomila

    2016-01-01

    Polyphenols can act as oxidants in some conditions, inducing redox-sensitive genes. We investigated the effect of preexposure to the olive oil polyphenols extract (PFE) on time-dependent changes in the hepatic oxidative state in a model of liver regeneration—a process in which oxidative stress associated with the metabolic overload accounts for the early events that contribute to the onset of liver self-repair. Liver regeneration was induced by one-third hepatectomy in mice. Prior to hepatectomy, mice were intraperitoneally given either PFE (50 mg/kg body weight) or saline for seven consecutive days, while respective controls received vehicle alone. Redox state-regulating enzymes and thiol proteins along with the mRNA levels of Nrf2 gene and its targets γ-glutamylcysteine synthetase and heme oxygenase-1 were determined at different time intervals after hepatectomy. The liver mass restoration was calculated to assess hepatic regeneration. The resulting data demonstrate the effectiveness of preexposure to PFE in stimulating liver regeneration in a model of a small tissue loss which may be ascribed to the transient increase in oxidant load during the first hours after hepatectomy and associated induction of stress response gene-profiles under the control of Nrf2. PMID:26925195

  1. Blueberry polyphenols attenuate kainic acid-induced decrements in cognition and alter inflammatory gene expression in rat hippocampus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cognitive impairment in age-related neurodegenerative diseases such as Alzheimer's disease may be partly due to long-term exposure and increased susceptibility to inflammatory insults. In the current study we investigated whether polyphenols in blueberries (BBs) can reduce the deleterious effects o...

  2. Epigenetic targets of polyphenols in cancer.

    PubMed

    Yang, Pinglin; He, Xijing; Malhotra, Anshoo

    2014-01-01

    Interest in dietary polyphenols has recently increased greatly owing to their antioxidant capacity and their possible beneficial implications in various pathological states, including cancer. Polyphenols are a group of chemicals found in many fruits, vegetables, and plants and have the ability to remove free radicals from the body. In the last 2 decades, the numbers of reports on the potential health benefits of polyphenols have increased. This review provides the available scientific data that justify importance of polyphenols in correlation with epigenetics to fight against carcinogenesis. Epigenetics involves genetic control by mechanisms other than DNA sequence. These epigenetic mechanisms have ability to switch on or off various important genes influencing the process of cancer. Furthermore, due to the reversible nature of these epigenetic mechanisms, they are influenced by a variety of dietary polyphenols. This review focuses on the dietary polyphenols that significantly affect these epigenetic mechanisms to mitigate carcinogenesis.

  3. Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.

    PubMed

    Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

    2014-08-01

    Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G. pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G. pecorum. High haplotype diversity was observed among G. pecorum populations from all host species, indicating that the G. pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G. pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G. pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures.

  4. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.

    PubMed

    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie

    2015-09-01

    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols.

  5. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.

    PubMed

    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie

    2015-09-01

    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols. PMID:26305170

  6. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  7. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  8. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  9. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    PubMed

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul).

  10. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  11. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  12. Regulation of gibberellin 20-oxidase gene expression and gibberellin content in citrus by temperature and citrus exocortis viroid.

    PubMed

    Vidal, Ana M; Ben-Cheikh, Waddi; Talón, Manuel; García-Martínez, José L

    2003-07-01

    A cDNA clone coding for a gibberellin (GA) 20-oxidase ( CcGA20ox1), an enzyme of GA biosynthesis, which when expressed in vitro catalyzed the conversion of GA(12) to GA(9) and of GA(53) to GA(20), was isolated from the citrus hybrid Carrizo citrange (C itrus sinensis x Poncirus trifoliata). Transcripts of CcGA20ox1 were abundant in the apex and leaves and much less abundant in internodes, nodes and roots. Seedlings of Carrizo citrange cultured under a 32 degrees C/27 degrees C (day/night) regime elongated more than seedlings growing under 17 degrees C/12 degrees C conditions. The effect of higher temperature was associated with more CcGA20ox1 transcripts and with higher content of GA(1), the main active GA in citrus, in the shoot. The infection of Etrog citron ( Citrus medica) plants with citrus exocortis viroid (CEVd), which produces a stunted phenotype, reduced the levels of transcripts in the apical shoot hybridizing to the gene CcGA20ox1 of Carrizo citrange and the content of GA(1). Thus GA(1) content correlated with CcGA20ox1 transcript levels. In contrast, results for gibberellic acid (GA(3)) and paclobutrazol applications to Carrizo citrange showed that CcGA20ox1 expression was subject to feed-back regulation. These observations indicate that the feed-back regulation of GA20ox operates mostly when the levels of active GAs have been dramatically altered. The results also show that the growth reduction induced by environmental (temperature) and biotic (CEVd) factors may be partially due to the modulation of the expression of GA20ox genes.

  13. Lysyl oxidase is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in human gastric cancers.

    PubMed

    Kaneda, Atsushi; Wakazono, Kuniko; Tsukamoto, Tetsuya; Watanabe, Naoko; Yagi, Yukiko; Tatematsu, Masae; Kaminishi, Michio; Sugimura, Takashi; Ushijima, Toshikazu

    2004-09-15

    Lysyl oxidase (LOX) and HRAS-like suppressor (HRASLS) are silenced in human gastric cancers and are reported to have growth-suppressive activities in ras-transformed mouse/rat fibroblasts. Here, we analyzed whether or not LOX and HRASLS are tumor suppressor genes in human gastric cancers. Loss of heterozygosity and promoter methylation of LOX were detected in 33% (9 of 27) and 27% (26 of 96) of gastric cancers, respectively. Biallelic methylation and loss of heterozygosity with promoter methylation were also demonstrated in gastric cancers. Silencing of LOX was also observed in colon, lung, and ovarian cancer cell lines. As for mutations, only one possible somatic mutation was found by analysis of 96 gastric cancer samples and 58 gastric and other cancer cell lines. When LOX was introduced into a gastric cancer cell line, MKN28, in which LOX and HRASLS were silenced, it reduced the number of anchorage-dependent colonies to 57 to 61%, and the number of anchorage-independent colonies to 11 to 23%. Sizes of tumors formed in nude mice were reduced to 19 to 26%. Growth suppression in soft agar assay was also observed in another gastric cancer cell line, KATOIII. On the other hand, neither loss of heterozygosity nor a somatic mutation was detected in HRASLS, and its introduction into MKN28 did not suppress the growth in vitro or in vivo. These data showed that LOX is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in gastric cancers, and possibly also in other cancers. PMID:15374948

  14. Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease

    PubMed Central

    Malech, Harry L.; Maples, Phillip B.; Whiting-Theobald, Narda; Linton, Gilda F.; Sekhsaria, Sudhir; Vowells, Sarah J.; Li, Fei; Miller, Judi A.; DeCarlo, Ellen; Holland, Steven M.; Leitman, Susan F.; Carter, Charles S.; Butz, Robert E.; Read, Elizabeth J.; Fleisher, Thomas A.; Schneiderman, Richard D.; Van Epps, Dennis E.; Spratt, S. Kaye; Maack, Christopher A.; Rokovich, Joseph A.; Cohen, Lawrence K.; Gallin, John I.

    1997-01-01

    Little is known about the potential for engraftment of autologous hematopoietic stem cells in human adults not subjected to myeloablative conditioning regimens. Five adult patients with the p47phox deficiency form of chronic granulomatous disease received intravenous infusions of autologous CD34+ peripheral blood stem cells (PBSCs) that had been transduced ex vivo with a recombinant retrovirus encoding normal p47phox. Although marrow conditioning was not given, functionally corrected granulocytes were detectable in peripheral blood of all five patients. Peak correction occurred 3–6 weeks after infusion and ranged from 0.004 to 0.05% of total peripheral blood granulocytes. Corrected cells were detectable for as long as 6 months after infusion in some individuals. Thus, prolonged engraftment of autologous PBSCs and continued expression of the transduced gene can occur in adults without conditioning. This trial also piloted the use of animal protein-free medium and a blood-bank-compatible closed system of gas-permeable plastic containers for culture and transduction of the PBSCs. These features enhance the safety of PBSCs directed gene therapy. PMID:9342375

  15. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

    PubMed

    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

    2013-10-01

    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.

  16. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  17. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  18. Human retina-specific amine oxidase: genomic structure of the gene (AOC2), alternatively spliced variant, and mRNA expression in retina.

    PubMed

    Imamura, Y; Noda, S; Mashima, Y; Kudoh, J; Oguchi, Y; Shimizu, N

    1998-07-15

    Previously, we reported the isolation of cDNA for human retina-specific amine oxidase (RAO) and the expression of RAO exclusively in retina. Bacterial artificial chromosome clones containing the human RAO gene (AOC2) were mapped to human chromosome 17q21 (Imamura et al., 1997, Genomics 40: 277-283). Here, we report the complete genomic structure of the RAO gene, including 5' flanking sequence, and mRNA expression in retina. The human RAO gene spans 6 kb and is composed of four exons corresponding to the amino acid sequence 1-530, 530-598, 598-641, and 642-729 separated by three introns of 3000, 310, and 351 bp. Screening of a human retina cDNA library revealed the existence of an alternatively spliced cDNA variant with an additional 81 bp at the end of exon 2. The sizes of exons and the locations of exon/intron boundaries in the human RAO gene showed remarkable similarity to those of the human kidney diamine oxidase gene (AOC1). In situ hybridization revealed that mRNA coding for RAO is expressed preferentially in the ganglion cell layer of the mouse retina. We designed four sets of PCR primers to amplify four exons, which will be valuable for analyzing mutations in patients with ocular diseases affecting the retinal ganglion cell layer.

  19. Elasto-regenerative properties of polyphenols.

    PubMed

    Sinha, Aditi; Nosoudi, Nasim; Vyavahare, Naren

    2014-02-01

    Abdominal aortic aneurysms (AAA) are progressive dilatations of infra-renal aorta causing structural weakening rendering the aorta prone to rupture. AAA can be potentially stabilized by inhibiting inflammatory enzymes such as matrix metalloproteinases (MMP); however, active regression of AAA is not possible without new elastic fiber regeneration. Here we report the elastogenic benefit of direct delivery of polyphenols such as pentagalloyl glucose (PGG), epigallocatechin gallate (EGCG), and catechin, to smooth muscle cells obtained either from healthy or from aneurysmal rat aorta. Addition of 10 μg/ml PGG and ECGC induce elastin synthesis, organization, and crosslinking while catechin does not. Our results indicate that polyphenols bind to monomeric tropoelastin and enhance coacervation, aid in crosslinking of elastin by increasing lysyl oxidase (LOX) synthesis, and by blocking MMP-2 activity. Thus, polyphenol treatments leads to increased mature elastin fibers synthesis without increasing the production of intracellular tropoelastin.

  20. A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio.

    PubMed

    Hernández-Romero, Diana; Sanchez-Amat, Antonio; Solano, Francisco

    2006-01-01

    The sequencing of the genome of Ralstonia solanacearum[Salanoubat M, Genin S, Artiguenave F, et al. (2002) Nature 415, 497-502] revealed several genes that putatively code for polyphenol oxidases (PPOs). This soil-borne pathogenic bacterium withers a wide range of plants. We detected the expression of two PPO genes (accession numbers NP_518458 and NP_519622) with high similarity to tyrosinases, both containing the six conserved histidines required to bind the pair of type-3 copper ions at the active site. Generation of null mutants in those genes by homologous recombination mutagenesis and protein purification allowed us to correlate each gene with its enzymatic activity. In contrast with all tyrosinases so far studied, the enzyme NP_518458 shows higher monophenolase than o-diphenolase activity and its initial activity does not depend on the presence of l-dopa cofactor. On the other hand, protein NP_519622 is an enzyme with a clear preference to oxidize o-diphenols and only residual monophenolase activity, behaving as a catechol oxidase. These catalytic characteristics are discussed in relation to two other characteristics apart from the six conserved histidines. One is the putative presence of a seventh histidine which interacts with the carboxy group on the substrate and controls the preference for carboxylated and decarboxylated substrates. The second is the size of the residue isosteric with the aromatic F261 reported in sweet potato catechol oxidase which acts as a gate to control accessibility to CuA at the active site. PMID:16403014

  1. Selected attributes of polyphenols in targeting oxidative stress in cancer.

    PubMed

    Stepanic, Visnja; Gasparovic, Ana Cipak; Troselj, Koraljka Gall; Amic, Dragan; Zarkovic, Neven

    2015-01-01

    Various plant polyphenols have been recognized as redox active molecules. This review discusses some aspects of polyphenols' modes of redox action, corresponding structure-activity relationships and their potential to be applied as adjuvants to conventional cytostatic drugs. Polyphenols' antioxidative capacity has been discussed as the basis for targeting oxidative stress and, consequently, for their chemopreventive and anti-inflammatory activities, which may alleviate side-effects on normal cells arising from oxidative stress caused by cytostatics. Some polyphenols may scavenge various free radicals directly, and some of them are found to suppress free radical production through inhibiting NADPH oxidases and xanthine oxidase. Additionally, polyphenols may increase antioxidative defense in normal cells by increasing the activity of NRF2, transcription factor for many protective proteins. The activation of the NRF2-mediated signaling pathways in cancer cells results in chemoresistance. Luteolin, apigenin and chrysin reduce NRF2 expression and increase the chemosensitivity of cancer cells to cytostatic drugs. Their common 5,7-dihydroxy-4H-chromen-4-one moiety, may represent a starting pharmacophore model for designing novel, non-toxic compounds for overcoming chemoresistance. However, prooxidative activity of some polyphenols (quercetin, EGCG) may also provide a basis for their use as chemotherapeutic adjuvants since they may enhance cytotoxic effects of cytostatics selectively on cancer cells. However, considerable caution is needed in applying polyphenols to anticancer therapy, since their effects greatly depend on the applied dose, the cell type, exposure time and environmental conditions.

  2. Systematic screening of lysyl oxidase-like (LOXL) family genes demonstrates that LOXL2 is a susceptibility gene to intracranial aneurysms.

    PubMed

    Akagawa, Hiroyuki; Narita, Akira; Yamada, Haruhiko; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hori, Tomokatsu; Kubota, Motoo; Saeki, Naokatsu; Hata, Akira; Mizutani, Tohru; Inoue, Ituro

    2007-05-01

    Four lysyl oxidase family genes (LOXL1, LOXL2, LOXL3, and LOXL4), which catalyze cross-linking of collagen and elastin, were considered to be functional candidates for intracranial aneurysms (IA) and were extensively screened for genetic susceptibility in Japanese IA patients. Total RNA was isolated from four paired ruptured IA and superficial temporal artery (STA) tissue and examined by real-time RT-PCR. The expression of LOXL2 in the paired IA and STA tissues was elevated in the IA tissue. A total of 55 single nucleotide polymorphisms (SNPs) of LOXL1-4 were genotyped for an allelic association study in 402 Japanese IA patients and 462 Japanese non-IA controls. Allelic associations were evaluated with the chi-square test and the permutation test especially designed for adjustment of multiple testing. SNPs of LOXL1 and LOXL4 were not significantly associated with IA, while several SNPs of LOXL2 and LOXL3 showed nominally significant associations in IA patients. We detected an empirically significant association with one SNP of LOXL2 in familial IA patients after adjustment for multiple testing [chi(2) = 10.23, empirical P = 0.023, OR (95% CI) = 1.49 (1.17, 1.90)]. Furthermore, multilocus interaction was evaluated by multifactor dimensionality reduction analysis. We found that the SNPs of LOXL2 have an interactive effect with elastin (ELN) and LIM kinase 1 (LIMK1) that have been previously found to be associated with IA. In conclusion, one SNP of LOXL2 showed a significant association with IA individually, and we also detected a gene-gene interaction of LOXL2 with ELN/LIMK1, which may play an important role in susceptibility to IA.

  3. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  4. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

    2010-01-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  5. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    PubMed

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  6. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  7. Phylogenetic position of Indian termites (Isoptera: Termitidae) with their respective genera inferred from DNA sequence analysis of the mitochondrial cytochrome oxidase gene subunit I compared to subunit II.

    PubMed

    Sharma, Vijay Lakshmi; Singla, Mandakini; Sobti, Ranbir Chander

    2013-08-20

    The present work was aimed to investigate the phylogenetic analysis of different species of Indian termites belonging to the family termitidae based on mitochondrial genes COI and COII. The sequences so obtained from public database revealed grouping of termites according to their ecological distribution. The sequences of the species under investigation were characterized on the basis of frequencies of nucleotide bases and in most of the species, a significantly high percentage of A+T base composition was observed. Phylogenetic tree revealed positioning of species according to the analysis of their cytochrome oxidase subunits.

  8. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.

    PubMed

    Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi

    2013-12-01

    Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R. solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R. solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance.

  9. Effects of water blanching on polyphenol reaction kinetics and quality of cocoa beans

    NASA Astrophysics Data System (ADS)

    Menon, A. S.; Hii, C. L.; Law, C. L.; Suzannah, S.; Djaeni, M.

    2015-12-01

    Several studies have been reported on the potential health benefits of cocoa polyphenols. However, drying has an inhibitory effect on the substantial recovery of cocoa polyphenols. This is majorly because of the high degradation of polyphenol compounds as well as the enhanced activity of polyphenol oxidases; a pre-cursor for browning of polyphenols during drying. Pre-treatment technique such as water blanching (80° and 90°C for 5 min, 10 min and 15 min exposure times respectively) can inactivate the polyphenol oxidases enzyme and promote high percent of the polyphenol recovery in dried cocoa bean. The degradation kinetics of cocoa polyphenols during hot water blanching are analyzed; The rate constant for the polyphenol degradation after blanching was found to be ranging from 0.0208 to 0.0340 /min. The results for dried fresh cocoa beans showed an optimal level of polyphenol recovery (118 mg GAE/g) when blanched at 90°C for 5 minutes duration. The antioxidant activity is also analyzed using DPPH scavenging assay.

  10. Polyphenols and Sunburn.

    PubMed

    Saric, Suzana; Sivamani, Raja K

    2016-01-01

    Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA) and ultraviolet B (UVB) radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats). Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP), Calluna vulgaris (Cv), grape seeds, honeybush, and Lepidium meyenii (maca). Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols. PMID:27618035

  11. Polyphenols and Sunburn

    PubMed Central

    Saric, Suzana; Sivamani, Raja K.

    2016-01-01

    Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA) and ultraviolet B (UVB) radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats). Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP), Calluna vulgaris (Cv), grape seeds, honeybush, and Lepidium meyenii (maca). Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols. PMID:27618035

  12. Polyphenols and Sunburn.

    PubMed

    Saric, Suzana; Sivamani, Raja K

    2016-09-09

    Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA) and ultraviolet B (UVB) radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats). Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP), Calluna vulgaris (Cv), grape seeds, honeybush, and Lepidium meyenii (maca). Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols.

  13. Wound-induced deposition of polyphenols in transgenic plants overexpressing peroxidase

    SciTech Connect

    Lagrimini, L.M. )

    1991-06-01

    Tobacco (Nicotiana tabacum) plants transformed with a chimeric tobacco anionic peroxidase gene have previously been shown to synthesize high levels of peroxidase in all tissues throughout the plant. One of several distinguishable phenotypes of transformed plants is the rapid browning of pith tissue upon wounding. Pith tissue from plants expressing high levels of peroxidase browned within 24 hours of wounding, while tissue from control plants did not brown as late as 7 days after wounding. A correlation between peroxidase activity and wound-induced browning was observed, whereas no relationship between polyphenol oxidase activity and browning was found. The purified tobacco anionic peroxidase was subjected to kinetic analysis with substrates which resemble the precursors of lignin or polyphenolic acid. The purified enzyme was found to readily polymerize phenolic acids in the presence of H{sub 2}O{sub 2} via a modified ping-pong mechanism. The percentage of lignin and lignin-related polymers in cell walls was nearly twofold greater in pith tissue isolated from peroxidase-overproducer plants compared to control plants. Lignin deposition in wounded pith tissue from control plants closely followed the induction of peroxidase activity. However, wound-induced lignification occurred 24 to 48 hours sooner in plants overexpressing the anionic peroxidase. This suggests that the availability of peroxidase rather than substrate may delay polyphenol deposition in wounded tissue.

  14. Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica.

    PubMed

    Nixon, Julie E J; Wang, Amy; Field, Jessica; Morrison, Hilary G; McArthur, Andrew G; Sogin, Mitchell L; Loftus, Brendan J; Samuelson, John

    2002-04-01

    Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen. Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis). The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible. A putative giardia [2Fe-2S]ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist). However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia [2Fe-2S]ferredoxin gene. Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis. Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer. In contrast, there was more robust phylogenetic evidence for the lateral transfer of G. lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes. In further support of lateral transfer, the G. lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E. histolytica.

  15. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    PubMed

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  16. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  17. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.

    1999-04-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  18. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease.

    PubMed

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E; Ortiz, Genaro Gabriel

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  19. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.

    PubMed

    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  20. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  1. Defects in NADPH Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel Disease

    PubMed Central

    Hayes, Patti; Dhillon, Sandeep; O'Neill, Kim; Thoeni, Cornelia; Hui, Ken Y.; Elkadri, Abdul; Guo, Conghui H.; Kovacic, Lidija; Aviello, Gabriella; Alvarez, Luis A.; Griffiths, Anne M.; Snapper, Scott B.; Brant, Steven R.; Doroshow, James H.; Silverberg, Mark S.; Peter, Inga; McGovern, Dermot P. B.; Cho, Judy; Brumell, John H.; Uhlig, Holm H.; Bourke, Billy; Muise, Aleixo A.; Knaus, Ulla G.

    2015-01-01

    Background & Aims Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD). Reactive oxygen species (ROS) generated by nicotinamide-adenine dinucleotide phosphate (NADPH) oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 209 children with very early onset inflammatory bowel disease (VEOIBD), the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn) and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys) in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. PMID:26301257

  2. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-09-01

    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  3. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

    PubMed

    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

    2015-02-01

    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  4. Impact of dietary polyphenols on carbohydrate metabolism.

    PubMed

    Hanhineva, Kati; Törrönen, Riitta; Bondia-Pons, Isabel; Pekkinen, Jenna; Kolehmainen, Marjukka; Mykkänen, Hannu; Poutanen, Kaisa

    2010-03-31

    Polyphenols, including flavonoids, phenolic acids, proanthocyanidins and resveratrol, are a large and heterogeneous group of phytochemicals in plant-based foods, such as tea, coffee, wine, cocoa, cereal grains, soy, fruits and berries. Growing evidence indicates that various dietary polyphenols may influence carbohydrate metabolism at many levels. In animal models and a limited number of human studies carried out so far, polyphenols and foods or beverages rich in polyphenols have attenuated postprandial glycemic responses and fasting hyperglycemia, and improved acute insulin secretion and insulin sensitivity. The possible mechanisms include inhibition of carbohydrate digestion and glucose absorption in the intestine, stimulation of insulin secretion from the pancreatic beta-cells, modulation of glucose release from the liver, activation of insulin receptors and glucose uptake in the insulin-sensitive tissues, and modulation of intracellular signalling pathways and gene expression. The positive effects of polyphenols on glucose homeostasis observed in a large number of in vitro and animal models are supported by epidemiological evidence on polyphenol-rich diets. To confirm the implications of polyphenol consumption for prevention of insulin resistance, metabolic syndrome and eventually type 2 diabetes, human trials with well-defined diets, controlled study designs and clinically relevant end-points together with holistic approaches e.g., systems biology profiling technologies are needed.

  5. Impact of Dietary Polyphenols on Carbohydrate Metabolism

    PubMed Central

    Hanhineva, Kati; Törrönen, Riitta; Bondia-Pons, Isabel; Pekkinen, Jenna; Kolehmainen, Marjukka; Mykkänen, Hannu; Poutanen, Kaisa

    2010-01-01

    Polyphenols, including flavonoids, phenolic acids, proanthocyanidins and resveratrol, are a large and heterogeneous group of phytochemicals in plant-based foods, such as tea, coffee, wine, cocoa, cereal grains, soy, fruits and berries. Growing evidence indicates that various dietary polyphenols may influence carbohydrate metabolism at many levels. In animal models and a limited number of human studies carried out so far, polyphenols and foods or beverages rich in polyphenols have attenuated postprandial glycemic responses and fasting hyperglycemia, and improved acute insulin secretion and insulin sensitivity. The possible mechanisms include inhibition of carbohydrate digestion and glucose absorption in the intestine, stimulation of insulin secretion from the pancreatic β–cells, modulation of glucose release from the liver, activation of insulin receptors and glucose uptake in the insulin-sensitive tissues, and modulation of intracellular signalling pathways and gene expression. The positive effects of polyphenols on glucose homeostasis observed in a large number of in vitro and animal models are supported by epidemiological evidence on polyphenol-rich diets. To confirm the implications of polyphenol consumption for prevention of insulin resistance, metabolic syndrome and eventually type 2 diabetes, human trials with well-defined diets, controlled study designs and clinically relevant end-points together with holistic approaches e.g., systems biology profiling technologies are needed. PMID:20480025

  6. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-01

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid.

  7. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-01

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid. PMID:27425865

  8. Abscisic Acid and LATERAL ROOT ORGAN DEFECTIVE/NUMEROUS INFECTIONS AND POLYPHENOLICS Modulate Root Elongation via Reactive Oxygen Species in Medicago truncatula1[W][OPEN

    PubMed Central

    Zhang, Chang; Bousquet, Amanda; Harris, Jeanne M.

    2014-01-01

    Abscisic acid (ABA) modulates root growth in plants grown under normal and stress conditions and can rescue the root growth defects of the Medicago truncatula lateral root-organ defective (latd) mutant. Here, we demonstrate that reactive oxygen species (ROS) function downstream of ABA in the regulation of root growth by controlling cell elongation. We also show that the MtLATD/NUMEROUS INFECTIONS AND POLYPHENOLICS (NIP) nitrate transporter is required for ROS homeostasis and cell elongation in roots and that this balance is perturbed in latd mutants, leading to an excess of superoxide and hydrogen peroxide and a corresponding decrease in cell elongation. We found that expression of the superoxide-generating NADPH oxidase genes, MtRbohA and MtRbohC (for respiratory burst oxidase homologs), is increased in latd roots and that inhibition of NADPH oxidase activity pharmacologically can both reduce latd root ROS levels and increase cell length, implicating NADPH oxidase function in latd root growth defects. Finally, we demonstrate that ABA treatment alleviates ectopic ROS accumulation in latd roots, restores MtRbohC expression to wild-type levels, and promotes an increase in cell length. Reducing the expression of MtRbohC using RNA interference leads to increased root elongation in both wild-type and latd roots. These results reveal a mechanism by which the MtLATD/NIP nitrate transporter and ABA modulate root elongation via superoxide generation by the MtRbohC NADPH oxidase. PMID:25192698

  9. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.

    PubMed

    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

    2014-09-01

    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function.

  10. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  11. Gene flow between Drosophila yakuba and Drosophila santomea in subunit V of cytochrome c oxidase: A potential case of cytonuclear cointrogression

    PubMed Central

    Beck, Emily A.; Thompson, Aaron C.; Sharbrough, Joel; Brud, Evgeny; Llopart, Ana

    2015-01-01

    Introgression is the effective exchange of genetic information between species through natural hybridization. Previous genetic analyses of the Drosophila yakuba—D. santomea hybrid zone showed that the mitochondrial genome of D. yakuba had introgressed into D. santomea and completely replaced its native form. Since mitochondrial proteins work intimately with nuclear‐encoded proteins in the oxidative phosphorylation (OXPHOS) pathway, we hypothesized that some nuclear genes in OXPHOS cointrogressed along with the mitochondrial genome. We analyzed nucleotide variation in the 12 nuclear genes that form cytochrome c oxidase (COX) in 33 Drosophila lines. COX is an OXPHOS enzyme composed of both nuclear‐ and mitochondrial‐encoded proteins and shows evidence of cytonuclear coadaptation in some species. Using maximum‐likelihood methods, we detected significant gene flow from D. yakuba to D. santomea for the entire COX complex. Interestingly, the signal of introgression is concentrated in the three nuclear genes composing subunit V, which shows population migration rates significantly greater than the background level of introgression in these species. The detection of introgression in three proteins that work together, interact directly with the mitochondrial‐encoded core, and are critical for early COX assembly suggests this could be a case of cytonuclear cointrogression. PMID:26155926

  12. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata.

    PubMed

    Costa, José Hélio; Mota, Erika Freitas; Cambursano, Mariana Virginia; Lauxmann, Martin Alexander; de Oliveira, Luciana Maia Nogueira; Silva Lima, Maria da Guia; Orellano, Elena Graciela; Fernandes de Melo, Dirce

    2010-05-01

    Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and 2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants, VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2 revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-element that is responsive to oxidative stress. Taken together, the data provide evidence for co-expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination. The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b gene of V. unguiculata has acquired inducible regulatory elements.

  13. Inhibition of Nm23H2 Gene Product (NDPK-B) by Angiostatin, Polyphenols and Nucleoside Analogs

    PubMed Central

    Buxton, Iain L. O.

    2009-01-01

    Human breast cancer cells (MDA-MB-435s) secrete a nucleoside diphosphate kinase (NDPK-B) as a phosphoprotein capable of converting diphosphate nucleosides to triphosphate nucleotides for one round in the absence of a phosphoryl donor. Incubation of the partially purified NDPK-B (Nm23-H2 by Western blot) from [γ32P]Pi-labeled cells with non-radioactive ADP results in the formation of [γ32P]ATP (Proc. West. Pharmacol. Soc. 44: 61–63, 2001). The presence of a secreted protein that can maintain ATP levels in the vicinity of capillary and lymph vessels may support cancer metastasis in several ways based on the known actions of ATP at P2Y receptors: facilitate intravasation of breast cancer cells that migrate from a solid tumor, support their extravasation at a distal site, and stimulate angiogenesis. The putative role of angiostatin (AS) as an ATP-synthase inhibitor led us to test the notion that AS blocks NDPK-B activity. Addition of commercial AS (kringles 1–4) did not alter enzyme activity. However, AS produced by us and never lyophilized, blocked NDPK activity in a dose-dependent fashion consistent with the notion that extracellular ATP generation by tumor cells may be important to the development of metastases. The ability of 0.5 mg/ml angiostatin to block NDPK-B activity to ~75% of control activity compared poorly with the polyphenol inhibitors of. The catechin gallates, theaflavins and ellagic acid inhibited NDPK-B completely with the rank order of potency: EA>theaflavins>EGCG>ECG>PAPS. Our results suggest that the biological activity of angiostatin as a putative metastasis inhibitor may be in part the result of nm23 inhibition and that the production, lyophilization, packaging or storage of commercial angiostatin leads to the alteration of its biological activity against NDPK-B. Ellagic acid is a potent (IC50 = 10.5 µM) NDPK-B inhibitor that may prove useful in elucidating the role of cancer-cell secreted NDPK-B in tumor development. PMID:19544670

  14. A negative regulating element controlling transcription of the gene encoding acyl-CoA oxidase in Saccharomyces cerevisiae.

    PubMed Central

    Wang, T W; Lewin, A S; Small, G M

    1992-01-01

    Peroxisomes are induced in Saccharomyces cerevisiae when this yeast is grown in the presence of oleate, and are repressed when glucose is supplied as the carbon source. Concomitant with this is an induction/repression of peroxisomal beta-oxidation enzymes. We are investigating the transcriptional control of acyl-CoA oxidase, the first and rate-limiting enzyme in the peroxisomal beta-oxidation cycle. The promoter region of POX1 from S. cerevisiae has been analyzed in POX1/lacZ fusions. Expression of the POX1/lacZ fusion protein underwent glucose repression and oleate induction. By deletion, DNA band shift and DNase I footprinting analyses we have identified a region that is involved in transcriptional repression of POX1. Elimination of this DNA sequence results in constitutive expression of POX1 when S. cerevisiae is grown on a fermentable carbon source or glycerol. Images PMID:1630920

  15. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.

    PubMed

    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

    2014-07-01

    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded.

  16. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity. PMID:26869262

  17. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity.

  18. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

    1994-01-01

    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide

  19. Polyphenols and Glycemic Control.

    PubMed

    Kim, Yoona; Keogh, Jennifer B; Clifton, Peter M

    2016-01-05

    Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1), stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5' adenosine monophosphate-activated protein kinase (AMPK), modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols.

  20. Polyphenols and Glycemic Control

    PubMed Central

    Kim, Yoona; Keogh, Jennifer B.; Clifton, Peter M.

    2016-01-01

    Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1), stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5′ adenosine monophosphate-activated protein kinase (AMPK), modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols. PMID:26742071

  1. Polyphenols and Glycemic Control.

    PubMed

    Kim, Yoona; Keogh, Jennifer B; Clifton, Peter M

    2016-01-01

    Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1), stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5' adenosine monophosphate-activated protein kinase (AMPK), modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols. PMID:26742071

  2. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  3. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    PubMed

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons.

  4. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  5. Thiol modification by bioactivated polyphenols and its potential role in skin inflammation.

    PubMed

    Nakamura, Yoshimasa; Ishii, Takeshi; Abe, Naomi; Murata, Yoshiyuki

    2014-01-01

    In the present study, we evaluated the modifying behavior of simple phenolic compounds on the sulfhydryl groups of glutathione and proteins. The catechol-type polyphenols, including protocatechuic acid, but neither the monophenols nor O-methylated catechol, can modify the sulfhydryl groups in a phenol oxidase-dependent manner. The possible involvement of polyphenol bioactivation in the enhancement of skin inflammation was also suggested.

  6. Phylogeography of stable fly (Diptera: Muscidae) estimated by diversity at ribosomal 16S and cytochrome oxidase I mitochondrial genes.

    PubMed

    Marquez, J G; Cummings, M A; Krafsur, E S

    2007-11-01

    The blood-feeding cosmopolitan stable fly, Stomoxys calcitrans L. (Diptera: Muscidae), is thought to disperse rapidly and widely, and earlier studies of allozyme variation were consistent with high vagility in this species. The geographic origins of New World populations are unknown. Diversity at mitochondrial loci r16S and cytochrome oxidase I was examined in 277 stable flies from 11 countries, including five zoogeographical regions. Of 809 nucleotides, 174 were polymorphic and 133 were parsimony informative. Seventy-six haplotypes were found in frequencies consistent with the Wright-Fisher infinite allele model. None were shared among four or more zoogeographical regions. The null hypothesis of mutation neutrality was not rejected, thereby validating the observed distribution. Fifty-nine haplotypes were singular, eight were private and confined to the Old World, and three of 76 haplotypes were shared between the Old and New World. Only 19 haplotypes were found in the New World, 14 of which were singletons. Haplotype and nucleotide diversities were heterogeneous among countries and regions. The most diversity was observed in sub-Saharan Africa. Regional differentiation indices were C(RT) = 0.26 and N(RT) = 0.31, indicating populations were highly structured macrogeographically. Palearctic and New World flies were the least differentiated from each other. There were strong genetic similarities among populations in the Nearctic, Neotropical, and Palearctic regions, and it is most likely that New World populations were derived from the Palearctic after 1492 CE, in the colonial era. PMID:18047198

  7. A role for active oxygen species as second messengers in the induction of alternative oxidase gene expression in Petunia hybrida cells.

    PubMed

    Wagner, A M

    1995-07-17

    Incubation of Petunia hybrida cells with H2O2 leads to an increase in alternative oxidase activity measured after 24 h. This increased activity is accompanied by an increase in alternative oxidase protein. A model is presented for the regulation of alternative oxidase protein synthesis in which active oxygen species and especially H2O2 play a crucial role as second messengers in the signal transducing pathway from the mitochondria to the nucleus. It is proposed that also the induction of the alternative oxidase by salicylic acid is mediated via H2O2.

  8. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.

  9. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  10. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.

    PubMed

    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C

    2003-12-01

    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  11. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  12. Cytochrome oxidase 1 gene sequence analysis in six flatfish species (Teleostei, Pleuronectidae) of Far East Russia with inferences in phylogeny and taxonomy.

    PubMed

    Kartavtsev, Yuri Ph; Sharina, Svetlana N; Goto, Tadasuke; Chichvarkhin, Anton Y; Balanov, Andrey A; Vinnikov, Kirill A; Ivankov, Vyacheslav N; Hanzawa, Naoto

    2008-12-01

    Mitochondrial DNA at the cytochrome oxidase 1 (Co-1) gene region was sequenced for six flatfish species (in total, 11 sequences of at least 539 base pairs) from the Far East of Russia and compared with other sequences of Pleuronectiformes, comprising altogether 26 flatfish sequences and two outgroup sequences (Perciformes). An analysis of the protein-coding Co-1 gene revealed a statistically substantiated bias in (T + C):(A + G) content, supporting earlier findings. Average scores of the p-distances for different scales of the evolutionary history at the Co-1 gene revealed a clear pattern of increased nucleotide diversity at four different levels: (1) intraspecies, (2) intragenus, (3) intrafamily, and (4) intra-order. Scores of average p-distances of the four categories of comparison in flatfishes were (1) 0.17 +/- 0.09%, (2) 10.60 +/- 1.57%, (3) 12.40 +/- 0.27%, and (4) 19.93 +/- 0.05%, respectively (mean +/- standard error). These data jointly with current knowledge support the concept that speciation in the order Pleuronectiformes mostly follows a geographic mode through accumulation of numerous small genetic changes over a long period of time. A phylogenetic tree for 26 sequences of flatfishes and two other fishes belonging to ray-finned fishes (Actinopterigii) was developed using the Co-1 gene and four different analytical approaches: neighbour-joining, Bayesian (BA), maximum parsimony (MP), and maximum likelihood. The analysis revealed a monophyletic origin for the representatives of Pleuronectidae, which is the principal flatfish family investigated (73-100% support level in our MP and BA analyses). According to the current and literary data, the monophyletic origin for the six compared flatfish families was well supported. Species identification on a per-individual basis (barcoding tagging) was high.

  13. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.

    PubMed

    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A

    2016-08-30

    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  14. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants.

  15. The Chemopreventive and Chemotherapeutic Potentials of Tea Polyphenols

    PubMed Central

    Thakur, Vijay S; Gupta, Karishma; Gupta, Sanjay

    2011-01-01

    Tea is the second most consumed beverage in the world reported to have multiple health benefits. Preventive and therapeutic benefits of tea polyphenols include enhanced general well being and anti-neoplastic effects. The pharmacologic action of tea is often attributed to various catechins present therein. Experiments conducted in cancer cell lines and animal models demonstrate that tea polyphenols protect against cellular damage caused by oxidative stress and altered immunity. Tea polyphenols modify various metabolic and signaling pathways in the regulation of proliferation, apoptosis, angiogenesis, and metastasis and therefore restrict clonal expansion of cancer cells. Tea polyphenols have been shown to reactivate tumor suppressors, block the unlimited replicative potential of cancer cells, and physically bind to nucleic acids involved in epigenetic alterations of gene regulation. Remarkable interest in green tea as a potential chemopreventive agent has been generated since recent epigenetic data showed that tea polyphenols have the potential to reverse epigenetic modifications which might otherwise be carcinogenic. Like green tea, black tea may also possess chemopreventive and chemotherapeutic potential; however, there is still not enough evidence available to make any conclusive statements. Here we present a brief description of tea polyphenols and discuss the findings of various in vitro and in vivo studies of the anticancer effects of tea polyphenols. Detailed discussion of various studies related to epigenetic changes caused by tea polyphenols leading to prevention of oncogenesis or cancer progression is included. Finally, we discuss on the scope and development of tea polyphenols in cancer prevention and therapy. PMID:21466438

  16. Polyphenols and aging.

    PubMed

    Queen, Brannon L; Tollefsbol, Trygve O

    2010-02-01

    Age-associated changes within an individual are inherently complex and occur at multiple levels of organismal function. The overall decline in function of various tissues is known to play a key role in both aging and the complex etiology of certain age-associated diseases such as Alzheimer's disease (AD) and cancer. Continuing research highlights the dynamic capacity of polyphenols to protect against age-associated disorders through a variety of important mechanisms. Numerous lines of evidence suggest that dietary polyphenols such as resveratrol, (-)-epigallocatechin-3-gallate (EGCG), and curcumin have the capacity to mitigate age-associated cellular damage induced via metabolic production of reactive oxygen species (ROS). However, recently acquired evidence also demonstrates a likely role for these polyphenols as anticancer agents capable of preventing formation of new vasculature in neoplastic tissues. Polyphenols have also been shown to possess other anticancer properties such as specific cell-signaling actions that may stimulate the activity of the regulatory protein SIRT1. Additionally, polyphenolic compounds have demonstrated their inhibitory effects against chronic vascular inflammation associated with atherosclerosis. These increasingly well-documented results have begun to provide a basis for considering the use of polyphenols in the development of novel therapies for certain human diseases. And while the mechanisms by which these effects occur are yet to be fully understood, it is evident that further investigation may yield a potential use for polyphenols as pharmacological interventions against specific age-associated diseases.

  17. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  18. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  19. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  20. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  1. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

    PubMed

    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

    2015-07-01

    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and for