Sample records for potential active site

  1. Enzyme/non-enzyme discrimination and prediction of enzyme active site location using charge-based methods.

    PubMed

    Bate, Paul; Warwicker, Jim

    2004-07-02

    Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.

  2. OFF THE SAND AND ONTO THE ASPHALT: DOES THE URBAN HEAT ISLAND INFLUENCE DESERT LIZARDS?

    EPA Science Inventory

    Lower lizard diversity and potential activity likely will be found at hotter sites in summer, with higher potential lizard activity at hotter sites in winter.

    Potential to Further Environmental/Human Health Protection

    This study will i...

  3. 10 CFR 960.3-2-1 - Site screening for potentially acceptable sites.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Implementation Guidelines § 960.3-2-1 Site screening for... first repository, the process shall begin with site-screening activities that consider large land masses... repositories, the Secretary shall first identify the State within which the site is located in a decision-basis...

  4. Impact of intertidal oyster trestle cultivation on the Ecological Status of benthic habitats.

    PubMed

    Forde, James; O'Beirn, Francis X; O'Carroll, Jack Pj; Patterson, Adrian; Kennedy, Robert

    2015-06-15

    A considerable number of Ireland's shellfish production areas co-occur with or are adjacent to Natura 2000 sites which are protected under European legislation. To investigate the general interaction between trestle oyster cultivation and the surrounding intertidal environment, six sites were selected within designated Natura 2000 sites. At each trestle site three Treatment areas were sampled. One Treatment area corresponded to potential impacts associated with cultivation activities occurring at trestle structures (designated the Trestle Treatment) while one Treatment area corresponded to potential impacts due to cultivation activities occurring along access routes (the Access Treatment). An area not subject to any known anthropogenic activity was used as a control (the Control Treatment). Potential impacts associated with Trestle Treatment areas included changes in sediment total organic matter (TOM) levels underneath trestles due to the bio-deposition of faecal/pseudofaecal material while the predominant impact associated with Access Treatment areas was compaction of sediments due to heavy vehicle traffic. In this study, macrobenthic communities at the sites were highly variable and exhibited low levels of diversity which prevented the detection of general effects of cultivation activity on community structure, diversity and secondary production. To overcome this variability, the Infaunal Quality Index (IQI) was used to assess impacts on Ecological Status (ES) of benthic communities (sensu Water Framework Directive). Relative to Control and Trestle Treatment areas, activities occurring at Access Treatment areas had a significant negative impact on ES. This study highlights the potential of the IQI for the management of aquaculture activity and provides validation for the use of the IQI in Irish intertidal environments. This study also highlights the IQI as a potential tool for assessing the conservation status of designated habitats in Natura 2000 sites. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    PubMed

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  6. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1

    PubMed Central

    Pryce, David W.; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J.

    2009-01-01

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion. PMID:19273851

  7. Structural inhibition and reactivation of Escherichia coli septation by elements of the SOS and TER pathways

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dopazo, A.; Tormo, A.; Aldea, M.

    1987-04-01

    The inhibition of cell division caused by induction of the SOS pathway in Escherichia coli structurally blocks septation, as deduced from two sets of results. Potential septation sites active at the time of SOS induction became inactivated, while those initiated during the following doubling time were active. Penicillin resistance increased in wild-type UV light-irradiated cells, a behavior similar to that observed in mutants in which structural blocks were introduced by inactivation of FtsA. Potential septation sites that have been structurally blocked by either the SOS division inhibitor, furazlocillin inhibition of PBP3, or inactivation of a TER pathway component, FtsA3, couldmore » be reactivated one doubling time after removal of the inhibitory agent in the presence of an active lon gene product. Reactivation of potential septation sites blocked by the presence of an inactivated FtsA3 was significantly lower when the lon protease was not active, suggesting that Lon plays a role in the removal of inactivated TER pathway products from the blocked potential septation sites.« less

  8. Stepwise Loop Insertion Strategy for Active Site Remodeling to Generate Novel Enzyme Functions.

    PubMed

    Hoque, Md Anarul; Zhang, Yong; Chen, Liuqing; Yang, Guangyu; Khatun, Mst Afroza; Chen, Haifeng; Hao, Liu; Feng, Yan

    2017-05-19

    The remodeling of active sites to generate novel biocatalysts is an attractive and challenging task. We developed a stepwise loop insertion strategy (StLois), in which randomized residue pairs are inserted into active site loops. The phosphotriesterase-like lactonase from Geobacillus kaustophilus (GkaP-PLL) was used to investigate StLois's potential for changing enzyme function. By inserting six residues into active site loop 7, the best variant ML7-B6 demonstrated a 16-fold further increase in catalytic efficiency toward ethyl-paraoxon compared with its initial template, that is a 609-fold higher, >10 7 fold substrate specificity shift relative to that of wild-type lactonase. The remodeled variants displayed 760-fold greater organophosphate hydrolysis activity toward the organophosphates parathion, diazinon, and chlorpyrifos. Structure and docking computations support the source of notably inverted enzyme specificity. Considering the fundamental importance of active site loops, the strategy has potential for the rapid generation of novel enzyme functions by loop remodeling.

  9. Computer simulation of the active site of human serum cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kefang Jiao; Song Li; Zhengzheng Lu

    1996-12-31

    The first 3D-structure of acetylchelinesterase from Torpedo California electric organ (T.AChE) was published by JL. Sussman in 1991. We have simulated 3D-structure of human serum cholinesterase (H.BuChE) and the active site of H.BuChE. It is discovered by experiment that the residue of H.BuChE is still active site after a part of H.BuChE is cut. For example, the part of 21KD + 20KD is active site of H.BuChE. The 20KD as it is. Studies on these peptides by Hemelogy indicate that two active peptides have same negative electrostatic potential maps diagram. These negative electrostatic areas attached by acetyl choline with positivemore » electrostatic potency. We predict that 147...236 peptide of AChE could be active site because it was as 20KD as with negative electrostatic potential maps. We look forward to proving from other ones.« less

  10. A Potential Biofilm Metabolite Signature for Caries Activity - A Pilot Clinical Study

    PubMed Central

    Zandona, F; Soini, HA; Novotny, MV; Santiago, E; Eckert, GJ; Preisser, JS; Benecha, HK; Arthur, RA; Zero, DT

    2016-01-01

    Background This study's aim was to compare the dental biofilm metabolite-profile of caries-active (N=11) or caries-free (N=4) children by gas chromatography-mass spectrometry (GC/MS) analyses. Methods Samples collected after overnight fasting, with or without a previous glucose rinse, were combined for each child based on the caries status of the site, re-suspended in ethanol and analyzed by GC/MS. Results Biofilm from caries-active sites exhibited a different chromatographic profile compared to caries-free sites. Qualitative and quantitative analysis suggested a special cluster of branched alcohols and esters present at substantially higher intensity in biofilms of caries-active sites. Conclusions This pilot study indicates that there are metabolites present in the biofilm which have the potential to provide a characteristic metabolomics signature for caries activity. PMID:27885354

  11. Cortico-cortical evoked potentials for sites of early versus late seizure spread in stereoelectroencephalography.

    PubMed

    Lega, Bradley; Dionisio, Sasha; Flanigan, Patrick; Bingaman, William; Najm, Imad; Nair, Dileep; Gonzalez-Martinez, Jorge

    2015-09-01

    Cortico-cortical evoked potentials offer the possibility of understanding connectivity within seizure networks to improve diagnosis and more accurately identify candidates for seizure surgery. We sought to determine if cortico-cortical evoked potentials and post-stimulation oscillatory changes differ for sites of EARLY versus LATE ictal spread. 37 patients undergoing stereoelectroencephalography were tested using a cortico-cortical evoked potential paradigm. All electrodes were classified according to the speed of ictal spread. EARLY spread sites were matched to a LATE spread site equidistant from the onset zone. Root-mean-square was used to quantify evoked responses and post-stimulation gamma band power and coherence were extracted and compared. Sites of EARLY spread exhibited significantly greater evoked responses after stimulation across all patients (t(36)=2.973, p=0.004). Stimulation elicited enhanced gamma band activity at EARLY spread sites (t(36)=2.61, p=0.03, FDR corrected); this gamma band oscillation was highly coherent with the onset zone. Cortico-cortical evoked potentials and post-stimulation changes in gamma band activity differ between sites of EARLY versus LATE ictal spread. The oscillatory changes can help visualize connectivity within the seizure network. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Extending the Diffuse Layer Model of Surface Acidity Behavior: III. Estimating Bound Site Activity Coefficients

    EPA Science Inventory

    Although detailed thermodynamic analyses of the 2-pK diffuse layer surface complexation model generally specify bound site activity coefficients for the purpose of accounting for those non-ideal excess free energies contributing to bound site electrochemical potentials, in applic...

  13. Discovery and characterization of a new family of lytic polysaccharide monooxygenases.

    PubMed

    Hemsworth, Glyn R; Henrissat, Bernard; Davies, Gideon J; Walton, Paul H

    2014-02-01

    Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They are attracting considerable attention owing to their potential use in biomass conversion, notably in the production of biofuels. Previous studies have identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here, we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the three-dimensional structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active center featuring the 'histidine brace' active site, but is distinct in terms of its active site details and its EPR spectroscopy. The newly characterized AA11 family expands the LPMO clan, potentially broadening both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs.

  14. Water stress impacts on bacterial carbon monoxide oxidation on recent volcanic deposits.

    PubMed

    Weber, Carolyn F; King, Gary M

    2009-12-01

    Water availability oscillates dramatically on young volcanic deposits, and may control the distribution and activity of microbes during early stages of biological succession. Carbon monoxide (CO)-oxidizing bacteria are among the pioneering colonists on volcanic deposits and are subjected to these water stresses. We report here the effects of water potential on CO-oxidizing bacteria in unvegetated (bare) and vegetated (canopy) sites on a 1959 volcanic deposit on Kilauea Volcano (Hawai'i). Time course measurements of water potential showed that average water potentials in the surface layer (0-1 cm) of canopy soil remained between -0.1 and 0 MPa, whereas dramatic diurnal oscillations (for example, between -60 and 0 MPa) occur in bare site surface cinders. During a moderate drying event in situ (-1.7 to 0 MPa), atmospheric CO consumption by intact bare site cores decreased 2.7-fold. For bare and canopy surface samples, maximum potential CO oxidation rates decreased 40 and 60%, respectively, when water potentials were lowered from 0 to -1.5 MPa in the laboratory. These observations indicated that CO oxidation is moderately sensitive to changes in water potential. Additional analyses showed that CO oxidation resumes within a few hours of rehydration, even after desiccation at -150 MPa for 63 days. Samples from both sites exposed to multiple cycles of drying and rewetting (-80 to 0 MPa), lost significant activity after the first cycle, but not after subsequent cycles. Similar responses of CO oxidation in both sites suggested that active CO-oxidizing communities in bare and canopy sites do not express differential adaptations to water stress.

  15. Information Technology Division’s Technical Paper Abstracts

    DTIC Science & Technology

    1994-07-05

    antenna systems. 86 Title: An Electromagnetic Interference Study of Potential Transmitter Sites for the HF Active Auroral Research Program ( HAARP ...examined a number of potential sites for the location of the proposed High Frequency Active Auroral Research Program ( HAARP ) transmitter facility. The...proposed HAARP facility will consist of a large planar array of antennas excited by phased high power transmitters operating in the lower portion of the

  16. De novo active sites for resurrected Precambrian enzymes

    NASA Astrophysics Data System (ADS)

    Risso, Valeria A.; Martinez-Rodriguez, Sergio; Candel, Adela M.; Krüger, Dennis M.; Pantoja-Uceda, David; Ortega-Muñoz, Mariano; Santoyo-Gonzalez, Francisco; Gaucher, Eric A.; Kamerlin, Shina C. L.; Bruix, Marta; Gavira, Jose A.; Sanchez-Ruiz, Jose M.

    2017-07-01

    Protein engineering studies often suggest the emergence of completely new enzyme functionalities to be highly improbable. However, enzymes likely catalysed many different reactions already in the last universal common ancestor. Mechanisms for the emergence of completely new active sites must therefore either plausibly exist or at least have existed at the primordial protein stage. Here, we use resurrected Precambrian proteins as scaffolds for protein engineering and demonstrate that a new active site can be generated through a single hydrophobic-to-ionizable amino acid replacement that generates a partially buried group with perturbed physico-chemical properties. We provide experimental and computational evidence that conformational flexibility can assist the emergence and subsequent evolution of new active sites by improving substrate and transition-state binding, through the sampling of many potentially productive conformations. Our results suggest a mechanism for the emergence of primordial enzymes and highlight the potential of ancestral reconstruction as a tool for protein engineering.

  17. Conservation and Role of Electrostatics in Thymidylate Synthase.

    PubMed

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C

    2015-11-27

    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  18. A Feasibility Study to Evaluate Wind Energy Potential on the Navajo Nation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terry Battiest

    2012-11-30

    The project, A Feasibility Study to Evaluate Wind Energy Potential on the Navajo Nation, is funded under a solicitation issued by the U.S. Department of Energy Tribal Energy Program. Funding provided by the grant allowed the Navajo Nation to measure wind potential at two sites, one located within the boundaries of the Navajo Nation and the other off-reservation during the project period (September 5, 2005 - September 30, 2009). The recipient for the grant award is the Navajo Tribal Utility Authority (NTUA). The grant allowed the Navajo Nation and NTUA manage the wind feasibility from initial site selection through themore » decision-making process to commit to a site for wind generation development. The grant activities help to develop human capacity at NTUA and help NTUA to engage in renewable energy generation activities, including not only wind but also solar and biomass. The final report also includes information about development activities regarding the sited included in the grant-funded feasibility study.« less

  19. Yucca Mountain Biological Resources Monitoring Program. Progress report, January 1994--December 1994

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-07-01

    The US Department of Energy (DOE) is required by the Nuclear Waste Policy Act of 1982 (as amended in 1987) to study and characterize the suitability of Yucca Mountain as a potential geological repository for high-level nuclear waste. During site characterization, the DOE will conduct a variety of geotechnical, geochemical, geological, and hydrological studies to determine the suitability of Yucca Mountain as a potential repository. To ensure that site characterization activities do not adversely affect the environment at Yucca Mountain, a program has been implemented to monitor and mitigate potential impacts and ensure activities comply with applicable environmental regulations. Thismore » report describes the activities and accomplishments of EG and G Energy Measurements, Inc. (EG and G/EM) from January 1994 through December 1994 for six program areas within the Terrestrial Ecosystem component of the environmental program for the Yucca Mountain Site Characterization Project (YMP): Site Characterization Effects, Desert Tortoises (Gopherus agassizii), Habitat Reclamation, Monitoring and Mitigation, Radiological Monitoring, and Biological Support.« less

  20. Yucca Mountain biological resources monitoring program; Annual report FY92

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1993-02-01

    The US Department of Energy (DOE) is required by the Nuclear Waste Policy Act of 1982 (as amended in 1987) to study and characterize Yucca Mountain as a potential site for a geologic repository for high-level nuclear waste. During site characterization, the DOE will conduct a variety of geotechnical, geochemical, geological, and hydrological studies to determine the suitability of Yucca Mountain as a potential repository. To ensure that site characterization activities (SCA) do not adversely affect the environment at Yucca Mountain, an environmental program has been implemented to monitor and mitigate potential impacts and ensure activities comply with applicable environmentalmore » regulations. This report describes the activities and accomplishments of EG&G Energy Measurements, Inc. (EG&G/EM) during fiscal year 1992 (FY92) for six program areas within the Terrestrial Ecosystem component of the YMP environmental program. The six program areas are Site Characterization Effects, Desert Tortoises, Habitat Reclamation, Monitoring and Mitigation, Radiological Monitoring, and Biological Support.« less

  1. In vitro toxicity of particulate matter (PM) collected at different sites in the Netherlands is associated with PM composition, size fraction and oxidative potential - the RAPTES project

    PubMed Central

    2011-01-01

    Background Ambient particulate matter (PM) exposure is associated with respiratory and cardiovascular morbidity and mortality. To what extent such effects are different for PM obtained from different sources or locations is still unclear. This study investigated the in vitro toxicity of ambient PM collected at different sites in the Netherlands in relation to PM composition and oxidative potential. Method PM was sampled at eight sites: three traffic sites, an underground train station, as well as a harbor, farm, steelworks, and urban background location. Coarse (2.5-10 μm), fine (< 2.5 μm) and quasi ultrafine PM (qUF; < 0.18 μm) were sampled at each site. Murine macrophages (RAW 264.7 cells) were exposed to increasing concentrations of PM from these sites (6.25-12.5-25-50-100 μg/ml; corresponding to 3.68-58.8 μg/cm2). Following overnight incubation, MTT-reduction activity (a measure of metabolic activity) and the release of pro-inflammatory markers (Tumor Necrosis Factor-alpha, TNF-α; Interleukin-6, IL-6; Macrophage Inflammatory Protein-2, MIP-2) were measured. The oxidative potential and the endotoxin content of each PM sample were determined in a DTT- and LAL-assay respectively. Multiple linear regression was used to assess the relationship between the cellular responses and PM characteristics: concentration, site, size fraction, oxidative potential and endotoxin content. Results Most PM samples induced a concentration-dependent decrease in MTT-reduction activity and an increase in pro-inflammatory markers with the exception of the urban background and stop & go traffic samples. Fine and qUF samples of traffic locations, characterized by a high concentration of elemental and organic carbon, induced the highest pro-inflammatory activity. The pro-inflammatory response to coarse samples was associated with the endotoxin level, which was found to increase dramatically during a three-day sample concentration procedure in the laboratory. The underground samples, characterized by a high content of transition metals, showed the largest decrease in MTT-reduction activity. PM size fraction was not related to MTT-reduction activity, whereas there was a statistically significant difference in pro-inflammatory activity between Fine and qUF PM. Furthermore, there was a statistically significant negative association between PM oxidative potential and MTT-reduction activity. Conclusion The response of RAW264.7 cells to ambient PM was markedly different using samples collected at various sites in the Netherlands that differed in their local PM emission sources. Our results are in support of other investigations showing that the chemical composition as well as oxidative potential are determinants of PM induced toxicity in vitro. PMID:21888644

  2. Insights into intermolecular interactions, electrostatic properties and the stability of C646 in the binding pocket of p300 histone acetyltransferase enzyme: a combined molecular dynamics and charge density study.

    PubMed

    Sivanandam, Magudeeswaran; Saravanan, Kandasamy; Kumaradhas, Poomani

    2017-10-30

    Histone acetyltransferases (HATs) and histone deacetylases (HDACs) are enzymes that exhibit an important transcription activity. Dysfunction of these enzymes may lead to different diseases including cancer, cardiovascular, and other diseases. Therefore, these enzymes are the potential target for the generation of new therapeutics. C646 is a synthetic p300 HAT inhibitor; its structural and the electrostatic properties are the paradigm to understand its activity in the active site of p300 HAT enzyme. The docked C646 molecule in the active site forms expected key intermolecular interactions with the amino acid residues Trp1436, Tyr1467, and one water molecule (W1861); and these interactions are important for acetylation reaction. When compare the active site structure of C646 with the gas-phase structure, it is confirmed that the electron density distribution of polar bonds are highly altered, when the molecule present in the active site. In the gas-phase structure of C646, a large negative regions of electrostatic potential is found at the vicinity of O(4), O(5), and O(6) atoms; whereas, the negative region of these atoms are reduced in the active site. The molecular dynamics (MD) simulation also performed, it reveals the conformational stability and the intermolecular interactions of C646 molecule in the active site of p300.

  3. DFT study of the active site of the XoxF-type natural, cerium-dependent methanol dehydrogenase enzyme.

    PubMed

    Bogart, Justin A; Lewis, Andrew J; Schelter, Eric J

    2015-01-19

    Rare-earth metal cations have recently been demonstrated to be essential co-factors for the growth of the methanotrophic bacterium Methylacidiphilum fumariolicum SolV. A crystal structure of the rare-earth-dependent methanol dehydrogenase (MDH) includes a cerium cation in the active site. Herein, the Ce-MDH active site has been analyzed through DFT calculations. The results show the stability of the Ce(III)-pyrroloquinoline quinone (PQQ) semiquinone configuration. Calculations on the active oxidized form of this complex indicate a 0.81 eV stabilization of the PQQ(0) LUMO at cerium versus calcium, supporting the observation that the cerium cation in the active site confers a competitive advantage to Methylacidiphilum fumariolicum SolV. Using reported aqueous electrochemical data, a semi-empirical correlation was established based on cerium(IV/III) redox potentials. The correlation allowed estimation of the cerium oxidation potential of +1.35 V versus saturated calomel electrode (SCE) in the active site. The results are expected to guide the design of functional model complexes and alcohol-oxidation catalysts based on lanthanide complexes of biologically relevant quinones. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Platinum nanoparticle during electrochemical hydrogen evolution: Adsorbate distribution, active reaction species, and size effect

    DOE PAGES

    Tan, Teck L.; Wang, Lin -Lin; Zhang, Jia; ...

    2015-03-02

    For small Pt nanoparticles (NPs), catalytic activity is, as observed, adversely affected by size in the 1–3 nm range. We elucidate, via first-principles-based thermodynamics, the operation H* distribution and cyclic voltammetry (CV) during the hydrogen evolution reaction (HER) across the electrochemical potential, including the underpotential region (U ≤ 0) that is difficult to assess in experiment. We consider multiple adsorption sites on a 1 nm Pt NP model and show that the characteristic CV peaks from different H* species correspond well to experiment. We next quantify the activity contribution from each H* species to explain the adverse effect of size.more » From the resolved CV peaks at the standard hydrogen electrode potential (U = 0), we first deduce that the active species for the HER are the partially covered (100)-facet bridge sites and the (111)-facet hollow sites. Upon evaluation of the reaction barriers at operation H* distribution and microkinetic modeling of the exchange current, we find that the nearest-neighbor (100)-facet bridge site pairs have the lowest activation energy and contribute to ~75% of the NP activity. Edge bridge sites (fully covered by H*) per se are not active; however, they react with neighboring (100)-facet H* to account for ~18% of the activity, whereas (111)-facet hollow sites contribute little. As a result, extrapolating the relative contributions to larger NPs in which the ratio of facet-to-edge sites increases, we show that the adverse size effect of Pt NP HER activity kicks in for sizes below 2 nm.« less

  5. What Motivates Young Adults to Talk About Physical Activity on Social Network Sites?

    PubMed Central

    Campo, Shelly; Yang, Jingzhen; Eckler, Petya; Snetselaar, Linda; Janz, Kathleen; Leary, Emily

    2017-01-01

    Background Electronic word-of-mouth on social network sites has been used successfully in marketing. In social marketing, electronic word-of-mouth about products as health behaviors has the potential to be more effective and reach more young adults than health education through traditional mass media. However, little is known about what motivates people to actively initiate electronic word-of-mouth about health behaviors on their personal pages or profiles on social network sites, thus potentially reaching all their contacts on those sites. Objective This study filled the gap by applying a marketing theoretical model to explore the factors associated with electronic word-of-mouth on social network sites about leisure-time physical activity. Methods A Web survey link was sent to undergraduate students at one of the Midwestern universities and 439 of them completed the survey. Results The average age of the 439 participants was 19 years (SD=1 year, range: 18-24). Results suggested that emotional engagement with leisure-time physical activity (ie, affective involvement in leisure-time physical activity) predicted providing relevant opinions or information on social network sites. Social network site users who perceived stronger ties with all their contacts were more likely to provide and seek leisure-time physical activity opinions and information. People who provided leisure-time physical activity opinions and information were more likely to seek opinions and information, and people who forwarded information about leisure-time physical activity were more likely to chat about it. Conclusions This study shed light on the application of the electronic word-of-mouth theoretical framework in promoting health behaviors. The findings can also guide the development of future social marketing interventions using social network sites to promote leisure-time physical activity. PMID:28642215

  6. Noninvasive cardiac activation imaging of ventricular arrhythmias during drug-induced QT prolongation in the rabbit heart.

    PubMed

    Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; Zhou, Zhaoye; He, Bin

    2013-10-01

    Imaging myocardial activation from noninvasive body surface potentials promises to aid in both cardiovascular research and clinical medicine. To investigate the ability of a noninvasive 3-dimensional cardiac electrical imaging technique for characterizing the activation patterns of dynamically changing ventricular arrhythmias during drug-induced QT prolongation in rabbits. Simultaneous body surface potential mapping and 3-dimensional intracardiac mapping were performed in a closed-chest condition in 8 rabbits. Data analysis was performed on premature ventricular complexes, couplets, and torsades de pointes (TdP) induced during intravenous administration of clofilium and phenylephrine with combinations of various infusion rates. The drug infusion led to a significant increase in the QT interval (from 175 ± 7 to 274 ± 31 ms) and rate-corrected QT interval (from 183 ± 5 to 262 ± 21 ms) during the first dose cycle. All the ectopic beats initiated by a focal activation pattern. The initial beat of TdPs arose at the focal site, whereas the subsequent beats were due to focal activity from different sites or 2 competing focal sites. The imaged results captured the dynamic shift of activation patterns and were in good correlation with the simultaneous measurements, with a correlation coefficient of 0.65 ± 0.02 averaged over 111 ectopic beats. Sites of initial activation were localized to be ~5 mm from the directly measured initiation sites. The 3-dimensional cardiac electrical imaging technique could localize the origin of activation and image activation sequence of TdP during QT prolongation induced by clofilium and phenylephrine in rabbits. It offers the potential to noninvasively investigate the proarrhythmic effects of drug infusion and assess the mechanisms of arrhythmias on a beat-to-beat basis. © 2013 Heart Rhythm Society. All rights reserved.

  7. Discovery and characterization of a new family of lytic polysaccharide mono-oxygenases

    PubMed Central

    Hemsworth, Glyn R.; Henrissat, Bernard; Davies, Gideon J.; Walton, Paul H.

    2014-01-01

    Lytic polysaccharide mono-oxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They currently attract much attention due to their potential use in biomass conversion, notably in the production of biofuels. Past work has identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the 3-D structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active centre featuring the histidine brace active site, but is distinct in terms of its active site details and its EPR spectroscopy. The new AA11 family expands the LPMO clan with the potential to broaden both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs. PMID:24362702

  8. Discovery of HDAC Inhibitors That Lack an Active Site Zn(2+)-Binding Functional Group.

    PubMed

    Vickers, Chris J; Olsen, Christian A; Leman, Luke J; Ghadiri, M Reza

    2012-06-14

    Natural and synthetic histone deacetylase (HDAC) inhibitors generally derive their strong binding affinity and high potency from a key functional group that binds to the Zn(2+) ion within the enzyme active site. However, this feature is also thought to carry the potential liability of undesirable off-target interactions with other metalloenzymes. As a step toward mitigating this issue, here, we describe the design, synthesis, and structure-activity characterizations of cyclic α3β-tetrapeptide HDAC inhibitors that lack the presumed indispensable Zn(2+)-binding group. The lead compounds (e.g., 15 and 26) display good potency against class 1 HDACs and are active in tissue culture against various human cancer cell lines. Importantly, enzymological analysis of 26 indicates that the cyclic α3β-tetrapeptide is a fast-on/off competitive inhibitor of HDACs 1-3 with K i values of 49, 33, and 37 nM, respectively. Our proof of principle study supports the idea that novel classes of HDAC inhibitors, which interact at the active-site opening, but not with the active site Zn(2+), can have potential in drug design.

  9. Controls of Sediment Nitrogen Dynamics in Tropical Coastal Lagoons

    PubMed Central

    Enrich-Prast, Alex; Figueiredo, Viviane; Esteves, Francisco de Assis; Nielsen, Lars Peter

    2016-01-01

    Sediment denitrification rates seem to be lower in tropical environments than in temperate environments. Using the isotope pairing technique, we measured actual denitrification rates in the sediment of tropical coastal lagoons. To explain the low denitrification rates observed at all study sites (<5 μmol N2 m-2 h-1), we also evaluated potential oxygen (O2) consumption, potential nitrification, potential denitrification, potential anammox, and estimated dissimilatory nitrate (NO3-) reduction to ammonium (NH4+; DNRA) in the sediment. 15NO3- and 15NH4+ conversion was measured in oxic and anoxic slurries from the sediment surface. Sediment potential O2 consumption was used as a proxy for overall mineralization activity. Actual denitrification rates and different potential nitrogen (N) oxidation and reduction processes were significantly correlated with potential O2 consumption. The contribution of potential nitrification to total O2 consumption decreased from contributing 9% at sites with the lowest sediment mineralization rates to less than 0.1% at sites with the highest rates. NO3- reduction switched completely from potential denitrification to estimated DNRA. Ammonium oxidation and nitrite (NO2-) reduction by potential anammox contributed up to 3% in sediments with the lowest sediment mineralization rates. The majority of these patterns could be explained by variations in the microbial environments from stable and largely oxic conditions at low sediment mineralization sites to more variable conditions and the prevalences of anaerobic microorganisms at high sediment mineralization sites. Furthermore, the presence of algal and microbial mats on the sediment had a significant effect on all studied processes. We propose a theoretical model based on low and high sediment mineralization rates to explain the growth, activity, and distribution of microorganisms carrying out denitrification and DNRA in sediments that can explain the dominance or coexistence of DNRA and denitrification processes. The results presented here show that the potential activity of anaerobic nitrate-reducing organisms is not dependent on the availability of environmental NO3-. PMID:27175907

  10. Controls of Sediment Nitrogen Dynamics in Tropical Coastal Lagoons.

    PubMed

    Enrich-Prast, Alex; Figueiredo, Viviane; Esteves, Francisco de Assis; Nielsen, Lars Peter

    2016-01-01

    Sediment denitrification rates seem to be lower in tropical environments than in temperate environments. Using the isotope pairing technique, we measured actual denitrification rates in the sediment of tropical coastal lagoons. To explain the low denitrification rates observed at all study sites (<5 μmol N2 m-2 h-1), we also evaluated potential oxygen (O2) consumption, potential nitrification, potential denitrification, potential anammox, and estimated dissimilatory nitrate (NO3-) reduction to ammonium (NH4+; DNRA) in the sediment. 15NO3- and 15NH4+ conversion was measured in oxic and anoxic slurries from the sediment surface. Sediment potential O2 consumption was used as a proxy for overall mineralization activity. Actual denitrification rates and different potential nitrogen (N) oxidation and reduction processes were significantly correlated with potential O2 consumption. The contribution of potential nitrification to total O2 consumption decreased from contributing 9% at sites with the lowest sediment mineralization rates to less than 0.1% at sites with the highest rates. NO3- reduction switched completely from potential denitrification to estimated DNRA. Ammonium oxidation and nitrite (NO2-) reduction by potential anammox contributed up to 3% in sediments with the lowest sediment mineralization rates. The majority of these patterns could be explained by variations in the microbial environments from stable and largely oxic conditions at low sediment mineralization sites to more variable conditions and the prevalences of anaerobic microorganisms at high sediment mineralization sites. Furthermore, the presence of algal and microbial mats on the sediment had a significant effect on all studied processes. We propose a theoretical model based on low and high sediment mineralization rates to explain the growth, activity, and distribution of microorganisms carrying out denitrification and DNRA in sediments that can explain the dominance or coexistence of DNRA and denitrification processes. The results presented here show that the potential activity of anaerobic nitrate-reducing organisms is not dependent on the availability of environmental NO3-.

  11. Trends in major-ion constituents and properties for selected sampling sites in the Tongue and Powder River watersheds, Montana and Wyoming, based on data collected during water years 1980-2010

    USGS Publications Warehouse

    Sando, Steven K.; Vecchia, Aldo V.; Barnhart, Elliott P.; Sando, Thomas R.; Clark, Melanie L.; Lorenz, David L.

    2014-01-01

    The primary purpose of this report is to present information relating to flow-adjusted temporal trends in major-ion constituents and properties for 16 sampling sites in the Tongue and Powder River watersheds based on data collected during 1980–2010. In association with this primary purpose, the report presents background information on major-ion characteristics (including specific conductance, calcium, magnesium, potassium, sodium adsorption ratio, sodium, alkalinity, chloride, fluoride, dissolved sulfate, and dissolved solids) of the sampling sites and coal-bed methane (CBM) produced water (groundwater pumped from coal seams) in the site watersheds, trend analysis methods, streamflow conditions, and factors that affect trend results. The Tongue and Powder River watersheds overlie the Powder River structural basin (PRB) in northeastern Wyoming and southeastern Montana. Limited extraction of coal-bed methane (CBM) from the PRB began in the early 1990’s, and increased dramatically during the late 1990’s and early 2000’s. CBM-extraction activities produce discharges of water with high concentrations of dissolved solids (particularly sodium and bicarbonate ions) relative to most stream water in the Tongue and Powder River watersheds. Water-quality of CBM produced water is of concern because of potential effects of sodium on agricultural soils and potential effects of bicarbonate on aquatic biota. Two parametric trend-analysis methods were used in this study: the time-series model (TSM) and ordinary least squares regression (OLS) on time, streamflow, and season. The TSM was used to analyze trends for 11 of the 16 study sites. For five sites, data requirements of the TSM were not met and OLS was used to analyze trends. Two primary 10-year trend-analysis periods were selected. Trend-analysis period 1 (water years 1986–95; hereinafter referred to as period 1) was selected to represent variability in major-ion concentrations in the Tongue and Powder River watersheds before potential effects of CBM-extraction activities. Trend analysis period 2 (water years 2001–10; hereinafter referred to as period 2) was selected because it encompassed substantial CBM-extraction activities and therefore might indicate potential effects of CBM-extraction activities on water quality of receiving streams in the Tongue and Powder River watersheds. For sites that did not satisfy data requirements for the TSM, OLS was used to analyze trends for period 2 (if complete data were available) or a 6-year period (2005–10). Flow-rate characteristics of CBM-produced water were estimated to allow general comparisons with streamflow characteristics of the sampling sites. The information on flow-rate characteristics of CBM-produced water in relation to streamflow does not account for effects of disposal, treatment, or other remediation activities on the potential quantitative effects of CBM-produced water on receiving streams. In many places, CBM-produced water is discharged into impoundments or channels in upper reaches of tributary watersheds where water infiltrates and does not directly contribute to streamflow. For Tongue River at State line (site 4) mean annual pumping rate of CBM-produced water during water years 2001–10 (hereinafter referred to as mean CBM pumping rate) was 6 percent of the mean of annual median streamflows during water years 2001–10 (hereinafter referred to as 2001–10 median streamflow). For main-stem Tongue River sites 5, 7, and 10, mean CBM pumping rate was 8–12 percent of 2001–10 median streamflow. For main-stem Powder River sites (sites 12, 13, and 16), mean CBM pumping rates were 26, 28, and 34 percent of 2001–10 median streamflows, respectively. For main-stem Tongue River sites analyzed by using the TSM and downstream from substantial CBM-extraction activities [Tongue River at State line (site 4), Tongue River at Tongue River Dam (site 5), Tongue River at Birney Day School (site 7), and Tongue River at Miles City (site 10)], generally small significant or nonsignificant decreases in most constituents are indicated for period 1. For period 2 for these sites, the TSM trend results do not allow confident conclusions concerning detection of effects of CBM-extraction activities on stream water quality. Detection of significant trends in major-ion constituents and properties for period 2 generally was infrequent, and direction, magnitudes, and significance of fitted trends were not strongly consistent with relative differences in water quality between stream water and CBM-produced water. The TSM indicated significant or generally large magnitude increases in median values of sodium adsorption ratio (SAR), sodium, and alkalinity for period 2 for sites 5 and 7, which might indicate potential effects of CBM-extraction activities on stream water. However, other factors, including operations of Tongue River Reservoir, irrigation activities, contributions of saline groundwater, and operations of the Decker coal mine, confound confident determination of causes of detected significant trends for sites 5 and 7. For all mainstem Tongue River sites, trends for period 2 generally are within ranges of those for period 1 before substantial CBM-extraction activities. For main-stem Powder River sites analyzed by using the TSM [Powder River at Sussex (site 11), Powder River at Arvada (site 12), Powder River at Moorhead (site 13), and Powder River near Locate (site 16)], significant or generally large magnitude decreases in median values of SAR, sodium, estimated alkalinity, chloride, fluoride, specific conductance, and dissolved solids are indicated for period 1. Patterns in trend results for period 1 for main-stem Powder River sites are consistent with effects of Salt Creek oil-brine reinjection that started in 1990. Trend results for all main-stem Powder River sites downstream from substantial CBM-extraction activities (sites 12, 13, and 16) indicate evidence of potential effects of CBM-extraction activities on stream water quality, although evidence is stronger for sites 12 and 13 than for site 16. Evidence in support of potential CBM effects includes significant increases in median values of SAR, sodium, and estimated alkalinity for period 2 for sites 12, 13, and 16 that are consistent with relative differences between stream water and CBM-produced water. Significant increases in median values of these constituents for period 2 are not indicated for Powder River at Sussex (site 11) upstream from substantial CBM-extraction activities. In interpreting the trend results, it is notable that the fitted trends evaluate changes in median concentrations and also notable that changes in median concentrations that might be attributed to CBM-extraction activities probably are more strongly evident during low to median streamflow conditions than during mean to high streamflow conditions. This observation is relevant in assessing trend results in relation to specific water-quality concerns, including effects of water-quality changes on irrigators and effects on stream biota and ecology.

  12. Navy Aquatic Hazardous Waste Sites: The Problem and Possible Solutions

    DTIC Science & Technology

    1989-08-01

    sensitive area. NEESA 13-013. Naval Weapons Station Concord , CA . This activity had 13 sites recommended for further study as having potential to impact the...also carry contaminants to the bay. NEESA 13-014. Naval Air Station Alameda, CA . Seven sites have the potential to impact San Francisco Bay. The West...addition, surface runoff may carry contaminants to the ponds or Kaneohe Bay. NEESA 13-040. Naval Weapons Station Charleston, SC. Four sites have the

  13. A survey of health-related activities on second life.

    PubMed

    Beard, Leslie; Wilson, Kumanan; Morra, Dante; Keelan, Jennifer

    2009-05-22

    Increasingly, governments, health care agencies, companies, and private groups have chosen Second Life as part of their Web 2.0 communication strategies. Second Life offers unique design features for disseminating health information, training health professionals, and enabling patient education for both academic and commercial health behavior research. This study aimed to survey and categorize the range of health-related activities on Second Life; to examine the design attributes of the most innovative and popular sites; and to assess the potential utility of Second Life for the dissemination of health information and for health behavior change. We used three separate search strategies to identify health-related sites on Second Life. The first used the application's search engine, entering both generic and select illness-specific keywords, to seek out sites. The second identified sites through a comprehensive review of print, blog, and media sources discussing health activities on Second Life. We then visited each site and used a snowball method to identify other health sites until we reached saturation (no new health sites were identified). The content, user experience, and chief purpose of each site were tabulated as well as basic site information, including user traffic data and site size. We found a wide range of health-related activities on Second Life, and a diverse group of users, including organizations, groups, and individuals. For many users, Second Life activities are a part of their Web 2.0 communication strategy. The most common type of health-related site in our sample (n = 68) were those whose principle aim was patient education or to increase awareness about health issues. The second most common type of site were support sites, followed by training sites, and marketing sites. Finally, a few sites were purpose-built to conduct research in SL or to recruit participants for real-life research. Studies show that behaviors from virtual worlds can translate to the real world. Our survey suggests that users are engaged in a range of health-related activities in Second Life which are potentially impacting real-life behaviors. Further research evaluating the impact of health-related activities on Second Life is warranted.

  14. A Survey of Health-Related Activities on Second Life

    PubMed Central

    Beard, Leslie; Wilson, Kumanan; Morra, Dante

    2009-01-01

    Background Increasingly, governments, health care agencies, companies, and private groups have chosen Second Life as part of their Web 2.0 communication strategies. Second Life offers unique design features for disseminating health information, training health professionals, and enabling patient education for both academic and commercial health behavior research. Objectives This study aimed to survey and categorize the range of health-related activities on Second Life; to examine the design attributes of the most innovative and popular sites; and to assess the potential utility of Second Life for the dissemination of health information and for health behavior change. Methods We used three separate search strategies to identify health-related sites on Second Life. The first used the application’s search engine, entering both generic and select illness-specific keywords, to seek out sites. The second identified sites through a comprehensive review of print, blog, and media sources discussing health activities on Second Life. We then visited each site and used a snowball method to identify other health sites until we reached saturation (no new health sites were identified). The content, user experience, and chief purpose of each site were tabulated as well as basic site information, including user traffic data and site size. Results We found a wide range of health-related activities on Second Life, and a diverse group of users, including organizations, groups, and individuals. For many users, Second Life activities are a part of their Web 2.0 communication strategy. The most common type of health-related site in our sample (n = 68) were those whose principle aim was patient education or to increase awareness about health issues. The second most common type of site were support sites, followed by training sites, and marketing sites. Finally, a few sites were purpose-built to conduct research in SL or to recruit participants for real-life research. Conclusions Studies show that behaviors from virtual worlds can translate to the real world. Our survey suggests that users are engaged in a range of health-related activities in Second Life which are potentially impacting real-life behaviors. Further research evaluating the impact of health-related activities on Second Life is warranted. PMID:19632971

  15. Design of N-Coordinated Dual-Metal Sites: A Stable and Active Pt-Free Catalyst for Acidic Oxygen Reduction Reaction.

    PubMed

    Wang, Jing; Huang, Zhengqing; Liu, Wei; Chang, Chunran; Tang, Haolin; Li, Zhijun; Chen, Wenxing; Jia, Chunjiang; Yao, Tao; Wei, Shiqiang; Wu, Yuen; Li, Yadong

    2017-12-06

    We develop a host-guest strategy to construct an electrocatalyst with Fe-Co dual sites embedded on N-doped porous carbon and demonstrate its activity for oxygen reduction reaction in acidic electrolyte. Our catalyst exhibits superior oxygen reduction reaction performance, with comparable onset potential (E onset , 1.06 vs 1.03 V) and half-wave potential (E 1/2 , 0.863 vs 0.858 V) than commercial Pt/C. The fuel cell test reveals (Fe,Co)/N-C outperforms most reported Pt-free catalysts in H 2 /O 2 and H 2 /air. In addition, this cathode catalyst with dual metal sites is stable in a long-term operation with 50 000 cycles for electrode measurement and 100 h for H 2 /air single cell operation. Density functional theory calculations reveal the dual sites is favored for activation of O-O, crucial for four-electron oxygen reduction.

  16. Active Site Detection by Spatial Conformity and Electrostatic Analysis—Unravelling a Proteolytic Function in Shrimp Alkaline Phosphatase

    PubMed Central

    Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.

    2011-01-01

    Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814

  17. Murine and human CFTR exhibit different sensitivities to CFTR potentiators

    PubMed Central

    Cui, Guiying

    2015-01-01

    Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as “Kalydeco.” Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by ∼13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators. PMID:26209275

  18. Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern.

    PubMed

    Kassotis, Christopher D; Alvarez, David A; Taylor, Julia A; vom Saal, Frederick S; Nagel, Susan C; Tillitt, Donald E

    2015-08-15

    Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrations present in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities. Published by Elsevier B.V.

  19. Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern

    USGS Publications Warehouse

    Kassotis, Christopher D.; Alvarez, David A.; Taylor, Julia A.; vom Saal, Frederick S.; Nagel, Susan C.; Tillitt, Donald E.

    2015-01-01

    Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrationspresent in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities.

  20. Unraveling the Nature of Active Sites in Ethanol Electro-oxidation by Site-Specific Marking of a Pt Catalyst with Isotope-Labeled 13CO.

    PubMed

    Farias, Manuel J S; Cheuquepán, William; Tanaka, Auro A; Feliu, Juan M

    2018-03-15

    This works deals with the identification of preferential site-specific activation at a model Pt surface during a multiproduct reaction. The (110)-type steps of a Pt(332) surface were selectively marked by attaching isotope-labeled 13 CO molecules to them, and ethanol oxidation was probed by in situ Foureir transfrom infrared spectroscopy in order to precisely determine the specific sites at which CO 2 , acetic acid, and acetaldehyde were preferentially formed. The (110) steps were active for splitting the C-C bond, but unexpectedly, we provide evidence that the pathway of CO 2 formation was preferentially activated at (111) terraces, rather than at (110) steps. Acetaldehyde was formed at (111) terraces at potentials comparable to those for CO 2 formation also at (111) terraces, while the acetic acid formation pathway became active only when the (110) steps were released by the oxidation of adsorbed 13 CO, at potentials higher than for the formation of CO 2 at (111) terraces of the stepped surface.

  1. Shape-Controllable Gold Nanoparticle-MoS2 Hybrids Prepared by Tuning Edge-Active Sites and Surface Structures of MoS2 via Temporally Shaped Femtosecond Pulses.

    PubMed

    Zuo, Pei; Jiang, Lan; Li, Xin; Li, Bo; Xu, Yongda; Shi, Xuesong; Ran, Peng; Ma, Tianbao; Li, Dawei; Qu, Liangti; Lu, Yongfeng; Grigoropoulos, Costas P

    2017-03-01

    Edge-active site control of MoS 2 is crucial for applications such as chemical catalysis, synthesis of functional composites, and biochemical sensing. This work presents a novel nonthermal method to simultaneously tune surface chemical (edge-active sites) and physical (surface periodic micro/nano structures) properties of MoS 2 using temporally shaped femtosecond pulses, through which shape-controlled gold nanoparticles are in situ and self-assembly grown on MoS 2 surfaces to form Au-MoS 2 hybrids. The edge-active sites with unbound sulfurs of laser-treated MoS 2 drive the reduction of gold nanoparticles, while the surface periodic structures of laser-treated MoS 2 assist the shape-controllable growth of gold nanoparticles. The proposed novel method highlights the broad application potential of MoS 2 ; for example, these Au-MoS 2 hybrids exhibit tunable and highly sensitive SERS activity with an enhancement factor up to 1.2 × 10 7 , indicating the marked potential of MoS 2 in future chemical and biological sensing applications.

  2. Continuous multi-component geophysical experiment on LUSI mud edifice: What can we learn from it?

    NASA Astrophysics Data System (ADS)

    Mauri, Guillaume; Husein, Alwi; Karyono, Karyono; Hadi, Soffian; Mazzini, Adriano; Collignon, Marine; Faubert, Maïté; Miller, Stephen A.; Lupi, Matteo

    2016-04-01

    The Lusi eruption is located in East Java, Indonesia, and is ongoing since May 29th, 2006. In the framework of joined international projects, several joint geophysical studies focussing on seismic monitoring, spatial investigation over the mud edifice and its surroundings are being conducted. Here we present freshly acquired data from a test site to investigate: (1) potential change in the natural electrical self-potential generation over time (2) potential change in gravity field associated to change in mass or volume, (3) if the geysering activity generates disruption on either the electrical or gravity field. We selected a location ˜200m to the NE of the active Lusi crater. The experiment site covers an area of 60m x 80m, crossing the boundaries between the soft and the solid walkable mud. The western edge of the study area was less than 100m away from the rim of the crater site. A self-potential array made of 6 Pb-PbCl2 electrodes was deployed over the site. The electrodes were positioned inside active seeps, on dry unaltered zones and close to the mud stream that flushes the water erupted from the crater site. All the electrodes were connected to a single Pb-PbCl2 electrode reference. A second array of 7 thermometers was installed positioning 5 of them next to SP electrodes, one to measure atmospheric temperature and another P/T probe to monitor the stream water. In addition a seismometer coupled with a HD video camera, a thermal camera and a gravimeter recorded on site for several days monitoring visual and seismic activity of the crater. The collected data allows us to 1) monitor and define the different geysering activities ongoing at the crater, 2) define the delay existing between the recorded seismicity and the visual observations, 3) verify if the crater activity triggers perturbations that are transmitted to e.g. the thousands of satellite seeps distributed in the 7 square kilometers zone inside the embankment; 4) how significant is the delay between the crater activity and the water streamed out.

  3. Radon soil gas measurements in a geological versatile region as basis to improve the prediction of areas with a high radon potential.

    PubMed

    Kabrt, Franz; Seidel, Claudia; Baumgartner, Andreas; Friedmann, Harry; Rechberger, Fabian; Schuff, Michael; Maringer, Franz Josef

    2014-07-01

    With the aim to predict the radon potential by geological data, radon soil gas measurements were made in a selected region in Styria, Austria. This region is characterised by mean indoor radon potentials of 130-280 Bq m(-3) and a high geological diversity. The distribution of the individual measuring sites was selected on the basis of geological aspects and the distribution of area settlements. In this work, the radon soil gas activity concentration and the soil permeability were measured at 100 sites, each with three single measurements. Furthermore, the local dose rate was determined and soil samples were taken at each site to determine the activity concentration of natural radionuclides. During two investigation periods, long-term soil gas radon measurements were made to study the time dependency of the radon activity concentration. All the results will be compared and investigated for correlation among each other to improve the prediction of areas with high radon potential. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. 10 CFR 960.4-2-8-2 - Site ownership and control.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...) Qualifying condition. The site shall be located on land for which the DOE can obtain, in accordance with the... required in order that potential surface and subsurface activities as the site will not be likely to lead...

  5. [Mechanism of action of neurotoxins acting on the inactivation of voltage-gated sodium channels].

    PubMed

    Benoit, E

    1998-01-01

    This review focuses on the mechanism(s) of action of neurotoxins acting on the inactivation of voltage-gated Na channels. Na channels are transmembrane proteins which are fundamental for cellular communication. These proteins form pores in the plasma membrane allowing passive ionic movements to occur. Their opening and closing are controlled by gating systems which depend on both membrane potential and time. Na channels have three functional properties, mainly studied using electrophysiological and biochemical techniques, to ensure their role in the generation and propagation of action potentials: 1) a highly selectivity for Na ions, 2) a rapid opening ("activation"), responsible for the depolarizing phase of the action potential, and 3) a late closing ("inactivation") involved in the repolarizing phase of the action potential. As an essential protein for membrane excitability, the Na channel is the specific target of a number of vegetal and animal toxins which, by binding to the channel, alter its activity by affecting one or more of its properties. At least six toxin receptor sites have been identified on the neuronal Na channel on the basis of binding studies. However, only toxins interacting with four of these sites (sites 2, 3, 5 et 6) produce alterations of channel inactivation. The maximal percentage of Na channels modified by the binding of neurotoxins to sites 2 (batrachotoxin and some alkaloids), 3 (alpha-scorpion and sea anemone toxins), 5 (brevetoxins and ciguatoxins) et 6 (delta-conotoxins) is different according to the site considered. However, in all cases, these channels do not inactivate. Moreover, Na channels modified by toxins which bind to sites 2, 5 and 6 activate at membrane potentials more negative than do unmodified channels. The physiological consequences of Na channel modifications, induced by the binding of neurotoxins to sites 2, 3, 5 and 6, are (i) an inhibition of cellular excitability due to an important membrane depolarization (site 2), (ii) a decrease of cellular excitability due to an important increase in the action potential duration (site 3) and (iii) an increase in cellular excitability which results in spontaneous and repetitive firing of action potentials (sites 5 and 6). The biochemical and electrophysiological studies performed with these toxins, as well as the determination of their molecular structure, have given basic information on the function and structure of the Na channel protein. Therefore, various models representing the different states of Na channels have been proposed to account for the neurotoxin-induced modifications of Na inactivation. Moreover, the localization of receptor binding sites 2, 3, 5 et 6 for these toxins on the neuronal Na channel has been deduced and the molecular identification of the recognition site(s) for some of them has been established on the alpha sub-unit forming the Na channel protein.

  6. What Motivates Young Adults to Talk About Physical Activity on Social Network Sites?

    PubMed

    Zhang, Ni; Campo, Shelly; Yang, Jingzhen; Eckler, Petya; Snetselaar, Linda; Janz, Kathleen; Leary, Emily

    2017-06-22

    Electronic word-of-mouth on social network sites has been used successfully in marketing. In social marketing, electronic word-of-mouth about products as health behaviors has the potential to be more effective and reach more young adults than health education through traditional mass media. However, little is known about what motivates people to actively initiate electronic word-of-mouth about health behaviors on their personal pages or profiles on social network sites, thus potentially reaching all their contacts on those sites. This study filled the gap by applying a marketing theoretical model to explore the factors associated with electronic word-of-mouth on social network sites about leisure-time physical activity. A Web survey link was sent to undergraduate students at one of the Midwestern universities and 439 of them completed the survey. The average age of the 439 participants was 19 years (SD=1 year, range: 18-24). Results suggested that emotional engagement with leisure-time physical activity (ie, affective involvement in leisure-time physical activity) predicted providing relevant opinions or information on social network sites. Social network site users who perceived stronger ties with all their contacts were more likely to provide and seek leisure-time physical activity opinions and information. People who provided leisure-time physical activity opinions and information were more likely to seek opinions and information, and people who forwarded information about leisure-time physical activity were more likely to chat about it. This study shed light on the application of the electronic word-of-mouth theoretical framework in promoting health behaviors. The findings can also guide the development of future social marketing interventions using social network sites to promote leisure-time physical activity. ©Ni Zhang, Shelly Campo, Jingzhen Yang, Petya Eckler, Linda Snetselaar, Kathleen Janz, Emily Leary. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 22.06.2017.

  7. Exploration of peptides that fit into the thermally vibrating active site of cathepsin K protease by alternating artificial intelligence and molecular simulation

    NASA Astrophysics Data System (ADS)

    Nishiyama, Katsuhiko

    2017-08-01

    Eighteen tripeptides that fit into the thermally vibrating active site of cathepsin K were discovered by alternating artificial intelligence and molecular simulation. The 18 tripeptides fit the active site better than the cysteine protease inhibitor E64, and a better inhibitor of cathepsin K could be designed considering these tripeptides. Among the 18 tripeptides, Phe-Arg-Asp and Tyr-Arg-Asp fit the active site the best and their structural similarity should be considered in the design process. Interesting factors emerged from the structure of the decision tree, and its structural information will guide exploration of potential inhibitor molecules for proteases.

  8. Cryo-Trapping the Distorted Octahedral Reaction Intermediate of Manganese Superoxide Dismutase

    NASA Technical Reports Server (NTRS)

    Borgstahl, Gloria; Snell, Edward H.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    Superoxide dismutase protects organisms from potentially damaging oxygen radicals by catalyzing the disproportion of superoxide to oxygen and hydrogen peroxide. We report the use of cryogenic temperatures to kinetically trap the 6th ligand bound to the active site of manganese superoxide dismutase. Using cryocrystallography and synchrotron radiation, we describe at 1.55A resolution the six-coordinate, distorted octahedral geometry assumed by the active site during catalysis and compare it to the room temperature, five-coordinate trigonal-bipyramidal active site. Gateway residues Tyr34, His30 and a tightly bound water molecule are implicated in closing off the active site and blocking the escape route of superoxide during dismutation.

  9. Activity-Dependent Calpain Activation Plays a Critical Role in Synaptic Facilitation and Post-Tetanic Potentiation

    ERIC Educational Resources Information Center

    Khoutorsky, Arkady; Spira, Micha E.

    2009-01-01

    Synaptic facilitation and post-tetanic potentiation (PTP) are believed to necessitate active regeneration of the release machinery and supply of synaptic vesicles to a ready-releasable site. The prevailing hypothesis assumes that synapsins play pivotal roles in these processes. Using a cholinergic synapse formed between cultured "Aplysia" neurons…

  10. Metal–organic and covalent organic frameworks as single-site catalysts

    PubMed Central

    Rogge, S. M. J.; Bavykina, A.; Hajek, J.; Garcia, H.; Olivos-Suarez, A. I.; Sepúlveda-Escribano, A.; Vimont, A.; Clet, G.; Bazin, P.; Kapteijn, F.

    2017-01-01

    Heterogeneous single-site catalysts consist of isolated, well-defined, active sites that are spatially separated in a given solid and, ideally, structurally identical. In this review, the potential of metal–organic frameworks (MOFs) and covalent organic frameworks (COFs) as platforms for the development of heterogeneous single-site catalysts is reviewed thoroughly. In the first part of this article, synthetic strategies and progress in the implementation of such sites in these two classes of materials are discussed. Because these solids are excellent playgrounds to allow a better understanding of catalytic functions, we highlight the most important recent advances in the modelling and spectroscopic characterization of single-site catalysts based on these materials. Finally, we discuss the potential of MOFs as materials in which several single-site catalytic functions can be combined within one framework along with their potential as powerful enzyme-mimicking materials. The review is wrapped up with our personal vision on future research directions. PMID:28338128

  11. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  12. Health assessment for Midwest Industrial Waste Disposal Company, Inc. (Midco II) NPL (National Priorities List) Site, 5900 Industrial Highway, Gary, Indiana, Region 5. CERCLIS No. IND980679559. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1989-04-12

    The 7-acre Midco II Site is located at 5900 Industrial Highway, Gary, Indiana. The site is listed on the National Priorities List. Various heavy metals, inorganic, and organic compounds were found in the media on-site. The environmental media of concern at the site are ground water, surface water, and soil. Although access to the Midco II site is restricted, the contaminants detected on-site will continue to migrate and may pose health threats until remedial activities are completed. Therefore, the Midco II site poses a potential health concern until an evaluation of the site is completed and remedial activities are chosen.

  13. 10 CFR 960.5-2-10 - Hydrology.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines Ease and Cost of Siting, Construction, Operation, and Closure § 960.5-2-10... site will (1) be compatible with the activities required for repository construction, operation, and...

  14. 10 CFR 960.5-2-10 - Hydrology.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines Ease and Cost of Siting, Construction, Operation, and Closure § 960.5-2-10... site will (1) be compatible with the activities required for repository construction, operation, and...

  15. 10 CFR 960.5-2-10 - Hydrology.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines Ease and Cost of Siting, Construction, Operation, and Closure § 960.5-2-10... site will (1) be compatible with the activities required for repository construction, operation, and...

  16. 10 CFR 960.5-2-10 - Hydrology.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines Ease and Cost of Siting, Construction, Operation, and Closure § 960.5-2-10... site will (1) be compatible with the activities required for repository construction, operation, and...

  17. Greenhouse Gas Fluxes at the Tablelands, NL, Canada: A Site of Active Serpentinization

    NASA Astrophysics Data System (ADS)

    Morrill, P. L.; Morrissey, L. S.; Cumming, E.

    2016-12-01

    Active sites of serpentinization have been proposed as sites for carbon capture and storage (CCS) projects. However, in addition to their ability to convert carbon dioxide to carbonate rock, sites of serpentinization also have the potential release methane, which is a more power greenhouse gas than carbon dioxide. Very little is known about the natural flux of carbon dioxide sequestered and methane released into the atmosphere from active sites of serpentinization. In this study we measured carbon dioxide, methane, and nitrous oxide gas fluxes at a pool of ultra-basic water discharging from serpentinized rock in Winterhouse Canyon, Gros Morne, Newfoundland. We found that the flux of methane released was 4.6 x 10-7 mol/m2/min and the carbon dioxide sequestered was 1.9 x 10-5 mol/m2/min, while the concentrations of nitrous oxide showed little change. Based on these fluxes we calculated predictive climate change parameters such as net radiative forcing and global warming potential which predicted that despite the methane being released the site still had an overall long-term atmospheric cooling effect based on the natural rate of carbon dioxide sequestration.

  18. Well-Defined Metal-O6 in Metal-Catecholates as a Novel Active Site for Oxygen Electroreduction.

    PubMed

    Liu, Xuan-He; Hu, Wei-Li; Jiang, Wen-Jie; Yang, Ya-Wen; Niu, Shuai; Sun, Bing; Wu, Jing; Hu, Jin-Song

    2017-08-30

    Metal-nitrogen coordination sites, M-N x (M = Fe, Co, Ni, etc.), have shown great potential to replace platinum group materials as electrocatalysts for oxygen reduction reaction (ORR). However, the real active site in M-N x is still vague to date due to their complicated structure and composition. It is therefore highly desirable but challenging to develop ORR catalysts with novel and clear active sites, which could meet the needs of comprehensive understanding of structure-function relationships and explore new cost-effective and efficient ORR electrocatalysts. Herein, well-defined M-O 6 coordination in metal-catecholates (M-CATs, M = Ni or Co) is discovered to be catalytically active for ORR via a four-electron-dominated pathway. In view of no pyrolysis involved and unambiguous crystalline structure of M-CATs, the M-O 6 octahedral coordination site with distinct structure is determined as a new type of active site for ORR. These findings extend the scope of metal-nonmetal coordination as an active site for ORR and pave a way for bottom-up design of novel electrocatalysts containing M-O 6 coordination.

  19. Neural correlates of active controlled retrieval development: An exploratory ERP study.

    PubMed

    Simard, France; Cadoret, Geneviève

    2018-07-01

    Working memory is composed of different processes and encompasses not only the temporary storage of information but also its manipulation in order to perform complex cognitive activities. During childhood, one of these manipulation processes, namely active controlled retrieval, improves significantly between the age of 6 to 10, suggesting that the neuronal network supporting this function undergoes substantial maturational changes. The present study examined the neural activity of 14 healthy children and 14 adults while performing an active controlled retrieval task. Results showed differences in brain activity according to active controlled retrieval in a 300-500 ms window corresponding to the retrieval period. Active controlled retrieval was associated with a P3b-like potential in parietal sites for both children and adults. In fronto-central sites, children demonstrated a "N400 like" potential associated with active retrieval processing. These results are discussed in terms of maturational development. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Activity of N-coordinated multi-metal-atom active site structures for Pt-free oxygen reduction reaction catalysis: Role of *OH ligands

    DOE PAGES

    Holby, Edward F.; Taylor, Christopher D.

    2015-03-19

    We report calculated oxygen reduction reaction energy pathways on multi-metal-atom structures that have previously been shown to be thermodynamically favorable. We predict that such sites have the ability to spontaneously cleave the O₂ bond and then will proceed to over-bind reaction intermediates. In particular, the *OH bound state has lower energy than the final 2 H₂O state at positive potentials. Contrary to traditional surface catalysts, this *OH binding does not poison the multi-metal-atom site but acts as a modifying ligand that will spontaneously form in aqueous environments leading to new active sites that have higher catalytic activities. These *OH boundmore » structures have the highest calculated activity to date.« less

  1. Asymmetric Volcano Trend in Oxygen Reduction Activity of Pt and Non-Pt Catalysts: In Situ Identification of the Site-Blocking Effect.

    PubMed

    Li, Jingkun; Alsudairi, Amell; Ma, Zi-Feng; Mukerjee, Sanjeev; Jia, Qingying

    2017-02-01

    Proper understanding of the major limitations of current catalysts for oxygen reduction reaction (ORR) is essential for further advancement. Herein by studying representative Pt and non-Pt ORR catalysts with a wide range of redox potential (E redox ) via combined electrochemical, theoretical, and in situ spectroscopic methods, we demonstrate that the role of the site-blocking effect in limiting the ORR varies drastically depending on the E redox of active sites; and the intrinsic activity of active sites with low E redox have been markedly underestimated owing to the overlook of this effect. Accordingly, we establish a general asymmetric volcano trend in the ORR activity: the ORR of the catalysts on the overly high E redox side of the volcano is limited by the intrinsic activity; whereas the ORR of the catalysts on the low E redox side is limited by either the site-blocking effect and/or intrinsic activity depending on the E redox .

  2. Effect of H2 binding on the nonadiabatic transition probability between singlet and triplet states of the [NiFe]-hydrogenase active site.

    PubMed

    Kaliakin, Danil S; Zaari, Ryan R; Varganov, Sergey A

    2015-02-12

    We investigate the effect of H2 binding on the spin-forbidden nonadiabatic transition probability between the lowest energy singlet and triplet electronic states of [NiFe]-hydrogenase active site model, using a velocity averaged Landau-Zener theory. Density functional and multireference perturbation theories were used to provide parameters for the Landau-Zener calculations. It was found that variation of the torsion angle between the terminal thiolate ligands around the Ni center induces an intersystem crossing between the lowest energy singlet and triplet electronic states in the bare active site and in the active site with bound H2. Potential energy curves between the singlet and triplet minima along the torsion angle and H2 binding energies to the two spin states were calculated. Upon H2 binding to the active site, there is a decrease in the torsion angle at the minimum energy crossing point between the singlet and triplet states. The probability of nonadiabatic transitions at temperatures between 270 and 370 K ranges from 35% to 32% for the active site with bound H2 and from 42% to 38% for the bare active site, thus indicating the importance of spin-forbidden nonadiabatic pathways for H2 binding on the [NiFe]-hydrogenase active site.

  3. PHOTOACTIVATED TOXICITY IN AMPHIPODS COLLECTED FROM POLYCYCLIC AROMATIC HYDROCARBON-CONTAMINATED SITES

    EPA Science Inventory

    The risk of photo-activated PAH toxicity in contaminated aquatic systems has not been well characterized. To better indicate this potential, amphipods (Gammarus spp.) were collected from two PAH contaminated sites (Hog Island and USX), as well as a reference site (Chipmunk Cove)...

  4. Safety performance functions for intersections : final report, December 2009.

    DOT National Transportation Integrated Search

    2009-12-01

    Road safety management activities include screening the network for sites with a potential for safety improvement (Network : Screening), diagnosing safety problems at specific sites, and evaluating the safety effectiveness of implemented : countermea...

  5. Assessment of potential migration of radionuclides and trace elements from the White Mesa uranium mill to the Ute Mountain Ute Reservation and surrounding areas, southeastern Utah

    USGS Publications Warehouse

    Naftz, David L.; Ranalli, Anthony J.; Rowland, Ryan C.; Marston, Thomas M.

    2011-01-01

    In 2007, the Ute Mountain Ute Tribe requested that the U.S. Environmental Protection Agency and U.S. Geological Survey conduct an independent evaluation of potential offsite migration of radionuclides and selected trace elements associated with the ore storage and milling process at an active uranium mill site near White Mesa, Utah. Specific objectives of this study were (1) to determine recharge sources and residence times of groundwater surrounding the mill site, (2) to determine the current concentrations of uranium and associated trace elements in groundwater surrounding the mill site, (3) to differentiate natural and anthropogenic contaminant sources to groundwater resources surrounding the mill site, (4) to assess the solubility and potential for offsite transport of uranium-bearing minerals in groundwater surrounding the mill site, and (5) to use stream sediment and plant material samples from areas surrounding the mill site to identify potential areas of offsite contamination and likely contaminant sources.

  6. Screening and identification of potential PTP1B allosteric inhibitors using in silico and in vitro approaches.

    PubMed

    Shinde, Ranajit Nivrutti; Kumar, G Siva; Eqbal, Shahbaz; Sobhia, M Elizabeth

    2018-01-01

    Protein tyrosine phosphatase 1B (PTP1B) is a validated therapeutic target for Type 2 diabetes due to its specific role as a negative regulator of insulin signaling pathways. Discovery of active site directed PTP1B inhibitors is very challenging due to highly conserved nature of the active site and multiple charge requirements of the ligands, which makes them non-selective and non-permeable. Identification of the PTP1B allosteric site has opened up new avenues for discovering potent and selective ligands for therapeutic intervention. Interactions made by potent allosteric inhibitor in the presence of PTP1B were studied using Molecular Dynamics (MD). Computationally optimized models were used to build separate pharmacophore models of PTP1B and TCPTP, respectively. Based on the nature of interactions the target residues offered, a receptor based pharmacophore was developed. The pharmacophore considering conformational flexibility of the residues was used for the development of pharmacophore hypothesis to identify potentially active inhibitors by screening large compound databases. Two pharmacophore were successively used in the virtual screening protocol to identify potential selective and permeable inhibitors of PTP1B. Allosteric inhibition mechanism of these molecules was established using molecular docking and MD methods. The geometrical criteria values confirmed their ability to stabilize PTP1B in an open conformation. 23 molecules that were identified as potential inhibitors were screened for PTP1B inhibitory activity. After screening, 10 molecules which have good permeability values were identified as potential inhibitors of PTP1B. This study confirms that selective and permeable inhibitors can be identified by targeting allosteric site of PTP1B.

  7. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  8. Landslide hazard assessment of the Black sea coastline (Caucasus, Russia) via drones

    NASA Astrophysics Data System (ADS)

    Kazeev, Andrey; Postoev, German; Fedotova, Ksenia

    2017-04-01

    Landslide hazard assessment of slopes of Sochi was performed along the railway between the cities Tuapse and Adler (total length 103 km). The railway passes through the territory with active development of hazardous geological processes such as landslides, rock falls and debris-flows. By the beginning of 2016, 36 landslide sites were discovered along the railway (total length 34 km), 48 rock-fall sites (length 31 km), and 5 debris-flow sites (length 0.14 km). In recent years the intensification of deformations was observed. For instance, during previous 10 years (1996¬¬-2005) 28 sudden deformations occurred due to slope processes, which caused interruptions in traffic. And in the present decade (2006-2015), 72 deformations were recorded. High landslide activity and economic loss determined the necessity of complex investigations of engineering geological conditions of landslides development and causes of its intensification. The protection strategy development was needed to minimize negative consequences. Thus, the investigations of landslide situation along the railway "Tuapse - Adler" included the categorization of landslide sites by level of hazard, with risk assessment based on numerical criteria. Preliminary evaluation of landslide hazard for the railway was conducted via the analysis of archived engineering-geological documents. 13 of 36 landslide sites (total length 13 km) were selected, reflecting the variety and peculiarities of landslide displacements on slopes (both active and inactive sites). Visual field observations of landslide slopes using drone "DJI Phantom 4" were completed during the second stage of this investigation. High-resolution photographs of landslide cirques, cracks, scarp walls, vegetation features were obtained via drone, which would have been impossible to obtain from the ground in conditions of dense subtropical vegetation cover. Possible approaches to the landslide activity and hazard assessment were evaluated: slope stability analysis, geophysical monitoring methods, analysis of critical deformations and critical velocities of displacement, the analysis of changes of conditions of landslide development during its displacement, as well as scoring approaches to landslide hazard and risk assessment. As the result, the method of probabilistic estimation of landslide activity and hazard has been proposed, based on selection and analysis of main factors, influencing landslide displacements. Slope steepness, landslide thickness, slope length, bedrock dip, slope relief, cracks, vegetation patterns and other factors were used for assessment of activity of landslide sites. The investigation was based on the proposed probabilistic method of assessment of landslide activity and hazard. The considered landslide sites were ranked by the rate of activity as inactive, potentially active and active. The most active sites were used to identify potentially the most hazardous sites. Furthermore, the following factors were additionally considered: the damage of railroad facilities due to landslide, landslide activity, thickness of landslide at the toe of the slope, bedrock stratification, the conditions for the cirque development, the position of the sliding surface relatively to the railway, the involvement of bedrock into displaced mass. As the result, the investigated railroad sites were divided into three categories: non-hazardous, potentially hazardous and hazardous. The research was supported by Russian Scientific Foundation (Project № 16-17-00125).

  9. Watching pornographic pictures on the Internet: role of sexual arousal ratings and psychological-psychiatric symptoms for using Internet sex sites excessively.

    PubMed

    Brand, Matthias; Laier, Christian; Pawlikowski, Mirko; Schächtle, Ulrich; Schöler, Tobias; Altstötter-Gleich, Christine

    2011-06-01

    Excessive or addictive Internet use can be linked to different online activities, such as Internet gaming or cybersex. The usage of Internet pornography sites is one important facet of online sexual activity. The aim of the present work was to examine potential predictors of a tendency toward cybersex addiction in terms of subjective complaints in everyday life due to online sexual activities. We focused on the subjective evaluation of Internet pornographic material with respect to sexual arousal and emotional valence, as well as on psychological symptoms as potential predictors. We examined 89 heterosexual, male participants with an experimental task assessing subjective sexual arousal and emotional valence of Internet pornographic pictures. The Internet Addiction Test (IAT) and a modified version of the IAT for online sexual activities (IATsex), as well as several further questionnaires measuring psychological symptoms and facets of personality were also administered to the participants. Results indicate that self-reported problems in daily life linked to online sexual activities were predicted by subjective sexual arousal ratings of the pornographic material, global severity of psychological symptoms, and the number of sex applications used when being on Internet sex sites in daily life, while the time spent on Internet sex sites (minutes per day) did not significantly contribute to explanation of variance in IATsex score. Personality facets were not significantly correlated with the IATsex score. The study demonstrates the important role of subjective arousal and psychological symptoms as potential correlates of development or maintenance of excessive online sexual activity.

  10. Achieving high-powered Zn/air fuel cell through N and S co-doped hierarchically porous carbons with tunable active-sites as oxygen electrocatalysts

    NASA Astrophysics Data System (ADS)

    Tang, Qiaowei; Wang, Luming; Wu, Mingjie; Xu, Nengneng; Jiang, Lei; Qiao, Jinli

    2017-10-01

    Electrochemical reduction of oxygen is the heart of the next-generation energy technologies to fuel cells and metal-air batteries, of which the reference catalysts suffer from two critical bottlenecks lying in their insufficient electroactivities and unclear active site structures. Herein, we introduce the effectively hierarchically porous carbons (HPCs) as the active-sites enriched platform for oxygen electroreduction. Three quaternized copolymers (PUB, PAADDA and PICP) with different chemical structures are used to pursue Fe/N/S-tailored ORR electrocatalysts. The most efficient one prepared by PAADDA gives the onset potential of 0.94 V and a half-wave potential of 0.85 V in basic solution, as well as superb electroactivities of low H2O2% and high electron transfer number in both alkaline and acidic medium. Surprisingly, they all display high discharge power density as applied to Zn-air fuel cells, and the HPCs-PAADDA catalyst thrillingly reaches 516.3 mW cm-2 when catalyst loading is optimized to 5.0 mg cm-2. The results elucidate that the polymer with long aliphatic chain is propitious to trap metals to create active sites and enwrap silica template to construct uniform pore structure. Only two kinds of nitrogen configuration (pyridinic-N and graphitic-N) are found with distinct structure in these HPCs, which happens to be active sites.

  11. Intramural activation and repolarization sequences in canine ventricles. Experimental and simulation studies.

    PubMed

    Taccardi, Bruno; Punske, Bonnie B; Sachse, Frank; Tricoche, Xavier; Colli-Franzone, Piero; Pavarino, Luca F; Zabawa, Christine

    2005-10-01

    There are no published data showing the three-dimensional sequence of repolarization and the associated potential fields in the ventricles. Knowledge of the sequence of repolarization has medical relevance because high spatial dispersion of recovery times and action potential durations favors cardiac arrhythmias. In this study we describe measured and simulated 3-D excitation and recovery sequences and activation-recovery intervals (ARIs) (measured) or action potential durations (APDs) (simulated) in the ventricular walls. We recorded from 600 to 1400 unipolar electrograms from canine ventricular walls during atrial and ventricular pacing at 350-450 ms cycle length. Measured excitation and recovery times and ARIs were displayed as 2-D maps in transmural planes or 3-D maps in the volume explored, using specially developed software. Excitation and recovery sequences and APD distributions were also simulated in parallelepipedal slabs using anisotropic monodomain or bidomain models based on the Lou-Rudy version 1 model with homogeneous membrane properties. Simulations showed that in the presence of homogeneous membrane properties, the sequence of repolarization was similar but not identical to the excitation sequence. In a transmural plane perpendicular to epicardial fiber direction, both activation and recovery pathways starting from an epicardial pacing site returned toward the epicardium at a few cm distance from the pacing site. However, APDs were not constant, but had a dispersion of approximately 14 ms in the simulated domain. The maximum APD value was near the pacing site and two minima appeared along a line perpendicular to fiber directions, passing through the pacing site. Electrical measurements in dog ventricles showed that, for short cycle lengths, both excitation and recovery pathways, starting from an epicardial pacing site, returned toward the epicardium. For slower pacing rates, pathways of recovery departed from the pathway of excitation. Highest ARI values were observed near the pacing site in part of the experiments. In addition, maps of activation-recovery intervals showed mid-myocardial clusters with activation-recovery intervals that were slightly longer than ARIs closer to the epi- or endocardium, suggesting the presence of M cells in those areas. Transmural dispersion of measured ARIs was on the order of 20-25 ms. Potential distributions during recovery were less affected by myocardial anisotropy than were excitation potentials.

  12. Dynamic Perturbation of the Active Site Determines Reversible Thermal Inactivation in Glycoside Hydrolase Family 12.

    PubMed

    Jiang, Xukai; Li, Wen; Chen, Guanjun; Wang, Lushan

    2017-02-27

    The temperature dependence of enzyme catalysis is highly debated. Specifically, how high temperatures induce enzyme inactivation has broad implications for both fundamental and applied science. Here, we explored the mechanism of the reversible thermal inactivation in glycoside hydrolase family 12 (GH12) using comparative molecular dynamics simulations. First, we investigated the distribution of structural flexibility over the enzyme and found that the active site was the general thermal-sensitive region in GH12 cellulases. The dynamic perturbation of the active site before enzyme denaturation was explored through principal-component analysis, which indicated that variations in the collective motion and conformational ensemble of the active site may precisely correspond to enzyme transition from its active form to the inactive form. Furthermore, the degree of dynamic perturbation of the active site was found to be negatively correlated with the melting temperatures of GH12 enzymes, further proving the importance of the dynamic stability of the active site. Additionally, analysis of the residue-interaction network revealed that the active site in thermophilic enzyme was capable of forming additional contacts with other amino acids than those observed in the mesophilic enzyme. These interactions are likely the key mechanisms underlying the differences in rigidity of the active site. These findings provide further biophysical insights into the reversible thermal inactivation of enzymes and potential applications in future protein engineering.

  13. A Combined Probe-Molecule, Mössbauer, Nuclear Resonance Vibrational Spectroscopy, and Density Functional Theory Approach for Evaluation of Potential Iron Active Sites in an Oxygen Reduction Reaction Catalyst

    DOE PAGES

    Kneebone, Jared L.; Daifuku, Stephanie L.; Kehl, Jeffrey A.; ...

    2017-07-06

    While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O 2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O 2 or O 2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe activemore » sites in complex ORR catalysts that combines an effective probe molecule (NO (g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO (g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO (g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO (g) probe molecules. Moreover, such sites are likely also reactive to O 2, possibly serving as the ORR active sites in the synthesized materials.« less

  14. A Combined Probe-Molecule, Mössbauer, Nuclear Resonance Vibrational Spectroscopy, and Density Functional Theory Approach for Evaluation of Potential Iron Active Sites in an Oxygen Reduction Reaction Catalyst

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kneebone, Jared L.; Daifuku, Stephanie L.; Kehl, Jeffrey A.

    While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O 2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O 2 or O 2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe activemore » sites in complex ORR catalysts that combines an effective probe molecule (NO (g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO (g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO (g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO (g) probe molecules. Moreover, such sites are likely also reactive to O 2, possibly serving as the ORR active sites in the synthesized materials.« less

  15. Structural analysis of peptides that fill sites near the active center of the two different enzyme molecules by artificial intelligence and computer simulations

    NASA Astrophysics Data System (ADS)

    Nishiyama, Katsuhiko

    2018-05-01

    Using artificial intelligence, the binding styles of 167 tetrapeptides were predicted in the active site of papain and cathepsin K. Five tetrapeptides (Asn-Leu-Lys-Trp, Asp-Gln-Trp-Gly, Cys-Gln-Leu-Arg, Gln-Leu-Trp-Thr and Arg-Ser-Glu-Arg) were found to bind sites near the active center of both papain and cathepsin K. These five tetrapeptides have the potential to also bind sites of other cysteine proteases, and structural characteristics of these tetrapeptides should aid the design of a common inhibitor of cysteine proteases. Smart application of artificial intelligence should accelerate data mining of important complex systems.

  16. Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.

    PubMed

    Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G

    2013-10-23

    We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Active-Site Hydration and Water Diffusion in Cytochrome P450cam: A Highly Dynamic Process

    PubMed Central

    Miao, Yinglong; Baudry, Jerome

    2011-01-01

    Long-timescale molecular dynamics simulations (300 ns) are performed on both the apo- (i.e., camphor-free) and camphor-bound cytochrome P450cam (CYP101). Water diffusion into and out of the protein active site is observed without biased sampling methods. During the course of the molecular dynamics simulation, an average of 6.4 water molecules is observed in the camphor-binding site of the apo form, compared to zero water molecules in the binding site of the substrate-bound form, in agreement with the number of water molecules observed in crystal structures of the same species. However, as many as 12 water molecules can be present at a given time in the camphor-binding region of the active site in the case of apo-P450cam, revealing a highly dynamic process for hydration of the protein active site, with water molecules exchanging rapidly with the bulk solvent. Water molecules are also found to exchange locations frequently inside the active site, preferentially clustering in regions surrounding the water molecules observed in the crystal structure. Potential-of-mean-force calculations identify thermodynamically favored trans-protein pathways for the diffusion of water molecules between the protein active site and the bulk solvent. Binding of camphor in the active site modifies the free-energy landscape of P450cam channels toward favoring the diffusion of water molecules out of the protein active site. PMID:21943431

  18. Biomonitoring of lead-contaminated Missouri streams with an assay for erythrocyte δ-aminolevulinic acid dehydratase activity in fish blood

    USGS Publications Warehouse

    Schmitt, C.J.; Wildhaber, M.L.; Hunn, J.B.; Nash, T.; Tieger, M. N.; Steadman, B. L.

    1993-01-01

    The activity of the enzyme δ-aminolevulinic acid dehydratase (ALA-D) in erythrocytes has long been used as a biomarker of lead exposure in humans and waterfowl and, more recently, in fishes. The assay was tested for ALA-D activity in fishes from streams affected by lead in combination with other metals from lead-zinc mining and related activities. Fishes (mostly catostomids) were collected from sites affected by historic and current mining activities, and from sites considered to be unaffected by mining (reference sites). A group of potentially toxic elements was measured in blood and carcass samples of individual fish, as were ALA-D activity, total protein (TP), and hemoglobin (Hb) in blood. Concentrations of mining-related metals (lead, zinc, and cadmium) were significantly greater (P<0.05) in fish blood and carcass at sites affected by historic mining activities than at reference and active mining sites. When analyzed by multiple regression, ALA-D activity, Hb, and TP accounted for 66% of blood-lead and 69% of carcass-lead variability. Differences among species were small. ALA-D activity as a biomarker adequately distinguished sites affected by bioavailable environmental lead. Zinc was the only other metal that affected ALA-D activity; it appeared to ameliorate the inactivation of ALA-D by lead.

  19. Health assessment for Koppers Company, Inc. , National Priorities List (NPL) Site, Texarkana, Texas, Region 6. CERCLIS No. TXD980623904. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The Koppers Company, Inc. Site located in Texarkana, Texas is on the National Priorities List. The site is the former location of a wood treatment facility. The site is contaminated with numerous chemicals from the former wood treatment operations including polyaromatic hydrocarbons (PAH), phenolic compounds, polychlorinated dibenzofurans (PCDF). Previous remedial activity has included reseeding and the installation of sod in highly contaminated residential areas. The primary environmental pathways of potential concern are surface soils and ground water. Long-term exposures to contaminated soils in the residential area pose a potential health risk for ingestion and dermal absorption of soil contaminants. Groundmore » water beneath the site is contaminated and would pose a potential health risk if used for potable purposes.« less

  20. Wind-Driven Erosion and Exposure Potential at Mars 2020 Rover Candidate-Landing Sites.

    PubMed

    Chojnacki, Matthew; Banks, Maria; Urso, Anna

    2018-02-01

    Aeolian processes have likely been the predominant geomorphic agent for most of Mars' history and have the potential to produce relatively young exposure ages for geologic units. Thus, identifying local evidence for aeolian erosion is highly relevant to the selection of landing sites for future missions, such as the Mars 2020 Rover mission that aims to explore astrobiologically relevant ancient environments. Here we investigate wind-driven activity at eight Mars 2020 candidate-landing sites to constrain erosion potential at these locations. To demonstrate our methods, we found that contemporary dune-derived abrasion rates were in agreement with rover-derived exhumation rates at Gale crater and could be employed elsewhere. The Holden crater candidate site was interpreted to have low contemporary erosion rates, based on the presence of a thick sand coverage of static ripples. Active ripples at the Eberswalde and southwest Melas sites may account for local erosion and the dearth of small craters. Moderate-flux regional dunes near Mawrth Vallis were deemed unrepresentative of the candidate site, which is interpreted to currently be experiencing low levels of erosion. The Nili Fossae site displayed the most unambiguous evidence for local sand transport and erosion, likely yielding relatively young exposure ages. The downselected Jezero crater and northeast Syrtis sites had high-flux neighboring dunes and exhibited substantial evidence for sediment pathways across their ellipses. Both sites had relatively high estimated abrasion rates, which would yield young exposure ages. The downselected Columbia Hills site lacked evidence for sand movement, and contemporary local erosion rates are estimated to be relatively low.

  1. Wind-Driven Erosion and Exposure Potential at Mars 2020 Rover Candidate-Landing Sites

    PubMed Central

    Chojnacki, Matthew; Banks, Maria; Urso, Anna

    2018-01-01

    Aeolian processes have likely been the predominant geomorphic agent for most of Mars’ history and have the potential to produce relatively young exposure ages for geologic units. Thus, identifying local evidence for aeolian erosion is highly relevant to the selection of landing sites for future missions, such as the Mars 2020 Rover mission that aims to explore astrobiologically relevant ancient environments. Here we investigate wind-driven activity at eight Mars 2020 candidate-landing sites to constrain erosion potential at these locations. To demonstrate our methods, we found that contemporary dune-derived abrasion rates were in agreement with rover-derived exhumation rates at Gale crater and could be employed elsewhere. The Holden crater candidate site was interpreted to have low contemporary erosion rates, based on the presence of a thick sand coverage of static ripples. Active ripples at the Eberswalde and southwest Melas sites may account for local erosion and the dearth of small craters. Moderate-flux regional dunes near Mawrth Vallis were deemed unrepresentative of the candidate site, which is interpreted to currently be experiencing low levels of erosion. The Nili Fossae site displayed the most unambiguous evidence for local sand transport and erosion, likely yielding relatively young exposure ages. The downselected Jezero crater and northeast Syrtis sites had high-flux neighboring dunes and exhibited substantial evidence for sediment pathways across their ellipses. Both sites had relatively high estimated abrasion rates, which would yield young exposure ages. The downselected Columbia Hills site lacked evidence for sand movement, and contemporary local erosion rates are estimated to be relatively low. PMID:29568719

  2. Wind-Driven Erosion and Exposure Potential at Mars 2020 Rover Candidate-Landing Sites

    NASA Astrophysics Data System (ADS)

    Chojnacki, Matthew; Banks, Maria; Urso, Anna

    2018-02-01

    Aeolian processes have likely been the predominant geomorphic agent for most of Mars' history and have the potential to produce relatively young exposure ages for geologic units. Thus, identifying local evidence for aeolian erosion is highly relevant to the selection of landing sites for future missions, such as the Mars 2020 Rover mission that aims to explore astrobiologically relevant ancient environments. Here we investigate wind-driven activity at eight Mars 2020 candidate-landing sites to constrain erosion potential at these locations. To demonstrate our methods, we found that contemporary dune-derived abrasion rates were in agreement with rover-derived exhumation rates at Gale crater and could be employed elsewhere. The Holden crater candidate site was interpreted to have low contemporary erosion rates, based on the presence of a thick sand coverage of static ripples. Active ripples at the Eberswalde and southwest Melas sites may account for local erosion and the dearth of small craters. Moderate-flux regional dunes near Mawrth Vallis were deemed unrepresentative of the candidate site, which is interpreted to currently be experiencing low levels of erosion. The Nili Fossae site displayed the most unambiguous evidence for local sand transport and erosion, likely yielding relatively young exposure ages. The downselected Jezero crater and northeast Syrtis sites had high-flux neighboring dunes and exhibited substantial evidence for sediment pathways across their ellipses. Both sites had relatively high estimated abrasion rates, which would yield young exposure ages. The downselected Columbia Hills site lacked evidence for sand movement, and contemporary local erosion rates are estimated to be relatively low.

  3. Orthosteric and allosteric potentiation of heteromeric neuronal nicotinic acetylcholine receptors.

    PubMed

    Wang, Jingyi; Lindstrom, Jon

    2018-06-01

    Heteromeric nicotinic ACh receptors (nAChRs) were thought to have two orthodox agonist-binding sites at two α/β subunit interfaces. Highly selective ligands are hard to develop by targeting orthodox agonist sites because of high sequence similarity of this binding pocket among different subunits. Recently, unorthodox ACh-binding sites have been discovered at some α/α and β/α subunit interfaces, such as α4/α4, α5/α4 and β3/α4. Targeting unorthodox sites may yield subtype-selective ligands, such as those for (α4β2) 2 α5, (α4β2) 2 β3 and (α6β2) 2 β3 nAChRs. The unorthodox sites have unique pharmacology. Agonist binding at one unorthodox site is not sufficient to activate nAChRs, but it increases activation from the orthodox sites. NS9283, a selective agonist for the unorthodox α4/α4 site, was initially thought to be a positive allosteric modulator (PAM). NS9283 activates nAChRs with three engineered α4/α4 sites. PAMs, on the other hand, act at allosteric sites where ACh cannot bind. Known PAM sites include the ACh-homologous non-canonical site (e.g. morantel at β/α), the C-terminus (e.g. Br-PBTC and 17β-estradiol), a transmembrane domain (e.g. LY2087101) or extracellular and transmembrane domain interfaces (e.g. NS206). Some of these PAMs, such as Br-PBTC and 17β-estradiol, require only one subunit to potentiate activation of nAChRs. In this review, we will discuss differences between activation from orthosteric and allosteric sites, their selective ligands and clinical implications. These studies have advanced understanding of the structure, assembly and pharmacology of heteromeric neuronal nAChRs. This article is part of a themed section on Nicotinic Acetylcholine Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v175.11/issuetoc. © 2017 The British Pharmacological Society.

  4. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  5. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.

    1998-05-01

    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  6. Carbinolamine Formation and Dehydration in a DNA Repair Enzyme Active Site

    PubMed Central

    Dodson, M. L.; Walker, Ross C.; Lloyd, R. Stephen

    2012-01-01

    In order to suggest detailed mechanistic hypotheses for the formation and dehydration of a key carbinolamine intermediate in the T4 pyrimidine dimer glycosylase (T4PDG) reaction, we have investigated these reactions using steered molecular dynamics with a coupled quantum mechanics–molecular mechanics potential (QM/MM). We carried out simulations of DNA abasic site carbinolamine formation with and without a water molecule restrained to remain within the active site quantum region. We recovered potentials of mean force (PMF) from thirty replicate reaction trajectories using Jarzynski averaging. We demonstrated feasible pathways involving water, as well as those independent of water participation. The water–independent enzyme–catalyzed reaction had a bias–corrected Jarzynski–average barrier height of approximately for the carbinolamine formation reaction and ) for the reverse reaction at this level of representation. When the proton transfer was facilitated with an intrinsic quantum water, the barrier height was approximately in the forward (formation) reaction and for the reverse. In addition, two modes of unsteered (free dynamics) carbinolamine dehydration were observed: in one, the quantum water participated as an intermediate proton transfer species, and in the other, the active site protonated glutamate hydrogen was directly transferred to the carbinolamine oxygen. Water–independent unforced proton transfer from the protonated active site glutamate carboxyl to the unprotonated N–terminal amine was also observed. In summary, complex proton transfer events, some involving water intermediates, were studied in QM/MM simulations of T4PDG bound to a DNA abasic site. Imine carbinolamine formation was characterized using steered QM/MM molecular dynamics. Dehydration of the carbinolamine intermediate to form the final imine product was observed in free, unsteered, QM/MM dynamics simulations, as was unforced acid-base transfer between the active site carboxylate and the N–terminal amine. PMID:22384015

  7. Active site of tripeptidyl peptidase II from human erythrocytes is of the subtilisin type.

    PubMed Central

    Tomkinson, B; Wernstedt, C; Hellman, U; Zetterqvist, O

    1987-01-01

    The present report presents evidence that the amino acid sequence around the serine of the active site of human tripeptidyl peptidase II is of the subtilisin type. The enzyme from human erythrocytes was covalently labeled at its active site with [3H]diisopropyl fluorophosphate, and the protein was subsequently reduced, alkylated, and digested with trypsin. The labeled tryptic peptides were purified by gel filtration and repeated reversed-phase HPLC, and their amino-terminal sequences were determined. Residue 9 contained the radioactive label and was, therefore, considered to be the active serine residue. The primary structure of the part of the active site (residues 1-10) containing this residue was concluded to be Xaa-Thr-Gln-Leu-Met-Asx-Gly-Thr-Ser-Met. This amino acid sequence is homologous to the sequence surrounding the active serine of the microbial peptidases subtilisin and thermitase. These data demonstrate that human tripeptidyl peptidase II represents a potentially distinct class of human peptidases and raise the question of an evolutionary relationship between the active site of a mammalian peptidase and that of the subtilisin family of serine peptidases. PMID:3313395

  8. Locomotor activity influences muscle architecture and bone growth but not muscle attachment site morphology.

    PubMed

    Rabey, Karyne N; Green, David J; Taylor, Andrea B; Begun, David R; Richmond, Brian G; McFarlin, Shannon C

    2015-01-01

    The ability to make behavioural inferences from skeletal remains is critical to understanding the lifestyles and activities of past human populations and extinct animals. Muscle attachment site (enthesis) morphology has long been assumed to reflect muscle strength and activity during life, but little experimental evidence exists to directly link activity patterns with muscle development and the morphology of their attachments to the skeleton. We used a mouse model to experimentally test how the level and type of activity influences forelimb muscle architecture of spinodeltoideus, acromiodeltoideus, and superficial pectoralis, bone growth rate and gross morphology of their insertion sites. Over an 11-week period, we collected data on activity levels in one control group and two experimental activity groups (running, climbing) of female wild-type mice. Our results show that both activity type and level increased bone growth rates influenced muscle architecture, including differences in potential muscular excursion (fibre length) and potential force production (physiological cross-sectional area). However, despite significant influences on muscle architecture and bone development, activity had no observable effect on enthesis morphology. These results suggest that the gross morphology of entheses is less reliable than internal bone structure for making inferences about an individual's past behaviour. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Locomotor activity influences muscle architecture and bone growth but not muscle attachment site morphology

    PubMed Central

    Rabey, Karyne N.; Green, David J.; Taylor, Andrea B.; Begun, David R.; Richmond, Brian G.; McFarlin, Shannon C.

    2014-01-01

    The ability to make behavioural inferences from skeletal remains is critical to understanding the lifestyles and activities of past human populations and extinct animals. Muscle attachment site (enthesis) morphology has long been assumed to reflect muscle strength and activity during life, but little experimental evidence exists to directly link activity patterns with muscle development and the morphology of their attachments to the skeleton. We used a mouse model to experimentally test how the level and type of activity influences forelimb muscle architecture of spinodeltoideus, acromiodeltoideus, and superficial pectoralis, bone growth rate and gross morphology of their insertion sites. Over an 11-week period, we collected data on activity levels in one control group and two experimental activity groups (running, climbing) of female wild-type mice. Our results show that both activity type and level increased bone growth rates influenced muscle architecture, including differences in potential muscular excursion (fibre length) and potential force production (physiological cross-sectional area). However, despite significant influences on muscle architecture and bone development, activity had no observable effect on enthesis morphology. These results suggest that the gross morphology of entheses is less reliable than internal bone structure for making inferences about an individual’s past behaviour. PMID:25467113

  10. Approaches to efficient molecular catalyst systems for photochemical H2 production using [FeFe]-hydrogenase active site mimics.

    PubMed

    Wang, Mei; Chen, Lin; Li, Xueqiang; Sun, Licheng

    2011-12-28

    The research on structural and functional biomimics of the active site of [FeFe]-hydrogenases is in an attempt to elucidate the mechanisms of H(2)-evolution and uptake at the [FeFe]-hydrogenase active site, and to learn from Nature how to create highly efficient H(2)-production catalyst systems. Undoubtedly, it is a challenging, arduous, and long-term work. In this perspective, the progresses in approaches to photochemical H(2) production using mimics of the [FeFe]-hydrogenase active site as catalysts in the last three years are reviewed, with emphasis on adjustment of the redox potentials and hydrophilicity of the [FeFe]-hydrogenase active site mimics to make them efficient catalysts for H(2) production. With gradually increasing understanding of the chemistry of the [FeFe]-hydrogenases and their mimics, more bio-inspired proton reduction catalysts with significantly improved efficiency of H(2) production will be realized in the future. This journal is © The Royal Society of Chemistry 2011

  11. The glycoprotein character of multiple forms of Aspergillus polygalacturonase.

    PubMed

    Stratilová, E; Mislovicová, D; Kacuráková, M; Machová, E; Kolarová, N; Markovic, O; Jörnvall, H

    1998-02-01

    Comparisons of known primary structures of polygalacturonases show that extent and localization of potential N-glycosylation sites differ. Some sites are similar in position and adjacent to strictly conserved residues at the potential active site. The presence of N-acetylglucosamine and mannose in the molecules of two homogeneous, major Aspergillus sp. polygalacturonase forms was confirmed by IR spectroscopy. The purification method, based on interaction of the carbohydrate part with concanavalin A immobilized on chlorotriazine bead cellulose, was optimized. Deglycosylation with N-glycosidase F under denaturating and nondenaturating conditions led to molecular mass decreases followed by complete inactivation of the polygalacturonase enzyme activity. These results show the importance of glycosylation in these protein forms, while the comparative patterns establish both variability and some similarities in overall glycosylation architectures.

  12. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  13. The enviornmental assessment of a contemporary coal mining system

    NASA Technical Reports Server (NTRS)

    Dutzi, E. J.; Sullivan, P. J.; Hutchinson, C. F.; Stevens, C. M.

    1980-01-01

    A contemporary underground coal mine in eastern Kentucky was assessed in order to determine potential off-site and on-site environmental impacts associated with the mining system in the given environmental setting. A 4 section, continuous room and pillor mine plan was developed for an appropriate site in eastern Kentucky. Potential environmental impacts were identified, and mitigation costs determined. The major potential environmental impacts were determined to be: acid water drainage from the mine and refuse site, uneven subsidence of the surface as a result of mining activity, and alteration of ground water aquifers in the subsidence zone. In the specific case examined, the costs of environmental impact mitigation to levels prescribed by regulations would not exceed $1/ton of coal mined, and post mining land values would not be affected.

  14. Assessing impacts of unconventional natural gas extraction on microbial communities in headwater stream ecosystems in Northwestern Pennsylvania

    PubMed Central

    Trexler, Ryan; Solomon, Caroline; Brislawn, Colin J.; Wright, Justin R.; Rosenberger, Abigail; McClure, Erin E.; Grube, Alyssa M.; Peterson, Mark P.; Keddache, Mehdi; Mason, Olivia U.; Hazen, Terry C.; Grant, Christopher J.; Lamendella, Regina

    2014-01-01

    Hydraulic fracturing and horizontal drilling have increased dramatically in Pennsylvania Marcellus shale formations, however the potential for major environmental impacts are still incompletely understood. High-throughput sequencing of the 16S rRNA gene was performed to characterize the microbial community structure of water, sediment, bryophyte, and biofilm samples from 26 headwater stream sites in northwestern Pennsylvania with different histories of fracking activity within Marcellus shale formations. Further, we describe the relationship between microbial community structure and environmental parameters measured. Approximately 3.2 million 16S rRNA gene sequences were retrieved from a total of 58 samples. Microbial community analyses showed significant reductions in species richness as well as evenness in sites with Marcellus shale activity. Beta diversity analyses revealed distinct microbial community structure between sites with and without Marcellus shale activity. For example, operational taxonomic units (OTUs) within the Acetobacteracea, Methylocystaceae, Acidobacteriaceae, and Phenylobacterium were greater than three log-fold more abundant in MSA+ sites as compared to MSA− sites. Further, several of these OTUs were strongly negatively correlated with pH and positively correlated with the number of wellpads in a watershed. It should be noted that many of the OTUs enriched in MSA+ sites are putative acidophilic and/or methanotrophic populations. This study revealed apparent shifts in the autochthonous microbial communities and highlighted potential members that could be responding to changing stream conditions as a result of nascent industrial activity in these aquatic ecosystems. PMID:25408683

  15. Catalysis by metal-organic frameworks: fundamentals and opportunities.

    PubMed

    Ranocchiari, Marco; van Bokhoven, Jeroen Anton

    2011-04-14

    Crystalline porous materials are extremely important for developing catalytic systems with high scientific and industrial impact. Metal-organic frameworks (MOFs) show unique potential that still has to be fully exploited. This perspective summarizes the properties of MOFs with the aim to understand what are possible approaches to catalysis with these materials. We categorize three classes of MOF catalysts: (1) those with active site on the framework, (2) those with encapsulated active species, and (3) those with active sites attached through post-synthetic modification. We identify the tunable porosity, the ability to fine tune the structure of the active site and its environment, the presence of multiple active sites, and the opportunity to synthesize structures in which key-lock bonding of substrates occurs as the characteristics that distinguish MOFs from other materials. We experience a unique opportunity to imagine and design heterogeneous catalysts, which might catalyze reactions previously thought impossible.

  16. Anisotropic Covalency Contributions to Superexchange Pathways in Type One Copper Active Sites

    PubMed Central

    2015-01-01

    Type one (T1) Cu sites deliver electrons to catalytic Cu active sites: the mononuclear type two (T2) Cu site in nitrite reductases (NiRs) and the trinuclear Cu cluster in the multicopper oxidases (MCOs). The T1 Cu and the remote catalytic sites are connected via a Cys-His intramolecular electron-transfer (ET) bridge, which contains two potential ET pathways: P1 through the protein backbone and P2 through the H-bond between the Cys and the His. The high covalency of the T1 Cu–S(Cys) bond is shown here to activate the T1 Cu site for hole superexchange via occupied valence orbitals of the bridge. This covalency-activated electronic coupling (HDA) facilitates long-range ET through both pathways. These pathways can be selectively activated depending on the geometric and electronic structure of the T1 Cu site and thus the anisotropic covalency of the T1 Cu–S(Cys) bond. In NiRs, blue (π-type) T1 sites utilize P1 and green (σ-type) T1 sites utilize P2, with P2 being more efficient. Comparing the MCOs to NiRs, the second-sphere environment changes the conformation of the Cys-His pathway, which selectively activates HDA for superexchange by blue π sites for efficient turnover in catalysis. These studies show that a given protein bridge, here Cys-His, provides different superexchange pathways and electronic couplings depending on the anisotropic covalencies of the donor and acceptor metal sites. PMID:25310460

  17. Design of Single-Site Photocatalyst using Metal-Organic Framework as Matrix.

    PubMed

    Wen, Meicheng; Mori, Kohsuke; Kuwahara, Yasutaka; An, Taicheng; Yamashita, Hiromi

    2018-05-14

    Single-site photocatalyst generally displays excellent photocatalytic activtiy and considerable high stability as compared to homogeneous catalytic system. A rational structural design of single-site photocatalyst with isolated, uniform and spatially separated active sites in a given solid is of prime importance to achieve high photocatalytic activity. Intense attentions have been focused on the engineering and fabrication of single-site photocatalys by using porous materials as platform. Metal-organic frameworks (MOFs) hold great potential for the design and fabrication of single-site photocatalysts due to their remarkable porosity, ultrahigh surface area, extraordinary tailorability and significant diversity. MOFs can provide abundant number of binding sites for anchoring active sites, result in significant enhancement of photocatalytic performance. In this focus review, the development of single-site MOF photocatalysts that perform in important and challenging chemical redox reaction such as photocatalytic water splitting, photocatalytic CO₂ conversion and organic transformations is summarized thoroughly. The successful strategies applied for the construction of single-site MOF photocatalysts and major challenge toward practical application was summarized and pointed out, respectively. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 1 of 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beck Colleen M,Edwards Susan R.,King Maureen L.

    2011-09-01

    This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archivalmore » research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.« less

  19. The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 3 of 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beck Colleen M.,Edwards Susan R.,King Maureen L.

    2011-09-01

    This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archivalmore » research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.« less

  20. The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 2 of 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beck Colleen M.,Edwards Susan R.,King Maureen L.

    2011-09-01

    This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archivalmore » research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.« less

  1. Predatory fish depletion and recovery potential on Caribbean reefs.

    PubMed

    Valdivia, Abel; Cox, Courtney Ellen; Bruno, John Francis

    2017-03-01

    The natural, prehuman abundance of most large predators is unknown because of the lack of historical data and a limited understanding of the natural factors that control their populations. Determining the supportable predator biomass at a given location (that is, the predator carrying capacity) would help managers to optimize protection and would provide site-specific recovery goals. We assess the relationship between predatory reef fish biomass and several anthropogenic and environmental variables at 39 reefs across the Caribbean to (i) estimate their roles determining local predator biomass and (ii) determine site-specific recovery potential if fishing was eliminated. We show that predatory reef fish biomass tends to be higher in marine reserves but is strongly negatively related to human activities, especially coastal development. However, human activities and natural factors, including reef complexity and prey abundance, explain more than 50% of the spatial variation in predator biomass. Comparing site-specific predator carrying capacities to field observations, we infer that current predatory reef fish biomass is 60 to 90% lower than the potential supportable biomass in most sites, even within most marine reserves. We also found that the scope for recovery varies among reefs by at least an order of magnitude. This suggests that we could underestimate unfished biomass at sites that provide ideal conditions for predators or greatly overestimate that of seemingly predator-depleted sites that may have never supported large predator populations because of suboptimal environmental conditions.

  2. National Wind Technology Center sitewide, Golden, CO: Environmental assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1996-11-01

    The National Renewable Energy Laboratory (NREL), the nation`s primary solar and renewable energy research laboratory, proposes to expand its wind technology research and development program activities at its National Wind Technology Center (NWTC) near Golden, Colorado. NWTC is an existing wind energy research facility operated by NREL for the US Department of Energy (DOE). Proposed activities include the construction and reuse of buildings and facilities, installation of up to 20 wind turbine test sites, improvements in infrastructure, and subsequent research activities, technology testing, and site operations. In addition to wind turbine test activities, NWTC may be used to support othermore » NREL program activities and small-scale demonstration projects. This document assesses potential consequences to resources within the physical, biological, and human environment, including potential impacts to: air quality, geology and soils, water resources, biological resources, cultural and historic resources, socioeconomic resources, land use, visual resources, noise environment, hazardous materials and waste management, and health and safety conditions. Comment letters were received from several agencies in response to the scoping and predecisional draft reviews. The comments have been incorporated as appropriate into the document with full text of the letters contained in the Appendices. Additionally, information from the Rocky Flats Environmental Technology Site on going sitewide assessment of potential environmental impacts has been reviewed and discussed by representatives of both parties and incorporated into the document as appropriate.« less

  3. Design, synthesis and evaluation of 4-dimethylamine flavonoid derivatives as potential multifunctional anti-Alzheimer agents.

    PubMed

    Luo, Wen; Wang, Ting; Hong, Chen; Yang, Ya-Chen; Chen, Ying; Cen, Juan; Xie, Song-Qiang; Wang, Chao-Jie

    2016-10-21

    A new series of 4-dimethylamine flavonoid derivatives were designed and synthesized as potential multifunctional anti-Alzheimer agents. The inhibition of cholinesterase activity, self-induced β-amyloid (Aβ) aggregation, and antioxidant activity by these derivatives was investigated. Most of the compounds exhibited potent acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory activity. A Lineweaver-Burk plot and molecular modeling study showed that these compounds targeted both the catalytic active site (CAS) and peripheral anionic site (PAS) of AChE. The derivatives showed potent self-induced Aβ aggregation inhibition and peroxyl radical absorbance activity. Moreover, compound 6d significantly protected PC12 neurons against H2O2-induced cell death at low concentrations. Thus, these compounds could become multifunctional agents for further development for the treatment of AD. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. Differential regulation of the transcriptional activity of the glucocorticoid receptor through site-specific phosphorylation.

    PubMed

    Kumar, Raj; Calhoun, William J

    2008-12-01

    Post-translational modifications such as phosphorylation are known to play an important role in the gene regulation by the transcription factors including the nuclear hormone receptor superfamily of which the glucocorticoid receptor (GR) is a member. Protein phosphorylation often switches cellular activity from one state to another. Like many other transcription factors, the GR is a phosphoprotein, and phosphorylation plays an important role in the regulation of GR activity. Cell signaling pathways that regulate phosphorylation of the GR and its associated proteins are important determinants of GR function under various physiological conditions. While the role of many phosphorylation sites in the GR is still not fully understood, the role of others is clearer. Several aspects of transcription factor function, including DNA binding affinity, interaction of transactivation domains with the transcription initiation complex, and shuttling between the cytoplasmic compartments, have all been linked to site-specific phosphorylation. All major phosphorylation sites in the human GR are located in the N-terminal domain including the major transactivation domain, AF1. Available literature clearly indicates that many of these potential phosphorylation sites are substrates for multiple kinases, suggesting the potential for a very complex regulatory network. Phosphorylated GR interacts favorably with critical coregulatory proteins and subsequently enhances transcriptional activity. In addition, the activities and specificities of coregulators may be subject to similar regulation by phosphorylation. Regulation of the GR activity due to phosphorylation appears to be site-specific and dependent upon specific cell signaling cascade. Taken together, site-specific phosphorylation and related kinase pathways play an important role in the action of the GR, and more precise mechanistic information will lead to fuller understanding of the complex nature of gene regulation by the GR- and related transcription factors. This review provides currently available information regarding the role of GR phosphorylation in its action, and highlights the possible underlying mechanisms of action.

  5. ExoMars 2018: the four final candidate Landing Sites

    NASA Astrophysics Data System (ADS)

    Loizeau, Damien; Flahaut, Jessica; Vago, Jorge L.; Hauber, Ernst; Bridges, John C.

    2015-04-01

    The ExoMars 2018 mission will land a rover on Mars, its scientific objectives are to search for signs of past and present life on Mars and to investigate the water/geochemical environment as a function of depth in the shallow subsurface. The rover will be able to travel several kilometres, analyzing surface and subsurface samples, down to a 2 meter depth. The very powerful combination of mobility with the ability to access in-depth locations, where organic molecules can be well preserved, is unique to this mission [1]. An invitation has been sent to the community to propose scientifically compelling sites for the mission [2], which comply to the main engineering constraints for landing and operation safety. Scientifically interesting sites include locations with evidence for long duration or frequently recurring aqueous activity, low energy transport and deposition, fined-grained, recently exposed sediments, and/or hydrated minerals such as clays or evaporites. The outcrops of interest must be distributed over the landing ellipse to ensure that the rover can access some of them over a short distance [2]. The received proposals have been reviewed by the Landing Site Selection Working Group (LSSWG) and at first eight sites were found to be compliant with the science, engineering, and planetary protection requirements [3]. These sites were presented by their proposers and discussed at the first landing site workshop that took place in ESAC, Spain, 26-28 March 2014. Following that workshop, four sites were selected for further investigation, on the base of their higher potential for long lived water activity, the presence of fine grained sediments, and also importantly on the high concentration of potential targets of interest over the whole landing ellipse [3]. The analysis of these sites, both in term of scientific relevance and engineering safety, is still on-going. Latest findings were presented during a second workshop that took place in ALTEC, Torino, Italy, 11 December 2014. The Aram Dorsum site comprises Noachian layered sedimentary rocks with a prominent inverted channel system (>80 km long). Potential targets include the inverted channel, the channel margins, a channel transition unit, and pits present within the floodplain. The Hypanis Vallis site lies near two fluvial fan/deltaic systems at the termination of Hypanis and Sabrina Valles. Potential targets include mainly outcrops of expected fine-grained sediments on the smooth transition unit that surrounds the delta/fan, and units around the rim of Magong crater. The Mawrth Vallis site contains one of the largest exposures of phyllosilicates detected on the Martian surface, in Noachian terrain [8]. Potential targets include the mineralogically diverse clay-rich outcrops and ancient channels. The Oxia Planum site lies on Fe/Mg phyllosilicates-rich exposures associated to layered rocks that may be related to the Mawrth Vallis sequence. Potential targets include the clay-rich outcrops as well as channels and inverted channels and delta-fan deposits. New data are being actively acquired by the HiRISE, CRISM and HRSC teams to support the ExoMars 2018 landing site selection process. The ellipses are large and new data are important for characterizing the potential targets and evaluating the safety of the sites. The proposing teams, the ExoMars project team and the LSSWG will continue their analysis and comparison of the sites, aiming to complete the certification of at least one site by September 2016 -- in time for the start of the mission's Critical Design Review (CDR). The final selection of the landing site is expected within 2017. References: [1] http://exploration.esa.int/mars/48088-mission-overview/ [2] http://exploration.esa.int/mars/53462-call-for-exo mars-2018-landing-site-selection/ [3] ExoMars 2018 LSSWG recommendation: http://exploration.esa.int/mars/54707-recommendation-for-the-narrowing-of-exomars-2018-landing-sites/

  6. An in-silico insight into the characteristics of β-propeller phytase.

    PubMed

    Mathew, Akash; Verma, Anukriti; Gaur, Smriti

    2014-06-01

    Phytase is an enzyme that is found extensively in the plant kingdom and in some species of bacteria and fungi. This paper identifies and analyses the available full length sequences of β-propeller phytases (BPP). BPP was chosen due to its potential applicability in the field of aquaculture. The sequences were obtained from the Uniprot database and subject to various online bioinformatics tools to elucidate the physio-chemical characteristics, secondary structures and active site compositions of BPP. Protparam and SOPMA were used to analyse the physiochemical and secondary structure characteristics, while the Expasy online modelling tool and CASTp were used to model the 3-D structure and identify the active sites of the BPP sequences. The amino acid compositions of the four sequences were compared and composed in a graphical format to identify similarities and highlight the potentially important amino acids that form the active site of BPP. This study aims to analyse BPP and contribute to the clarification of the molecular mechanism involved in the enzyme activity of BPP and contribute in part to the possibility of constructing a synthetic version of BPP.

  7. Spontaneous and evoked release are independently regulated at individual active zones.

    PubMed

    Melom, Jan E; Akbergenova, Yulia; Gavornik, Jeffrey P; Littleton, J Troy

    2013-10-30

    Neurotransmitter release from synaptic vesicle fusion is the fundamental mechanism for neuronal communication at synapses. Evoked release following an action potential has been well characterized for its function in activating the postsynaptic cell, but the significance of spontaneous release is less clear. Using transgenic tools to image single synaptic vesicle fusion events at individual release sites (active zones) in Drosophila, we characterized the spatial and temporal dynamics of exocytotic events that occur spontaneously or in response to an action potential. We also analyzed the relationship between these two modes of fusion at single release sites. A majority of active zones participate in both modes of fusion, although release probability is not correlated between the two modes of release and is highly variable across the population. A subset of active zones is specifically dedicated to spontaneous release, indicating a population of postsynaptic receptors is uniquely activated by this mode of vesicle fusion. Imaging synaptic transmission at individual release sites also revealed general rules for spontaneous and evoked release, and indicate that active zones with similar release probability can cluster spatially within individual synaptic boutons. These findings suggest neuronal connections contain two information channels that can be spatially segregated and independently regulated to transmit evoked or spontaneous fusion signals.

  8. Recruitment of local inhibitory networks by horizontal connections in layer 2/3 of ferret visual cortex.

    PubMed

    Tucker, Thomas R; Katz, Lawrence C

    2003-01-01

    To investigate how neurons in cortical layer 2/3 integrate horizontal inputs arising from widely distributed sites, we combined intracellular recording and voltage-sensitive dye imaging to visualize the spatiotemporal dynamics of neuronal activity evoked by electrical stimulation of multiple sites in visual cortex. Individual stimuli evoked characteristic patterns of optical activity, while delivering stimuli at multiple sites generated interacting patterns in the regions of overlap. We observed that neurons in overlapping regions received convergent horizontal activation that generated nonlinear responses due to the emergence of large inhibitory potentials. The results indicate that co-activation of multiple sets of horizontal connections recruit strong inhibition from local inhibitory networks, causing marked deviations from simple linear integration.

  9. Competitive Inhibition Mechanism of Acetylcholinesterase without Catalytic Active Site Interaction: Study on Functionalized C60 Nanoparticles via in Vitro and in Silico Assays.

    PubMed

    Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian

    2017-06-07

    Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.

  10. Not in My Backyard: CCS Sites and Public Perception of CCS.

    PubMed

    Braun, Carola

    2017-12-01

    Carbon capture and storage (CCS) is a technology that counteracts climate change by capturing atmospheric emissions of CO 2 from human activities, storing them in geological formations underground. However, CCS also involves major risks and side effects, and faces strong public opposition. The whereabouts of 408 potential CCS sites in Germany were released in 2011. Using detailed survey data on the public perception of CCS, this study quantifies how living close to a potential storage site affects the acceptance of CCS. It also analyzes the influence of other regional characteristics on the acceptance of CCS. The study finds that respondents who live close to a potential CCS site have significantly lower acceptance rates than those who do not. Living in a coal-mining region also markedly decreases acceptance. © 2017 Society for Risk Analysis.

  11. The adjuvant PCEP induces recruitment of myeloid and lymphoid cells at the injection site and draining lymph node.

    PubMed

    Awate, Sunita; Wilson, Heather L; Singh, Baljit; Babiuk, Lorne A; Mutwiri, George

    2014-05-01

    Poly[di(sodiumcarboxylatoethylphenoxy)phosphazene] (PCEP) has shown great potential as a vaccine adjuvant, but the mechanisms that mediate its adjuvant activity have not been investigated. Previously, we had reported the potential of PCEP to induce cytokines and chemokines at the site of injection. Hence, we hypothesized that PCEP creates strong immuno-competent environment leading to recruitment of immune cells at the injection site. Intramuscular injection of mice with PCEP induced significant recruitment of neutrophils, macrophages, monocytes, dendritic cells (DCs), and lymphocytes at the site of injection as well as in the draining lymph nodes. Flow cytometric analysis showed that the majority of the recruited immune cells took up and/or were associated with PCEP at the injection site, with lymphocytes taking up PCEP in lesser quantity. Further, confocal analysis revealed intracytoplasmic lysosomal localization of PCEP in recruited immune cells. These observations suggest that recruitment of distinct immune cells to the site of injection site may be an important mechanism by which PCEP potentiates immune responses to antigens. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Requirement of histidine 217 for ubiquinone reductase activity (Qi site) in the cytochrome bc1 complex.

    PubMed

    Gray, K A; Dutton, P L; Daldal, F

    1994-01-25

    Folding models suggest that the highly conserved histidine 217 of the cytochrome b subunit from the cytochrome bc1 complex is close to the quinone reductase (Qi) site. This histidine (bH217) in the cytochrome b polypeptide of the photosynthetic bacterium Rhodobacter capsulatus has been replaced with three other residues, aspartate (D), arginine (R), and leucine (L). bH217D and bH217R are able to grow photoheterotrophically and contain active cytochrome bc1 complexes (60% of wild-type activity), whereas the bH217L mutant is photosynthetically incompetent and contains a cytochrome bc1 complex that has only 10% of the wild-type activity. Single-turnover flash-activated electron transfer experiments show that cytochrome bH is reduced via the Qo site with near native rates in the mutant strains but that electron transfer between cytochrome bH and quinone bound at the Qi site is greatly slowed. These results are consistent with redox midpoint potential (Em) measurements of the cytochrome b subunit hemes and the Qi site quinone. The Em values of cyt bL and bH are approximately the same in the mutants and wild type, although the mutant strains have a larger relative concentration of what may be the high-potential form of cytochrome bH, called cytochrome b150. However, the redox properties of the semiquinone at the Qi site are altered significantly. The Qi site semiquinone stability constant of bH217R is 10 times higher than in the wild type, while in the other two strains (bH217D and bH217L) the stability constant is much lower than in the wild type. Thus H217 appears to have major effects on the redox properties of the quinone bound at the Qi site. These data are incorporated into a suggestion that H217 forms part of the binding pocket of the Qi site in a manner reminiscent of the interaction between quinone bound at the Qb site and H190 of the L subunit of the bacterial photosynthetic reaction center.

  13. Structure-based design of bacterial nitric oxide synthase inhibitors

    DOE PAGES

    Holden, Jeffrey K.; Kang, Soosung; Hollingsworth, Scott A.; ...

    2014-12-18

    Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial. Here wemore » present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Lastly, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors.« less

  14. Anti-mycobacterium tuberculosis activity of polyherbal medicines used for the treatment of tuberculosis in Eastern Cape, South Africa.

    PubMed

    Famewo, Elizabeth B; Clarke, Anna M; Wiid, Ian; Ngwane, Andile; van Helden, Paul; Afolayan, Anthony J

    2017-09-01

    The emergence of drug-resistant strains of Mycobacterium tuberculosis has become a global public health problem. Polyherbal medicines offer great hope for developing alternative drugs for the treatment of tuberculosis. To evaluate the anti-tubercular activity of polyherbal medicines used for the treatment of tuberculosis. The remedies were screened against Mycobacterium tuberculosis H37Rv using Middlebrook 7H9 media and MGIT BACTEC 960 system. They were liquid preparations from King Williams Town site A (KWTa), King Williams Town site B (KWTb), King Williams Town site C (KWTc), Hogsback first site (HBfs), Hogsback second site (HBss), Hogsback third site (HBts), East London (EL), Alice (AL) and Fort Beaufort (FB). The susceptibility testing revealed that all the remedies contain anti-tubercular activity with KWTa, KWTb, KWTc, HBfs, HBts, AL and FB exhibiting more activity at a concentration below 25 µl/ml. Furthermore, MIC values exhibited inhibitory activity with the most active remedies from KWTa, HBfs and HBts at 1.562 µg/ml. However, isoniazid showed more inhibitory activity against M. tuberculosis at 0.05 µg/ml when compare to the polyherbal remedies. This study has indicated that these remedies could be potential sources of new anti-mycobacterial agents against M. tuberculosis . However, the activity of these preparations and their active principles still require in vivo study in order to assess their future as new anti-tuberculosis agents.

  15. Tauroursodeoxycholic acid binds to the G-protein site on light activated rhodopsin.

    PubMed

    Lobysheva, E; Taylor, C M; Marshall, G R; Kisselev, O G

    2018-05-01

    The heterotrimeric G-protein binding site on G-protein coupled receptors remains relatively unexplored regarding its potential as a new target of therapeutic intervention or as a secondary site of action by the existing drugs. Tauroursodeoxycholic acid bears structural resemblance to several compounds that were previously identified to specifically bind to the light-activated form of the visual receptor rhodopsin and to inhibit its activation of transducin. We show that TUDCA stabilizes the active form of rhodopsin, metarhodopsin II, and does not display the detergent-like effects of common amphiphilic compounds that share the cholesterol scaffold structure, such as deoxycholic acid. Computer docking of TUDCA to the model of light-activated rhodopsin revealed that it interacts using similar mode of binding to the C-terminal domain of transducin alpha subunit. The ring regions of TUDCA made hydrophobic contacts with loop 3 region of rhodopsin, while the tail of TUDCA is exposed to solvent. The results show that TUDCA interacts specifically with rhodopsin, which may contribute to its wide-ranging effects on retina physiology and as a potential therapeutic compound for retina degenerative diseases. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Environmental, policy, and cultural factors related to physical activity in African American women.

    PubMed

    Richter, Donna L; Wilcox, Sara; Greaney, Mary L; Henderson, Karla A; Ainsworth, Barbara E

    2002-01-01

    Six focus groups were conducted in South Carolina with African American women (n = 42) aged 19-51 years to identify factors that influence physical activity. Transcripts were analyzed using NUD*IST. Cultural influences were seen as more important in determining the type of physical activity than its level. Barriers to and enablers of physical activity were identified in the social and physical environments, as were policy issues affecting physical activity in the community and at the work site. Potential community and work site interventions were suggested. Child care and monetary costs were frequently cited as barriers to physical activity.

  17. Active site of tripeptidyl peptidase II from human erythrocytes is of the subtilisin type

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkinson, B.; Wernstedt, C.; Hellman, U.

    1987-11-01

    The present report presents evidence that the amino acid sequence around the serine of the active site of human tripeptidyl peptidase II is of the subtilisin type. The enzyme from human erythrocytes was covalently labeled at its active site with (/sup 3/H)diisopropyl fluorophosphate, and the protein was subsequently reduced, alkylated, and digested with trypsin. The labeled tryptic peptides were purified by gel filtration and repeated reversed-phase HPLC, and their amino-terminal sequences were determined. Residue 9 contained the radioactive label and was, therefore, considered to be the active serine residue. The primary structure of the part of the active site (residuesmore » 1-10) containing this residue was concluded to be Xaa-Thr-Gln-Leu-Met-Asx-Gly-Thr-Ser-Met. This amino acid sequence is homologous to the sequence surrounding the active serine of the microbial peptidases subtilisin and thermitase. These data demonstrate that human tripeptidyl peptidase II represents a potentially distinct class of human peptidases and raise the question of an evolutionary relationship between the active site of a mammalian peptidase and that of the subtilisin family of serine peptidases.« less

  18. Noninvasive imaging of three-dimensional cardiac activation sequence during pacing and ventricular tachycardia.

    PubMed

    Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin

    2011-08-01

    Imaging cardiac excitation within ventricular myocardium is important in the treatment of cardiac arrhythmias and might help improve our understanding of arrhythmia mechanisms. This study sought to rigorously assess the imaging performance of a 3-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of 3D intracardiac mapping from up to 216 intramural sites during paced rhythm and norepinephrine (NE)-induced ventricular tachycardia (VT) in the rabbit heart. Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in 13 healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous NE. Computed tomography images were obtained to construct geometry models. The noninvasively imaged activation sequence correlated well with invasively measured counterpart, with a correlation coefficient of 0.72 ± 0.04, and a relative error of 0.30 ± 0.02 averaged over 520 paced beats as well as 73 NE-induced PVCs and VT beats. All PVCs and VT beats initiated in the subendocardium by a nonreentrant mechanism. The averaged distance from the imaged site of initial activation to the pacing site or site of arrhythmias determined from intracardiac mapping was ∼5 mm. For dual-site pacing, the double origins were identified when they were located at contralateral sides of ventricles or at the lateral wall and the apex. 3DCEI can noninvasively delineate important features of focal or multifocal ventricular excitation. It offers the potential to aid in localizing the origins and imaging activation sequences of ventricular arrhythmias, and to provide noninvasive assessment of the underlying arrhythmia mechanisms. Copyright © 2011 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  19. Noninvasive Imaging of Three-dimensional Cardiac Activation Sequence during Pacing and Ventricular Tachycardia

    PubMed Central

    Han, Chengzong; Pogwizd, Steven M.; Killingsworth, Cheryl R.; He, Bin

    2011-01-01

    Background Imaging cardiac excitation within ventricular myocardium is important in the treatment of cardiac arrhythmias and might help improve our understanding of arrhythmia mechanisms. Objective This study aims to rigorously assess the imaging performance of a three-dimensional (3-D) cardiac electrical imaging (3-DCEI) technique with the aid of 3-D intra-cardiac mapping from up to 216 intramural sites during paced rhythm and norepinephrine (NE) induced ventricular tachycardia (VT) in the rabbit heart. Methods Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in thirteen healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous NE. Computer tomography images were obtained to construct geometry model. Results The non-invasively imaged activation sequence correlated well with invasively measured counterparts, with a correlation coefficient of 0.72±0.04, and a relative error of 0.30±0.02 averaged over 520 paced beats as well as 73 NE-induced PVCs and VT beats. All PVCs and VT beats initiated in the subendocardium by a nonreentrant mechanism. The averaged distance from imaged site of initial activation to pacing site or site of arrhythmias determined from intra-cardiac mapping was ~5mm. For dual-site pacing, the double origins were identified when they were located at contralateral sides of ventricles or at the lateral wall and the apex. Conclusion 3-DCEI can non-invasively delineate important features of focal or multi-focal ventricular excitation. It offers the potential to aid in localizing the origins and imaging activation sequence of ventricular arrhythmias, and to provide noninvasive assessment of the underlying arrhythmia mechanisms. PMID:21397046

  20. Catalytically active Au-O(OH) x- species stabilized by alkali ions on zeolites and mesoporous oxides

    DOE PAGES

    Yang, Ming; Li, Sha; Wang, Yuan; ...

    2014-11-27

    Here we report that the addition of alkali ions (sodium or potassium) to gold on KLTL-zeolite and mesoporous MCM-41 silica stabilizes mononuclear gold in Au-O(OH) x-(Na or K) ensembles. This single-site gold species is active for the low-temperature (<200°C) water-gas shift (WGS) reaction. Unexpectedly, gold is thus similar to platinum in creating –O linkages with more than eight alkali ions and establishing an active site on various supports. The intrinsic activity of the single-site gold species is the same on irreducible supports as on reducible ceria, iron oxide, and titania supports, apparently all sharing a common, similarly structured gold activemore » site. This finding paves the way for using earth-abundant supports to disperse and stabilize precious metal atoms with alkali additives for the WGS and potentially other fuel-processing reactions.« less

  1. Yucca Mountain Biological Resources Monitoring Program; Annual report, FY91

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1992-01-01

    The US Department of Energy (DOE) is required by the Nuclear Waste Policy Act of 1982 (as amended in 1987) to study and characterize Yucca Mountain as a possible site for a geologic repository for high-level nuclear waste. During site characterization, the DOE will conduct a variety of geotechnical, geochemical, geological, and hydrological studies to determine the suitability of Yucca Mountain as a repository. To ensure that site characterization activities (SCA) do not adversely affect the Yucca Mountain area, an environmental program has been implemented to monitor and mitigate potential impacts and to ensure that activities comply with applicable environmentalmore » regulations. This report describes the activities and accomplishments during fiscal year 1991 (FY91) for six program areas within the Terrestrial Ecosystem component of the YMP environmental program. The six program areas are Site Characterization Activities Effects, Desert Tortoises, Habitat Reclamation, Monitoring and Mitigation, Radiological Monitoring, and Biological Support.« less

  2. An evaluation of the behaviour-change techniques used on Canadian cancer centre Web sites to support physical activity behaviour for breast cancer survivors

    PubMed Central

    Sylvester, B.D.; Zammit, K.; Fong, A.J.; Sabiston, C.M.

    2017-01-01

    Background Cancer centre Web sites can be a useful tool for distributing information about the benefits of physical activity for breast cancer (bca) survivors, and they hold potential for supporting health behaviour change. However, the extent to which cancer centre Web sites use evidence-based behaviour change techniques to foster physical activity behaviour among bca survivors is currently unknown. The aim of our study was to evaluate the presentation of behaviour-change techniques on Canadian cancer centre Web sites to promote physical activity behaviour for bca survivors. Methods All Canadian cancer centre Web sites (n = 39) were evaluated by two raters using the Coventry, Aberdeen, and London–Refined (calo-re) taxonomy of behaviour change techniques and the eEurope 2002 Quality Criteria for Health Related Websites. Descriptive statistics were calculated. Results The most common behaviour change techniques used on Web sites were providing information about consequences in general (80%), suggesting goal-setting behaviour (56%), and planning social support or social change (46%). Overall, Canadian cancer centre Web sites presented an average of M = 6.31 behaviour change techniques (of 40 that were coded) to help bca survivors increase their physical activity behaviour. Evidence of quality factors ranged from 90% (sites that provided evidence of readability) to 0% (sites that provided an editorial policy). Conclusions Our results provide preliminary evidence that, of 40 behaviour-change techniques that were coded, fewer than 20% were used to promote physical activity behaviour to bca survivors on cancer centre Web sites, and that the most effective techniques were inconsistently used. On cancer centre Web sites, health promotion specialists could focus on emphasizing knowledge mobilization efforts using available research into behaviour-change techniques to help bca survivors increase their physical activity. PMID:29270056

  3. An evaluation of the behaviour-change techniques used on Canadian cancer centre Web sites to support physical activity behaviour for breast cancer survivors.

    PubMed

    Sylvester, B D; Zammit, K; Fong, A J; Sabiston, C M

    2017-12-01

    Cancer centre Web sites can be a useful tool for distributing information about the benefits of physical activity for breast cancer (bca) survivors, and they hold potential for supporting health behaviour change. However, the extent to which cancer centre Web sites use evidence-based behaviour change techniques to foster physical activity behaviour among bca survivors is currently unknown. The aim of our study was to evaluate the presentation of behaviour-change techniques on Canadian cancer centre Web sites to promote physical activity behaviour for bca survivors. All Canadian cancer centre Web sites ( n = 39) were evaluated by two raters using the Coventry, Aberdeen, and London-Refined (calo-re) taxonomy of behaviour change techniques and the eEurope 2002 Quality Criteria for Health Related Websites. Descriptive statistics were calculated. The most common behaviour change techniques used on Web sites were providing information about consequences in general (80%), suggesting goal-setting behaviour (56%), and planning social support or social change (46%). Overall, Canadian cancer centre Web sites presented an average of M = 6.31 behaviour change techniques (of 40 that were coded) to help bca survivors increase their physical activity behaviour. Evidence of quality factors ranged from 90% (sites that provided evidence of readability) to 0% (sites that provided an editorial policy). Our results provide preliminary evidence that, of 40 behaviour-change techniques that were coded, fewer than 20% were used to promote physical activity behaviour to bca survivors on cancer centre Web sites, and that the most effective techniques were inconsistently used. On cancer centre Web sites, health promotion specialists could focus on emphasizing knowledge mobilization efforts using available research into behaviour-change techniques to help bca survivors increase their physical activity.

  4. Protein pharmacophore selection using hydration-site analysis

    PubMed Central

    Hu, Bingjie; Lill, Markus A.

    2012-01-01

    Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751

  5. Synthesis of Zn-MOF incorporating titanium-hydrides as active sites binding H{sub 2} molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Jongsik, E-mail: jkim40@nd.edu; Ok Kim, Dong; Wook Kim, Dong

    2015-10-15

    This paper describes the synthetic effort for a Zn-MOF imparting Ti-H as a preferential binding site potentially capturing H{sub 2} molecules via Kubas-type interaction. The formation mechanism of Ti-H innate to the final material was potentially demonstrated to follow a radical dissociation rather than a β-hydrogen elimination and a C-H reductive elimination. - Graphical abstract: This study details the synthesis and the formation mechanism of Zn-MOF adsorbent site-isolating TiH{sub 3} that can potentially capture H{sub 2} molecules via Kubas-binding mechanism. - Highlights: • OH-functionalized Zn-MOF was employed as a reactive template to site-isolate TiH{sub 3}. • This MOF was post-syntheticallymore » modified using a tetracyclohexyl titanium (IV). • This intermediate was hydrogenolyzed to change ligand from cyclohexyl to hydride. • Formation mechanism of TiH{sub 3} was investigated via two control GC–MS experiments. • Final Zn-MOF potentially site-isolating TiH{sub 3} species was used as a H{sub 2} adsorbent.« less

  6. Oxidative potential of ambient water-soluble PM2.5 measured by Dithiothreitol (DTT) and Ascorbic Acid (AA) assays in the southeastern United States: contrasts in sources and health associations

    NASA Astrophysics Data System (ADS)

    Fang, T.; Verma, V.; Bates, J. T.; Abrams, J.; Klein, M.; Strickland, M. J.; Sarnat, S. E.; Chang, H. H.; Mulholland, J. A.; Tolbert, P. E.; Russell, A. G.; Weber, R. J.

    2015-11-01

    The ability of certain components of particulate matter to induce oxidative stress through catalytic generation of reactive oxygen species (ROS) in vivo may be one mechanism accounting for observed linkages between ambient aerosols and adverse health outcomes. A variety of assays have been used to measure this so-called aerosol oxidative potential. We developed a semi-automated system to quantify oxidative potential of filter aqueous extracts utilizing the dithiothreitol (DTT) assay and have recently developed a similar semi-automated system using the ascorbic acid (AA) assay. Approximately 500 PM2.5 filter samples collected in contrasting locations in the southeastern US were analyzed using both assays. We found that water-soluble DTT activity on a per air volume basis was more spatially uniform than water-soluble AA activity. DTT activity was higher in winter than in summer/fall, whereas AA activity was higher in summer/fall compared to winter, with highest levels near highly trafficked highways. DTT activity was correlated with organic and metal species, whereas AA activity was correlated with water-soluble metals (especially water-soluble Cu, r=0.70-0.91 at most sites). Source apportionment models, Positive Matrix Factorization (PMF) and a Chemical Mass Balance Method with ensemble-averaged source impact profiles (CMB-E), suggest a strong contribution from secondary processes (e.g., organic aerosol oxidation or metal mobilization by formation of an aqueous particle with secondary acids) and traffic emissions to both DTT and AA activities in urban Atlanta. Biomass burning was a large source for DTT activity, but insignificant for AA. DTT activity was well correlated with PM2.5 mass (r=0.49-0.86 across sites/seasons), while AA activity did not co-vary strongly with mass. A linear model was developed to estimate DTT and AA activities for the central Atlanta Jefferson Street site, based on the CMB-E sources that are statistically significant with positive coefficients. The model was used to estimate oxidative potential at this site over the period 1998-2009. Time-series epidemiological analyses were conducted to assess daily emergency department (ED) visits data for the five-county Atlanta metropolitan area based on the estimated 10 year backcast oxidative potential. Results suggest that estimated DTT activity was associated with ED visits for both asthma/wheeze and congestive heart failure, while AA activity was not linked to any health outcomes. The findings point to the importance of both organic components and transition metals from biomass burning and mobile sources to adverse health outcomes in this region.

  7. Use of octopus as a bioindicator species: Baseline studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Holdway, D.A.; Butty, J.S.; Brennan, S.E.

    1995-12-31

    The Australian octopus Octopus pallidus, is abundant, territorial, has a large digestive gland. This study was undertaken to assess octopii as a potential bioindicator species by establishing the efficacy of capturing octopi using traplines, and determining the impact of various modifying factors on the activities of digestive gland mixed-function oxidase (MFO) enzymes including ethoxyresorufin O-deethylase (EROD), ethoxycoumarin O-deethylase (ECOD) and total P-450. Trap success rates in Port Phillip Bay were 15--28% for the ``potentially contaminated`` site and 85% for the reference site. Cytochrome P-450 showed significant seasonal differences, with no site or sex differences. Mean ({+-} SE) Autumn P-450 valuesmore » of 74.8 ({+-}5.5) pmol/mg protein were higher than Winter values of 51.2 ({+-}7.6), which were higher than Spring values of 21.8 ({+-}4.0) pmol/mg protein. Summer P-450 values of 61.4 ({+-} 9.8) pmol/mg protein were only different from Spring values. Mean ({+-} SE) Spring ECOD activity of 3.3 ({+-} 0.7) pmol/min/mg protein was lower than Summer, Autumn and Winter ECOD values of 8.9 ({+-} 1.6) 6.5 ({+-} 1.2) and 8.6 ({+-} 2.3) pmol/min/mg protein respectively. Females had roughly half the ECOD activities of males (3.8 {+-} 0.8 compared to 7.4 {+-} 0.9 pmol/min/mg protein). All octopi digestive gland EROD activities were low (roughly 0.2 pmol/min/mg protein) with no sex, site nor seasonal differences. Potential for using octopus as a bioindicator appears promising but sensitivity to chemical exposure has yet to be determined.« less

  8. Lysine Methylation of Nuclear Co-repressor Receptor Interacting Protein 140

    PubMed Central

    Huq, MD Mostaqul; Ha, Sung Gil; Barcelona, Helene; Wei, Li-Na

    2009-01-01

    Receptor interacting protein 140 (RIP140) undergoes extensive posttranslational modifications (PTMs), including phosphorylation, acetylation, arginine methylation, and pyridoxylation. PTMs affect its sub-cellular distribution, protein-protein interaction, and biological activity in adipocyte differentiation. Arginine methylation on Arg240, Arg650, and Arg948 suppresses the repressive activity of RIP140. Here we find that endogenous RIP140 in differentiated 3T3-L1 cells is also modified by lysine methylation. Three lysine residues, Lys591, Lys653, and Lys757 are mapped as potential methylation sites by mass spectrometry. Site-directed mutagenesis study shows that lysine methylation enhances its gene repressive activity. Mutation of lysine methylation sites enhances arginine methylation, while mutation on arginine methylation sites has little effect on its lysine methylation, suggesting a relationship between lysine methylation and arginine methylation. Kinetic analysis of PTMs of endogenous RIP140 in differentiated 3T3-L1 cells demonstrates sequential modifications on RIP140, initiated from constitutive lysine methylation, followed by increased arginine methylation later in differentiation. This study reveals a potential hierarchy of modifications, at least for lysine and arginine methylation, which bi-directionally regulate the functionality of a non-histone protein. PMID:19216533

  9. An analysis of the potential for Glen Canyon Dam releases to inundate archaeological sites in the Grand Canyon, Arizona

    USGS Publications Warehouse

    Sondossi, Hoda A.; Fairley, Helen C.

    2014-01-01

    The development of a one-dimensional flow-routing model for the Colorado River between Lees Ferry and Diamond Creek, Arizona in 2008 provided a potentially useful tool for assessing the degree to which varying discharges from Glen Canyon Dam may inundate terrestrial environments and potentially affect resources located within the zone of inundation. Using outputs from the model, a geographic information system analysis was completed to evaluate the degree to which flows from Glen Canyon Dam might inundate archaeological sites located along the Colorado River in the Grand Canyon. The analysis indicates that between 4 and 19 sites could be partially inundated by flows released from Glen Canyon Dam under current (2014) operating guidelines, and as many as 82 archaeological sites may have been inundated to varying degrees by uncontrolled high flows released in June 1983. Additionally, the analysis indicates that more of the sites currently (2014) proposed for active management by the National Park Service are located at low elevations and, therefore, tend to be more susceptible to potential inundation effects than sites not currently (2014) targeted for management actions, although the potential for inundation occurs in both groups of sites. Because of several potential sources of error and uncertainty associated with the model and with limitations of the archaeological data used in this analysis, the results are not unequivocal. These caveats, along with the fact that dam-related impacts can involve more than surface-inundation effects, suggest that the results of this analysis should be used with caution to infer potential effects of Glen Canyon Dam on archaeological sites in the Grand Canyon.

  10. Particulate matter oxidative potential from waste transfer station activity.

    PubMed

    Godri, Krystal J; Duggan, Sean T; Fuller, Gary W; Baker, Tim; Green, David; Kelly, Frank J; Mudway, Ian S

    2010-04-01

    Adverse cardiorespiratory health is associated with exposure to ambient particulate matter (PM). The highest PM concentrations in London occur in proximity to waste transfer stations (WTS), sites that experience high numbers of dust-laden, heavy-duty diesel vehicles transporting industrial and household waste. Our goal was to quantify the contribution of WTS emissions to ambient PM mass concentrations and oxidative potential. PM with a diameter < 10 microm (PM10) samples were collected daily close to a WTS. PM10 mass concentrations measurements were source apportioned to estimate local versus background sources. PM oxidative potential was assessed using the extent of antioxidant depletion from a respiratory tract lining fluid model. Total trace metal and bioavailable iron concentrations were measured to determine their contribution to PM oxidative potential. Elevated diurnal PM10 mass concentrations were observed on all days with WTS activity (Monday-Saturday). Variable PM oxidative potential, bioavailable iron, and total metal concentrations were observed on these days. The contribution of WTS emissions to PM at the sampling site, as predicted by microscale wind direction measurements, was correlated with ascorbate (r = 0.80; p = 0.030) and glutathione depletion (r = 0.76; p = 0.046). Increased PM oxidative potential was associated with aluminum, lead, and iron content. PM arising from WTS activity has elevated trace metal concentrations and, as a consequence, increased oxidative potential. PM released by WTS activity should be considered a potential health risk to the nearby residential community.

  11. Antidromic propagation of action potentials in branched axons: implications for the mechanisms of action of deep brain stimulation.

    PubMed

    Grill, Warren M; Cantrell, Meredith B; Robertson, Matthew S

    2008-02-01

    Electrical stimulation of the central nervous system creates both orthodromically propagating action potentials, by stimulation of local cells and passing axons, and antidromically propagating action potentials, by stimulation of presynaptic axons and terminals. Our aim was to understand how antidromic action potentials navigate through complex arborizations, such as those of thalamic and basal ganglia afferents-sites of electrical activation during deep brain stimulation. We developed computational models to study the propagation of antidromic action potentials past the bifurcation in branched axons. In both unmyelinated and myelinated branched axons, when the diameters of each axon branch remained under a specific threshold (set by the antidromic geometric ratio), antidromic propagation occurred robustly; action potentials traveled both antidromically into the primary segment as well as "re-orthodromically" into the terminal secondary segment. Propagation occurred across a broad range of stimulation frequencies, axon segment geometries, and concentrations of extracellular potassium, but was strongly dependent on the geometry of the node of Ranvier at the axonal bifurcation. Thus, antidromic activation of axon terminals can, through axon collaterals, lead to widespread activation or inhibition of targets remote from the site of stimulation. These effects should be included when interpreting the results of functional imaging or evoked potential studies on the mechanisms of action of DBS.

  12. Predatory fish depletion and recovery potential on Caribbean reefs

    PubMed Central

    Valdivia, Abel; Cox, Courtney Ellen; Bruno, John Francis

    2017-01-01

    The natural, prehuman abundance of most large predators is unknown because of the lack of historical data and a limited understanding of the natural factors that control their populations. Determining the supportable predator biomass at a given location (that is, the predator carrying capacity) would help managers to optimize protection and would provide site-specific recovery goals. We assess the relationship between predatory reef fish biomass and several anthropogenic and environmental variables at 39 reefs across the Caribbean to (i) estimate their roles determining local predator biomass and (ii) determine site-specific recovery potential if fishing was eliminated. We show that predatory reef fish biomass tends to be higher in marine reserves but is strongly negatively related to human activities, especially coastal development. However, human activities and natural factors, including reef complexity and prey abundance, explain more than 50% of the spatial variation in predator biomass. Comparing site-specific predator carrying capacities to field observations, we infer that current predatory reef fish biomass is 60 to 90% lower than the potential supportable biomass in most sites, even within most marine reserves. We also found that the scope for recovery varies among reefs by at least an order of magnitude. This suggests that we could underestimate unfished biomass at sites that provide ideal conditions for predators or greatly overestimate that of seemingly predator-depleted sites that may have never supported large predator populations because of suboptimal environmental conditions. PMID:28275730

  13. Oxidative potential of ambient water-soluble PM2.5 in the southeastern United States: contrasts in sources and health associations between ascorbic acid (AA) and dithiothreitol (DTT) assays

    NASA Astrophysics Data System (ADS)

    Fang, Ting; Verma, Vishal; Bates, Josephine T.; Abrams, Joseph; Klein, Mitchel; Strickland, Matthew J.; Sarnat, Stefanie E.; Chang, Howard H.; Mulholland, James A.; Tolbert, Paige E.; Russell, Armistead G.; Weber, Rodney J.

    2016-03-01

    The ability of certain components of particulate matter to induce oxidative stress through the generation of reactive oxygen species (ROS) in vivo may be one mechanism accounting for observed linkages between ambient aerosols and adverse health outcomes. A variety of assays have been used to measure this so-called aerosol oxidative potential. We developed a semi-automated system to quantify oxidative potential of filter aqueous extracts utilizing the dithiothreitol (DTT) assay and report here the development of a similar semi-automated system for the ascorbic acid (AA) assay. Approximately 500 PM2.5 filter samples collected in contrasting locations in the southeastern US were analyzed for a host of aerosol species, along with AA and DTT activities. We present a detailed contrast in findings from these two assays. Water-soluble AA activity was higher in summer and fall than in winter, with highest levels near heavily trafficked highways, whereas DTT activity was higher in winter compared to summer and fall and more spatially homogeneous. AA activity was nearly exclusively correlated with water-soluble Cu (r = 0.70-0.94 at most sites), whereas DTT activity was correlated with organic and metal species. Source apportionment models, positive matrix factorization (PMF) and a chemical mass balance method with ensemble-averaged source impact profiles (CMB-E), suggest a strong contribution from traffic emissions and secondary processes (e.g., organic aerosol oxidation or metals mobilization by secondary acids) to both AA and DTT activities in urban Atlanta. In contrast, biomass burning was a large source for DTT activity, but insignificant for AA. AA activity was not correlated with PM2.5 mass, while DTT activity co-varied strongly with mass (r = 0.49-0.86 across sites and seasons). Various linear models were developed to estimate AA and DTT activities for the central Atlanta Jefferson Street site, based on the CMB-E sources. The models were then used to estimate daily oxidative potential at this site over the 1998-2009 period. Time series epidemiological analyses were conducted to assess daily emergency department (ED) visits data for the five-county Atlanta metropolitan area based on the estimated 10-year backcast oxidative potential. Estimated AA activity was not statistically associated with any tested health outcome, while DTT activity was associated with ED visits for both asthma or wheeze and congestive heart failure. The findings point to the importance of both organic components and transition metals from biomass burning and mobile sources to adverse health outcomes in this region.

  14. Hydrothermal activity lowers trophic diversity in Antarctic hydrothermal sediments

    NASA Astrophysics Data System (ADS)

    Bell, James B.; Reid, William D. K.; Pearce, David A.; Glover, Adrian G.; Sweeting, Christopher J.; Newton, Jason; Woulds, Clare

    2017-12-01

    Hydrothermal sediments are those in which hydrothermal fluid is discharged through sediments and are one of the least studied deep-sea ecosystems. We present a combination of microbial and biochemical data to assess trophodynamics between and within hydrothermal and background areas of the Bransfield Strait (1050-1647 m of depth). Microbial composition, biomass, and fatty acid signatures varied widely between and within hydrothermally active and background sites, providing evidence of diverse metabolic activity. Several species had different feeding strategies and trophic positions between hydrothermally active and inactive areas, and the stable isotope values of consumers were not consistent with feeding morphology. Niche area and the diversity of microbial fatty acids was lowest at the most hydrothermally active site, reflecting trends in species diversity. Faunal uptake of chemosynthetically produced organics was relatively limited but was detected at both hydrothermal and non-hydrothermal sites, potentially suggesting that hydrothermal activity can affect trophodynamics over a much wider area than previously thought.

  15. Molecular imprint of enzyme active site by camel nanobodies: rapid and efficient approach to produce abzymes with alliinase activity.

    PubMed

    Li, Jiang-Wei; Xia, Lijie; Su, Youhong; Liu, Hongchun; Xia, Xueqing; Lu, Qinxia; Yang, Chunjin; Reheman, Kalbinur

    2012-04-20

    Screening of inhibitory Ab1 antibodies is a critical step for producing catalytic antibodies in the anti-idiotypic approach. However, the incompatible surface of the active site of the enzyme and the antigen-binding site of heterotetrameric conventional antibodies become the limiting step. Because camelid-derived nanobodies possess the potential to preferentially bind to the active site of enzymes due to their small size and long CDR3, we have developed a novel approach to produce antibodies with alliinase activities by exploiting the molecular mimicry of camel nanobodies. By screening the camelid-derived variable region of the heavy chain cDNA phage display library with alliinase, we obtained an inhibitory nanobody VHHA4 that recognizes the active site. Further screening with VHHA4 from the same variable domain of the heavy chain of a heavy-chain antibody library led to a higher incidence of anti-idiotypic Ab2 abzymes with alliinase activities. One of the abzymes, VHHC10, showed the highest activity that can be inhibited by Ab1 VHHA4 and alliinase competitive inhibitor penicillamine and significantly suppressed the B16 tumor cell growth in the presence of alliin in vitro. The results highlight the feasibility of producing abzymes via anti-idiotypic nanobody approach.

  16. Lentivector Integration Sites in Ependymal Cells From a Model of Metachromatic Leukodystrophy: Non-B DNA as a New Factor Influencing Integration

    PubMed Central

    McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D

    2014-01-01

    The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091

  17. Methane combustion reactivity during the metal→metallic oxide transformation of Pd-Pt catalysts: Effect of oxygen pressure

    NASA Astrophysics Data System (ADS)

    Qi, Wenjie; Ran, Jingyu; Zhang, Zhien; Niu, Juntian; Zhang, Peng; Fu, Lijuan; Hu, Bo; Li, Qilai

    2018-03-01

    Density functional theory combined with kinetic models were used to probe different kinetics consequences by which methane activation on different oxygen chemical potential surfaces as oxygen pressure increased. The metallic oxide → metal transformation temperature of Pd-Pt catalysts increased with the increase of the Pd content or/and O2 pressure. The methane conversion rate on Pt catalyst increased and then decreased to a constant value when increasing the O2 pressure, and Pd catalyst showed a poor activity performance in the case of low O2 pressure. Moreover, its activity increased as the oxygen chemical potential for O2 pressure increased in the range of 2.5-10 KPa. For metal clusters, the Csbnd H bond and Odbnd O bond activation steps occurred predominantly on *-* site pairs. The methane conversion rate was determined by O2 pressure because the adsorbed O atoms were rapidly consumed by other adsorbed species in this kinetic regime. As the O2 pressure increased, the metallic active sites for methane activation were decreased and there was no longer lack of adsorbed O atoms, resulting in the decrease of the methane conversion rate. Furthermore, when the metallic surfaces were completely covered by adsorbed oxygen atoms at higher oxygen chemical potentials, Pt catalyst showed a poor activity due to a high Csbnd H bond activation barrier on O*sbnd O*. In the case of high O2 pressure, Pd atoms preferred to segregate to the active surface of Pd-Pt catalysts, leading to the formation of PdO surfaces. The increase of Pd segregation promoted a subsequent increase in active sites and methane conversion rate. The PdO was much more active than metallic and O* saturated surfaces for methane activation, inferred from the theory and experimental study. Pd-rich bimetallic catalyst (75% molar Pd) showed a dual high methane combustion activity on O2-poor and O2-rich conditions.

  18. 76 FR 39133 - Agency Information Collection Activities: Proposed Collection; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-05

    ... assess the adequacy of proposed seismic design bases and the design bases for other site hazards for... sited, designed, constructed, and maintained to withstand geologic hazards, such as faulting, seismic... potential man-made hazards will be appropriately accounted for in the design of nuclear power and test...

  19. Development of sinkholes resulting from man's activities in the Eastern United States

    USGS Publications Warehouse

    Newton, John G.

    1987-01-01

    Alternatives that allow avoiding or minimizing sinkhole hazards are most numerous when a problem or potential problem is recognized during site evaluation. The number of alternatives declines after the beginning of site development. Where sinkhole development is predictable, zoning of land use can minimize hazards.

  20. 30 CFR 785.25 - Lands eligible for remining.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... application to conduct a surface coal mining operation on lands eligible for remining must comply with this... environmental and safety problems related to prior mining activity at the site and that could be reasonably... tailored to current site conditions. (2) With regard to potential environmental and safety problems...

  1. Evaluating and Increasing In-Home Leisure Activity among Adults with Severe Disabilities in Supported Independent Living

    ERIC Educational Resources Information Center

    Wilson, Philip G.; Reid, Dennis H.; Green, Carolyn W.

    2006-01-01

    Observations were conducted of the in-home leisure activity of three adults with severe disabilities in three supported independent living (SIL) sites. Results indicated a lack of leisure engagement. Potentially preferred, typical leisure activities were then identified by consulting lists of common leisure activities, surveying adults in…

  2. Automating ATLAS Computing Operations using the Site Status Board

    NASA Astrophysics Data System (ADS)

    J, Andreeva; Iglesias C, Borrego; S, Campana; Girolamo A, Di; I, Dzhunov; Curull X, Espinal; S, Gayazov; E, Magradze; M, Nowotka M.; L, Rinaldi; P, Saiz; J, Schovancova; A, Stewart G.; M, Wright

    2012-12-01

    The automation of operations is essential to reduce manpower costs and improve the reliability of the system. The Site Status Board (SSB) is a framework which allows Virtual Organizations to monitor their computing activities at distributed sites and to evaluate site performance. The ATLAS experiment intensively uses the SSB for the distributed computing shifts, for estimating data processing and data transfer efficiencies at a particular site, and for implementing automatic exclusion of sites from computing activities, in case of potential problems. The ATLAS SSB provides a real-time aggregated monitoring view and keeps the history of the monitoring metrics. Based on this history, usability of a site from the perspective of ATLAS is calculated. The paper will describe how the SSB is integrated in the ATLAS operations and computing infrastructure and will cover implementation details of the ATLAS SSB sensors and alarm system, based on the information in the SSB. It will demonstrate the positive impact of the use of the SSB on the overall performance of ATLAS computing activities and will overview future plans.

  3. Second generation engineering of transketolase for polar aromatic aldehyde substrates.

    PubMed

    Payongsri, Panwajee; Steadman, David; Hailes, Helen C; Dalby, Paul A

    2015-04-01

    Transketolase has significant industrial potential for the asymmetric synthesis of carboncarbon bonds with new chiral centres. Variants evolved on propanal were found previously with nascent activity on polar aromatic aldehydes 3-formylbenzoic acid (3-FBA), 4-formylbenzoic acid (4-FBA), and 3-hydroxybenzaldehyde (3-HBA), suggesting a potential novel route to analogues of chloramphenicol. Here we evolved improved transketolase activities towards aromatic aldehydes, by saturation mutagenesis of two active-site residues (R358 and S385), predicted to interact with the aromatic substituents. S385 variants selectively controlled the aromatic substrate preference, with up to 13-fold enhanced activities, and KM values comparable to those of natural substrates with wild-type transketolase. S385E even completely removed the substrate inhibition for 3-FBA, observed in all previous variants. The mechanisms of catalytic improvement were both mutation type and substrate dependent. S385E improved 3-FBA activity via kcat, but reduced 4-FBA activity via KM. Conversely, S385Y/T improved 3-FBA activity via KM and 4-FBA activity via kcat. This suggested that both substrate proximity and active-site orientation are very sensitive to mutation. Comparison of all variant activities on each substrate indicated different binding modes for the three aromatic substrates, supported by computational docking. This highlights a potential divergence in the evolution of different substrate specificities, with implications for enzyme engineering. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Estrogen and androgen receptor activities of hydraulic fracturing chemicals and surface and ground water in a drilling-dense region

    USGS Publications Warehouse

    Kassotis, Christopher D.; Tillitt, Donald E.; Davis, J. Wade; Hormann, Anette M.; Nagel, Susan C.

    2014-01-01

    The rapid rise in natural gas extraction using hydraulic fracturing increases the potential for contamination of surface and ground water from chemicals used throughout the process. Hundreds of products containing more than 750 chemicals and components are potentially used throughout the extraction process, including more than 100 known or suspected endocrine-disrupting chemicals. We hypothesized thataselected subset of chemicalsusedin natural gas drilling operationsandalso surface and ground water samples collected in a drilling-dense region of Garfield County, Colorado, would exhibit estrogen and androgen receptor activities. Water samples were collected, solid-phase extracted, and measured for estrogen and androgen receptor activities using reporter gene assays in human cell lines. Of the 39 unique water samples, 89%, 41%, 12%, and 46% exhibited estrogenic, antiestrogenic, androgenic, and antiandrogenic activities, respectively. Testing of a subset of natural gas drilling chemicals revealed novel antiestrogenic, novel antiandrogenic, and limited estrogenic activities. The Colorado River, the drainage basin for this region, exhibited moderate levels of estrogenic, antiestrogenic, and antiandrogenic activities, suggesting that higher localized activity at sites with known natural gas–related spills surrounding the river might be contributing to the multiple receptor activities observed in this water source. The majority of water samples collected from sites in a drilling-dense region of Colorado exhibited more estrogenic, antiestrogenic, or antiandrogenic activities than reference sites with limited nearby drilling operations. Our data suggest that natural gas drilling operationsmayresult in elevated endocrine-disrupting chemical activity in surface and ground water.

  5. Two-electron Reduction versus One-electron Oxidation of the Type 3 Pair in the Multicopper Oxidases

    PubMed Central

    Kjaergaard, Christian H.; Jones, Stephen M.; Gounel, Sébastien; Mano, Nicolas; Solomon, Edward I.

    2015-01-01

    Multicopper Oxidases (MCOs) utilize an electron shuttling Type 1 Cu (T1) site in conjunction with a mononuclear Type 2 (T2) and a binuclear Type 3 (T3) site, arranged in a trinuclear copper cluster (TNC), to reduce O2 to H2O. Reduction of O2 occurs with limited overpotential indicating that all the coppers in the active site can be reduced via high-potential electron donors. Two forms of the resting enzyme have been observed in MCOs: the Alternative Resting form (AR), where only one of the three TNC Cu’s is oxidized, and the Resting Oxidized form (RO), where all three TNC Cu’s are oxidized. In contrast to the AR form, we show that in the RO form of a high-potential MCO, the binuclear T3 Cu(II) site can be reduced via the 700 mV T1 Cu. Systematic spectroscopic evaluation reveals that this proceeds by a two-electron process, where delivery of the first electron, forming a high energy, meta-stable half reduced T3 state, is followed by the rapid delivery of a second energetically favorable electron to fully reduce the T3 site. Alternatively, when this fully reduced binuclear T3 site is oxidized via the T1 Cu, a different thermodynamically favored half oxidized T3 form, i.e. the AR site, is generated. This behavior is evaluated by DFT calculations, which reveal that the protein backbone plays a significant role in controlling the environment of the active site coppers. This allows for the formation of the meta-stable, half reduced state and thus the complete reductive activation of the enzyme for catalysis. PMID:26075678

  6. Heavy metals distribution and risk assessment in soil from an informal E-waste recycling site in Lagos State, Nigeria.

    PubMed

    Isimekhai, Khadijah A; Garelick, Hemda; Watt, John; Purchase, Diane

    2017-07-01

    Informal E-waste recycling can pose a risk to human health and the environment which this study endeavours to evaluate. The distribution of a number of heavy metals in soil from an informal recycling site in the largest market for used and new electronics and electrical equipment in West Africa was investigated. The potential bioavailability of heavy metals, extent of contamination, potential risk due to the recycling activities and impact of external factors such as rainfall were also assessed. The concentrations of all the heavy metals tested were higher in the area where burning of the waste occurred than at the control site, suggesting an impact of the recycling activities on the soil. The order of total metal concentrations was Cu > Pb > Zn > Mn > Ni > Sb > Cr > Cd for both the dry and wet seasons. The total concentrations of Cd, Cu, Mn, Ni and Zn were all significantly higher (p < 0.001) in the dry season than in the wet season. The concentrations of Cu (329-7106 mg kg -1 ), Pb (115-9623 mg kg -1 ) and Zn (508-8178 mg kg -1 ) were consistently higher than international soil guideline values. Using a sequential extraction method, the potential bioavailability of the heavy metals was indicated as Cd > Sb > Zn > Cu > Ni > Pb > Cr. When the risk was assessed using the Potential Ecological Risk Index (PERI), Cu was found to contribute the most to the potential ecological risk and Cd gave rise to the greatest concern due to its high toxic-response factor within the study site. Similarly, utilising the Risk Assessment Code (RAC) suggested that Cd posed the most risk in this site. This research establishes a high level of contamination in the study site and underscores the importance of applying the appropriate chemical speciation in risk assessment.

  7. Increasing Stability and Activity of Core-Shell Catalysts by Preferential Segregation of Oxide on Edges and Vertexes: Oxygen Reduction on Ti-Au@Pt/C

    DOE PAGES

    Hu, J.; Wu, L.; Kuttiyiel, K.; ...

    2016-06-30

    We describe a new class of core-shell nanoparticle catalysts having edges and vertexes covered by refractory metal oxide that preferentially segregates onto these catalyst sites. The monolayer shell is deposited on the oxidefree core atoms. The oxide on edges and vertexes induces high catalyst’s stability and activity. The catalyst and synthesis are exemplified by fabrication of Au nanoparticles doped by Ti atoms that segregate as oxide onto low–coordination sites of edges and vertexes. Pt monolayer shell deposited on Au sites has the mass and specific activities for the oxygen reduction reaction about 13 and 5 times higher than those ofmore » commercial Pt/C catalysts. The durability tests show no activity loss after 10000 potential cycles from 0.6 to 1.0V. The superior activity and durability of the Ti-Au@Pt catalyst originate from protective Ti oxide located at the most dissolution-prone edge and vertex sites, and Au-supported active and stable Pt shell.« less

  8. Extra-Territorial Siting of Nuclear Installations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shea, Thomas E.; Morris, Frederic A.

    2009-10-07

    Arrangements might be created for siting nuclear installations on land ceded by a host State for administration by an international or multinational organization. Such arrangements might prove useful in terms of resolving suspicions of proliferation in troubled areas of the world, or as a means to introduce nuclear activities into areas where political, financial or technical capabilities might otherwise make such activities unsound, or as a means to enable global solutions to be instituted for major nuclear concerns (e.g., spent fuel management). The paper examines practical matters associated with the legal and programmatic aspects of siting nuclear installations, including diplomatic/politicalmore » frameworks, engaging competent industrial bodies, protection against seizure, regulation to ensure safety and security, waste management, and conditions related to the dissolution of the extra-territorial provisions as may be agreed as the host State(s) achieve the capabilities to own and operate the installations. The paper considers the potential for using such a mechanism across the spectrum of nuclear power activities, from mining to geological repositories for nuclear waste. The paper considers the non-proliferation dimensions associated with such arrangements, and the pros and cons affecting potential host States, technology vendor States, regional neighbors and the international community. It considers in brief potential applications in several locations today.« less

  9. Integrated field and laboratory tests to evaluate effects of metals-impacted wetlands on amphibians: A case study from Montana

    USGS Publications Warehouse

    Linder, G.; ,

    2003-01-01

    Mining activities frequently impact wildlife habitats, and a wide range of habitats may require evaluations of the linkages between wildlife and environmental stressors common to mining activities (e.g., physical alteration of habitat, releases of chemicals such as metals and other inorganic constituents as part of the mining operation). Wetlands, for example, are frequently impacted by mining activities. Within an ecological assessment for a wetland, toxicity evaluations for representative species may be advantageous to the site evaluation, since these species could be exposed to complex chemical mixtures potentially released from the site. Amphibian species common to these transition zones between terrestrial and aquatic habitats are one key biological indicator of exposure, and integrated approaches which involve both field and laboratory methods focused on amphibians are critical to the assessment process. The laboratory and field evaluations of a wetland in western Montana illustrates the integrated approach to risk assessment and causal analysis. Here, amphibians were used to evaluate the potential toxicity associated with heavy metal-laden sediments deposited in a reservoir. Field and laboratory methods were applied to a toxicity assessment for metals characteristic of mine tailings to reduce potential "lab to field" extrapolation errors and provide adaptive management programs with critical site-specific information targeted on remediation.

  10. Electrochemical studies of a truncated laccase produced in Pichia pastoris

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.

    1999-12-01

    The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms ofmore » their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.« less

  11. California Dept. of Toxic Substances Control (DTSC) Update of the Schools Naturally Occurring Asbestos Guidance

    NASA Astrophysics Data System (ADS)

    Malinowski, M.

    2012-12-01

    Prior to acquisition and/or construction of prospective school sites, the California Education Code mandates that school districts complete environmental assessments and cleanups for prospective new or expanding school sites in order to qualify for state funding. If prospective school sites are determined to have environmental contamination from hazardous materials, including naturally occurring hazardous materials such as naturally occurring asbestos (NOA), where there may be unacceptable potential health risks, the school sites must be properly mitigated prior to occupancy for protection of human health and the environment. NOA is of special concern for schools, because children who are exposed to asbestos may be at increased risk of developing asbestos-related diseases over time. In order to protect human health, the Department of Toxic Substances Control's (DTSC) goals at school sites are to: 1) identify the presence of NOA in school site soils using exposure-reducing soil thresholds; 2) manage potential NOA exposures using mitigation measures to reduce generation of airborne asbestos fibers from soils on school sites; and 3) ensure long-term monitoring and protection of mitigation measures via Operations & Maintenance activities. DTSC is currently in the process of revising its Interim Guidance Naturally Occurring Asbestos (NOA) at School Sites - September 2004. The revisions include: 1) updating the guidance to consider incremental sampling for use at NOA sites in consultation with DTSC's project manager and technical staff, and 2) documenting a tiered approach to addressing high and low activity areas on a school.

  12. A NMDA receptor glycine site partial agonist, GLYX-13, simultaneously enhances LTP and reduces LTD at Schaffer collateral-CA1 synapses in hippocampus.

    PubMed

    Zhang, Xiao-lei; Sullivan, John A; Moskal, Joseph R; Stanton, Patric K

    2008-12-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) are a key route for Ca2+ influx into neurons important to both activity-dependent synaptic plasticity and, when uncontrolled, triggering events that cause neuronal degeneration and death. Among regulatory binding sites on the NMDAR complex is a glycine binding site, distinct from the glutamate binding site, which must be co-activated for NMDAR channel opening. We developed a novel glycine site partial agonist, GLYX-13, which is both nootropic and neuroprotective in vivo. Here, we assessed the effects of GLYX-13 on long-term synaptic plasticity and NMDAR transmission at Schaffer collateral-CA1 synapses in hippocampal slices in vitro. GLYX-13 simultaneously enhanced the magnitude of long-term potentiation (LTP) of synaptic transmission, while reducing long-term depression (LTD). GLYX-13 reduced NMDA receptor-mediated synaptic currents in CA1 pyramidal neurons evoked by low frequency Schaffer collateral stimulation, but enhanced NMDAR currents during high frequency bursts of activity, and these actions were occluded by a saturating concentration of the glycine site agonist d-serine. Direct two-photon imaging of Schaffer collateral burst-evoked increases in [Ca2+] in individual dendritic spines revealed that GLYX-13 selectively enhanced burst-induced NMDAR-dependent spine Ca2+ influx. Examining the rate of MK-801 block of synaptic versus extrasynaptic NMDAR-gated channels revealed that GLYX-13 selectively enhanced activation of burst-driven extrasynaptic NMDARs, with an action that was blocked by the NR2B-selective NMDAR antagonist ifenprodil. Our data suggest that GLYX-13 may have unique therapeutic potential as a learning and memory enhancer because of its ability to simultaneously enhance LTP and suppress LTD.

  13. Pitting corrosion of titanium. Interim report, June-December 1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Casillas, N.; Charlebois, S.J.; Smyrl, W.H.

    1994-01-20

    The breakdown of native and anodically-grown oxide films on Ti electrodes is investigated by scanning electrochemical microscopy (SECM), video microscopy, transmission electron microscopy and voltammetry. SECM is used to demonstrate that the oxidation of Br- on Ti occurs at microscopic surface sites (10 - 50 micrometer diameter, 30 sites/sq cm) that are randomly positioned across the oxide surface. After determining the position of the active sites for Br- oxidation, breakdown of the oxide is initiated by increasing the electrode potential to more positive values. Direct correspondence is observed between the location of the electroactive sites and corrosion pits, indicating thatmore » oxide breakdown is associated with a localized site of high electrical conductivity. The potential at which pitting is observed in voltammetric experiments is found to be proportional to the average oxide thickness, for values ranging between 20 and 100 A, indicating that breakdown is determined either by the magnitude of the electric field within the oxide or by the interfacial potential at the oxide/Br- solution interface. Pitting occurs at significantly lower potentials in Br- solutions than in C 1- solutions, suggesting a strong chemical interaction between the TiO2 surface and Br-. A mechanism of oxide breakdown is proposed that is based on the potential-dependent chemical dissolution of the oxide at microscopic surface sites.« less

  14. Anti-Alzheimers activity and molecular mechanism of albumin-derived peptides against AChE and BChE.

    PubMed

    Yu, Zhipeng; Wu, Sijia; Zhao, Wenzhu; Ding, Long; Fan, Yue; Shiuan, David; Liu, Jingbo; Chen, Feng

    2018-02-21

    Alzheimer's disease (AD) is a global health issue affecting millions of elderly people worldwide. The aim of the present study was to identify novel anti-AD peptides isolated from albumin. Anti-AD activities of the peptides were evaluated via inhibitory activities on acetylcholinesterase (AChE) and butyrylcholinesterase (BChE). Furthermore, the potential molecular mechanisms of the KLPGF/AChE were investigated by CDOCKER of Discovery studio 2017. The results revealed that peptide KLPGF could effectively inhibit AChE with an inhibition rate of 61.23% at a concentration of 50 μg mL -1 . In addition, the peptide KLPGF came in contact with acylation sites and peripheral anion sites of AChE. The present study demonstrates that the peptide KLPGF could become a potential functional food intervention in AD.

  15. Action potentials in retinal ganglion cells are initiated at the site of maximal curvature of the extracellular potential.

    PubMed

    Eickenscheidt, Max; Zeck, Günther

    2014-06-01

    The initiation of an action potential by extracellular stimulation occurs after local depolarization of the neuronal membrane above threshold. Although the technique shows remarkable clinical success, the site of action and the relevant stimulation parameters are not completely understood. Here we identify the site of action potential initiation in rabbit retinal ganglion cells (RGCs) interfaced to an array of extracellular capacitive stimulation electrodes. We determine which feature of the extracellular potential governs action potential initiation by simultaneous stimulation and recording RGCs interfaced in epiretinal configuration. Stimulation electrodes were combined to areas of different size and were presented at different positions with respect to the RGC. Based on stimulation by electrodes beneath the RGC soma and simultaneous sub-millisecond latency measurement we infer axonal initiation at the site of maximal curvature of the extracellular potential. Stimulation by electrodes at different positions along the axon reveals a nearly constant threshold current density except for a narrow region close to the cell soma. These findings are explained by the concept of the activating function modified to consider a region of lower excitability close to the cell soma. We present a framework how to estimate the site of action potential initiation and the stimulus required to cross threshold in neurons tightly interfaced to capacitive stimulation electrodes. Our results underscore the necessity of rigorous electrical characterization of the stimulation electrodes and of the interfaced neural tissue.

  16. Distribution, Community Composition, and Potential Metabolic Activity of Bacterioplankton in an Urbanized Mediterranean Sea Coastal Zone.

    PubMed

    Richa, Kumari; Balestra, Cecilia; Piredda, Roberta; Benes, Vladimir; Borra, Marco; Passarelli, Augusto; Margiotta, Francesca; Saggiomo, Maria; Biffali, Elio; Sanges, Remo; Scanlan, David J; Casotti, Raffaella

    2017-09-01

    Bacterioplankton are fundamental components of marine ecosystems and influence the entire biosphere by contributing to the global biogeochemical cycles of key elements. Yet, there is a significant gap in knowledge about their diversity and specific activities, as well as environmental factors that shape their community composition and function. Here, the distribution and diversity of surface bacterioplankton along the coastline of the Gulf of Naples (GON; Italy) were investigated using flow cytometry coupled with high-throughput sequencing of the 16S rRNA gene. Heterotrophic bacteria numerically dominated the bacterioplankton and comprised mainly Alphaproteobacteria , Gammaproteobacteria , and Bacteroidetes Distinct communities occupied river-influenced, coastal, and offshore sites, as indicated by Bray-Curtis dissimilarity, distance metric (UniFrac), linear discriminant analysis effect size (LEfSe), and multivariate analyses. The heterogeneity in diversity and community composition was mainly due to salinity and changes in environmental conditions across sites, as defined by nutrient and chlorophyll a concentrations. Bacterioplankton communities were composed of a few dominant taxa and a large proportion (92%) of rare taxa (here defined as operational taxonomic units [OTUs] accounting for <0.1% of the total sequence abundance), the majority of which were unique to each site. The relationship between 16S rRNA and the 16S rRNA gene, i.e., between potential metabolic activity and abundance, was positive for the whole community. However, analysis of individual OTUs revealed high rRNA-to-rRNA gene ratios for most (71.6% ± 16.7%) of the rare taxa, suggesting that these low-abundance organisms were potentially active and hence might be playing an important role in ecosystem diversity and functioning in the GON. IMPORTANCE The study of bacterioplankton in coastal zones is of critical importance, considering that these areas are highly productive and anthropogenically impacted. Their richness and evenness, as well as their potential activity, are very important to assess ecosystem health and functioning. Here, we investigated bacterial distribution, community composition, and potential metabolic activity in the GON, which is an ideal test site due to its heterogeneous environment characterized by a complex hydrodynamics and terrestrial inputs of varied quantities and quality. Our study demonstrates that bacterioplankton communities in this region are highly diverse and strongly regulated by a combination of different environmental factors leading to their heterogeneous distribution, with the rare taxa contributing to a major proportion of diversity and shifts in community composition and potentially holding a key role in ecosystem functioning. Copyright © 2017 American Society for Microbiology.

  17. Distribution, Community Composition, and Potential Metabolic Activity of Bacterioplankton in an Urbanized Mediterranean Sea Coastal Zone

    PubMed Central

    Richa, Kumari; Balestra, Cecilia; Piredda, Roberta; Benes, Vladimir; Borra, Marco; Passarelli, Augusto; Margiotta, Francesca; Saggiomo, Maria; Biffali, Elio; Sanges, Remo; Scanlan, David J.

    2017-01-01

    ABSTRACT Bacterioplankton are fundamental components of marine ecosystems and influence the entire biosphere by contributing to the global biogeochemical cycles of key elements. Yet, there is a significant gap in knowledge about their diversity and specific activities, as well as environmental factors that shape their community composition and function. Here, the distribution and diversity of surface bacterioplankton along the coastline of the Gulf of Naples (GON; Italy) were investigated using flow cytometry coupled with high-throughput sequencing of the 16S rRNA gene. Heterotrophic bacteria numerically dominated the bacterioplankton and comprised mainly Alphaproteobacteria, Gammaproteobacteria, and Bacteroidetes. Distinct communities occupied river-influenced, coastal, and offshore sites, as indicated by Bray-Curtis dissimilarity, distance metric (UniFrac), linear discriminant analysis effect size (LEfSe), and multivariate analyses. The heterogeneity in diversity and community composition was mainly due to salinity and changes in environmental conditions across sites, as defined by nutrient and chlorophyll a concentrations. Bacterioplankton communities were composed of a few dominant taxa and a large proportion (92%) of rare taxa (here defined as operational taxonomic units [OTUs] accounting for <0.1% of the total sequence abundance), the majority of which were unique to each site. The relationship between 16S rRNA and the 16S rRNA gene, i.e., between potential metabolic activity and abundance, was positive for the whole community. However, analysis of individual OTUs revealed high rRNA-to-rRNA gene ratios for most (71.6% ± 16.7%) of the rare taxa, suggesting that these low-abundance organisms were potentially active and hence might be playing an important role in ecosystem diversity and functioning in the GON. IMPORTANCE The study of bacterioplankton in coastal zones is of critical importance, considering that these areas are highly productive and anthropogenically impacted. Their richness and evenness, as well as their potential activity, are very important to assess ecosystem health and functioning. Here, we investigated bacterial distribution, community composition, and potential metabolic activity in the GON, which is an ideal test site due to its heterogeneous environment characterized by a complex hydrodynamics and terrestrial inputs of varied quantities and quality. Our study demonstrates that bacterioplankton communities in this region are highly diverse and strongly regulated by a combination of different environmental factors leading to their heterogeneous distribution, with the rare taxa contributing to a major proportion of diversity and shifts in community composition and potentially holding a key role in ecosystem functioning. PMID:28667110

  18. Preconcentration for Improved Long-term Monitoring of Contaminants in Groundwater

    DTIC Science & Technology

    2014-04-10

    Johnson of the US Army Corps of Engineers, Tulsa District (recently retired) provided sites in northeastern Oklahoma for field trials as well as...neighboring wildlife is also a concern. Long-term monitoring of sites undergoing remediation as well as sites that may eventually require cleanup is...Activated charcoal and peroxide cleanup steps offer potential avenues for addressing this problem. The materials may be of value in isotopic analysis of

  19. Diagnostic Tools for Performance Evaluation of Innovative In-Situ Remediation Technologies at Chlorinated Solvent-Contaminated Sites

    DTIC Science & Technology

    2011-07-01

    fluid resistivity , temperature logging, and flow metering at other sites that typically indicated only two or three active fractures in each hole...was consistent with results of conventional borehole fluid resistivity , temperature logging, and flow metering at other sites that typically indicated...following tests were performed in each boundary monitoring well: ■ Gamma Ray; ■ Spontaneous Potential (SP); ■ Single Point Resistance (SPR

  20. PHL7/441: Fixing a Broken Line between the Perceived "Anarchy" of the Web and a Process-Comfortable Pharmaceutical Company

    PubMed Central

    Vercellesi, L

    1999-01-01

    Introduction In 1998 a pharmaceutical company published its Web site to provide: an institutional presence multifunctional information to primary customers and general public a new way of access to the company a link to existing company-sponsored sites a platform for future projects Since the publication, some significant integration have been added; in particular one is a primary interactive service, addressed to a selected audience. The need has been felt to foster new projects and establish the idea of routinely considering the site as a potential tool in the marketing mix, to provide advanced services to customers. Methods Re-assessment of the site towards objectives. Assessment of its perception with company potential suppliers. Results The issue "web use" was discussed in various management meetings; the trend of use of Internet among the primary customers was known; major concerns expressed were about staffing and return of investment for activities run in the Web. These perceptions are being addressed by making the company more comfortable by: Running the site through a detailed process and clear procedures, defining A new process of maintenance of the site, involving representatives of all the functions. Procedures and guidelines. A master file of approved answers and company contacts. Categories of activities (information, promotion, education, information to investors, general services, target-specific services). Measures for all the activities run in the Web site Specifically for the Web site a concise periodical report is being assessed, covering 1. Statistics about hits and mails, compared to the corporate data. Indication of new items published. Description by the "supplier" of new or ongoing innovative projects, to transfer best practice. Basic figures on the Italian trend in internet use and specifically in the pharmaceutical and medical fields. Comments to a few competitor sites. Examples of potential uses deriving from other Web sites. Discussion The comparatively low use of Internet in Italy has affected the systematic professional exploitation of the company site. The definition of "anarchic" commonly linked to the Web by local media has lead to the attempt to "master" and "normalize" the site with a stricter approach than usual: most procedures and guidelines have been designed from scratch as not available for similar activities traditionally run. A short set of information has been requested for inclusion in the report: its wide coverage will help to receive a flavour of the global parallel new world developing in the net. Hopefully this approach will help to create a comfortable attitude towards the medium in the whole organisation and to acquire a working experience with the net.

  1. Executive summary: Weldon Spring Site Environmental Report for calendar year 1992. Weldon Spring Site Remedial Action Project, Weldon Spring, Missouri

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1993-06-01

    This report has been prepared to provide information about the public safety and environmental protection programs conducted by the Weldon Spring Site Remedial Action Project. The Weldon Spring site is located in southern St. Charles County, Missouri, approximately 48 km (30 mi) west of St. Louis. The site consists of two main areas, the Weldon Spring Chemical Plant and raffinate pits and the Weldon Spring Quarry. The objectives of the Site Environmental Report are to present a summary of data from the environmental monitoring program, to characterize trends and environmental conditions at the site, and to confirm compliance with environmentalmore » and health protection standards and requirements. The report also presents the status of remedial activities and the results of monitoring these activities to assess their impacts on the public and environment. The scope of the environmental monitoring program at the Weldon Spring site has changed since it was initiated. Previously, the program focused on investigations of the extent and level of contaminants in the groundwater, surface waters, buildings, and air at the site. In 1992, the level of remedial activities required monitoring for potential impacts of those activities, particularly on surface water runoff and airborne effluents. This report includes monitoring data from routine radiological and nonradiological sampling activities. These data include estimates of dose to the public from the Weldon Spring site; estimates of effluent releases; and trends in groundwater contaminant levels. Also, applicable compliance requirements, quality assurance programs, and special studies conducted in 1992 to support environmental protection programs are reviewed.« less

  2. Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

    PubMed

    Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

    2018-04-01

    Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

  3. Changing concepts of geologic structure and the problem of siting nuclear reactors: Examples from Washington State

    NASA Astrophysics Data System (ADS)

    Tabor, R. W.

    1986-09-01

    The conflict between regulation and healthy evolution of geological science has contributed to the difficulties of siting nuclear reactors. On the Columbia Plateau in Washington, but for conservative design of the Hanford reactor facility, the recognition of the little-understood Olympic-Wallowa lineament as a major, possibly still active structural alinement might have jeopardized the acceptability of the site for nuclear reactors. On the Olympic Peninsula, evolving concepts of compressive structures and their possible recent activity and the current recognition of a subducting Juan de Fuca plate and its potential for generating great earthquakes—both concepts little-considered during initial site selection—may delay final acceptance of the Satsop site. Conflicts of this sort are inevitable but can be accommodated if they are anticipated in the reactor-licensing process. More important, society should be increasing its store of geologic knowledge now, during the current recess in nuclear reactor siting.

  4. Remedial Action Plan and site design for stabilization of the inactive uranium mill tailings site at Durango, Colorado: Attachment 3, Groundwater hydrology report. Revised final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1991-12-01

    The US Environmental Protection Agency (EPA) has established health and environmental protection regulations to correct and prevent groundwater contamination resulting from processing activities at inactive uranium milling sites. According to the Uranium Mill Tailings Radiation Control Act of 1978, (UMTRCA) the US Department of Energy (DOE) is responsible for assessing the inactive uranium processing sites. The DOE has determined this assessment shall include information on hydrogeologic site characterization. The water resources protection strategy that describes how the proposed action will comply with the EPA groundwater protection standards is presented in Attachment 4. Site characterization activities discussed in this section include:more » Characterization of the hydrogeologic environment; characterization of existing groundwater quality; definition of physical and chemical characteristics of the potential contaminant source; and description of local water resources.« less

  5. Is There a Role for Social Networking Sites in Education?

    NASA Astrophysics Data System (ADS)

    Santos, Ieda M.; Hammond, Michael; Durli, Zenilde; Chou, Shiao-Yuh

    Social networking sites such as Facebook and MySpace have become popular among millions of users including students of all ages. There are ongoing discussions over the potential of these sites to support teaching and learning, particularly to complement traditional or online classroom activities. This paper explores whether social networking have a place in teaching and learning by investigating how students use these sites and whether they find opportunities to discuss study related activities with their peers. Two small scale studies were carried out in a face-to-face undergraduate course in Singapore and students enrolled in a face-to-face Master’s programme in Brazil. Data were collected using surveys and interviews; findings were mixed. Many of the Brazilian students used social networking sites to both socialize and discuss their studies while the Singaporean students used such sites for social interactions only. The paper discusses these differences and offers suggestions for further research.

  6. Brain Region and Isoform-Specific Phosphorylation Alters Kalirin SH2 Domain Interaction Sites and Calpain Sensitivity

    PubMed Central

    Miller, Megan B.; Yan, Yan; Machida, Kazuya; Kiraly, Drew D.; Levy, Aaron D.; Wu, Yi I.; Lam, TuKiet T.; Abbott, Thomas; Koleske, Anthony J.; Eipper, Betty A.; Mains, Richard E.

    2017-01-01

    Kalirin7 (Kal7), a postsynaptic Rho GDP/GTP exchange factor (RhoGEF), plays a crucial role in long term potentiation and in the effects of cocaine on behavior and spine morphology. The KALRN gene has been linked to schizophrenia and other disorders of synaptic function. Mass spectrometry was used to quantify phosphorylation at 26 sites in Kal7 from individual adult rat nucleus accumbens and prefrontal cortex before and after exposure to acute or chronic cocaine. Region- and isoform-specific phosphorylation was observed along with region-specific effects of cocaine on Kal7 phosphorylation. Evaluation of the functional significance of multi-site phosphorylation in a complex protein like Kalirin is difficult. With the identification of five tyrosine phosphorylation (pY) sites, a panel of 71 SH2 domains was screened, identifying subsets that interacted with multiple pY sites in Kal7. In addition to this type of reversible interaction, endoproteolytic cleavage by calpain plays an essential role in long-term potentiation. Calpain cleaved Kal7 at two sites, separating the N-terminal domain, which affects spine length, and the PDZ binding motif from the GEF domain. Mutations preventing phosphorylation did not affect calpain sensitivity or GEF activity; phosphomimetic mutations at specific sites altered protein stability, increased calpain sensitivity and reduced GEF activity. PMID:28418645

  7. Develop high activity, low cost non-PGM fuel cell electrocatalyst and stable supports

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colon-Mercado, H. R.; Elvington, M. C.; Garcia-Diaz, B. L.

    2016-09-28

    A unique approach has been developed to probe the non-PGM catalyst active site for the Oxygen Reduction Reaction (ORR) for PEMFC. Iron based functionalities have been engineered into Metallic Organic Framework (MOF) catalysts to evaluate their impact on activity for the ORR. A series of FePhen@MOF catalysts have been synthesized with varying [Fe] to investigate the effect on electrochemical and electrocatalytic properties. The magnitude of the Fe II/III redox couple and the electrochemical surface area are analyzed to determine if there is a correlation between [Fe] and the ORR onset potential and/or the relative number of active sites.

  8. Overview of the 2015 Algodones Sand Dunes field campaign to support sensor intercalibration

    NASA Astrophysics Data System (ADS)

    McCorkel, Joel; Bachmann, Charles M.; Coburn, Craig; Gerace, Aaron; Leigh, Larry; Czapla-Myers, Jeff; Helder, Dennis; Cook, Bruce

    2018-01-01

    Several sites from around the world are being used operationally and are suitable for vicarious calibration of space-borne imaging platforms. However, due to the proximity of these sites (e.g., Libya 4), a rigorous characterization of the landscape is not feasible, limiting their utility for sensor intercalibration efforts. Due to its accessibility and similarities to Libya 4, the Algodones Sand Dunes System in California, USA, was identified as a potentially attractive intercalibration site for space-borne, reflective instruments such as Landsat. In March 2015, a 4-day field campaign was conducted to develop an initial characterization of Algodones with a primary goal of assessing its intercalibration potential. Five organizations from the US and Canada collaborated to collect both active and passive airborne image data, spatial and temporal measurements of spectral bidirectional reflectance distribution function, and in-situ sand samples from several locations across the Algodones system. The collection activities conducted to support the campaign goal is summarized, including a summary of all instrumentation used, the data collected, and the experiments performed in an effort to characterize the Algodones site.

  9. Exposure of nonbreeding migratory shorebirds to cholinesterase-inhibiting contaminants in the western hemisphere

    USGS Publications Warehouse

    Strum, K.M.; Hooper, M.J.; Johnson, K.A.; Lanctot, Richard B.; Zaccagnini, M.E.; Sandercock, B.K.

    2010-01-01

    Migratory shorebirds frequently forage and roost in agricultural habitats, where they may be exposed to cholinesterase-inhibiting pesticides. Exposure to organophosphorus and carbamate compounds, common anti-cholinesterases, can cause sublethal effects, even death. To evaluate exposure of migratory shorebirds to organophosphorus and carbamates, we sampled birds stopping over during migration in North America and wintering in South America. We compared plasma cholinesterase activities and body masses of individuals captured at sites with no known sources of organophosphorus or carbamates to those captured in agricultural areas where agrochemicals were recommended for control of crop pests. In South America, plasma acetylcholinesterase and butyrylcholinesterase activity in Buff-breasted Sandpipers was lower at agricultural sites than at reference sites, indicating exposure to organophosphorus and carbamates. Results of plasma cholinesterase reactivation assays and foot-wash analyses were inconclusive. A meta-analysis of six species revealed no widespread effect of agricultural chemicals on cholinesterase activity. however, four of six species were negative for acetylcholinesterase and one of six for butyrylcholinesterase, indicating negative effects of pesticides on cholinesterase activity in a subset of shorebirds. Exposure to cholinesterase inhibitors can decrease body mass, but comparisons between treatments and hemispheres suggest that agrochemicals did not affect migratory shorebirds' body mass. Our study, one of the first to estimate of shorebirds' exposure to cholinesterase-inhibiting pesticides, suggests that shorebirds are being exposed to cholinesterase- inhibiting pesticides at specific sites in the winter range but not at migratory stopover sites. future research should examine potential behavioral effects of exposure and identify other potential sitesand levels of exposure. ?? The Cooper Ornithological Society 2010.

  10. Geo-Statistical Approach to Estimating Asteroid Exploration Parameters

    NASA Technical Reports Server (NTRS)

    Lincoln, William; Smith, Jeffrey H.; Weisbin, Charles

    2011-01-01

    NASA's vision for space exploration calls for a human visit to a near earth asteroid (NEA). Potential human operations at an asteroid include exploring a number of sites and analyzing and collecting multiple surface samples at each site. In this paper two approaches to formulation and scheduling of human exploration activities are compared given uncertain information regarding the asteroid prior to visit. In the first approach a probability model was applied to determine best estimates of mission duration and exploration activities consistent with exploration goals and existing prior data about the expected aggregate terrain information. These estimates were compared to a second approach or baseline plan where activities were constrained to fit within an assumed mission duration. The results compare the number of sites visited, number of samples analyzed per site, and the probability of achieving mission goals related to surface characterization for both cases.

  11. Fire treatment effects on vegetation structure, fuels, and potential fire severity in western U.S. forests

    USGS Publications Warehouse

    Stephens, S.L.; Moghaddas, J.J.; Edminster, C.; Fiedler, C.E.; Haase, S.; Harrington, M.; Keeley, J.E.; Knapp, E.E.; Mciver, J.D.; Metlen, K.; Skinner, C.N.; Youngblood, A.

    2009-01-01

    Abstract. Forest structure and species composition in many western U.S. coniferous forests have been altered through fire exclusion, past and ongoing harvesting practices, and livestock grazing over the 20th century. The effects of these activities have been most pronounced in seasonally dry, low and mid-elevation coniferous forests that once experienced frequent, low to moderate intensity, fire regimes. In this paper, we report the effects of Fire and Fire Surrogate (FFS) forest stand treatments on fuel load profiles, potential fire behavior, and fire severity under three weather scenarios from six western U.S. FFS sites. This replicated, multisite experiment provides a framework for drawing broad generalizations about the effectiveness of prescribed fire and mechanical treatments on surface fuel loads, forest structure, and potential fire severity. Mechanical treatments without fire resulted in combined 1-, 10-, and 100-hour surface fuel loads that were significantly greater than controls at three of five FFS sites. Canopy cover was significantly lower than controls at three of five FFS sites with mechanical-only treatments and at all five FFS sites with the mechanical plus burning treatment; fire-only treatments reduced canopy cover at only one site. For the combined treatment of mechanical plus fire, all five FFS sites with this treatment had a substantially lower likelihood of passive crown fire as indicated by the very high torching indices. FFS sites that experienced significant increases in 1-, 10-, and 100-hour combined surface fuel loads utilized harvest systems that left all activity fuels within experimental units. When mechanical treatments were followed by prescribed burning or pile burning, they were the most effective treatment for reducing crown fire potential and predicted tree mortality because of low surface fuel loads and increased vertical and horizontal canopy separation. Results indicate that mechanical plus fire, fire-only, and mechanical-only treatments using whole-tree harvest systems were all effective at reducing potential fire severity under severe fire weather conditions. Retaining the largest trees within stands also increased fire resistance. ?? 2009 by the Ecological Society of America.

  12. A Site Characterization Protocol for Evaluating the Potential for Triggered or Induced Seismicity Resulting from Wastewater Injection and Hydraulic Fracturing

    NASA Astrophysics Data System (ADS)

    Walters, R. J.; Zoback, M. D.; Gupta, A.; Baker, J.; Beroza, G. C.

    2014-12-01

    Regulatory and governmental agencies, individual companies and industry groups and others have recently proposed, or are developing, guidelines aimed at reducing the risk associated with earthquakes triggered by waste water injection or hydraulic fracturing. While there are a number of elements common to the guidelines proposed, not surprisingly, there are also some significant differences among them and, in a number of cases, important considerations that are not addressed. The goal of this work is to develop a comprehensive protocol for site characterization based on a rigorous scientific understanding of the responsible processes. Topics addressed will include the geologic setting (emphasizing faults that might be affected), historical seismicity, hydraulic characterization of injection and adjacent intervals, geomechanical characterization to identify potentially active faults, plans for seismic monitoring and reporting, plans for monitoring and reporting injection (pressure, volumes, and rates), other factors contributing to risk (potentially affected population centers, structures, and facilities), and implementing a modified Probabilistic Seismic Hazard Analysis (PSHA). The guidelines will be risk based and adaptable, rather than prescriptive, for a proposed activity and region of interest. They will be goal oriented and will rely, to the degree possible, on established best practice procedures, referring to existing procedures and recommendations. By developing a risk-based site characterization protocol, we hope to contribute to the development of rational and effective measures for reducing the risk posed by activities that potentially trigger earthquakes.

  13. Novel nootropic drug sunifiram enhances hippocampal synaptic efficacy via glycine-binding site of N-methyl-D-aspartate receptor.

    PubMed

    Moriguchi, Shigeki; Tanaka, Tomoya; Narahashi, Toshio; Fukunaga, Kohji

    2013-10-01

    Sunifiram is a novel pyrrolidone nootropic drug structurally related to piracetam, which was developed for neurodegenerative disorder like Alzheimer's disease. Sunifiram is known to enhance cognitive function in some behavioral experiments such as Morris water maze task. To address question whether sunifiram affects N-methyl-D-aspartate receptor (NMDAR)-dependent synaptic function in the hippocampal CA1 region, we assessed the effects of sunifiram on NMDAR-dependent long-term potentiation (LTP) by electrophysiology and on phosphorylation of synaptic proteins by immunoblotting analysis. In mouse hippocampal slices, sunifiram at 10-100 nM significantly enhanced LTP in a bell-shaped dose-response relationship which peaked at 10 nM. The enhancement of LTP by sunifiram treatment was inhibited by 7-chloro-kynurenic acid (7-ClKN), an antagonist for glycine-binding site of NMDAR, but not by ifenprodil, an inhibitor for polyamine site of NMDAR. The enhancement of LTP by sunifilam was associated with an increase in phosphorylation of α-amino-3-hydroxy-5-methylisozazole-4-propionate receptor (AMPAR) through activation of calcium/calmodulin-dependent protein kinase II (CaMKII) and an increase in phosphorylation of NMDAR through activation of protein kinase Cα (PKCα). Sunifiram treatments at 1-1000 nM increased the slope of field excitatory postsynaptic potentials (fEPSPs) in a dose-dependent manner. The enhancement was associated with an increase in phosphorylation of AMPAR receptor through activation of CaMKII. Interestingly, under the basal condition, sunifiram treatments increased PKCα (Ser-657) and Src family (Tyr-416) activities with the same bell-shaped dose-response curve as that of LTP peaking at 10 nM. The increase in phosphorylation of PKCα (Ser-657) and Src (Tyr-416) induced by sunifiram was inhibited by 7-ClKN treatment. The LTP enhancement by sunifiram was significantly inhibited by PP2, a Src family inhibitor. Finally, when pretreated with a high concentration of glycine (300 μM), sunifiram treatments failed to potentiate LTP in the CA1 region. Taken together, sunifiram stimulates the glycine-binding site of NMDAR with concomitant PKCα activation through Src kinase. Enhancement of PKCα activity triggers to potentiate hippocampal LTP through CaMKII activation. Copyright © 2013 Wiley Periodicals, Inc.

  14. Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

    Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

  15. Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.

    PubMed

    Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D

    2016-08-30

    The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.

  16. Molecular dynamics simulation studies of novel β-lactamase inhibitor.

    PubMed

    Ul Haq, Farhan; Abro, Asma; Raza, Saad; Liedl, Klaus R; Azam, Syed Sikander

    2017-06-01

    New Delhi Metallo-β-Lactamase-1 (NDM-1) has drawn great attention due to its diverse antibiotic resistant activity. It can hydrolyze almost all clinically available β-lactam antibiotics. To inhibit the activity of NDM-1 a new strategy is proposed using computational methods. Molecular dynamics (MD) simulations are used to analyze the molecular interactions between selected inhibitor candidates and NDM-1 structure. The enzyme-ligand complex is subject to binding free energy calculations using MM(PB/GB)SA methods. The role of each residue of the active site contributing in ligand binding affinity is explored using energy decomposition analysis. Furthermore, a hydrogen bonding network between ligand and enzyme active site is observed and key residues are identified ensuring that the ligand stays inside the active site and maintains its movement towards the active site pocket. A production run of 150ns is carried out and results are analyzed using root mean square deviation (RMSD), root mean square fluctuation (RMSF), and radius of gyration (Rg) to explain the stability of enzyme ligand complex. Important active site residue e.g. PHE70, VAL73, TRP93, HIS122, GLN123, ASP124, HIS189, LYS216, CYS208, LYS211, ALA215, HIS250, and SER251 were observed to be involved in ligand attachemet inside the active site pocket, hence depicting its inhibitor potential. Hydrogen bonds involved in structural stability are analyzed through radial distribution function (RDF) and contribution of important residues involved in ligand movement is explained using a novel analytical tool, axial frequency distribution (AFD) to observe the role of important hydrogen bonding partners between ligand atoms and active site residues. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Allosteric regulation of epigenetic modifying enzymes.

    PubMed

    Zucconi, Beth E; Cole, Philip A

    2017-08-01

    Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  19. SABER: A computational method for identifying active sites for new reactions

    PubMed Central

    Nosrati, Geoffrey R; Houk, K N

    2012-01-01

    A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644–1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were l-Ala d/l-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. PMID:22492397

  20. Understanding the conformational flexibility and electrostatic properties of curcumin in the active site of rhAChE via molecular docking, molecular dynamics, and charge density analysis.

    PubMed

    Saravanan, Kandasamy; Kalaiarasi, Chinnasamy; Kumaradhas, Poomani

    2017-12-01

    Acetylcholinesterase (AChE) is an important enzyme responsible for Alzheimer's disease, as per report, keto-enol form of curcumin inhibits this enzyme. The present study aims to understand the binding mechanism of keto-enol curcumin with the recombinant human Acetylcholinesterase (rhAChE) from its conformational flexibility, intermolecular interactions, charge density distribution, and the electrostatic properties at the active site of rhAChE. To accomplish this, a molecular docking analysis of curcumin with the rhAChE was performed, which gives the structure and conformation of curcumin in the active site of rhAChE. Further, the charge density distribution and the electrostatic properties of curcumin molecule (lifted from the active site of rhAChE) were determined from the high level density functional theory (DFT) calculations coupled with the charge density analysis. On the other hand, the curcumin molecule was optimized (gas phase) using DFT method and further, the structure and charge density analysis were also carried out. On comparing the conformation, charge density distribution and the electrostatic potential of the active site form of curcumin with the corresponding gas phase form reveals that the above said properties are significantly altered when curcumin is present in the active site of rhAChE. The conformational stability and the interaction of curcumin in the active site are also studied using molecular dynamics simulation, which shows a large variation in the conformational geometry of curcumin as well as the intermolecular interactions.

  1. Usefulness of ventricular endocardial electric reconstruction from body surface potential maps to noninvasively localize ventricular ectopic activity in patients

    NASA Astrophysics Data System (ADS)

    Lai, Dakun; Sun, Jian; Li, Yigang; He, Bin

    2013-06-01

    As radio frequency (RF) catheter ablation becomes increasingly prevalent in the management of ventricular arrhythmia in patients, an accurate and rapid determination of the arrhythmogenic site is of important clinical interest. The aim of this study was to test the hypothesis that the inversely reconstructed ventricular endocardial current density distribution from body surface potential maps (BSPMs) can localize the regions critical for maintenance of a ventricular ectopic activity. Patients with isolated and monomorphic premature ventricular contractions (PVCs) were investigated by noninvasive BSPMs and subsequent invasive catheter mapping and ablation. Equivalent current density (CD) reconstruction (CDR) during symptomatic PVCs was obtained on the endocardial ventricular surface in six patients (four men, two women, years 23-77), and the origin of the spontaneous ectopic activity was localized at the location of the maximum CD value. Compared with the last (successful) ablation site (LAS), the mean and standard deviation of localization error of the CDR approach were 13.8 and 1.3 mm, respectively. In comparison, the distance between the LASs and the estimated locations of an equivalent single moving dipole in the heart was 25.5 ± 5.5 mm. The obtained CD distribution of activated sources extending from the catheter ablation site also showed a high consistency with the invasively recorded electroanatomical maps. The noninvasively reconstructed endocardial CD distribution is suitable to predict a region of interest containing or close to arrhythmia source, which may have the potential to guide RF catheter ablation.

  2. A pharmacophore model specific to active site of CYP1A2 with a novel molecular modeling explorer and CoMFA.

    PubMed

    Zhang, Tao; Wei, Dong-Qing; Chou, Kuo-Chen

    2012-03-01

    Comparative molecular field analysis (CoMFA) is a widely used 3D-QSAR method by which we can investigate the potential relation between biological activity of compounds and their structural features. In this study, a new application of this approach is presented by combining the molecular modeling with a new developed pharmacophore model specific to CYP1A2 active site. During constructing the model, we used the molecular dynamics simulation and molecular docking method to select the sensible binding conformations for 17 CYP1A2 substrates based on the experimental data. Subsequently, the results obtained via the alignment of binding conformations of substrates were projected onto the active- site residues, upon which a simple blueprint of active site was produced. It was validated by the experimental and computational results that the model did exhibit the high degree of rationality and provide useful insights into the substrate binding. It is anticipated that our approach can be extended to investigate the protein-ligand interactions for many other enzyme-catalyzed systems as well.

  3. Contamination of potentially toxic elements in streams and water sediments in the area of abandoned Pb-Zn-Cu deposits (Hrubý Jesenník, Czech Republic)

    NASA Astrophysics Data System (ADS)

    Lichnovský, J.; Kupka, J.; Štěrbová, V.; Andráš, P.; Midula, P.

    2017-10-01

    The deposits, located in Nová Ves and Zlaté Hory were well known and important sources of metal ore in Jesenniky region in the past. Especially the one in Nová Ves, which is recently the most important hydrothermal deposit of venous type in the whole area. The mining activity, aimed on lead and zinc minerals was practically permanent here from the middle-age to 1959. On the other hand, the site in Zlaté Hory is the most important ore deposit in Czech Silesia. The non-venous types of polymetallic, copper and gold deposits, evolved in the complex of metamorphic devon rocks are located on south and south-west directions of the area. Long and permanent mining industry caused remarkable changes in the local environment, creating mine heaps and depressions. The probability, that dump material contains potentially toxic substances that could be possibly leaked into surrounded environment is high. This contribution presents the part of complex study results, aimed on evaluating of potential environmental impacts in above mentioned locations. It aims on contamination, caused by potentially toxic heavy metals (Pb, Zn, Cu, Ni, Fe, Mn, Co, Cd, Cr and As) at the sites, exposed to mining activity in the past. The study focus on the contamination of these sites and evaluate them as potential risk for surrounded environment.

  4. River Corridor Cleanup Contract Fiscal Year 2006 Detailed Work Plan: D4 Project/Reactor ISS Closure Projects Field Remediation Project Waste Operations Project End State and Final Closure Project Mission/General Support, Volume 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Project Integration

    2005-09-26

    The Hanford Site contains many surplus facilities and waste sites that remain from plutonium production activities. These contaminated facilities and sites must either be stabilized and maintained, or removed, to prevent the escape of potentially hazardous contaminants into the environment and exposure to workers and the public.

  5. Ethanol (EtOH) inhibition of NMDA-activated ion current is not voltage-dependent and EtOH does not interact with other binding sites on the NMDA receptor/ionophore complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lovinger, D.M.; White, G.; Weight, F.F.

    1990-02-26

    Recent studies indicate that intoxicating concentrations of EtOH inhibit neuronal responses to activation of NMDA-type glutamate receptors. The authors have observed that the potency of different alcohols for inhibiting NMDA-activated ion current in hippocampal neurons increases as a function of increasing hydrophobicity, suggesting that EtOH acts at a hydrophobic site. To further characterize the mechanisms of this effect, the authors examined the voltage-dependence of the EtOH inhibition of NMDA-activated ion current as well as potential interactions of EtOH with other effectors of the NMDA receptor/ionophore complex. The amount of inhibition of peak NMDA-activated current by 50 mM EtOH did notmore » differ over a range of membrane potentials from {minus}60 to +60 mV, and EtOH did not alter the reversal potential of NMDA-activated current. The percent inhibition observed in the presence of 10-100 mM EtOH did not differ with NMDA concentrations from 10-100 {mu}M. The percent inhibition by 50 mM EtOH (30-48%) did not differ in the absence or presence of the channel blockers Mg{sup 2+} (50-500 {mu}M), Zn{sup 2+} (5 and 20 {mu}M) or ketamine (2 and 10 {mu}M), or with increasing concentrations of the NMDA receptor cofactor glycine (0.01-1 {mu}M). These data indicate that: (i) EtOH does not change the ion selectivity of the ionophore, and (ii) EtOH does not appear to interact with previously described binding sites on the NMDA receptor/ionophore complex.« less

  6. Testing the applicability of rapid on-site enzymatic activity detection for surface water monitoring

    NASA Astrophysics Data System (ADS)

    Stadler, Philipp; Vogl, Wolfgang; Juri, Koschelnik; Markus, Epp; Maximilian, Lackner; Markus, Oismüller; Monika, Kumpan; Peter, Strauss; Regina, Sommer; Gabriela, Ryzinska-Paier; Farnleitner Andreas, H.; Matthias, Zessner

    2015-04-01

    On-site detection of enzymatic activities has been suggested as a rapid surrogate for microbiological pollution monitoring of water resources (e.g. using glucuronidases, galactosidases, esterases). Due to the possible short measuring intervals enzymatic methods have high potential as near-real time water quality monitoring tools. This presentation describes results from a long termed field test. For twelve months, two ColiMinder devices (Vienna Water Monitoring, Austria) for on-site determination of enzymatic activity were tested for stream water monitoring at the experimental catchment HOAL (Hydrological Open Air Laboratory, Center for Water Resource Systems, Vienna University of Technology). The devices were overall able to follow and reflect the diverse hydrological and microbiological conditions of the monitored stream during the test period. Continuous data in high temporal resolution captured the course of enzymatic activity in stream water during diverse rainfall events. The method also proofed sensitive enough to determine diurnal fluctuations of enzymatic activity in stream water during dry periods. The method was able to capture a seasonal trend of enzymatic activity in stream water that matches the results gained from Colilert18 analysis for E. coli and coliform bacteria of monthly grab samples. Furthermore the comparison of ColiMinder data with measurements gained at the same test site with devices using the same method but having different construction design (BACTcontrol, microLAN) showed consistent measuring results. Comparative analysis showed significant differences between measured enzymatic activity (modified fishman units and pmol/min/100ml) and cultivation based analyses (most probable number, colony forming unit). Methods of enzymatic activity measures are capable to detect ideally the enzymatic activity caused by all active target bacteria members, including VBNC (viable but nonculturable) while cultivation based methods cannot detect VBNC bacteria. Therefore the applicability of on-site enzymatic activity determination as a direct surrogate or proxy parameter for microbiological standard assays and quantification of fecal indicator bacteria (FIB) concentration could not be approved and further research in this field is necessary. Presently we conclude that rapid on-site detection of enzymatic activity is applicable for surface water monitoring and that it constitutes a complementary on-site monitoring parameter with high potential. Selection of the type of measured enzymatic activities has to be done on a catchment-specific basis and further work is needed to learn more about its detailed information characteristics in different habitats. The accomplishment of this method detecting continuous data of enzymatic activity in high temporal resolution caused by a target bacterial member is on the way of becoming a powerful tool for water quality monitoring, health related water quality- and early warning requirements.

  7. Variability of acute extracellular action potential measurements with multisite silicon probes

    PubMed Central

    Scott, Kimberly M.; Du, Jiangang; Lester, Henry A.; Masmanidis, Sotiris C.

    2012-01-01

    Device miniaturization technologies have led to significant advances in sensors for extracellular measurements of electrical activity in the brain. Multisite, silicon-based probes containing implantable electrode arrays afford greater coverage of neuronal activity than single electrodes and therefore potentially offer a more complete view of how neuronal ensembles encode information. However, scaling up the number of sites is not sufficient to ensure capture of multiple neurons, as action potential signals from extracellular electrodes may vary due to numerous factors. In order to understand the large-scale recording capabilities and potential limitations of multisite probes, it is important to quantify this variability, and to determine whether certain key device parameters influence the recordings. Here we investigate the effect of four parameters, namely, electrode surface, width of the structural support shafts, shaft number, and position of the recording site relative to the shaft tip. This study employs acutely implanted silicon probes containing up to 64 recording sites, whose performance is evaluated by the metrics of noise, spike amplitude, and spike detection probability. On average, we find no significant effect of device geometry on spike amplitude and detection probability but we find significant differences among individual experiments, with the likelihood of detecting spikes varying by a factor of approximately three across trials. PMID:22971352

  8. Public health assessment for petitioned public health assessment, West Pullman Iron and Metal (a/k/a West Pullman/Victory Heights), Chicago, Cook County, Illinois, Region 5: CERCLIS number ILD005428651. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    The West Pullman/Victory Heights/Maple Park site consists of two abandoned industrial properties. The Navistar International Transportation Corporation (Navistar) property is commonly called International Harvester (IH) and the NL Industries, Incorporated property is commonly called Dutch Boy (DB). These industries were active from the early part of this century until the early 1980s when the factories were closed and abandoned. Currently, for people trespassing on the site, both the Dutch Boy and the International Harvester properties represent a potential public health hazard. Limited data are available to assess potential off-site exposures to site-related contaminants, and therefore, exposure to off-site contaminants frommore » the International Harvester and Dutch Boy properties is classified as an indeterminate public health hazard.« less

  9. Teen smoking cessation help via the Internet: a survey of search engines.

    PubMed

    Edwards, Christine C; Elliott, Sean P; Conway, Terry L; Woodruff, Susan I

    2003-07-01

    The objective of this study was to assess Web sites related to teen smoking cessation on the Internet. Seven Internet search engines were searched using the keywords teen quit smoking. The top 20 hits from each search engine were reviewed and categorized. The keywords teen quit smoking produced between 35 and 400,000 hits depending on the search engine. Of 140 potential hits, 62% were active, unique sites; 85% were listed by only one search engine; and 40% focused on cessation. Findings suggest that legitimate on-line smoking cessation help for teens is constrained by search engine choice and the amount of time teens spend looking through potential sites. Resource listings should be updated regularly. Smoking cessation Web sites need to be picked up on multiple search engine searches. Further evaluation of smoking cessation Web sites need to be conducted to identify the most effective help for teens.

  10. Tacrine-based dual binding site acetylcholinesterase inhibitors as potential disease-modifying anti-Alzheimer drug candidates.

    PubMed

    Camps, Pelayo; Formosa, Xavier; Galdeano, Carles; Gómez, Tània; Muñoz-Torrero, Diego; Ramírez, Lorena; Viayna, Elisabet; Gómez, Elena; Isambert, Nicolás; Lavilla, Rodolfo; Badia, Albert; Clos, M Victòria; Bartolini, Manuela; Mancini, Francesca; Andrisano, Vincenza; Bidon-Chanal, Axel; Huertas, Oscar; Dafni, Thomai; Luque, F Javier

    2010-09-06

    Two novel families of dual binding site acetylcholinesterase (AChE) inhibitors have been developed, consisting of a tacrine or 6-chlorotacrine unit as the active site interacting moiety, either the 5,6-dimethoxy-2-[(4-piperidinyl)methyl]-1-indanone fragment of donepezil (or the indane derivative thereof) or a 5-phenylpyrano[3,2-c]quinoline system, reminiscent to the tryciclic core of propidium, as the peripheral site interacting unit, and a linker of suitable length as to allow the simultaneous binding at both sites. These hybrid compounds are all potent and selective inhibitors of human AChE, and more interestingly, are able to interfere in vitro both formation and aggregation of the beta-amyloid peptide, the latter effects endowing these compounds with the potential to modify Alzheimer's disease progression. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Measurement of attitudes toward commercial development of geothermal energy in Federal Region IX. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1981-06-01

    A survey was conducted of ten target study groups and subgroups for Klamath Falls, Oregon, and Susanville, California: local government, current and potential industry at the site, relocators to the site, current and potential financial community, regulators, and current and potential promoters and developers. The results of benchmark attitudinal measurement is presented separately for each target group. A literature review was conducted and Macro-environmental attitudes of a sample of local government and industry personnel at the sites were assessed. An assessment of capabilities was made which involved two measurements. The first was a measurement of a sample of promoters, developers,more » and industrial service companies active at the site to determine infrastructure capabilities required by industry for geothermal plants. The second measurement involved analyzing a sample of industry management in the area and defining their requirements for plant retrofit and expansion. Finally, the processes used by the study group to analyze information to reach commitment and regulatory decisions that significantly impact on geothermal energy projects at the site were identified and defined.« less

  12. Supplement Analysis for the Wildlife Mitigation Program EIS (DOE/EIS-0246/SA-36)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    N /A

    2003-10-10

    The compliance checklist for this project was originally completed by the Burns Paiute Tribe in 2000, and meets the standards and guidelines for the Wildlife Mitigation Program Environmental Impact Statement (EIS) and Record of Decision (ROD), as well as the Watershed Management Program Environmental Impact Statement (EIS) and Record of Decision (ROD). The Logan Valley Wildlife Mitigation Plan, now being implemented, continues to be consistent with the above mentioned EISs and RODs. Pursuant to its obligations under the Endangered Species Act, BPA has made a determination of whether its proposed project will have any effects on any listed species undermore » the jurisdiction of the United States Fish and Wildlife Service (USFWS). A species list was obtained from USFWS on June 12, 2003, identifying bald eagles, Canada lynx, and bull trout as potentially occurring in the project area. A site assessment was conducted on July 15, 2003 to determine if these species were present and the potential effects of project activities. A ''No Effect'' determination was made for all ESA-listed species. There were no listed species under the jurisdiction of NOAA Fisheries present in the project area. As management activities proceed in the future, BPA will annually re-assess potential effects of planned activities on listed species. The Burns-Paiute Tribe conducted a literature search for historic and archaeological sites on the property on January 11, 1999. No known sites were identified. Further site-specific surveys will be conducted for individual ground disturbing activities. The results of these surveys will be sent to the Oregon State Historic Preservation Office and BPA. BPA will annually summarize and submit a report to the State Historic Preservation Office. On December 29, 1999, Fred Walasavage of BPA completed a Phase I Site Assessment and concluded that the site did not reveal any environmental factors that would pose a significant liability for remedial action or cleanup under the Comprehensive Recovery, Compensation and Liability Act. A public meeting was held when the property was initially acquired where the property acquisition and proposed activities were discussed. Subsequent public involvement was conducted on July 23, 2002 for commenting on the proposed Logan Valley Wildlife Mitigation Plan.« less

  13. Identifying diabetes knowledge network nodes as sites for a diabetes prevention program.

    PubMed

    Gesler, Wilbert M; Arcury, Thomas A; Skelly, Anne H; Nash, Sally; Soward, April; Dougherty, Molly

    2006-12-01

    This paper reports on the methods used and results of a study that identified specific places within a community that have the potential to be sites for a diabetes prevention program. These sites, termed diabetes knowledge network nodes (DKNNs), are based on the concept of socio-spatial knowledge networks (SSKNs), the web of social relationships within which people obtain knowledge about type 2 diabetes. The target population for the study was working poor African Americans, Latinos, and European Americans of both sexes in a small rural southern town who had not been diagnosed with diabetes. Information was collected from a sample of 121 respondents on the places they visited in carrying out their daily activities. Data on number of visits to specific sites, degree of familiarity with these sites, and ratings of sites as places to receive diabetes information were used to develop three categories of DKNNs for six subgroups based on ethnicity and sex. Primary potential sites of importance to one or more subgroups included churches, grocery stores, drugstores, the local library, a beauty salon, laundromats, a community service agency, and a branch of the County Health Department. Secondary potential sites included gas stations, restaurants, banks, and post offices. Latent potential sites included three medical facilities. Most of the DKNNs were located either in the downtown area or in one of two shopping areas along the most used highway that passed through the town. The procedures used in this study can be generalized to other communities and prevention programs for other chronic diseases.

  14. Risk-based economic decision analysis of remediation options at a PCE-contaminated site.

    PubMed

    Lemming, Gitte; Friis-Hansen, Peter; Bjerg, Poul L

    2010-05-01

    Remediation methods for contaminated sites cover a wide range of technical solutions with different remedial efficiencies and costs. Additionally, they may vary in their secondary impacts on the environment i.e. the potential impacts generated due to emissions and resource use caused by the remediation activities. More attention is increasingly being given to these secondary environmental impacts when evaluating remediation options. This paper presents a methodology for an integrated economic decision analysis which combines assessments of remediation costs, health risk costs and potential environmental costs. The health risks costs are associated with the residual contamination left at the site and its migration to groundwater used for drinking water. A probabilistic exposure model using first- and second-order reliability methods (FORM/SORM) is used to estimate the contaminant concentrations at a downstream groundwater well. Potential environmental impacts on the local, regional and global scales due to the site remediation activities are evaluated using life cycle assessments (LCA). The potential impacts on health and environment are converted to monetary units using a simplified cost model. A case study based upon the developed methodology is presented in which the following remediation scenarios are analyzed and compared: (a) no action, (b) excavation and off-site treatment of soil, (c) soil vapor extraction and (d) thermally enhanced soil vapor extraction by electrical heating of the soil. Ultimately, the developed methodology facilitates societal cost estimations of remediation scenarios which can be used for internal ranking of the analyzed options. Despite the inherent uncertainties of placing a value on health and environmental impacts, the presented methodology is believed to be valuable in supporting decisions on remedial interventions. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. EVALUATION OF THE POTENTIAL CARCINOGENICITY OF ELECTROMAGNETIC FIELDS (EXTERNAL REVIEW DRAFT)

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA or Agency) is posting on this web site a draft document related to the potential adverse human health effects resulting from exposure to electromagnetic fields (EMF). This document was never finalized after EPA activities were discon...

  16. Active site similarity between human and Plasmodium falciparum phosphodiesterases: considerations for antimalarial drug design

    NASA Astrophysics Data System (ADS)

    Howard, Brittany L.; Thompson, Philip E.; Manallack, David T.

    2011-08-01

    The similarity between Plasmodium falciparum phosphodiesterase enzymes ( PfPDEs) and their human counterparts have been examined and human PDE9A was found to be a suitable template for the construction of homology models for each of the four PfPDE isoforms. In contrast, the architecture of the active sites of each model was most similar to human PDE1. Molecular docking was able to model cyclic guanosine monophosphate (cGMP) substrate binding in each case but a docking mode supporting cyclic adenosine monophosphate (cAMP) binding could not be found. Anticipating the potential of PfPDE inhibitors as anti-malarial drugs, a range of reported PDE inhibitors including zaprinast and sildenafil were docked into the model of PfPDEα. The results were consistent with their reported biological activities, and the potential of PDE1/9 inhibitor analogues was also supported by docking.

  17. Evaluating the Substrate Selectivity of Alkyladenine DNA Glycosylase: The Synergistic Interplay of Active Site Flexibility and Water Reorganization.

    PubMed

    Lenz, Stefan A P; Wetmore, Stacey D

    2016-02-09

    Human alkyladenine DNA glycosylase (AAG) functions as part of the base excision repair (BER) pathway by cleaving the N-glycosidic bond that connects nucleobases to the sugar-phosphate backbone in DNA. AAG targets a range of structurally diverse purine lesions using nonspecific DNA-protein π-π interactions. Nevertheless, the enzyme discriminates against the natural purines and is inhibited by pyrimidine lesions. This study uses molecular dynamics simulations and seven different neutral or charged substrates, inhibitors, or canonical purines to probe how the bound nucleotide affects the conformation of the AAG active site, and the role of active site residues in dictating substrate selectivity. The neutral substrates form a common DNA-protein hydrogen bond, which results in a consistent active site conformation that maximizes π-π interactions between the aromatic residues and the nucleobase required for catalysis. Nevertheless, subtle differences in DNA-enzyme contacts for different neutral substrates explain observed differential catalytic efficiencies. In contrast, the exocyclic amino groups of the natural purines clash with active site residues, which leads to catalytically incompetent DNA-enzyme complexes due to significant reorganization of active site water. Specifically, water resides between the A nucleobase and the active site aromatic amino acids required for catalysis, while a shift in the position of the general base (E125) repositions (potentially nucleophilic) water away from G. Despite sharing common amino groups, the methyl substituents in cationic purine lesions (3MeA and 7MeG) exhibit repulsion with active site residues, which repositions the damaged bases in the active site in a manner that promotes their excision. Overall, we provide a structural explanation for the diverse yet discriminatory substrate selectivity of AAG and rationalize key kinetic data available for the enzyme. Specifically, our results highlight the complex interplay of many different DNA-protein interactions used by AAG to facilitate BER, as well as the crucial role of the general base and water (nucleophile) positioning. The insights gained from our work will aid the understanding of the function of other enzymes that use flexible active sites to exhibit diverse substrate specificity.

  18. Charge density distribution and the electrostatic moments of CTPB in the active site of p300 enzyme: a DFT and charge density study.

    PubMed

    Devipriya, B; Kumaradhas, P

    2013-10-21

    A molecular docking and charge density analysis have been carried out to understand the conformational change, charge distribution and electrostatic properties of N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-6-pentadecyl-benzamide (CTPB) in the active site of p300. The nearest neighbors, shortest intermolecular contacts between CTPB-p300 and the lowest binding energy of CTPB have been analyzed from the docking analysis. Further, a charge density analysis has been carried out for the molecule in gas phase and for the corresponding molecule lifted from the active site of p300. Due to the intermolecular interaction between CTPB and the amino acids of active site, the conformation of the CTPB has been significantly altered (particularly the pentadecyl chain). CTPB forms strong interaction with the amino acid residues Tyr1397 and Trp1436 at the distance 2.12 and 2.72Å, respectively. However, the long pentadecyl alkyl chain of CTPB produces a barrier and reducing the chance of forming hydrogen bonding with p300. The electron density ρbcp(r) of the polar bonds (C-O, C-N, C-F and C-Cl) of CTPB are increased when it present in the active site. The dipole moment of CTPB in the active site is significantly less (5.73D) when compared with the gas phase (8.16D) form. In the gas phase structure, a large region of negative electrostatic potential (ESP) is found at the vicinity of O(2) and CF3 group, which is less around the O(1) atom. Whereas, in the active site, the negative ESP around the CF3 group is decreased and increased at the O(1) and O(2)-atoms. The ESP modifications of CTPB in the active site are mainly attributed to the effect of intermolecular interaction. The gas phase and active site study insights the molecular flexibility and the electrostatic properties of CTPB in the active site. © 2013 Elsevier Ltd. All rights reserved.

  19. Alternative Nucleophilic Substrates for the Endonuclease Activities of Human Immunodeficiency Virus Type 1 Integrase

    PubMed Central

    Ealy, Julie B.; Sudol, Malgorzata; Krzeminski, Jacek; Amin, Shantu; Katzman, Michael

    2012-01-01

    Retroviral integrase can use water or some small alcohols as the attacking nucleophile to nick DNA. To characterize the range of compounds that human immunodeficiency virus type 1 integrase can accommodate for its endonuclease activities, we tested 45 potential electron donors (having varied size and number or spacing of nucleophilic groups) as substrates during site-specific nicking at viral DNA ends and during nonspecific nicking reactions. We found that integrase used 22 of the 45 compounds to nick DNA, but not all active compounds were used for both activities. In particular, 13 compounds were used for site-specific and nonspecific nicking, 5 only for site-specific nicking, and 4 only for nonspecific nicking; 23 other compounds were not used for either activity. Thus, integrase can accommodate a large number of nucleophilic substrates but has selective requirements for its different activities, underscoring its dynamic properties and providing new information for modeling and understanding integrase. PMID:22910593

  20. The allosteric site regulates the voltage sensitivity of muscarinic receptors.

    PubMed

    Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas

    2018-01-01

    Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Engineering evaluation/cost analysis for the proposed management of 15 nonprocess buildings (15 series) at the Weldon Spring Site Chemical Plant, Weldon Spring, Missouri. Environmental assessment: Weldon Spring Site Remedial Action Project, Weldon Spring, Missouri

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacDonell, M.M.; Peterson, J.M.

    1991-11-01

    The US Department of Energy, under its Surplus Facilities Management Program (SFMP), is responsible for cleanup activities at the Weldon Spring site, located near Weldon Spring, Missouri. The site consists of two noncontiguous areas: (1) a raffinate pits and chemical plant area and (2) a quarry. This engineering evaluation/cost analysis (EE/CA) report has been prepared to support a proposed removal action to manage 15 nonprocess buildings, identified as the 15 Series buildings, at the chemical plant on the Weldon Spring site. These buildings have been nonoperational for more than 20 years, and the deterioration that has occurred during this timemore » has resulted in a potential threat to site workers, the general public, and the environment. The EE/CA documentation of this proposed action is consistent with guidance from the US Environmental Protection Agency (EPA) that addresses removal actions at sites subject to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) of 1980, as amended by the Superfund Amendments and Reauthorization Act of 1986. Actions at the Weldon Spring site are subject to CERCLA requirements because the site is on the EPA`s National Priorities List. The objectives of this report are to (1) identify alternatives for management of the nonprocess buildings; (2) document the selection of response activities that will mitigate the potential threat to workers, the public, and the environment associated with these buildings; and (3) address environmental impact associated with the proposed action.« less

  2. Electrochemical generation of sulfur vacancies in the basal plane of MoS2 for hydrogen evolution

    PubMed Central

    Tsai, Charlie; Li, Hong; Park, Sangwook; Park, Joonsuk; Han, Hyun Soo; Nørskov, Jens K.; Zheng, Xiaolin; Abild-Pedersen, Frank

    2017-01-01

    Recently, sulfur (S)-vacancies created on the basal plane of 2H-molybdenum disulfide (MoS2) using argon plasma exposure exhibited higher intrinsic activity for the electrochemical hydrogen evolution reaction than the edge sites and metallic 1T-phase of MoS2 catalysts. However, a more industrially viable alternative to the argon plasma desulfurization process is needed. In this work, we introduce a scalable route towards generating S-vacancies on the MoS2 basal plane using electrochemical desulfurization. Even though sulfur atoms on the basal plane are known to be stable and inert, we find that they can be electrochemically reduced under accessible applied potentials. This can be done on various 2H-MoS2 nanostructures. By changing the applied desulfurization potential, the extent of desulfurization and the resulting activity can be varied. The resulting active sites are stable under extended desulfurization durations and show consistent HER activity. PMID:28429782

  3. Electrochemical generation of sulfur vacancies in the basal plane of MoS2 for hydrogen evolution

    DOE PAGES

    Tsai, Charlie; Li, Hong; Park, Sangwook; ...

    2017-04-21

    Recently, sulfur (S)-vacancies created on the basal plane of 2H-molybdenum disulfide (MoS 2) using argon plasma exposure exhibited higher intrinsic activity for the electrochemical hydrogen evolution reaction than the edge sites and metallic 1T-phase of MoS 2 catalysts. But, a more industrially viable alternative to the argon plasma desulfurization process is needed. In this work, we introduce a scalable route towards generating S-vacancies on the MoS 2 basal plane using electrochemical desulfurization. We found that they can be electrochemically reduced under accessible applied potentials, even though sulfur atoms on the basal plane are known to be stable and inert. Thismore » can be done on various 2H-MoS 2 nanostructures. Furthermore, by changing the applied desulfurization potential, the extent of desulfurization and the resulting activity can be varied. The resulting active sites are stable under extended desulfurization durations and show consistent HER activity.« less

  4. Highly uniform and monodisperse carbon nanospheres enriched with cobalt-nitrogen active sites as a potential oxygen reduction electrocatalyst

    NASA Astrophysics Data System (ADS)

    Wan, Xing; Wang, Hongjuan; Yu, Hao; Peng, Feng

    2017-04-01

    Uniform cobalt and nitrogen co-doped carbon nanospheres (CoN-CNS) with high specific surface area (865 m2 g-1) have been prepared by a simple but efficient method. The prepared CoN-CNS catalyst exhibits outstanding catalytic performance for the oxygen reduction reaction (ORR) in both alkaline and acidic electrolytes. In alkaline electrolyte, the prepared CoN-CNS has more positive half-wave potential and larger kinetic current density than commercial Pt/C. In acidic electrolyte, CoN-CNS also shows good ORR activity with high electron transfer number, its onset and half-wave potentials are all close to those of commercial carbon supported platinum catalyst (Pt/C). CoN-CNS catalyst shows more superior stability and higher methanol-tolerance than commercial Pt/C both in alkaline and in acidic electrolytes. The potassium thiocyanate-poisoning test further confirms that the cobalt-nitrogen active sites exist in CoN-CNS, which are dominating to endow high ORR catalytic activity in acidic electrolyte. This study develops a new method to prepare non-precious metal catalyst with excellent ORR performances for direct methanol fuel cells.

  5. Monitoring tobacco brand websites to understand marketing strategies aimed at tobacco product users and potential users.

    PubMed

    Escobedo, Patricia; Cruz, Tess Boley; Tsai, Kai-Ya; Allem, Jon-Patrick; Soto, Daniel W; Kirkpatrick, Matthew G; Pattarroyo, Monica; Unger, Jennifer B

    2017-09-11

    Limited information exists about strategies and methods used on brand marketing websites to transmit pro-tobacco messages to tobacco users and potential users. This study compared age verification methods, themes, interactive activities and links to social media across tobacco brand websites. This study examined 12 tobacco brand websites representing four tobacco product categories: cigarettes, cigar/cigarillos, smokeless tobacco, and e-cigarettes. Website content was analyzed by tobacco product category and data from all website visits (n = 699) were analyzed. Adult smokers (n=32) coded websites during a one-year period, indicating whether or not they observed any of 53 marketing themes, seven interactive activities, or five external links to social media sites. Most (58%) websites required online registration before entering, however e-cigarette websites used click-through age verification. Compared to cigarette sites, cigar/cigarillo sites were more likely to feature themes related to "party" lifestyle, and e-cigarette websites were much more likely to feature themes related to harm reduction. Cigarette sites featured greater levels of interactive content compared to other tobacco products. Compared to cigarette sites, cigar/cigarillo sites were more likely to feature activities related to events and music. Compared to cigarette sites, both cigar and e-cigarette sites were more likely to direct visitors to external social media sites. Marketing methods and strategies normalize tobacco use by providing website visitors with positive themes combined with interactive content, and is an area of future research. Moreover, all tobacco products under federal regulatory authority should be required to use more stringent age verification gates. Findings indicate the Food and Drug Administration (FDA) should require brand websites of all tobacco products under its regulatory authority use more stringent age verification gates by requiring all visitors be at least 18 years of age and register online prior to entry. This is important given that marketing strategies may encourage experimentation with tobacco or deter quit attempts among website visitors. Future research should examine the use of interactive activities and social media on a wide variety of tobacco brand websites as interactive content is associated with more active information processing. © The Author 2017. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Microbial transformations of arsenic: Mobilization from glauconitic sediments to water

    USGS Publications Warehouse

    Mumford, Adam C.; Barringer, Julia L.; Benzel, William M.; Reilly, Pamela A.; Young, L.Y.

    2012-01-01

    In the Inner Coastal Plain of New Jersey, arsenic (As) is released from glauconitic sediment to carbon- and nutrient-rich shallow groundwater. This As-rich groundwater discharges to a major area stream. We hypothesize that microbes play an active role in the mobilization of As from glauconitic subsurface sediments into groundwater in the Inner Coastal Plain of New Jersey. We have examined the potential impact of microbial activity on the mobilization of arsenic from subsurface sediments into the groundwater at a site on Crosswicks Creek in southern New Jersey. The As contents of sediments 33–90 cm below the streambed were found to range from 15 to 26.4 mg/kg, with siderite forming at depth. Groundwater beneath the streambed contains As at concentrations up to 89 μg/L. Microcosms developed from site sediments released 23 μg/L of As, and active microbial reduction of As(V) was observed in microcosms developed from site groundwater. DNA extracted from site sediments was amplified with primers for the 16S rRNA gene and the arsenate respiratory reductase gene, arrA, and indicated the presence of a diverse anaerobic microbial community, as well as the presence of potential arsenic-reducing bacteria. In addition, high iron (Fe) concentrations in groundwater and the presence of iron-reducing microbial genera suggests that Fe reduction in minerals may provide an additional mechanism for release of associated As, while arsenic-reducing microorganisms may serve to enhance the mobility of As in groundwater at this site.

  7. Double layer zinc-UDP coordination polymers: structure and properties.

    PubMed

    Qiu, Qi-Ming; Gu, Leilei; Ma, Hongwei; Yan, Li; Liu, Minghua; Li, Hui

    2018-05-17

    A homochiral Zn-UDP coordination polymer with an alternating parallel ABAB sequence was constructed and studied by X-ray single crystal diffraction analysis. Its crystal structure shows that there are potentially open sites in the 2D layers. The activation of the sites makes the coordination polymer a fluorescent sensor for novel heterogeneous detection of amino acids.

  8. Online Social Networks as Formal Learning Environments: Learner Experiences and Activities

    ERIC Educational Resources Information Center

    Veletsianos, George; Navarrete, Cesar C.

    2012-01-01

    While the potential of social networking sites to contribute to educational endeavors is highlighted by researchers and practitioners alike, empirical evidence on the use of such sites for formal online learning is scant. To fill this gap in the literature, we present a case study of learners' perspectives and experiences in an online course…

  9. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Improving the neutral phytase activity from Bacillus amyloliquefaciens DSM 1061 by site-directed mutagenesis.

    PubMed

    Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua

    2015-03-01

    Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed.

  11. Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris

    PubMed Central

    Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

    1999-01-01

    The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI→LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10−4 cm s−1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

  12. Reduction Potentials of [FeFe]-Hydrogenase Accessory Iron-Sulfur Clusters Provide Insights into the Energetics of Proton Reduction Catalysis.

    PubMed

    Artz, Jacob H; Mulder, David W; Ratzloff, Michael W; Lubner, Carolyn E; Zadvornyy, Oleg A; LeVan, Axl X; Williams, S Garrett; Adams, Michael W W; Jones, Anne K; King, Paul W; Peters, John W

    2017-07-19

    An [FeFe]-hydrogenase from Clostridium pasteurianum, CpI, is a model system for biological H 2 activation. In addition to the catalytic H-cluster, CpI contains four accessory iron-sulfur [FeS] clusters in a branched series that transfer electrons to and from the active site. In this work, potentiometric titrations have been employed in combination with electron paramagnetic resonance (EPR) spectroscopy at defined electrochemical potentials to gain insights into the role of the accessory clusters in catalysis. EPR spectra collected over a range of potentials were deconvoluted into individual components attributable to the accessory [FeS] clusters and the active site H-cluster, and reduction potentials for each cluster were determined. The data suggest a large degree of magnetic coupling between the clusters. The distal [4Fe-4S] cluster is shown to have a lower reduction potential (∼ < -450 mV) than the other clusters, and molecular docking experiments indicate that the physiological electron donor, ferredoxin (Fd), most favorably interacts with this cluster. The low reduction potential of the distal [4Fe-4S] cluster thermodynamically restricts the Fd ox /Fd red ratio at which CpI can operate, consistent with the role of CpI in recycling Fd red that accumulates during fermentation. Subsequent electron transfer through the additional accessory [FeS] clusters to the H-cluster is thermodynamically favorable.

  13. Using mass spectrometry to study the photo-affinity labeling of protein tyrosine phosphatase 1B

    NASA Astrophysics Data System (ADS)

    Leriche, Tammy; Skorey, Kathryn; Roy, Patrick; McKay, Dan; Bateman, Kevin P.

    2004-11-01

    Protein tyrosine phosphatase 1B (PTP1B) is a potential target for the treatment of Type II diabetes and several companies are developing small molecule inhibitors of this enzyme. Part of the characterization of these compounds as PTP1B inhibitors is the understanding of how they bind in the enzyme active site. The use of photo-activated inhibitors that target the active site can provide such insight. This paper describes the characterization of a photoprobe directed at the active site of PTP1B. Mass spectrometry revealed the specific binding of the probe to the intact protein. Digestion of the labeled protein followed by LC-MS and LC-MS/MS was used to show that the photoprobe binds to a specific active site amino acid. This was confirmed by comparison with the X-ray structure of PTP1B with a PTP1B inhibitor. The probe labels a conserved acidic residue (Asp) that is required for catalytic activity. This photoprobe may prove to be a useful tool for the development of a PTP1B inhibitor or for the study of PTPs in general.

  14. Sediment Contaminants and Infauna Associated with Recreational Boating Structures in a Multi-Use Marine Park.

    PubMed

    Sim, Vivian X Y; Dafforn, Katherine A; Simpson, Stuart L; Kelaher, Brendan P; Johnston, Emma L

    2015-01-01

    Multi-use marine parks achieve conservation through spatial management of activities. Zoning of marine parks in New South Wales, Australia, includes high conservation areas and special purpose zones (SPZ) where maritime activities are concentrated. Although such measures geographically constrain anthropogenic impacts, we have limited understanding of potential ecological effects. We assessed sediment communities and contaminants adjacent to boating infrastructure (boat ramps, jetties and a marina) in a SPZ from the Clyde Estuary in Batemans Marine Park. Metal concentrations and fines content were elevated at boating structures compared to reference sites. Species richness was higher at sites with boating structures, where capitellid polychaetes and nematodes dominated the communities. Changes associated with boating structures were localised and did not extend beyond breakwalls or to reference sites outside the SPZ. The study highlights the benefits of appropriate zoning in a multi-use marine park and the potential to minimise stress on pristine areas through the application of spatial management.

  15. Sediment Contaminants and Infauna Associated with Recreational Boating Structures in a Multi-Use Marine Park

    PubMed Central

    Sim, Vivian X. Y.; Dafforn, Katherine A.; Simpson, Stuart L.; Kelaher, Brendan P.; Johnston, Emma L.

    2015-01-01

    Multi-use marine parks achieve conservation through spatial management of activities. Zoning of marine parks in New South Wales, Australia, includes high conservation areas and special purpose zones (SPZ) where maritime activities are concentrated. Although such measures geographically constrain anthropogenic impacts, we have limited understanding of potential ecological effects. We assessed sediment communities and contaminants adjacent to boating infrastructure (boat ramps, jetties and a marina) in a SPZ from the Clyde Estuary in Batemans Marine Park. Metal concentrations and fines content were elevated at boating structures compared to reference sites. Species richness was higher at sites with boating structures, where capitellid polychaetes and nematodes dominated the communities. Changes associated with boating structures were localised and did not extend beyond breakwalls or to reference sites outside the SPZ. The study highlights the benefits of appropriate zoning in a multi-use marine park and the potential to minimise stress on pristine areas through the application of spatial management. PMID:26086427

  16. Oxygen reduction reaction activity and structural stability of Pt-Au nanoparticles prepared by arc-plasma deposition.

    PubMed

    Takahashi, Shuntaro; Chiba, Hiroshi; Kato, Takashi; Endo, Shota; Hayashi, Takehiro; Todoroki, Naoto; Wadayama, Toshimasa

    2015-07-28

    The oxygen reduction reaction (ORR) activity and durability of various Au(x)/Pt100 nanoparticles (where x is the atomic ratio of Au against Pt) are evaluated herein. The samples were fabricated on a highly-oriented pyrolytic graphite substrate at 773 K through sequential arc-plasma depositions of Pt and Au. The electrochemical hydrogen adsorption charges (electrochemical surface area), particularly the characteristic currents caused by the corner and edge sites of the Pt nanoparticles, decrease with increasing Au atomic ratio (x). In contrast, the specific ORR activities of the Au(x)/Pt100 samples were dependent on the atomic ratios of Pt and Au: the Au28/Pt100 sample showed the highest specific activity among all the investigated samples (x = 0-42). As for ORR durability evaluated by applying potential cycles between 0.6 and 1.0 V in oxygen-saturated 0.1 M HClO4, Au28/Pt100 was the most durable sample against the electrochemical potential cycles. The results clearly showed that the Au atoms located at coordinatively-unsaturated sites, e.g. at the corners or edges of the Pt nanoparticles, can improve the ORR durability by suppressing unsaturated-site-induced degradation of the Pt nanoparticles.

  17. Use of enzymatic tools for biomonitoring inorganic pollution in aquatic sediments: a case study (Bor, Serbia)

    PubMed Central

    2013-01-01

    Background Sediment bacterial communities are key players in biogeochemical cycling of elements in the aquatic environment. Copper mining, smelting, and processing operations located in Bor area (Serbia) are major environmental hot spots in the lower Danube Basin and Western Balkans. In the present study, we evaluate the influence of trace element (TE) concentration in sediments and physico-chemical properties of water on sediment microbial communities in water streams adjacent to the Copper Smelter Complex Bor (RTB Bor, Serbia). The degree to which metabolic activities of bacterial biota inhabiting differently polluted sites is inhibited by inorganic pollution were compared using selected enzymatic bioindicators. Results Cu, Zn, Pb, and As concentrations systematically exceeded the target values for metal loadings in aquatic sediments. Water electrical conductivity (WEC) followed the same pattern of spatial variation, irrespective of season. Interestingly, the most intense enzymatic activity occurred at the reference site although this site showed the greatest TE levels in aquatic sediments. Catalase activity (CA), potential dehydrogenase activity (PDA), actual dehydrogenase activity (ADA), urease activity (UA), and phosphatase activity (PA) in aquatic sediments displayed heterogeneous patterns of spatio-temporal variation. Inorganic pollution greatly affected CA, ADA, and PDA, but much less so UA and PA. Canonical correlation analysis showed that pH and WEC were the strongest determinants of enzymatic activity in bacterial biota, with the latter variable being reversely correlated with the enzymatic indicator of sediment quality (EISQ). The median values of EISQ increased with distance from the major sources of pollution. In addition, it was found that sites with different degrees of inorganic pollution can be appropriately classified by applying cluster analysis to EISQ, TE levels in sediments, and physico-chemical properties of water. Conclusions Because EISQ can precisely identify changes in overall enzymatic activity of sediment bacterial communities, this enzymatic bioindicator has a great potential for biomonitoring the current status of inorganic pollution in aquatic ecosystems. PMID:23536970

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Daniel P.; Tymińska, Nina; Zurek, Eva, E-mail: ezurek@buffalo.edu

    Dispersion corrected Density Functional Theory calculations were employed to study the adsorption of benzenes derivatized with functional groups encompassing a large region of the activated/deactivated spectrum to the Ag(111) surface. Benzenes substituted with weak activating or deactivating groups, such as methyl and fluoro, do not have a strong preference for adsorbing to a particular site on the substrate, with the corrugations in the potential energy surface being similar to those of benzene. Strong activating (N(CH{sub 3}){sub 2}) and deactivating (NO{sub 2}) groups, on the other hand, possess a distinct site preference. The nitrogen in the former prefers to lie abovemore » a silver atom (top site), but in the latter a hollow hexagonal-closed-packed (H{sub hcp}) site of the Ag(111) surface is favored instead. Benzenes derivatized with classic activating groups donate electron density from their highest occupied molecular orbital to the surface, and those functionalized with deactivating groups withdraw electron density from the surface into orbitals that are unoccupied in the gas phase. For benzenes functionalized with two substituents, the groups that are strongly activating or deactivating control the site preference and the other groups assume sites that are, to a large degree, dictated by their positions on the benzene ring. The relative stabilities of the ortho, meta, and para positional isomers of disubstituted benzenes can, in some cases, be modified by adsorption to the surface.« less

  19. The N Domain of Human Angiotensin-I-converting Enzyme

    PubMed Central

    Anthony, Colin S.; Corradi, Hazel R.; Schwager, Sylva L. U.; Redelinghuys, Pierre; Georgiadis, Dimitris; Dive, Vincent; Acharya, K. Ravi; Sturrock, Edward D.

    2010-01-01

    Angiotensin-I-converting enzyme (ACE) plays a critical role in the regulation of blood pressure through its central role in the renin-angiotensin and kallikrein-kinin systems. ACE contains two domains, the N and C domains, both of which are heavily glycosylated. Structural studies of ACE have been fraught with severe difficulties because of surface glycosylation of the protein. In order to investigate the role of glycosylation in the N domain and to create suitable forms for crystallization, we have investigated the importance of the 10 potential N-linked glycan sites using enzymatic deglycosylation, limited proteolysis, and mass spectrometry. A number of glycosylation mutants were generated via site-directed mutagenesis, expressed in CHO cells, and analyzed for enzymatic activity and thermal stability. At least eight of 10 of the potential glycan sites are glycosylated; three C-terminal sites were sufficient for expression of active N domain, whereas two N-terminal sites are important for its thermal stability. The minimally glycosylated Ndom389 construct was highly suitable for crystallization studies. The structure in the presence of an N domain-selective phosphinic inhibitor RXP407 was determined to 2.0 Å resolution. The Ndom389 structure revealed a hinge region that may contribute to the breathing motion proposed for substrate binding. PMID:20826823

  20. Tests and refinements of a general structure-activity model for avian repellents.

    PubMed

    Clark, L; Shah, P

    1994-02-01

    We tested the robustness of a structure-activity model for avian trigeminal chemoirritants. Fourteen benzoates and acetophenones were tested using European starlingsSturnus vulgaris as a bioassay. In general, the previously proposed model was a reasonable predictor of repellency (i.e., irritant potency). We found that the presence of a phenyl ring was critical to repellency. Basicity of the molecule is the next most critical feature influencing repellency. The presence of an acidic function within the electron-withdrawing functionality seriously detracts from repellency. The presence or absence of an electron-withdrawing or -donating group may potentiate repellent effects, but its presence is not critical, so long as the phenyl ring is electron rich. Our data suggest that there is ano-aminoacetophenone/methyl anthranilate trigeminal chemoreceptor in birds analogous to the mammalian capsaicin receptor. Both receptors contain a benzene site. However, birds seem to lack the associated thiol/hydrogen-bonding site present in mammals which is needed to activate the benzene site. Rather, birds may possess an associated exposed charged site that in turn may interact with the stimulus to activate the benzene site. These differences may explain the differential sensitivity of birds and mammals to aromatic irritants.

  1. Martian Magmatic-Driven Hydrothermal Sites: Potential Sources of Energy, Water, and Life

    NASA Technical Reports Server (NTRS)

    Anderson, R. C.; Dohm, J. M.; Baker, V. R.; Ferris, J. C.; Hare, T. M.; Tanaka, K. L.; Klemaszewski, J. E.; Skinner, J. A.; Scott, D. H.

    2000-01-01

    Magmatic-driven processes and impact events dominate the geologic record of Mars. Such recorded geologic activity coupled with significant evidence of past and present-day water/ice, above and below the martian surface, indicate that hydrothermal environments certainly existed in the past and may exist today. The identification of such environments, especially long-lived magmatic-driven hydrothermal environments, provides NASA with significant target sites for future sample return missions, since they (1) could favor the development and sustenance of life, (2) may comprise a large variety of exotic mineral assemblages, and (3) could potentially contain water/ice reservoirs for future Mars-related human activities. If life developed on Mars, the fossil record would presumably be at its greatest concentration and diversity in environments where long-term energy sources and water coexisted such as at sites where long-lived, magmatic-driven hydrothermal activity occurred. These assertions are supported by terrestrial analogs. Small, single-celled creatures (prokaryotes) are vitally important in the evolution of the Earth; these prokaryotes are environmentally tough and tolerant of environmental extremes of pH, temperature, salinity, and anoxic conditions found around hydrothermal vents. In addition, there is a great ability for bacteria to survive long periods of geologic time in extreme conditions, including high temperature hydrogen sulfide and sulfur erupted from Mount St. Helens volcano. Our team of investigators is conducting a geological investigation using multiple mission-derived datasets (e.g., existing geologic map data, MOC imagery, MOLA, TES image data, geophysical data, etc.) to identify prime target sites of hydrothermal activity for future hydrological, mineralogical, and biological investigations. The identification of these sites will enhance the probability of success for future missions to Mars.

  2. Visualization of liposomes carrying fibrinogen gamma-chain dodecapeptide accumulated to sites of vascular injury using computed tomography.

    PubMed

    Okamura, Yosuke; Eto, Kaoruko; Maruyama, Hitomi; Handa, Makoto; Ikeda, Yasuo; Takeoka, Shinji

    2010-04-01

    We have constructed liposomes with hemostatic activity as a platelet substitute using moderately thrombocytopenic rats. The liposomes were conjugated with the dodecapeptide (HHLGGAKQAGDV: H12), which is a fibrinogen gamma-chain C-terminal sequence (gamma 400-411). To visualize liposome accumulation at the site of vascular injury by in vivo computed tomography, a water-soluble contrast dye, N,N'-bis[2-hydroxy-1-(hydroxylmethyl)ethyl]-5-[(2S)-2-hydroxylpropanoylamino]-2,4,6-triiodoisophthalamide (iopamidol), was encapsulated into the H12-conjugated liposomes. We achieved direct visualization of specific accumulation of the H12-(iopamidol)liposomes at the jugular vein injured by ferric chloride and succeeded in semiquantitative analyses of the accumulated amount of H12-liposomes in the injured site. We therefore propose that H12-liposomes that are specifically recruited to, and exert their hemostatic activity at the site of vascular injury, have a significant potential as a carrier and/or as an ideal platelet substitute. Furthermore, the H12-(iopamidol)liposomes would also be clinically useful as diagnostic agents for pathological thrombus detection and as contrast dyes for hepatosplenography. The authors have constructed liposomes with hemostatic activity as a platelet substitute using moderately thrombocytopenic rats. They propose that H12-liposomes that are specifically recruited to, and exert their hemostatic activity at the site of vascular injury, have a significant potential as a carrier and/or as an ideal platelet substitute. Furthermore, the H12-(iopamidol) liposomes would also be clinically useful as diagnostic agents for thrombus detection and as contrast dyes for hepatosplenography. Copyright 2010 Elsevier Inc. All rights reserved.

  3. Spectroscopic evidence for an engineered, catalytically active Trp radical that creates the unique reactivity of lignin peroxidase.

    PubMed

    Smith, Andrew T; Doyle, Wendy A; Dorlet, Pierre; Ivancich, Anabella

    2009-09-22

    The surface oxidation site (Trp-171) in lignin peroxidase (LiP) required for the reaction with veratryl alcohol a high-redox-potential (1.4 V) substrate, was engineered into Coprinus cinereus peroxidase (CiP) by introducing a Trp residue into a heme peroxidase that has similar protein fold but lacks this activity. To create the catalytic activity toward veratryl alcohol in CiP, it was necessary to reproduce the Trp site and its negatively charged microenvironment by means of a triple mutation. The resulting D179W+R258E+R272D variant was characterized by multifrequency EPR spectroscopy. The spectra unequivocally showed that a new Trp radical [g values of g(x) = 2.0035(5), g(y) = 2.0027(5), and g(z) = 2.0022(1)] was formed after the [Fe(IV)=O Por(*+)] intermediate, as a result of intramolecular electron transfer between Trp-179 and the porphyrin. Also, the EPR characterization crucially showed that [Fe(IV)=O Trp-179(*)] was the reactive intermediate with veratryl alcohol. Accordingly, our work shows that it is necessary to take into account the physicochemical properties of the radical, fine-tuned by the microenvironment, as well as those of the preceding [Fe(IV)=O Por(*+)] intermediate to engineer a catalytically competent Trp site for a given substrate. Manipulation of the microenvironment of the Trp-171 site in LiP allowed the detection by EPR spectroscopy of the Trp-171(*), for which direct evidence has been missing so far. Our work also highlights the role of Trp residues as tunable redox-active cofactors for enzyme catalysis in the context of peroxidases with a unique reactivity toward recalcitrant substrates that require oxidation potentials not realized at the heme site.

  4. A comprehensive search for calcium binding sites critical for TMEM16A calcium-activated chloride channel activity

    PubMed Central

    Tien, Jason; Peters, Christian J; Wong, Xiu Ming; Cheng, Tong; Jan, Yuh Nung; Jan, Lily Yeh; Yang, Huanghe

    2014-01-01

    TMEM16A forms calcium-activated chloride channels (CaCCs) that regulate physiological processes such as the secretions of airway epithelia and exocrine glands, the contraction of smooth muscles, and the excitability of neurons. Notwithstanding intense interest in the mechanism behind TMEM16A-CaCC calcium-dependent gating, comprehensive surveys to identify and characterize potential calcium sensors of this channel are still lacking. By aligning distantly related calcium-activated ion channels in the TMEM16 family and conducting systematic mutagenesis of all conserved acidic residues thought to be exposed to the cytoplasm, we identify four acidic amino acids as putative calcium-binding residues. Alterations of the charge, polarity, and size of amino acid side chains at these sites alter the ability of different divalent cations to activate the channel. Furthermore, TMEM16A mutant channels containing double cysteine substitutions at these residues are sensitive to the redox potential of the internal solution, providing evidence for their physical proximity and solvent accessibility. DOI: http://dx.doi.org/10.7554/eLife.02772.001 PMID:24980701

  5. Flavonol Activation Defines an Unanticipated Ligand-Binding Site in the Kinase-RNase Domain of IRE1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiseman, R. Luke; Zhang, Yuhong; Lee, Kenneth P.K.

    2010-08-18

    Signaling in the most conserved branch of the endoplasmic reticulum (ER) unfolded protein response (UPR) is initiated by sequence-specific cleavage of the HAC1/XBP1 mRNA by the ER stress-induced kinase-endonuclease IRE1. We have discovered that the flavonol quercetin activates yeast IRE1's RNase and potentiates activation by ADP, a natural activating ligand that engages the IRE1 nucleotide-binding cleft. Enzyme kinetics and the structure of a cocrystal of IRE1 complexed with ADP and quercetin reveal engagement by quercetin of an unanticipated ligand-binding pocket at the dimer interface of IRE1's kinase extension nuclease (KEN) domain. Analytical ultracentrifugation and crosslinking studies support the preeminence ofmore » enhanced dimer formation in quercetin's mechanism of action. These findings hint at the existence of endogenous cytoplasmic ligands that may function alongside stress signals from the ER lumen to modulate IRE1 activity and at the potential for the development of drugs that modify UPR signaling from this unanticipated site.« less

  6. Using virtual robot-mediated play activities to assess cognitive skills.

    PubMed

    Encarnação, Pedro; Alvarez, Liliana; Rios, Adriana; Maya, Catarina; Adams, Kim; Cook, Al

    2014-05-01

    To evaluate the feasibility of using virtual robot-mediated play activities to assess cognitive skills. Children with and without disabilities utilized both a physical robot and a matching virtual robot to perform the same play activities. The activities were designed such that successfully performing them is an indication of understanding of the underlying cognitive skills. Participants' performance with both robots was similar when evaluated by the success rates in each of the activities. Session video analysis encompassing participants' behavioral, interaction and communication aspects revealed differences in sustained attention, visuospatial and temporal perception, and self-regulation, favoring the virtual robot. The study shows that virtual robots are a viable alternative to the use of physical robots for assessing children's cognitive skills, with the potential of overcoming limitations of physical robots such as cost, reliability and the need for on-site technical support. Virtual robots can provide a vehicle for children to demonstrate cognitive understanding. Virtual and physical robots can be used as augmentative manipulation tools allowing children with disabilities to actively participate in play, educational and therapeutic activities. Virtual robots have the potential of overcoming limitations of physical robots such as cost, reliability and the need for on-site technical support.

  7. Noninvasive reconstruction of the three-dimensional ventricular activation sequence during pacing and ventricular tachycardia in the canine heart.

    PubMed

    Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin

    2012-01-01

    Single-beat imaging of myocardial activation promises to aid in both cardiovascular research and clinical medicine. In the present study we validate a three-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of simultaneous 3D intracardiac mapping to assess its capability to localize endocardial and epicardial initiation sites and image global activation sequences during pacing and ventricular tachycardia (VT) in the canine heart. Body surface potentials were measured simultaneously with bipolar electrical recordings in a closed-chest condition in healthy canines. Computed tomography images were obtained after the mapping study to construct realistic geometry models. Data analysis was performed on paced rhythms and VTs induced by norepinephrine (NE). The noninvasively reconstructed activation sequence was in good agreement with the simultaneous measurements from 3D cardiac mapping with a correlation coefficient of 0.74 ± 0.06, a relative error of 0.29 ± 0.05, and a root mean square error of 9 ± 3 ms averaged over 460 paced beats and 96 ectopic beats including premature ventricular complexes, couplets, and nonsustained monomorphic VTs and polymorphic VTs. Endocardial and epicardial origins of paced beats were successfully predicted in 72% and 86% of cases, respectively, during left ventricular pacing. The NE-induced ectopic beats initiated in the subendocardium by a focal mechanism. Sites of initial activation were estimated to be ∼7 mm from the measured initiation sites for both the paced beats and ectopic beats. For the polymorphic VTs, beat-to-beat dynamic shifts of initiation site and activation pattern were characterized by the reconstruction. The present results suggest that 3DCEI can noninvasively image the 3D activation sequence and localize the origin of activation of paced beats and NE-induced VTs in the canine heart with good accuracy. This 3DCEI technique offers the potential to aid interventional therapeutic procedures for treating ventricular arrhythmias arising from epicardial or endocardial sites and to noninvasively assess the mechanisms of these arrhythmias.

  8. Noninvasive reconstruction of the three-dimensional ventricular activation sequence during pacing and ventricular tachycardia in the canine heart

    PubMed Central

    Han, Chengzong; Pogwizd, Steven M.; Killingsworth, Cheryl R.

    2012-01-01

    Single-beat imaging of myocardial activation promises to aid in both cardiovascular research and clinical medicine. In the present study we validate a three-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of simultaneous 3D intracardiac mapping to assess its capability to localize endocardial and epicardial initiation sites and image global activation sequences during pacing and ventricular tachycardia (VT) in the canine heart. Body surface potentials were measured simultaneously with bipolar electrical recordings in a closed-chest condition in healthy canines. Computed tomography images were obtained after the mapping study to construct realistic geometry models. Data analysis was performed on paced rhythms and VTs induced by norepinephrine (NE). The noninvasively reconstructed activation sequence was in good agreement with the simultaneous measurements from 3D cardiac mapping with a correlation coefficient of 0.74 ± 0.06, a relative error of 0.29 ± 0.05, and a root mean square error of 9 ± 3 ms averaged over 460 paced beats and 96 ectopic beats including premature ventricular complexes, couplets, and nonsustained monomorphic VTs and polymorphic VTs. Endocardial and epicardial origins of paced beats were successfully predicted in 72% and 86% of cases, respectively, during left ventricular pacing. The NE-induced ectopic beats initiated in the subendocardium by a focal mechanism. Sites of initial activation were estimated to be ∼7 mm from the measured initiation sites for both the paced beats and ectopic beats. For the polymorphic VTs, beat-to-beat dynamic shifts of initiation site and activation pattern were characterized by the reconstruction. The present results suggest that 3DCEI can noninvasively image the 3D activation sequence and localize the origin of activation of paced beats and NE-induced VTs in the canine heart with good accuracy. This 3DCEI technique offers the potential to aid interventional therapeutic procedures for treating ventricular arrhythmias arising from epicardial or endocardial sites and to noninvasively assess the mechanisms of these arrhythmias. PMID:21984548

  9. Ultrafast infrared spectroscopy reveals water-mediated coherent dynamics in an enzyme active site.

    PubMed

    Adamczyk, Katrin; Simpson, Niall; Greetham, Gregory M; Gumiero, Andrea; Walsh, Martin A; Towrie, Michael; Parker, Anthony W; Hunt, Neil T

    2015-01-01

    Understanding the impact of fast dynamics upon the chemical processes occurring within the active sites of proteins and enzymes is a key challenge that continues to attract significant interest, though direct experimental insight in the solution phase remains sparse. Similar gaps in our knowledge exist in understanding the role played by water, either as a solvent or as a structural/dynamic component of the active site. In order to investigate further the potential biological roles of water, we have employed ultrafast multidimensional infrared spectroscopy experiments that directly probe the structural and vibrational dynamics of NO bound to the ferric haem of the catalase enzyme from Corynebacterium glutamicum in both H 2 O and D 2 O. Despite catalases having what is believed to be a solvent-inaccessible active site, an isotopic dependence of the spectral diffusion and vibrational lifetime parameters of the NO stretching vibration are observed, indicating that water molecules interact directly with the haem ligand. Furthermore, IR pump-probe data feature oscillations originating from the preparation of a coherent superposition of low-frequency vibrational modes in the active site of catalase that are coupled to the haem ligand stretching vibration. Comparisons with an exemplar of the closely-related peroxidase enzyme family shows that they too exhibit solvent-dependent active-site dynamics, supporting the presence of interactions between the haem ligand and water molecules in the active sites of both catalases and peroxidases that may be linked to proton transfer events leading to the formation of the ferryl intermediate Compound I. In addition, a strong, water-mediated, hydrogen bonding structure is suggested to occur in catalase that is not replicated in peroxidase; an observation that may shed light on the origins of the different functions of the two enzymes.

  10. SABER: a computational method for identifying active sites for new reactions.

    PubMed

    Nosrati, Geoffrey R; Houk, K N

    2012-05-01

    A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644-1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were L-Ala D/L-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. Copyright © 2012 The Protein Society.

  11. Physico-chemical studies of the experimental and theoretical properties of organic nonlinear optical material 4-chloro-4'methoxy benzylideneaniline

    NASA Astrophysics Data System (ADS)

    George, Merin; John, Nimmy L.; Saravana Kumar, M.; Subashini, A.; Sajan, D.

    2017-01-01

    The FT-IR, FT-Raman and UV-visible spectral analysis of 4-chloro 4'-methoxy benzylidene aniline were done experimentally and interpreted with the aid of normal coordinate analysis based on density functional theory (DFT) at the B3LYP/6-311++G (d, p) level of theory. Natural Bond orbital analysis was performed to understand the charge transfer interactions and reactive sites within the system. HOMO-LUMO analysis and first static and dynamic hyperpolarizability calculations were carried out in order to confirm the NLO activity of CMOBA. Photophysical characterization was done to understand the fluorescence emission and lifetime of CMOBA leading to application in blue OLEDs. The Molecular Electrostatic Potential Map was simulated to identify the active sites for electrophilic and nucleophilic attack or the active sites of the molecule which can bind to proteins. Molecular docking analysis revealed its potential as an inhibitor for different proteins which are responsible for cancer and many inflammatory diseases such as rheumatoid arthritis, inflammatory bowel disease, Crohn's disease and psoriasis. Experimental studies of invitro antiproliferative effect by MTT assay verified the anticancer properties of CMOBA.

  12. Development of SH2 probes and pull-down assays to detect pathogen-induced, site-specific tyrosine phosphorylation of the TLR adaptor SCIMP.

    PubMed

    Luo, Lin; Tong, Samuel J; Wall, Adam A; Khromykh, Tatiana; Sweet, Matthew J; Stow, Jennifer L

    2017-07-01

    Protein tyrosine phosphorylation guides many molecular interactions for cellular functions. SCIMP is a transmembrane adaptor protein (TRAP) family member that mediates selective proinflammatory cytokine responses generated by pathogen-activated Toll-like receptor (TLR) pathways in macrophages. TLR activation triggers SCIMP phosphorylation and selective phosphorylation of distinct tyrosine residues on this adaptor offers the potential for regulating or biasing inflammatory responses. To analyze site-specific phosphorylation events, we developed three probes based on the SH2 domains of known SCIMP effectors, and used them for pull-downs from macrophage extracts. CRISPR-mediated SCIMP-deficient RAW264.7 macrophage-like cells were reconstituted with various phosphorylation-deficient (Y58F, Y96F, Y120F) SCIMPs, and used to demonstrate the specificity of LPS/TLR4-induced, site-specific phosphorylation of SCIMP for the temporal recruitment of the effectors Grb2, Csk and SLP65. Our findings reveal potential for differential SCIMP phosphorylation and specific effectors to influence TLR signaling and inflammatory programs. Furthermore, the use of Csk-SH2 pull-downs to identify additional known and new Csk targets in LPS-activated macrophages reveals the wider utility of our SH2 probes.

  13. A data mining approach to predict in situ chlorinated ethene detoxification potential

    NASA Astrophysics Data System (ADS)

    Lee, J.; Im, J.; Kim, U.; Loeffler, F. E.

    2015-12-01

    Despite major advances in physicochemical remediation technologies, in situ biostimulation and bioaugmentation treatment aimed at stimulating Dehalococcoides mccartyi (Dhc) reductive dechlorination activity remains a cornerstone approach to remedy sites impacted with chlorinated ethenes. In practice, selecting the best remedial strategy is challenging due to uncertainties associated with the microbiology (e.g., presence and activity of Dhc) and geochemical factors influencing Dhc activity. Extensive groundwater datasets collected over decades of monitoring exist, but have not been systematically analyzed. In the present study, geochemical and microbial data sets collected from 35 wells at 5 contaminated sites were used to develop a predictive empirical model using a machine learning algorithm (i) to rank the relative importance of parameters that affect in situ reductive dechlorination potential, and (ii) to provide recommendations for selecting the optimal remediation strategy at a specific site. Classification and regression tree (CART) analysis was applied, and a representative classification tree model was developed that allowed short-term prediction of dechlorination potential. Indirect indicators for low dissolved oxygen (e.g., low NO3-and NO2-, high Fe2+ and CH4) were the most influential factors for predicting dechlorination potential, followed by total organic carbon content (TOC) and Dhc cell abundance. These findings indicate that machine learning-based data mining techniques applied to groundwater monitoring data can lead to the development of predictive groundwater remediation models. A major need for improving the predictive capabilities of the data mining approach is a curated, up-to-date and comprehensive collection of groundwater monitoring data.

  14. The role of toxicological science in meeting the challenges and opportunities of hydraulic fracturing.

    PubMed

    Goldstein, Bernard D; Brooks, Bryan W; Cohen, Steven D; Gates, Alexander E; Honeycutt, Michael E; Morris, John B; Orme-Zavaleta, Jennifer; Penning, Trevor M; Snawder, John

    2014-06-01

    We briefly describe how toxicology can inform the discussion and debate of the merits of hydraulic fracturing by providing information on the potential toxicity of the chemical and physical agents associated with this process, individually and in combination. We consider upstream activities related to bringing chemical and physical agents to the site, on-site activities including drilling of wells and containment of agents injected into or produced from the well, and downstream activities including the flow/removal of hydrocarbon products and of produced water from the site. A broad variety of chemical and physical agents are involved. As the industry expands this has raised concern about the potential for toxicological effects on ecosystems, workers, and the general public. Response to these concerns requires a concerted and collaborative toxicological assessment. This assessment should take into account the different geology in areas newly subjected to hydraulic fracturing as well as evolving industrial practices that can alter the chemical and physical agents of toxicological interest. The potential for ecosystem or human exposure to mixtures of these agents presents a particular toxicological and public health challenge. These data are essential for developing a reliable assessment of the potential risks to the environment and to human health of the rapidly increasing use of hydraulic fracturing and deep underground horizontal drilling techniques for tightly bound shale gas and other fossil fuels. Input from toxicologists will be most effective when employed early in the process, before there are unwanted consequences to the environment and human health, or economic losses due to the need to abandon or rework costly initiatives.

  15. The Role of Toxicological Science in Meeting the Challenges and Opportunities of Hydraulic Fracturing

    PubMed Central

    Goldstein, Bernard D.; Brooks, Bryan W.; Cohen, Steven D.; Gates, Alexander E.; Honeycutt, Michael E.; Morris, John B.; Orme-Zavaleta, Jennifer; Penning, Trevor M.; Snawder, John

    2014-01-01

    We briefly describe how toxicology can inform the discussion and debate of the merits of hydraulic fracturing by providing information on the potential toxicity of the chemical and physical agents associated with this process, individually and in combination. We consider upstream activities related to bringing chemical and physical agents to the site, on-site activities including drilling of wells and containment of agents injected into or produced from the well, and downstream activities including the flow/removal of hydrocarbon products and of produced water from the site. A broad variety of chemical and physical agents are involved. As the industry expands this has raised concern about the potential for toxicological effects on ecosystems, workers, and the general public. Response to these concerns requires a concerted and collaborative toxicological assessment. This assessment should take into account the different geology in areas newly subjected to hydraulic fracturing as well as evolving industrial practices that can alter the chemical and physical agents of toxicological interest. The potential for ecosystem or human exposure to mixtures of these agents presents a particular toxicological and public health challenge. These data are essential for developing a reliable assessment of the potential risks to the environment and to human health of the rapidly increasing use of hydraulic fracturing and deep underground horizontal drilling techniques for tightly bound shale gas and other fossil fuels. Input from toxicologists will be most effective when employed early in the process, before there are unwanted consequences to the environment and human health, or economic losses due to the need to abandon or rework costly initiatives. PMID:24706166

  16. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  17. Occupational exposure to crystalline silica at Alberta work sites.

    PubMed

    Radnoff, Diane; Todor, Maria S; Beach, Jeremy

    2014-01-01

    Although crystalline silica has been recognized as a health hazard for many years, it is still encountered in many work environments. Numerous studies have revealed an association between exposure to respirable crystalline silica and the development of silicosis and other lung diseases including lung cancer. Alberta Jobs, Skills, Training and Labour conducted a project to evaluate exposure to crystalline silica at a total of 40 work sites across 13 industries. Total airborne respirable dust and respirable crystalline silica concentrations were quite variable, but there was a potential to exceed the Alberta Occupational Exposure Limit (OEL) of 0.025 mg/m(3) for respirable crystalline silica at many of the work sites evaluated. The industries with the highest potentials for overexposure occurred in sand and mineral processing (GM 0.090 mg/m(3)), followed by new commercial building construction (GM 0.055 mg/m(3)), aggregate mining and crushing (GM 0.048 mg/m(3)), abrasive blasting (GM 0.027 mg/m(3)), and demolition (GM 0.027 mg/m(3)). For worker occupations, geometric mean exposure ranged from 0.105 mg/m(3) (brick layer/mason/concrete cutting) to 0.008 mg/m(3) (dispatcher/shipping, administration). Potential for GM exposure exceeding the OEL was identified in a number of occupations where it was not expected, such as electricians, carpenters and painters. These exposures were generally related to the specific task the worker was doing, or arose from incidental exposure from other activities at the work site. The results indicate that where there is a potential for activities producing airborne respirable crystalline silica, it is critical that the employer include all worker occupations at the work site in their hazard assessment. There appears to be a relationship between airborne total respirable dust concentration and total respirable dust concentrations, but further study is require to fully characterize this relationship. If this relationship holds true, it may provide a useful hazard assessment tool for employers by which the potential for exposure to airborne respirable silica at the work site can be more easily estimated.

  18. Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

    NASA Astrophysics Data System (ADS)

    Baghaee Ravari, Soodeh

    G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

  19. The activity of nitrifying microorganisms in a high-altitude Andean wetland.

    PubMed

    Molina, Verónica; Dorador, Cristina; Fernández, Camila; Bristow, Laura; Eissler, Yoanna; Hengst, Martha; Hernandez, Klaudia; Olsen, Lasse Mork; Harrod, Chris; Marchant, Francisca; Anguita, Cristobal; Cornejo, Marcela

    2018-06-01

    High-altitude wetland holds freshwater springs, evaporitic ponds and lagoon with variable salinity and nutrients, potentially influencing the ecology of nitrifying communities. In this study, nitrifying microorganisms in Salar de Huasco (Chile) were surveyed to determine bacterial and archaeal contribution to ammonium (AO), nitrite oxidation (NO), ammonium uptake (AU) during wet and dry seasons. The activity signals from these groups were assessed by specific amoA-qPCR transcription, 15N tracer studies and addition of group specific inhibitor experiments for nitrifying microorganisms (N1-guanyl-1, 7-diaminoheptane [GC7]-archaeal specific and allylthiourea [ATU]-bacterial specific). Nitrifying communities, i.e. Nitrosopumilus, Nitrosospira, Nitrosomonas, Kuenenia and Nitrospira, were more frequent (∼0.25% of 16S rRNA sequences) at low salinity sites. Bacterial amoA-qPCR transcripts also increased at low salinity and along in situ ammonium increase observed between wet/dry seasons. Nutrient changes through time and 15N tracer experiments results showed that AO and NO were detected and peaked mainly at low salinity-high ammonium sites (<37 000 μS cm-1 and >0.3 μM), whereas AU was predominant at evaporitic sites. Our results indicate that salinity and ammonium affect the nitrifying communities that are potentially more active at low-salinity sites but persistent at saltier evaporitic areas of the wetland when ammonium is available.

  20. Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.

    PubMed

    Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V

    1998-05-26

    To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.

  1. Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis

    NASA Astrophysics Data System (ADS)

    Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; de Proft, Frank; Huang, Jingjing; van Breusegem, Frank; Messens, Joris

    2017-02-01

    Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release.

  2. Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol*

    PubMed Central

    Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.; Fiamengo, Bryan A.; Foley, Sage E.; Frank, Kristine E.; George, Jonathan S.; Harris, Christopher M.; Hobson, Adrian D.; Ihle, David C.; Marcotte, Douglas; Merta, Philip J.; Michalak, Mark E.; Murdock, Sara E.; Tomlinson, Medha J.; Voss, Jeffrey W.

    2015-01-01

    The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. We have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). We found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC50 < 100 nm) inhibit Jak3 activity in cell-based assays. These results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases. PMID:25552479

  3. Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis

    PubMed Central

    Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; De Proft, Frank; Huang, Jingjing; Van Breusegem, Frank; Messens, Joris

    2017-01-01

    Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release. PMID:28195196

  4. Computational characterization of how the VX nerve agent binds human serum paraoxonase 1.

    PubMed

    Fairchild, Steven Z; Peterson, Matthew W; Hamza, Adel; Zhan, Chang-Guo; Cerasoli, Douglas M; Chang, Wenling E

    2011-01-01

    Human serum paraoxonase 1 (HuPON1) is an enzyme that can hydrolyze various chemical warfare nerve agents including VX. A previous study has suggested that increasing HuPON1's VX hydrolysis activity one to two orders of magnitude would make the enzyme an effective countermeasure for in vivo use against VX. This study helps facilitate further engineering of HuPON1 for enhanced VX-hydrolase activity by computationally characterizing HuPON1's tertiary structure and how HuPON1 binds VX. HuPON1's structure is first predicted through two homology modeling procedures. Docking is then performed using four separate methods, and the stability of each bound conformation is analyzed through molecular dynamics and solvated interaction energy calculations. The results show that VX's lone oxygen atom has a strong preference for forming a direct electrostatic interaction with HuPON1's active site calcium ion. Various HuPON1 residues are also detected that are in close proximity to VX and are therefore potential targets for future mutagenesis studies. These include E53, H115, N168, F222, N224, L240, D269, I291, F292, and V346. Additionally, D183 was found to have a predicted pKa near physiological pH. Given D183's location in HuPON1's active site, this residue could potentially act as a proton donor or accepter during hydrolysis. The results from the binding simulations also indicate that steered molecular dynamics can potentially be used to obtain accurate binding predictions even when starting with a closed conformation of a protein's binding or active site.

  5. Electrochemically mediated polymerization for highly sensitive detection of protein kinase activity.

    PubMed

    Hu, Qiong; Wang, Qiangwei; Jiang, Cuihua; Zhang, Jian; Kong, Jinming; Zhang, Xueji

    2018-07-01

    Protein kinases play a pivotal role in cellular regulation and signal transduction, the detection of protein kinase activity and inhibition is therefore of great importance to clinical diagnosis and drug discovery. In this work, a novel electrochemical platform using the electrochemically mediated polymerization as an efficient and cost-effective signal amplification strategy is described for the highly sensitive detection of protein kinase activity. This platform involves 1) the phosphorylation of substrate peptide by protein kinase, 2) the attachment of alkyl halide to the phosphorylated sites via the carboxylate-Zr 4+ -phosphate chemistry, and 3) the in situ grafting of electroactive polymers from the phosphorylated sites through the electrochemically mediated atom transfer radical polymerization (eATRP) at a negative potential, in the presence of the surface-attached alkyl halide as the initiator and the electroactive tag-conjugated acrylate as the monomer, respectively. Due to the electrochemically mediated polymerization, a large number of electroactive tags can be linked to each phosphorylated site, thereby greatly improving the detection sensitivity. This platform has been successfully applied to detect the activity of cAMP-dependent protein kinase (PKA) with a detection limit down to 1.63 mU mL -1 . Results also demonstrate that it is highly selective and can be used for the screening of protein kinase inhibitors. The potential application of our platform for protein kinase activity detection in complex biological samples has been further verified using normal human serum and HepG2 cell lysate. Moreover, our platform is operationally simple, highly efficient and cost-effective, thus holding great potential in protein kinase detection and inhibitor screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Comparison of natural resource issues on tropical pacific ranges

    USGS Publications Warehouse

    Helweg, D.A.; Jacobi, J.D.

    2004-01-01

    The natural resources issues on tropical Pacific ranges are compared. If active management plan is in place, FWS may exempt those spp. from critical Habitat Prevention and control or invasive species essential. Wetlands are low-hanging fruit for restoration, but birds present mgmt. challenge. Marine sites may offer less potential for precise mgmt. of natural resources than terrestrial sites such as, lack of knowledge, observational limits, ecosystem complexity, mobile biota. It has been suggested that the tremendus public interest in helping with conservation activities - volunteer opportunities may offset staffing shortfalls.

  7. Engineering Neprilysin Activity and Specificity to Create a Novel Therapeutic for Alzheimer’s Disease

    PubMed Central

    Webster, Carl I.; Burrell, Matthew; Olsson, Lise-Lotte; Fowler, Susan B.; Digby, Sarah; Sandercock, Alan; Snijder, Arjan; Tebbe, Jan; Haupts, Ulrich; Grudzinska, Joanna; Jermutus, Lutz; Andersson, Christin

    2014-01-01

    Neprilysin is a transmembrane zinc metallopeptidase that degrades a wide range of peptide substrates. It has received attention as a potential therapy for Alzheimer’s disease due to its ability to degrade the peptide amyloid beta. However, its broad range of peptide substrates has the potential to limit its therapeutic use due to degradation of additional peptides substrates that tightly regulate many physiological processes. We sought to generate a soluble version of the ectodomain of neprilysin with improved activity and specificity towards amyloid beta as a potential therapeutic for Alzheimer’s disease. Extensive amino acid substitutions were performed at positions surrounding the active site and inner surface of the enzyme and variants screened for activity on amyloid beta 1–40, 1–42 and a variety of other physiologically relevant peptides. We identified several mutations that modulated and improved both enzyme selectivity and intrinsic activity. Neprilysin variant G399V/G714K displayed an approximately 20-fold improved activity on amyloid beta 1–40 and up to a 3,200-fold reduction in activity on other peptides. Along with the altered peptide substrate specificity, the mutant enzyme produced a markedly altered series of amyloid beta cleavage products compared to the wild-type enzyme. Crystallisation of the mutant enzyme revealed that the amino acid substitutions result in alteration of the shape and size of the pocket containing the active site compared to the wild-type enzyme. The mutant enzyme offers the potential for the more efficient degradation of amyloid beta in vivo as a therapeutic for the treatment of Alzheimer’s disease. PMID:25089527

  8. Active sites of ligand-protected Au{sub 25} nanoparticle catalysts for CO{sub 2} electroreduction to CO

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alfonso, Dominic R., E-mail: alfonso@netl.doe.gov; Kauffman, Douglas; Matranga, Christopher

    2016-05-14

    Recent experimental studies have reported the electrochemical reduction of carbon dioxide (CO{sub 2}) into CO at atomically precise negatively charged Au{sub 25}{sup −} nanoclusters. The studies showed CO{sub 2} conversion at remarkably low overpotentials, but the exact mechanisms and nature of the active sites remain unclear. We used first-principles density functional theory and continuum solvation models to examine the role of the cluster during electrochemical CO{sub 2} reduction and analyze the free energies of proposed intermediate species. Contrary to previous assumptions, our results show that the fully ligand protected cluster is not an active CO{sub 2} reduction catalyst because formationmore » of the crucial carboxyl intermediate required very high electrochemical potentials. Instead, our calculations suggest that the reduction process likely occurs on a dethiolated gold site, and adsorbed carboxyl intermediate formation was significantly stabilized at dethiolated gold sites. These findings point to the crucial role of exposed metal sites during electrochemical CO{sub 2} reduction at gold nanocluster catalysts.« less

  9. Decarboxylative alkylation for site-selective bioconjugation of native proteins via oxidation potentials.

    PubMed

    Bloom, Steven; Liu, Chun; Kölmel, Dominik K; Qiao, Jennifer X; Zhang, Yong; Poss, Michael A; Ewing, William R; MacMillan, David W C

    2018-02-01

    The advent of antibody-drug conjugates as pharmaceuticals has fuelled a need for reliable methods of site-selective protein modification that furnish homogeneous adducts. Although bioorthogonal methods that use engineered amino acids often provide an elegant solution to the question of selective functionalization, achieving homogeneity using native amino acids remains a challenge. Here, we explore visible-light-mediated single-electron transfer as a mechanism towards enabling site- and chemoselective bioconjugation. Specifically, we demonstrate the use of photoredox catalysis as a platform to selectivity wherein the discrepancy in oxidation potentials between internal versus C-terminal carboxylates can be exploited towards obtaining C-terminal functionalization exclusively. This oxidation potential-gated technology is amenable to endogenous peptides and has been successfully demonstrated on the protein insulin. As a fundamentally new approach to bioconjugation this methodology provides a blueprint toward the development of photoredox catalysis as a generic platform to target other redox-active side chains for native conjugation.

  10. Decarboxylative alkylation for site-selective bioconjugation of native proteins via oxidation potentials

    NASA Astrophysics Data System (ADS)

    Bloom, Steven; Liu, Chun; Kölmel, Dominik K.; Qiao, Jennifer X.; Zhang, Yong; Poss, Michael A.; Ewing, William R.; MacMillan, David W. C.

    2018-02-01

    The advent of antibody-drug conjugates as pharmaceuticals has fuelled a need for reliable methods of site-selective protein modification that furnish homogeneous adducts. Although bioorthogonal methods that use engineered amino acids often provide an elegant solution to the question of selective functionalization, achieving homogeneity using native amino acids remains a challenge. Here, we explore visible-light-mediated single-electron transfer as a mechanism towards enabling site- and chemoselective bioconjugation. Specifically, we demonstrate the use of photoredox catalysis as a platform to selectivity wherein the discrepancy in oxidation potentials between internal versus C-terminal carboxylates can be exploited towards obtaining C-terminal functionalization exclusively. This oxidation potential-gated technology is amenable to endogenous peptides and has been successfully demonstrated on the protein insulin. As a fundamentally new approach to bioconjugation this methodology provides a blueprint toward the development of photoredox catalysis as a generic platform to target other redox-active side chains for native conjugation.

  11. Are the users of social networking sites homogeneous? A cross-cultural study.

    PubMed

    Alarcón-Del-Amo, María-Del-Carmen; Gómez-Borja, Miguel-Ángel; Lorenzo-Romero, Carlota

    2015-01-01

    The growing use of Social Networking Sites (SNS) around the world has made it necessary to understand individuals' behaviors within these sites according to different cultures. Based on a comparative study between two different European countries (The Netherlands versus Spain), a comparison of typologies of networked Internet users has been obtained through a latent segmentation approach. These typologies are based on the frequency with which users perform different activities, their socio-demographic variables, and experience in social networking and interaction patterns. The findings show new insights regarding international segmentation in order to analyse SNS user behaviors in both countries. These results are relevant for marketing strategists eager to use the communication potential of networked individuals and for marketers willing to explore the potential of online networking as a low cost and a highly efficient alternative to traditional networking approaches. For most businesses, expert users could be valuable opinion leaders and potential brand influencers.

  12. Are the users of social networking sites homogeneous? A cross-cultural study

    PubMed Central

    Alarcón-del-Amo, María-del-Carmen; Gómez-Borja, Miguel-Ángel; Lorenzo-Romero, Carlota

    2015-01-01

    The growing use of Social Networking Sites (SNS) around the world has made it necessary to understand individuals' behaviors within these sites according to different cultures. Based on a comparative study between two different European countries (The Netherlands versus Spain), a comparison of typologies of networked Internet users has been obtained through a latent segmentation approach. These typologies are based on the frequency with which users perform different activities, their socio-demographic variables, and experience in social networking and interaction patterns. The findings show new insights regarding international segmentation in order to analyse SNS user behaviors in both countries. These results are relevant for marketing strategists eager to use the communication potential of networked individuals and for marketers willing to explore the potential of online networking as a low cost and a highly efficient alternative to traditional networking approaches. For most businesses, expert users could be valuable opinion leaders and potential brand influencers. PMID:26321971

  13. On the Preferred Active Sites of Promoted MoS 2 for Hydrodesulfurization with Minimal Organonitrogen Inhibition

    DOE PAGES

    Rangarajan, Srinivas; Mavrikakis, Manos

    2016-12-14

    Hydrodesulfurization is a process to produce ultralow-sulfur diesel fuel. Although promoted molybdenum sulfide (MoS 2) catalysts have been used industrially for several decades, the active site requirements for selective hydrodesulfurization of organosulfur compounds with minimal inhibition by organonitrogen constituents of a real gasoil feed has not been resolved. By using molecular binding energy descriptors derived from plane wave density functional theory calculations for comparative adsorption of organosulfur and organonitrogen compounds, we analyzed more than 20 potential sites on unpromoted and Ni- and Co-promoted MoS 2. We also found that hydrogen sulfide and ammonia are simple descriptors of adsorption of stericallymore » unhindered organosulfur and organonitrogen compounds such as dibenzothiophene and acridine, respectively. Further, organonitrogen compounds in gasoil bind more strongly than organosulfur compounds on all sites except on sites with exposed metal atoms on the corner and sulfur edges of promoted MoS 2. Consequently, these sites are proposed as required for maximum-hydrodesulfurization minimum-inhibition catalysis.« less

  14. Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

    PubMed

    Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

    2017-09-09

    The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Cool Tools for the New Frontier: Technological Advances Help Associates Tell Their Story.

    ERIC Educational Resources Information Center

    Hersch, James

    1998-01-01

    Argues that creation of a World Wide Web site that makes good use of the available digital audio and visual technologies can be useful in campus activities planning and advertising. The design of a good Web site and the potential uses of digital video and compact discs are discussed. Costs of these technologies are also outlined. (MSE)

  16. Photosynthesis, water relations, and growth of planted Pinus strobus L. on burned sites in the southern Appalachians

    Treesearch

    Katherine J. Elliott; James M. Vose

    1994-01-01

    We measured net photosynthesis,leaf conductance, xylem water potential, and growth of Pinus strbus L. seedlings two years after planting on two clear-cut and burned sites in the southern Appalachians. Multiple regression analysis was used to relate seedling net pholosynthesis to vapor pressure deficit, seedling crown temperature, photosynthetically active radiation (...

  17. Determination of precursor sites for pitting corrosion of polycrystalline titanium by using different techniques

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garfias-Mesias, L.F.; Alodan, M.; James, P.I.

    1998-06-01

    Scanning electrochemical microscopy (SECM) in ferrocyanide and bromide solutions was used to locate active sites (pitting precursors) on polycrystalline Ti where oxidation of Br{sup {minus}} and Fe(CN){sub 6}{sup 4{minus}} was possible. Analysis of the electrochemically active sites was done by using electron microscopy (SEM), energy dispersive X-ray analysis (EDX), atomic force microscopy (AFM), and in situ confocal laser scanning microscopy (CLSM). In most cases, the active sites were found to be associated with particles (inclusions) which contained mainly Al and Si; however, some other areas not associated with particles were also found to be active. Although the size of themore » inclusions was normally smaller than 20 {micro}m, as revealed by SEM and AFM imaging, in some cases larger particles were also found. Pitting corrosion tests in bromide solution at potentials above 1.5 V{sub SCE} followed by EDX analysis inside the pits and in situ CLSM observation, confirmed that most of the localized attack started in the areas where particles had been located.« less

  18. Individual and cumulative effects of agriculture, forestry and metal mining activities on the metal and phosphorus content of fluvial fine-grained sediment; Quesnel River Basin, British Columbia, Canada.

    PubMed

    Smith, Tyler B; Owens, Philip N

    2014-10-15

    The impact of agriculture, forestry and metal mining on the quality of fine-grained sediment (<63 μm) was investigated in the Quesnel River Basin (QRB) (~11,500 km(2)) in British Columbia, Canada. Samples of fine-grained sediment were collected monthly during the snow-free season in 2008 using time-integrated samplers at replicate sites representative of agriculture, forestry and mining activities in the basin (i.e. "impacted" sites). Samples were also collected from replicate reference sites and also from the main stem of the Quesnel River at the downstream confluence with the Fraser River. Generally, metal(loid) and phosphorus (P) concentrations for "impacted" sites were greater than for reference sites. Furthermore, concentrations of copper (forestry and mining sites), manganese (agriculture and forestry sites) and selenium (agriculture, forestry and mining sites) exceeded upper sediment quality guideline (SQG) thresholds. These results suggest that agriculture, forestry and metal mining activities are having an influence on the concentrations of sediment-associated metal(loid)s and P in the Quesnel basin. Metal(loid) and P concentrations of sediment collected from the downstream site were not significantly greater than values for the reference sites, and were typically lower than the values for the impacted sites. This suggests that the cumulative effects of agriculture, forestry and mining activities in the QRB are presently not having a measureable effect at the river basin-scale. The lack of a cumulative effect at the basin-scale is thought to reflect: (i) the relatively recent occurrence of land use disturbances in this basin; (ii) the dominance of sediment contributions from natural forest and agriculture; and (iii) the potential for storage of contaminants on floodplains and other storage elements between the locations of disturbance activities and the downstream sampling site, which may be attenuating the disturbance signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Miglustat (NB-DNJ) works as a chaperone for mutated acid beta-glucosidase in cells transfected with several Gaucher disease mutations.

    PubMed

    Alfonso, Pilar; Pampín, Sandra; Estrada, Jorge; Rodríguez-Rey, José Carlos; Giraldo, Pilar; Sancho, Javier; Pocoví, Miguel

    2005-01-01

    Gaucher disease (GD) is a disorder of glycosphinglipid metabolism caused by deficiency of lysosomal acid beta-glucosidase (GC), resulting in progressive deposition of glucosylceramide in macrophages. The glucose analogue, N-butyl-deoxynojirimycin (NB-DNJ, Miglustat), is an inhibitor of the ceramide-specific glucosyltransferase (CSG) which catalyzes the first step of glycosphingolipids biosynthesis and is currently approved for the oral treatment of type 1 GD. Using site-directed mutagenesis, we constructed plasmids containing wild-type and several mutations in glucocerebrosidase (GBA) gene. The plasmids were transfected into COS-7 cells and stable transfected cell lines were obtained by geneticin (G418) selection. Cells were cultured during 6 days with medium with or without 10 microM NB-DNJ. The addition of NB-DNJ to COS-7 cell medium leads to 1.3-, 2.1-, 2.3-, 3.6-, and 9.9-fold increase in the activity of S364R, wild-type, N370S, V15M, and M123T GC, respectively. However, no significant changes were observed in the activity of the L444P, L336P, and S465del mutated proteins, but a small decrease in the rare P266L variant was observed. These results suggest that NB-DNJ, in addition to the inhibitory effect on CSG, also works as a "chemical chaperone", increasing the activity of acid beta-glucosidase of wild-type and several GC mutated proteins, including the most frequent N370S mutation. The specific location of the Miglustat binding site in GC is unknown. Potential binding sites in the enzyme have been searched for using computational molecular docking. The searching strategy identified three potential GC binding sites for Miglustat, one being the substrate-binding site of the enzyme, which was the best-ranked site by AutoDock program. Therefore, it is possible that Miglustat exerts its chaperoning activity on acid beta-glucosidase by acting as an inhibitor bound at the active site. This increase on the activity of the acid beta-glucosidase would imply that Miglustat is not only a substrate reducer but also an inhibitor of the GC degradation, with very promising clinical implications for the treatment of GD patients.

  20. Enhancement and inhibition of microbial activity in hydrocarbon- contaminated arctic soils: Implications for nutrient-amended bioremediation

    USGS Publications Warehouse

    Braddock, J.F.; Ruth, M.L.; Catterall, P.H.; Walworth, J.L.; McCarthy, K.A.

    1997-01-01

    Bioremediation is being used or proposed as a treatment option at many hydrocarbon-contaminated sites. One such site is a former bulk-fuel storage facility near Barrow, AK, where contamination persists after approximately 380 m3 of JP-5 was spilled in 1970. The soil at the site is primarily coarse sand with low organic carbon (<1%) end low moisture (1-3%) contents. We examined the effects of nutrient additions on microorganisms in contaminated soil from this site in laboratory microcosms and in mesocosms incubated for 6 weeks in the field. Nitrogen was the major limiting nutrient in this system, but microbial populations and activity were maximally enhanced by additions of both nitrogen and phosphorus. When nutrients were added to soil in the field at three levels of N:P (100:45, 200:90, and 300:135 mg/kg soil), the greatest stimulation in microbial activity occurred at the lowest, rather than the highest, level of nutrient addition. The total soil-water potentials ranged from -2 to -15 bar with increasing levels of fertilizer. Semivolatile hydrocarbon concentrations declined significantly only in the soils treated at the low fertilizer level. These results indicate that an understanding of nutrient effects at a specific site is essential for successful bioremediation.Bioremediation is being used or proposed as a treatment option at many hydrocarbon-contaminated sites. One such site is a former bulk-fuel storage facility near Barrow, AK, where contamination persists after approximately 380 m3 of JP-5 was spilled in 1970. The soil at the site is primarily coarse sand with low organic carbon (<1%) and low moisture (1-3%) contents. We examined the effects of nutrient additions on microorganisms in contaminated soil from this site in laboratory microcosms and in mesocosms incubated for 6 weeks in the field. Nitrogen was the major limiting nutrient in this system, but microbial populations and activity were maximally enhanced by additions of both nitrogen and phosphorus. When nutrients were added to soil in the field at three levels of N:P (100:45, 200:90, and 300:135 mg/kg soil), the greatest stimulation in microbial activity occurred at the lowest, rather than the highest, level of nutrient addition. The total soil-water potentials ranged from -2 to -15 bar with increasing levels of fertilizer. Semi-volatile hydrocarbon concentrations declined significantly only in the soils treated at the low fertilizer level. These results indicate that an understanding of nutrient effects at a specific site is essential for successful bioremediation.

  1. The Role of Sodium in Tuning Product Distribution in Syngas Conversion by Rh Catalysts

    DOE PAGES

    Yang, Nuoya; Liu, Xinyan; Asundi, Arun S.; ...

    2017-10-23

    Alkali metal oxides commonly exist as impurities or promoters in syngas conversion catalysts and can significantly influence the activity and selectivity towards higher oxygenate products. In this study, we investigate the effects of sodium oxide on silica-supported Rh catalysts by experimentally introducing different amounts of sodium and monitoring the change in reactivity and CO adsorption behavior. The experimental results combined with density functional theory (DFT) calculations show that sodium selectively blocks step/defect sites on Rh surfaces, leading to reduced activity but higher C 2 oxygenate selectivity. DFT calculations also suggest that sodium present on Rh terrace sites can facilitate COmore » dissociation, potentially increasing C 2 oxygenate production. The overall activity and selectivity toward various products can be changed significantly based on the degree of site blocking by the added sodium.« less

  2. The Role of Sodium in Tuning Product Distribution in Syngas Conversion by Rh Catalysts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Nuoya; Liu, Xinyan; Asundi, Arun S.

    Alkali metal oxides commonly exist as impurities or promoters in syngas conversion catalysts and can significantly influence the activity and selectivity towards higher oxygenate products. In this study, we investigate the effects of sodium oxide on silica-supported Rh catalysts by experimentally introducing different amounts of sodium and monitoring the change in reactivity and CO adsorption behavior. The experimental results combined with density functional theory (DFT) calculations show that sodium selectively blocks step/defect sites on Rh surfaces, leading to reduced activity but higher C 2 oxygenate selectivity. DFT calculations also suggest that sodium present on Rh terrace sites can facilitate COmore » dissociation, potentially increasing C 2 oxygenate production. The overall activity and selectivity toward various products can be changed significantly based on the degree of site blocking by the added sodium.« less

  3. Dynamic multistate site occupancy models to evaluate hypotheses relevant to conservation of Golden Eagles in Denali National Park, Alaska

    USGS Publications Warehouse

    Martin, Julien; McIntyre, Carol L.; Hines, James E.; Nichols, James D.; Schmutz, Joel A.; MacCluskie, Margaret C.

    2009-01-01

    The recent development of multistate site occupancy models offers great opportunities to frame and solve decision problems for conservation that can be viewed in terms of site occupancy. These models have several characteristics (e.g., they account for detectability) that make them particularly well suited for addressing management and conservation problems. We applied multistate site occupancy models to evaluate hypotheses related to the conservation and management of Golden Eagles (Aquila chrysaetos) in Denali National Park, Alaska, and provided estimates of transition probabilities among three occupancy states for nesting areas (occupied with successful reproduction, occupied with unsuccessful reproduction, and unoccupied). Our estimation models included the effect of potential recreational activities (hikers) and environmental covariates such as a snowshoe hare (Lepus americanus) index on transition probabilities among the three occupancy states. Based on the most parsimonious model, support for the hypothesis of an effect of potential human disturbance on site occupancy dynamics was equivocal. There was some evidence that potential human disturbance negatively affected local colonization of territories, but there was no evidence of an effect on reproductive performance parameters. In addition, models that assume a positive relationship between the hare index and successful reproduction were well supported by the data. The statistical approach that we used is particularly useful to parameterize management models that can then be used to make optimal decisions related to the management of Golden Eagles in Denali. Although in our case we were particularly interested in managing recreational activities, we believe that such models should be useful to for a broad class of management and conservation problems.

  4. Comparison of nitrogen monoxide emissions from several African tropical ecosystems and influence of season and fire

    NASA Astrophysics Data System (ADS)

    SerçA, D.; Delmas, R.; Le Roux, X.; Parsons, D. A. B.; Scholes, M. C.; Abbadie, L.; Lensi, R.; Ronce, O.; Labroue, L.

    1998-12-01

    NO emission rates from soils were measured for twelve major African ecosystems in four countries (Congo, Niger, Ivory Coast, and South Africa) and within four major phytogeographic domains: the Guineo-Congolese, Guinean, Sahelian, and Zambezian domains. Measurements were performed during wet and/or dry seasons. All the measurements were made with the same dynamic chamber device, which allowed true comparisons to be made. This study showed that emission rates strongly differed between ecosystems and exhibited a marked temporal variability. Ecosystem effect was highly significant during both the dry and wet seasons. Emission rates were low (<0.6 ng NO-N m-2 s-1) in Hyparrhenia and Loudetia savannas of the Guinean or Guineo-Congolese domains. Intermediate NO fluxes were obtained in rain forest and gallery forest ecosystems, in a broad-leafed savanna and in a seasonally wetted grassland (sandy soil) of the Zambezian domain, and in a dry fallow savanna of the Sahelian domain. Emission rates were maximum (>7 ng NO-N m-2 s-1) in a seasonally wetted grassland (site 2) and in particular sites subjected to various disturbances, for example soil fauna activity (termite mounds) or past human disturbance (Acacia patches-settlement site). Microbial activity potentials (i.e., carbon mineralization, nitrification, denitrification, and total net N mineralization) were determined for most of the soils where NO fluxes were measured. In some sites, these potential activities were useful to identify the major processes controlling NO emission rates. Denitrification potential was very low and could not explain substantial NO fluxes from broad- and fine-leafed savannas and Hyperihelia savannas of the Zambezian domain. Very low potentials of both nitrification and denitrification could be related to the low NO fluxes for the three Guinean savanna sites studied. NO fluxes were significantly higher during the wet season than the dry season in both savanna and forest ecosystems. Emission rates in savanna ecosystems were significantly increased within a few hours after fire. The measurements presented here provide a unique, consistent database which can be used to further analyze the processes involved in the spatial and temporal variations of NO emissions.

  5. Active Site Mutations Change the Cleavage Specificity of Neprilysin

    PubMed Central

    Sexton, Travis; Hitchcook, Lisa J.; Rodgers, David W.; Bradley, Luke H.; Hersh, Louis B.

    2012-01-01

    Neprilysin (NEP), a member of the M13 subgroup of the zinc-dependent endopeptidase family is a membrane bound peptidase capable of cleaving a variety of physiological peptides. We have generated a series of neprilysin variants containing mutations at either one of two active site residues, Phe563 and Ser546. Among the mutants studied in detail we observed changes in their activity towards leucine5-enkephalin, insulin B chain, and amyloid β1–40. For example, NEPF563I displayed an increase in preference towards cleaving leucine5-enkephalin relative to insulin B chain, while mutant NEPS546E was less discriminating than neprilysin. Mutants NEPF563L and NEPS546E exhibit different cleavage site preferences than neprilysin with insulin B chain and amyloid ß1–40 as substrates. These data indicate that it is possible to alter the cleavage site specificity of neprilysin opening the way for the development of substrate specific or substrate exclusive forms of the enzyme with enhanced therapeutic potential. PMID:22384224

  6. Streambed scour evaluations and conditions at selected bridge sites in Alaska, 2013–15

    USGS Publications Warehouse

    Beebee, Robin A.; Dworsky, Karenth L.; Knopp, Schyler J.

    2017-12-27

    Streambed scour potential was evaluated at 52 river- and stream-spanning bridges in Alaska that lack a quantitative scour analysis or have unknown foundation details. All sites were evaluated for stream stability and long-term scour potential. Contraction scour and abutment scour were calculated for 52 bridges, and pier scour was calculated for 11 bridges that had piers. Vertical contraction (pressure flow) scour was calculated for sites where the modeled water surface was higher than the superstructure of the bridge. In most cases, hydraulic models of the 1- and 0.2-percent annual exceedance probability floods (also known as the 100- and 500-year floods, respectively) were used to derive hydraulic variables for the scour calculations. Alternate flood values were used in scour calculations for sites where smaller floods overtopped a bridge or where standard flood-frequency estimation techniques did not apply. Scour also was calculated for large recorded floods at 13 sites.Channel instability at 11 sites was related to human activities (in-channel mining, dredging, and channel relocation). Eight of the dredged sites are located on active unstable alluvial fans and were graded to protect infrastructure. The trend toward aggradation during major floods at these sites reduces confidence in scour estimates.Vertical contraction and pressure flow occurred during the 0.2-percent or smaller annual exceedance probability floods at eight sites. Contraction scour exceeded 5 feet (ft) at four sites, and total scour at piers (pier scour plus contraction scour) exceeded 5 ft at four sites. Debris accumulation increased calculated pier scour at six sites by an average of 2.4 ft. Total scour at abutments exceeded 5 ft at 10 sites. Scour estimates seemed excessive at two piers where equations did not account for channel armoring, and at four abutments where failure of the embankment and attendant channel widening would reduce scour.

  7. Observations on the migration of bacillus spores outside a contaminated facility during a decontamination efficacy study

    USGS Publications Warehouse

    Silvestri, Erin E.; Perkins, Sarah; Lordo, Robert; Kovacik, William; Nichols, Tonya L.; Bowling, Charlena Yoder; Griffin, Dale W.; Schaefer, Frank W.

    2015-01-01

    Bacillus species spores have the potential to remain viable in the soil for many years. Lasting environmental contamination following a release is a possibility, and planning for site characterization and remediation activities should consider both indoor-to-outdoor spore transport and outdoor soil as potential exposure pathways.

  8. [3Fe-4S] to [4Fe-4S] cluster conversion in Desulfovibrio fructosovorans [NiFe] hydrogenase by site-directed mutagenesis.

    PubMed

    Rousset, M; Montet, Y; Guigliarelli, B; Forget, N; Asso, M; Bertrand, P; Fontecilla-Camps, J C; Hatchikian, E C

    1998-09-29

    The role of the high potential [3Fe-4S]1+,0 cluster of [NiFe] hydrogenase from Desulfovibrio species located halfway between the proximal and distal low potential [4Fe-4S]2+,1+ clusters has been investigated by using site-directed mutagenesis. Proline 238 of Desulfovibrio fructosovorans [NiFe] hydrogenase, which occupies the position of a potential ligand of the lacking fourth Fe-site of the [3Fe-4S] cluster, was replaced by a cysteine residue. The properties of the mutant enzyme were investigated in terms of enzymatic activity, EPR, and redox properties of the iron-sulfur centers and crystallographic structure. We have shown on the basis of both spectroscopic and x-ray crystallographic studies that the [3Fe-4S] cluster of D. fructosovorans hydrogenase was converted into a [4Fe-4S] center in the P238 mutant. The [3Fe-4S] to [4Fe-4S] cluster conversion resulted in a lowering of approximately 300 mV of the midpoint potential of the modified cluster, whereas no significant alteration of the spectroscopic and redox properties of the two native [4Fe-4S] clusters and the NiFe center occurred. The significant decrease of the midpoint potential of the intermediate Fe-S cluster had only a slight effect on the catalytic activity of the P238C mutant as compared with the wild-type enzyme. The implications of the results for the role of the high-potential [3Fe-4S] cluster in the intramolecular electron transfer pathway are discussed.

  9. The heterodimeric sweet taste receptor has multiple potential ligand binding sites.

    PubMed

    Cui, Meng; Jiang, Peihua; Maillet, Emeline; Max, Marianna; Margolskee, Robert F; Osman, Roman

    2006-01-01

    The sweet taste receptor is a heterodimer of two G protein coupled receptors, T1R2 and T1R3. This discovery has increased our understanding at the molecular level of the mechanisms underlying sweet taste. Previous experimental studies using sweet receptor chimeras and mutants show that there are at least three potential binding sites in this heterodimeric receptor. Receptor activity toward the artificial sweeteners aspartame and neotame depends on residues in the amino terminal domain of human T1R2. In contrast, receptor activity toward the sweetener cyclamate and the sweet taste inhibitor lactisole depends on residues within the transmembrane domain of human T1R3. Furthermore, receptor activity toward the sweet protein brazzein depends on the cysteine rich domain of human T1R3. Although crystal structures are not available for the sweet taste receptor, useful homology models can be developed based on appropriate templates. The amino terminal domain, cysteine rich domain and transmembrane helix domain of T1R2 and T1R3 have been modeled based on the crystal structures of metabotropic glutamate receptor type 1, tumor necrosis factor receptor, and bovine rhodopsin, respectively. We have used homology models of the sweet taste receptors, molecular docking of sweet ligands to the receptors, and site-directed mutagenesis of the receptors to identify potential ligand binding sites of the sweet taste receptor. These studies have led to a better understanding of the structure and function of this heterodimeric receptor, and can act as a guide for rational structure-based design of novel non-caloric sweeteners, which can be used in the fighting against obesity and diabetes.

  10. Small molecule correctors of F508del-CFTR discovered by structure-based virtual screening

    NASA Astrophysics Data System (ADS)

    Kalid, Ori; Mense, Martin; Fischman, Sharon; Shitrit, Alina; Bihler, Hermann; Ben-Zeev, Efrat; Schutz, Nili; Pedemonte, Nicoletta; Thomas, Philip J.; Bridges, Robert J.; Wetmore, Diana R.; Marantz, Yael; Senderowitz, Hanoch

    2010-12-01

    Folding correctors of F508del-CFTR were discovered by in silico structure-based screening utilizing homology models of CFTR. The intracellular segment of CFTR was modeled and three cavities were identified at inter-domain interfaces: (1) Interface between the two Nucleotide Binding Domains (NBDs); (2) Interface between NBD1 and Intracellular Loop (ICL) 4, in the region of the F508 deletion; (3) multi-domain interface between NBD1:2:ICL1:2:4. We hypothesized that compounds binding at these interfaces may improve the stability of the protein, potentially affecting the folding yield or surface stability. In silico structure-based screening was performed at the putative binding-sites and a total of 496 candidate compounds from all three sites were tested in functional assays. A total of 15 compounds, representing diverse chemotypes, were identified as F508del folding correctors. This corresponds to a 3% hit rate, tenfold higher than hit rates obtained in corresponding high-throughput screening campaigns. The same binding sites also yielded potentiators and, most notably, compounds with a dual corrector-potentiator activity (dual-acting). Compounds harboring both activity types may prove to be better leads for the development of CF therapeutics than either pure correctors or pure potentiators. To the best of our knowledge this is the first report of structure-based discovery of CFTR modulators.

  11. The availability of hydrogeologic data associated with areas identified by the US Geological Survey as experiencing potentially induced seismicity resulting from subsurface injection

    NASA Astrophysics Data System (ADS)

    Barnes, Caitlin; Halihan, Todd

    2018-05-01

    A critical need exists for site-specific hydrogeologic data in order to determine potential hazards of induced seismicity and to manage risk. By 2015, the United States Geological Survey (USGS) had identified 17 locations in the USA that are experiencing an increase in seismicity, which may be potentially induced through industrial subsurface injection. These locations span across seven states, which vary in geological setting, industrial exposure and seismic history. Comparing the research across the 17 locations revealed patterns for addressing induced seismicity concerns, despite the differences between geographical locations. Most induced seismicity studies evaluate geologic structure and seismic data from areas experiencing changes in seismic activity levels, but the inherent triggering mechanism is the transmission of hydraulic pressure pulses. This research conducted a systematic review of whether data are available in these locations to generate accurate hydrogeologic predictions, which could aid in managing seismicity. After analyzing peer-reviewed research within the 17 locations, this research confirms a lack of site-specific hydrogeologic data availability for at-risk areas. Commonly, formation geology data are available for these sites, but hydraulic parameters for the seismically active injection and basement zones are not available to researchers conducting peer-reviewed research. Obtaining hydrogeologic data would lead to better risk management for injection areas and provide additional scientific evidential support for determining a potentially induced seismic area.

  12. N-linked oligosaccharides on chondroitin 6-sulfotransferase-1 are required for production of the active enzyme, Golgi localization, and sulfotransferase activity toward keratan sulfate.

    PubMed

    Yusa, Akiko; Kitajima, Ken; Habuchi, Osami

    2006-07-21

    We have shown previously that purified chondroitin 6-sulfotransferase-1 (C6ST-1) was a glycoprotein abundant in N-linked oligosaccharides and could sulfate both chondroitin (C6ST activity) and keratan sulfate (KSST activity); however, functional roles of the N-glycans have remained unclear. In the present study, we show essential roles of N-glycans attached to C6ST-1 in the generation of the active enzyme and in its KSST activity. Treatment with tunicamycin of COS-7 cells transfected with C6ST-1 cDNA totally abolished production of the active C6ST-1. A nearly complete removal of N-glycans of the recombinant C6ST-1 by peptide N-glycosidase F increased the C6ST activity but decreased the KSST activity. Among six potential N-glycosylation sites, deletion of the fourth or sixth site from the amino terminus inhibited production of the active C6ST-1, whereas deletion of the fifth site resulted in a marked loss of the KSST activity. Wild-type recombinant C6ST-1 showed a typical Golgi localization, whereas M-4 recombinant C6ST-1, in which the fourth N-glycosylation site was deleted, colocalized with calnexin, an endoplasmic reticulum-resident protein. Unlike wildtype recombinant C6ST-1, M-4 recombinant C6ST-1 showed a weak affinity toward wheat germ agglutinin and was converted completely to the nonglycosylated form by endoglycosidase H. These observations suggest that N-glycan attached to the fourth N-glycosylation site may function in the proper processing of N-glycans required for the Golgi localization, thereby causing the production of the active C6ST-1, and that N-glycan attached to the fifth N-glycosylation site may contribute to the KSST activity of C6ST-1.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clayton, C.; Gueretta, J.; Tack, J.

    The Manhattan Engineer District (MED) and U.S. Atomic Energy Commission (AEC) contracted for support work through private and academic parties through the early 1960's. The work often involved radioactive materials. Residual radioactive contamination was left at some of more than 600 potentially contaminated (candidate) sites, and worker health and safety concerns remain from the site operations and subsequent remediation activities. The U.S. Department of Energy (DOE) initiated a program to identify and protect records of MED/AEC activities and of remediation work conducted under the Formerly Utilized Sites Remedial Action Program (FUSRAP) to aid in resolving questions about site conditions, liability,more » and worker health and safety and to ensure ongoing protectiveness of human health and the environment. This paper discusses DOE activities undertaken to locate records collections, confirm retention schedules and access requirements, and document information about the collections for use by future stewards. In conclusion: DOE-LM recognizes that records and information management is a critical component of effective LTS and M. Records are needed to answer questions about site conditions and demonstrate to the public in the future that the sites are safe. DOE-LM is working to satisfy present needs and anticipate future uses for FUSRAP records, and compile a collection of site and program information from which future stewards can readily locate and retrieve needed information. (authors)« less

  14. Half-of-the-Sites Reactivity of the Castor Δ9-18:0-Acyl Carrier Protein Desaturase.

    PubMed

    Liu, Qin; Chai, Jin; Moche, Martin; Guy, Jodie; Lindqvist, Ylva; Shanklin, John

    2015-09-01

    Fatty acid desaturases regulate the unsaturation status of cellular lipids. They comprise two distinct evolutionary lineages, a soluble class found in the plastids of higher plants and an integral membrane class found in plants, yeast (Saccharomyces cerevisiae), animals, and bacteria. Both classes exhibit a dimeric quaternary structure. Here, we test the functional significance of dimeric organization of the soluble castor Δ9-18:0-acyl carrier protein desaturase, specifically, the hypothesis that the enzyme uses an alternating subunit half-of-the-sites reactivity mechanism whereby substrate binding to one subunit is coordinated with product release from the other subunit. Using a fluorescence resonance energy transfer assay, we demonstrated that dimers stably associate at concentrations typical of desaturase assays. An active site mutant T104K/S202E, designed to occlude the substrate binding cavity, was expressed, purified, and its properties validated by x-ray crystallography, size exclusion chromatography, and activity assay. Heterodimers comprising distinctly tagged wild-type and inactive mutant subunits were purified at 1:1 stoichiometry. Despite having only one-half the number of active sites, purified heterodimers exhibit equivalent activity to wild-type homodimers, consistent with half-of-the-sites reactivity. However, because multiple rounds of turnover were observed, we conclude that substrate binding to one subunit is not required to facilitate product release from the second subunit. The observed half-of-the-sites reactivity could potentially buffer desaturase activity from oxidative inactivation. That soluble desaturases require only one active subunit per dimer for full activity represents a mechanistic difference from the membrane class of desaturases such as the Δ9-acyl-CoA, Ole1p, from yeast, which requires two catalytically competent subunits for activity. © 2015 American Society of Plant Biologists. All Rights Reserved.

  15. Half-of-the-Sites Reactivity of the Castor Δ9-18:0-Acyl Carrier Protein Desaturase1[OPEN

    PubMed Central

    Liu, Qin; Chai, Jin; Moche, Martin; Guy, Jodie; Lindqvist, Ylva; Shanklin, John

    2015-01-01

    Fatty acid desaturases regulate the unsaturation status of cellular lipids. They comprise two distinct evolutionary lineages, a soluble class found in the plastids of higher plants and an integral membrane class found in plants, yeast (Saccharomyces cerevisiae), animals, and bacteria. Both classes exhibit a dimeric quaternary structure. Here, we test the functional significance of dimeric organization of the soluble castor Δ9-18:0-acyl carrier protein desaturase, specifically, the hypothesis that the enzyme uses an alternating subunit half-of-the-sites reactivity mechanism whereby substrate binding to one subunit is coordinated with product release from the other subunit. Using a fluorescence resonance energy transfer assay, we demonstrated that dimers stably associate at concentrations typical of desaturase assays. An active site mutant T104K/S202E, designed to occlude the substrate binding cavity, was expressed, purified, and its properties validated by x-ray crystallography, size exclusion chromatography, and activity assay. Heterodimers comprising distinctly tagged wild-type and inactive mutant subunits were purified at 1:1 stoichiometry. Despite having only one-half the number of active sites, purified heterodimers exhibit equivalent activity to wild-type homodimers, consistent with half-of-the-sites reactivity. However, because multiple rounds of turnover were observed, we conclude that substrate binding to one subunit is not required to facilitate product release from the second subunit. The observed half-of-the-sites reactivity could potentially buffer desaturase activity from oxidative inactivation. That soluble desaturases require only one active subunit per dimer for full activity represents a mechanistic difference from the membrane class of desaturases such as the Δ9-acyl-CoA, Ole1p, from yeast, which requires two catalytically competent subunits for activity. PMID:26224800

  16. Towards identifying the active sites on RuO 2 (110) in catalyzing oxygen evolution

    DOE PAGES

    Rao, Reshma R.; Kolb, Manuel J.; Halck, Niels Bendtsen; ...

    2017-11-17

    While the surface atomic structure of RuO 2 has been well studied in ultra high vacuum, much less is known about the interaction between water and RuO 2 in aqueous solution. In this work, in situ surface X-ray scattering measurements combined with density functional theory (DFT) were used to determine the surface structural changes on single-crystal RuO2(110) as a function of potential in acidic electrolyte. The redox peaks at 0.7, 1.1 and 1.4 V vs. reversible hydrogen electrode (RHE) could be attributed to surface transitions associated with the successive deprotonation of –H 2O on the coordinatively unsaturated Ru sites (CUS)more » and hydrogen adsorbed to the bridging oxygen sites. At potentials relevant to the oxygen evolution reaction (OER), an –OO species on the Ru CUS sites was detected, which was stabilized by a neighboring –OH group on the Ru CUS or bridge site. Combining potential-dependent surface structures with their energetics from DFT led to a new OER pathway, where the deprotonation of the –OH group used to stabilize –OO was found to be rate-limiting.« less

  17. Towards identifying the active sites on RuO 2 (110) in catalyzing oxygen evolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rao, Reshma R.; Kolb, Manuel J.; Halck, Niels Bendtsen

    While the surface atomic structure of RuO 2 has been well studied in ultra high vacuum, much less is known about the interaction between water and RuO 2 in aqueous solution. In this work, in situ surface X-ray scattering measurements combined with density functional theory (DFT) were used to determine the surface structural changes on single-crystal RuO2(110) as a function of potential in acidic electrolyte. The redox peaks at 0.7, 1.1 and 1.4 V vs. reversible hydrogen electrode (RHE) could be attributed to surface transitions associated with the successive deprotonation of –H 2O on the coordinatively unsaturated Ru sites (CUS)more » and hydrogen adsorbed to the bridging oxygen sites. At potentials relevant to the oxygen evolution reaction (OER), an –OO species on the Ru CUS sites was detected, which was stabilized by a neighboring –OH group on the Ru CUS or bridge site. Combining potential-dependent surface structures with their energetics from DFT led to a new OER pathway, where the deprotonation of the –OH group used to stabilize –OO was found to be rate-limiting.« less

  18. Charge neutralization in the active site of the catalytic trimer of aspartate transcarbamoylase promotes diverse structural changes.

    PubMed

    Endrizzi, James A; Beernink, Peter T

    2017-11-01

    A classical model for allosteric regulation of enzyme activity posits an equilibrium between inactive and active conformations. An alternative view is that allosteric activation is achieved by increasing the potential for conformational changes that are essential for catalysis. In the present study, substitution of a basic residue in the active site of the catalytic (C) trimer of aspartate transcarbamoylase with a non-polar residue results in large interdomain hinge changes in the three chains of the trimer. One conformation is more open than the chains in both the wild-type C trimer and the catalytic chains in the holoenzyme, the second is closed similar to the bisubstrate-analog bound conformation and the third hinge angle is intermediate to the other two. The active-site 240s loop conformation is very different between the most open and closed chains, and is disordered in the third chain, as in the holoenzyme. We hypothesize that binding of anionic substrates may promote similar structural changes. Further, the ability of the three catalytic chains in the trimer to access the open and closed active-site conformations simultaneously suggests a cyclic catalytic mechanism, in which at least one of the chains is in an open conformation suitable for substrate binding whereas another chain is closed for catalytic turnover. Based on the many conformations observed for the chains in the isolated catalytic trimer to date, we propose that allosteric activation of the holoenzyme occurs by release of quaternary constraint into an ensemble of active-site conformations. © 2017 The Protein Society.

  19. Dynamic Neurovascular Coupling and Uncoupling during Ictal Onset, Propagation, and Termination Revealed by Simultaneous In Vivo Optical Imaging of Neural Activity and Local Blood Volume

    PubMed Central

    Zhao, Mingrui; Schwartz, Theodore H.

    2013-01-01

    Traditional models of ictal propagation involve the concept of an initiation site and a progressive outward march of activation. The process of neurovascular coupling, whereby the brain supplies oxygenated blood to metabolically active neurons presumably results in a similar outward cascade of hyperemia. However, ictal neurovascular coupling has never been assessed in vivo using simultaneous measurements of membrane potential change and hyperemia with wide spatial sampling. In an acute rat ictal model, using simultaneous intrinsic optical signal (IOS) and voltage-sensitive dye (VSD) imaging of cerebral blood volume and membrane potential changes, we demonstrate that seizures consist of multiple dynamic multidirectional waves of membrane potential change with variable onset sites that spread through a widespread network. Local blood volume evolves on a much slower spatiotemporal scale. At seizure onset, the VSD waves extend beyond the IOS signal. During evolution, spatial correlation with hemodynamic signal only exists briefly at the maximal spread of the VSD signal. At termination, the IOS signal extends spatially and temporally beyond the VSD waves. Hence, vascular reactivity evolves in a separate but parallel fashion to membrane potential changes resulting in a mechanism of neurovascular coupling and uncoupling, which is as dynamic as the seizure itself. PMID:22499798

  20. Roles of s3 site residues of nattokinase on its activity and substrate specificity.

    PubMed

    Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong

    2007-09-01

    Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent.

  1. Mercury behaviour and C, N, and P biogeochemical cycles during ecological restoration processes of old mining sites in French Guiana.

    PubMed

    Couic, Ewan; Grimaldi, Michel; Alphonse, Vanessa; Balland-Bolou-Bi, Clarisse; Livet, Alexandre; Giusti-Miller, Stéphanie; Sarrazin, Max; Bousserrhine, Noureddine

    2018-04-25

    Several decades of gold mining extraction activities in the Amazonian rainforest have caused deforestation and pollution. While ecological rehabilitation is essential for restoring biodiversity and decreasing erosion on deforested lands, few studies note the behaviour or toxicity of trace elements during the rehabilitation process. Our original study focused on the potential use of microbial activity and Hg speciation and compared them with As, Cu, Zn and Cr speciation in assessing the chemical and biological quality of ecological restoration efforts. We sampled two sites in French Guyana 17 years after rehabilitation efforts began. The former site was actively regenerated (R) with the leguminous species Clitoria racemosa and Acacia mangium, and the second site was passively regenerated with spontaneous vegetation (Sv). We also sampled soil from a control site without a history of gold mining (F). We performed microcosm soil experiments for 30 days, where trace element speciation and enzyme activities (i.e., FDA, dehydrogenase, β-glucosidase, urease, alkaline and acid phosphatase) were estimated to characterise the behaviour of trace elements and the soil microbial activity. As bioindicators, the use of soil microbial carbon biomass and soil enzyme activities related to the carbon and phosphorus cycles seems to be relevant for assessing soil quality in rehabilitated and regenerated old mining sites. Our results showed that restoration with leguminous species had a positive effect on soil chemical quality and on soil microbial bioindicators, with activities that tended toward natural non-degraded soil (F). Active restoration processes also had a positive effect on Hg speciation by reducing its mobility. While in Sv we found more exchangeable and soluble mercury, in regenerated sites, Hg was mostly bound to organic matter. These results also suggested that enzyme activities and mercury cycles are sensitive to land restoration and must be considered when evaluating the efficiency of restoration processes.

  2. Seasonal and diel patterns in cetacean use and foraging at a potential marine renewable energy site.

    PubMed

    Nuuttila, Hanna K; Bertelli, Chiara M; Mendzil, Anouska; Dearle, Nessa

    2018-04-01

    Marine renewable energy (MRE) developments often coincide with sites frequented by small cetaceans. To understand habitat use and assess potential impact from development, echolocation clicks were recorded with acoustic click loggers (C-PODs) in Swansea Bay, Wales (UK). General Additive Models (GAMs) were applied to assess the effects of covariates including month, hour, tidal range and temperature. Analysis of inter-click intervals allowed the identification of potential foraging events as well as patterns of presence and absence. Data revealed year-round presence of porpoise, with distinct seasonal and diel patterns. Occasional acoustic encounters of dolphins were also recorded. This study provides further evidence of the need for assessing temporal trends in cetacean presence and habitat use in areas considered for development. These findings could assist MRE companies to monitor and mitigate against disturbance from construction, operation and decommissioning activities by avoiding times when porpoise presence and foraging activity is highest in the area. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Nevada National Security Site Environmental Report 2011 Attachment A: Site Description

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cathy Wills, ed.

    2012-09-12

    This attachment expands on the general description of the Nevada National Security Site (NNSS) presented in the Introduction to the Nevada National Security Site Environmental Report 2011. Included are subsections that summarize the site's geological, hydrological, climatological, and ecological setting and the cultural resources of the NNSS. The subsections are meant to aid the reader in understanding the complex physical and biological environment of the NNSS. An adequate knowledge of the site's environment is necessary to assess the environmental impacts of new projects, design and implement environmental monitoring activities for current site operations, and assess the impacts of site operationsmore » on the public residing in the vicinity of the NNSS. The NNSS environment contributes to several key features of the site that afford protection to the inhabitants of adjacent areas from potential exposure to radioactivity or other contaminants resulting from NNSS operations. These key features include the general remote location of the NNSS, restricted access, extended wind transport times, the great depths to slow-moving groundwater, little or no surface water, and low population density. This attachment complements the annual summary of monitoring program activities and dose assessments presented in the main body of this report.« less

  4. Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom.

    PubMed

    Kitchen, Sheila A; Bourdelais, Andrea J; Taylor, Alison R

    2018-01-01

    The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability. Recent biophysical and genomic evidence supports widespread presence of homologous sodium (Na + ) and calcium (Ca 2+ ) permeable VGCs in unicellular algae, including marine phytoplankton. We therefore hypothesized that VGCs of these phytoplankton may be an allelopathic target for waterborne neurotoxins produced by K. brevis blooms that could lead to ion channel dysfunction and disruption of signaling in a similar manner to animal Na + VGCs. We examined the interaction of brevetoxin-3 (PbTx-3), a K. brevis neurotoxin, with the Na + /Ca 2+ VGC of the non-toxic diatom Odontella sinensi s using electrophysiology. Single electrode current- and voltage- clamp recordings from O. sinensis in the presence of PbTx-3 were used to examine the toxin's effect on voltage gated Na + /Ca 2+ currents. In silico analysis was used to identify the putative PbTx binding site in the diatoms. We identified Na + /Ca 2+ VCG homologs from the transcriptomes and genomes of 12 diatoms, including three transcripts from O. sinensis and aligned them with site-5 of Na + VGCs, previously identified as the PbTx binding site in animals. Up to 1 µM PbTx had no effect on diatom resting membrane potential or membrane excitability. The kinetics of fast inward Na + /Ca 2+ currents that underlie diatom action potentials were also unaffected. However, the peak inward current was inhibited by 33%, delayed outward current was inhibited by 25%, and reversal potential of the currents shifted positive, indicating a change in permeability of the underlying channels. Sequence analysis showed a lack of conservation of the PbTx binding site in diatom VGC homologs, many of which share molecular features more similar to single-domain bacterial Na + /Ca 2+ VGCs than the 4-domain eukaryote channels. Although membrane excitability and the kinetics of action potential currents were unaffected, the permeation of the channels underlying the diatom action potential was significantly altered in the presence of PbTx-3. However, at environmentally relevant concentrations the effects of PbTx- on diatom voltage activated currents and interference of cell signaling through this pathway may be limited. The relative insensitivity of phytoplankton VGCs may be due to divergence of site-5 (the putative PbTx binding site), and in some cases, such as O. sinensis , resistance to toxin effects may be because of evolutionary loss of the 4-domain eukaryote channel, while retaining a single domain bacterial-like VGC that can substitute in the generation of fast action potentials.

  5. Remediation of petroleum hydrocarbon-contaminated sites by DNA diagnosis-based bioslurping technology.

    PubMed

    Kim, Seungjin; Krajmalnik-Brown, Rosa; Kim, Jong-Oh; Chung, Jinwook

    2014-11-01

    The application of effective remediation technologies can benefit from adequate preliminary testing, such as in lab-scale and Pilot-scale systems. Bioremediation technologies have demonstrated tremendous potential with regards to cost, but they cannot be used for all contaminated sites due to limitations in biological activity. The purpose of this study was to develop a DNA diagnostic method that reduces the time to select contaminated sites that are good candidates for bioremediation. We applied an oligonucleotide microarray method to detect and monitor genes that lead to aliphatic and aromatic degradation. Further, the bioremediation of a contaminated site, selected based on the results of the genetic diagnostic method, was achieved successfully by applying bioslurping in field tests. This gene-based diagnostic technique is a powerful tool to evaluate the potential for bioremediation in petroleum hydrocarbon contaminated soil. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Metal and metalloid accumulation in shrews (Soricomorpha, Mammalia) from two protected Mediterranean coastal sites.

    PubMed

    Sánchez-Chardi, Alejandro; López-Fuster, María José

    2009-04-01

    Although ecotoxicological data on heavy metals are abundant, information on other potentially toxic elements with attributed deficiency and/or toxic disturbances is scarce. Here we quantify zinc, copper, iron, manganese, chromium, molybdenum, strontium, barium, and boron in bones of greater white-toothed shrews, Crocidura russula, inhabiting two protected Mediterranean coastal sites: the Ebro Delta, a wetland impacted by human activities, and the Medas Islands, a reference site. Natural and anthropogenic inputs significantly increase Fe, Mn, Mo, Sr, Ba, and B in specimens from the Ebro Delta, whereas Cu and Cr were higher in Medas' shrews. Principal component analysis allowed complete separation between sites along the first two axes in particular due to B, Sr, and Cu. This study provides metal reference values in bones of insectivores, explores their variability and bioaccumulation patterns in depth, and assesses the potential environmental risk and toxicity for biota exposed to the above elements.

  7. The active site of hydroxynitrile lyase from Prunus amygdalus: Modeling studies provide new insights into the mechanism of cyanogenesis

    PubMed Central

    Dreveny, Ingrid; Kratky, Christoph; Gruber, Karl

    2002-01-01

    The FAD-dependent hydroxynitrile lyase from almond (Prunus amygdalus, PaHNL) catalyzes the cleavage of R-mandelonitrile into benzaldehyde and hydrocyanic acid. Catalysis of the reverse reaction—the enantiospecific formation of α-hydroxynitriles—is now widely utilized in organic syntheses as one of the few industrially relevant examples of enzyme-mediated C–C bond formation. Starting from the recently determined X-ray crystal structure, systematic docking calculations with the natural substrate were used to locate the active site of the enzyme and to identify amino acid residues involved in substrate binding and catalysis. Analysis of the modeled substrate complexes supports an enzymatic mechanism that includes the flavin cofactor as a mere "spectator" of the reaction and relies on general acid/base catalysis by the conserved His-497. Stabilization of the negative charge of the cyanide ion is accomplished by a pronounced positive electrostatic potential at the binding site. PaHNL activity requires the FAD cofactor to be bound in its oxidized form, and calculations of the pKa of enzyme-bound HCN showed that the observed inactivation upon cofactor reduction is largely caused by the reversal of the electrostatic potential within the active site. The suggested mechanism closely resembles the one proposed for the FAD-independent, and structurally unrelated HNL from Hevea brasiliensis. Although the actual amino acid residues involved in the catalytic cycle are completely different in the two enzymes, a common motif for the mechanism of cyanogenesis (general acid/base catalysis plus electrostatic stabilization of the cyanide ion) becomes evident. PMID:11790839

  8. Use of biological characteristics of common carp (Cyprinus carpio) to indicate exposure to hormonally active agents in selected Minnesota streams, 1999

    USGS Publications Warehouse

    Lee, Kathy E.; Blazer, Vicki; Denslow, Nancy D.; Goldstein, Robert M.; Talmage, Philip J.

    2000-01-01

    The presence of HAAs in selected Minnesota streams was indicated by biological characteristics in common carp. Biological characteristics used in this study identified WWTP effluent as a potential source of HAAs. Additionally, fish located at sites upstream of WWTP effluent primarily draining agricultural land show indications of HAAs, which may be the result of agricultural runoff or other sources of HAAs. There was variability among all sites and among sites within each site group. Differences among sites may be due to differences in water chemistry or fish exposure time. Natural variation in the biological characteristics may account for some of the differences observed in this study. This study and others indicate the presence of HAAs in surface water and the potential signs of endocrine disruption in resident fish populations. Detailed controlled studies could confirm the effects of particular chemicals such as pesticides or components of WWTPs on fish reproduction and population structure.

  9. 2010 Ecological Survey of the Pacific Northwest National Laboratory Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chamness, Michele A.; Perry, Christopher; Downs, Janelle L.

    The U.S. Department of Energy (DOE) Pacific Northwest Site Office (PNSO) oversees and manages the DOE contract for the Pacific Northwest National Laboratory (PNNL), a DOE Office of Science multi-program laboratory located in Richland, Washington. PNSO is responsible for ensuring that all activities conducted on the PNNL Site comply with applicable laws, policies, and DOE orders. The DOE Pacific Northwest Site Office Cultural and Biological Resources Management Plan (DOE/PNSO 2008) addresses the requirement for annual surveys and monitoring for species of concern and to identify and map invasive species. In addition to the requirement for an annual survey, proposed projectmore » activities must be reviewed to assess any potential environmental consequences of conducting the project. The assessment process requires a thorough understanding of the resources present, the potential impacts of a proposed action to those resources, and the ultimate consequences of those actions. The PNNL Site is situated on the southeastern corner of the DOE Hanford Site, located at the north end of the city of Richland in south-central Washington. The site is bordered on the east by the Columbia River, on the west by Stevens Drive, and on the north by the Hanford Site 300 Area (Figure 1). The environmental setting of the PNNL Site is described in Larson and Downs (2009). There are currently two facilities on the PNNL Site: the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL), and the recently completed Physical Sciences Facility (PSF). This report describes the results of the annual survey of the biological resources found on the undeveloped portions of the PNNL Site in 2010. A brief description of the methods PNNL ecologists used to conduct the surveys and the results of the surveys are presented. Actions taken to fully delineate noxious weed populations discovered in 2009 and efforts in 2010 to control those weeds also are described. Appendix A provides a list of plant and animal species identified on the PNNL Site.« less

  10. Molecular basis for zinc potentiation at strychnine-sensitive glycine receptors.

    PubMed

    Miller, Paul S; Da Silva, Helena M A; Smart, Trevor G

    2005-11-11

    The divalent cation Zn(2+) is a potent potentiator at the strychnine-sensitive glycine receptor (GlyR). This occurs at nanomolar concentrations, which are the predicted endogenous levels of extracellular neuronal Zn(2+). Using structural modeling and functional mutagenesis, we have identified the molecular basis for the elusive Zn(2+) potentiation site on GlyRs and account for the differential sensitivity of GlyR alpha(1) and GlyR alpha(2) to Zn(2+) potentiation. In addition, juxtaposed to this Zn(2+) site, which is located externally on the N-terminal domain of the alpha subunit, another residue was identified in the nearby Cys loop, a region that is critical for receptor gating in all Cys loop ligand-gated ion channels. This residue acted as a key control element in the allosteric transduction pathway for Zn(2+) potentiation, enabling either potentiation or overt inhibition of receptor activation depending upon the moiety resident at this location. Overall, we propose that Zn(2+) binds to a site on the extracellular outer face of the GlyR alpha subunit and exerts its positive allosteric effect via an interaction with the Cys loop to increase the efficacy of glycine receptor gating.

  11. Influence of demography and environment on persistence in toad populations

    USGS Publications Warehouse

    Lambert, Brad A.; Schorr, Robert A.; Schneider, Scott C.; Muths, Erin L.

    2016-01-01

    Effective conservation of rare species requires an understanding of how potential threats affect population dynamics. Unfortunately, information about population demographics prior to threats (i.e., baseline data) is lacking for many species. Perturbations, caused by climate change, disease, or other stressors can lead to population declines and heightened conservation concerns. Boreal toads (Anaxyrus boreas boreas) have undergone rangewide declines due mostly to the amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd), with only a few sizable populations remaining in the southern Rocky Mountains, USA, that are disease-free. Despite the apparent region-wide occurrence of Bd, our focal populations in central Colorado were disease free over a 14-year capture-mark-recapture study until the recent discovery of Bd at one of the sites. We used recapture data and the Pradel reverse-time model to assess the influence of environmental and site-specific conditions on survival and recruitment. We then forecast changes in the toad populations with 2 growth models; one using an average lambda value to initiate the projection, and one using the most recent value to capture potential effects of the incursion of disease into the system. Adult survival was consistently high at the 3 sites, whereas recruitment was more variable and markedly low at 1 site. We found that active season moisture, active season length, and breeding shallows were important factors in estimating recruitment. Population growth models indicated a slight increase at 1 site but decreasing trends at the 2 other sites, possibly influenced by low recruitment. Insight into declining species management can be gained from information on survival and recruitment and how site-specific environmental factors influence these demographic parameters. Our data are particularly useful because they provide baseline data on demographics in populations before a disease outbreak and enhance our ability to detect changes in population parameters potentially caused by the disease.

  12. Inhibition of erythrocytes δ-aminolevulinic acid dehydratase (ALAD) activity in fish from waters affected by lead smelters

    USGS Publications Warehouse

    Schmitt, Christopher J.; Caldwell, Colleen A.; Olsen, Bill; Serdar, Dave; Coffey, Mike

    2002-01-01

    We assessed the effects on fish of lead (Pb) released to streamsby smelters located in Trail, BC (Canada), E. Helena, MT, Herculaneum, MO, and Glover, MO. Fish were collected by electrofishing from sites located downstream of smelters and from reference sites. Blood from each fish was analyzed for δ-aminolevulinic acid dehydratase (ALAD) activity and hemoglobin (Hb), and samples of blood, liver, or carcass were analyzed for Pb, zinc (Zn), or both. Fish collected downstreamof all four smelters sites had elevated Pb concentrations, decreased ALAD activity, or both relative to their respectivereference sites. At E. Helena, fish from the downstream site also had lower Hb concentrations than fish from upstream. Differences among taxa were also apparent. Consistent with previous studies, ALAD activity in catostomids (Pisces: Catostomidae-northern hog sucker,Hypentelium nigricans;river carpsucker, Carpiodes carpio; largescale sucker, Catostomus macrocheilus; and mountain sucker, C. platyrhynchus) seemed more sensitive to Pb-induced ALADinhibition than the salmonids (Pisces: Salmonidae-rainbow trout,Oncorhynchus mykiss; brook trout,Salvelinus fontinalis) or common carp (Cyprinus carpio). Some of these differences may have resulted from differential accumulation of Zn, which was not measured at all sites. We detected noALAD activity in channel catfish (Ictaluruspunctatus) from either site on the Mississippi River at Herculaneum, MO. Our findings confirmed that Pb is releasedto aquatic ecosystems by smelters and accumulated by fish, andwe documented potentially adverse effects of Pb in fish. We recommend that Zn be measured along with Pb when ALAD activityis used as a biomarker and the collection of at least 10 fish ofa species at each site to facilitate statistical analysis.

  13. Potential negative impacts of nuclear activities on local economies: Rethinking the issue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Metz, W.C.

    1994-10-01

    Surveys of public opinion about perceptions of risk associated with the nuclear fuel cycle have shown that the public professes a widespread feeling of dread, a fear of associated stigmas, and a concern about possible catastrophic nuclear accidents. Various interest groups and state governments that oppose congressionally mandated siting of centralized high-level radioactive waste (HLW) storage and disposal facilities are using this negative imagery to create a powerful, emotional obstacle to the siting process. From statistical analyses of images and location preferences, researchers have claimed that possible significant economic losses could potentially accompany the siting of HLW facilities. However, severalmore » paradoxes, or self-contradictory statements, apparently exist between the responses expressed in surveys and the actual economic and demographic behavior evidenced in the marketplace. Federal policymakers need to evaluate whether the request for a change in siting policy is based on subjective fear of a potential negative economic effect or on proven negative effects. Empirically observed behavior does not support predicted negative economic effects based on survey responses. 41 refs.« less

  14. Staunton 1 reclamation demonstration project. Aquatic ecosystems. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vinikour, W. S.

    1981-02-01

    To provide long-term indications of the potential water quality improvements following reclamation efforts at the Staunton 1 Reclamation Demonstration Project, macroinvertebrates were collected from three on-site ponds and from the receiving stream (Cahokia Creek) for site drainage. Implications for potential benthic community differences resulting from site runoff were disclosed, but macroinvertebrate diversity throughout Cahokia Creek was limited due to an unstable, sandy substrate. The three ponds sampled were the New Pond, which was created as part of the reclamation activities; the Shed Pond, which and the Old Pond, which, because it was an existing, nonimpacted pond free of site runoff,more » served as a control. Comparisons of macroinvertebrates from the ponds indicated the potential for the New Pond to develop into a productive ecosystem. Macroinvertebrates in the New Pond were generally species more tolerant of acid mine drainage conditions. However, due to the present limited faunal densities and the undesirable physical and chemical characteristics of the New Pond, the pond should not be stocked with fish at this time.« less

  15. A fast stimulability screening protocol for neuronal cultures on microelectrode arrays.

    PubMed

    Kapucu, Fikret E; Tanskanen, Jarno M A; Yuan, Yuting; Hyttinen, Jari A K

    2015-01-01

    Microelectrode arrays (MEAs) are used to study the electrical activity in brain slices and neuronal cultures. MEA experiments for the analysis of electrical stimulation responses require the tissue or culture to be prone to stimulation. For brain slices, potential stimulation sites may be directly visible in microscope, in which case the determination of stimulability at those locations is sufficient. In unstructured neuronal cultures, potential stimulation sites may not be known a priori, and spatial stimulability screening should be performed. Considering, e.g., 59 microelectrode sites, each to be stimulated several times, may result in long screening times, unacceptable with a MEA system without an integrated CO2 incubator, or in high stimulation effects on the networks. Here, we describe an implementation of a fast stimulation protocol employing pseudorandom stimulation site switching aiming at alleviating the network effects of the stimulability screening. In this paper, we show the usability of the proposed protocol by first detecting stimulable locations and subsequently apply repeated stimulation on the identified potentially stimulable locations to observe an exemplary neuronal pathway.

  16. Structure based design, synthesis and biological evaluation of amino phosphonate derivatives as human glucokinase activators.

    PubMed

    Yellapu, Nanda Kumar; Kilaru, Ravendra Babu; Chamarthi, Nagaraju; Pvgk, Sarma; Matcha, Bhaskar

    2017-06-01

    Glucokinase (GK) is a potential therapeutic target of type 2 diabetes and GK activators (GKAs) represent a promising class of small organic molecules which enhance GK activity. Based on the configuration and conformation of the allosteric site of GK, we have designed a novel class of amino phosphonate derivatives in order to develop potent GKAs. The QSAR model developed using numerous descriptors revealed its potential with the best effective statistical values of RMSE=1.52 and r 2 =0.30. Moreover, application of this model on the present test set GKAs proved to be worthy to predict their activities as a better linear relationship was observed with RMSE=0.14 and r 2 =0.88. ADME studies and Lipinski filters encouraged them as safer therapeutics. The molecular dynamics and docking studies against the GK allosteric site revealed that all GKAs bind with best affinities and the complexes are strengthened by H-bonding, phosphonate salt bridges, hydrophobic and arene cat ionic interactions. Finally, in vitro evaluation with human liver GK revealed their potential to increase the GK activity by different folds. The results from QSAR, ADME, molecular docking and in vitro assays strongly suggested that the present molecules could be used as effective and safer therapeutics to control and manage type 2 diabetes. Copyright © 2017. Published by Elsevier Ltd.

  17. A study on the correlation between soil radon potential and average indoor radon potential in Canadian cities.

    PubMed

    Chen, Jing; Ford, Ken L

    2017-01-01

    Exposure to indoor radon is identified as the main source of natural radiation exposure to the population. Since radon in homes originates mainly from soil gas radon, it is of public interest to study the correlation between radon in soil and radon indoors in different geographic locations. From 2007 to 2010, a total of 1070 sites were surveyed for soil gas radon and soil permeability. Among the sites surveyed, 430 sites were in 14 cities where indoor radon information is available from residential radon and thoron surveys conducted in recent years. It is observed that indoor radon potential (percentage of homes above 200 Bq m -3 ; range from 1.5% to 42%) correlates reasonably well with soil radon potential (SRP: an index proportional to soil gas radon concentration and soil permeability; average SRP ranged from 8 to 26). In five cities where in-situ soil permeability was measured at more than 20 sites, a strong correlation (R 2  = 0.68 for linear regression and R 2  = 0.81 for non-linear regression) was observed between indoor radon potential and soil radon potential. This summary report shows that soil gas radon measurement is a practical and useful predictor of indoor radon potential in a geographic area, and may be useful for making decisions around prioritizing activities to manage population exposure and future land-use planning. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  18. Identification and characterization of the sodium-binding site of activated protein C.

    PubMed

    He, X; Rezaie, A R

    1999-02-19

    Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.

  19. Concealed Accessory Pathways with a Single Ventricular and Two Discrete Atrial Insertion Sites.

    PubMed

    Kipp, Ryan T; Abu Sham'a, Raed; Hiroyuki, Ito; Han, Frederick T; Refaat, Marwan; Hsu, Jonathan C; Field, Michael E; Kopp, Douglas E; Marcus, Gregory M; Scheinman, Melvin M; Hoffmayer, Kurt S

    2017-03-01

    Atrioventricular reciprocating tachycardia (AVRT) utilizing a concealed accessory pathway is common. It is well appreciated that some patients may have multiple accessory pathways with separate atrial and ventricular insertion sites. We present three cases of AVRT utilizing concealed pathways with evidence that each utilizing a single ventricular insertion and two discrete atrial insertion sites. In case one, two discrete atrial insertion sites were mapped in two separate procedures, and only during the second ablation was the Kent potential identified. Ablation of the Kent potential at this site remote from the two atrial insertion sites resulted in the termination of the retrograde conduction in both pathways. Case two presented with supraventricular tachycardia (SVT) with alternating eccentric atrial activation patterns without alteration in the tachycardia cycle length. The two distinct atrial insertion sites during orthodromic AVRT and ventricular pacing were targeted and each of the two atrial insertion sites were successfully mapped and ablated. In case three, retrograde decremental conduction utilizing both atrial insertion sites was identified prior to ablation. After mapping and ablation of the first discrete atrial insertion site, tachycardia persisted utilizing the second atrial insertion site. Only after ablation of the second atrial insertion site was SVT noninducible, and VA conduction was no longer present. Concealed retrograde accessory pathways with discrete atrial insertion sites may have a common ventricular insertion site. Identification and ablation of the ventricular insertion site or the separate discrete atrial insertion sites result in successful treatment. © 2017 Wiley Periodicals, Inc.

  20. Grounds for Movement: Green School Grounds as Sites for Promoting Physical Activity

    ERIC Educational Resources Information Center

    Dyment, J. E.; Bell, A. C.

    2008-01-01

    An environmental factor of particular importance to children's physical activity levels appears to be the presence of parks and open space. Thus, in promoting children's health, school grounds merit consideration as a potential setting for intervention. This paper explores how "green" school grounds, which contain a greater diversity of…

  1. Design and synthesis of dual inhibitors of acetylcholinesterase and serotonin transporter targeting potential agents for Alzheimer's disease.

    PubMed

    Kogen, Hiroshi; Toda, Narihiro; Tago, Keiko; Marumoto, Shinji; Takami, Kazuko; Ori, Mayuko; Yamada, Naho; Koyama, Kazuo; Naruto, Shunji; Abe, Kazumi; Yamazaki, Reina; Hara, Takao; Aoyagi, Atsushi; Abe, Yasuyuki; Kaneko, Tsugio

    2002-10-03

    Highly efficient acetylcholinesterase (AChE) and serotonin transporter (SERT) dual inhibitors, (S)-4 and (R)-13 were designed and synthesized on the basis of the hypothetical model of AChE active site. Both compounds showed potent inhibitory activities against AChE and SERT. [structure: see text

  2. TRPV1: A Potential Drug Target for Treating Various Diseases

    PubMed Central

    Brito, Rafael; Sheth, Sandeep; Mukherjea, Debashree; Rybak, Leonard P.; Ramkumar, Vickram

    2014-01-01

    Transient receptor potential vanilloid 1 (TRPV1) is an ion channel present on sensory neurons which is activated by heat, protons, capsaicin and a variety of endogenous lipids termed endovanilloids. As such, TRPV1 serves as a multimodal sensor of noxious stimuli which could trigger counteractive measures to avoid pain and injury. Activation of TRPV1 has been linked to chronic inflammatory pain conditions and peripheral neuropathy, as observed in diabetes. Expression of TRPV1 is also observed in non-neuronal sites such as the epithelium of bladder and lungs and in hair cells of the cochlea. At these sites, activation of TRPV1 has been implicated in the pathophysiology of diseases such as cystitis, asthma and hearing loss. Therefore, drugs which could modulate TRPV1 channel activity could be useful for the treatment of conditions ranging from chronic pain to hearing loss. This review describes the roles of TRPV1 in the normal physiology and pathophysiology of selected organs of the body and highlights how drugs targeting this channel could be important clinically. PMID:24861977

  3. Corrective Action Investigation Plan for Corrective Action Unit 528: Polychlorinated Biphenyls Contamination, Nevada Test Site, Nevada, Rev. 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 528, Polychlorinated Biphenyls Contamination (PCBs), Nevada Test Site (NTS), Nevada, under the Federal Facility Agreement and Consent Order. Located in the southwestern portion of Area 25 on the NTS in Jackass Flats (adjacent to Test Cell C [TCC]), CAU 528 consists of Corrective Action Site 25-27-03, Polychlorinated Biphenyls Surface Contamination. Test Cell C was built to support the Nuclear Rocket Development Stationmore » (operational between 1959 and 1973) activities including conducting ground tests and static firings of nuclear engine reactors. Although CAU 528 was not considered as a direct potential source of PCBs and petroleum contamination, two potential sources of contamination have nevertheless been identified from an unknown source in concentrations that could potentially pose an unacceptable risk to human health and/or the environment. This CAU's close proximity to TCC prompted Shaw to collect surface soil samples, which have indicated the presence of PCBs extending throughout the area to the north, east, south, and even to the edge of the western boundary. Based on this information, more extensive field investigation activities are being planned, the results of which are to be used to support a defensible evaluation of corrective action alternatives in the corrective action decision document.« less

  4. Computational active site analysis of molecular pathways to improve functional classification of enzymes.

    PubMed

    Ozyurt, A Sinem; Selby, Thomas L

    2008-07-01

    This study describes a method to computationally assess the function of homologous enzymes through small molecule binding interaction energy. Three experimentally determined X-ray structures and four enzyme models from ornithine cyclo-deaminase, alanine dehydrogenase, and mu-crystallin were used in combination with nine small molecules to derive a function score (FS) for each enzyme-model combination. While energy values varied for a single molecule-enzyme combination due to differences in the active sites, we observe that the binding energies for the entire pathway were proportional for each set of small molecules investigated. This proportionality of energies for a reaction pathway appears to be dependent on the amino acids in the active site and their direct interactions with the small molecules, which allows a function score (FS) to be calculated to assess the specificity of each enzyme. Potential of mean force (PMF) calculations were used to obtain the energies, and the resulting FS values demonstrate that a measurement of function may be obtained using differences between these PMF values. Additionally, limitations of this method are discussed based on: (a) larger substrates with significant conformational flexibility; (b) low homology enzymes; and (c) open active sites. This method should be useful in accurately predicting specificity for single enzymes that have multiple steps in their reactions and in high throughput computational methods to accurately annotate uncharacterized proteins based on active site interaction analysis. 2008 Wiley-Liss, Inc.

  5. Long-term application of winery wastewater - Effect on soil microbial populations and soil chemistry

    NASA Astrophysics Data System (ADS)

    Mosse, Kim; Patti, Antonio; Smernik, Ron; Cavagnaro, Timothy

    2010-05-01

    The ability to reuse winery wastewater (WWW) has potential benefits both with respect to treatment of a waste stream, as well as providing a beneficial water resource in water limited regions such as south-eastern Australia, California and South Africa. Over an extended time period, this practice leads to changes in soil chemistry, and potentially, also to soil microbial populations. In this study, we compared the short term effects of WWW (both treated and untreated) application on soil biology and chemistry in two adjacent paired sites with the same soil type, one of which had received WWW for approximately 30 years, and the other which had not. The paired sites were treated with an industrially relevant quantity of WWW, and the soil microbial activity (measured as soil CO2 efflux) and common soil physicochemical properties were monitored over a 16-day period. In addition, Solid State 13C NMR was employed on whole soil samples from the two sites, to measure and compare the chemical nature of the soil organic matter at the paired sites. The acclimatised soil showed a high level of organic matter and a greater spike in microbial activity following WWW addition, in comparison with the non-acclimatised soil, suggesting differences in soil chemistry and soil microbial communities between the two sites. Soil nitrate and phosphorus levels showed significant differences between WWW treatments; these differences likely to be microbially mediated.

  6. Amino acid sequence of human cholinesterase. Annual report, 30 September 1984-30 September 1985

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lockridge, O.

    1985-10-01

    The active-site serine residue is located 198 amino acids from the N-terminal. The active-site peptide was isolated from three different genetic types of human serum cholinesterase: from usual, atypical, and atypical-silent genotypes. It was found that the amino acid sequence of the active-site peptide was identical in all three genotypes. Comparison of the complete sequences of cholinesterase from human serum and acetylcholinesterase from the electric organ of Torpedo californica shows an identity of 53%. Cholinesterase is of interest to the Department of Defense because cholinesterase protects against organophosphate poisons of the type used in chemical warfare. The structural results presentedmore » here will serve as the basis for cloning the gene for cholinesterase. The potential uses of large amounts of cholinesterase would be for cleaning up spills of organophosphates and possibly for detoxifying exposed personnel.« less

  7. Microbial Functional Potential and Community Composition in Permafrost-Affected Soils of the NW Canadian Arctic

    PubMed Central

    Frank-Fahle, Béatrice A.; Yergeau, Étienne; Greer, Charles W.; Lantuit, Hugues; Wagner, Dirk

    2014-01-01

    Permafrost-affected soils are among the most obvious ecosystems in which current microbial controls on organic matter decomposition are changing as a result of global warming. Warmer conditions in polygonal tundra will lead to a deepening of the seasonal active layer, provoking changes in microbial processes and possibly resulting in exacerbated carbon degradation under increasing anoxic conditions. To identify current microbial assemblages in carbon rich, water saturated permafrost environments, four polygonal tundra sites were investigated on Herschel Island and the Yukon Coast, Western Canadian Arctic. Ion Torrent sequencing of bacterial and archaeal 16S rRNA amplicons revealed the presence of all major microbial soil groups and indicated a local, vertical heterogeneity of the polygonal tundra soil community with increasing depth. Microbial diversity was found to be highest in the surface layers, decreasing towards the permafrost table. Quantitative PCR analysis of functional genes involved in carbon and nitrogen-cycling revealed a high functional potential in the surface layers, decreasing with increasing active layer depth. We observed that soil properties driving microbial diversity and functional potential varied in each study site. These results highlight the small-scale heterogeneity of geomorphologically comparable sites, greatly restricting generalizations about the fate of permafrost-affected environments in a warming Arctic. PMID:24416279

  8. Influence of codon usage bias on FGLamide-allatostatin mRNA secondary structure.

    PubMed

    Martínez-Pérez, Francisco; Bendena, William G; Chang, Belinda S W; Tobe, Stephen S

    2011-03-01

    The FGLamide allatostatins (ASTs) are invertebrate neuropeptides which inhibit juvenile hormone biosynthesis in Dictyoptera and related orders. They also show myomodulatory activity. FGLamide AST nucleotide frequencies and codon bias were investigated with respect to possible effects on mRNA secondary structure. 367 putative FGLamide ASTs and their potential endoproteolytic cleavage sites were identified from 40 species of crustaceans, chelicerates and insects. Among these, 55% comprised only 11 amino acids. An FGLamide AST consensus was identified to be (X)(1→16)Y(S/A/N/G)FGLGKR, with a strong bias for the codons UUU encoding for Phe and AAA for Lys, which can form strong Watson-Crick pairing in all peptides analyzed. The physical distance between these codons favor a loop structure from Ser/Ala-Phe to Lys-Arg. Other loop and hairpin loops were also inferred from the codon frequencies in the N-terminal motif, and the first amino acids from the C-terminal motif, or the dibasic potential endoproteolytic cleavage site. Our results indicate that nucleotide frequencies and codon usage bias in FGLamide ASTs tend to favor mRNA folds in the codon sequence in the C-terminal active peptide core and at the dibasic potential endoproteolytic cleavage site. Copyright © 2010 Elsevier Inc. All rights reserved.

  9. Allosteric Modulation of Chemoattractant Receptors

    PubMed Central

    Allegretti, Marcello; Cesta, Maria Candida; Locati, Massimo

    2016-01-01

    Chemoattractants control selective leukocyte homing via interactions with a dedicated family of related G protein-coupled receptor (GPCR). Emerging evidence indicates that the signaling activity of these receptors, as for other GPCR, is influenced by allosteric modulators, which interact with the receptor in a binding site distinct from the binding site of the agonist and modulate the receptor signaling activity in response to the orthosteric ligand. Allosteric modulators have a number of potential advantages over orthosteric agonists/antagonists as therapeutic agents and offer unprecedented opportunities to identify extremely selective drug leads. Here, we resume evidence of allosterism in the context of chemoattractant receptors, discussing in particular its functional impact on functional selectivity and probe/concentration dependence of orthosteric ligands activities. PMID:27199992

  10. Methane seepage effects on biodiversity and biological traits of macrofauna inhabiting authigenic carbonates

    NASA Astrophysics Data System (ADS)

    Levin, Lisa A.; Mendoza, Guillermo F.; Grupe, Benjamin M.

    2017-03-01

    Authigenic carbonate rocks at methane seeps are recognized as hosting diverse and abundant invertebrate assemblages, with potential forcing from fluid seepage and hydrography. Mensurative studies of carbonate macrofauna (>0.3 mm) at Hydrate Ridge, OR revealed little effect of water depth and overlying oxygenation (at 600 m and 800 m) but a large influence of seepage activity on density, taxonomic composition, diversity, and biological traits (feeding, lifestyle, motility, size and calcification). Rocks exposed to active seepage had 3-4× higher total macrofaunal densities than under inactive conditions. Assemblages exhibited higher species richness and reduced evenness (greater dominance) under active seepage than inactive conditions, but no difference in H‧ or rarefaction diversity. Actively seeping sites were characterized by errant (motile), bacterial grazing, small- and medium-sized, heavily calcified species, whereas inactive sites exhibited a greater diversity of feeding modes and more burrowers, sessile, large and lightly calcified species. Active rocks supported more exogonid (Syllidae), ampharetid, and cirratulid polychaetes, provannid snails, pyropeltid limpets, nemerteans, and sponges; whereas inactive rocks supported higher densities of ophiuroids, isopods, gammarid amphipods, hydroids, Typosyllis (Syllidae) and tanaids. Transplant experiments, in which rocks were transferred between active and inactive sites at Hydrate Ridge North (600 m), revealed that assemblages respond within 13 months to increase or cessation of seepage, taking on the feeding, size and calcification characteristics of the background fauna at the new site. Lifestyles and motility patterns shifted more slowly as the sessile, attached species did not track seepage as quickly. Provannid snails and pyropeltid limpets rapidly colonized rocks transplanted to active sites and disappeared when transplanted to inactive sites. Given the known variability of fluid fluxes and rapid community response, a mosaic of communities changing in space and time is hypothesized to generate the relatively high species diversity at methane seeps.

  11. 75 FR 62435 - Agency Information Collection Activities: Submission for the Office of Management and Budget (OMB...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-08

    ... Proposed Geologic Repository at Yucca Mountain, Nevada.'' 3. Current OMB approval number: 3150-0199. [[Page... potential high-level waste geologic repository site, or wishing to participate in a license application review for the potential geologic repository. 7. An estimate of the number of annual responses: 3. 8. The...

  12. 77 FR 70190 - Agency Information Collection Activities: Submission for the Office of Management and Budget (OMB...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-23

    ... Repositories.'' 3. Current OMB approval number: 3150-0127. 4. The form number if applicable: N/A. 5. How often... the NRC staff regarding review of a potential high-level radioactive waste geologic repository site, or wishing to participate in a license application review for a potential geologic repository (other...

  13. Conceptual Model of Iodine Behavior in the Subsurface at the Hanford Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Truex, Michael J.; Lee, Brady D.; Johnson, Christian D.

    The fate and transport of 129I in the environment and potential remediation technologies are currently being studied as part of environmental remediation activities at the Hanford Site. A conceptual model describing the nature and extent of subsurface contamination, factors that control plume behavior, and factors relevant to potential remediation processes is needed to support environmental remedy decisions. Because 129I is an uncommon contaminant, relevant remediation experience and scientific literature are limited. Thus, the conceptual model also needs to both describe known contaminant and biogeochemical process information and to identify aspects about which additional information needed to effectively support remedy decisions.more » this document summarizes the conceptual model of iodine behavior relevant to iodine in the subsurface environment at the Hanford site.« less

  14. Potential methane production and oxidation in soil reclamation covers of an oil sands mining site in Alberta, Canada

    NASA Astrophysics Data System (ADS)

    Pum, Lisa; Reichenauer, Thomas; Germida, Jim

    2015-04-01

    Anthropogenic activities create a number of significant greenhouse gases and thus potentially contribute to global warming. Methane production is significant in some agricultural production systems and from wetlands. In soil, methane can be oxidised by methanotrophic bacteria. However, little is known about methane production and oxidation in oil sand reclamation covers. The purpose of this study was to investigate methane production and oxidation potential of tailing sands and six different reclamation layers of oil sands mining sites in Alberta, Canada. Methane production and oxidation potential were investigated in laboratory scale microcosms through continuous headspace analysis using gas chromatography. Samples from a reclamation layer were collected at the Canadian Natural Resources Limited (CNRL) reclamation site at depths of 0-10 cm, 10-20 cm and 20-40 cm in October 2014. In addition, tailing sands provided by Suncor Energy Inc. and soil from a CNRL wetland were studied for methane production. Samples were dried, crushed and sieved to 4 mm, packed into serum bottle microcosms and monitored for eight weeks. Methane production potential was assessed by providing an anoxic environment and by adjusting the samples to a moisture holding capacity of 100 %. Methane oxidation potential was examined by an initial application of 2 vol % methane to the microcosms and by adjusting the samples to a moisture holding capacity of 50 %. Microcosm headspace gas was analysed for methane, carbon dioxide, nitrous oxide and oxygen. All experiments were carried out in triplicates, including controls. SF6 and Helium were used as internal standards to detect potential leaks. Our results show differences for methane production potential between the soil depths, tailing sands and wetlands. Moreover, there were differences in the methane oxidation potential of substrate from the three depths investigated and between the reclamation layers. In conclusion, the present study shows that reclamation layers for oil sands mining sites in Alberta, Canada have the potential to oxidize on-site produced methane emissions to the less harmful greenhouse gas carbon dioxide. Such oxidation might mitigate impacts of methane production from these sites.

  15. P-selectin is a nanotherapeutic delivery target in the tumor microenvironment.

    PubMed

    Shamay, Yosi; Elkabets, Moshe; Li, Hongyan; Shah, Janki; Brook, Samuel; Wang, Feng; Adler, Keren; Baut, Emily; Scaltriti, Maurizio; Jena, Prakrit V; Gardner, Eric E; Poirier, John T; Rudin, Charles M; Baselga, José; Haimovitz-Friedman, Adriana; Heller, Daniel A

    2016-06-29

    Disseminated tumors are poorly accessible to nanoscale drug delivery systems because of the vascular barrier, which attenuates extravasation at the tumor site. We investigated P-selectin, a molecule expressed on activated vasculature that facilitates metastasis by arresting tumor cells at the endothelium, for its potential to target metastases by arresting nanomedicines at the tumor endothelium. We found that P-selectin is expressed on cancer cells in many human tumors. To develop a targeted drug delivery platform, we used a fucosylated polysaccharide with nanomolar affinity to P-selectin. The nanoparticles targeted the tumor microenvironment to localize chemotherapeutics and a targeted MEK (mitogen-activated protein kinase kinase) inhibitor at tumor sites in both primary and metastatic models, resulting in superior antitumor efficacy. In tumors devoid of P-selectin, we found that ionizing radiation guided the nanoparticles to the disease site by inducing P-selectin expression. Radiation concomitantly produced an abscopal-like phenomenon wherein P-selectin appeared in unirradiated tumor vasculature, suggesting a potential strategy to target disparate drug classes to almost any tumor. Copyright © 2016, American Association for the Advancement of Science.

  16. A catalytic approach to estimate the redox potential of heme-peroxidases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ayala, Marcela; Roman, Rosa; Vazquez-Duhalt, Rafael

    2007-06-08

    The redox potential of heme-peroxidases varies according to a combination of structural components within the active site and its vicinities. For each peroxidase, this redox potential imposes a thermodynamic threshold to the range of oxidizable substrates. However, the instability of enzymatic intermediates during the catalytic cycle precludes the use of direct voltammetry to measure the redox potential of most peroxidases. Here we describe a novel approach to estimate the redox potential of peroxidases, which directly depends on the catalytic performance of the activated enzyme. Selected p-substituted phenols are used as substrates for the estimations. The results obtained with this catalyticmore » approach correlate well with the oxidative capacity predicted by the redox potential of the Fe(III)/Fe(II) couple.« less

  17. Crystal Structure of the Dithiol Oxidase DsbA Enzyme from Proteus Mirabilis Bound Non-covalently to an Active Site Peptide Ligand

    PubMed Central

    Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A.; Fairlie, David P.; Martin, Jennifer L.

    2014-01-01

    The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. PMID:24831013

  18. Fear of feces? Trade-offs between disease risk and foraging drive animal activity around raccoon latrines

    USGS Publications Warehouse

    Weinstein, Sara B.; Moura, Chad W.; Mendez, Jon Francis; Lafferty, Kevin D.

    2017-01-01

    Fear of predation alters prey behavior, which can indirectly alter entire landscapes. A parasite-induced ecology of fear might also exist if animals avoid parasite-contaminated resources when infection costs outweigh foraging benefits. To investigate whether animals avoid parasite contaminated sites, and if such avoidance balances disease costs and foraging gains, we monitored animal behavior at raccoon latrines – sites that concentrate both seeds and pathogenic parasite eggs. Using wildlife cameras, we documented over 40 potentially susceptible vertebrate species in latrines and adjacent habitat. Latrine contact rates reflected background activity, diet preferences and disease risk. Disease-tolerant raccoons and rats displayed significant site attraction, while susceptible birds and small mammals avoided these high-risk sites. This suggests that parasites, like predators, might create a landscape of fear for vulnerable hosts. Such non-consumptive parasite effects could alter disease transmission, population dynamics, and even ecosystem structure.

  19. Computational evaluation of sub-nanometer cluster activity of singly exposed copper atom with various coordinative environment in catalytic CO2 transformation

    NASA Astrophysics Data System (ADS)

    Shanmugam, Ramasamy; Thamaraichelvan, Arunachalam; Ganesan, Tharumeya Kuppusamy; Viswanathan, Balasubramanian

    2017-02-01

    Metal cluster, at sub-nanometer level has a unique property in the activation of small molecules, in contrast to that of bulk surface. In the present work, singly exposed active site of copper metal cluster at sub-nanometer level was designed to arrive at the energy minimised configurations, binding energy, electrostatic potential map, frontier molecular orbitals and partial density of states. The ab initio molecular dynamics was carried out to probe the catalytic nature of the cluster. Further, the stability of the metal cluster and its catalytic activity in the electrochemical reduction of CO2 to CO were evaluated by means of computational hydrogen electrode via calculation of the free energy profile using DFT/B3LYP level of theory in vacuum. The activity of the cluster is ascertained from the fact that the copper atom, present in a two coordinative environment, performs a more selective conversion of CO2 to CO at an applied potential of -0.35 V which is comparatively lower than that of higher coordinative sites. The present study helps to design any sub-nano level metal catalyst for electrochemical reduction of CO2 to various value added chemicals.

  20. Multi-Modal Active Perception for Autonomously Selecting Landing Sites on Icy Moons

    NASA Technical Reports Server (NTRS)

    Arora, A.; Furlong, P. M.; Wong, U.; Fong, T.; Sukkarieh, S.

    2017-01-01

    Selecting suitable landing sites is fundamental to achieving many mission objectives in planetary robotic lander missions. However, due to sensing limitations, landing sites which are both safe and scientifically valuable often cannot be determined reliably from orbit, particularly, in icy moon missions where orbital sensing data is noisy and incomplete. This paper presents an active perception approach to Entry Descent and Landing (EDL) which enables the lander to autonomously plan informative descent trajectories, acquire high quality sensing data during descent and exploit this additional information to select higher utility landing sites. Our approach consists of two components: probabilistic modeling of landing site features and approximate trajectory planning using a sampling based planner. The proposed framework allows the lander to plan long horizons paths and remain robust to noisy data. Results in simulated environments show large performance improvements over alternative approaches and show promise that our approach has strong potential to improve science return of not only icy moon missions but EDL systems in general.

  1. Application of ground-penetrating radar imagery for three-dimensional visualisation of near-surface structures in ice-rich permafrost, Barrow, Alaska

    USGS Publications Warehouse

    Munroe, Jeffrey S.; Doolittle, James A.; Kanevskiy, Mikhail; Hinkel, Kenneth M.; Nelson, Frederick E.; Jones, Benjamin M.; Shur, Yuri; Kimble, John M.

    2007-01-01

    Three-dimensional ground-penetrating radar (3D GPR) was used to investigate the subsurface structure of ice-wedge polygons and other features of the frozen active layer and near-surface permafrost near Barrow, Alaska. Surveys were conducted at three sites located on landscapes of different geomorphic age. At each site, sediment cores were collected and characterised to aid interpretation of GPR data. At two sites, 3D GPR was able to delineate subsurface ice-wedge networks with high fidelity. Three-dimensional GPR data also revealed a fundamental difference in ice-wedge morphology between these two sites that is consistent with differences in landscape age. At a third site, the combination of two-dimensional and 3D GPR revealed the location of an active frost boil with ataxitic cryostructure. When supplemented by analysis of soil cores, 3D GPR offers considerable potential for imaging, interpreting and 3D mapping of near-surface soil and ice structures in permafrost environments.

  2. Slowing ash mortality: a potential strategy to slam emerald ash borer in outlier sites

    Treesearch

    Deborah G. McCullough; Nathan W. Siegert; John Bedford

    2009-01-01

    Several isolated outlier populations of emerald ash borer (Agrilus planipennis Fairmaire) were discovered in 2008 and additional outliers will likely be found as detection surveys and public outreach activities...

  3. Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations

    PubMed Central

    Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère

    1998-01-01

    To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896

  4. Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

    PubMed

    Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

    2003-04-01

    Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

  5. Inhibition of Urease by Disulfiram, an FDA-Approved Thiol Reagent Used in Humans.

    PubMed

    Díaz-Sánchez, Ángel Gabriel; Alvarez-Parrilla, Emilio; Martínez-Martínez, Alejandro; Aguirre-Reyes, Luis; Orozpe-Olvera, Jesica Aline; Ramos-Soto, Miguel Armando; Núñez-Gastélum, José Alberto; Alvarado-Tenorio, Bonifacio; de la Rosa, Laura Alejandra

    2016-11-26

    Urease is a nickel-dependent amidohydrolase that catalyses the decomposition of urea into carbamate and ammonia, a reaction that constitutes an important source of nitrogen for bacteria, fungi and plants. It is recognized as a potential antimicrobial target with an impact on medicine, agriculture, and the environment. The list of possible urease inhibitors is continuously increasing, with a special interest in those that interact with and block the flexible active site flap. We show that disulfiram inhibits urease in Citrullus vulgaris (CVU), following a non-competitive mechanism, and may be one of this kind of inhibitors. Disulfiram is a well-known thiol reagent that has been approved by the FDA for treatment of chronic alcoholism. We also found that other thiol reactive compounds (l-captopril and Bithionol) and quercetin inhibits CVU. These inhibitors protect the enzyme against its full inactivation by the thiol-specific reagent Aldrithiol (2,2'-dipyridyl disulphide, DPS), suggesting that the three drugs bind to the same subsite. Enzyme kinetics, competing inhibition experiments, auto-fluorescence binding experiments, and docking suggest that the disulfiram reactive site is Cys592, which has been proposed as a "hinge" located in the flexible active site flap. This study presents the basis for the use of disulfiram as one potential inhibitor to control urease activity.

  6. Flexible microelectrode array for interfacing with the surface of neural ganglia

    NASA Astrophysics Data System (ADS)

    Sperry, Zachariah J.; Na, Kyounghwan; Parizi, Saman S.; Chiel, Hillel J.; Seymour, John; Yoon, Euisik; Bruns, Tim M.

    2018-06-01

    Objective. The dorsal root ganglia (DRG) are promising nerve structures for sensory neural interfaces because they provide centralized access to primary afferent cell bodies and spinal reflex circuitry. In order to harness this potential, new electrode technologies are needed which take advantage of the unique properties of DRG, specifically the high density of neural cell bodies at the dorsal surface. Here we report initial in vivo results from the development of a flexible non-penetrating polyimide electrode array interfacing with the surface of ganglia. Approach. Multiple layouts of a 64-channel iridium electrode (420 µm2) array were tested, with pitch as small as 25 µm. The buccal ganglia of invertebrate sea slug Aplysia californica were used to develop handling and recording techniques with ganglionic surface electrode arrays (GSEAs). We also demonstrated the GSEA’s capability to record single- and multi-unit activity from feline lumbosacral DRG related to a variety of sensory inputs, including cutaneous brushing, joint flexion, and bladder pressure. Main results. We recorded action potentials from a variety of Aplysia neurons activated by nerve stimulation, and units were observed firing simultaneously on closely spaced electrode sites. We also recorded single- and multi-unit activity associated with sensory inputs from feline DRG. We utilized spatial oversampling of action potentials on closely-spaced electrode sites to estimate the location of neural sources at between 25 µm and 107 µm below the DRG surface. We also used the high spatial sampling to demonstrate a possible spatial sensory map of one feline’s DRG. We obtained activation of sensory fibers with low-amplitude stimulation through individual or groups of GSEA electrode sites. Significance. Overall, the GSEA has been shown to provide a variety of information types from ganglia neurons and to have significant potential as a tool for neural mapping and interfacing.

  7. Structural insight of dopamine β-hydroxylase, a drug target for complex traits, and functional significance of exonic single nucleotide polymorphisms.

    PubMed

    Kapoor, Abhijeet; Shandilya, Manish; Kundu, Suman

    2011-01-01

    Human dopamine β-hydroxylase (DBH) is an important therapeutic target for complex traits. Several single nucleotide polymorphisms (SNPs) have also been identified in DBH with potential adverse physiological effect. However, difficulty in obtaining diffractable crystals and lack of a suitable template for modeling the protein has ensured that neither crystallographic three-dimensional structure nor computational model for the enzyme is available to aid rational drug design, prediction of functional significance of SNPs or analytical protein engineering. Adequate biochemical information regarding human DBH, structural coordinates for peptidylglycine alpha-hydroxylating monooxygenase and computational data from a partial model of rat DBH were used along with logical manual intervention in a novel way to build an in silico model of human DBH. The model provides structural insight into the active site, metal coordination, subunit interface, substrate recognition and inhibitor binding. It reveals that DOMON domain potentially promotes tetramerization, while substrate dopamine and a potential therapeutic inhibitor nepicastat are stabilized in the active site through multiple hydrogen bonding. Functional significance of several exonic SNPs could be described from a structural analysis of the model. The model confirms that SNP resulting in Ala318Ser or Leu317Pro mutation may not influence enzyme activity, while Gly482Arg might actually do so being in the proximity of the active site. Arg549Cys may cause abnormal oligomerization through non-native disulfide bond formation. Other SNPs like Glu181, Glu250, Lys239 and Asp290 could potentially inhibit tetramerization thus affecting function. The first three-dimensional model of full-length human DBH protein was obtained in a novel manner with a set of experimental data as guideline for consistency of in silico prediction. Preliminary physicochemical tests validated the model. The model confirms, rationalizes and provides structural basis for several biochemical data and claims testable hypotheses regarding function. It provides a reasonable template for drug design as well.

  8. Concentrations of selected metals in Quaternary-age fluvial deposits along the lower Cheyenne and middle Belle Fourche Rivers, western South Dakota, 2009-10

    USGS Publications Warehouse

    Stamm, John F.; Hoogestraat, Galen K.

    2012-01-01

    The headwaters of the Cheyenne and Belle Fourche Rivers drain the Black Hills of South Dakota and Wyoming, an area that has been affected by mining and ore-milling operations since the discovery of gold in 1875. A tributary to the Belle Fourche River is Whitewood Creek, which drains the area of the Homestake Mine, a gold mine that operated from 1876 to 2001. Tailings discharged into Whitewood Creek contained arsenopyrite, an arsenic-rich variety of pyrite associated with gold ore, and mercury used as an amalgam during the gold-extraction process. Approximately 18 percent of the tailings that were discharged remain in fluvial deposits on the flood plain along Whitewood Creek, and approximately 25 percent remain in fluvial deposits on the flood plain along the Belle Fourche River, downstream from Whitewood Creek. In 1983, a 29-kilometer (18-mile) reach of Whitewood Creek and the adjacent flood plain was included in the U.S. Environmental Protection Agency's National Priority List of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980, commonly referred to as a "Superfund site." Listing of this reach of Whitewood Creek was primarily in response to arsenic toxicity of fluvial deposits on the flood plain. Lands along the lower Cheyenne River were transferred to adjoining States and Tribes in response to the Water Resources Development Act (WRDA) of 1999. An amendment in 2000 to WRDA required a study of sediment contamination of the Cheyenne River. In response to the WRDA amendment, the U.S. Geological Survey completed field sampling of reference sites (not affected by mine-tailing disposal) along the lower Belle Fourche and lower Cheyenne Rivers. Reference sites were located on stream terraces that were elevated well above historical stream stages to ensure no contamination from historical mining activity. Sampling of potentially contaminated sites was performed on transects of the active flood plain and adjacent terraces that could potentially be inundated during high-flow events. Sampling began in 2009 and was completed in 2010. A total of 74 geochemical samples were collected from fluvial deposits at reference sites, and 473 samples were collected from potentially contaminated sites. Sediment samples collected were analyzed for 23 metals, including arsenic and mercury. Sequential replicate, split duplicate, and field quality-control samples were analyzed for quality assurance of data-collection methods. The metal concentrations in sediment samples and location information are presented in this report in electronic format (Microsoft Excel), along with non-parametric summary statistics of those data. Cross-sectional topography is graphed with arsenic and mercury concentrations on transects at the potentially contaminated sites. The mean arsenic concentration in reference sediment samples was 8 milligrams per kilogram (mg/kg), compared to 250, 650, and 76 mg/kg for potentially contaminated sediment samples at the surface of the middle Belle Fourche River site, the subsurface of the middle Belle Fourche River site, and the surface of the lower Cheyenne River site, respectively. The mean mercury concentration in reference sediment samples was 16 micrograms per kilogram (μg/kg), compared to 130, 370, and 71 μg/kg for potentially contaminated sediment samples at the surface of the middle Belle Fourche River site, the subsurface of the middle Belle Fourche River site, and the surface of the lower Cheyenne River site, respectively.

  9. Den site activity patterns of adult male and female swift foxes, Vulpes velox, in Northwestern Texas

    USGS Publications Warehouse

    Lemons, P.R.; Ballard, W.B.; Sullivan, R.M.; Sovada, M.A.

    2003-01-01

    Activity of Swift Foxes (Vulpes velox) at den sites was studied in northwestern Texas during pup rearing seasons in 2000 and 2001 to determine role of males in parental care. Twenty-four percent of radio-collared females with a potential to breed successfully raised pups to eight weeks of age. We intensively monitored presence and absence of male and female Swift Foxes at two den sites each year. Females were present >2.6 times more at den sites than males during the pup rearing season. Female and male Swift Foxes largely stayed at dens during diurnal hours and were active away from dens during nocturnal and crepuscular hours. Females and males spent 12.4% and 3.0% more time at dens before pups emerged, than after pups emerged, respectively. Following depredation of one male parent, the female spent 29% less time at the den site. Decrease in time spent at the den by the female following loss of her mate suggested that loss of one parent might severely impact recruitment of Swift Foxes. Our observations indicated that intense Coyote (Canis latrans) depredation may severely impact pup-rearing success as well as the parental care within Swift Fox family groups.

  10. [3Fe-4S] to [4Fe-4S] cluster conversion in Desulfovibrio fructosovorans [NiFe] hydrogenase by site-directed mutagenesis

    PubMed Central

    Rousset, Marc; Montet, Yael; Guigliarelli, Bruno; Forget, Nicole; Asso, Marcel; Bertrand, Patrick; Fontecilla-Camps, Juan C.; Hatchikian, E. Claude

    1998-01-01

    The role of the high potential [3Fe-4S]1+,0 cluster of [NiFe] hydrogenase from Desulfovibrio species located halfway between the proximal and distal low potential [4Fe-4S]2+,1+ clusters has been investigated by using site-directed mutagenesis. Proline 238 of Desulfovibrio fructosovorans [NiFe] hydrogenase, which occupies the position of a potential ligand of the lacking fourth Fe-site of the [3Fe-4S] cluster, was replaced by a cysteine residue. The properties of the mutant enzyme were investigated in terms of enzymatic activity, EPR, and redox properties of the iron-sulfur centers and crystallographic structure. We have shown on the basis of both spectroscopic and x-ray crystallographic studies that the [3Fe-4S] cluster of D. fructosovorans hydrogenase was converted into a [4Fe-4S] center in the P238 mutant. The [3Fe-4S] to [4Fe-4S] cluster conversion resulted in a lowering of approximately 300 mV of the midpoint potential of the modified cluster, whereas no significant alteration of the spectroscopic and redox properties of the two native [4Fe-4S] clusters and the NiFe center occurred. The significant decrease of the midpoint potential of the intermediate Fe-S cluster had only a slight effect on the catalytic activity of the P238C mutant as compared with the wild-type enzyme. The implications of the results for the role of the high-potential [3Fe-4S] cluster in the intramolecular electron transfer pathway are discussed. PMID:9751716

  11. Final state of the Strategic Petroleum Reserve (SPR) Weeks Island Mine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MOLECKE,MARTIN A.

    2000-02-01

    This report documents the decommissioning and abandonment activities at the Weeks Island Strategic Petroleum Reserve (SPR) site, Iberia Parish, Louisiana, that were concluded in 1999. These activities required about six years of intense operational, engineering, geotechnical, and management support efforts, following initiation of site abandonment plans in 1994. The Weeks Island SPR mine stored about 72.5 million bbl of crude oil following oil fill in 1980--1982, until November 1995, when the DOE initiated oil drawdown procedures, with brine refill and oil skimming, and numerous plugging and sealing activities. About 98% of the crude oil was recovered and transferred to othermore » SPR facilities in Louisiana and Texas; a small amount was also sold. This document summarizes recent pre- and post-closure: conditions of surface features at the site, including the sinkholes, the freeze wall, surface subsidence measurements and predictions; conditions within the SPR mine, including oil recovery, brine filling, and the Markel Wet Drift; risk assessment evaluations relevant to the decommissioning and long-term potential environmental impacts; continuing environmental monitoring activities at the site; and, an overview on the background and history of the Weeks Island SPR facility.« less

  12. Caseoperoxidase, Mixed β-Casein-SDS-Hemin-Imidazole Complex: A Nano Artificial Enzyme

    PubMed Central

    Moosavi-Movahedi, Zainab; Gharibi, Hussein; Hadi-Alijanvand, Hamid; Akbarzadeh, Mohammad; Esmaili, Mansoore; Atri, Maliheh S.; Sefidbakht, Yahya; Bohlooli, Mousa; Nazari, Khodadad; Javadian, Soheila; Hong, Jun; Saboury, Ali A.; Sheibani, Nader; Moosavi-Movahedi, Ali A.

    2016-01-01

    A novel peroxidase-like artificial enzyme, named “caseoperoxidase”, was biomimetically designed using a nano artificial amino acid apo-protein hydrophobic pocket. This four-component nano artificial enzyme containing heme-imidazole-β-casein-SDS exhibited high activity growth and kcat performance towards the native horseradish peroxidase (HRP) demonstrated by the steady state kinetics using UV-Vis spectrophotometry. The hydrophobicity and secondary structure of the caseoperoxidase were studied by ANS fluorescence and circular dichroism spectroscopy. Camel β-casein (Cβ-casein), with a flexible structure and exalted hydrophobicity, was selected as an appropriate apo-protein for the heme active site using a homology modeling method. Heme docking into the newly obtained Cβ-casein structure indicated one heme was mainly incorporated with Cβ-casein. The presence of a main electrostatic site for the active site in the Cβ-casein was also confirmed by experimental methods through Wyman binding potential and isothermal titration calorimetry. The existence of Cβ-casein protein in this biocatalyst lowered the suicide inactivation, and indicated that the obtained structure has a good protective role for the heme active-site. Additional further experiments confirmed the retention of caseoperoxidase structure and function as an artificial enzyme. PMID:25562503

  13. Caseoperoxidase, mixed β-casein-SDS-hemin-imidazole complex: a nano artificial enzyme.

    PubMed

    Moosavi-Movahedi, Zainab; Gharibi, Hussein; Hadi-Alijanvand, Hamid; Akbarzadeh, Mohammad; Esmaili, Mansoore; Atri, Maliheh S; Sefidbakht, Yahya; Bohlooli, Mousa; Nazari, Khodadad; Javadian, Soheila; Hong, Jun; Saboury, Ali A; Sheibani, Nader; Moosavi-Movahedi, Ali A

    2015-01-01

    A novel peroxidase-like artificial enzyme, named "caseoperoxidase", was biomimetically designed using a nano artificial amino acid apo-protein hydrophobic pocket. This four-component nano artificial enzyme containing heme-imidazole-β-casein-SDS exhibited high activity growth and k(cat) performance toward the native horseradish peroxidase demonstrated by the steady state kinetics using UV-vis spectrophotometry. The hydrophobicity and secondary structure of the caseoperoxidase were studied by ANS fluorescence and circular dichroism spectroscopy. Camel β-casein (Cβ-casein) was selected as an appropriate apo-protein for the heme active site because of its innate flexibility and exalted hydrophobicity. This selection was confirmed by homology modeling method. Heme docking into the newly obtained Cβ-casein structure indicated one heme was mainly incorporated with Cβ-casein. The presence of a main electrostatic site for the active site in the Cβ-casein was also confirmed by experimental methods through Wyman binding potential and isothermal titration calorimetry. The existence of Cβ-casein protein in this biocatalyst lowered the suicide inactivation and provided a suitable protective role for the heme active-site. Additional experiments confirmed the retention of caseoperoxidase structure and function as an artificial enzyme.

  14. Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol

    DOE PAGES

    Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.; ...

    2014-12-31

    The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. In this paper, we have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). Wemore » found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC 50 < 100 nM) inhibit Jak3 activity in cell-based assays. Finally, these results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases.« less

  15. Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.

    The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. In this paper, we have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). Wemore » found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC 50 < 100 nM) inhibit Jak3 activity in cell-based assays. Finally, these results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases.« less

  16. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  17. NHS-Esters As Versatile Reactivity-Based Probes for Mapping Proteome-Wide Ligandable Hotspots.

    PubMed

    Ward, Carl C; Kleinman, Jordan I; Nomura, Daniel K

    2017-06-16

    Most of the proteome is considered undruggable, oftentimes hindering translational efforts for drug discovery. Identifying previously unknown druggable hotspots in proteins would enable strategies for pharmacologically interrogating these sites with small molecules. Activity-based protein profiling (ABPP) has arisen as a powerful chemoproteomic strategy that uses reactivity-based chemical probes to map reactive, functional, and ligandable hotspots in complex proteomes, which has enabled inhibitor discovery against various therapeutic protein targets. Here, we report an alkyne-functionalized N-hydroxysuccinimide-ester (NHS-ester) as a versatile reactivity-based probe for mapping the reactivity of a wide range of nucleophilic ligandable hotspots, including lysines, serines, threonines, and tyrosines, encompassing active sites, allosteric sites, post-translational modification sites, protein interaction sites, and previously uncharacterized potential binding sites. Surprisingly, we also show that fragment-based NHS-ester ligands can be made to confer selectivity for specific lysine hotspots on specific targets including Dpyd, Aldh2, and Gstt1. We thus put forth NHS-esters as promising reactivity-based probes and chemical scaffolds for covalent ligand discovery.

  18. Studies on the regulation of the human E1 subunit of the 2-oxoglutarate dehydrogenase complex, including the identification of a novel calcium-binding site.

    PubMed

    Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M

    2014-04-15

    The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.

  19. Abundance, Composition and Activity of Ammonia Oxidizer and Denitrifier Communities in Metal Polluted Rice Paddies from South China

    PubMed Central

    Liu, Yuan; Liu, Yongzhuo; Ding, Yuanjun; Zheng, Jinwei; Zhou, Tong; Pan, Genxing; Crowley, David; Li, Lianqing; Zheng, Jufeng; Zhang, Xuhui; Yu, Xinyan; Wang, Jiafang

    2014-01-01

    While microbial nitrogen transformations in soils had been known to be affected by heavy metal pollution, changes in abundance and community structure of the mediating microbial populations had been not yet well characterized in polluted rice soils. Here, by using the prevailing molecular fingerprinting and enzyme activity assays and comparisons to adjacent non-polluted soils, we examined changes in the abundance and activity of ammonia oxidizing and denitrifying communities of rice paddies in two sites with different metal accumulation situation under long-term pollution from metal mining and smelter activities. Potential nitrifying activity was significantly reduced in polluted paddies in both sites while potential denitrifying activity reduced only in the soils with high Cu accumulation up to 1300 mg kg−1. Copy numbers of amoA (AOA and AOB genes) were lower in both polluted paddies, following the trend with the enzyme assays, whereas that of nirK was not significantly affected. Analysis of the DGGE profiles revealed a shift in the community structure of AOA, and to a lesser extent, differences in the community structure of AOB and denitrifier between soils from the two sites with different pollution intensity and metal composition. All of the retrieved AOB sequences belonged to the genus Nitrosospira, among which species Cluster 4 appeared more sensitive to metal pollution. In contrast, nirK genes were widely distributed among different bacterial genera that were represented differentially between the polluted and unpolluted paddies. This could suggest either a possible non-specific target of the primers conventionally used in soil study or complex interactions between soil properties and metal contents on the observed community and activity changes, and thus on the N transformation in the polluted rice soils. PMID:25058658

  20. Kinetics and Molecular Docking Studies of 6-Formyl Umbelliferone Isolated from Angelica decursiva as an Inhibitor of Cholinesterase and BACE1.

    PubMed

    Ali, Md Yousof; Seong, Su Hui; Reddy, Machireddy Rajeshkumar; Seo, Sung Yong; Choi, Jae Sue; Jung, Hyun Ah

    2017-09-24

    Coumarins, which have low toxicity, are present in some natural foods, and are used in various herbal remedies, have attracted interest in recent years because of their potential medicinal properties. In this study, we report the isolation of two natural coumarins, namely umbelliferone ( 1 ) and 6-formyl umbelliferone ( 2 ), from Angelica decursiva , and the synthesis of 8-formyl umbelliferone ( 3 ) from 1 . We investigated the anti-Alzheimer disease (anti-AD) potential of these coumarins by assessing their ability to inhibit acetylcholinesterase (AChE), butyrylcholinesterase (BChE), and β-site amyloid precursor protein (APP) cleaving enzyme 1 (BACE1). Among these coumarins, 2 exhibited poor inhibitory activity against AChE and BChE, and modest activity against BACE1. Structure-activity relationship analysis showed that 2 has an aldehyde group at the C-6 position, and exhibited strong anti-AD activity, whereas the presence or absence of an aldehyde group at the C-8 position reduced the anti-AD activity of 3 and 1 , respectively. In addition, 2 exhibited concentration-dependent inhibition of peroxynitrite-mediated protein tyrosine nitration. A kinetic study revealed that 2 and 3 non-competitively inhibited BACE1. To confirm enzyme inhibition, we predicted the 3D structures of AChE and BACE1, and used AutoDock 4.2 to simulate binding of coumarins to these enzymes. The blind docking studies demonstrated that these molecules could interact with both the catalytic active sites and peripheral anionic sites of AChE and BACE1. Together, our results indicate that 2 has an interesting inhibitory activity in vitro, and can be used in further studies to develop therapeutic modalities for the treatment of AD.

  1. Investigation of Natural Radioactivity in a Monazite Processing Plant in Japan.

    PubMed

    Iwaoka, Kazuki; Yajima, Kazuaki; Suzuki, Toshikazu; Yonehara, Hidenori; Hosoda, Masahiro; Tokonami, Shinji; Kanda, Reiko

    2017-09-01

    Monazite is a naturally occurring radioactive material that is processed for use in a variety of domestic applications. At present, there is little information available on potential radiation doses experienced by people working with monazite. The ambient dose rate and activity concentration of natural radionuclides in raw materials, products, and dust in work sites as well as the Rn and Rn concentrations in work sites were measured in a monazite processing plant in Japan. Dose estimations for plant workers were also conducted. The activity concentration of the U series in raw materials and products for the monazite processing plant was found to be higher than the relevant values described in the International Atomic Energy Agency Safety Standards. The ambient dose rates in the raw material yard were higher than those in other work sites. Moreover, the activity concentrations of dust in the milling site were higher than those in other work sites. The Rn concentrations in all work sites were almost the same as those in regular indoor environments in Japan. The Rn concentrations in all work sites were much higher than those in regular indoor environments in Japan. The maximum value of the effective dose for workers was 0.62 mSv y, which is lower than the reference level range (1-20 mSv y) for abnormally high levels of natural background radiation published in the International Commission of Radiological Protection Publication 103.

  2. Ligand-binding specificity and promiscuity of the main lignocellulolytic enzyme families as revealed by active-site architecture analysis.

    PubMed

    Tian, Li; Liu, Shijia; Wang, Shuai; Wang, Lushan

    2016-03-24

    Biomass can be converted into sugars by a series of lignocellulolytic enzymes, which belong to the glycoside hydrolase (GH) families summarized in CAZy databases. Here, using a structural bioinformatics method, we analyzed the active site architecture of the main lignocellulolytic enzyme families. The aromatic amino acids Trp/Tyr and polar amino acids Glu/Asp/Asn/Gln/Arg occurred at higher frequencies in the active site architecture than in the whole enzyme structure. And the number of potential subsites was significantly different among different families. In the cellulase and xylanase families, the conserved amino acids in the active site architecture were mostly found at the -2 to +1 subsites, while in β-glucosidase they were mainly concentrated at the -1 subsite. Families with more conserved binding amino acid residues displayed strong selectivity for their ligands, while those with fewer conserved binding amino acid residues often exhibited promiscuity when recognizing ligands. Enzymes with different activities also tended to bind different hydroxyl oxygen atoms on the ligand. These results may help us to better understand the common and unique structural bases of enzyme-ligand recognition from different families and provide a theoretical basis for the functional evolution and rational design of major lignocellulolytic enzymes.

  3. Active Site Flexibility of Mycobacterium tuberculosis Isocitrate Lyase in Dimer Form.

    PubMed

    Lee, Yie-Vern; Choi, Sy Bing; Wahab, Habibah A; Choong, Yee Siew

    2017-09-25

    Tuberculosis (TB) still remains a global threat due to the emergence of a drug-resistant strain. Instead of focusing on the drug target of active stage TB, we are highlighting the isocitrate lyase (ICL) at the dormant stage TB. ICL is one of the persistent factors for Mycobacterium tuberculosis (MTB) to survive during the dormant phase. In addition, the absence of ICL in human has made ICL a potential drug target for TB therapy. However, the dynamic details of ICL which could give insights to the ICL-ligand interaction have yet to be solved. Therefore, a series of ICL dimer dynamics studies through molecular dynamics simulation were performed in this work. The ICL active site entrance gate closure is contributed to by hydrogen bonding and electrostatic interactions with the C-terminal. Analysis suggested that the open-closed behavior of the ICL active site entrance depends on the type of ligand present in the active site. We also observed four residues (Ser91, Asp108, Asp153, and Cys191) which could possibly be the nucleophiles for nucleophilic attack on the cleavage of isocitrate at the C 2 -C 3 bond. We hope that the elucidation of ICL dynamics can benefit future works such as lead identification or antibody design against ICL for TB therapeutics.

  4. Noninvasive reconstruction of the three-dimensional ventricular activation sequence during pacing and ventricular tachycardia in the rabbit heart.

    PubMed

    Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin

    2011-01-01

    Ventricular arrhythmias represent one of leading causes for sudden cardiac death, a significant problem in public health. Noninvasive imaging of cardiac electric activities associated with ventricular arrhythmias plays an important role in better our understanding of the mechanisms and optimizing the treatment options. The present study aims to rigorously validate a novel three-dimensional (3-D) cardiac electrical imaging (3-DCEI) technique with the aid of 3-D intra-cardiac mapping during paced rhythm and ventricular tachycardia (VT) in the rabbit heart. Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in thirteen healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous norepinephrine (NE). The non-invasively imaged activation sequence correlated well with invasively measured counterparts, with a correlation coefficient of 0.72 and a relative error of 0.30 averaged over all paced beats and NE-induced PVCs and VT beats. The averaged distance from imaged site of initial activation to measured site determined from intra-cardiac mapping was ∼5mm. These promising results suggest that 3-DCEI is feasible to non-invasively localize the origins and image activation sequence of focal ventricular arrhythmias.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aurelio, Mario; Taguibao, Kristine Joy; Vargas, Edmundo

    In the selection of sites for disposal facilities involving low- and intermediate-level radioactive waste (LILW), International Atomic Energy Agency (IAEA) recommendations require that 'the region in which the site is located shall be such that significant tectonic and surface processes are not expected to occur with an intensity that would compromise the required isolation capability of the repository'. Evaluating the appropriateness of a site therefore requires a deep understanding of the geological and tectonic setting of the area. The Philippines sits in a tectonically active region frequented by earthquakes and volcanic activity. Its highly variable morphology coupled with its locationmore » along the typhoon corridor in the west Pacific region subjects the country to surface processes often manifested in the form of landslides. The Philippine LILW near surface repository project site is located on the north eastern sector of the Island of Luzon in northern Philippines. This island is surrounded by active subduction trenches; to the east by the East Luzon Trough and to the west by the Manila Trench. The island is also traversed by several branches of the Philippine Fault System. The Philippine LILW repository project is located more than 100 km away from any of these major active fault systems. In the near field, the project site is located less than 10 km from a minor fault (Dummon River Fault) and more than 40 km away from a volcanic edifice (Mt. Caguas). This paper presents an analysis of the potential hazards that these active tectonic features may pose to the project site. The assessment of such geologic hazards is imperative in the characterization of the site and a crucial input in the design and safety assessment of the repository. (authors)« less

  6. CREB, NF-Y and MEIS1 conserved binding sites are essential to balance Myostatin promoter/enhancer activity during early myogenesis.

    PubMed

    Grade, Carla Vermeulen Carvalho; Mantovani, Carolina Stefano; Fontoura, Marina Alves; Yusuf, Faisal; Brand-Saberi, Beate; Alvares, Lúcia Elvira

    2017-10-01

    Myostatin (MSTN) is a strong inhibitor of skeletal muscle growth in human and other vertebrates. Its transcription is controlled by a proximal promoter/enhancer (Mstn P/E) containing a TATA box besides CREB, NF-Y, MEIS1 and FXR transcription factor binding sites (TFBSs), which are conserved throughout evolution. The aim of this work was to investigate the role of these TFBSs on Mstn P/E activity and evaluate the potential of their putative ligands as Mstn trans regulators. Mstn P/E mutant constructs were used to establish the role of conserved TFBSs using dual-luciferase assays. Expression analyses were performed by RT-PCR and in situ hybridization in C2C12 myoblasts and E10.5 mouse embryos, respectively. Our results revealed that CREB, NF-Y and MEIS1 sites are required to balance Mstn P/E activity, keeping Mstn transcription within basal levels during myoblast proliferation. Furthermore, our data showed that NF-Y site is essential, although not sufficient, to mediate Mstn P/E transcriptional activity. In turn, CREB and MEIS1 binding sites seem to depend on the presence of NF-Y site to induce Mstn P/E. FXR appears not to confer any effect on Mstn P/E activity, except in the absence of all other conserved TFBS. Accordingly, expression studies pointed to CREB, NF-Y and MEIS1 but not to FXR factors as possible regulators of Mstn transcription in the myogenic context. Altogether, our findings indicated that CREB, NF-Y and MEIS1 conserved sites are essential to control basal Mstn transcription during early myogenesis, possibly by interacting with these or other related factors.

  7. Health Risks to Ecological Workers on Contaminated Sites - the Department of Energy as a Case Study

    PubMed Central

    Burger, Joanna; Gochfeld, Michael

    2016-01-01

    Background At most contaminated sites the risk to workers focuses on those ‘hazardous waste workers’ directly exposed to chemicals or radionuclides, and to the elaborate approaches implemented to protecting their health and safety. Ecological workers generally are not considered. Objectives To explore the risks to the health and safety of ecological workers on sites with potential chemical and radiological exposures before, during or after remediation of contamination. To use the U.S. Department of Energy as a case study, and to develop concepts that apply generally to sites contaminated with hazardous or nuclear wastes, Methods Develop categories of ecological workers, describe their usual jobs, and provide information on the kinds of risks they face. Ecological activities include continued surveillance and monitoring work on any sites with residual contamination, subject to institutional controls and engineered barriers following closure as well as the restoration. Results The categories of ecological workers and their tasks include 1) Ecological characterization, mapping and monitoring, 2) biodiversity studies, 2) Contaminant fate and transport, 3) On-going industrial activities 4) Remediation activities (environmental management), 5) Environmental restoration, 6) Post-cleanup surveillance and monitoring, and 7) Post-closure future site activities. There are a set of functional activities that can occur with different frequencies and intensities, including visual inspection, collecting biological samples, collecting media physical samples, collecting biological debris, restoration planting, and maintaining ecosystems. Conclusions Ecological workers face different exposures and risks than other environmental cleanup workers. Many of their tasks mimic shift work with long hours leading to fatigue, and they are exposed to biological as well as chemical/radiological hazards. DOE and other entities need to examine the risks to ecological workers on site with an eye to risk reduction. PMID:27668128

  8. Specific phospholipid binding to Na,K-ATPase at two distinct sites.

    PubMed

    Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

    2017-03-14

    Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

  9. Utilizing hydrologic, statistical, and geochemical tools to assess uranium mobility in surface and near-surface environments

    NASA Astrophysics Data System (ADS)

    Naftz, D. L.; Walton-Day, K. E.; Fuller, C.; Dam, W. L.; Briggs, M. A.; Snyder, T.

    2015-12-01

    Legacy uranium (U) mining and processing activities have resulted in soil and water contamination on Federal, state, and tribal lands in the western United States. Sites include legacy mill sites associated with U extraction now managed by the Department of Energy and thousands of waste dumps associated with U exploration, mining, and processing. Recently (2012), over 400,000 hectares of federally managed land in northern Arizona was withdrawn from consideration of mining for a 20-year period to protect the Grand Canyon watershed from potentially adverse effects of U mineral exploration and development. Ore from active and recently active U mines in the Colorado Plateau, the Henry Mountains Complex, and the Arizona Strip is transported to the only currently (2015) active conventional mill site in the western United States, located in Utah. Previous and ongoing U.S. Geological Survey assessments to examine U mobility at a variety of legacy and active sites associated with ore exploration, extraction, and processing will be presented as field-scale examples. Topics associated with site investigations will include: (1) offsite migration of radionuclides associated with the operation of the White Mesa U mill; (2) long-term contaminant transport from legacy U waste dumps on Bureau of Land Management regulated land in Utah; (3) application of incremental soil sampling techniques to determine pre- and post-mining radionuclide levels associated with planned and operating U mines in northern Arizona; (4) application of fiber optic digital temperature sensing equipment to identify areas where shallow groundwater containing elevated U levels may be discharging to a river adjacent to a reclaimed mill site in central Wyoming; and (5) field-scale manipulation of groundwater chemistry to limit U migration from a legacy upgrader site in southeastern Utah.

  10. An integrated approach for identifying priority contaminant in the Great Lakes Basin - Investigations in the Lower Green Bay/Fox River and Milwaukee Estuary areas of concern.

    PubMed

    Li, Shibin; Villeneuve, Daniel L; Berninger, Jason P; Blackwell, Brett R; Cavallin, Jenna E; Hughes, Megan N; Jensen, Kathleen M; Jorgenson, Zachary; Kahl, Michael D; Schroeder, Anthony L; Stevens, Kyle E; Thomas, Linnea M; Weberg, Matthew A; Ankley, Gerald T

    2017-02-01

    Environmental assessment of complex mixtures typically requires integration of chemical and biological measurements. This study demonstrates the use of a combination of instrumental chemical analyses, effects-based monitoring, and bio-effects prediction approaches to help identify potential hazards and priority contaminants in two Great Lakes Areas of Concern (AOCs), the Lower Green Bay/Fox River located near Green Bay, WI, USA and the Milwaukee Estuary, located near Milwaukee, WI, USA. Fathead minnows were caged at four sites within each AOC (eight sites total). Following 4d of in situ exposure, tissues and biofluids were sampled and used for targeted biological effects analyses. Additionally, 4d composite water samples were collected concurrently at each caged fish site and analyzed for 132 analytes as well as evaluated for total estrogenic and androgenic activity using cell-based bioassays. Of the analytes examined, 75 were detected in composite samples from at least one site. Based on multiple analyses, one site in the East River and another site near a paper mill discharge in the Lower Green Bay/Fox River AOC, were prioritized due to their estrogenic and androgenic activity, respectively. The water samples from other sites generally did not exhibit significant estrogenic or androgenic activity, nor was there evidence for endocrine disruption in the fish exposed at these sites as indicated by the lack of alterations in ex vivo steroid production, circulating steroid concentrations, or vitellogenin mRNA expression in males. Induction of hepatic cyp1a mRNA expression was detected at several sites, suggesting the presence of chemicals that activate the aryl hydrocarbon receptor. To expand the scope beyond targeted investigation of endpoints selected a priori, several bio-effects prediction approaches were employed to identify other potentially disturbed biological pathways and related chemical constituents that may warrant future monitoring at these sites. For example, several chemicals such as diethylphthalate and naphthalene, and genes and related pathways, such as cholinergic receptor muscarinic 3 (CHRM3), estrogen receptor alpha1 (esr1), chemokine ligand 10 protein (CXCL10), tumor protein p53 (p53), and monoamine oxidase B (Maob), were identified as candidates for future assessments at these AOCs. Overall, this study demonstrates that a better prioritization of contaminants and associated hazards can be achieved through integrated evaluation of multiple lines of evidence. Such prioritization can guide more comprehensive follow-up risk assessment efforts. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. The impact of social media on children, adolescents, and families.

    PubMed

    O'Keeffe, Gwenn Schurgin; Clarke-Pearson, Kathleen

    2011-04-01

    Using social media Web sites is among the most common activity of today's children and adolescents. Any Web site that allows social interaction is considered a social media site, including social networking sites such as Facebook, MySpace, and Twitter; gaming sites and virtual worlds such as Club Penguin, Second Life, and the Sims; video sites such as YouTube; and blogs. Such sites offer today's youth a portal for entertainment and communication and have grown exponentially in recent years. For this reason, it is important that parents become aware of the nature of social media sites, given that not all of them are healthy environments for children and adolescents. Pediatricians are in a unique position to help families understand these sites and to encourage healthy use and urge parents to monitor for potential problems with cyberbullying, "Facebook depression," sexting, and exposure to inappropriate content.

  12. Aryl hydrocarbon receptor-mediated activity of particulate organic matter from the Paso del Norte airshed along the U.S.-Mexico border.

    PubMed Central

    Arrieta, Daniel E; Ontiveros, Cynthia C; Li, Wen-Whai; Garcia, Jose H; Denison, Michael S; McDonald, Jacob D; Burchiel, Scott W; Washburn, Barbara Shayne

    2003-01-01

    In this study, we determined the biologic activity of dichloromethane-extracted particulate matter < 10 micro m in aerodynamic diameter (PM10) obtained from filters at three sites in the Paso del Norte airshed, which includes El Paso, Texas, USA; Juarez, Chihuahua, Mexico, and Sunland Park, New Mexico, USA. The extracts were rich in polycyclic aromatic hydrocarbons (PAHs) and had significant biologic activity, measured using two in vitro assay systems: ethoxyresorufin-(O-deethylase (EROD) induction and the aryl hydrocarbon-receptor luciferase reporter system. In most cases, both EROD (5.25 pmol/min/mg protein) and luciferase activities (994 relative light units/mg) were highest in extracts from the Advance site located in an industrial neighborhood in Juarez. These values represented 58% and 55%, respectively, of induction associated with 1 micro M ss-naphthoflavone exposures. In contrast, little activity was observed at the Northeast Clinic site in El Paso, the reference site. In most cases, luciferase and EROD activity from extracts collected from the Tillman Health Center site, situated in downtown El Paso, fell between those observed at the other two sites. Overall, a statistically significant correlation existed between PM10 and EROD and luciferase activities. Chemical analysis of extracts collected from the Advance site demonstrated that concentrations of most PAHs were higher than those reported in most other metropolitan areas in the United States. Calculations made with these data suggest a cancer risk of 5-12 cases per 100,000 people. This risk estimate, as well as comparisons with the work of other investigators, raises concern regarding the potential for adverse health effects to the residents of this airshed. Further work is needed to understand the sources, exposure, and effects of PM10 and particulate organic material in the Paso del Norte airshed. PMID:12896850

  13. BOREAS TE-12 SSA Leaf Water Potential Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Curd, Shelaine (Editor); Walter-Shea, Elizabeth A.; Mesarch, Mark A.; Chen, L.; Yang, Litao

    2000-01-01

    The Boreal Ecosystem-Atmospheric Study (BOREAS) TE-12 (Terrestrial Ecology) team collected water potential data in 1993 and 1994 from aspen, jack pine, and black spruce leaves/needles. Collections were made at the Southern Study Area Nipawin Fen Site (SSA FEN), Young Jack Pine (YJP), Young Aspen (YA), Old Aspen (OA), and Old Black Spruce (OBS) sites. Measurements were made using a pressure chamber on a platform in the field. The data are provided in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  14. Feasibility of new simulation technology to train novice drivers

    DOT National Transportation Integrated Search

    1996-12-01

    This project examined the feasibility of using existing simulation and other electronic device technology with the potential for the safety training of novice drivers. Project activities included: a literature review; site visits and telephone inquir...

  15. Reduction Potentials of [FeFe]-Hydrogenase Accessory Iron–Sulfur Clusters Provide Insights into the Energetics of Proton Reduction Catalysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Artz, Jacob H.; Mulder, David W.; Ratzloff, Michael W.

    An [FeFe]-hydrogenase from Clostridium pasteurianum, CpI, is a model system for biological H 2 activation. In addition to the catalytic H-cluster, CpI contains four accessory iron-sulfur [FeS] clusters in a branched series that transfer electrons to and from the active site. In this work, potentiometric titrations have been employed in combination with electron paramagnetic resonance (EPR) spectroscopy at defined electrochemical potentials to gain insights into the role of the accessory clusters in catalysis. EPR spectra collected over a range of potentials were deconvoluted into individual components attributable to the accessory [FeS] clusters and the active site H-cluster, and reduction potentialsmore » for each cluster were determined. The data suggest a large degree of magnetic coupling between the clusters. The distal [4Fe-4S] cluster is shown to have a lower reduction potential (~ < -450 mV) than the other clusters, and molecular docking experiments indicate that the physiological electron donor, ferredoxin (Fd), most favorably interacts with this cluster. The low reduction potential of the distal [4Fe-4S] cluster thermodynamically restricts the Fd ox/Fd red ratio at which CpI can operate, consistent with the role of CpI in recycling Fd redthat accumulates during fermentation. In conclusion, subsequent electron transfer through the additional accessory [FeS] clusters to the H-cluster is thermodynamically favorable.« less

  16. Reduction Potentials of [FeFe]-Hydrogenase Accessory Iron–Sulfur Clusters Provide Insights into the Energetics of Proton Reduction Catalysis

    DOE PAGES

    Artz, Jacob H.; Mulder, David W.; Ratzloff, Michael W.; ...

    2017-06-21

    An [FeFe]-hydrogenase from Clostridium pasteurianum, CpI, is a model system for biological H 2 activation. In addition to the catalytic H-cluster, CpI contains four accessory iron-sulfur [FeS] clusters in a branched series that transfer electrons to and from the active site. In this work, potentiometric titrations have been employed in combination with electron paramagnetic resonance (EPR) spectroscopy at defined electrochemical potentials to gain insights into the role of the accessory clusters in catalysis. EPR spectra collected over a range of potentials were deconvoluted into individual components attributable to the accessory [FeS] clusters and the active site H-cluster, and reduction potentialsmore » for each cluster were determined. The data suggest a large degree of magnetic coupling between the clusters. The distal [4Fe-4S] cluster is shown to have a lower reduction potential (~ < -450 mV) than the other clusters, and molecular docking experiments indicate that the physiological electron donor, ferredoxin (Fd), most favorably interacts with this cluster. The low reduction potential of the distal [4Fe-4S] cluster thermodynamically restricts the Fd ox/Fd red ratio at which CpI can operate, consistent with the role of CpI in recycling Fd redthat accumulates during fermentation. In conclusion, subsequent electron transfer through the additional accessory [FeS] clusters to the H-cluster is thermodynamically favorable.« less

  17. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents.

    PubMed

    Olazaran, Fabián E; Rivera, Gildardo; Pérez-Vázquez, Alondra M; Morales-Reyes, Cynthia M; Segura-Cabrera, Aldo; Balderas-Rentería, Isaías

    2017-01-12

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [ N -( p -methoxy-phenyl)-2-( p -methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site.

  18. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents

    PubMed Central

    2016-01-01

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [N-(p-methoxy-phenyl)-2-(p-methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site. PMID:28105271

  19. Blood tolerant laccase by directed evolution.

    PubMed

    Mate, Diana M; Gonzalez-Perez, David; Falk, Magnus; Kittl, Roman; Pita, Marcos; De Lacey, Antonio L; Ludwig, Roland; Shleev, Sergey; Alcalde, Miguel

    2013-02-21

    High-redox potential laccases are powerful biocatalysts with a wide range of applications in biotechnology. We have converted a thermostable laccase from a white-rot fungus into a blood tolerant laccase. Adapting the fitness of this laccase to the specific composition of human blood (above neutral pH, high chloride concentration) required several generations of directed evolution in a surrogate complex blood medium. Our evolved laccase was tested in both human plasma and blood, displaying catalytic activity while retaining a high redox potential at the T1 copper site. Mutations introduced in the second coordination sphere of the T1 site shifted the pH activity profile and drastically reduced the inhibitory effect of chloride. This proof of concept that laccases can be adapted to function in extreme conditions opens an array of opportunities for implantable nanobiodevices, chemical syntheses, and detoxification. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Driving Protein Conformational Changes with Light: Photoinduced Structural Rearrangement in a Heterobimetallic Oxidase.

    PubMed

    Maugeri, Pearson T; Griese, Julia J; Branca, Rui M; Miller, Effie K; Smith, Zachary R; Eirich, Jürgen; Högbom, Martin; Shafaat, Hannah S

    2018-01-31

    The heterobimetallic R2lox protein binds both manganese and iron ions in a site-selective fashion and activates oxygen, ultimately performing C-H bond oxidation to generate a tyrosine-valine cross-link near the active site. In this work, we demonstrate that, following assembly, R2lox undergoes photoinduced changes to the active site geometry and metal coordination motif. Through spectroscopic, structural, and mass spectrometric characterization, the photoconverted species is found to consist of a tyrosinate-bound iron center following light-induced decarboxylation of a coordinating glutamate residue and cleavage of the tyrosine-valine cross-link. This process occurs with high quantum efficiencies (Φ = 3%) using violet and near-ultraviolet light, suggesting that the photodecarboxylation is initiated via ligand-to-metal charge transfer excitation. Site-directed mutagenesis and structural analysis suggest that the cross-linked tyrosine-162 is the coordinating residue. One primary product is observed following irradiation, indicating potential use of this class of proteins, which contains a putative substrate channel, for controlled photoinduced decarboxylation processes, with relevance for in vivo functionality of R2lox as well as application in environmental remediation.

  1. Exclusive Ni-N4 Sites Realize Near-Unity CO Selectivity for Electrochemical CO2 Reduction.

    PubMed

    Li, Xiaogang; Bi, Wentuan; Chen, Minglong; Sun, Yuexiang; Ju, Huanxin; Yan, Wensheng; Zhu, Junfa; Wu, Xiaojun; Chu, Wangsheng; Wu, Changzheng; Xie, Yi

    2017-10-25

    Electrochemical reduction of carbon dioxide (CO 2 ) to value-added carbon products is a promising approach to reduce CO 2 levels and mitigate the energy crisis. However, poor product selectivity is still a major obstacle to the development of CO 2 reduction. Here we demonstrate exclusive Ni-N 4 sites through a topo-chemical transformation strategy, bringing unprecedentedly high activity and selectivity for CO 2 reduction. Topo-chemical transformation by carbon layer coating successfully ensures preservation of the Ni-N 4 structure to a maximum extent and avoids the agglomeration of Ni atoms to particles, providing abundant active sites for the catalytic reaction. The Ni-N 4 structure exhibits excellent activity for electrochemical reduction of CO 2 with particularly high selectivity, achieving high faradaic efficiency over 90% for CO in the potential range from -0.5 to -0.9 V and gives a maximum faradaic efficiency of 99% at -0.81 V with a current density of 28.6 mA cm -2 . We anticipate exclusive catalytic sites will shed new light on the design of high-efficiency electrocatalysts for CO 2 reduction.

  2. Long-term community dynamics of small landbirds with and without exposure to extensive disturbance from military training activities.

    PubMed

    Rivers, James W; Gipson, Philip S; Althoff, Donald P; Pontius, Jeffrey S

    2010-02-01

    Military training activities are known to impact individual species, yet our understanding of how such activities influence animal communities is limited. In this study, we used long-term data in a case study approach to examine the extent to which the local small landbird community differed between a site in northeast Kansas that experienced intensive disturbance from military training activities (Ft. Riley Military Installation) and a similar, nearby site that experienced minimal human disturbance (Konza Prairie Biological Station). In addition, we characterized how the regional pool of potential colonizers influenced local community dynamics using Breeding Bird Survey data. From 1991 to 2001, most species of small terrestrial landbirds (73%) recorded during breeding surveys were found at both sites and the mean annual richness at Ft. Riley (39.0 +/- 2.86 [SD]) was very similar to that of Konza Prairie (39.4 +/- 2.01). Richness was maintained at relatively constant levels despite compositional changes because colonizations compensated local extinctions at both sites. These dynamics were driven primarily by woodland species that exhibited stochastic losses and gains and were present at a low local and regional abundance. Our results suggest that military training activities may mimic natural disturbances for some species in this area because the small landbird community did not differ markedly between sites with and sites without extensive human disturbance. Although our results suggest that military training is not associated with large changes in the avian community, additional studies are needed to determine if this pattern is found in other ecological communities.

  3. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  4. Silver-coated nylon dressing plus active DC microcurrent for healing of autogenous skin donor sites.

    PubMed

    Malin, Edward W; Galin, Chaya M; Lairet, Kimberley F; Huzar, Todd F; Williams, James F; Renz, Evan M; Wolf, Steven E; Cancio, Leopoldo C

    2013-11-01

    Burn wounds are a significant cause of morbidity and mortality, and improved outcomes are demonstrated with early closure of both primary burn wounds and skin donor sites. Thus, technology that decreases the healing time of burns and donor sites would be potentially lifesaving. We present the results of a single-center, prospective, double-blinded, randomized controlled trial to evaluate the efficacy of silver-coated dressing with active microcurrent in comparison to silver-coated dressing with sham microcurrent on wound-closure time for autogenous skin donor sites. Four hundred five patients were screened for treatment of their donor sites using a silver-coated nylon dressing with either sham or active microcurrent stimulation. Thirty patients were enrolled in the study and then randomized. Of these, 5 patients were removed from analysis due to protocol deviations. Differences in time-to-closure were analyzed using Kaplan-Meier analysis and the proportional hazard regression model. Subjective verbal pain rating scores (0-10; 0, no pain; 10, worst pain) were also recorded. All devices were blinded and programmed at an outside facility, so that every patient had either an active or sham device. The study was unblinded only after the final patient's donor site had healed. All patients achieved donor-site healing before postoperative day 20. The 14 patients in the active microcurrent group [mean, 10.8 (2.9) days; range, 7-15 days] experienced no difference in time to wound healing as compared to the remaining patients in the sham microcurrent group [mean, 11.1 (2.0) days; range, 8-14 days; P = 0.75]. There were no differences in pain from one group compared to the other. None of the donor sites exhibited clinical signs of infection. In a sample size of 25 burn patients, the addition of direct microcurrent to silver-nylon dressings did not decrease time to wound closure of skin donor sites, and it did not show a difference in reported pain levels.

  5. Low Dose Sarin Leads To Murine Cardiac Dysfunction

    DTIC Science & Technology

    2010-03-01

    work directly supported a grant held by Wright State University, grant # GW060050, from the United States Army Medical Research Acquisition Activity ...GB), acts as an irreversible AChE inhibitor. Sarin reacts with the serine hydroxyl residue in the active site of AChE to form a phosphate or...United States Air Force has become increasingly engaged with terrorist groups and other elusive enemies. As these activities increase, the potential for

  6. Probing the Role of Active Site Water in the Sesquiterpene Cyclization Reaction Catalyzed by Aristolochene Synthase.

    PubMed

    Chen, Mengbin; Chou, Wayne K W; Al-Lami, Naeemah; Faraldos, Juan A; Allemann, Rudolf K; Cane, David E; Christianson, David W

    2016-05-24

    Aristolochene synthase (ATAS) is a high-fidelity terpenoid cyclase that converts farnesyl diphosphate exclusively into the bicyclic hydrocarbon aristolochene. Previously determined crystal structures of ATAS complexes revealed trapped active site water molecules that could potentially interact with catalytic intermediates: water "w" hydrogen bonds with S303 and N299, water molecules "w1" and "w2" hydrogen bond with Q151, and a fourth water molecule coordinates to the Mg(2+)C ion. There is no obvious role for water in the ATAS mechanism because the enzyme exclusively generates a hydrocarbon product. Thus, these water molecules are tightly controlled so that they cannot react with carbocation intermediates. Steady-state kinetics and product distribution analyses of eight ATAS mutants designed to perturb interactions with active site water molecules (S303A, S303H, S303D, N299A, N299L, N299A/S303A, Q151H, and Q151E) indicate relatively modest effects on catalysis but significant effects on sesquiterpene product distributions. X-ray crystal structures of S303A, N299A, N299A/S303A, and Q151H mutants reveal minimal perturbation of active site solvent structure. Seven of the eight mutants generate farnesol and nerolidol, possibly resulting from addition of the Mg(2+)C-bound water molecule to the initially formed farnesyl cation, but no products are generated that would suggest enhanced reactivity of other active site water molecules. However, intermediate germacrene A tends to accumulate in these mutants. Thus, apart from the possible reactivity of Mg(2+)C-bound water, active site water molecules in ATAS are not directly involved in the chemistry of catalysis but instead contribute to the template that governs the conformation of the flexible substrate and carbocation intermediates.

  7. Agonist activation of α7 nicotinic acetylcholine receptors via an allosteric transmembrane site

    PubMed Central

    Gill, JasKiran K.; Savolainen, Mari; Young, Gareth T.; Zwart, Ruud; Sher, Emanuele; Millar, Neil S.

    2011-01-01

    Conventional nicotinic acetylcholine receptor (nAChR) agonists, such as acetylcholine, act at an extracellular “orthosteric” binding site located at the interface between two adjacent subunits. Here, we present evidence of potent activation of α7 nAChRs via an allosteric transmembrane site. Previous studies have identified a series of nAChR-positive allosteric modulators (PAMs) that lack agonist activity but are able to potentiate responses to orthosteric agonists, such as acetylcholine. It has been shown, for example, that TQS acts as a conventional α7 nAChR PAM. In contrast, we have found that a compound with close chemical similarity to TQS (4BP-TQS) is a potent allosteric agonist of α7 nAChRs. Whereas the α7 nAChR antagonist metyllycaconitine acts competitively with conventional nicotinic agonists, metyllycaconitine is a noncompetitive antagonist of 4BP-TQS. Mutation of an amino acid (M253L), located in a transmembrane cavity that has been proposed as being the binding site for PAMs, completely blocks agonist activation by 4BP-TQS. In contrast, this mutation had no significant effect on agonist activation by acetylcholine. Conversely, mutation of an amino acid located within the known orthosteric binding site (W148F) has a profound effect on agonist potency of acetylcholine (resulting in a shift of ∼200-fold in the acetylcholine dose-response curve), but had little effect on the agonist dose-response curve for 4BP-TQS. Computer docking studies with an α7 homology model provides evidence that both TQS and 4BP-TQS bind within an intrasubunit transmembrane cavity. Taken together, these findings provide evidence that agonist activation of nAChRs can occur via an allosteric transmembrane site. PMID:21436053

  8. Ab initio study of the binding of Trichostatin A (TSA) in the active site of histone deacetylase like protein (HDLP).

    PubMed

    Vanommeslaeghe, Kenno; Van Alsenoy, Christian; De Proft, Frank; Martins, José C; Tourwé, Dirk; Geerlings, Paul

    2003-08-21

    Histone deacetylase (HDAC) inhibitors have recently attracted considerable interest because of their therapeutic potential for the treatment of cell proliferative diseases. An X-ray structure of a very potent inhibitor, Trichostatin A (TSA), bound to HDLP (an HDAC analogue isolated from Aquifex aeolicus), is available. From this structure, an active site model (322 atoms), relevant for the binding of TSA and structural analogues, has been derived, and TSA has been minimized in this active site at HF 3-21G* level. The resulting conformation is in excellent accordance with the X-ray structure, and indicates a deprotonation of the hydroxamic acid in TSA by His 131. Also, a water molecule was minimized in the active site. In addition to a similar deprotonation, in accordance with a possible catalytic mechanism of HDAC as proposed by Finnin et al. (M. S. Finnin, J. R. Donigian, A. Cohen, V. M. Richon, R. A. Rifkind and P. A. Marks, Nature, 1999, 401, 188-193), a displacement of the resulting OH- ion in the active site was observed. Based on these results, the difference in energy of binding between TSA and water was calculated. The resulting value is realistic in respect to experimental binding affinities. Furthermore, the mechanism of action of the His 131-Asp 166 charge relay system was investigated. Although the Asp residue in this motif is known to substantially increase the basicity of the His residue, no proton transfer from His 131 to Asp 166 was observed on binding of TSA or water. However, in the empty protonated active site, this proton transfer does occur.

  9. Minimizing impacts of land use change on ecosystem services using multi-criteria heuristic analysis.

    PubMed

    Keller, Arturo A; Fournier, Eric; Fox, Jessica

    2015-06-01

    Development of natural landscapes to support human activities impacts the capacity of the landscape to provide ecosystem services. Typically, several ecosystem services are impacted at a single development site and various footprint scenarios are possible, thus a multi-criteria analysis is needed. Restoration potential should also be considered for the area surrounding the permanent impact site. The primary objective of this research was to develop a heuristic approach to analyze multiple criteria (e.g. impacts to various ecosystem services) in a spatial configuration with many potential development sites. The approach was to: (1) quantify the magnitude of terrestrial ecosystem service (biodiversity, carbon sequestration, nutrient and sediment retention, and pollination) impacts associated with a suite of land use change scenarios using the InVEST model; (2) normalize results across categories of ecosystem services to allow cross-service comparison; (3) apply the multi-criteria heuristic algorithm to select sites with the least impact to ecosystem services, including a spatial criterion (separation between sites). As a case study, the multi-criteria impact minimization algorithm was applied to InVEST output to select 25 potential development sites out of 204 possible locations (selected by other criteria) within a 24,000 ha property. This study advanced a generally applicable spatial multi-criteria approach for 1) considering many land use footprint scenarios, 2) balancing impact decisions across a suite of ecosystem services, and 3) determining the restoration potential of ecosystem services after impacts. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

    PubMed

    Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

    2008-04-11

    The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

  11. Molecular dynamics simulations and statistical coupling analysis of GPI12 in L. major: functional co-evolution and conservedness reveals potential drug-target sites.

    PubMed

    Singh, Shailza; Mandlik, Vineetha; Shinde, Sonali

    2015-03-01

    GPI12 represents an important enzyme in the GPI biosynthetic pathway of several parasites like 'Leishmania'. GPI activity is generally regulated through either the hindrance in GPI complex assembly formation or the modulation of the lipophosphoglycan (LPG) flux to either reduce or enhance the pathogenicity in an organism. Of the various GPI molecules known, GPI12 is an important enzyme in the GPI biosynthetic pathway which can be exploited as a target due to the substrate specificity difference in parasites and humans. In the present study, the functional importance of the co-evolving residues of the GPI12 protein of Leishmania has been highlighted using the GPI proteins belonging to the GlcNAC-deacetylase family. Exploring the active site of the GPI12 protein and designing inhibitors against the functional residues provide ways and means to change the efficiency of deacetylation activity of the enzyme. The activity of de-N-acetylase is low in the absence of metal ions like zinc. Hence we designed eight small molecules in order to modulate the activity of GPI12. Compound 8 was found to be an appropriate choice to target the agonist (GPI12) active site thereby targeting the residues which were essential in the Zn binding and chelation activity. Inhibition of these sites offered a strong constraint to block the protein activity and in turn GPI biosynthesis.

  12. Effects of urbanization, construction activity, management practices, and impoundments on suspended-sediment transport in Johnson County, northeast Kansas, February 2006 through November 2008

    USGS Publications Warehouse

    Lee, Casey J.; Ziegler, Andrew C.

    2010-01-01

    The U.S. Geological Survey, in cooperation with the Johnson County, Kansas, Stormwater Management Program, investigated the effects of urbanization, construction activity, management practices, and impoundments on suspended-sediment transport in Johnson County from February 2006 through November 2008. Streamgages and continuous turbidity sensors were operated at 15 sites within the urbanizing 57-square-mile Mill Creek Basin, and 4 sites downstream from the other largest basins (49 to 66 square miles) in Johnson County. The largest sediment yields in Johnson County were observed downstream from basins with increased construction activity. Sediment yields attributed to the largest (68 acre) active construction site in the study area were 9,300 tons per square mile in 2007 and 12,200 tons per square mile in 2008; 5 to 55 times larger than yields observed at other sampling sites. However, given erodible soils and steep slopes at this site, sediment yields were relatively small compared to the range in historic values from construction sites without erosion and sediment controls in the United States (2,300 to 140,000 tons per square mile). Downstream from this construction site, a sediment forebay and wetland were constructed in series upstream from Shawnee Mission Lake, a 120-acre reservoir within Shawnee Mission Park. Although the original intent of the sediment forebay and constructed wetland were unrelated to upstream construction, they were nonetheless evaluated in 2008 to characterize sediment removal before stream entry into the lake. The sediment forebay was estimated to reduce 33 percent of sediment transported to the lake, whereas the wetland did not appear to decrease downstream sediment transport. Comparisons of time-series data and relations between turbidity and sediment concentration indicate that larger silt-sized particles were deposited within the sediment forebay, whereas smaller silt and clay-sized sediments were transported through the wetland and into the lake. Data collected at sites up and downstream from the constructed wetland indicated that hydraulic retention alone did not substantially reduce sediment loading to Shawnee Mission Lake. Mean-daily turbidity values at sampling sites downstream from basins with increased construction activity were compared to U.S. Environmental Protection Agency turbidity criteria designed to reduce discharge of pollutants from construction sites. The U.S. Environmental Protection Agency numeric turbidity criteria specifies that effluent from construction sites greater than 20 acres not exceed a mean-daily turbidity value of 280 nephelometric turbidity units beginning in 2011; this criteria will apply to sites greater than 10 acres beginning in 2014. Although numeric criteria would not have been applicable to data from sampling sites in Johnson County because they were not directly downstream from construction sites and because individual states still have to determine additional details as to how this criteria will be enforced, comparisons were made to characterize the potential of construction site effluent in Johnson County to exceed U.S. Environmental Protection Agency Criteria, even under extensive erosion and sediment controls. Numeric criteria were exceeded at sampling sites downstream from basins with increased construction activity for multiple days during the study period, potentially indicating the need for additional erosion and sediment controls and (or) treatment to bring discharges from construction sites into compliance with future numeric turbidity criteria. Among sampling sites in the Mill Creek Basin, sediment yields from the urbanizing Clear Creek Basin were approximately 2 to 3 times those from older, more stable urban or rural basins. Sediments eroded from construction sites adjacent to or surrounding streams appear to be more readily transported downstream, whereas sediments eroded from construction sites in headwater areas are more likely to

  13. NMDA-induced potentiation of mGluR5 is mediated by activation of protein phosphatase 2B/calcineurin

    PubMed Central

    Alagarsamy, Sudar; Saugstad, Julie; Warren, Lee; Mansuy, Isabelle M.; Gereau, Robert W.; Conn, P. Jeffrey

    2010-01-01

    Previous reports have shown that activation of N-methyl-D-aspartate (NMDA) receptors potentiates responses to activation of the group I metabotropic glutamate receptor mGluR5 by reversing PKC-mediated desensitization of this receptor. NMDA-induced reversal of mGluR5 desensitization is dependent on activation of protein phosphatases. However, the specific protein phosphatase involved and the precise mechanism by which NMDA receptor activation reduces mGluR desensitization are not known. We have performed a series of molecular, biochemical, and genetic studies to show that NMDA-induced regulation of mGluR5 is dependent on activation of calcium-dependent protein phosphatase 2B/calcineurin (PP2B/CaN). Furthermore, we report that purified calcineurin directly dephosphorylates the C-terminal tail of mGluR5 at sites that are phosphorylated by PKC. Finally, immunoprecipitation and GST fusion protein pull-down experiments reveal that calcineurin interacts with mGluR5, suggesting that these proteins could be colocalized in a signaling complex. Taken together with previous studies, these data suggest that activation of NMDA receptors leads to activation of calcineurin and that calcineurin modulates mGluR5 function by directly dephosphorylating mGluR5 at PKC sites that are involved in desensitization of this receptor. 2005 Elsevier Ltd. All rights reserved. PMID:16005030

  14. A trap potential model investigation of the optical activity induced in dye-DNA intercalation complexes

    NASA Astrophysics Data System (ADS)

    Kamiya, Mamoru

    1988-02-01

    The fundamental features of the optical activity induced in dye-DNA intercalation complexes are studied by application of the trap potential model which is useful to evaluate the induced rotational strength without reference to detailed geometrical information about the intercalation complexes. The specific effect of the potential depth upon the induced optical activity is explained in terms of the relative magnitudes of the wave-phase and helix-phase variations in the path of an electron moving on a restricted helical segment just like an exciton trapped around the dye intercalation site. The parallel and perpendicular components of the induced rotational strength well reflect basic properties of the helicity effects about the longitudinal and tangential axes of the DNA helical cylinder. The trap potential model is applied to optimize the potential parameters so as to reproduce the ionic strength effect upon the optical activity induced to proflavine-DNA intercalation complexes. From relationships between the optimized potential parameters and ionic strengths, it is inferred that increase in the ionic strength contributes to the optical activity induced by the nearest-neighbour interaction between intercalated proflavine and DNA base pairs.

  15. Control of peroxisome proliferator-activated receptor gamma2 stability and activity by SUMOylation.

    PubMed

    Floyd, Z Elizabeth; Stephens, Jacqueline M

    2004-06-01

    To determine whether small ubiquitin-related modifier (SUMO)ylation of lysine 107 plays a role in regulating the activity of peroxisome proliferator-activated receptor gamma (PPARgamma). Transient expression of wild-type and K107R-PPARgamma2 in the NIH 3T3 fibroblast cell line was carried out in conjunction with half-life studies, luciferase activity assays, and indirect immunofluorescence localization studies. Additional in vitro analysis was carried out using recombinant SUMOylation pathway proteins along with in vitro transcribed and translated wild-type or K107R-PPARgamma2 to examine the SUMO-1 modification state of wild-type and SUMO-deficient K107R-PPARgamma2. While examining PPARgamma2 for potential ubiquitylation sites, we identified a strong consensus site for SUMO modification that contains lysine 107. In vitro, SUMOylation studies showed that lysine 107 of PPARgamma2 is a major SUMOylation site and that at least one other SUMOylation site is present in PPARgamma. In addition, our results demonstrated that SUMO-1 affects PPARgamma stability and transcriptional activity but not the nuclear localization of PPARgamma. These results indicated that SUMOylation plays a role in regulating PPARgamma, both indirectly and directly by modification of lysine 107. Because PPARgamma is regulated in numerous animal models of obesity, understanding the covalent modifications of PPARgamma may enhance our understanding of the metabolic syndrome.

  16. Modulation of HIV Protease Flexibility by the T80N Mutation

    PubMed Central

    Zhou, Hao; Li, Shangyang; Badger, John; Nalivaika, Ellen; Cai, Yufeng; Foulkes-Murzycki, Jennifer; Schiffer, Celia; Makowski, Lee

    2015-01-01

    The flexibility of HIV protease plays a critical role in enabling enzymatic activity and is required for substrate access to the active site. While the importance of flexibility in the flaps that cover the active site is well known, flexibility in other parts of the enzyme is also critical for function. One key region is a loop containing Thr 80 which forms the walls of the active site. Although not situated within the active site, amino acid Thr80 is absolutely conserved. The mutation T80N preserves the structure of the enzyme but catalytic activity is completely lost. To investigate the potential influence of the T80N mutation on HIVp flexibility, wide-angle scattering (WAXS) data was measured for a series of HIV protease variants. Starting with a calculated WAXS pattern from a rigid atomic model, the modulations in the intensity distribution caused by structural fluctuations in the protein were predicted by simple analytic methods and compared to the experimental data. An analysis of T80N WAXS data shows that this variant is significantly more rigid than the WT across all length scales. The effects of this single point mutation extend throughout the protein, so as to alter the mobility of amino acids in the enzymatic core. These results support the contentions that significant protein flexibility extends throughout HIV protease and is critical to catalytic function. PMID:25488402

  17. EPA Region 2 SEMS_CERCLIS Sites All [R2] and SEMS_CERCLIS Sites NPL [R2] GIS Layers

    EPA Pesticide Factsheets

    The Region 2 SEMS_CERCLIS Sites All [R2] GIS layer contains unique Superfund Enterprise Management System (SEMS) site records. These records have the following NPL_STATUS designations: CURRENTLY ON FINAL NPL, DELETED FROM FINAL NPL, NOT ON NPL, PROPOSED FOR NPL, REMOVED FROM PROPOSED NPL, and SITE IS PART OF NPL SITE. The Region 2 SEMS_CERCLIS NPL Sites [R2] GIS layer only has SEMS records with the following NPL_STATUS designations: 'CURRENTLY ON FINAL NPL', 'DELETED FROM FINAL NPL', 'PROPOSED FOR NPL'.The Superfund Enterprise Management System (SEMS) is EPA's official record for tracking hazardous waste sites, potentially hazardous waste sites, and remedial activities performed in support of the Superfund Program across the nation. This includes sites that are on the National Priorities List (NPL) or are being considered for the NPL. SEMS represents a joint development and ongoing collaboration between Superfund's Remedial, Removal, Federal Facilities, Enforcement, and Emergency Response programs. It provides its wide audience base with a means of ongoing analysis of Superfund Program activities and informational needs at the site, regional management, and national management levels. The customers of SEMS or SEMS data are five EPA Headquarters offices and regional staff, citizens, the regulated community, other Federal agencies, States, Tribes, local agencies, and industry. SEMS stakeholders are States, Congress, other Federal agencies, industry groups, and cit

  18. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  19. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  20. The potential of beech seedlings to adapt to low P availability in soil - plant versus microbial effects on P mobilising potential in the rhizosphere

    NASA Astrophysics Data System (ADS)

    Meller, Sonia; Frey, Beat; Frossard, Emmanuel; Spohn, Marie; Schack-Kirchner, Helmer; Luster, Jörg

    2016-04-01

    The objective of our work was to investigate to what extent tree seedlings (Fagus sylvatica) are able to adapt the process of P mobilisation in the rhizosphere according to P speciation in the soil. Such mobilisation activity can include root exudation of P mobilising compounds or stimulation of specific P mobilising soil microbes. We hypothesized that Fagus sylvatica seedlings can adapt their own activity based on their P nutritional status and genetic memory of how to react under a given nutritional situation. To test the hypothesis, we set up a cross-growth experiment with beech of different provenances growing in soil from their own provenance site and in soil differing in P availability. Experiments were performed as a greenhouse experiment, with temperature control and natural light, during one vegetation period in rhizoboxes . We used two acidic forest soils, contrasting in P availability, collected at field sites of the German research priority program "Ecosystem Nutrition". Juvenile trees were collected along with the soils at the sites and planted respectively. The occurrence of P mobilising compounds and available P in the rhizosphere and in bulk soil were measured during the active growth season of the plants. In particular, we assessed phosphatase activity, (measured with zymography and plate enzymatic assay at pH 4,6.5, and 11) carboxylates and phosphate (measured by application of ion exchange membranes to specific soil micro zones, and by microdialysis), and pH (mapping with optodes). Plant P nutrition status was assessed by total P, N/P, phosphatase activity, and metabolic (TCA extractable) P in the leaves. The P-nutritional status of the beech provenances differed markedly independent from the P status of the soil where they were actually grown during experiment. In particular, the juvenile trees from the site rich in mineral P were sufficient in P, while those from the P-poor site with mostly organic P, were deficient. Enzymatic activity at the rhizoplane was mostly determined by the soil and was affected only to a small degree by plant provenance. On the other hand, plant provenance appeared to affect the occurrence of oxalate in the rhizosphere. The observed pH gradients near the root reflect the production of nitrate in the soil and the plant nitrate uptake. These results suggest, that the potential to hydrolyse organic P in the rhizosphere is mainly governed by the existing soil microbial community, while the plant itself actively influence the mobilisation of inorganic P by root exudation of carboxylates or possibly by stimulating the carboxylate exudation by specific microorganisms.

  1. E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

    PubMed

    Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

    2017-01-01

    Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

  2. Disconnect of microbial structure and function: enzyme activities and bacterial communities in nascent stream corridors.

    PubMed

    Frossard, Aline; Gerull, Linda; Mutz, Michael; Gessner, Mark O

    2012-03-01

    A fundamental issue in microbial and general ecology is the question to what extent environmental conditions dictate the structure of communities and the linkages with functional properties of ecosystems (that is, ecosystem function). We approached this question by taking advantage of environmental gradients established in soil and sediments of small stream corridors in a recently created, early successional catchment. Specifically, we determined spatial and temporal patterns of bacterial community structure and their linkages with potential microbial enzyme activities along the hydrological flow paths of the catchment. Soil and sediments were sampled in a total of 15 sites on four occasions spread throughout a year. Denaturing gradient gel electrophoresis (DGGE) was used to characterize bacterial communities, and substrate analogs linked to fluorescent molecules served to track 10 different enzymes as specific measures of ecosystem function. Potential enzyme activities varied little among sites, despite contrasting environmental conditions, especially in terms of water availability. Temporal changes, in contrast, were pronounced and remarkably variable among the enzymes tested. This suggests much greater importance of temporal dynamics than spatial heterogeneity in affecting specific ecosystem functions. Most strikingly, bacterial community structure revealed neither temporal nor spatial patterns. The resulting disconnect between bacterial community structure and potential enzyme activities indicates high functional redundancy within microbial communities even in the physically and biologically simplified stream corridors of early successional landscapes.

  3. Bifunctional cis-Abienol Synthase from Abies balsamea Discovered by Transcriptome Sequencing and Its Implications for Diterpenoid Fragrance Production*

    PubMed Central

    Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg

    2012-01-01

    The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889

  4. Satellite Power System (SPS) laser studies. Volume 2: Meteorological effects on laser beam propagation and direct solar pumped lasers for the SPS

    NASA Technical Reports Server (NTRS)

    Beverly, R. E., III

    1980-01-01

    The primary emphasis of this research activity was to investigate the effect of the environment on laser power transmission/reception from space to ground. Potential mitigation techniques to minimize the environment effect by a judicious choice of laser operating parameters was investigated. Using these techniques, the availability of power at selected sites was determined using statistical meteorological data for each site.

  5. Photoaffinity-labeled Cytokinins

    PubMed Central

    Theiler, Jane B.; Leonard, Nelson J.; Schmitz, Ruth Y.; Skoog, Folke

    1976-01-01

    Two new azidopurine derivatives, 2-azido-N6-(Δ2-isopentenyl)adenine and 2-azido-N6-benzyladenine, have been synthesized as potential photoaffinity labels for probing cytokinin-binding sites. The preparation and the biological activity of these compounds are described. PMID:16659772

  6. ANALYSIS OF GEOTHERMAL WASTES FOR HAZARDOUS COMPONENTS

    EPA Science Inventory

    Regulations governing the disposal of hazardous wastes led to an assessment for geothermal solid wastes for potentially hazardous properties. Samples were collected from three active geothermal sites in the western United States: The Geysers, Imperial Valley, and northwestern Nev...

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robichaud, R.; Fields, J.; Roberts, J. O.

    The U.S. Environmental Protection Agency (EPA) launched the RE-Powering America's Land initiative to encourage development of renewable energy (RE) on potentially contaminated land and mine sites. EPA is collaborating with the U.S. Department of Energy's (DOE's) National Renewable Energy Laboratory (NREL) to evaluate RE options at Naval Station (NAVSTA) Newport in Newport, Rhode Island where multiple contaminated areas pose a threat to human health and the environment. Designated a superfund site on the National Priorities List in 1989, the base is committed to working toward reducing the its dependency on fossil fuels, decreasing its carbon footprint, and implementing RE projectsmore » where feasible. The Naval Facilities Engineering Service Center (NFESC) partnered with NREL in February 2009 to investigate the potential for wind energy generation at a number of Naval and Marine bases on the East Coast. NAVSTA Newport was one of several bases chosen for a detailed, site-specific wind resource investigation. NAVSTA Newport, in conjunction with NREL and NFESC, has been actively engaged in assessing the wind resource through several ongoing efforts. This report focuses on the wind resource assessment, the estimated energy production of wind turbines, and a survey of potential wind turbine options based upon the site-specific wind resource.« less

  8. Active Site Metal Identity Alters Histone Deacetylase 8 Substrate Selectivity: A Potential Novel Regulatory Mechanism.

    PubMed

    Castaneda, Carol Ann; Lopez, Jeffrey E; Joseph, Caleb G; Scholle, Michael D; Mrksich, Milan; Fierke, Carol A

    2017-10-24

    Histone deacetylase 8 (HDAC8) is a well-characterized member of the class I acetyl-lysine deacetylase (HDAC) family. Previous work has shown that the efficiency of HDAC8-catalyzed deacetylation of a methylcoumarin peptide varies depending on the identity of the divalent metal ion in the HDAC8 active site. Here we demonstrate that both HDAC8 activity and substrate selectivity for a diverse range of peptide substrates depend on the identity of the active site metal ion. Varied deacetylase activities of Fe(II)- and Zn(II)-HDAC8 toward an array of peptide substrates were identified using self-assembled monolayers for matrix-assisted laser desorption ionization (SAMDI) mass spectrometry. Subsequently, the metal dependence of deacetylation of peptides of biological interest was measured using an in vitro peptide assay. While Fe(II)-HDAC8 is generally more active than Zn(II)-HDAC8, the Fe(II)/Zn(II) HDAC8 activity ratio varies widely (from 2 to 150) among the peptides tested. These data provide support for the hypothesis that HDAC8 may undergo metal switching in vivo that, in turn, may regulate its activity. However, future studies are needed to explore the identity of the metal ion bound to HDAC8 in cells under varied conditions.

  9. Virtual colleagues, virtually colleagues—physicians’ use of Twitter: a population-based observational study

    PubMed Central

    Brynolf, Anne; Johansson, Stefan; Appelgren, Ester; Lynoe, Niels; Edstedt Bonamy, Anna-Karin

    2013-01-01

    Objective To investigate potential violations of patient confidentiality or other breaches of medical ethics committed by physicians and medical students active on the social networking site Twitter. Design Population-based cross-sectional observational study. Setting The social networking site Twitter (Swedish-speaking users, n=298819). Population Physicians and medical students (Swedish-speaking users, n=237) active on the social networking site Twitter between July 2007 and March 2012. Main outcome measure Postings that reflect unprofessional behaviour and ethical breaches among physicians and medical students. Results In all, 237 Twitter accounts were established as held by physicians and medical students and a total of 13 780 tweets were analysed by content. In all, 276 (1.9%) tweets were labelled as ‘unprofessional’. Among these, 26 (0.2%) tweets written by 15 (6.3%) physicians and medical students included information that could violate patient privacy. No information on the personal ID number or names was disclosed, but parts of the patient documentation or otherwise specific indicatory information on patients were found. Unprofessional tweets were more common among users writing under a pseudonym and among medical students. Conclusions In this study of physicians and medical students on Twitter, we observed potential violations of patient privacy and other breaches of medical ethics. Our findings underline that every physician and medical student has to consider his or her presence on social networking sites. It remains to be investigated if the introduction of social networking site guidelines for medical professionals will improve awareness. PMID:23883885

  10. Virtual colleagues, virtually colleagues--physicians' use of Twitter: a population-based observational study.

    PubMed

    Brynolf, Anne; Johansson, Stefan; Appelgren, Ester; Lynoe, Niels; Edstedt Bonamy, Anna-Karin

    2013-01-01

    To investigate potential violations of patient confidentiality or other breaches of medical ethics committed by physicians and medical students active on the social networking site Twitter. Population-based cross-sectional observational study. The social networking site Twitter (Swedish-speaking users, n=298819). Physicians and medical students (Swedish-speaking users, n=237) active on the social networking site Twitter between July 2007 and March 2012. Postings that reflect unprofessional behaviour and ethical breaches among physicians and medical students. In all, 237 Twitter accounts were established as held by physicians and medical students and a total of 13 780 tweets were analysed by content. In all, 276 (1.9%) tweets were labelled as 'unprofessional'. Among these, 26 (0.2%) tweets written by 15 (6.3%) physicians and medical students included information that could violate patient privacy. No information on the personal ID number or names was disclosed, but parts of the patient documentation or otherwise specific indicatory information on patients were found. Unprofessional tweets were more common among users writing under a pseudonym and among medical students. In this study of physicians and medical students on Twitter, we observed potential violations of patient privacy and other breaches of medical ethics. Our findings underline that every physician and medical student has to consider his or her presence on social networking sites. It remains to be investigated if the introduction of social networking site guidelines for medical professionals will improve awareness.

  11. Multi-method Near-surface Geophysical Surveys for Site Response and Earthquake Damage Assessments at School Sites in Washington, USA

    NASA Astrophysics Data System (ADS)

    Cakir, R.; Walsh, T. J.; Norman, D. K.

    2017-12-01

    We, Washington Geological Survey (WGS), have been performing multi-method near surface geophysical surveys to help assess potential earthquake damage at public schools in Washington. We have been conducting active and passive seismic surveys, and estimating Shear-wave velocity (Vs) profiles, then determining the NEHRP soil classifications based on Vs30m values at school sites in Washington. The survey methods we have used: 1D and 2D MASW and MAM, P- and S-wave refraction, horizontal-to-vertical spectral ratio (H/V), and 2ST-SPAC to measure Vs and Vp at shallow (0-70m) and greater depths at the sites. We have also run Ground Penetrating Radar (GPR) surveys at the sites to check possible horizontal subsurface variations along and between the seismic survey lines and the actual locations of the school buildings. The seismic survey results were then used to calculate Vs30m for determining the NEHRP soil classifications at school sites, thus soil amplification effects on the ground motions. Resulting shear-wave velocity profiles generated from these studies can also be used for site response and liquefaction potential studies, as well as for improvement efforts of the national Vs30m database, essential information for ShakeMap and ground motion modeling efforts in Washington and Pacific Northwest. To estimate casualties, nonstructural, and structural losses caused by the potential earthquakes in the region, we used these seismic site characterization results associated with structural engineering evaluations based on ASCE41 or FEMA 154 (Rapid Visual Screening) as inputs in FEMA Hazus-Advanced Engineering Building Module (AEBM) analysis. Compelling example surveys will be presented for the school sites in western and eastern Washington.

  12. Geo-Chip analysis reveals reduced functional diversity of the bacterial community at a dumping site for dredged Elbe sediment.

    PubMed

    Störmer, Rebecca; Wichels, Antje; Gerdts, Gunnar

    2013-12-15

    The dumping of dredged sediments represents a major stressor for coastal ecosystems. The impact on the ecosystem function is determined by its complexity not easy to assess. In the present study, we evaluated the potential of bacterial community analyses to act as ecological indicators in environmental monitoring programmes. We investigated the functional structure of bacterial communities, applying functional gene arrays (GeoChip4.2). The relationship between functional genes and environmental factors was analysed using distance-based multivariate multiple regression. Apparently, both the function and structure of the bacterial communities are impacted by dumping activities. The bacterial community at the dumping centre displayed a significant reduction of its entire functional diversity compared with that found at a reference site. DDX compounds separated bacterial communities of the dumping site from those of un-impacted sites. Thus, bacterial community analyses show great potential as ecological indicators in environmental monitoring. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site.

    PubMed

    Kassotis, Christopher D; Iwanowicz, Luke R; Akob, Denise M; Cozzarelli, Isabelle M; Mumford, Adam C; Orem, William H; Nagel, Susan C

    2016-07-01

    Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Crystal structure of the dithiol oxidase DsbA enzyme from proteus mirabilis bound non-covalently to an active site peptide ligand.

    PubMed

    Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A; Fairlie, David P; Martin, Jennifer L

    2014-07-11

    The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

    USGS Publications Warehouse

    Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam; Orem, William H.; Nagel, Susan C.

    2016-01-01

    Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby.

  16. Health system reform and the role of field sites based upon demographic and health surveillance.

    PubMed Central

    Tollman, S. M.; Zwi, A. B.

    2000-01-01

    Field sites for demographic and health surveillance have made well-recognized contributions to the evaluation of new or untested interventions, largely through efficacy trials involving new technologies or the delivery of selected services, e.g. vaccines, oral rehydration therapy and alternative contraceptive methods. Their role in health system reform, whether national or international, has, however, proved considerably more limited. The present article explores the characteristics and defining features of such field sites in low-income and middle-income countries and argues that many currently active sites have a largely untapped potential for contributing substantially to national and subnational health development. Since the populations covered by these sites often correspond with the boundaries of districts or subdistricts, the strategic use of information generated by demographic surveillance can inform the decentralization efforts of national and provincial health authorities. Among the areas of particular importance are the following: making population-based information available and providing an information resource; evaluating programmes and interventions; and developing applications to policy and practice. The question is posed as to whether their potential contribution to health system reform justifies arguing for adaptations to these field sites and expanded investment in them. PMID:10686747

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Booth, Peter M.; Da Silva, Nivaldo Carlos; Pereira de Oliveira, Alexandre

    The Caldas site is located in the Federal State of Minas Gerais in Brazil about 25 km from the city of Pocos de Caldas. While the city itself has 150,000 inhabitants there is a total population of around 0.5 million people living in an area that could potentially be influenced by the site. Uranium ore was mined and milled here between the years of 1982 and 1995, with ore extraction taking place from an open pit. Of the material removed, aside from that extracted for uranium, some was used on-site for road construction and building embankments while the remainder wasmore » disposed of onto two major rock piles. There are a number of potential historical and current environmental impacts to groundwater as a consequence of discharges into streams which then flow off site. The site is now undergoing a phase of decommissioning which includes the formulation and substantiation of a site remediation strategy. As part of a wider International Atomic Energy Agency (IAEA) Technical Cooperation Project aimed at providing practical guidance for implementing a decommissioning and remediation plan at the site, WSP E and E were invited to lead a mission in order to provide advice on the importance and merits of stakeholder engagement and how to ultimately build an engagement program. In November 2011, WSP E and E met with personnel from the site operators, the Brazilian regulatory bodies and representatives from the local stakeholder community and explained the principles of stakeholder engagement and how the process had internationally evolved principally from a decide-announce-defend approach to a more formal two way mechanism of engagement. Historically there had been insufficient liaison between the site operator, the nuclear regulator and the environmental regulator. All parties had recognized that greater interaction was necessary. There had also been very little engagement with local stakeholders about the various activities on the site and the potential implications of these activities on human health and the environment. The main concerns of the local stakeholders were in relation to potential environmental impacts on groundwater and surface water as well as their lack of knowledge about the site's activities and how it might evolve over time. There was a feeling that the site brought no real benefit to the local community as local labor was rarely utilized when work was being undertaken. WSP E and E were asked many questions about stakeholder engagement processes and had to address a number of concerns relating to being able to construct and control an engagement program. Advice was provided on how to construct a phased program in a manner that would allow the site operator to demonstrate increased transparency and allow as wide a range of stakeholders as possible the opportunity to become engaged. We provided an important message in that engagement often had to be culture and project specific and that what might work in one country could not necessarily purely be transposed to another. Since the WSP E and E mission there has been evidence of a number of positive steps in many of the areas of stakeholder engagement related to the Caldas site. The nuclear and environmental regulators work in a more open and transparent manner and continue to undertake joint inspections of the Caldas site. They have agreed to develop a written agreement that will enable them to jointly assess and discuss the issues on the site. Both regulatory bodies had previously accompanied the site operator on a visit to the Wismut uranium mining area in Germany and as well as providing useful learning had also allowed the regulators to discuss some common issues, thus bringing them closer together. A local stakeholder group under the auspices of the Water Commission had previously been set up but now they are starting to have more regular meetings with the site operator and nuclear regulator. They are now additionally considering the formation of a site specific advisory board (based on similar lines to those at US legacy sites) in order to gain some further technical focus within the stakeholder community. The site operator has started to present and explain the proposed environmental remediation plans to various towns and cities potentially influenced by the Caldas site. The successes to date can be attributed primarily to the willingness of the site operator to engage more openly with local community representatives in addition to the enthusiasm of the Water Commission itself. Providing stakeholder engagement advice to all the relevant parties in a manner which recognized their concerns, aspirations and country specific culture was extremely important for this positive progress to have been established. The process established and the subsequent successes could provide useful learning to those countries that face similar cultural engagement challenges. (authors)« less

  18. Zinc binding in HDAC inhibitors: a DFT study.

    PubMed

    Wang, Difei; Helquist, Paul; Wiest, Olaf

    2007-07-06

    Histone deacetylases (HDACs) are attractive targets for the treatment of cancers and a variety of other diseases. Most currently studied HDAC inhibitors contain hydroxamic acids, which are potentially problematic in the development of practical drugs. DFT calculations of the binding modes and free energies of binding for a variety of other functionalities in a model active site of HDAC are described. The protonation state of hydroxamic acids in the active site and the origin of the high affinity are discussed. These results emphasize the importance of a carefully chosen pKa for zinc binding and provide guidance for the design of novel, non-hydroxamic acid HDAC inhibitors.

  19. A Methodology to Evaluate Ecological Resources and Risk Using Two Case Studies at the Department of Energy's Hanford Site

    NASA Astrophysics Data System (ADS)

    Burger, Joanna; Gochfeld, Michael; Bunn, Amoret; Downs, Janelle; Jeitner, Christian; Pittfield, Taryn; Salisbury, Jennifer; Kosson, David

    2017-03-01

    An assessment of the potential risks to ecological resources from remediation activities or other perturbations should involve a quantitative evaluation of resources on the remediation site and in the surrounding environment. We developed a risk methodology to rapidly evaluate potential impact on ecological resources for the U.S. Department of Energy's Hanford Site in southcentral Washington State. We describe the application of the risk evaluation for two case studies to illustrate its applicability. The ecological assessment involves examining previous sources of information for the site, defining different resource levels from 0 to 5. We also developed a risk rating scale from non-discernable to very high. Field assessment is the critical step to determine resource levels or to determine if current conditions are the same as previously evaluated. We provide a rapid assessment method for current ecological conditions that can be compared to previous site-specific data, or that can be used to assess resource value on other sites where ecological information is not generally available. The method is applicable to other Department of Energy's sites, where its development may involve a range of state regulators, resource trustees, Tribes and other stakeholders. Achieving consistency across Department of Energy's sites for valuation of ecological resources on remediation sites will assure Congress and the public that funds and personnel are being deployed appropriately.

  20. A Methodology to Evaluate Ecological Resources and Risk Using Two Case Studies at the Department of Energy's Hanford Site.

    PubMed

    Burger, Joanna; Gochfeld, Michael; Bunn, Amoret; Downs, Janelle; Jeitner, Christian; Pittfield, Taryn; Salisbury, Jennifer; Kosson, David

    2017-03-01

    An assessment of the potential risks to ecological resources from remediation activities or other perturbations should involve a quantitative evaluation of resources on the remediation site and in the surrounding environment. We developed a risk methodology to rapidly evaluate potential impact on ecological resources for the U.S. Department of Energy's Hanford Site in southcentral Washington State. We describe the application of the risk evaluation for two case studies to illustrate its applicability. The ecological assessment involves examining previous sources of information for the site, defining different resource levels from 0 to 5. We also developed a risk rating scale from non-discernable to very high. Field assessment is the critical step to determine resource levels or to determine if current conditions are the same as previously evaluated. We provide a rapid assessment method for current ecological conditions that can be compared to previous site-specific data, or that can be used to assess resource value on other sites where ecological information is not generally available. The method is applicable to other Department of Energy's sites, where its development may involve a range of state regulators, resource trustees, Tribes and other stakeholders. Achieving consistency across Department of Energy's sites for valuation of ecological resources on remediation sites will assure Congress and the public that funds and personnel are being deployed appropriately.

  1. Single Atomic Iron Catalysts for Oxygen Reduction in Acidic Media: Particle Size Control and Thermal Activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hanguang; Hwang, Sooyeon; Wang, Maoyu

    It remains a grand challenge to replace platinum group metal (PGM) catalysts with earth-abundant materials for the oxygen reduction reaction (ORR) in acidic media, which is crucial for large-scale deployment of proton exchange membrane fuel cells (PEMFCs). Here, we report a high-performance atomic Fe catalyst derived from chemically Fe-doped zeolitic imidazolate frameworks (ZIFs) by directly bonding Fe ions to imidazolate ligands within 3D frameworks. Although the ZIF was identified as a promising precursor, the new synthetic chemistry enables the creation of well-dispersed atomic Fe sites embedded into porous carbon without the formation of aggregates. The size of catalyst particles ismore » tunable through synthesizing Fe-doped ZIF nanocrystal precursors in a wide range from 20 to 1000 nm followed by one-step thermal activation. Similar to Pt nanoparticles, the unique size control without altering chemical properties afforded by this approach is able to increase the number of PGM-free active sites. The best ORR activity is measured with the catalyst at a size of 50 nm. Further size reduction to 20 nm leads to significant particle agglomeration, thus decreasing the activity. Using the homogeneous atomic Fe model catalysts, we elucidated the active site formation process through correlating measured ORR activity with the change of chemical bonds in precursors during thermal activation up to 1100 °C. The critical temperature to form active sites is 800 °C, which is associated with a new Fe species with a reduced oxidation number (from Fe3+ to Fe2+) likely bonded with pyridinic N (FeN4) embedded into the carbon planes. Further increasing the temperature leads to continuously enhanced activity, linked to the rise of graphitic N and Fe–N species. The new atomic Fe catalyst has achieved respectable ORR activity in challenging acidic media (0.5 M H2SO4), showing a half-wave potential of 0.85 V vs RHE and leaving only a 30 mV gap with Pt/C (60 μgPt/cm2). Enhanced stability is attained with the same catalyst, which loses only 20 mV after 10 000 potential cycles (0.6–1.0 V) in O2 saturated acid. The high-performance atomic Fe PGM-free catalyst holds great promise as a replacement for Pt in future PEMFCs.« less

  2. Single Atomic Iron Catalysts for Oxygen Reduction in Acidic Media: Particle Size Control and Thermal Activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hanguang; Hwang, Sooyeon; Wang, Maoyu

    It remains a grand challenge to replace platinum group metal (PGM) catalysts with earth-abundant materials for the oxygen reduction reaction (ORR) in acidic media, which is crucial for large-scale deployment of proton exchange membrane fuel cells (PEMFCs). We report a high-performance atomic Fe catalyst derived from chemically Fe-doped zeolitic imidazolate frameworks (ZIFs) by directly bonding Fe ions to imidazolate ligands within 3D frameworks. Although the ZIF was identified as a promising precursor, the new synthetic chemistry enables the creation of well-dispersed atomic Fe sites embedded into porous carbon without the formation of aggregates. The size of catalyst particles is tunablemore » through synthesizing Fe-doped ZIF nanocrystal precursors in a wide range from 20 to 1000 nm followed by one-step thermal activation. Similar to Pt nanoparticles, the unique size control without altering chemical properties afforded by this approach is able to increase the number of PGM-free active sites. The best ORR activity is measured with the catalyst at a size of 50 nm. Further size reduction to 20 nm leads to significant particle agglomeration, thus decreasing the activity. In using the homogeneous atomic Fe model catalysts, we elucidated the active site formation process through correlating measured ORR activity with the change of chemical bonds in precursors during thermal activation up to 1100 °C. The critical temperature to form active sites is 800 °C, which is associated with a new Fe species with a reduced oxidation number (from Fe 3+ to Fe 2+) likely bonded with pyridinic N (FeN 4) embedded into the carbon planes. Further increasing the temperature leads to continuously enhanced activity, linked to the rise of graphitic N and Fe–N species. The new atomic Fe catalyst has achieved respectable ORR activity in challenging acidic media (0.5 M H 2SO 4), showing a half-wave potential of 0.85 V vs RHE and leaving only a 30 mV gap with Pt/C (60 μg Pt/cm 2). Finally, enhanced stability is attained with the same catalyst, which loses only 20 mV after 10 000 potential cycles (0.6–1.0 V) in O 2 saturated acid. The high-performance atomic Fe PGM-free catalyst holds great promise as a replacement for Pt in future PEMFCs.« less

  3. Single Atomic Iron Catalysts for Oxygen Reduction in Acidic Media: Particle Size Control and Thermal Activation

    DOE PAGES

    Zhang, Hanguang; Hwang, Sooyeon; Wang, Maoyu; ...

    2017-09-13

    It remains a grand challenge to replace platinum group metal (PGM) catalysts with earth-abundant materials for the oxygen reduction reaction (ORR) in acidic media, which is crucial for large-scale deployment of proton exchange membrane fuel cells (PEMFCs). We report a high-performance atomic Fe catalyst derived from chemically Fe-doped zeolitic imidazolate frameworks (ZIFs) by directly bonding Fe ions to imidazolate ligands within 3D frameworks. Although the ZIF was identified as a promising precursor, the new synthetic chemistry enables the creation of well-dispersed atomic Fe sites embedded into porous carbon without the formation of aggregates. The size of catalyst particles is tunablemore » through synthesizing Fe-doped ZIF nanocrystal precursors in a wide range from 20 to 1000 nm followed by one-step thermal activation. Similar to Pt nanoparticles, the unique size control without altering chemical properties afforded by this approach is able to increase the number of PGM-free active sites. The best ORR activity is measured with the catalyst at a size of 50 nm. Further size reduction to 20 nm leads to significant particle agglomeration, thus decreasing the activity. In using the homogeneous atomic Fe model catalysts, we elucidated the active site formation process through correlating measured ORR activity with the change of chemical bonds in precursors during thermal activation up to 1100 °C. The critical temperature to form active sites is 800 °C, which is associated with a new Fe species with a reduced oxidation number (from Fe 3+ to Fe 2+) likely bonded with pyridinic N (FeN 4) embedded into the carbon planes. Further increasing the temperature leads to continuously enhanced activity, linked to the rise of graphitic N and Fe–N species. The new atomic Fe catalyst has achieved respectable ORR activity in challenging acidic media (0.5 M H 2SO 4), showing a half-wave potential of 0.85 V vs RHE and leaving only a 30 mV gap with Pt/C (60 μg Pt/cm 2). Finally, enhanced stability is attained with the same catalyst, which loses only 20 mV after 10 000 potential cycles (0.6–1.0 V) in O 2 saturated acid. The high-performance atomic Fe PGM-free catalyst holds great promise as a replacement for Pt in future PEMFCs.« less

  4. Identification of a putative binding site critical for general anesthetic activation of TRPA1.

    PubMed

    Ton, Hoai T; Phan, Thieu X; Abramyan, Ara M; Shi, Lei; Ahern, Gerard P

    2017-04-04

    General anesthetics suppress CNS activity by modulating the function of membrane ion channels, in particular, by enhancing activity of GABA A receptors. In contrast, several volatile (isoflurane, desflurane) and i.v. (propofol) general anesthetics excite peripheral sensory nerves to cause pain and irritation upon administration. These noxious anesthetics activate transient receptor potential ankyrin repeat 1 (TRPA1), a major nociceptive ion channel, but the underlying mechanisms and site of action are unknown. Here we exploit the observation that pungent anesthetics activate mammalian but not Drosophila TRPA1. Analysis of chimeric Drosophila and mouse TRPA1 channels reveal a critical role for the fifth transmembrane domain (S5) in sensing anesthetics. Interestingly, we show that anesthetics share with the antagonist A-967079 a potential binding pocket lined by residues in the S5, S6, and the first pore helix; isoflurane competitively disrupts A-967079 antagonism, and introducing these mammalian TRPA1 residues into dTRPA1 recapitulates anesthetic agonism. Furthermore, molecular modeling predicts that isoflurane and propofol bind to this pocket by forming H-bond and halogen-bond interactions with Ser-876, Met-915, and Met-956. Mutagenizing Met-915 or Met-956 selectively abolishes activation by isoflurane and propofol without affecting actions of A-967079 or the agonist, menthol. Thus, our combined experimental and computational results reveal the potential binding mode of noxious general anesthetics at TRPA1. These data may provide a structural basis for designing drugs to counter the noxious and vasorelaxant properties of general anesthetics and may prove useful in understanding effects of anesthetics on related ion channels.

  5. Effects of tetraethylammonium on potassium currents in a molluscan neurons

    PubMed Central

    1981-01-01

    The effects of tetraethylammonium (TEA) on the delayed K+ current and on the Ca2+-activated K+ current of the Aplysia pacemaker neurons R-15 and L-6 were studied. The delayed outward K+ current was measured in Ca2+-free ASW containing tetrodotoxin (TTX), using brief depolarizing clamp pulses. External TEA blocks the delayed K+ current reversibly in a dose-dependent manner. The experimental results are well fitted with a Michaelis-Menten expression, assuming a one-to-one reaction between TEA and a receptor site, with an apparent dissociation constant of 6.0 mM. The block depends on membrane voltage and is reduced at positive membrane potentials. The Ca2+-activated K+ current was measured in Ca2+- free artificial seawater (ASW) containing TTX, using internal Ca2+ ion injection to directly activate the K+ conductance. External TEA and a number of other quaternary ammonium ions block the Ca2+-activated K+ current reversibly in a dose-dependent manner. TEA is the most effective blocker, with an apparent dissociation constant, for a one-to- one reaction with a receptor site, of 0.4 mM. The block decreases with depolarization. The Ca2+-activated K+ current was also measured after intracellular iontophoretic TEA injection. Internal TEA blocks the Ca2+- activated K+ current (but the block is only apparent at positive membrane potentials), is increased by depolarization, and is irreversible. The effects of external and internal TEA can be seen in measurements of the total outward K+ current at different membrane potentials in normal ASW. PMID:6265594

  6. Human health risk assessment in restoring safe and productive use of abandoned contaminated sites.

    PubMed

    Wcisło, Eleonora; Bronder, Joachim; Bubak, Anicenta; Rodríguez-Valdés, Eduardo; Gallego, José Luis R

    2016-09-01

    In Europe soil contamination has been recognized as a serious problem. The needs to remediate contaminated sites are not questionable, although the remediation actions are often hindered by their very high financial costs. On the other hand, the abandoned contaminated sites may have the potential for redevelopment and creating conditions appropriate for their productive reuse bringing social, economic and environmental benefits. The main concern associated with the contaminated sites is their potential adverse health impact. Therefore, in the process of contaminated site redevelopment the risk assessment and the subsequent risk management decisions will play a crucial role. The main objective of this study was to illustrate the role of the human health risk assessment (HRA) in supporting site remediation and reuse decisions. To exemplify the significance of the HRA process in this field the Nitrastur site, located in Asturias, Spain was used. Risks resulting from soil contamination with arsenic (As), cadmium (Cd), chromium (Cr), copper (Cu), nickel (Ni), mercury (Hg), zinc (Zn) and lead (Pb) were assessed under three potential future land use patterns: industrial, residential and recreational. The results of the study indicated that soil at the Nitrastur site might pose non-cancer and cancer risks to potential future receptors - industrial workers, residents and recreational users. Arsenic and lead are the main substances responsible for the health risk and the primary drivers of remedial decisions at the site. The highest total cancer risks were observed under the residential scenario, followed in descending order by the recreational and industrial ones. The remedial maps illustrate in which areas remediation activities are required, depending on a given land use pattern. The obtained results may be used to develop, analyse, compare and select the remedial options within the intended land use pattern. They may also be used to support the decisions concerning the reuse of the site or to create different redevelopment plans for different parts of the site. The study may help improve understanding and interaction between risk assessors and risk managers which are necessary to make proper, fully informed decisions enhancing public trust and credibility. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Pyrrole-indolinone SU11652 targets the nucleoside diphosphate kinase from Leishmania parasites.

    PubMed

    Vieira, Plínio Salmazo; Souza, Tatiana de Arruda Campos Brasil; Honorato, Rodrigo Vargas; Zanphorlin, Letícia Maria; Severiano, Kelven Ulisses; Rocco, Silvana Aparecida; de Oliveira, Arthur Henrique Cavalcante; Cordeiro, Artur Torres; Oliveira, Paulo Sérgio Lopes; de Giuseppe, Priscila Oliveira; Murakami, Mário Tyago

    2017-07-01

    Nucleoside diphosphate kinases (NDKs) are key enzymes in the purine-salvage pathway of trypanosomatids and have been associated with the maintenance of host-cell integrity for the benefit of the parasite, being potential targets for rational drug discovery and design. The NDK from Leishmania major (LmNDK) and mutants were expressed and purified to homogeneity. Thermal shift assays were employed to identify potential inhibitors for LmNDK. Calorimetric experiments, site-directed mutagenesis and molecular docking analysis were performed to validate the interaction and to evaluate the structural basis of ligand recognition. Furthermore, the anti-leishmanial activity of the newly identified and validated compound was tested in vitro against different Leishmania species. The molecule SU11652, a Sunitinib analog, was identified as a potential inhibitor for LmNDK and structural studies indicated that this molecule binds to the active site of LmNDK in a similar conformation to nucleotides, mimicking natural substrates. Isothermal titration calorimetry experiments combined with site-directed mutagenesis revealed that the residues H50 and H117, considered essential for catalysis, play an important role in ligand binding. In vitro cell studies showed that SU11652 had similar efficacy to Amphotericin b against some Leishmania species. Together, our results indicate the pyrrole-indolinone SU11652 as a promising scaffold for the rational design of new drugs targeting the enzyme NDK from Leishmania parasites. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Targeted Delivery of LXR Agonist Using a Site-Specific Antibody-Drug Conjugate.

    PubMed

    Lim, Reyna K V; Yu, Shan; Cheng, Bo; Li, Sijia; Kim, Nam-Jung; Cao, Yu; Chi, Victor; Kim, Ji Young; Chatterjee, Arnab K; Schultz, Peter G; Tremblay, Matthew S; Kazane, Stephanie A

    2015-11-18

    Liver X receptor (LXR) agonists have been explored as potential treatments for atherosclerosis and other diseases based on their ability to induce reverse cholesterol transport and suppress inflammation. However, this therapeutic potential has been hindered by on-target adverse effects in the liver mediated by excessive lipogenesis. Herein, we report a novel site-specific antibody-drug conjugate (ADC) that selectively delivers a LXR agonist to monocytes/macrophages while sparing hepatocytes. The unnatural amino acid para-acetylphenylalanine (pAcF) was site-specifically incorporated into anti-CD11a IgG, which binds the α-chain component of the lymphocyte function-associated antigen 1 (LFA-1) expressed on nearly all monocytes and macrophages. An aminooxy-modified LXR agonist was conjugated to anti-CD11a IgG through a stable, cathepsin B cleavable oxime linkage to afford a chemically defined ADC. The anti-CD11a IgG-LXR agonist ADC induced LXR activation specifically in human THP-1 monocyte/macrophage cells in vitro (EC50-27 nM), but had no significant effect in hepatocytes, indicating that payload delivery is CD11a-mediated. Moreover, the ADC exhibited higher-fold activation compared to a conventional synthetic LXR agonist T0901317 (Tularik) (3-fold). This novel ADC represents a fundamentally different strategy that uses tissue targeting to overcome the limitations of LXR agonists for potential use in treating atherosclerosis.

  9. How registered nurses, licensed practical nurses and resident aides spend time in nursing homes: An observational study.

    PubMed

    McCloskey, Rose; Donovan, Cindy; Stewart, Connie; Donovan, Alicia

    2015-09-01

    Calls for improved conditions in nursing homes have pointed to the importance of optimizing the levels and skills of care providers. Understanding the work of care providers will help to determine if staff are being used to their full potential and if opportunities exist for improved efficiencies. To explore the activities of care providers in different nursing homes and to identify if variations exist within and across homes and shifts. A multi-centre cross-sectional observational work flow study was conducted in seven different nursing homes sites in one Canadian province. Data were collected by a research assistant who conducted 368 h of observation. The research assistant collected data by following an identical route in each site and recording observations on staff activities. Findings indicate staff activities vary across roles, sites and shifts. Licensed practical nurses (nursing assistants) have the greatest variation in their role while registered nurses have the least amount of variability. In some sites both registered nurses and licensed practical nurses perform activities that may be safely delegated to others. Care providers spend as much as 53.7% of their time engaged in non-value added activities. There may be opportunities for registered nurses and licensed practical nurses to delegate some of their activities to non-regulated workers. The time care providers spend in non-value activities suggest there may be opportunities to improve efficiencies within the nursing home setting. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Kinetic Modeling of the Mitochondrial Energy Metabolism of Neuronal Cells: The Impact of Reduced α-Ketoglutarate Dehydrogenase Activities on ATP Production and Generation of Reactive Oxygen Species

    PubMed Central

    Berndt, Nikolaus; Bulik, Sascha; Holzhütter, Hermann-Georg

    2012-01-01

    Reduced activity of brain α-ketoglutarate dehydrogenase complex (KGDHC) occurs in a number of neurodegenerative diseases like Parkinson's disease and Alzheimer's disease. In order to quantify the relation between diminished KGDHC activity and the mitochondrial ATP generation, redox state, transmembrane potential, and generation of reactive oxygen species (ROS) by the respiratory chain (RC), we developed a detailed kinetic model. Model simulations revealed a threshold-like decline of the ATP production rate at about 60% inhibition of KGDHC accompanied by a significant increase of the mitochondrial membrane potential. By contrast, progressive inhibition of the enzyme aconitase had only little impact on these mitochondrial parameters. As KGDHC is susceptible to ROS-dependent inactivation, we also investigated the reduction state of those sites of the RC proposed to be involved in ROS production. The reduction state of all sites except one decreased with increasing degree of KGDHC inhibition suggesting an ROS-reducing effect of KGDHC inhibition. Our model underpins the important role of reduced KGDHC activity in the energetic breakdown of neuronal cells during development of neurodegenerative diseases. PMID:22719765

  11. A study on the determination of the natural park's sustainable tourism potential.

    PubMed

    Cetin, Mehmet; Zeren, Ilknur; Sevik, Hakan; Cakir, Cansel; Akpinar, Huseyin

    2018-02-23

    The surface site of Yesilyuva Nature Park encompasses natural, social, economic, and cultural characteristics and has become a marker of the region's natural and cultural heritage. To support the preservation of this site, promotional activities should be planned. In this study, because of tourism and related opinions of residents and visitors alike in terms of their natural determination, an important cultural and historical feature is aimed at evaluating the tourism potential of Yesilyuva Nature Park. This framework is designed to establish prospective tourism sustainability. As a result, Yesilyuva Nature Park's natural and cultural properties have been determined to be suitable for sustainable tourism activities using geographic information systems (GIS). This protection in the field, which balances sustainability and landscape design, will provide for the development of tourism activities. In the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis and survey, residents and visitors reported that the most important feature of the Yesilyuva Nature Park was its natural beauty. Visitors often come to observe traditional and natural life and to engage in tourism activities. All the data, which includes maps derived from GIS, represents landscape planning for sustainable tourism areas in Yesilyuva Nature Park.

  12. Toxic assessment of the leachates of paddy soils and river sediments from e-waste dismantling sites to microalga, Pseudokirchneriella subcapitata.

    PubMed

    Nie, Xiangping; Fan, Canpeng; Wang, Zhaohui; Su, Tian; Liu, Xinyu; An, Taicheng

    2015-01-01

    The potential adverse effects of e-waste recycling activity on environment are getting increasing concern. In this work, a model alga, Pseudokirchneriella subcapitata, was employed to assess the toxic effects of the leachates of paddy soils and river sediments collected from e-waste dismantling sites. Chemical analysis of the paddy soils and river sediments and their leachates were carried out and the growth rate, chlorophyll a fluorescence and anti-oxidative systems of the alga were measured. Results showed that two leachates decreased the amount of PSII active reaction centers and affected photosynthesis performance, interfered with chlorophyll synthesis and inhibited algal growth. Some chemical pollutants in the sediments and soils such as polybrominated diphenyl ethers (PBDEs) and metals derived from e-waste recycling activity may impose oxidative stress on algae and affect the activity of anti-oxidative enzymes such as GST, SOD, CAT and APX. The leachates of both river sediments and paddy soils are potentially toxic to the primary producers, P. subcapitata and the leachate from sediments was more deleterious than that from soils. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Scanning laser Doppler imaging may predict disease progression of localized scleroderma in children and young adults.

    PubMed

    Shaw, L J; Shipley, J; Newell, E L; Harris, N; Clinch, J G; Lovell, C R

    2013-07-01

    Localized scleroderma is a rare but potentially disfiguring and disabling condition. Systemic treatment should be started early in those with active disease in key functional and cosmetic sites, but disease activity is difficult to determine clinically. Superficial blood flow has been shown to correlate with disease activity in localized scleroderma. To examine whether superficial blood flow measured by laser Doppler imaging (LDI) has the potential to predict disease progression and therefore select patients for early systemic treatment. A group of 20 individuals had clinical assessment and scanning LDI blood-flow measurements of 32 affected body sites. After a mean follow-up of 8.7 months their clinical outcome was compared with the results of the initial LDI assessment. Eleven out of 15 patients with an assessment of active LDI had progressed clinically, and 16 out of the 17 scans with inactive LDI assessment had not progressed, giving a positive predictive value of 73% and a negative predictive value of 94%. We believe that LDI can be a useful tool in predicting disease progression in localized scleroderma, and it may help clinicians to decide which patients to treat early. © 2013 The Authors BJD © 2013 British Association of Dermatologists.

  14. Inhibitory activities of major anthraquinones and other constituents from Cassia obtusifolia against β-secretase and cholinesterases.

    PubMed

    Jung, Hyun Ah; Ali, Md Yousof; Jung, Hee Jin; Jeong, Hyong Oh; Chung, Hae Young; Choi, Jae Sue

    2016-09-15

    Semen Cassiae has been traditionally used as an herbal remedy for liver, eye, and acute inflammatory diseases. Recent pharmacological reports have indicated that Cassiae semen has neuroprotective effects, attributable to its anti-inflammatory actions, in ischemic stroke and Alzheimer's disease (AD) models. The basic goal of this study was to evaluate the anti-AD activities of C. obtusifolia and its major constituents. Previously, the extract of C. obtusifolia seeds, was reported to have memory enhancing properties and anti-AD activity to ameliorate amyloid β-induced synaptic dysfunction. However, the responsible components of C. obtusifolia seeds in an AD are currently still unknown. In this study, we investigated the inhibitory effects of C. obtusifolia and its constituents against acetylcholinesterase (AChE), butyrylcholinesterase (BChE), and β-site amyloid precursor protein (APP) cleaving enzyme 1 (BACE1) enzyme activity. In vitro cholinesterase enzyme assays by using AChE, BChE, and BACE1 were performed. We also scrutinized the potentials of Cassiae semen active component as BACE1 inhibitors via enzyme kinetics and molecular docking simulation. In vitro enzyme assays demonstrated that C. obtusifolia and its major constituents have promising inhibitory potential against AChE, BChE, and BACE1. All Cassiae semen constituents exhibited potent inhibitory activities against AChE and BACE1 with IC50 values of 6.29-109µg/mL and 0.94-190µg/mL, whereas alaternin, questin, and toralactone gentiobioside exhibited significant inhibitory activities against BChE with IC50 values of 113.10-137.74µg/mL. Kinetic study revealed that alaternin noncompetitively inhibited, whereas cassiaside and emodin showed mixed-type inhibition against BACE1. Furthermore, molecular docking simulation results demonstrated that hydroxyl group of alaternin and emodin tightly interacted with the active site residues of BACE1 and their relevant binding energies (-6.62 and -6.89kcal/mol), indicating a higher affinity and tighter binding capacity of these compounds for the active site of BACE1. The findings of the present study suggest the potential of C. obtusifolia and its major constituents for use in the development of therapeutic or preventive agents for AD, especially through inhibition of AChE, BChE and BACE1 activities. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Controlling the Active Sites of Sulfur-Doped Carbon Nanotube-Graphene Nanolobes for Highly Efficient Oxygen Evolution and Reduction Catalysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Sawy, Abdelhamid M.; Mosa, Islam M.; Su, Dong

    Controlling active sites of metal-free catalysts is an important strategy to enhance activity of the oxygen evolution reaction (OER). We made many attempts have been made to develop metal-free catalysts, but the lack of understanding of active-sites at the atomic-level has slowed the design of highly active and stable metal-free catalysts. We also developed a sequential two-step strategy to dope sulfur into carbon nanotube–graphene nanolobes. This bidoping strategy introduces stable sulfur–carbon active-sites. Fluorescence emission of the sulfur K-edge by X-ray absorption near edge spectroscopy (XANES) and scanning transmission electron microscopy electron energy loss spectroscopy (STEM-EELS) mapping and spectra confirm thatmore » increasing the incorporation of heterocyclic sulfur into the carbon ring of CNTs not only enhances OER activity with an overpotential of 350 mV at a current density of 10 mA cm -2, but also retains 100% of stability after 75 h. Furthermore, the bidoped sulfur carbon nanotube–graphene nanolobes behave like the state-of-the-art catalysts for OER but outperform those systems in terms of turnover frequency (TOF) which is two orders of magnitude greater than (20% Ir/C) at 400 mV overpotential with very high mass activity 1000 mA cm -2 at 570 mV. Moreover, the sulfur bidoping strategy shows high catalytic activity for the oxygen reduction reaction (ORR). Stable bifunctional (ORR and OER) catalysts are low cost, and light-weight bidoped sulfur carbon nanotubes are potential candidates for next-generation metal-free regenerative fuel cells.« less

  16. Controlling the Active Sites of Sulfur-Doped Carbon Nanotube-Graphene Nanolobes for Highly Efficient Oxygen Evolution and Reduction Catalysis

    DOE PAGES

    El-Sawy, Abdelhamid M.; Mosa, Islam M.; Su, Dong; ...

    2015-12-03

    Controlling active sites of metal-free catalysts is an important strategy to enhance activity of the oxygen evolution reaction (OER). We made many attempts have been made to develop metal-free catalysts, but the lack of understanding of active-sites at the atomic-level has slowed the design of highly active and stable metal-free catalysts. We also developed a sequential two-step strategy to dope sulfur into carbon nanotube–graphene nanolobes. This bidoping strategy introduces stable sulfur–carbon active-sites. Fluorescence emission of the sulfur K-edge by X-ray absorption near edge spectroscopy (XANES) and scanning transmission electron microscopy electron energy loss spectroscopy (STEM-EELS) mapping and spectra confirm thatmore » increasing the incorporation of heterocyclic sulfur into the carbon ring of CNTs not only enhances OER activity with an overpotential of 350 mV at a current density of 10 mA cm -2, but also retains 100% of stability after 75 h. Furthermore, the bidoped sulfur carbon nanotube–graphene nanolobes behave like the state-of-the-art catalysts for OER but outperform those systems in terms of turnover frequency (TOF) which is two orders of magnitude greater than (20% Ir/C) at 400 mV overpotential with very high mass activity 1000 mA cm -2 at 570 mV. Moreover, the sulfur bidoping strategy shows high catalytic activity for the oxygen reduction reaction (ORR). Stable bifunctional (ORR and OER) catalysts are low cost, and light-weight bidoped sulfur carbon nanotubes are potential candidates for next-generation metal-free regenerative fuel cells.« less

  17. High-resolution non-contact measurement of the electrical activity of plants in situ using optical recording

    PubMed Central

    Zhao, Dong-Jie; Chen, Yang; Wang, Zi-Yang; Xue, Lin; Mao, Tong-Lin; Liu, Yi-Min; Wang, Zhong-Yi; Huang, Lan

    2015-01-01

    The limitations of conventional extracellular recording and intracellular recording make high-resolution multisite recording of plant bioelectrical activity in situ challenging. By combining a cooled charge-coupled device camera with a voltage-sensitive dye, we recorded the action potentials in the stem of Helianthus annuus and variation potentials at multiple sites simultaneously with high spatial resolution. The method of signal processing using coherence analysis was used to determine the synchronization of the selected signals. Our results provide direct visualization of the phloem, which is the distribution region of the electrical activities in the stem and leaf of H. annuus, and verify that the phloem is the main action potential transmission route in the stems of higher plants. Finally, the method of optical recording offers a unique opportunity to map the dynamic bioelectrical activity and provides an insight into the mechanisms of long-distance electrical signal transmission in higher plants. PMID:26333536

  18. Single Atomic Iron Catalysts for Oxygen Reduction in Acidic Media: Particle Size Control and Thermal Activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hanguang; Hwang, Sooyeon; Wang, Maoyu

    To significantly reduce the cost of proton exchange membrane (PEM) fuel cells, current Pt must be replaced by platinum-metal-group (PGM)-free catalysts for the oxygen reduction reaction (ORR) in acid. We report here a new class of high-performance atomic iron dispersed carbon catalysts through controlled chemical doping of iron ions into zinc-zeolitic imidazolate framework (ZIF), a type of metal-organic framework (MOF). The novel synthetic chemistry enables accurate size control of Fe-doped ZIF catalyst particles with a wide range from 20 to 1000 nm without changing chemical properties, which provides a great opportunity to increase the density of active sites that ismore » determined by the particle size. We elucidated the active site formation mechanism by correlating the chemical and structural changes with thermal activation process for the conversion from Fe-N4 complex containing hydrocarbon networks in ZIF to highly active FeNx sites embedded into carbon. A temperature of 800oC was identified as the critical point to start forming pyridinic nitrogen doping at the edge of the graphitized carbon planes. Further increasing heating temperature to 1100oC leads to increase of graphitic nitrogen, generating possible synergistic effect with FeNx sites to promote ORR activity. The best performing catalyst, which has well-defined particle size around 50 nm and abundance of atomic FeNx sites embedded into carbon structures, achieve a new performance milestone for the ORR in acid including a half-wave potential of 0.85 V vs RHE and only 20 mV loss after 10,000 cycles in O2 saturated H2SO4 electrolyte. The new class PGM-free catalyst with approaching activity to Pt holds great promise for future PEM fuel cells.« less

  19. Challenges in coupling LTER with environmental assessments: An insight from potential and reality of the Chinese Ecological Research Network in servicing environment assessments.

    PubMed

    Xia, Shaoxia; Liu, Yu; Yu, Xiubo; Fu, Bojie

    2018-08-15

    Environmental assessments estimate, evaluate and predict the consequences of natural processes and human activities on the environment. Long-term ecosystem observation and research networks (LTERs) are potentially valuable infrastructure to support environmental assessments. However, very few environmental assessments have successfully incorporated them. In this study, we try to reveal the current status of coupling LTERs with environmental assessments and look at the challenges involved in improving this coupling through exploring the role that Chinese Ecological Research Network (CERN), the LTER of China, currently plays in regional environment assessments. A review of official protocols and standards, regional assessments and CERN researches related to ecosystems and environment shows that there is great potential for coupling CERN with environment assessments. However in practice, CERN does not currently play the expected role. Remote sensing and irregular inventory data are still the main data sources currently used in regional assessments. Several causes led to the present situation: (1) insufficient cross-site research and failure to scale up site-level variables to the regional scale; (2) data barriers resulting from incompatible protocols and low data usability due to lack of data assimilation and scaling; and (3) absence of indicators relevant to human activities in existing monitoring protocols. For these reasons, enhancing cross-site monitoring and research, data assimilation and scaling up are critical steps required to improve coupling of LTER with environmental assessments. Site-focused long-term monitoring should be combined with wide-scale ground surveys and remote sensing to establish an effective connection between different environmental monitoring platforms for regional assessments. It is also necessary to revise the current monitoring protocols to include human activities and their impacts on the ecosystem, or change the LTERs into Long-Term Socio-Ecological Research (LTSER) networks. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Identification of potential glutaminyl cyclase inhibitors from lead-like libraries by in silico and in vitro fragment-based screening.

    PubMed

    Szaszkó, Mária; Hajdú, István; Flachner, Beáta; Dobi, Krisztina; Magyar, Csaba; Simon, István; Lőrincz, Zsolt; Kapui, Zoltán; Pázmány, Tamás; Cseh, Sándor; Dormán, György

    2017-02-01

    A glutaminyl cyclase (QC) fragment library was in silico selected by disconnection of the structure of known QC inhibitors and by lead-like 2D virtual screening of the same set. The resulting fragment library (204 compounds) was acquired from commercial suppliers and pre-screened by differential scanning fluorimetry followed by functional in vitro assays. In this way, 10 fragment hits were identified ([Formula: see text]5 % hit rate, best inhibitory activity: 16 [Formula: see text]). The in vitro hits were then docked to the active site of QC, and the best scoring compounds were analyzed for binding interactions. Two fragments bound to different regions in a complementary manner, and thus, linking those fragments offered a rational strategy to generate novel QC inhibitors. Based on the structure of the virtual linked fragment, a 77-membered QC target focused library was selected from vendor databases and docked to the active site of QC. A PubChem search confirmed that the best scoring analogues are novel, potential QC inhibitors.

  1. Vegetative communities, Davis and Lavender Canyons, Paradox Basin, Utah: ecosystem studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1983-04-01

    The major vegetative communities of Davis and Lavender canyons located in southeastern Utah are characterized. The report identifies potential secondary impacts and appropriate mitigation options. The Davis Canyon and Lavender Canyon Study Area contains nine major vegetative communities: galleta-shadscale, juniper-blackbrush, juniper-shadscale-ephedra, shadscale-ephedra, grayia-shadscale, juniper, drywash, greasewood, and riparian. The natural recovery times of these communities are exceedingly long. Natural reinvasion of various species would take from 15 to 100 years. No threatened or endangered plant species were identified in the study area. Davis and Lavender canyons have been subject to off-road vehicle activity and extensive grazing. The plant communities maymore » be subject to additional impacts as a result of increased human activity and off-highway activities such as camping, hiking, and hunting could result in changes in cover, composition, and frequency of plant species. Mitigation options for potential impacts include shuttle-busing workers to the site from the highway and fencing site access roads to prevent vehicles from leaving the roads.« less

  2. 3D Pharmacophore-Based Virtual Screening and Docking Approaches toward the Discovery of Novel HPPD Inhibitors.

    PubMed

    Fu, Ying; Sun, Yi-Na; Yi, Ke-Han; Li, Ming-Qiang; Cao, Hai-Feng; Li, Jia-Zhong; Ye, Fei

    2017-06-09

    p -Hydroxyphenylpyruvate dioxygenase (HPPD) is not only the useful molecular target in treating life-threatening tyrosinemia type I, but also an important target for chemical herbicides. A combined in silico structure-based pharmacophore and molecular docking-based virtual screening were performed to identify novel potential HPPD inhibitors. The complex-based pharmacophore model (CBP) with 0.721 of ROC used for screening compounds showed remarkable ability to retrieve known active ligands from among decoy molecules. The ChemDiv database was screened using CBP-Hypo2 as a 3D query, and the best-fit hits subjected to molecular docking with two methods of LibDock and CDOCKER in Accelrys Discovery Studio 2.5 (DS 2.5) to discern interactions with key residues at the active site of HPPD. Four compounds with top rankings in the HipHop model and well-known binding model were finally chosen as lead compounds with potential inhibitory effects on the active site of target. The results provided powerful insight into the development of novel HPPD inhibitors herbicides using computational techniques.

  3. Structure of Plasmodium falciparum orotate phosphoribosyltransferase with autologous inhibitory protein–protein interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Shiva; Krishnamoorthy, Kalyanaraman; Mudeppa, Devaraja G.

    P. falciparum orotate phosphoribosyltransferase, a potential target for antimalarial drugs and a conduit for prodrugs, crystallized as a structure with eight molecules per asymmetric unit that included some unique parasite-specific auto-inhibitory interactions between catalytic dimers. The most severe form of malaria is caused by the obligate parasite Plasmodium falciparum. Orotate phosphoribosyltransferase (OPRTase) is the fifth enzyme in the de novo pyrimidine-synthesis pathway in the parasite, which lacks salvage pathways. Among all of the malaria de novo pyrimidine-biosynthesis enzymes, the structure of P. falciparum OPRTase (PfOPRTase) was the only one unavailable until now. PfOPRTase that could be crystallized was obtained aftermore » some low-complexity sequences were removed. Four catalytic dimers were seen in the asymmetic unit (a total of eight polypeptides). In addition to revealing unique amino acids in the PfOPRTase active sites, asymmetric dimers in the larger structure pointed to novel parasite-specific protein–protein interactions that occlude the catalytic active sites. The latter could potentially modulate PfOPRTase activity in parasites and possibly provide new insights for blocking PfOPRTase functions.« less

  4. Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

    PubMed

    Forman, Stuart A; Miller, Keith W

    2016-11-01

    IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.

  5. Revealing potential functions of VBNC bacteria in polycyclic aromatic hydrocarbons biodegradation.

    PubMed

    Su, X M; Bamba, A M; Zhang, S; Zhang, Y G; Hashmi, M Z; Lin, H J; Ding, L X

    2018-04-01

    The bioremediation of polycyclic aromatic hydrocarbon (PAH)-contaminated sites is not running smoothly, because of the lower activity of PAH-degrading bacteria in actual bioremediation applications. The phenomenon of "viable but nonculturable" (VBNC) state may be a main limiting factor for their poor biodegradation capabilities of PAHs. Due to their abilities of entering into the VBNC state, most of bacterial populations with PAH-degradation potential remain unculturable. Resuscitation of VBNC bacteria will enhance the degradation capability of indigenous bacteria which will eventually obtain their better capabilities in environmental bioremediation. Although evidences have been presented indicating that resuscitation of VBNC bacteria in polychlorinated biphenyl (PCB)-contaminated environments not only significantly enhanced PCB degradation, but also obtained novel highly efficient PCB-degrading bacteria, scanty information is available on the VBNC bacteria in PAH-contaminated sites. VBNC bacteria, as a vast majority of potential microbial resource could be the repository of novel highly efficient PAH-biodegraders. Therefore, studies need to be done on resuscitation of VBNC bacteria to overcome key bottlenecks in bioremediation of PAH-contaminated sites. This mini-review provides a new insight into the potential functions of VBNC bacteria in PAHs biodegradation. As the vast majority microbial resource, viable but nonculturable (VBNC) bacteria, which showed their potential functions in polycyclic aromatic hydrocarbons (PAHs) biodegradation, can be of great significance in environmental bioremediation. It is therefore important to resuscitate VBNC bacteria for their better capabilities. Meanwhile, preventing the indigenous functional community from entering into the VBNC state will also maintain the high activity of PAH-degrading bacteria in actual bioremediation applications. Undoubtedly, much more work needs to be done to reveal indigenous micro-organisms in the VBNC state from the perspective of environmental functions. © 2018 The Society for Applied Microbiology.

  6. "Spacecraft Reveals Recent Geological Activity on the Moon": Exploring the Features of NASA Twitter Posts and Their Potential to Engage Adolescents

    ERIC Educational Resources Information Center

    Lesley, Mellinee

    2014-01-01

    Through a content analysis of 200 "tweets," this study was an exploration into the distinct features of text posted to NASA's "Twitter" site and the potential for these posts to serve as more engaging scientific text than traditional textbooks for adolescents. Results of the content analysis indicated the tweets and linked…

  7. A long-time, high spatiotemporal resolution optical recording system for membrane potential activity via real-time writing to the hard disk.

    PubMed

    Hirota, Akihiko; Ito, Shin-ichi

    2006-06-01

    Using real-time hard disk recording, we have developed an optical system for the long-duration detection of changes in membrane potential from 1,020 sites with a high temporal resolution. The signal-to-noise ratio was sufficient for analyzing the spreading pattern of excitatory waves in frog atria in a single sweep.

  8. Chemical probes for competitive profiling of the quorum sensing signal synthase PqsD of Pseudomonas aeruginosa

    PubMed Central

    Prothiwa, Michaela; Szamosvári, Dávid; Glasmacher, Sandra

    2016-01-01

    The human pathogen Pseudomonas aeruginosa uses the pqs quorum sensing system to coordinate the production of its broad spectrum of virulence factors to facilitate colonization and infection of its host. Hereby, the enzyme PqsD is a virulence related quorum sensing signal synthase that catalyzes the central step in the biosynthesis of the Pseudomonas quinolone signals HHQ and PQS. We developed a library of cysteine reactive chemical probes with an alkyne handle for fluorescence tagging and report the selective and highly sensitive in vitro labelling of the active site cysteine of this important enzyme. Interestingly, only one type of probe, with a reactive α-chloroacetamide was capable of covalently reacting with the active site. We demonstrated the potential of our probes in a competitive labelling platform where we screened a library of synthetic HHQ and PQS analogues with heteroatom replacements and found several inhibitors of probe binding that may represent promising scaffolds for the development of customized PqsD inhibitors as well as a chemical toolbox to investigate the activity and active site specificity of the enzyme. PMID:28144351

  9. [Toxic effect of DDT, chlordane and water from the Ignacio Ramírez dam (Mexico), on Daphnia magna (Crustacea: Daphnidae)].

    PubMed

    Martínez-Tabche, L; Romero Solís, M; López López, E; Galar Martínez, M

    1999-12-01

    Chlorodiphenylnitrichloroethane (DDT) and chlordane (CLO) are currently used in Mexico to control malaria and termites. From 1990 to 1996 a total of 27 ton of DDT and 508 of CLO were imported. We establish a methodology to determine their environmental impact in a Mexican dam (Ignacio Ramírez). The toxic effect of DDT and CLO were evaluated on the o-demethylase (OD) and acethycholinesterase activities (AchA) of the cladoceran Daphnia magna exposed to different concentrations of the insecticides solved in water from three sites. Their effect on the AchA and OD activities, and so the CL50 were used as exposure bioindicators to determine the more polluted sites. The physicochemical characteristics of water and the biodiversity of the dam test sites were considered. The station near the floodgate has toxicity potential because enzymatic activities were modified. We suggest the use of AchA and OD activities measure in the cladoceran to evaluate the toxicity of a water body polluted by organochlorate insecticides.

  10. Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

    PubMed Central

    Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

    2016-01-01

    Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

  11. Orientation-Dependent Oxygen Evolution on RuO 2 without Lattice Exchange

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoerzinger, Kelsey A.; Diaz-Morales, Oscar; Kolb, Manuel

    RuO2 catalysts exhibit record activities towards the oxygen evolution reaction (OER), which is crucial to enable efficient and sustainable energy storage. Here we examine the RuO2 OER kinetics on rutile (110), (100), (101), and (111) orientations, finding (100) the most active. We assess the potential involvement of lattice oxygen in the OER mechanism with online 3 electrochemical mass spectrometry, which showed no evidence of oxygen exchange on these oriented facets in acidic or basic electrolytes. Similar results were obtained for polyoriented RuO2 films and particles, in contrast to previous work, suggesting lattice oxygen is not exchanged in catalyzing OER onmore » crystalline RuO2 surfaces. This hypothesis is supported by the correlation of activity with the number of active Ru-sites calculated by DFT, where more active facets bind oxygen more weakly. This new understanding of the active sites provides a design strategy to enhance the OER activity of RuO2 nanoparticles by facet engineering.« less

  12. Computational Tools for Allosteric Drug Discovery: Site Identification and Focus Library Design.

    PubMed

    Huang, Wenkang; Nussinov, Ruth; Zhang, Jian

    2017-01-01

    Allostery is an intrinsic phenomenon of biological macromolecules involving regulation and/or signal transduction induced by a ligand binding to an allosteric site distinct from a molecule's active site. Allosteric drugs are currently receiving increased attention in drug discovery because drugs that target allosteric sites can provide important advantages over the corresponding orthosteric drugs including specific subtype selectivity within receptor families. Consequently, targeting allosteric sites, instead of orthosteric sites, can reduce drug-related side effects and toxicity. On the down side, allosteric drug discovery can be more challenging than traditional orthosteric drug discovery due to difficulties associated with determining the locations of allosteric sites and designing drugs based on these sites and the need for the allosteric effects to propagate through the structure, reach the ligand binding site and elicit a conformational change. In this study, we present computational tools ranging from the identification of potential allosteric sites to the design of "allosteric-like" modulator libraries. These tools may be particularly useful for allosteric drug discovery.

  13. Design of potent and selective human cathepsin K inhibitors that span the active site

    PubMed Central

    Thompson, Scott K.; Halbert, Stacie M.; Bossard, Mary J.; Tomaszek, Thaddeus A.; Levy, Mark A.; Zhao, Baoguang; Smith, Ward W.; Abdel-Meguid, Sherin S.; Janson, Cheryl A.; D’Alessio, Karla J.; McQueney, Michael S.; Amegadzie, Bernard Y.; Hanning, Charles R.; DesJarlais, Renee L.; Briand, Jacques; Sarkar, Susanta K.; Huddleston, Michael J.; Ijames, Carl F.; Carr, Steven A.; Garnes, Keith T.; Shu, Art; Heys, J. Richard; Bradbeer, Jeremy; Zembryki, Denise; Lee-Rykaczewski, Liz; James, Ian E.; Lark, Michael W.; Drake, Fred H.; Gowen, Maxine; Gleason, John G.; Veber, Daniel F.

    1997-01-01

    Potent and selective active-site-spanning inhibitors have been designed for cathepsin K, a cysteine protease unique to osteoclasts. They act by mechanisms that involve tight binding intermediates, potentially on a hydrolytic pathway. X-ray crystallographic, MS, NMR spectroscopic, and kinetic studies of the mechanisms of inhibition indicate that different intermediates or transition states are being represented that are dependent on the conditions of measurement and the specific groups flanking the carbonyl in the inhibitor. The species observed crystallographically are most consistent with tetrahedral intermediates that may be close approximations of those that occur during substrate hydrolysis. Initial kinetic studies suggest the possibility of irreversible and reversible active-site modification. Representative inhibitors have demonstrated antiresorptive activity both in vitro and in vivo and therefore are promising leads for therapeutic agents for the treatment of osteoporosis. Expansion of these inhibitor concepts can be envisioned for the many other cysteine proteases implicated for therapeutic intervention. PMID:9405598

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kersten, Roland D.; Diedrich, Jolene K.; Yates, III, John R.

    Terpenes are ubiquitous natural chemicals with diverse biological functions spanning all three domains of life. In specialized metabolism, the active sites of terpene synthases (TPSs) evolve in shape and reactivity to direct the biosynthesis of a myriad of chemotypes for organismal fitness. As most terpene biosynthesis mechanistically involves highly reactive carbocationic intermediates, the protein surfaces catalyzing these cascade reactions possess reactive regions possibly prone to premature carbocation capture and potentially enzyme inactivation. Here, we show using proteomic and X-ray crystallographic analyses that cationic intermediates undergo capture by conserved active site residues leading to inhibitory self-alkylation. Furthermore, the level of cation-mediatedmore » inactivation increases with mutation of the active site, upon changes in the size and structure of isoprenoid diphosphate substrates, and alongside increases in reaction temperatures. TPSs that individually synthesize multiple products are less prone to self-alkylation then TPSs possessing relatively high product specificity. In total, the results presented suggest that mechanism-based alkylation represents an overlooked mechanistic pressure during the evolution of cation-derived terpene biosynthesis.« less

  15. Homology modelling, molecular docking, and molecular dynamics simulations reveal the inhibition of Leishmania donovani dihydrofolate reductase-thymidylate synthase enzyme by Withaferin-A.

    PubMed

    Vadloori, Bharadwaja; Sharath, A K; Prabhu, N Prakash; Maurya, Radheshyam

    2018-04-16

    Present in silico study was carried out to explore the mode of inhibition of Leishmania donovani dihydrofolate reductase-thymidylate synthase (Ld DHFR-TS) enzyme by Withaferin-A, a withanolide isolated from Withania somnifera. Withaferin-A (WA) is known for its profound multifaceted properties, but its antileishmanial activity is not well understood. The parasite's DHFR-TS enzyme is diverse from its mammalian host and could be a potential drug target in parasites. A 3D model of Ld DHFR-TS enzyme was built and verified using Ramachandran plot and SAVES tools. The protein was docked with WA-the ligand, methotrexate (MTX)-competitive inhibitor of DHFR, and dihydrofolic acid (DHFA)-substrate for DHFR-TS. Molecular docking studies reveal that WA competes for active sites of both Hu DHFR and TS enzymes whereas it binds to a site other than active site in Ld DHFR-TS. Moreover, Lys 173 residue of DHFR-TS forms a H-bond with WA and has higher binding affinity to Ld DHFR-TS than Hu DHFR and Hu TS. The MD simulations confirmed the H-bonding interactions were stable. The binding energies of WA with Ld DHFR-TS were calculated using MM-PBSA. Homology modelling, molecular docking and MD simulations of Ld DHFR-TS revealed that WA could be a potential anti-leishmanial drug.

  16. Stream reconnaissance for nutrients and other water-quality parameters, Greater Pittsburgh Region, Pennsylvania

    USGS Publications Warehouse

    Beall, Robert M.

    1975-01-01

    Eighty-five stream sites in and near the six-county Greater Pittsburgh Region were sampled in mid-June 1971 in mid-October 1972. Data are reported for 89 sites because 4 substitute sites were sampled in the second period. Drainage areas of the basins sampled ranged from 4.1 to 19,5000 square miles (10.6 to 50,500 square kilometres). The chemical analyses included constituents of three general classes: (1) nutrients, (2) activity indicators, and (3) dominant anions. Modification of the natural chemical and physical characteristics of the surface waters by man's activities is evident in some of the data. However, the activities are so diverse in type and in areal extent that their influence in terms of cause and effect is often obscure. Nutrient concentrations were high enough to indicate potential problems at about a quarter of the sampling sites. Temperature, dissolved oxygen, and pH values indicated a generally favorable capacity for regeneration or recovery from degradation, although a number a streams east of the Allegheny and Monongahela Rivers are marginal or lacking in the capacity. Regionally, sulfate is the dominant ion and was observed in concentrations of 40 milligrams per litre or more at 90 percent of the sites. Bicarbonate exceeded 100 milligrams per litre at 22 sites. A moderate to high degree of mineralization, as indicated by conductance readings of more than 500 micromhos per cetrimetre at half of the sampling sites, is a characteristic of the region's surface waters.

  17. Problems and pressures, management and measures in a site of marine conservation importance: Carmarthen Bay and Estuaries

    NASA Astrophysics Data System (ADS)

    Bullimore, Blaise

    2014-10-01

    Management of anthropogenic activities that cause pressure on estuarine wildlife and biodiversity is beset by a wide range of challenges. Some, such as the differing environmental and socio-economic objectives and conflicting views and priorities, are common to many estuaries; others are site specific. The Carmarthen Bay and Estuaries European Marine Site encompasses four estuaries of European wildlife and conservation importance and considerable socio-economic value. The estuaries and their wildlife are subject to a range of pressures and threats and the statutory authorities responsible for management in and adjacent to the Site have developed a management scheme to address these. Preparation of the management scheme included an assessment of human activities known to occur in and adjacent to the Site for their potential to cause a threat to the designated habitats and species features, and identified actions the management authorities need to take to minimise or eliminate pressures and threats. To deliver the scheme the partner authorities need to accept the requirement for management actions and work together to achieve them. The Welsh Government also needs to work with these authorities because it is responsible for management of many of the most important pressure-causing activities. However, the absence of statutory obligations for partnership working has proved an impediment to successful management.

  18. Improving the activity of the subtilisin nattokinase by site-directed mutagenesis and molecular dynamics simulation.

    PubMed

    Weng, Meizhi; Deng, Xiongwei; Bao, Wei; Zhu, Li; Wu, Jieyuan; Cai, Yongjun; Jia, Yan; Zheng, Zhongliang; Zou, Guolin

    2015-09-25

    Nattokinase (NK), a bacterial serine protease from Bacillus subtilis var. natto, is a potential cardiovascular drug exhibiting strong fibrinolytic activity. To broaden its commercial and medical applications, we constructed a single-mutant (I31L) and two double-mutants (M222A/I31L and T220S/I31L) by site-directed mutagenesis. Active enzymes were expressed in Escherichia coli with periplasmic secretion and were purified to homogeneity. The kinetic parameters of enzymes were examined by spectroscopy assay and isothermal titration calorimetry (ITC), and their fibrinolytic activities were determined by fibrin plate method. The substitution of Leu(31) for Ile(31) resulted in about 2-fold enhancement of catalytic efficiency (Kcat/KM) compared with wild-type NK. The specific activities of both double-mutants (M222A/I31L and T220S/I31L) were significantly increased when compared with the single-mutants (M222A and T220S) and the oxidative stability of M222A/I31L mutant was enhanced with respect to wild-type NK. This study demonstrates the feasibility of improving activity of NK by site-directed mutagenesis and shows successful protein engineering cases to improve the activity of NK as a potent therapeutic agent. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Human 15-LOX-1 active site mutations alter inhibitor binding and decrease potency.

    PubMed

    Armstrong, Michelle; van Hoorebeke, Christopher; Horn, Thomas; Deschamps, Joshua; Freedman, J Cody; Kalyanaraman, Chakrapani; Jacobson, Matthew P; Holman, Theodore

    2016-11-01

    Human 15-lipoxygenase-1 (h15-LOX-1 or h12/15-LOX) reacts with polyunsaturated fatty acids and produces bioactive lipid derivatives that are implicated in many important human diseases. One such disease is stroke, which is the fifth leading cause of death and the first leading cause of disability in America. The discovery of h15-LOX-1 inhibitors could potentially lead to novel therapeutics in the treatment of stroke, however, little is known about the inhibitor/active site interaction. This study utilizes site-directed mutagenesis, guided in part by molecular modeling, to gain a better structural understanding of inhibitor interactions within the active site. We have generated eight mutants (R402L, R404L, F414I, F414W, E356Q, Q547L, L407A, I417A) of h15-LOX-1 to determine whether these active site residues interact with two h15-LOX-1 inhibitors, ML351 and an ML094 derivative, compound 18. IC 50 values and steady-state inhibition kinetics were determined for the eight mutants, with four of the mutants affecting inhibitor potency relative to wild type h15-LOX-1 (F414I, F414W, E356Q and L407A). The data indicate that ML351 and compound 18, bind in a similar manner in the active site to an aromatic pocket close to F414 but have subtle differences in their specific binding modes. This information establishes the binding mode for ML094 and ML351 and will be leveraged to develop next-generation inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Role of apamin-sensitive small conductance calcium-activated potassium currents in long-term cardiac memory in rabbits.

    PubMed

    Yin, Dechun; Chen, Mu; Yang, Na; Wu, Adonis Z; Xu, Dongzhu; Tsai, Wei-Chung; Yuan, Yuan; Tian, Zhipeng; Chan, Yi-Hsin; Shen, Changyu; Chen, Zhenhui; Lin, Shien-Fong; Weiss, James N; Chen, Peng-Sheng; Everett, Thomas H

    2018-05-01

    Apamin-sensitive small conductance calcium-activated K current (I KAS ) is up-regulated during ventricular pacing and masks short-term cardiac memory (CM). The purpose of this study was to determine the role of I KAS in long-term CM. CM was created with 3-5 weeks of ventricular pacing and defined by a flat or inverted T wave off pacing. Epicardial optical mapping was performed in both paced and normal ventricles. Action potential duration (APD 80 ) was determined during right atrial pacing. Ventricular stability was tested before and after I KAS blockade. Four paced hearts and 4 normal hearts were used for western blotting and histology. There were no significant differences in either echocardiographic parameters or fibrosis levels between groups. Apamin induced more APD 80 prolongation in CM than in normal ventricles (mean [95% confidence interval]: 9.6% [8.8%-10.5%] vs 3.1% [1.9%-4.3%]; P <.001). Apamin significantly lengthened APD 80 in the CM model at late activation sites, indicating significant I KAS up-regulation at those sites. The CM model also had altered Ca 2+ handling, with the 50% Ca 2+ transient duration and amplitude increased at distal sites compared to a proximal site (near the pacing site). After apamin, the CM model had increased ventricular fibrillation (VF) inducibility (paced vs control: 33/40 (82.5%) vs 7/20 (35%); P <.001) and longer VF durations (124 vs 26 seconds; P <.001). Chronic ventricular pacing increases Ca 2+ transients at late activation sites, which activates I KAS to maintain repolarization reserve. I KAS blockade increases VF vulnerability in chronically paced rabbit ventricles. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  1. Emerging principles in protease-based drug discovery

    PubMed Central

    Drag, Marcin; Salvesen, Guy S.

    2010-01-01

    Proteases have an important role in many signalling pathways, and represent potential drug targets for diseases ranging from cardiovascular disorders to cancer, as well as for combating many parasites and viruses. Although inhibitors of well-established protease targets such as angiotensin-converting enzyme and HIV protease have shown substantial therapeutic success, developing drugs for new protease targets has proved challenging in recent years. This in part could be due to issues such as the difficulty of achieving selectivity when targeting protease active sites. This Perspective discusses the general principles in protease-based drug discovery, highlighting the lessons learned and the emerging strategies, such as targeting allosteric sites, which could help harness the therapeutic potential of new protease targets. PMID:20811381

  2. Trojan horses and guided missiles: targeted therapies in the war on arthritis.

    PubMed

    Ferrari, Mathieu; Onuoha, Shimobi C; Pitzalis, Costantino

    2015-06-01

    Despite major advances in the treatment of rheumatoid arthritis (RA) led by the success of biologic therapies, the lack of response to therapy in a proportion of patients, as well as therapy discontinuation owing to systemic toxicity, are still unsolved issues. Unchecked RA might develop into progressive structural joint damage, loss of function and long-term disability, disorders which are associated with a considerable health-economic burden. Therefore, new strategies are required to actively target and deliver therapeutic agents to disease sites in order to promote in situ activity and decrease systemic toxicity. Polymer-drug conjugates can improve the pharmacokinetics of therapeutic agents, conferring desirable properties such as increased solubility and tissue penetration at sites of active disease. Additionally, nanotechnology is an exciting modality in which drugs are encapsulated to protect them from degradation or early activation in the circulation, as well as to reduce systemic toxicity. Together with the targeting capacity of antibodies and site-specific peptides, these approaches will facilitate selective accumulation of therapeutic agents in the inflamed synovium, potentially improving drug efficacy at disease sites without affecting healthy tissues. This Review aims to summarize key developments in the past 5 years in polymer conjugation, nanoparticulate drug delivery and antibody or peptide-based targeting--strategies that might constitute the platform for the next generation of RA therapeutics.

  3. A computational study of the dechlorination of β-hexachlorocyclohexane (β-HCH) catalyzed by the haloalkane dehalogenase LinB.

    PubMed

    Manna, Rabindra Nath; Dybala-Defratyka, Agnieszka

    2014-11-15

    LinB, a haloalkane dehalogenase from Sphingomonas paucimobilis UT26, is known to metabolize halohydrocarbons to halide ions and the respective alcohols. Its broad substrate specificity allowed its consideration for bioremediation. Herein, we have shown its catalytic action toward β-hexachlorocyclohexane (β-HCH) - an example of large-size substrates that can be accommodated in its active site. We have analyzed the capability of combined QM/MM schemes to describe in detail the SN2 dechlorination reaction between β-HCH and Asp108 in the active site of LinB. Free energy surfaces have been calculated using one and two dimensional potentials of mean force (PMF) obtained at the PM3/MM (MM=amberff99SB, TIP3P) level of theory. The overestimated energetic barriers by the PM3 Hamiltonian were corrected using a DFT functional (M06-2X). The resulted activation energies (16 and 19 kcal mol(-1) from 1D and 2D-PMF profiles, respectively) for the dechlorination reaction of β-HCH in the active site of LinB enzyme are in qualitative agreement with the experimentally determined value of 17 kcal mol(-1). The binding of β-HCH to the active site of LinB has been compared to the binding of smaller 1-chlorobutane (1-CB) and larger δ-hexabromocyclododecane (δ-HBCD). Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Crystal Structure and Functional Analysis of Homocitrate Synthase, an Essential Enzyme in Lysine Biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bulfer, Stacie L.; Scott, Erin M.; Couture, Jean-François

    2010-01-12

    Homocitrate synthase (HCS) catalyzes the first and committed step in lysine biosynthesis in many fungi and certain Archaea and is a potential target for antifungal drugs. Here we report the crystal structure of the HCS apoenzyme from Schizosaccharomyces pombe and two distinct structures of the enzyme in complex with the substrate 2-oxoglutarate (2-OG). The structures reveal that HCS forms an intertwined homodimer stabilized by domain-swapping between the N- and C-terminal domains of each monomer. The N-terminal catalytic domain is composed of a TIM barrel fold in which 2-OG binds via hydrogen bonds and coordination to the active site divalent metalmore » ion, whereas the C-terminal domain is composed of mixed {alpha}/{beta} topology. In the structures of the HCS apoenzyme and one of the 2-OG binary complexes, a lid motif from the C-terminal domain occludes the entrance to the active site of the neighboring monomer, whereas in the second 2-OG complex the lid is disordered, suggesting that it regulates substrate access to the active site through its apparent flexibility. Mutations of the active site residues involved in 2-OG binding or implicated in acid-base catalysis impair or abolish activity in vitro and in vivo. Together, these results yield new insights into the structure and catalytic mechanism of HCSs and furnish a platform for developing HCS-selective inhibitors.« less

  5. Potential anti-cholinesterase and β-site amyloid precursor protein cleaving enzyme 1 inhibitory activities of cornuside and gallotannins from Cornus officinalis fruits.

    PubMed

    Bhakta, Himanshu Kumar; Park, Chan Hum; Yokozawa, Takako; Tanaka, Takashi; Jung, Hyun Ah; Choi, Jae Sue

    2017-07-01

    Cholinesterase (ChE) and β-site amyloid precursor protein cleaving enzyme 1 (BACE1) inhibitors are promising agents for the treatment of Alzheimer's disease (AD). In the present study, we examined the inhibitory activity of seven compounds isolated from the fruits of Cornus officinalis, cornuside, polymeric proanthocyanidins, 1,2,3-tri-O-galloyl-β-D-glucose, 1,2,3,6-tetra-O-galloyl-β-D-glucose, tellimagrandin I, tellimagrandin II, and isoterchebin, against acetylcholinesterase (AChE), butyrylcholinesterase (BChE), and BACE1. All of the compounds displayed concentration-dependent in vitro inhibitory activity toward the ChEs and BACE1. Among them, tellimagrandin II exhibited the best inhibitory activity toward ChEs, whereas the best BACE1 inhibitor was 1,2,3,6-tetra-O-galloyl-β-D-glucose. Isoterchebin and polymeric proanthocyanidins were also significant ChE inhibitors. The kinetic and docking studies demonstrated that all compounds interacted with both the catalytic active sites and the peripheral anionic sites of the ChEs and BACE1. Tellimagrandin II, isoterchebin, and the polymeric proanthocyanidins exhibited concentration-dependent inhibition of peroxynitrite-mediated protein tyrosine nitration. In conclusion, we identified significant ChE and BACE1 inhibitors from Corni Fructus that could have value as new multi-targeted compounds for anti-AD agents.

  6. Molecular Insights into the Potential Toxicological Interaction of 2-Mercaptothiazoline with the Antioxidant Enzyme—Catalase

    PubMed Central

    Huang, Zhenxing; Huang, Ming; Mi, Chenyu; Wang, Tao; Chen, Dong; Teng, Yue

    2016-01-01

    2-mercaptothiazoline (2-MT) is widely used in many industrial fields, but its residue is potentially harmful to the environment. In this study, to evaluate the biological toxicity of 2-MT at protein level, the interaction between 2-MT and the pivotal antioxidant enzyme—catalase (CAT) was investigated using multiple spectroscopic techniques and molecular modeling. The results indicated that the CAT fluorescence quenching caused by 2-MT should be dominated by a static quenching mechanism through formation of a 2-MT/CAT complex. Furthermore, the identifications of the binding constant, binding forces, and the number of binding sites demonstrated that 2-MT could spontaneously interact with CAT at one binding site mainly via Van der Waals’ forces and hydrogen bonding. Based on the molecular docking simulation and conformation dynamic characterization, it was found that 2-MT could bind into the junctional region of CAT subdomains and that the binding site was close to enzyme active sites, which induced secondary structural and micro-environmental changes in CAT. The experiments on 2-MT toxicity verified that 2-MT significantly inhibited CAT activity via its molecular interaction, where 2-MT concentration and exposure time both affected the inhibitory action. Therefore, the present investigation provides useful information for understanding the toxicological mechanism of 2-MT at the molecular level. PMID:27537873

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Helmich, Kate E.; Pereira, Jose Henrique; Gall, Daniel L.

    Here, lignin is a combinatorial polymer comprising monoaromatic units that are linked via covalent bonds. Although lignin is a potential source of valuable aromatic chemicals, its recalcitrance to chemical or biological digestion presents major obstacles to both the production of second-generation biofuels and the generation of valuable coproducts from lignin's monoaromatic units. Degradation of lignin has been relatively well characterized in fungi, but it is less well understood in bacteria. A catabolic pathway for the enzymatic breakdown of aromatic oligomers linked via β-aryl ether bonds typically found in lignin has been reported in the bacterium Sphingobium sp. SYK-6. Here, wemore » present x-ray crystal structures and biochemical characterization of the glutathione-dependent β-etherases, LigE and LigF, from this pathway. The crystal structures show that both enzymes belong to the canonical two-domain fold and glutathione binding site architecture of the glutathione S-transferase family. Mutagenesis of the conserved active site serine in both LigE and LigF shows that, whereas the enzymatic activity is reduced, this amino acid side chain is not absolutely essential for catalysis. The results include descriptions of cofactor binding sites, substrate binding sites, and catalytic mechanisms. Because β-aryl ether bonds account for 50–70% of all interunit linkages in lignin, understanding the mechanism of enzymatic β-aryl ether cleavage has significant potential for informing ongoing studies on the valorization of lignin.« less

  8. Integrated Computational Approach for Virtual Hit Identification against Ebola Viral Proteins VP35 and VP40.

    PubMed

    Mirza, Muhammad Usman; Ikram, Nazia

    2016-10-26

    The Ebola virus (EBOV) has been recognised for nearly 40 years, with the most recent EBOV outbreak being in West Africa, where it created a humanitarian crisis. Mortalities reported up to 30 March 2016 totalled 11,307. However, up until now, EBOV drugs have been far from achieving regulatory (FDA) approval. It is therefore essential to identify parent compounds that have the potential to be developed into effective drugs. Studies on Ebola viral proteins have shown that some can elicit an immunological response in mice, and these are now considered essential components of a vaccine designed to protect against Ebola haemorrhagic fever. The current study focuses on chemoinformatic approaches to identify virtual hits against Ebola viral proteins (VP35 and VP40), including protein binding site prediction, drug-likeness, pharmacokinetic and pharmacodynamic properties, metabolic site prediction, and molecular docking. Retrospective validation was performed using a database of non-active compounds, and early enrichment of EBOV actives at different false positive rates was calculated. Homology modelling and subsequent superimposition of binding site residues on other strains of EBOV were carried out to check residual conformations, and hence to confirm the efficacy of potential compounds. As a mechanism for artefactual inhibition of proteins through non-specific compounds, virtual hits were assessed for their aggregator potential compared with previously reported aggregators. These systematic studies have indicated that a few compounds may be effective inhibitors of EBOV replication and therefore might have the potential to be developed as anti-EBOV drugs after subsequent testing and validation in experiments in vivo.

  9. The pH dependence of the cathodic peak potential of the active sites in bilirubin oxidase.

    PubMed

    Filip, Jaroslav; Tkac, Jan

    2014-04-01

    This is the first study showing pH dependence of three distinct redox sites within bilirubin oxidase (BOD) adsorbed on a nanocomposite modified electrode. The 1st redox centre with the highest redox potential Ec(1st)=404 mV vs. Ag/AgCl (614 mV vs. NHE at pH7.0) exhibited pH dependence with a slope -dEc(1st)/dpH=66(±3) mV under a non-turnover process. The 2nd redox centre with a potential Ec(2nd)=228 mV vs. Ag/AgCl (438 mV vs. NHE at pH7.0) was not dependent on pH in the absence and presence of O2. Finally, the 3rd redox site with a redox potential Ec(3rd)=92 mV vs. Ag/AgCl (302 mV vs. NHE at pH7.0) exhibited pH dependence for a cathodic process with -dEc(3rd)/dpH=70(±6) mV and for anodic process with -dEa(3rd)/dpH=73(±2) mV, respectively. Moreover, two break points for dependence of Ec(1st) or Ec(3rd) on pH were observed for the 1st (T1) site and the 3rd site assigned to involvement of two acidic amino acids (Asp105 and Glu463). A diagram of a potential difference between cathodic peaks of BOD as a dependence on pH is shown. The results obtained can be of interest for construction of biofuel cells based on BOD such as for generation of a low level of electricity from body fluids. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Environmental impact reduction through ecological planning at Bahia Magdalena, Mexico.

    PubMed

    Malagrino, Giovanni; Lagunas, Magdalena; Rubio, Alfredo Ortega

    2008-03-01

    For analyzing basic marine and coastal characteristics we selected the potential sites where shrimp culture could be developed in a large coastal zone, Bahia Magdalena, Baja California Sur, Mexico. Based on our analysis, 6 sites were preselected and field stages of work were then developed to assess the precise suitability of each site in order to develop the proposed aquaculture activities. In ranking the suitability we were able to recommend the most appropriate places to develop shrimp culture in this region. Also, knowing the exact biological, physico-chemical and social environment, we determined the best species to cultivate, the recommended total area and the methodology to be used to lessen the environmental impact and to obtain the maximum profitability Our methodology could be used not only to select appropriate sites for shrimp culture in other coastal lagoons, but it also could be applied to assess the suitability in a quick and accurate way, of any other production activity in coastal zones.

  11. A novel allosteric mechanism in the cysteine peptidase cathepsin K discovered by computational methods

    NASA Astrophysics Data System (ADS)

    Novinec, Marko; Korenč, Matevž; Caflisch, Amedeo; Ranganathan, Rama; Lenarčič, Brigita; Baici, Antonio

    2014-02-01

    Allosteric modifiers have the potential to fine-tune enzyme activity. Therefore, targeting allosteric sites is gaining increasing recognition as a strategy in drug design. Here we report the use of computational methods for the discovery of the first small-molecule allosteric inhibitor of the collagenolytic cysteine peptidase cathepsin K, a major target for the treatment of osteoporosis. The molecule NSC13345 is identified by high-throughput docking of compound libraries to surface sites on the peptidase that are connected to the active site by an evolutionarily conserved network of residues (protein sector). The crystal structure of the complex shows that NSC13345 binds to a novel allosteric site on cathepsin K. The compound acts as a hyperbolic mixed modifier in the presence of a synthetic substrate, it completely inhibits collagen degradation and has good selectivity for cathepsin K over related enzymes. Altogether, these properties qualify our methodology and NSC13345 as promising candidates for allosteric drug design.

  12. Transcription and DNA Damage: Holding Hands or Crossing Swords?

    PubMed

    D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

    2017-10-27

    Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Description and hydrogeologic evaluation of nine hazardous-waste sites in Kansas, 1984-86

    USGS Publications Warehouse

    Hart, R.J.; Spruill, T.B.

    1988-01-01

    Wastes generated at nine hazardous-waste sites in Kansas were disposed in open pits, 55-gal drums, or large storage tanks. These disposal methods have the potential to contaminate groundwater beneath the sites, the soil on the sites, and nearby surface water bodies. Various activities on the nine sites included production of diborane, transformer oil waste, production of soda ash, use of solvents for the manufacture of farm implements, reclamation of solvents and paints, oil-refinery wastes, meat packaging, and the manufacture and cleaning of tanker-truck tanks. Monitoring wells were installed upgradient and downgradient from the potential contamination source on each site. Strict decontamination procedures were followed to prevent cross contamination between well installations. Air-quality surveys were made on each site before other investigative procedures started. Hydrogeologic investigative techniques, such as terrain geophysical surveys, gamma-ray logs, and laboratory permeameter tests, were used. Groundwater level measurements provide data to determine the direction of flow. Groundwater contamination detected under the sites posed the greatest threat to the environment because of possible migration of contaminants by groundwater flow. Concentrations of volatile organic compounds, polynuclear aromatic hydrocarbons, and trace metals were detected in the groundwater at several of the sites. Many of the same compounds detected in the groundwater also were detected in soil and bed-material samples collected onsite or adjacent to the sites. Several contaminants were detected in background samples of groundwater and soil. (USGS)

  14. Federal environmental standards of potential importance to operations and activities at US Department of Energy sites. Draft

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fowler, K.M.; Bilyard, G.R.; Davidson, S.A.

    1993-06-01

    The US Department of Energy (DOE) is now engaged in a program of environmental restoration nationwide across its 45 sites. It is also bringing its facilities into compliance with environmental regulations, decontaminating and decommissioning unwanted facilities, and constructing new waste management facilities. One of the most difficult questions that DOE must face in successfully remediating its inactive waste sites, decontaminating and decommissioning its inactive facilities, and operating its waste management facilities is: ``What criteria and standards should be met?`` Acceptable standards or procedures for determining standards will assist DOE in its conduct of ongoing waste management and pending cleanup activitiesmore » by helping to ensure that those activities are conducted in compliance with applicable laws and regulations and are accepted by the regulatory community and the public. This document reports on the second of three baseline activities that are being conducted as prerequisites to either the development of quantitative standards that could be used by DOE, or consistent procedures for developing such standards. The first and third baseline activities are also briefly discussed in conjunction with the second of the three activities.« less

  15. Activation by Phoneutria nigriventer (armed spider) venom of tissue kallikrein-kininogen-kinin system in rabbit skin in vivo.

    PubMed

    Marangoni, R A; Antunes, E; Brain, S D; de Nucci, G

    1993-06-01

    1. The purpose of the present study was to investigate the mechanisms by which venom from Phoneutria nigriventer spider induces increases in vascular permeability in rabbit skin. 2. Local oedema formation, in response to intradermally-injected agents, was measured in male New Zealand white rabbits as the local accumulation of i.v. injected 125I-labelled human serum albumin into skin sites. 3. Phoneutria nigriventer venom (10-30 micrograms/site) increased vascular permeability, which was inhibited by trasylol (10 micrograms/site) and the bradykinin B2 receptor antagonists D-Arg,[Hyp3,Thi5,8,D-Phe7]-BK (3 nmol/site) and Hoe 140 (0.3 nmol/site). In addition, the oedema induced by the venom was potentiated by the kinase II inhibitor, captopril (1 nmol/site). The lipoxygenase inhibitor, BWA4C (10 nmol/site) and the PAF antagonist, WEB 2086 (100 nmol/site) had no effect on the venom-induced increase in vascular permeability. 4. Incubation of rabbit plasma with Phoneutria nigriventer venom in vitro did not cause bradykinin formation. Further, the plasma kallikrein inhibitor, soybean trypsin inhibitor (10 micrograms/site), had no effect on the venom-induced increase in vascular permeability in rabbit skin. 5. These results indicate that the oedema produced by Phoneutria nigriventer venom is dependent on the activation of the tissue kallikrein-kinin system.

  16. Activation by Phoneutria nigriventer (armed spider) venom of tissue kallikrein-kininogen-kinin system in rabbit skin in vivo.

    PubMed Central

    Marangoni, R. A.; Antunes, E.; Brain, S. D.; de Nucci, G.

    1993-01-01

    1. The purpose of the present study was to investigate the mechanisms by which venom from Phoneutria nigriventer spider induces increases in vascular permeability in rabbit skin. 2. Local oedema formation, in response to intradermally-injected agents, was measured in male New Zealand white rabbits as the local accumulation of i.v. injected 125I-labelled human serum albumin into skin sites. 3. Phoneutria nigriventer venom (10-30 micrograms/site) increased vascular permeability, which was inhibited by trasylol (10 micrograms/site) and the bradykinin B2 receptor antagonists D-Arg,[Hyp3,Thi5,8,D-Phe7]-BK (3 nmol/site) and Hoe 140 (0.3 nmol/site). In addition, the oedema induced by the venom was potentiated by the kinase II inhibitor, captopril (1 nmol/site). The lipoxygenase inhibitor, BWA4C (10 nmol/site) and the PAF antagonist, WEB 2086 (100 nmol/site) had no effect on the venom-induced increase in vascular permeability. 4. Incubation of rabbit plasma with Phoneutria nigriventer venom in vitro did not cause bradykinin formation. Further, the plasma kallikrein inhibitor, soybean trypsin inhibitor (10 micrograms/site), had no effect on the venom-induced increase in vascular permeability in rabbit skin. 5. These results indicate that the oedema produced by Phoneutria nigriventer venom is dependent on the activation of the tissue kallikrein-kinin system. PMID:8395291

  17. Social media and suicide prevention: findings from a stakeholder survey.

    PubMed

    Robinson, Jo; Rodrigues, Maria; Fisher, Steve; Bailey, Eleanor; Herrman, Helen

    2015-02-25

    Suicide is a leading cause of death, particularly among young adults. The rapid growth of social media and its heavy use by young adults presents new challenges and opportunities for suicide prevention. Social media sites are commonly used for communicating about suicide-related behavior with others, which raises the possibility of using social media to help prevent suicide. However, the use of social media varies widely between different suicide prevention advocates. The role this type of intervention should play in a community's overall suicide prevention strategy remains a matter of debate. Explore the ways in which stakeholders use social media for suicide prevention and assess their views about the potential utility of social media as a suicide prevention tool. A 12-week stakeholder consultation that involved the online administration and completion of surveys by 10 individuals who conduct research about suicide and social media, 13 organizations that use social media for suicide prevention purposes, and 64 users of social media. Social media was seen as a useful means of delivering a range of suicide prevention activities. Respondents reported that the key benefits of social media were the opportunity to obtain emotional support from others, to express one's feelings, to talk to others with similar problems, and to provide help to others. The social media site believed to hold most potential for delivering suicide prevention activities was Facebook. There were concerns about potential risks of social media, but respondents felt the potential benefits outweighed the risks. Social media was recognized by different types of stakeholders as holding potential for delivering suicide prevention activities. More research is required to establish the efficacy and safety of potential social media-based interventions and ethical standards and protocols to ensure that such interventions are delivered safely need to be developed and implemented.

  18. Geologic and geophysical characterization studies of Yucca Mountain, Nevada, a potential high-level radioactive-waste repository

    USGS Publications Warehouse

    Whitney, J.W.; Keefer, W.R.

    2000-01-01

    In recognition of a critical national need for permanent radioactive-waste storage, Yucca Mountain in southwestern Nevada has been investigated by Federal agencies since the 1970's, as a potential geologic disposal site. In 1987, Congress selected Yucca Mountain for an expanded and more detailed site characterization effort. As an integral part of this program, the U.S. Geological Survey began a series of detailed geologic, geophysical, and related investigations designed to characterize the tectonic setting, fault behavior, and seismicity of the Yucca Mountain area. This document presents the results of 13 studies of the tectonic environment of Yucca Mountain, in support of a broad goal to assess the effects of future seismic and fault activity in the area on design, long-term performance, and safe operation of the potential surface and subsurface repository facilities.

  19. Chemical Rescue of Enzymes: Proton Transfer in Mutants of Human Carbonic Anhydrase II

    PubMed Central

    Maupin, C. Mark; Castillo, Norberto; Taraphder, Srabani; Tu, Chingkuang; McKenna, Robert; Silverman, David N.; Voth, Gregory A.

    2011-01-01

    In human carbonic anhydrase II (HCA II) the mutation of position 64 from histidine to alanine (H64A) disrupts the rate limiting proton transfer (PT) event, resulting in a reduction of the catalytic activity of the enzyme as compared to the wild-type. Potential of mean force (PMF) calculations utilizing the multistate empirical valence bond (MS-EVB) methodology for H64A HCA II give a PT free energy barrier significantly higher than that found in the wild-type enzyme. This high barrier, determined in the absence of exogenous buffer and assuming no additional ionizable residues in the PT pathway, indicates the likelihood of alternate enzyme pathways that utilize either ionizable enzyme residues (self-rescue) and/or exogenous buffers (chemical rescue). It has been shown experimentally that the catalytic activity of H64A HCA II can be chemically rescued to near wild type levels by the addition of the exogenous buffer 4-methylimidazole (4MI). Crystallographic studies have identified two 4MI binding sites, yet site specific mutations intended to disrupt 4MI binding have demonstrated these sites to be non-productive. In the present work MS-EVB simulations show that binding of 4MI near Thr199 in the H64A HCA II mutant, a binding site determined by NMR spectroscopy, results in a viable chemical rescue pathway. Additional viable rescue pathways are also identified where 4MI acts as a proton transport intermediary from the active site to ionizable residues on the rim of the active site, revealing a probable mode of action for the chemical rescue pathway PMID:21452838

  20. 10 CFR 960.5-2-5 - Environmental quality.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... repository siting, construction, operation, closure, and decommissioning, and projected environmental impacts..., technical, social, economic, and environmental factors; and (2) the requirements specified in § 960.5-1(a)(2... the activities proposed to take place thereon. (2) Potential significant adverse environmental impacts...

  1. 10 CFR 960.5-2-5 - Environmental quality.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... repository siting, construction, operation, closure, and decommissioning, and projected environmental impacts..., technical, social, economic, and environmental factors; and (2) the requirements specified in § 960.5-1(a)(2... the activities proposed to take place thereon. (2) Potential significant adverse environmental impacts...

  2. 10 CFR 960.5-2-5 - Environmental quality.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... repository siting, construction, operation, closure, and decommissioning, and projected environmental impacts..., technical, social, economic, and environmental factors; and (2) the requirements specified in § 960.5-1(a)(2... the activities proposed to take place thereon. (2) Potential significant adverse environmental impacts...

  3. Alteration of neural action potential patterns by axonal stimulation: the importance of stimulus location.

    PubMed

    Crago, Patrick E; Makowski, Nathaniel S

    2014-10-01

    Stimulation of peripheral nerves is often superimposed on ongoing motor and sensory activity in the same axons, without a quantitative model of the net action potential train at the axon endpoint. We develop a model of action potential patterns elicited by superimposing constant frequency axonal stimulation on the action potentials arriving from a physiologically activated neural source. The model includes interactions due to collision block, resetting of the neural impulse generator, and the refractory period of the axon at the point of stimulation. Both the mean endpoint firing rate and the probability distribution of the action potential firing periods depend strongly on the relative firing rates of the two sources and the intersite conduction time between them. When the stimulus rate exceeds the neural rate, neural action potentials do not reach the endpoint and the rate of endpoint action potentials is the same as the stimulus rate, regardless of the intersite conduction time. However, when the stimulus rate is less than the neural rate, and the intersite conduction time is short, the two rates partially sum. Increases in stimulus rate produce non-monotonic increases in endpoint rate and continuously increasing block of neurally generated action potentials. Rate summation is reduced and more neural action potentials are blocked as the intersite conduction time increases. At long intersite conduction times, the endpoint rate simplifies to being the maximum of either the neural or the stimulus rate. This study highlights the potential of increasing the endpoint action potential rate and preserving neural information transmission by low rate stimulation with short intersite conduction times. Intersite conduction times can be decreased with proximal stimulation sites for muscles and distal stimulation sites for sensory endings. The model provides a basis for optimizing experiments and designing neuroprosthetic interventions involving motor or sensory stimulation.

  4. Assessing landslide potential on coastal bluffs near Mukilteo, Washington—Geologic site characterization for hydrologic monitoring

    USGS Publications Warehouse

    Mirus, Benjamin B.; Smith, Joel B.; Benjamin Stark,; York Lewis,; Abigail Michel,; Baum, Rex L.

    2016-07-01

    During the summer 2015, the U.S. Geological Survey collected geologic and geotechnical data for two sites on coastal bluffs along the eastern shore of Puget Sound, Washington. The U.S. Geological Survey also installed hydrologic instrumentation at the sites and collected specimens for laboratory testing. The two sites are located on City of Mukilteo open-space land and are about 0.6 kilometers apart. The bluffs at each site are approximately 42 meters high, and rise steeply from the shoreline with 32–35° slopes. The more northerly of the two sites occupies an active landslide and is mostly unvegetated. The other site is forested, and although stable during the preparation of this report, shows evidence of historical and potential landslide activity. The slopes of the bluffs at both sites are mantled by a thin, nonuniform colluvium underlain by clay-rich glacial deposits and tills of the Whidbey Formation or Double Bluff Drift. Till consisting of sand, gravel, and cobbles caps the bluffs and rests on finer grained glacial deposits of sand, silt, and clay. These types of different glacial deposits are dense, vertically fractured, and generally have low permeability, but field observations indicate that locally the deposits are sufficiently permeable to allow lateral flow of water along fractures and subhorizontal boundaries between deposits of different texture. Laboratory tests indicate that many of the deposits are highly plastic, with low hydraulic conductivity, and moderate shear strength. Steep slopes combined with the strength and hydraulic characteristics of the deposits leave the bluffs prone to slope instability, particularly during the wet season when infiltrating rainfall changes moisture content, pore-water pressure, and effective stress within the hillslope. The instrumentation was designed to primarily observe rainfall variability and hydrologic changes in the subsurface that can affect stability of the bluffs, and also to compare the hydrologic response between areas where previous landslides have disturbed vegetation and areas where the bluff is apparently more stable and well vegetated.

  5. Novel multitarget-directed ligands (MTDLs) with acetylcholinesterase (AChE) inhibitory and serotonergic subtype 4 receptor (5-HT4R) agonist activities as potential agents against Alzheimer's disease: the design of donecopride.

    PubMed

    Rochais, Christophe; Lecoutey, Cédric; Gaven, Florence; Giannoni, Patrizia; Hamidouche, Katia; Hedou, Damien; Dubost, Emmanuelle; Genest, David; Yahiaoui, Samir; Freret, Thomas; Bouet, Valentine; Dauphin, François; Sopkova de Oliveira Santos, Jana; Ballandonne, Céline; Corvaisier, Sophie; Malzert-Fréon, Aurélie; Legay, Remi; Boulouard, Michel; Claeysen, Sylvie; Dallemagne, Patrick

    2015-04-09

    In this work, we describe the synthesis and in vitro evaluation of a novel series of multitarget-directed ligands (MTDL) displaying both nanomolar dual-binding site (DBS) acetylcholinesterase inhibitory effects and partial 5-HT4R agonist activity, among which donecopride was selected for further in vivo evaluations in mice. The latter displayed procognitive and antiamnesic effects and enhanced sAPPα release, accounting for a potential symptomatic and disease-modifying therapeutic benefit in the treatment of Alzheimer's disease.

  6. An Analysis of the Potential Use of Red Horse Capabilities and Training Activities to Perform or Accelerate Air Force Environmental Cleanups

    DTIC Science & Technology

    1992-09-01

    capable of remediating sites contaminated with VOCs. Technologies which are innovative , emerging or not applicable are all considered to be...AD-A261 422 AFIT/GEE/CE%’/92S-’ AN" ANALYSIS OF T1’E, P’OTEN-TIAL USE OF RED HORSE CAPABILITIES AND TRAINING ACTIVITIES TO PEPFORM OR ACCELERATE AIR...Approved for public release; distribution unlimited 93 2 2-5 1󈧤 A.FIT/GEE/CEV/92S-7 AIN A.N.AýLYSIS OF THE POTENTIAL USE OF RED HORSE CAPABILITIES

  7. Association Between Pain at Sites Outside the Knee and Knee Cartilage Volume Loss in Elderly People Without Knee Osteoarthritis: A Prospective Study.

    PubMed

    Pan, Feng; Laslett, Laura; Tian, Jing; Cicuttini, Flavia; Winzenberg, Tania; Ding, Changhai; Jones, Graeme

    2017-05-01

    Pain is common in the elderly. Knee pain may predict knee cartilage loss, but whether generalized pain is associated with knee cartilage loss is unclear. This study, therefore, aimed to determine whether pain at multiple sites predicts knee cartilage volume loss among community-dwelling older adults, and, if so, to explore potential mechanisms. Data from the prospective Tasmanian Older Adult Cohort study was utilized (n = 394, mean age 63 years, range 52-79 years). Experience of pain at multiple sites was assessed using a questionnaire at baseline. T1-weighted fat-saturated magnetic resonance imaging of the right knee was performed to assess the cartilage volume at baseline and after 2.6 years. Linear regression modeling was used with adjustment for potential confounders. The median number of painful sites was 3 (range 0-7). There was a dose-response relationship between the number of painful sites and knee cartilage volume loss in the lateral and total tibiofemoral compartments (lateral β = -0.28% per annum; total β = -0.25% per annum, both P for trend < 0.05), but not in the medial compartment. These associations were stronger in participants without radiographic knee osteoarthritis (OA) (P < 0.05) and independent of age, sex, body mass index, physical activity, pain medication, and knee structural abnormalities. The number of painful sites independently predicts knee cartilage volume loss, especially in people without knee OA, suggesting that widespread pain may be an early marker of more rapid knee cartilage loss in those without radiographic knee OA. The underlying mechanism is unclear, but it is independent of anthropometrics, physical activity, and knee structural abnormalities. © 2016, American College of Rheumatology.

  8. Input- and subunit-specific AMPA receptor trafficking underlying long-term potentiation at hippocampal CA3 synapses.

    PubMed

    Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji

    2004-07-01

    Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.

  9. Reasons for non-recruitment of eligible patients to a randomised controlled trial of secondary prevention after intracerebral haemorrhage: observational study.

    PubMed

    Maxwell, Amy E; MacLeod, Mary Joan; Joyson, Anu; Johnson, Sharon; Ramadan, Hawraman; Bellfield, Ruth; Byrne, Anthony; McGhee, Caroline; Rudd, Anthony; Price, Fiona; Vasileiadis, Evangelos; Holden, Melinda; Hewitt, Jonathan; Carpenter, Michael; Needle, Ann; Valentine, Stacey; Patel, Farzana; Harrington, Frances; Mudd, Paul; Emsley, Hedley; Gregary, Bindu; Kane, Ingrid; Muir, Keith; Tiwari, Divya; Owusu-Agyei, Peter; Temple, Natalie; Sekaran, Lakshmanan; Ragab, Suzanne; England, Timothy; Hedstrom, Amanda; Jones, Phil; Jones, Sarah; Doherty, Mandy; McCarron, Mark O; Cohen, David L; Tysoe, Sharon; Al-Shahi Salman, Rustam

    2017-04-05

    Recruitment to randomised prevention trials is challenging, not least for intracerebral haemorrhage (ICH) associated with antithrombotic drug use. We investigated reasons for not recruiting apparently eligible patients at hospital sites that keep screening logs in the ongoing REstart or STop Antithrombotics Randomised Trial (RESTART), which seeks to determine whether to start antiplatelet drugs after ICH. By the end of May 2015, 158 participants had been recruited at 108 active sites in RESTART. The trial coordinating centre invited all sites that kept screening logs to submit screening log data, followed by one reminder. We checked the integrity of data, focused on the completeness of data about potentially eligible patients and categorised the reasons they were not randomised. Of 108 active sites, 39 (36%) provided usable screening log data over a median of ten (interquartile range = 5-13) months of recruitment per site. During this time, sites screened 633 potentially eligible patients and randomised 53 (8%) of them. The main reasons why 580 patients were not randomised were: 43 (7%) patients started anticoagulation, 51 (9%) patients declined, 148 (26%) patients' stroke physicians were not uncertain about using antiplatelet drugs, 162 (28%) patients were too unwell and 176 (30%) patients were not randomised due to other reasons. RESTART recruited ~8% of eligible patients. If more physicians were uncertain about the therapeutic dilemma that RESTART is addressing, RESTART could have recruited up to four times as many participants. The trial coordinating centre continues to engage with physicians about their uncertainty. EU Clinical Trials, EudraCT 2012-003190-26 . Registered on 3 July 2012.

  10. Spectroscopic insights into the nature of active sites in iron–nitrogen–carbon electrocatalysts for oxygen reduction in acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jia, Qingying; Ramaswamy, Nagappan; Tylus, Urszula

    Developing efficient and inexpensive catalysts for the sluggish oxygen reduction reaction (ORR) constitutes one of the grand challenges in the fabrication of commercially viable fuel cell devices and metal–air batteries for future energy applications. Despite recent achievements in designing advanced Pt-based and Pt-free catalysts, current progress primarily involves an empirical approach of trial-and-error combination of precursors and synthesis conditions, which limits further progress. Rational design of catalyst materials requires proper understanding of the mechanistic origin of the ORR and the underlying surface properties under operating conditions that govern catalytic activity. Herein, several different groups of iron-based catalysts synthesized via differentmore » methods and/or precursors were systematically studied by combining multiple spectroscopic techniques under ex situ and in situ conditions in an effort to obtain a comprehensive understanding of the synthesis-products correlations, nature of active sites, and the reaction mechanisms. These catalysts include original macrocycles, macrocycle-pyrolyzed catalysts, and Fe-N–C catalysts synthesized from individual Fe, N, and C precursors including polymer-based catalysts, metal organic framework (MOF)-based catalysts, and sacrificial support method (SSM)-based catalysts. The latter group of catalysts is most promising as not only they exhibit exceptional ORR activity and/or durability, but also the final products are controllable. We show that the high activity observed for most pyrolyzed Fe-based catalysts can mainly be attributed to a single active site: non-planar Fe–N 4 moiety embedded in distorted carbon matrix characterized by a high potential for the Fe 2+/3+ redox transition in acidic electrolyte/environment. The high intrinsic ORR activity, or turnover frequency (TOF), of this site is shown to be accounted for by redox catalysis mechanism that highlights the dominant role of the site-blocking effect. Moreover, a highly active MOF-based catalyst without Fe–N moieties was developed, and the active sites were identified as nitrogen-doped carbon fibers with embedded iron particles that are not directly involved in the oxygen reduction pathway. The high ORR activity and durability of catalysts involving this second site, as demonstrated in fuel cell, are attributed to the high density of active sites and the elimination or reduction of Fenton-type processes. The latter are initiated by hydrogen peroxide but are known to be accelerated by iron ions exposed to the surface, resulting in the formation of damaging free-radicals.« less

  11. The Northwestern Slope Valleys Region, Mars: A Prime Target for the Future Exploration of Mars

    NASA Astrophysics Data System (ADS)

    Dohm, J. M.; Ferris, J. C.; Anderson, R. C.; Baker, V. R.; Hare, T. M.; Mahaney, W. C.

    2002-12-01

    Mars is a water-enriched planet theorized to have had Earth-like conditions during its embryonic stages of evolution (Early into Middle Noachian or > 3.8 GA). The Earth-like conditions include: (1) plate tectonism, (2) an active hydrosphere resulting in higher erosion rates and the presence of layered sedimentary deposits, and (3) a potential biosphere. Due to its smaller size and lower gravity, its thermal energy rapidly declined, sending the planet into a permanent monoplate regime. The Tharsis superplume, Elysium superplume, and structural discontinuities in the lithosphere are sites of long-lived energy releases and hydrothermal activity. Furthermore, as its atmosphere thinned and cooled, and water was lost to hydrodynamic escape, the Earth-like hydrological cycle transitioned into a persisting cold desert climate, approximating the present-day climate of the Dry Valleys in Antarctica. Stratigraphic, hydrogeomorphic, and paleotectonic information indicate an active Mars (e.g., late-stage superplume activity) that experienced punctuated periods of magmatic-driven hydrologic activity long after the Earth-like hydrologic regime had ended. Existing geologic, geomorphic, geophysical, topographic, impact cratering, spectral, and elemental information collectively point to a prime target site for future exploration that has the potential to yield significant geologic, paleoclimatic, paleohydrologic, and exobiologic information. The Northwestern Slope Valleys (NSVs) region archives traits similar to terrestrial field sites where the processes associated with: (1) fluvial, eolian, and hydrothermal activity, (2) modification due to landslides and glaciers, and (3) the formation of diverse rock assemblages (e.g., provenances include Noachian Thaumasia highlands mountain range and Europe-sized sedimentary basin and Noachian-Amazonian basaltic and possibly silica-enriched volcanoes and lava flow fields) are recorded. The region is especially remarkable since it encapsulates at least three distinct paleohydrologic regimes: Noachian-Early Hesperian NSVs flooding (~108 - 1010 m3/sec), Late Hesperian-Early Amazonian Mangala Valles flooding (~107 m3/sec), Amazonian sapping channel formation (~103 m3/sec), and recent groundwater seeps (<102 m3/sec), all of which expose deposits for in-situ study and sample return. Terrestrial analogs include: (1) Wet Beaver Creek, Arizona, which reveals intriguing geologic, hydrogeologic, and geomorphic similarities to a well-developed martian sapping channel, Abus Vallis, and (2) the Gray Mountain FIDO rover test site, which records diverse geological terrains similar to what might be encountered at the proposed NSVs prime target site.

  12. Rates and determinants of uptake and use of an internet physical activity and weight management program in office and manufacturing work sites in England: Cohort Study

    USDA-ARS?s Scientific Manuscript database

    Internet-based physical activity (PA) and weight management programs have the potential to improve employees' health in large occupational health settings. To be successful, the program must engage a wide range of employees, especially those at risk of weight gain or ill health. The aim of the study...

  13. HPLC-Based Activity Profiling: Discovery of Piperine as a Positive GABAA Receptor Modulator Targeting a Benzodiazepine-Independent Binding Site

    PubMed Central

    Zaugg, Janine; Baburin, Igor; Strommer, Barbara; Kim, Hyun-Jung; Hering, Steffen; Hamburger, Matthias

    2011-01-01

    A plant extract library was screened for GABAA receptor activity making use of a two-microelectrode voltage clamp assay on Xenopus laevis oocytes. An ethyl acetate extract of black pepper fruits [Piper nigrum L. (Piperaceae) 100 μg/mL] potentiated GABA-induced chloride currents through GABAA receptors (composed of α1, β2, and γ2S subunits) by 169.1 ± 2.4%. With the aid of an HPLC-based activity profiling approach, piperine (5) was identified as the main active compound, together with 12 structurally related less active or inactive piperamides (1–4, 6–13). Identification was achieved by on-line high-resolution mass spectrometry and off-line microprobe 1D and 2D NMR spectroscopy, using only milligram amounts of extract. Compound 5 induced a maximum potentiation of the chloride currents by 301.9 ± 26.5% with an EC50 of 52.4 ± 9.4 μM. A comparison of the modulatory activity of 5 and other naturally occurring piperamides enabled insights into structural features critical for GABAA receptor modulation. The stimulation of chloride currents through GABAA receptors by compound 5 was not antagonized by flumazenil (10 μM). These data show that piperine (5) represents a new scaffold of positive allosteric GABAA receptor modulators targeting a benzodiazepine-independent binding site. PMID:20085307

  14. Artificial Metalloproteins Containing Co 4O 4Cubane Active Sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olshansky, Lisa; Huerta-Lavorie, Raul; Nguyen, Andy I.

    Artificial metalloproteins (ArMs) containing Co 4O 4 cubane active sites were constructed via biotin-streptavidin technology. Stabilized by hydrogen bonds (H-bonds), terminal and cofacial Co III-OH 2 moieties are observed crystallographically in a series of immobilized cubane sites. Solution electrochemistry provided correlations of oxidation potential and pH. For variants containing Ser and Phe adjacent to the metallocofactor, 1e -/1H + chemistry predominates until pH 8, above which the oxidation becomes pH-independent. Installation of Tyr proximal to the Co 4O 4 active site provided a single H-bond to one of a set of cofacial Co III-OH 2 groups. With this variant, multi-emore » - /multi-H + chemistry is observed, along with a change in mechanism at pH 9.5 that is consistent with Tyr deprotonation. Finally, with structural similarities to both the oxygen-evolving complex of photosystem II (H-bonded Tyr) and to thin film water oxidation catalysts (Co 4O 4 core), these findings bridge synthetic and biological systems for water oxidation, highlighting the importance of secondary sphere interactions in mediating multi-e - /multi-H + reactivity.« less

  15. Artificial Metalloproteins Containing Co 4O 4Cubane Active Sites

    DOE PAGES

    Olshansky, Lisa; Huerta-Lavorie, Raul; Nguyen, Andy I.; ...

    2018-02-05

    Artificial metalloproteins (ArMs) containing Co 4O 4 cubane active sites were constructed via biotin-streptavidin technology. Stabilized by hydrogen bonds (H-bonds), terminal and cofacial Co III-OH 2 moieties are observed crystallographically in a series of immobilized cubane sites. Solution electrochemistry provided correlations of oxidation potential and pH. For variants containing Ser and Phe adjacent to the metallocofactor, 1e -/1H + chemistry predominates until pH 8, above which the oxidation becomes pH-independent. Installation of Tyr proximal to the Co 4O 4 active site provided a single H-bond to one of a set of cofacial Co III-OH 2 groups. With this variant, multi-emore » - /multi-H + chemistry is observed, along with a change in mechanism at pH 9.5 that is consistent with Tyr deprotonation. Finally, with structural similarities to both the oxygen-evolving complex of photosystem II (H-bonded Tyr) and to thin film water oxidation catalysts (Co 4O 4 core), these findings bridge synthetic and biological systems for water oxidation, highlighting the importance of secondary sphere interactions in mediating multi-e - /multi-H + reactivity.« less

  16. Public health assessment for Freeway Sanitary Landfill, Burnsville, Dakota County, Minnesota, Region 5. CERCLIS No. MND038384004. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1993-03-30

    The Freeway Sanitary Landfill National Priorities List (NPL) site in Burnsville, Minnesota is situated in the Lower Minnesota River Valley. Shallow groundwater beneath the site is contaminated with low levels of volatile organic hydrocarbons and heavy metals. Under current conditions, no human exposures to site-related contaminants are known to occur at levels of health concern. Based on currently available information, the Minnesota Department of Health concludes that the site poses an indeterminate public health hazard under current conditions because exposure to volatile gases released to the air is possible, but cannot be evaluated from the very limited information available. Theremore » are also a few physical hazards on the site which pose a risk of accident or injury if trespassing occurs. Otherwise, there are no indications that people have been, or are being, exposed to site-related contaminants at levels that would be of health concern. The Agency For Toxic Substances and Disease Registry (ATSDR) Health Activities Recommendation Panel has evaluated the Freeway Sanitary Landfill Public Health Assessment for appropriate follow-up activities. The Panel has recommended that health education be considered to assist site workers in better understanding their potential for exposure to landfill gases.« less

  17. Nevada National Security Site Environmental Report 2012 Attachment A: Site Description

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wills, Cathy A

    This attachment expands on the general description of the Nevada National Security Site (NNSS) presented in the Introduction to the Nevada National Security Site Environmental Report 2012 (National Security Technologies, LLC [NSTec], 2013). Included are subsections that summarize the site’s geological, hydrological, climatological, and ecological setting and the cultural resources of the NNSS. The subsections are meant to aid the reader in understanding the complex physical and biological environment of the NNSS. An adequate knowledge of the site’s environment is necessary to assess the environmental impacts of new projects, design and implement environmental monitoring activities for current site operations, andmore » assess the impacts of site operations on the public residing in the vicinity of the NNSS. The NNSS environment contributes to several key features of the site that afford protection to the inhabitants of adjacent areas from potential exposure to radioactivity or other contaminants resulting from NNSS operations. These key features include the general remote location of the NNSS, restricted access, extended wind transport times, the great depths to slow-moving groundwater, little or no surface water, and low population density. This attachment complements the annual summary of monitoring program activities and dose assessments presented in the main body of this report.« less

  18. Nevada National Security Site Environmental Report 2013 Attachment A: Site Description

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wills, C.

    This attachment expands on the general description of the Nevada National Security Site (NNSS) presented in the Introduction to the Nevada National Security Site Environmental Report 2012 (National Security Technologies, LLC [NSTec], 2013). Included are subsections that summarize the site’s geological, hydrological, climatological, and ecological setting and the cultural resources of the NNSS. The subsections are meant to aid the reader in understanding the complex physical and biological environment of the NNSS. An adequate knowledge of the site’s environment is necessary to assess the environmental impacts of new projects, design and implement environmental monitoring activities for current site operations, andmore » assess the impacts of site operations on the public residing in the vicinity of the NNSS. The NNSS environment contributes to several key features of the site that afford protection to the inhabitants of adjacent areas from potential exposure to radioactivity or other contaminants resulting from NNSS operations. These key features include the general remote location of the NNSS, restricted access, extended wind transport times, the great depths to slow-moving groundwater, little or no surface water, and low population density. This attachment complements the annual summary of monitoring program activities and dose assessments presented in the main body of this report.« less

  19. Salt Effect on the Antioxidant Activity of Red Microalgal Sulfated Polysaccharides in Soy-Bean Formula.

    PubMed

    Burg, Ariela; Oshrat, Levy-Ontman

    2015-10-20

    Sulfated polysaccharides produced by microalgae, which are known to exhibit various biological activities, may potentially serve as natural antioxidant sources. To date, only a few studies have examined the antioxidant bioactivity of red microalgal polysaccharides. In this research, the effect of different salts on the antioxidant activities of two red microalgal sulfated polysaccharides derived from Porphyridium sp. and Porphyridium aerugineum were studied in a soy bean-based infant milk formula. Salt composition and concentration were both shown to affect the polysaccharides' antioxidant activity. It can be postulated that the salt ions intefer with the polysaccharide chains' interactions and alter their structure, leading to a new three-dimensional structure that better exposes antiooxidant sites in comparison to the polysaccharide without salt supplement. Among the cations that were studied, Ca(2+) had the strongest enhancement effect on antioxidant activities of both polysaccharides. Understanding the effect of salts on polysaccharides' stucture, in addition to furthering knowledge on polysaccharide bioactivities, may also shed light on the position of the antioxidant active sites.

  20. Brain oscillations and BIS/BAS (behavioral inhibition/activation system) effects on processing masked emotional cues. ERS/ERD and coherence measures of alpha band.

    PubMed

    Balconi, Michela; Mazza, Guido

    2009-11-01

    Alpha brain oscillation modulation was analyzed in response to masked emotional facial expressions. In addition, behavioural activation (BAS) and behavioural inhibition systems (BIS) were considered as an explicative factor to verify the effect of motivational significance on cortical activity. Nineteen subjects were submitted to an ample range of facial expressions of emotions (anger, fear, surprise, disgust, happiness, sadness, and neutral). The results demonstrated that anterior frontal sites were more active than central and posterior sites in response to facial stimuli. Moreover, right-side responses varied as a function of emotional types, with an increased right-frontal activity for negative emotions. Finally, whereas higher BIS subjects generated a more right hemisphere activation for some negative emotions (such as fear, anger, and surprise), Reward-BAS subjects were more responsive to positive emotion (happiness) within the left hemisphere. Valence and potential threatening power of facial expressions were considered to elucidate these cortical differences.

  1. Letter Report to Address Comments on the Closure Report for Corrective Action Unit 224: Decon Pad and Septic Systems, Nevada Test Site, Nevada, Revision 0, March 2008

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NSTec Environmental Restoration

    2008-03-17

    The Closure Report (CR) for Corrective Action Unit (CAU) 224, Decon Pad and Septic Systems, was approved by the Nevada Department of Environmental Protection (NDEP) on November 01, 2007. The approval letter contained the following two comments: Comment 1--For 06-05-01, 06-17-04, 06-23-01 provide evidence that the 6 inch VCP pipe originating from building CP-2 is no longer active and sealed to prevent possible future contamination. Comment 2--For the area that includes 06-03-01, provide evidence that active lines are no longer feeding the North and South lagoons and have been sealed to prevent possible future contamination. To address these comments, closuremore » documentation was reviewed, and site visits were conducted to locate and document the areas of concern. Additional fieldwork was conducted in March 2008 to seal the lines and openings described in the two comments. Photographs were taken of the closed drains and lines to document that the NDEP comments were adequately addressed and potential inadvertent discharge to the environment has been eliminated. Investigation and closure documentation was reviewed to identify the locations of potential drains, lines, and other features that could receive and/or transmit liquid. Based on the investigation findings and subsequent closure activities, no openings, distribution boxes, or other features (excluding known floor drains at CP-2) that could receive liquid were found at the CP-2 location (Figure 1), and potential manholes for the north and south sewage lagoons were identified for Corrective Action Site (CAS) 06-03-01 (Figure 2). The distribution box identified in Figure 1 was not located during the investigation and was assumed to have been previously removed.« less

  2. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions

    PubMed Central

    Sengupta, Raghuvir N.; Van Schie, Sabine N.S.; Giambaşu, George; Dai, Qing; Yesselman, Joseph D.; York, Darrin; Piccirilli, Joseph A.; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such “off-pathway” species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2′- and 3′-deoxy (–H) and −amino (–NH2) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3′-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2′-OH making no interaction. Upon S binding, a rearrangement occurs that allows both –OH groups to contact a different active site metal ion, termed MC, to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. PMID:26567314

  3. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions.

    PubMed

    Sengupta, Raghuvir N; Van Schie, Sabine N S; Giambaşu, George; Dai, Qing; Yesselman, Joseph D; York, Darrin; Piccirilli, Joseph A; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such "off-pathway" species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2'- and 3'-deoxy (-H) and -amino (-NH(2)) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3'-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2'-OH making no interaction. Upon S binding, a rearrangement occurs that allows both -OH groups to contact a different active site metal ion, termed M(C), to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. © 2015 Sengupta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Biomarkers of metals exposure in fish from lead-zinc mining areas of Southeastern Missouri, USA

    USGS Publications Warehouse

    Schmitt, C.J.; Whyte, J.J.; Roberts, A.P.; Annis, M.L.; May, T.W.; Tillitt, D.E.

    2007-01-01

    The potential effects of proposed lead-zinc mining in an ecologically sensitive area were assessed by studying a nearby mining district that has been exploited for about 30 y under contemporary environmental regulations and with modern technology. Blood and liver samples representing fish of three species (largescale stoneroller, Campostoma oligolepis, n=91; longear sunfish, Lepomis megalotis, n=105; and northern hog sucker, Hypentelium nigricans, n=20) from 16 sites representing a range of conditions relative to mining activities were collected. Samples were analyzed for metals (also reported in a companion paper) and for biomarkers of metals exposure [erythrocyte ??-aminolevulinic acid dehydratase (ALA-D) activity; concentrations of zinc protoporphyrin (ZPP), iron, and hemoglobin (Hb) in blood; and hepatic metallothionein (MT) gene expression and lipid peroxidation]. Blood lead concentrations were significantly higher and ALA-D activity significantly lower in all species at sites nearest to active lead-zinc mines and in a stream contaminated by historical mining than at reference or downstream sites. ALA-D activity was also negatively correlated with blood lead concentrations in all three species but not with other metals. Iron and Hb concentrations were positively correlated in all three species, but were not correlated with any other metals in blood or liver in any species. MT gene expression was positively correlated with liver zinc concentrations, but neither MT nor lipid peroxidase differences among fish grouped according to lead concentrations were statistically significant. ZPP was not detected by hematofluorometry in most fish, but fish with detectable ZPP were from sites affected by mining. Collectively, these results confirm that metals are released to streams from active lead-zinc mining sites and are accumulated by fish. ?? 2007 Elsevier Inc. All rights reserved.

  5. PqsBC, a Condensing Enzyme in the Biosynthesis of the Pseudomonas aeruginosa Quinolone Signal

    PubMed Central

    Drees, Steffen Lorenz; Li, Chan; Prasetya, Fajar; Saleem, Muhammad; Dreveny, Ingrid; Williams, Paul; Hennecke, Ulrich; Emsley, Jonas; Fetzner, Susanne

    2016-01-01

    Pseudomonas aeruginosa produces a number of alkylquinolone-type secondary metabolites best known for their antimicrobial effects and involvement in cell-cell communication. In the alkylquinolone biosynthetic pathway, the β-ketoacyl-(acyl carrier protein) synthase III (FabH)-like enzyme PqsBC catalyzes the condensation of octanoyl-coenzyme A and 2-aminobenzoylacetate (2-ABA) to form the signal molecule 2-heptyl-4(1H)-quinolone. PqsBC, a potential drug target, is unique for its heterodimeric arrangement and an active site different from that of canonical FabH-like enzymes. Considering the sequence dissimilarity between the subunits, a key question was how the two subunits are organized with respect to the active site. In this study, the PqsBC structure was determined to a 2 Å resolution, revealing that PqsB and PqsC have a pseudo-2-fold symmetry that unexpectedly mimics the FabH homodimer. PqsC has an active site composed of Cys-129 and His-269, and the surrounding active site cleft is hydrophobic in character and approximately twice the volume of related FabH enzymes that may be a requirement to accommodate the aromatic substrate 2-ABA. From physiological and kinetic studies, we identified 2-aminoacetophenone as a pathway-inherent competitive inhibitor of PqsBC, whose fluorescence properties could be used for in vitro binding studies. In a time-resolved setup, we demonstrated that the catalytic histidine is not involved in acyl-enzyme formation, but contributes to an acylation-dependent increase in affinity for the second substrate 2-ABA. Introduction of Asn into the PqsC active site led to significant activity toward the desamino substrate analog benzoylacetate, suggesting that the substrate 2-ABA itself supplies the asparagine-equivalent amino function that assists in catalysis. PMID:26811339

  6. Assessing cumulative impacts to wintering Bald Eagles and their habitats in western Washington

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Witmer, G.W.; O'Neil, T.A.

    Bald Eagles (Haliaeetus leucocephalus) of Washington, the largest wintering population in the lower 48 states, are subject to numerous pressures and impacts from human activites. An evaluative method potential cumulative impacts of multiple hydroelectric development and logging activities on known and potential eagle use areas. Four resource components include food supply, roost sites, mature riparian forest, and disturbance. In addition to actual estimates of losses in food supply (fish biomass in kg) and habitat (km/sup 2/) in one river basin, impact levels from 0 (none) to 4 (high) were assigned for each development and for each component based on themore » impacts anticipated and the estimated value of the site to eagles. Midwinter eagle surveys, aerial photography, topographic and forest stand maps, and site visits were used in the analysis. Impacts were considered additive for all but the disturbance component, which was adjusted for potential synergism between developments. Adjustments were made for mitigation before the impacts were aggregated into a single, dimensionless cumulative impact score. 50 refs., 1 fig., 1 tab.« less

  7. There's Iron in Them Thar Hills: A Geologic Look at the Aristarchus Plateau as a Potential Landing Site for Human Lunar Return

    NASA Technical Reports Server (NTRS)

    Coombs, Cassandra R.; McKay, David S.

    1997-01-01

    Lunar pyroclastic deposits are unique among lunar soils. Composed of very fine grained glass beads rich in Fe, Ti and Mg they yield unique spectral signatures. From the spectra two major classes and five subclasses of lunar dark mantling deposits have been identified. Recent work by me and others has shown that the larger regional deposits are more numerous, extensive, thicker, and widely distributed than previously thought, leading us to suggest that they would make ideal resource feedstock for future lunar surface activities. Returned sample studies and the recently collected Galileo and Clementine data also corroborate these findings. Recent planning for return to the Moon indicates that large cost savings can result from using locally produced oxygen, and recent JSC laboratory results indicate that iron-rich pyroclastic dark mantling deposits may be the richest oxygen resource on the Moon. My earlier work demonstrated that instead of using regolith, bulk lunar pyroclastic deposits are better suited for beneficiation as they are thick (lO's m's), unconsolidated, fine-grained deposits. In addition, the lack of rocks and boulders and the typically flat to gently rolling terrain will facilitate their mining and processing. In preparation for the Human Lunar Return (HLR) I have characterized the Aristarchus Plateau (24 deg. N 52 deg. W) as a potential landing site for an in-situ resource utilization (ISRU) demonstration. The geologic diversity and large volume of Fe-rich pyroclastic material present at the Aristarchus site make it an ideal target for extracting O2, H2 and halogens. This paper (1) describes the current understanding of the geology of Aristarchus plateau; (2) describes the resource potential of the Aristarchus plateau; and (3) presents several candidate landing sites on the plateau for future lunar activities.

  8. Periphyton Biofilms Influence Net Methylmercury Production in an Industrially Contaminated System.

    PubMed

    Olsen, Todd A; Brandt, Craig C; Brooks, Scott C

    2016-10-18

    Mercury (Hg) methylation and methylmercury (MMHg) demethylation activity of periphyton biofilms from the industrially contaminated East Fork Poplar Creek, Tennessee (EFPC) were measured during 2014-2016 using stable Hg isotopic rate assays. 201 Hg II and MM 202 Hg were added to intact periphyton samples in ambient streamwater and the formation of MM 201 Hg and loss of MM 202 Hg were monitored over time and used to calculate first-order rate potentials for methylation and demethylation. The influences of location, temperature/season, light exposure and biofilm structure on methylation and demethylation potentials were examined. Between-site differences in net methylation for samples collected from an upstream versus downstream location were driven by differences in the demethylation rate potential (k d ). In contrast, the within-site temperature-dependent difference in net methylation was driven by changes in the methylation rate potential (k m ). Samples incubated in the dark had lower net methylation due to lower k m values than those incubated in the light. Disrupting the biofilm structure decreased k m and resulted in lower net methylation. Overall, the measured rates resulted in a net excess of MMHg generated which could account for 3.71-7.88 mg d -1 MMHg flux in EFPC and suggests intact, actively photosynthesizing periphyton biofilms harbor zones of MMHg production.

  9. First-principles study of low Miller index Ni3S2 surfaces in hydrotreating conditions.

    PubMed

    Aray, Yosslen; Vega, David; Rodriguez, Jesus; Vidal, Alba B; Grillo, Maria Elena; Coll, Santiago

    2009-03-12

    Density functional theory (DFT) calculations combined with surface thermodynamic arguments and the Gibbs-Curie-Wulff equilibrium morphology formalism have been employed to explore the effect of the reaction conditions, temperature (T), and gas-phase partial pressures (PH2 and PH2S) on the stability of nickel sulfide (Ni3S2) surfaces. Furthermore, the strength and nature of chemical bonds for selected Ni3S2 surface cuts were investigated with the quantum theory of atoms in molecules methodology. A particular analysis of the electrostatic potential within this theoretical framework is performed to study the potential activity of nickel sulfide nanoparticles as hydrodesulfurization (HDS) catalysts. The calculated thermodynamic surface stabilities and the resulting equilibrium morphology model suggest that unsupported Ni3S2 nanoparticles mainly expose (111) and (111) type surface faces in HDS conditions. Analysis of the electrostatic potential mapped onto a selected electron density isocontour (0.001 au) on those expose surface reveals a poor potential reactivity toward electron-donating reagents (i.e., low Lewis acidity). Consequently, a very low attraction between coordinatively unsaturated active sites (Lewis sites) exposed at the catalytic particles and the S atoms coming from reagent polluting molecules does inactive these kinds of particles for HDS.

  10. Gunnison sage-grouse lek site suitability modeling

    USGS Publications Warehouse

    Ouren, Douglas S.; Ignizio, Drew A.; Siders, Melissa; Childers, Theresa; Tucker, Karen; Seward, Nathan

    2014-01-01

    In order to better understand and protect species with minimal or decreasing populations, it is imperative to determine their actual existing population size. The focal species for this project is the Gunnison sage-grouse (GUSG), which became a proposed endangered species under the Endangered Species Act, thus confirming the need for better population estimates. Lek site counting during mating season has historically been the primary method for estimating population size since the grouse are very difficult to count at other times of the year. The objective of this project was to use historical data and available technology to identify additional potential lekking sites. This was done by determining areas throughout the study area that have the same landscape characteristics as those where known lekking activities occur. More accurate population counts could be the outcome of locating more lek sites. One of the remaining seven GUSG populations, the Crawford population (estimated at 128 individuals) exists in an area that includes the Gunnison Gorge National Conservation Area and the northern portion of the Black Canyon of the Gunnison National Park (our study area). While the Crawford population is small, it is still considered a self-sustaining population; the persistence and growth of this population directly contribute to genetic diversity conservation of this declining species. To date, only observational and anecdotal information about the Crawford population’s range, movements, and seasonal habitat use exist. From 1978 to the present, GUSG population monitoring has been accomplished through annual lek counts conducted each spring during GUSG mating season. Although this method has provided information on GUSG population trends, it is somewhat limited because counts are based only on known lekking sites and historically minimal efforts have been made to identify additional lek sites. To meet the objective of locating more potential lekking sites, we used a suite of spatial data, geographic information system tools, and maximum entropy species distribution tools. Based on expert knowledge and landscape variables, the modeling process evolved into a hybrid approach for delineating areas that would have a significant probability for supporting GUSG lekking activities. Based on model results, a sampling protocol was developed for model verification. The results of this project provide wildlife managers with a more sophisticated methodology to evaluate GUSG habitat for potential lekking sites.

  11. Crystallographic Analysis of Active Site Contributions to Regiospecificity in the Diiron Enzyme Toluene 4-Monooxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bailey, Lucas J.; Acheson, Justin F.; McCoy, Jason G.

    Crystal structures of toluene 4-monooxygenase hydroxylase in complex with reaction products and effector protein reveal active site interactions leading to regiospecificity. Complexes with phenolic products yield an asymmetric {mu}-phenoxo-bridged diiron center and a shift of diiron ligand E231 into a hydrogen bonding position with conserved T201. In contrast, complexes with inhibitors p-NH{sub 2}-benzoate and p-Br-benzoate showed a {mu}-1,1 coordination of carboxylate oxygen between the iron atoms and only a partial shift in the position of E231. Among active site residues, F176 trapped the aromatic ring of products against a surface of the active site cavity formed by G103, E104 andmore » A107, while F196 positioned the aromatic ring against this surface via a {pi}-stacking interaction. The proximity of G103 and F176 to the para substituent of the substrate aromatic ring and the structure of G103L T4moHD suggest how changes in regiospecificity arise from mutations at G103. Although effector protein binding produced significant shifts in the positions of residues along the outer portion of the active site (T201, N202, and Q228) and in some iron ligands (E231 and E197), surprisingly minor shifts (<1 {angstrom}) were produced in F176, F196, and other interior residues of the active site. Likewise, products bound to the diiron center in either the presence or absence of effector protein did not significantly shift the position of the interior residues, suggesting that positioning of the cognate substrates will not be strongly influenced by effector protein binding. Thus, changes in product distributions in the absence of the effector protein are proposed to arise from differences in rates of chemical steps of the reaction relative to motion of substrates within the active site channel of the uncomplexed, less efficient enzyme, while structural changes in diiron ligand geometry associated with cycling between diferrous and diferric states are discussed for their potential contribution to product release.« less

  12. The regulation of transient receptor potential canonical 4 (TRPC4) channel by phosphodiesterase 5 inhibitor via the cyclic guanosine 3'5'-monophosphate.

    PubMed

    Wie, Jinhong; Jeong, SeungJoo; Kwak, Misun; Myeong, Jongyun; Chae, MeeRee; Park, Jong Kwan; Lee, Sung Won; So, Insuk

    2017-06-01

    The transient receptor potential (TRP) protein superfamily consists of a diverse group of cation channels that bear structural similarities to the fruit fly Drosophila TRP. The TRP superfamily is distinct from other groups of ion channels in displaying a large diversity in ion selectivity, modes of activation, and physiological functions. Classical TRP (transient receptor potential canonical (TRPC)) channels are activated by stimulation of Gq-PLC-coupled receptors and modulated by phosphorylation. The cyclic guanosine monophosphate (cGMP)-PKG pathway is involved in the regulation of TRPC3 and TRPC6 channels. Phosphodiesterase (PDE) 5 inhibitor induced muscle relaxation in corporal smooth muscle cells and was used to treat erectile dysfunction by inhibiting cGMP degradation. Here, we report the functional relationship between TRPC4 and cGMP. In human embryonic kidney (HEK) 293 cells overexpressing TRPC4, cGMP selectively activated TRPC4 channels and increased cytosolic calcium level through TRPC4 channel. We investigated phosphorylation sites in TRPC4 channels and identified S688 as an important phosphorylation site for the cGMP-PKG pathway. Cyclic GMP also activated TRPC4-like current with doubly rectifying current-voltage relationship in prostate smooth muscle cell lines. Taken together, these results show that TRPC4 is phosphorylated by the cGMP-PKG pathway and might be an important target for modulating prostate function by PDE5 inhibitors.

  13. LFP Oscillations in the Mesencephalic Locomotor Region during Voluntary Locomotion

    PubMed Central

    Noga, Brian R.; Sanchez, Francisco J.; Villamil, Luz M.; O’Toole, Christopher; Kasicki, Stefan; Olszewski, Maciej; Cabaj, Anna M.; Majczyński, Henryk; Sławińska, Urszula; Jordan, Larry M.

    2017-01-01

    Oscillatory rhythms in local field potentials (LFPs) are thought to coherently bind cooperating neuronal ensembles to produce behaviors, including locomotion. LFPs recorded from sites that trigger locomotion have been used as a basis for identification of appropriate targets for deep brain stimulation (DBS) to enhance locomotor recovery in patients with gait disorders. Theta band activity (6–12 Hz) is associated with locomotor activity in locomotion-inducing sites in the hypothalamus and in the hippocampus, but the LFPs that occur in the functionally defined mesencephalic locomotor region (MLR) during locomotion have not been determined. Here we record the oscillatory activity during treadmill locomotion in MLR sites effective for inducing locomotion with electrical stimulation in rats. The results show the presence of oscillatory theta rhythms in the LFPs recorded from the most effective MLR stimulus sites (at threshold ≤60 μA). Theta activity increased at the onset of locomotion, and its power was correlated with the speed of locomotion. In animals with higher thresholds (>60 μA), the correlation between locomotor speed and theta LFP oscillations was less robust. Changes in the gamma band (previously recorded in vitro in the pedunculopontine nucleus (PPN), thought to be a part of the MLR) were relatively small. Controlled locomotion was best achieved at 10–20 Hz frequencies of MLR stimulation. Our results indicate that theta and not delta or gamma band oscillation is a suitable biomarker for identifying the functional MLR sites. PMID:28579945

  14. Investigation of the potential source area, contamination pathway, and probable release history of chlorinated-solvent-contaminated groundwater at the Capital City Plume Site, Montgomery, Alabama, 2008-2010

    USGS Publications Warehouse

    Landmeyer, James E.; Miller, Scott; Campbell, Bruce G.; Vroblesky, Don A.; Gill, Amy C.; Clark, Athena P.

    2011-01-01

    Detection of the organic solvent perchloroethylene (PCE) in a shallow public-supply well in 1991 and exposure of workers in 1993 to solvent vapors during excavation activities to depths near the water table provided evidence that the shallow aquifer beneath the capital city of Montgomery, Alabama, was contaminated. Investigations conducted from 1993 to 1999 by State and Federal agencies confirmed the detection of PCE in the shallow aquifer, as well as the detection of the organic solvent trichloroethylene (TCE) and various inorganic compounds, but the source of the groundwater contamination was not determined. In May 2000 the U.S. Environmental Protection Agency proposed that the site, called the Capital City Plume (CCP) Site, be a candidate for the National Priorities List. Between 2000 and 2007, numerous site-investigation activities also did not determine the source of the groundwater contamination. In 2008, additional assessments were conducted at the CCP Site to investigate the potential source area, contamination pathway, and the probable release history of the chlorinated-solvent-contaminated groundwater. The assessments included the collection of (1) pore water in 2008 from the hyporheic zone of a creek using passive-diffusion bag samplers; (2) tissue samples in 2008 and 2009 from trees growing in areas of downtown Montgomery characterized by groundwater contamination and from trees growing in riparian zones along the Alabama River and Cypress Creek; and (3) groundwater samples in 2009 and 2010. The data collected were used to investigate the potential source area of contaminants detected in groundwater, the pathway of groundwater contamination, and constraints on the probable contaminant-release history. The data collected between 2008 and 2010 indicate that the PCE and TCE contamination of the shallow aquifer beneath the CCP Site most likely resulted from the past use and disposal of industrial wastewater from printing operations containing chlorinated solvents into the sanitary sewer and (or) stormwater systems of Montgomery. Moreover, chlorinated-solvent use and disposal occurred at least between the 1940s and 1970s at several locations occupied by printing operations. The data also indicate that PCE and TCE contamination continues to occur in the shallow subsurface near potential release areas and that PCE and TCE have been transported to the intermediate part of the shallow aquifer.

  15. Volcanic hazards: Perspectives from eruption prediction to risk assessment for disposal of radioactive waste

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Crowe, B.

    1980-12-31

    This document summarizes an oral presentation that described the potential for volcanic activity at the proposed Yucca Mountain, Texas repository site. Yucca Mountain is located in a broad zone of volcanic activity known as the Death Valley-Pancake Ridge volcanic zone. The probability estimate for the likelihood that some future volcanic event will intersect a buried repository at Yucca Mountain is low. Additionally, the radiological consequences of penetration of a repository by basaltic magma followed by eruption of the magma at the surface are limited. The combination of low probability and limited consequence suggests that the risk posed by waste storagemore » at this site is low. (TEM)« less

  16. Tricyclic GyrB/ParE (TriBE) Inhibitors: A New Class of Broad-Spectrum Dual-Targeting Antibacterial Agents

    PubMed Central

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael; Bensen, Daniel C.; Chen, Zhiyong; Lam, Thanh; Zhang, Junhu; Lee, Suk Joong; Hough, Grayson; Phillipson, Doug; Akers-Rodriguez, Suzanne; Cunningham, Mark L.; Kwan, Bryan P.; Nelson, Kirk J.; Castellano, Amanda; Locke, Jeff B.; Brown-Driver, Vickie; Murphy, Timothy M.; Ong, Voon S.; Pillar, Chris M.; Shinabarger, Dean L.; Nix, Jay; Lightstone, Felice C.; Wong, Sergio E.; Nguyen, Toan B.; Shaw, Karen J.; Finn, John

    2013-01-01

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. However, growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highly conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models. PMID:24386374

  17. A Methodology to Evaluate Ecological Resources and Risk Using Two Case Studies at the Department of Energy’s Hanford Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burger, Joanna; Gochfeld, Michael; Bunn, Amoret

    An assessment of the potential risks to ecological resources from remediation activities or other perturbations should involve a quantitative evaluation of resources on the remediation site and in the surrounding environment. We developed a risk methodology to rapidly evaluate potential impact on ecological resources for the U.S. Department of Energy’s Hanford Site in southcentral Washington State. We describe the application of the risk evaluation for two case studies to illustrate its applicability. The ecological assessment involves examining previous sources of information for the site, defining different resource levels from 0 to 5. We also developed a risk rating scale frommore » nondiscernable to very high. Field assessment is the critical step to determine resource levels or to determine if current conditions are the same as previously evaluated. We provide a rapid assessment method for current ecological conditions that can be compared to previous site-specific data, or that can be used to assess resource value on other sites where ecological information is not generally available. The method is applicable to other Department of Energy’s sites, where its development may involve a range of state regulators, resource trustees, Tribes and other stakeholders. Achieving consistency across Department of Energy’s sites for valuation of ecological resources on remediation sites will assure Congress and the public that funds and personnel are being deployed appropriately.« less

  18. Hot Dry Rock Geothermal Energy Development Program. Annual report, fiscal year 1979

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cremer, G.M.; Duffield, R.B.; Smith, M.C.

    1980-08-01

    The Fenton Hill Project is still the principal center for developing methods, equipment, and instrumentation for creating and utilizing HDR geothermal reservoirs. The search for a second site for a similar experimental system in a different geological environment has been intensified, as have the identification and characterization of other HDR areas that may prove suitable for either experimental or commercial development. The Phase I fracture system was enlarged during FY79. Drilling of the injection well of the Phase II system began at Fenton Hill in April 1979. Environmental monitoring of the Fenton Hill area continued through FY79. The environmental studiesmore » indicate that the hot dry rock operations have caused no significant environmental impact. Other supporting activities included rock physics, rock mechanics, fracture mapping, and instrumentation development. Two closely related activities - evaluation of the potential HDR energy resource of the US and the selection of a site for development of a second experimental heat-extraction system generally similar to that at Fenton Hill - have resulted in the collection of geology, hydrology, and heat-flow data on some level of field activity in 30 states. The resource-evaluation activity included reconnaissance field studies and a listing and preliminary characterization of US geothermal areas in which HDR energy extraction methods may be applicable. The selection of Site 2 has taken into account such legal, institutional, and economic factors as land ownership and use, proximity to possible users, permitting and licensing requirements and procedures, environmental issues, areal extent of the geothermal area, and visibility to and apparent interest by potential industrial developers.« less

  19. Active site nanospace of aminoacyl tRNA synthetase: difference between the class I and class II synthetases.

    PubMed

    Dutta, Saheb; Choudhury, Kaberi; Banik, Sindrila Dutta; Nandi, Nilashis

    2014-03-01

    The present work is aimed at understanding the origin of the difference in the molecular organization of the active site nanospaces of the class I and class II aminoacyl tRNA synthetases (aaRSs) which are tunnel-like structures. The active site encloses the cognate amino acid (AA) and the adenosine triphosphate (ATP) to carry out aminoacylation reaction. Comparison of the structures of the active site of the class I and class II (aaRSs) shows that the nanodimensional tunnels are curved in opposite directions in the two classes. We investigated the origin of this difference using quantum mechanical computation of electrostatic potential (ESP) of substrates, surrounding residues and ions, using Atoms in Molecule (AIM) Theory and charge population analysis. We show that the difference is principally due to the variation in the spatial charge distribution of ATP in the two classes which correspond to extended and bent conformations of ATP. The present computation shows that the most feasible pathway for nucleophilic attack to alphaP is oppositely directed for class I and class II aaRSs. The available crystal structures show that the cognate AA is indeed located along the channel favorable for nucleophilic attack as predicted by the ESP analysis. It is also shown that the direction of the channel changes its orientation when the orientation of ATP is changed from extended to a bent like structure. We further used the AIM theory to confirm the direction of the approach of AA in each case and the results corroborate the results from the ESP analysis. The opposite curvatures of the active site nanospaces in class I and class II aaRSs are related with the influence of the charge distributions of the extended and bent conformations of ATP, respectively. The results of the computation of electrostatic potential by successive addition of active site residues show that their roles on the reaction are similar in both classes despite the difference in the organization of the active sites of class I and class II aaRSs. The difference in mechanism in two classes as pointed out in recent study (S. Dutta Banik and N. Nandi, J. Biomol. Struct. Dyn. 30, 701 (2012)) is related with the fact that the relative arrangement of the ATP with respect to the AA is opposite in class I and class II aaRSs as explained in the present work. The charge population difference between the reacting centers (which are the alphaP atom of ATP (q(p)) and the attacking oxygen atom of carboxylic acid group (q(o)), respectively) denoted by delta(q), is a measure of the propensity of nucleophilic attack. The population analysis of the substrate AA shows that a non-negligible difference exists between the attacking oxygens of AA in class I (syn) and in class II (anti) which is one reason for the lower value of delta(q) in class II relative to class I. The population analysis of the AA, ATP, Mg+2 ions and active site residues shows that the difference in delta(q) values of the two classes is substantially reduced. When ions and residues are considered. Thus, the bent state of ATP, Mg+2 ions and active site residues complements it cognate AA to carry out the nucleophilic reaction in class I as efficiently as occurs in class I (with the extended state of ATP, single Mg+2 ion and active site residues). This could be one reason for the two different conformations of ATP in the two classes. The mutual arrangements of AA and ATP in each aaRS are guided by the spatial charge distribution of ATP (extended and bent). The present work shows that the construction of nanospace complements the arrangement of the substrate (AA and ATP).

  20. External protons destabilize the activated voltage sensor in hERG channels.

    PubMed

    Shi, Yu Patrick; Cheng, Yen May; Van Slyke, Aaron C; Claydon, Tom W

    2014-03-01

    Extracellular acidosis shifts hERG channel activation to more depolarized potentials and accelerates channel deactivation; however, the mechanisms underlying these effects are unclear. External divalent cations, e.g., Ca(2+) and Cd(2+), mimic these effects and coordinate within a metal ion binding pocket composed of three acidic residues in hERG: D456 and D460 in S2 and D509 in S3. A common mechanism may underlie divalent cation and proton effects on hERG gating. Using two-electrode voltage clamp, we show proton sensitivity of hERG channel activation (pKa = 5.6), but not deactivation, was greatly reduced in the presence of Cd(2+) (0.1 mM), suggesting a common binding site for the Cd(2+) and proton effect on activation and separable effects of protons on activation and deactivation. Mutational analysis confirmed that D509 plays a critical role in the pH dependence of activation, as shown previously, and that cooperative actions involving D456 and D460 are also required. Importantly, neutralization of all three acidic residues abolished the proton-induced shift of activation, suggesting that the metal ion binding pocket alone accounts for the effects of protons on hERG channel activation. Voltage-clamp fluorimetry measurements demonstrated that protons shifted the voltage dependence of S4 movement to more depolarized potentials. The data indicate a site and mechanism of action for protons on hERG activation gating; protonation of D456, D460 and D509 disrupts interactions between these residues and S4 gating charges to destabilize the activated configuration of S4.

Top