Sample records for potential binding sites

  1. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  2. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  3. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  4. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  5. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  6. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  7. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  8. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  9. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  10. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  11. Discovery of a small-molecule HIV-1 integrase inhibitor-binding site | Center for Cancer Research

    Cancer.gov

    The lowest energy-binding conformation of an inhibitor bound to the dimeric interface of HIV-1 integrase core domain. The yellow region represents a unique allosteric binding site identified by affinity labeling and mass spectrometry and validated through mutagenesis. This site can provide a potential platform for the rational design of inhibitors selective for disruption of

  12. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  13. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  14. The Influence of Spatial Variation in Chromatin Density Determined by X-Ray Tomograms on the Time to Find DNA Binding Sites

    PubMed Central

    Larabell, Carolyn A.; Le Gros, Mark A.; McQueen, David M.; Peskin, Charles S.

    2014-01-01

    In this work, we examine how volume exclusion caused by regions of high chromatin density might influence the time required for proteins to find specific DNA binding sites. The spatial variation of chromatin density within mouse olfactory sensory neurons is determined from soft X-ray tomography reconstructions of five nuclei. We show that there is a division of the nuclear space into regions of low-density euchromatin and high-density heterochromatin. Volume exclusion experienced by a diffusing protein caused by this varying density of chromatin is modeled by a repulsive potential. The value of the potential at a given point in space is chosen to be proportional to the density of chromatin at that location. The constant of proportionality, called the volume exclusivity, provides a model parameter that determines the strength of volume exclusion. Numerical simulations demonstrate that the mean time for a protein to locate a binding site localized in euchromatin is minimized for a finite, nonzero volume exclusivity. For binding sites in heterochromatin, the mean time is minimized when the volume exclusivity is zero (the protein experiences no volume exclusion). An analytical theory is developed to explain these results. The theory suggests that for binding sites in euchromatin there is an optimal level of volume exclusivity that balances a reduction in the volume searched in finding the binding site, with the height of effective potential barriers the protein must cross during the search process. PMID:23955281

  15. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  16. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  17. Identification of Small Molecules against Botulinum Neurotoxin B Binding to Neuronal Cells at Ganglioside GT1b Binding Site with Low to Moderate Affinity

    DTIC Science & Technology

    2014-10-01

    BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the BoNT/B/trisaccharide (GT1b) complex ( PDB ...trisaccharide and all the water from the structure and identified four potential binding pockets (Pocket-1, Pocket-2, and Pocket-4) as shown in...four potential binding sites or pockets on BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the

  18. [Mechanism of action of neurotoxins acting on the inactivation of voltage-gated sodium channels].

    PubMed

    Benoit, E

    1998-01-01

    This review focuses on the mechanism(s) of action of neurotoxins acting on the inactivation of voltage-gated Na channels. Na channels are transmembrane proteins which are fundamental for cellular communication. These proteins form pores in the plasma membrane allowing passive ionic movements to occur. Their opening and closing are controlled by gating systems which depend on both membrane potential and time. Na channels have three functional properties, mainly studied using electrophysiological and biochemical techniques, to ensure their role in the generation and propagation of action potentials: 1) a highly selectivity for Na ions, 2) a rapid opening ("activation"), responsible for the depolarizing phase of the action potential, and 3) a late closing ("inactivation") involved in the repolarizing phase of the action potential. As an essential protein for membrane excitability, the Na channel is the specific target of a number of vegetal and animal toxins which, by binding to the channel, alter its activity by affecting one or more of its properties. At least six toxin receptor sites have been identified on the neuronal Na channel on the basis of binding studies. However, only toxins interacting with four of these sites (sites 2, 3, 5 et 6) produce alterations of channel inactivation. The maximal percentage of Na channels modified by the binding of neurotoxins to sites 2 (batrachotoxin and some alkaloids), 3 (alpha-scorpion and sea anemone toxins), 5 (brevetoxins and ciguatoxins) et 6 (delta-conotoxins) is different according to the site considered. However, in all cases, these channels do not inactivate. Moreover, Na channels modified by toxins which bind to sites 2, 5 and 6 activate at membrane potentials more negative than do unmodified channels. The physiological consequences of Na channel modifications, induced by the binding of neurotoxins to sites 2, 3, 5 and 6, are (i) an inhibition of cellular excitability due to an important membrane depolarization (site 2), (ii) a decrease of cellular excitability due to an important increase in the action potential duration (site 3) and (iii) an increase in cellular excitability which results in spontaneous and repetitive firing of action potentials (sites 5 and 6). The biochemical and electrophysiological studies performed with these toxins, as well as the determination of their molecular structure, have given basic information on the function and structure of the Na channel protein. Therefore, various models representing the different states of Na channels have been proposed to account for the neurotoxin-induced modifications of Na inactivation. Moreover, the localization of receptor binding sites 2, 3, 5 et 6 for these toxins on the neuronal Na channel has been deduced and the molecular identification of the recognition site(s) for some of them has been established on the alpha sub-unit forming the Na channel protein.

  19. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  20. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  1. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  2. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  3. Synthesis of Zn-MOF incorporating titanium-hydrides as active sites binding H{sub 2} molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Jongsik, E-mail: jkim40@nd.edu; Ok Kim, Dong; Wook Kim, Dong

    2015-10-15

    This paper describes the synthetic effort for a Zn-MOF imparting Ti-H as a preferential binding site potentially capturing H{sub 2} molecules via Kubas-type interaction. The formation mechanism of Ti-H innate to the final material was potentially demonstrated to follow a radical dissociation rather than a β-hydrogen elimination and a C-H reductive elimination. - Graphical abstract: This study details the synthesis and the formation mechanism of Zn-MOF adsorbent site-isolating TiH{sub 3} that can potentially capture H{sub 2} molecules via Kubas-binding mechanism. - Highlights: • OH-functionalized Zn-MOF was employed as a reactive template to site-isolate TiH{sub 3}. • This MOF was post-syntheticallymore » modified using a tetracyclohexyl titanium (IV). • This intermediate was hydrogenolyzed to change ligand from cyclohexyl to hydride. • Formation mechanism of TiH{sub 3} was investigated via two control GC–MS experiments. • Final Zn-MOF potentially site-isolating TiH{sub 3} species was used as a H{sub 2} adsorbent.« less

  4. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  5. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  6. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

    PubMed

    Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

    2010-08-01

    Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

  8. Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

    2016-03-24

    The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less

  9. Active sites prediction and binding analysis E1-E2 protein human papillomavirus with biphenylsulfonacetic acid

    NASA Astrophysics Data System (ADS)

    Iryani, I.; Amelia, F.; Iswendi, I.

    2018-04-01

    Cervix cancer triggered by Human papillomavirus infection is the second cause to woman death in worldwide. The binding site of E1-E2 protein of HPV 16 is not known from a 3-D structure yet, so in this study we address this issue to study the structure of E1-E2 protein from Human papillomavirus type 16 and to find its potential binding sites using biphenylsulfonacetic acid as inhibitor. Swiss model was used for 3D structure prediction and PDB: 2V9P (E1 protein) and 2NNU (E2 protein) having 52.32% and 100% identity respectively was selected as a template. The 3D model structure developed of E1 and E2 in the core and allowed regions were 99.2% and 99.5%. The ligand binding sites were predicted using online server meta pocket 2.0 and MOE 2009.10 was used for docking. E1-and E2 protein of HPV-16 has three potential binding site that can interact with the inhibitors. The Docking biphenylsulfonacetic acid using these binding sites shows that ligand interact with the protein through hydrogen bonds on Lys 403, Arg 410, His 551 in the first pocket, on Tyr 32, Leu 99 in the second pocket, and Lys 558m Lys 517 in the third pocket.

  10. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  11. Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jin,R.; Clark, S.; Weeks, A.

    2005-01-01

    Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less

  12. Identification of the residues involved in stabilization of the semiquinone radical in the high-affinity ubiquinone binding site in cytochrome bo(3) from Escherichia coli by site-directed mutagenesis and EPR spectroscopy.

    PubMed

    Hellwig, Petra; Yano, Takahiro; Ohnishi, Tomoko; Gennis, Robert B

    2002-08-27

    During turnover of cytochrome bo(3) from Escherichia coli, a semiquinone radical is stabilized in a high-affinity binding site. To identify binding partners of this radical, site-directed mutants have been designed on the basis of a recently modeled quinone binding site (Abramson et al., 2000). The R71H, H98F, D75H, and I102W mutant enzymes were found to show very little or no quinol oxidase activity. The thermodynamic and EPR spectroscopic properties of semiquinone radicals in these mutants were characterized. For the H98F and the R71H mutants, no EPR signal of the semiquinone radical was observed in the redox potential range from -100 to 250 mV. During potentiometric titration of the D75H mutant enzyme, a semiquinone signal was detected in the same potential range as that of the wild-type enzyme. However, the EPR spectrum of the D75H mutant lacks the characteristic hyperfine structure of the semiquinone radical signal observed in the wild-type oxidase, indicating that D75 or the introduced His, interacts with the semiquinone radical. For the I102W mutant, a free radical signal was observed with a redox midpoint potential downshifted by about 200 mV. On the basis of these observations, it is suggested that R71, D75, and H98 residues are involved in the stabilization of the semiquinone state in the high-affinity binding site. Details of the possible binding motif and mechanistic implications are discussed.

  13. Tacrine-based dual binding site acetylcholinesterase inhibitors as potential disease-modifying anti-Alzheimer drug candidates.

    PubMed

    Camps, Pelayo; Formosa, Xavier; Galdeano, Carles; Gómez, Tània; Muñoz-Torrero, Diego; Ramírez, Lorena; Viayna, Elisabet; Gómez, Elena; Isambert, Nicolás; Lavilla, Rodolfo; Badia, Albert; Clos, M Victòria; Bartolini, Manuela; Mancini, Francesca; Andrisano, Vincenza; Bidon-Chanal, Axel; Huertas, Oscar; Dafni, Thomai; Luque, F Javier

    2010-09-06

    Two novel families of dual binding site acetylcholinesterase (AChE) inhibitors have been developed, consisting of a tacrine or 6-chlorotacrine unit as the active site interacting moiety, either the 5,6-dimethoxy-2-[(4-piperidinyl)methyl]-1-indanone fragment of donepezil (or the indane derivative thereof) or a 5-phenylpyrano[3,2-c]quinoline system, reminiscent to the tryciclic core of propidium, as the peripheral site interacting unit, and a linker of suitable length as to allow the simultaneous binding at both sites. These hybrid compounds are all potent and selective inhibitors of human AChE, and more interestingly, are able to interfere in vitro both formation and aggregation of the beta-amyloid peptide, the latter effects endowing these compounds with the potential to modify Alzheimer's disease progression. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Insulator function and topological domain border strength scale with architectural protein occupancy

    PubMed Central

    2014-01-01

    Background Chromosome conformation capture studies suggest that eukaryotic genomes are organized into structures called topologically associating domains. The borders of these domains are highly enriched for architectural proteins with characterized roles in insulator function. However, a majority of architectural protein binding sites localize within topological domains, suggesting sites associated with domain borders represent a functionally different subclass of these regulatory elements. How topologically associating domains are established and what differentiates border-associated from non-border architectural protein binding sites remain unanswered questions. Results By mapping the genome-wide target sites for several Drosophila architectural proteins, including previously uncharacterized profiles for TFIIIC and SMC-containing condensin complexes, we uncover an extensive pattern of colocalization in which architectural proteins establish dense clusters at the borders of topological domains. Reporter-based enhancer-blocking insulator activity as well as endogenous domain border strength scale with the occupancy level of architectural protein binding sites, suggesting co-binding by architectural proteins underlies the functional potential of these loci. Analyses in mouse and human stem cells suggest that clustering of architectural proteins is a general feature of genome organization, and conserved architectural protein binding sites may underlie the tissue-invariant nature of topologically associating domains observed in mammals. Conclusions We identify a spectrum of architectural protein occupancy that scales with the topological structure of chromosomes and the regulatory potential of these elements. Whereas high occupancy architectural protein binding sites associate with robust partitioning of topologically associating domains and robust insulator function, low occupancy sites appear reserved for gene-specific regulation within topological domains. PMID:24981874

  15. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  16. Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.

    PubMed

    Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V

    1998-05-26

    To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.

  17. Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

    NASA Astrophysics Data System (ADS)

    Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

    1992-09-01

    Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

  18. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  19. Metallofullerenol Gd@C82(OH)22 distracts the proline-rich-motif from putative binding on the SH3 domain

    NASA Astrophysics Data System (ADS)

    Kang, Seung-Gu; Huynh, Tien; Zhou, Ruhong

    2013-03-01

    Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials.Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr33756a

  20. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  1. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  2. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  3. Recognition of functional sites in protein structures.

    PubMed

    Shulman-Peleg, Alexandra; Nussinov, Ruth; Wolfson, Haim J

    2004-06-04

    Recognition of regions on the surface of one protein, that are similar to a binding site of another is crucial for the prediction of molecular interactions and for functional classifications. We first describe a novel method, SiteEngine, that assumes no sequence or fold similarities and is able to recognize proteins that have similar binding sites and may perform similar functions. We achieve high efficiency and speed by introducing a low-resolution surface representation via chemically important surface points, by hashing triangles of physico-chemical properties and by application of hierarchical scoring schemes for a thorough exploration of global and local similarities. We proceed to rigorously apply this method to functional site recognition in three possible ways: first, we search a given functional site on a large set of complete protein structures. Second, a potential functional site on a protein of interest is compared with known binding sites, to recognize similar features. Third, a complete protein structure is searched for the presence of an a priori unknown functional site, similar to known sites. Our method is robust and efficient enough to allow computationally demanding applications such as the first and the third. From the biological standpoint, the first application may identify secondary binding sites of drugs that may lead to side-effects. The third application finds new potential sites on the protein that may provide targets for drug design. Each of the three applications may aid in assigning a function and in classification of binding patterns. We highlight the advantages and disadvantages of each type of search, provide examples of large-scale searches of the entire Protein Data Base and make functional predictions.

  4. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  6. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  7. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  8. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  9. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  10. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  11. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

    PubMed

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

  12. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations

    PubMed Central

    Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère

    1998-01-01

    To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896

  14. Cryptic binding sites on proteins: definition, detection, and druggability.

    PubMed

    Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

    2018-05-22

    Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Tetrazepam: a benzodiazepine which dissociates sedation from other benzodiazepine activities. II. In vitro and in vivo interactions with benzodiazepine binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keane, P.E.; Bachy, A.; Morre, M.

    1988-05-01

    Tetrazepam is a 1,4-benzodiazepine (BZD) derivative which, in rodents, appears to have very little sedative and ataxic effects. In an attempt to identify the molecular mechanisms underlying this particular pharmacological profile we examined the interaction of tetrazepam with BZD binding sites. Tetrazepam interacted competitively with central and peripheral BZD binding sites and exhibited comparable affinities for both sites. Tetrazepam was approximately one-seventh as potent as diazepam at the central receptor and as potent as diazepam at the peripheral binding site. Tetrazepam did not distinguish type I from type II central BZD receptors, as evidenced by comparable affinities for the cerebellarmore » and hippocampal receptors. In vitro autoradiographic studies showed that tetrazepam displaced (3H)flunitrazepam from rat brain membranes without any clear regional specificity. Like all BZD receptor agonists, tetrazepam exhibited a gamma-aminobutyric acid shift, a photoaffinity shift and potentiated the binding of 35S-t-butyl-bicyclophosphorothionate to rat brain membranes. However, the latter effect was observed at relatively high concentrations of tetrazepam. In vivo, tetrazepam displaced specifically bound (3H)flunitrazepam from mouse brain (ID50, 37 mg/kg p.o. vs 3.5 mg/kg p.o. for diazepam) and from mouse kidney (ID50, 38 mg/kg p.o. vs. 21 mg/kg p.o. for diazepam). It is concluded that tetrazepam is a BZD receptor agonist; the molecular mechanisms which underly the low sedative potential of the drug cannot at present be explained by a particular interaction with either central or peripheral BZD binding sites, but may be related to the drug's relatively weak effect on 35S-t-butyl-bicyclophosphorothionate binding.« less

  16. Dopamine Transporter-Dependent and -Independent Striatal Binding of the Benztropine Analog JHW 007, a Cocaine Antagonist with Low Abuse Liability

    PubMed Central

    Kopajtic, Theresa A.; Liu, Yi; Surratt, Christopher K.; Donovan, David M.; Newman, Amy H.; Katz, Jonathan L.

    2010-01-01

    The benztropine analog N-(n-butyl)-3α-[bis(4′-fluorophenyl)methoxy]-tropane (JHW 007) displays high affinity for the dopamine transporter (DAT), but unlike typical DAT ligands, has relatively low abuse liability and blocks the effects of cocaine, including its self-administration. To determine sites responsible for the cocaine antagonist effects of JHW 007, its in vitro binding was compared with that of methyl (1R,2S,3S,5S)-3-(4-fluorophenyl)-8-methyl-8-azabicyclo[3.2.1]octane-2-carboxylate (WIN 35428) in rats, mice, and human DAT (hDAT)-transfected cells. A one-site model, with Kd values of 4.21 (rat) and 8.99 nM (mouse) best fit the [3H]WIN 35428 data. [3H]JHW 007 binding best fit a two-site model (rat, 7.40/4400 nM; mouse, 8.18/2750 nM), although a one-site fit was observed with hDAT membranes (43.7 nM). Drugs selective for the norepinephrine and serotonin transporters had relatively low affinity in competition with [3H]JHW 007 binding, as did drugs selective for other sites identified previously as potential JHW 007 binding sites. The association of [3H]WIN 35428 best fit a one-phase model, whereas the association of [3H]JHW 007 best fit a two-phase model in all tissues. Because cocaine antagonist effects of JHW 007 have been observed previously soon after injection, its rapid association observed here may contribute to those effects. Multiple [3H]JHW 007 binding sites were obtained in tissue from mice lacking the DAT, suggesting these as yet unidentified sites as potential contributors to the cocaine antagonist effects of JHW 007. Unlike WIN 35428, the binding of JHW 007 was Na+-independent. This feature of JHW 007 has been linked to the conformational status of the DAT, which in turn may contribute to the antagonism of cocaine. PMID:20855444

  17. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  18. Discovery of HDAC Inhibitors That Lack an Active Site Zn(2+)-Binding Functional Group.

    PubMed

    Vickers, Chris J; Olsen, Christian A; Leman, Luke J; Ghadiri, M Reza

    2012-06-14

    Natural and synthetic histone deacetylase (HDAC) inhibitors generally derive their strong binding affinity and high potency from a key functional group that binds to the Zn(2+) ion within the enzyme active site. However, this feature is also thought to carry the potential liability of undesirable off-target interactions with other metalloenzymes. As a step toward mitigating this issue, here, we describe the design, synthesis, and structure-activity characterizations of cyclic α3β-tetrapeptide HDAC inhibitors that lack the presumed indispensable Zn(2+)-binding group. The lead compounds (e.g., 15 and 26) display good potency against class 1 HDACs and are active in tissue culture against various human cancer cell lines. Importantly, enzymological analysis of 26 indicates that the cyclic α3β-tetrapeptide is a fast-on/off competitive inhibitor of HDACs 1-3 with K i values of 49, 33, and 37 nM, respectively. Our proof of principle study supports the idea that novel classes of HDAC inhibitors, which interact at the active-site opening, but not with the active site Zn(2+), can have potential in drug design.

  19. Stigmatellin Probes the Electrostatic Potential in the QB Site of the Photosynthetic Reaction Center

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gerencsér, László; Boros, Bogáta; Derrien, Valerie

    2015-01-01

    The electrostatic potential in the secondary quinone (QB) binding site of the reaction center (RC) of the photosynthetic bacterium Rhodobacter sphaeroides determines the rate and free energy change (driving force) of electron transfer to QB. It is controlled by the ionization states of residues in a strongly interacting cluster around the QB site. Reduction of the QB induces change of the ionization states of residues and binding of protons from the bulk. Stigmatellin, an inhibitor of the mitochondrial and photosynthetic respiratory chain, has been proven to be a unique voltage probe of the QB binding pocket. It binds to themore » QB site with high affinity, and the pK value of its phenolic group monitors the local electrostatic potential with high sensitivity. Investigations with different types of detergent as a model system of isolated RC revealed that the pK of stigmatellin was controlled overwhelmingly by electrostatic and slightly by hydrophobic interactions. Measurements showed a high pK value (>11) of stigmatellin in the QB pocket of the dark-state wild-type RC, indicating substantial negative potential. When the local electrostatics of the QB site was modulated by a single mutation, L213Asp/Ala, or double mutations, L213Asp-L212Glu/Ala-Ala (AA), the pK of stigmatellin dropped to 7.5 and 7.4, respectively, which corresponds to a >210 mV increase in the electrostatic potential relative to the wild-type RC. This significant pK drop (DpK > 3.5) decreased dramatically to (DpK > 0.75) in the RC of the compensatory mutant (AAþM44Asn/AAþM44Asp). Our results indicate that the L213Asp is the most important actor in the control of the electrostatic potential in the QB site of the dark-state wild-type RC, in good accordance with conclusions of former studies using theoretical calculations or light-induced charge recombination assay.« less

  20. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Relationship between Hot Spot Residues and Ligand Binding Hot Spots in Protein-Protein Interfaces

    PubMed Central

    Zerbe, Brandon S.; Hall, David R.

    2013-01-01

    In the context of protein-protein interactions, the term “hot spot” refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening. PMID:22770357

  2. Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces.

    PubMed

    Zerbe, Brandon S; Hall, David R; Vajda, Sandor; Whitty, Adrian; Kozakov, Dima

    2012-08-27

    In the context of protein-protein interactions, the term "hot spot" refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research, a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening.

  3. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  4. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    PubMed

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  5. Binding modes of environmental endocrine disruptors to human serum albumin: insights from STD-NMR, ITC, spectroscopic and molecular docking studies.

    PubMed

    Yang, Hongqin; Huang, Yanmei; Liu, Jiuyang; Tang, Peixiao; Sun, Qiaomei; Xiong, Xinnuo; Tang, Bin; He, Jiawei; Li, Hui

    2017-09-11

    Given that bisphenols have an endocrine-disrupting effect on human bodies, thoroughly exposing their potential effects at the molecular level is important. Saturation transfer difference (STD) NMR-based binding studies were performed to investigate the binding potential of two bisphenol representatives, namely, bisphenol B (BPB) and bisphenol E (BPE), toward human serum albumin (HSA). The relative STD (%) suggested that BPB and BPE show similar binding modes and orientations, in which the phenolic rings were spatially close to HSA binding site. ITC analysis results showed that BPB and BPE were bound to HSA with moderately strong binding affinity through electrostatic interactions and hydrogen bonds. The order of binding affinity of HSA for two test bisphenols is as follows: BPE > BPB. The results of fluorescence competitive experiments using 5-dimethylaminonaphthalene-1-sulfonamide and dansylsarcosine as competitors, combined with molecular docking indicated that both bisphenols are prone to attach to the binding site II in HSA. Spectroscopic results (FT-IR, CD, synchronous and 3D fluorescence spectra) showed that BPB/BPE induces different degrees of microenvironmental and conformational changes to HSA.

  6. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Molecular Insights into the Potential Toxicological Interaction of 2-Mercaptothiazoline with the Antioxidant Enzyme—Catalase

    PubMed Central

    Huang, Zhenxing; Huang, Ming; Mi, Chenyu; Wang, Tao; Chen, Dong; Teng, Yue

    2016-01-01

    2-mercaptothiazoline (2-MT) is widely used in many industrial fields, but its residue is potentially harmful to the environment. In this study, to evaluate the biological toxicity of 2-MT at protein level, the interaction between 2-MT and the pivotal antioxidant enzyme—catalase (CAT) was investigated using multiple spectroscopic techniques and molecular modeling. The results indicated that the CAT fluorescence quenching caused by 2-MT should be dominated by a static quenching mechanism through formation of a 2-MT/CAT complex. Furthermore, the identifications of the binding constant, binding forces, and the number of binding sites demonstrated that 2-MT could spontaneously interact with CAT at one binding site mainly via Van der Waals’ forces and hydrogen bonding. Based on the molecular docking simulation and conformation dynamic characterization, it was found that 2-MT could bind into the junctional region of CAT subdomains and that the binding site was close to enzyme active sites, which induced secondary structural and micro-environmental changes in CAT. The experiments on 2-MT toxicity verified that 2-MT significantly inhibited CAT activity via its molecular interaction, where 2-MT concentration and exposure time both affected the inhibitory action. Therefore, the present investigation provides useful information for understanding the toxicological mechanism of 2-MT at the molecular level. PMID:27537873

  8. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  9. Ion Selectivity in the KcsA Potassium Channel from the Perspective of the Ion Binding Site

    PubMed Central

    Dixit, Purushottam D.; Merchant, Safir; Asthagiri, D.

    2009-01-01

    To understand the thermodynamic exclusion of Na+ relative to K+ from the S2 site of the selectivity filter, the distribution PX(ɛ) (X = K+ or Na+) of the binding energy (ɛ) of the ion with the channel is analyzed using the potential distribution theorem. By expressing the excess chemical potential of the ion as a sum of mean-field 〈ɛ〉 and fluctuation μexflux,X contributions, we find that selectivity arises from a higher value of μflux,Na+ex relative to μflux,K+ex. To understand the role of site-site interactions on μexflux,X, we decompose PX(ɛ) into n-dependent distributions, where n is the number of ion-coordinating ligands within a distance λ from the ion. For λ comparable to typical ion-oxygen bond distances, investigations building on this multistate model reveal an inverse correlation between favorable ion-site and site-site interactions: the ion-coordination states that most influence the thermodynamics of the ion are also those for which the binding site is energetically less strained and vice versa. This correlation motivates understanding entropic effects in ion binding to the site and leads to the finding that μexflux,X is directly proportional to the average site-site interaction energy, a quantity that is sensitive to the chemical type of the ligand coordinating the ion. Increasing the coordination number around Na+ only partially accounts for the observed magnitude of selectivity; acknowledging the chemical type of the ion-coordinating ligand is essential. PMID:19289040

  10. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  11. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  12. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  13. Structural analysis of peptides that fill sites near the active center of the two different enzyme molecules by artificial intelligence and computer simulations

    NASA Astrophysics Data System (ADS)

    Nishiyama, Katsuhiko

    2018-05-01

    Using artificial intelligence, the binding styles of 167 tetrapeptides were predicted in the active site of papain and cathepsin K. Five tetrapeptides (Asn-Leu-Lys-Trp, Asp-Gln-Trp-Gly, Cys-Gln-Leu-Arg, Gln-Leu-Trp-Thr and Arg-Ser-Glu-Arg) were found to bind sites near the active center of both papain and cathepsin K. These five tetrapeptides have the potential to also bind sites of other cysteine proteases, and structural characteristics of these tetrapeptides should aid the design of a common inhibitor of cysteine proteases. Smart application of artificial intelligence should accelerate data mining of important complex systems.

  14. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  16. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  17. In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

    PubMed Central

    Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

    2016-01-01

    Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

  18. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  19. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  20. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  1. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  2. Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

    PubMed

    Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

    2015-06-09

    The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

  3. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  4. Two reaction pathways for transformation of high potential cytochrome b559 of PS II into the intermediate potential form.

    PubMed

    Kaminskaya, Olga; Shuvalov, Vladimir A; Renger, Gernot

    2007-06-01

    This study describes an analysis of different treatments that influence the relative content and the midpoint potential of HP Cyt b559 in PS II membrane fragments from higher plants. Two basically different types of irreversible modification effects are distinguished: the HP form of Cyt b559 is either predominantly affected when the heme group is oxidized ("O-type" effects) or when it is reduced ("R-type" effects). Transformation of HP Cyt b559 to lower potential redox forms (IP and LP forms) by the "O-type" mechanism is induced by high pH and detergent treatments. In this case the effects consist of a gradual decrease in the relative content of HP Cyt b559 while its midpoint potential remains unaffected. Transformation of HP Cyt b559 via an "R-type" mechanism is caused by a number of exogenous compounds denoted L: herbicides, ADRY reagents and tetraphenylboron. These compounds are postulated to bind to the PS II complex at a quinone binding site designated as Q(C) which interacts with Cyt b559 and is clearly not the Q(B) site. Binding of compounds L to the Q(C) site when HP Cyt b559 is oxidized gives rise to a gradual decrease in the E(m) of HP Cyt b559 with increasing concentration of L (up to 10 K(ox)(L) values) while the relative content of HP Cyt b559 is unaffected. Higher concentrations of compounds L required for their binding to Q(C) site when HP Cyt b559 is reduced (described by K(red)(L)) induce a conversion of HP Cyt b559 to lower potential redox forms ("R-type" transformation). Two reaction pathways for transitions of Cyt b559 between the different protein conformations that are responsible for the HP and IP/LP redox forms are proposed and new insights into the functional regulation of Cyt b559 via the Q(C) site are discussed.

  5. [Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Binding of L-[3H]glutamate to synaptic membranes of the rat cerebral cortex].

    PubMed

    Dambinova, S A; Gorodinskiĭ, A I

    1984-01-01

    The binding of L-[3H]glutamate to rat cerebral cortex synaptic membranes was investigated. Two types of binding sites, a Na+-independent (Kd = 140-160 nm; Bmax = 3.8-4.5 pmol-mg of protein) and a Na+-dependent (Kd = 2.0 microM; Bmax = 45-50 pmol/mg of protein) ones, were detected. The dependence of Na+-insensitive binding on time and temperature and membrane content in a sample was determined. Mono- and divalent cations (5-10 mM) potentiated specific binding by 2.1-3.3 times. The Na+-dependent binding is associated with active transport systems, while the Na+-independent one-with true receptor binding. The relationship between CNS glutamate receptors and Na+-independent binding sites is discussed.

  6. Effect of H2 binding on the nonadiabatic transition probability between singlet and triplet states of the [NiFe]-hydrogenase active site.

    PubMed

    Kaliakin, Danil S; Zaari, Ryan R; Varganov, Sergey A

    2015-02-12

    We investigate the effect of H2 binding on the spin-forbidden nonadiabatic transition probability between the lowest energy singlet and triplet electronic states of [NiFe]-hydrogenase active site model, using a velocity averaged Landau-Zener theory. Density functional and multireference perturbation theories were used to provide parameters for the Landau-Zener calculations. It was found that variation of the torsion angle between the terminal thiolate ligands around the Ni center induces an intersystem crossing between the lowest energy singlet and triplet electronic states in the bare active site and in the active site with bound H2. Potential energy curves between the singlet and triplet minima along the torsion angle and H2 binding energies to the two spin states were calculated. Upon H2 binding to the active site, there is a decrease in the torsion angle at the minimum energy crossing point between the singlet and triplet states. The probability of nonadiabatic transitions at temperatures between 270 and 370 K ranges from 35% to 32% for the active site with bound H2 and from 42% to 38% for the bare active site, thus indicating the importance of spin-forbidden nonadiabatic pathways for H2 binding on the [NiFe]-hydrogenase active site.

  7. Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1

    PubMed Central

    Malina, Jaroslav; Scott, Peter; Brabec, Viktor

    2015-01-01

    Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo–helical ‘flexicate’ complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3]4+ incorporating the common NN–NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo–helical complexes for cancer chemotherapy. PMID:25940617

  8. Inhibition of ferric ion to oxalate oxidase shed light on the substrate binding site.

    PubMed

    Pang, Yu; Lan, Wanjun; Huang, Xuelei; Zuo, Guanke; Liu, Hui; Zhang, Jingyan

    2015-10-01

    Oxalate oxidase (OxOx), a well known enzyme catalyzes the cleavage of oxalate to carbon dioxide with reduction of dioxygen to hydrogen peroxide, however its catalytic process is not well understood. To define the substrate binding site, interaction of Fe(3+) ions with OxOx was systemically investigated using biochemical method, circular dichrosim spectroscopy, microscale thermophoresis, and computer modeling. We demonstrated that Fe(3+) is a non-competitive inhibitor with a milder binding affinity to OxOx, and the secondary structure of the OxOx was slightly altered upon its binding. On the basis of the structural properties of the OxOx and its interaction with Fe(3+) ions, two residue clusters of OxOx were assigned as potential Fe(3+) binding sites, the mechanism of the inhibition of Fe(3+) was delineated. Importantly, the residues that interact with Fe(3+) ions are involved in the substrate orienting based on computer docking. Consequently, the interaction of OxOx with Fe(3+) highlights insight into substrate binding site in OxOx.

  9. Novel bis-(−)-nor-meptazinol derivatives act as dual binding site AChE inhibitors with metal-complexing property

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Wei; NPFPC Key Laboratory of Contraceptives and Devices, Shanghai Institute of Planned Parenthood Research, 2140 Xietu Road, Shanghai 200032; Li, Juan

    The strategy of dual binding site acetylcholinesterase (AChE) inhibition along with metal chelation may represent a promising direction for multi-targeted interventions in the pathophysiological processes of Alzheimer's disease (AD). In the present study, two derivatives (ZLA and ZLB) of a potent dual binding site AChE inhibitor bis-(−)-nor-meptazinol (bis-MEP) were designed and synthesized by introducing metal chelating pharmacophores into the middle chain of bis-MEP. They could inhibit human AChE activity with IC{sub 50} values of 9.63 μM (for ZLA) and 8.64 μM (for ZLB), and prevent AChE-induced amyloid-β (Aβ) aggregation with IC{sub 50} values of 49.1 μM (for ZLA) and 55.3more » μM (for ZLB). In parallel, molecular docking analysis showed that they are capable of interacting with both the catalytic and peripheral anionic sites of AChE. Furthermore, they exhibited abilities to complex metal ions such as Cu(II) and Zn(II), and inhibit Aβ aggregation triggered by these metals. Collectively, these results suggest that ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency, and may be potential leads of value for further study on disease-modifying treatment of AD. -- Highlights: ► Two novel bis-(−)-nor-meptazinol derivatives are designed and synthesized. ► ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency. ► They are potential leads for disease-modifying treatment of Alzheimer's disease.« less

  10. Two-step interrogation then recognition of DNA binding site by Integration Host Factor: an architectural DNA-bending protein.

    PubMed

    Velmurugu, Yogambigai; Vivas, Paula; Connolly, Mitchell; Kuznetsov, Serguei V; Rice, Phoebe A; Ansari, Anjum

    2018-02-28

    The dynamics and mechanism of how site-specific DNA-bending proteins initially interrogate potential binding sites prior to recognition have remained elusive for most systems. Here we present these dynamics for Integration Host factor (IHF), a nucleoid-associated architectural protein, using a μs-resolved T-jump approach. Our studies show two distinct DNA-bending steps during site recognition by IHF. While the faster (∼100 μs) step is unaffected by changes in DNA or protein sequence that alter affinity by >100-fold, the slower (1-10 ms) step is accelerated ∼5-fold when mismatches are introduced at DNA sites that are sharply kinked in the specific complex. The amplitudes of the fast phase increase when the specific complex is destabilized and decrease with increasing [salt], which increases specificity. Taken together, these results indicate that the fast phase is non-specific DNA bending while the slow phase, which responds only to changes in DNA flexibility at the kink sites, is specific DNA kinking during site recognition. Notably, the timescales for the fast phase overlap with one-dimensional diffusion times measured for several proteins on DNA, suggesting that these dynamics reflect partial DNA bending during interrogation of potential binding sites by IHF as it scans DNA.

  11. Iron depletion strategy for targeted cancer therapy: utilizing the dual roles of neutrophil gelatinase-associated lipocalin protein.

    PubMed

    Tang, Hsin-Chieh; Chang, Pei-Chun; Chen, Yu-Chian

    2016-01-01

    Decreasing iron uptake and increasing iron efflux may result in cell death by oxidative inactivation of vital enzymes. Applying the dual function of neutrophil gelatinase-associated lipocalin (NGAL) could achieve the goal of iron depletion in the cancer cells. Tyr106, Lys125 or Lys134 was the key binding site for NGAL protein to sequester iron-chelating siderophores. In this study, we employed all bioactive peptides in peptide databank to dock with the siderophore-binding sites of NGAL protein by virtual screening. In addition, we performed molecular dynamics (MD) simulation to observe the molecular character and structural variation of ligand-protein interaction. Glu-Glu-Lys-Glu (EEKE), Glu-Glu-Asp-Cys-Lys (EEDCK), and Gly-Glu-Glu-Cys-Asp (GEECD) were selected preliminarily by rigorous scoring functions for further investigation. GEECD was excluded due to higher binding total energy than the others. Moreover, we also excluded EEKE due to larger influence to the stability of binding residues by the information of root mean square fluctuation (RMSF) and principal component analysis (PCA). Thus, we suggested that EEDCK was the potential bioactive peptide which had been proved to inhibit malignant cells for targeted cancer therapy. Graphical Abstract Perspective drug design of occupying the siderophore-binding sites of NGAL outside the cell temporarily by a potential short peptide until NGAL enters into the cell, and releasing the siderophore-binding sites inside the cell.

  12. One Crystal, Two Temperatures: Cryocooling Penalties Alter Ligand Binding to Transient Protein Sites

    DOE PAGES

    Fischer, Marcus; Shoichet, Brian K.; Fraser, James S.

    2015-05-28

    Interrogating fragment libraries by X-ray crystallography is a powerful strategy for discovering allosteric ligands for protein targets. Cryocooling of crystals should theoretically increase the fraction of occupied binding sites and decrease radiation damage. However, it might also perturb protein conformations that can be accessed at room temperature. Using data from crystals measured consecutively at room temperature and at cryogenic temperature, we found that transient binding sites could be abolished at the cryogenic temperatures employed by standard approaches. Finally, changing the temperature at which the crystallographic data was collected could provide a deliberate perturbation to the equilibrium of protein conformations andmore » help to visualize hidden sites with great potential to allosterically modulate protein function.« less

  13. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  14. Design of Broad-Spectrum Inhibitors of Influenza A Virus M2 Proton Channels: A Molecular Modeling Approach.

    PubMed

    Klimochkin, Yuri N; Shiryaev, Vadim A; Petrov, Pavel V; Radchenko, Eugene V; Palyulin, Vladimir A; Zefirov, Nikolay S

    2016-01-01

    The influenza A virus M2 proton channel plays a critical role in its life cycle. However, known M2 inhibitors have lost their clinical efficacy due to the spread of resistant mutant channels. Thus, the search for broad-spectrum M2 channel inhibitors is of great importance. The goal of the present work was to develop a general approach supporting the design of ligands interacting with multiple labile targets and to propose on its basis the potential broad-spectrum inhibitors of the M2 proton channel. The dynamic dimer-of-dimers structures of the three primary M2 target variants, wild-type, S31N and V27A, were modeled by molecular dynamics and thoroughly analyzed in order to define the inhibitor binding sites. The potential inhibitor structures were identified by molecular docking and their binding was verified by molecular dynamics simulation. The binding sites of the M2 proton channel inhibitors were analyzed, a number of potential broad-spectrum inhibitors were identified and the binding modes and probable mechanisms of action of one promising compound were clarified. Using the molecular dynamics and molecular docking techniques, we have refined the dynamic dimer-ofdimers structures of the WT, S31N and V27A variants of the M2 proton channel of the influenza A virus, analyzed the inhibitor binding sites, identified a number of potential broad-spectrum inhibitor structures targeting them, and clarified the binding modes and probable mechanisms of action of one promising compound. The proposed approach is also suitable for the design of ligands interacting with other multiple labile targets.

  15. Site of anticonvulsant action on sodium channels: autoradiographic and electrophysiological studies in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Worley, P.F.; Baraban, J.M.

    1987-05-01

    The anticonvulsants phenytoin and carbamazepine interact allosterically with the batrachotoxin binding site of sodium channels. In the present study, we demonstrate an autoradiographic technique to localize the batrachotoxin binding site on sodium channels in rat brain using (/sup 3/H)batrachotoxinin-A 20-alpha-benzoate (BTX-B). Binding of (/sup 3/H)BTX-B to brain sections is dependent on potentiating allosteric interactions with scorpion venom and is displaced by BTX-B (Kd approximately 200 nM), aconitine, veratridine, and phenytoin with the same rank order of potencies as described in brain synaptosomes. The maximum number of (/sup 3/H)BTX-B binding sites in forebrain sections also agrees with biochemical determinations. Autoradiographic localizationsmore » indicate that (/sup 3/H)BTX-B binding sites are not restricted to cell bodies and axons but are present in synaptic zones throughout the brain. For example, a particularly dense concentration of these sites in the substantia nigra is associated with afferent terminals of the striatonigral projection. By contrast, myelinated structures possess much lower densities of binding sites. In addition, we present electrophysiological evidence that synaptic transmission, as opposed to axonal conduction, is preferentially sensitive to the action of aconitine and veratridine. Finally, the synaptic block produced by these sodium channel activators is inhibited by phenytoin and carbamazepine at therapeutic anticonvulsant concentrations.« less

  16. Exploration of gated ligand binding recognizes an allosteric site for blocking FABP4-protein interaction.

    PubMed

    Li, Yan; Li, Xiang; Dong, Zigang

    2015-12-28

    Fatty acid binding protein 4 (FABP4), reversibly binding to fatty acids and other lipids with high affinities, is a potential target for treatment of cancers. The binding site of FABP4 is buried in an interior cavity and thereby ligand binding/unbinding is coupled with opening/closing of FABP4. It is a difficult task both experimentally and computationally to illuminate the entry or exit pathway, especially with the conformational gating. In this report we combine extensive computer simulations, clustering analysis, and the Markov state model to investigate the binding mechanism of FABP4 and troglitazone. Our simulations capture spontaneous binding and unbinding events as well as the conformational transition of FABP4 between the open and closed states. An allosteric binding site on the protein surface is recognized for the development of novel FABP4 inhibitors. The binding affinity is calculated and compared with the experimental value. The kinetic analysis suggests that ligand residence on the protein surface may delay the binding process. Overall, our results provide a comprehensive picture of ligand diffusion on the protein surface, ligand migration into the buried cavity, and the conformational change of FABP4 at an atomic level.

  17. Synthesis of heteroaromatic tropeines and heterogeneous binding to glycine receptors.

    PubMed

    Maksay, Gábor; Vincze, Zoltán; Nemes, Péter

    2009-10-01

    Heteroaromatic carboxylic esters of (nor)tropine were synthesized. Tropine esters displaced [(3)H]strychnine binding to glycine receptors of rat spinal cord with low Hill slopes. Two-site displacement resulted in nanomolar IC(50,1) and micromolar IC(50,2) values, and IC(50,2)/IC(50,1) ratios up to 615 depending on the heteroaromatic rings and N-methyl substitution. Nortropeines displayed high affinity and low heterogeneity. IC(50,1) and IC(50,2) values of tropeines did not correlate suggesting different binding modes/sites. Glycine potentiated only the nanomolar displacement reflecting positive allosteric interactions and potentiation of ionophore function. Affinities of three (nor)tropeines were different for glycine receptors but identical for 5-HT(3) receptors.

  18. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-11-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  19. Computational investigation of cholesterol binding sites on mitochondrial VDAC.

    PubMed

    Weiser, Brian P; Salari, Reza; Eckenhoff, Roderic G; Brannigan, Grace

    2014-08-21

    The mitochondrial voltage-dependent anion channel (VDAC) allows passage of ions and metabolites across the mitochondrial outer membrane. Cholesterol binds mammalian VDAC, and we investigated the effects of binding to human VDAC1 with atomistic molecular dynamics simulations that totaled 1.4 μs. We docked cholesterol to specific sites on VDAC that were previously identified with NMR, and we tested the reliability of multiple docking results in each site with simulations. The most favorable binding modes were used to build a VDAC model with cholesterol occupying five unique sites, and during multiple 100 ns simulations, cholesterol stably and reproducibly remained bound to the protein. For comparison, VDAC was simulated in systems with identical components but with cholesterol initially unbound. The dynamics of loops that connect adjacent β-strands were most affected by bound cholesterol, with the averaged root-mean-square fluctuation (RMSF) of multiple residues altered by 20-30%. Cholesterol binding also stabilized charged residues inside the channel and localized the surrounding electrostatic potentials. Despite this, ion diffusion through the channel was not significantly affected by bound cholesterol, as evidenced by multi-ion potential of mean force measurements. Although we observed modest effects of cholesterol on the open channel, our model will be particularly useful in experiments that investigate how cholesterol affects VDAC function under applied electrochemical forces and also how other ligands and proteins interact with the channel.

  20. Computational Investigation of Cholesterol Binding Sites on Mitochondrial VDAC

    PubMed Central

    2015-01-01

    The mitochondrial voltage-dependent anion channel (VDAC) allows passage of ions and metabolites across the mitochondrial outer membrane. Cholesterol binds mammalian VDAC, and we investigated the effects of binding to human VDAC1 with atomistic molecular dynamics simulations that totaled 1.4 μs. We docked cholesterol to specific sites on VDAC that were previously identified with NMR, and we tested the reliability of multiple docking results in each site with simulations. The most favorable binding modes were used to build a VDAC model with cholesterol occupying five unique sites, and during multiple 100 ns simulations, cholesterol stably and reproducibly remained bound to the protein. For comparison, VDAC was simulated in systems with identical components but with cholesterol initially unbound. The dynamics of loops that connect adjacent β-strands were most affected by bound cholesterol, with the averaged root-mean-square fluctuation (RMSF) of multiple residues altered by 20–30%. Cholesterol binding also stabilized charged residues inside the channel and localized the surrounding electrostatic potentials. Despite this, ion diffusion through the channel was not significantly affected by bound cholesterol, as evidenced by multi-ion potential of mean force measurements. Although we observed modest effects of cholesterol on the open channel, our model will be particularly useful in experiments that investigate how cholesterol affects VDAC function under applied electrochemical forces and also how other ligands and proteins interact with the channel. PMID:25080204

  1. Small molecule correctors of F508del-CFTR discovered by structure-based virtual screening

    NASA Astrophysics Data System (ADS)

    Kalid, Ori; Mense, Martin; Fischman, Sharon; Shitrit, Alina; Bihler, Hermann; Ben-Zeev, Efrat; Schutz, Nili; Pedemonte, Nicoletta; Thomas, Philip J.; Bridges, Robert J.; Wetmore, Diana R.; Marantz, Yael; Senderowitz, Hanoch

    2010-12-01

    Folding correctors of F508del-CFTR were discovered by in silico structure-based screening utilizing homology models of CFTR. The intracellular segment of CFTR was modeled and three cavities were identified at inter-domain interfaces: (1) Interface between the two Nucleotide Binding Domains (NBDs); (2) Interface between NBD1 and Intracellular Loop (ICL) 4, in the region of the F508 deletion; (3) multi-domain interface between NBD1:2:ICL1:2:4. We hypothesized that compounds binding at these interfaces may improve the stability of the protein, potentially affecting the folding yield or surface stability. In silico structure-based screening was performed at the putative binding-sites and a total of 496 candidate compounds from all three sites were tested in functional assays. A total of 15 compounds, representing diverse chemotypes, were identified as F508del folding correctors. This corresponds to a 3% hit rate, tenfold higher than hit rates obtained in corresponding high-throughput screening campaigns. The same binding sites also yielded potentiators and, most notably, compounds with a dual corrector-potentiator activity (dual-acting). Compounds harboring both activity types may prove to be better leads for the development of CF therapeutics than either pure correctors or pure potentiators. To the best of our knowledge this is the first report of structure-based discovery of CFTR modulators.

  2. Biochemical and biophysical characterization of the selenium-binding and reducing site in Arabidopsis thaliana homologue to mammals selenium-binding protein 1.

    PubMed

    Schild, Florie; Kieffer-Jaquinod, Sylvie; Palencia, Andrés; Cobessi, David; Sarret, Géraldine; Zubieta, Chloé; Jourdain, Agnès; Dumas, Renaud; Forge, Vincent; Testemale, Denis; Bourguignon, Jacques; Hugouvieux, Véronique

    2014-11-14

    The function of selenium-binding protein 1 (SBP1), present in almost all organisms, has not yet been established. In mammals, SBP1 is known to bind the essential element selenium but the binding site has not been identified. In addition, the SBP family has numerous potential metal-binding sites that may play a role in detoxification pathways in plants. In Arabidopsis thaliana, AtSBP1 over-expression increases tolerance to two toxic compounds for plants, selenium and cadmium, often found as soil pollutants. For a better understanding of AtSBP1 function in detoxification mechanisms, we investigated the chelating properties of the protein toward different ligands with a focus on selenium using biochemical and biophysical techniques. Thermal shift assays together with inductively coupled plasma mass spectrometry revealed that AtSBP1 binds selenium after incubation with selenite (SeO3(2-)) with a ligand to protein molar ratio of 1:1. Isothermal titration calorimetry confirmed the 1:1 stoichiometry and revealed an unexpectedly large value of binding enthalpy suggesting a covalent bond between selenium and AtSBP1. Titration of reduced Cys residues and comparative mass spectrometry on AtSBP1 and the purified selenium-AtSBP1 complex identified Cys(21) and Cys(22) as being responsible for the binding of one selenium. These results were validated by site-directed mutagenesis. Selenium K-edge x-ray absorption near edge spectroscopy performed on the selenium-AtSBP1 complex demonstrated that AtSBP1 reduced SeO3(2-) to form a R-S-Se(II)-S-R-type complex. The capacity of AtSBP1 to bind different metals and selenium is discussed with respect to the potential function of AtSBP1 in detoxification mechanisms and selenium metabolism. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Biochemical and Biophysical Characterization of the Selenium-binding and Reducing Site in Arabidopsis thaliana Homologue to Mammals Selenium-binding Protein 1*

    PubMed Central

    Schild, Florie; Kieffer-Jaquinod, Sylvie; Palencia, Andrés; Cobessi, David; Sarret, Géraldine; Zubieta, Chloé; Jourdain, Agnès; Dumas, Renaud; Forge, Vincent; Testemale, Denis; Bourguignon, Jacques; Hugouvieux, Véronique

    2014-01-01

    The function of selenium-binding protein 1 (SBP1), present in almost all organisms, has not yet been established. In mammals, SBP1 is known to bind the essential element selenium but the binding site has not been identified. In addition, the SBP family has numerous potential metal-binding sites that may play a role in detoxification pathways in plants. In Arabidopsis thaliana, AtSBP1 over-expression increases tolerance to two toxic compounds for plants, selenium and cadmium, often found as soil pollutants. For a better understanding of AtSBP1 function in detoxification mechanisms, we investigated the chelating properties of the protein toward different ligands with a focus on selenium using biochemical and biophysical techniques. Thermal shift assays together with inductively coupled plasma mass spectrometry revealed that AtSBP1 binds selenium after incubation with selenite (SeO32−) with a ligand to protein molar ratio of 1:1. Isothermal titration calorimetry confirmed the 1:1 stoichiometry and revealed an unexpectedly large value of binding enthalpy suggesting a covalent bond between selenium and AtSBP1. Titration of reduced Cys residues and comparative mass spectrometry on AtSBP1 and the purified selenium-AtSBP1 complex identified Cys21 and Cys22 as being responsible for the binding of one selenium. These results were validated by site-directed mutagenesis. Selenium K-edge x-ray absorption near edge spectroscopy performed on the selenium-AtSBP1 complex demonstrated that AtSBP1 reduced SeO32− to form a R-S-Se(II)-S-R-type complex. The capacity of AtSBP1 to bind different metals and selenium is discussed with respect to the potential function of AtSBP1 in detoxification mechanisms and selenium metabolism. PMID:25274629

  4. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  5. Positive and Negative Allosteric Modulation of an α1β3γ2 γ-Aminobutyric Acid Type A (GABAA) Receptor by Binding to a Site in the Transmembrane Domain at the γ+-β− Interface*

    PubMed Central

    Jayakar, Selwyn S.; Zhou, Xiaojuan; Savechenkov, Pavel Y.; Chiara, David C.; Desai, Rooma; Bruzik, Karol S.; Miller, Keith W.; Cohen, Jonathan B.

    2015-01-01

    In the process of developing safer general anesthetics, isomers of anesthetic ethers and barbiturates have been discovered that act as convulsants and inhibitors of γ-aminobutyric acid type A receptors (GABAARs) rather than potentiators. It is unknown whether these convulsants act as negative allosteric modulators by binding to the intersubunit anesthetic-binding sites in the GABAAR transmembrane domain (Chiara, D. C., Jayakar, S. S., Zhou, X., Zhang, X., Savechenkov, P. Y., Bruzik, K. S., Miller, K. W., and Cohen, J. B. (2013) J. Biol. Chem. 288, 19343–19357) or to known convulsant sites in the ion channel or extracellular domains. Here, we show that S-1-methyl-5-propyl-5-(m-trifluoromethyl-diazirynylphenyl) barbituric acid (S-mTFD-MPPB), a photoreactive analog of the convulsant barbiturate S-MPPB, inhibits α1β3γ2 but potentiates α1β3 GABAAR responses. In the α1β3γ2 GABAAR, S-mTFD-MPPB binds in the transmembrane domain with high affinity to the γ+-β− subunit interface site with negative energetic coupling to GABA binding in the extracellular domain at the β+-α− subunit interfaces. GABA inhibits S-[3H]mTFD-MPPB photolabeling of γ2Ser-280 (γM2–15′) in this site. In contrast, within the same site GABA enhances photolabeling of β3Met-227 in βM1 by an anesthetic barbiturate, R-[3H]methyl-5-allyl-5-(m-trifluoromethyl-diazirynylphenyl)barbituric acid (mTFD-MPAB), which differs from S-mTFD-MPPB in structure only by chirality and two hydrogens (propyl versus allyl). S-mTFD-MPPB and R-mTFD-MPAB are predicted to bind in different orientations at the γ+-β− site, based upon the distance in GABAAR homology models between γ2Ser-280 and β3Met-227. These results provide an explanation for S-mTFD-MPPB inhibition of α1β3γ2 GABAAR function and provide a first demonstration that an intersubunit-binding site in the GABAAR transmembrane domain binds negative and positive allosteric modulators. PMID:26229099

  6. Zinc binding in HDAC inhibitors: a DFT study.

    PubMed

    Wang, Difei; Helquist, Paul; Wiest, Olaf

    2007-07-06

    Histone deacetylases (HDACs) are attractive targets for the treatment of cancers and a variety of other diseases. Most currently studied HDAC inhibitors contain hydroxamic acids, which are potentially problematic in the development of practical drugs. DFT calculations of the binding modes and free energies of binding for a variety of other functionalities in a model active site of HDAC are described. The protonation state of hydroxamic acids in the active site and the origin of the high affinity are discussed. These results emphasize the importance of a carefully chosen pKa for zinc binding and provide guidance for the design of novel, non-hydroxamic acid HDAC inhibitors.

  7. Regulation of Hippocampal Glutamate Receptors: Evidence for the Involvement of a Calcium-Activated Protease

    NASA Astrophysics Data System (ADS)

    Baudry, Michel; Lynch, Gary

    1980-04-01

    Specific [3H]glutamate binding to rat hippocampal membranes and the calcium-induced increase in this binding are markedly temperature-sensitive and are inhibited by alkylating or reducing agents as well as by various protease inhibitors. N-Ethylmaleimide, chloromethyl ketone derivatives of lysine and phenylalanine, and tosylarginine methyl ester decrease the maximum number of [3H]glutamate binding sites without changing their affinity for glutamate. Preincubation of the membranes with glutamate does not protect the glutamate ``receptors'' from the suppressive effects of these agents. The proteases trypsin and α -chymotrypsin increase the maximum number of [3H]glutamate binding sites. The effects of calcium on glutamate binding are different across brain regions. Cerebellar membranes are almost insensitive whereas hippocampal and striatal membranes exhibit a strong increase in the number of binding sites after exposure to even low concentrations of calcium. These results suggest that an endogenous membrane-associated thiol protease regulates the number of [3H]glutamate binding sites in hippocampal membranes and that this is the mechanism by which calcium stimulates glutamate binding. The possibility is discussed that the postulated mechanisms participate in synaptic physiology and in particular may be related to the long-term potentiation of transmission found in hippocampus under certain conditions.

  8. Protein pharmacophore selection using hydration-site analysis

    PubMed Central

    Hu, Bingjie; Lill, Markus A.

    2012-01-01

    Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751

  9. Murine and human CFTR exhibit different sensitivities to CFTR potentiators

    PubMed Central

    Cui, Guiying

    2015-01-01

    Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as “Kalydeco.” Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by ∼13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators. PMID:26209275

  10. Predicting Displaceable Water Sites Using Mixed-Solvent Molecular Dynamics.

    PubMed

    Graham, Sarah E; Smith, Richard D; Carlson, Heather A

    2018-02-26

    Water molecules are an important factor in protein-ligand binding. Upon binding of a ligand with a protein's surface, waters can either be displaced by the ligand or may be conserved and possibly bridge interactions between the protein and ligand. Depending on the specific interactions made by the ligand, displacing waters can yield a gain in binding affinity. The extent to which binding affinity may increase is difficult to predict, as the favorable displacement of a water molecule is dependent on the site-specific interactions made by the water and the potential ligand. Several methods have been developed to predict the location of water sites on a protein's surface, but the majority of methods are not able to take into account both protein dynamics and the interactions made by specific functional groups. Mixed-solvent molecular dynamics (MixMD) is a cosolvent simulation technique that explicitly accounts for the interaction of both water and small molecule probes with a protein's surface, allowing for their direct competition. This method has previously been shown to identify both active and allosteric sites on a protein's surface. Using a test set of eight systems, we have developed a method using MixMD to identify conserved and displaceable water sites. Conserved sites can be determined by an occupancy-based metric to identify sites which are consistently occupied by water even in the presence of probe molecules. Conversely, displaceable water sites can be found by considering the sites which preferentially bind probe molecules. Furthermore, the inclusion of six probe types allows the MixMD method to predict which functional groups are capable of displacing which water sites. The MixMD method consistently identifies sites which are likely to be nondisplaceable and predicts the favorable displacement of water sites that are known to be displaced upon ligand binding.

  11. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria.

    PubMed

    Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong

    2017-01-24

    Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains poorly explored for the diversity of CcpA-mediated catabolite regulation. Here, we discovered a novel flexible CcpA-binding site architecture (cre var ) that is highly variable in both length and base composition but follows certain principles, providing new insights into how CcpA can differentially recognize a variety of target genes to form a complicated regulatory network. A comprehensive search further revealed the wide distribution of cre var sites in Gram-positive bacteria, indicating it may have a universal function. This finding is the first to characterize such a highly flexible transcription factor-binding site architecture, which would be valuable for deeper understanding of CcpA-mediated global catabolite regulation in bacteria. Copyright © 2017 Yang et al.

  12. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  13. Orthosteric and allosteric potentiation of heteromeric neuronal nicotinic acetylcholine receptors.

    PubMed

    Wang, Jingyi; Lindstrom, Jon

    2018-06-01

    Heteromeric nicotinic ACh receptors (nAChRs) were thought to have two orthodox agonist-binding sites at two α/β subunit interfaces. Highly selective ligands are hard to develop by targeting orthodox agonist sites because of high sequence similarity of this binding pocket among different subunits. Recently, unorthodox ACh-binding sites have been discovered at some α/α and β/α subunit interfaces, such as α4/α4, α5/α4 and β3/α4. Targeting unorthodox sites may yield subtype-selective ligands, such as those for (α4β2) 2 α5, (α4β2) 2 β3 and (α6β2) 2 β3 nAChRs. The unorthodox sites have unique pharmacology. Agonist binding at one unorthodox site is not sufficient to activate nAChRs, but it increases activation from the orthodox sites. NS9283, a selective agonist for the unorthodox α4/α4 site, was initially thought to be a positive allosteric modulator (PAM). NS9283 activates nAChRs with three engineered α4/α4 sites. PAMs, on the other hand, act at allosteric sites where ACh cannot bind. Known PAM sites include the ACh-homologous non-canonical site (e.g. morantel at β/α), the C-terminus (e.g. Br-PBTC and 17β-estradiol), a transmembrane domain (e.g. LY2087101) or extracellular and transmembrane domain interfaces (e.g. NS206). Some of these PAMs, such as Br-PBTC and 17β-estradiol, require only one subunit to potentiate activation of nAChRs. In this review, we will discuss differences between activation from orthosteric and allosteric sites, their selective ligands and clinical implications. These studies have advanced understanding of the structure, assembly and pharmacology of heteromeric neuronal nAChRs. This article is part of a themed section on Nicotinic Acetylcholine Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v175.11/issuetoc. © 2017 The British Pharmacological Society.

  14. Unbinding Pathways of an Agonist and an Antagonist from the 5-HT3 Receptor

    PubMed Central

    Thompson, A. J.; Chau, P.-L.; Chan, S. L.; Lummis, S. C. R.

    2006-01-01

    The binding sites of 5-HT3 and other Cys-loop receptors have been extensively studied, but there are no data on the entry and exit routes of ligands for these sites. Here we have used molecular dynamics simulations to predict the pathway for agonists and antagonists exiting from the 5-HT3 receptor binding site. The data suggest that the unbinding pathway follows a tunnel at the interface of two subunits, which is ∼8 Å long and terminates ∼20 Å above the membrane. The exit routes for an agonist (5-HT) and an antagonist (granisetron) were similar, with trajectories toward the membrane and outward from the ligand binding site. 5-HT appears to form many hydrogen bonds with residues in the unbinding pathway, and experiments show that mutating these residues significantly affects function. The location of the pathway is also supported by docking studies of granisetron, which show a potential binding site for granisetron on the unbinding route. We propose that leaving the binding pocket along this tunnel places the ligands close to the membrane and prevents their immediate reentry into the binding pocket. We anticipate similar exit pathways for other members of the Cys-loop receptor family. PMID:16387779

  15. Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1.

    PubMed

    Malina, Jaroslav; Scott, Peter; Brabec, Viktor

    2015-06-23

    Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo-helical 'flexicate' complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3](4+) incorporating the common NN-NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo-helical complexes for cancer chemotherapy. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

    PubMed

    Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

    2011-12-23

    Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

  17. Identification and characterization of the sodium-binding site of activated protein C.

    PubMed

    He, X; Rezaie, A R

    1999-02-19

    Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.

  18. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  19. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

  20. Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

    PubMed Central

    Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

    2010-01-01

    The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

  1. Studies of the mechanism of selectivity of protein tyrosine phosphatase 1B (PTP1B) bidentate inhibitors using molecular dynamics simulations and free energy calculations.

    PubMed

    Fang, Lei; Zhang, Huai; Cui, Wei; Ji, Mingjun

    2008-10-01

    Bidentate inhibitors of protein tyrosine phosphatase 1B (PTP1B) are considered as a group of ideal inhibitors with high binding potential and high selectivity in treating type II diabetes. In this paper, the binding models of five bidentate inhibitors to PTP1B, TCPTP, and SHP-2 were investigated and compared by using molecular dynamics (MD) simulations and free energy calculations. The binding free energies were computed using the Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) methodology. The calculation results show that the predicted free energies of the complexes are well consistent with the experimental data. The Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) free energy decomposition analysis indicates that the residues ARG24, ARG254, and GLN262 in the second binding site of PTP1B are essential for the high selectivity of inhibitors. Furthermore, the residue PHE182 close to the active site is also important for the selectivity and the binding affinity of the inhibitors. According to our analysis, it can be concluded that in most cases the polarity of the portion of the inhibitor that binds to the second binding site of the protein is positive to the affinity of the inhibitors while negative to the selectivity of the inhibitors. We expect that the information we obtained here can help to develop potential PTP1B inhibitors with more promising specificity.

  2. Lactose-containing starburst dendrimers: influence of dendrimer generation and binding-site orientation of receptors (plant/animal lectins and immunoglobulins) on binding properties.

    PubMed

    André, S; Ortega, P J; Perez, M A; Roy, R; Gabius, H J

    1999-11-01

    Starburst glycodendrimers offer the potential to serve as high-affinity ligands for clinically relevant sugar receptors. In order to define areas of application, their binding behavior towards sugar receptors with differential binding-site orientation but identical monosaccharide specificity must be evaluated. Using poly(amidoamine) starburst dendrimers of five generations, which contain the p-isothiocyanato derivative of p-aminophenyl-beta-D-lactoside as ligand group, four different types of galactoside-binding proteins were chosen for this purpose, i.e., the (AB)(2)-toxic agglutinin from mistletoe, a human immunoglobulin G fraction, the homodimeric galectin-1 with its two binding sites at opposite ends of the jelly-roll-motif-harboring protein and monomeric galectin-3. Direct solid-phase assays with surface-immobilized glycodendrimers resulted in obvious affinity enhancements by progressive core branching for the plant agglutinin and less pronounced for the antibody and galectin-1. High density of binding of galectin-3 with modest affinity increases only from the level of the 32-mer onwards points to favorable protein-protein interactions of the monomeric lectin and a spherical display of the end groups without a major share of backfolding. When the inhibitory potency of these probes was evaluated as competitor of receptor binding to an immobilized neoglycoprotein or to asialofetuin, a marked selectivity was detected. The 32- and 64-mers were second to none as inhibitors for the plant agglutinin against both ligand-exposing matrices and for galectin-1 on the matrix with a heterogeneous array of interglycoside distances even on the per-sugar basis. In contrast, a neoglycoprotein with the same end group was superior in the case of the antibody and, less pronounced, monomeric galectin-3. Intimate details of topological binding-site presentation and the ligand display on different generations of core assembly are major operative factors which determine the potential of dendrimers for applications as lectin-targeting device, as attested by these observations.

  3. Models of metal binding structures in fulvic acid from the Suwannee River, Georgia

    USGS Publications Warehouse

    Leenheer, J.A.; Brown, G.K.; MacCarthy, P.; Cabaniss, S.E.

    1998-01-01

    Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The 'metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-1R spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short- chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The `metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-IR spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.

  4. Insights into the Binding Sites of Organometallic Ruthenium Anticancer Compounds on Peptides Using Ultra-High Resolution Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Wills, Rebecca H.; Habtemariam, Abraha; Lopez-Clavijo, Andrea F.; Barrow, Mark P.; Sadler, Peter J.; O'Connor, Peter B.

    2014-04-01

    The binding sites of two ruthenium(II) organometallic complexes of the form [(η6-arene)Ru( N, N)Cl]+, where arene/ N, N = biphenyl (bip)/bipyridine (bipy) for complex AH076, and biphenyl (bip)/ o-phenylenediamine ( o-pda) for complex AH078, on the peptides angiotensin and bombesin have been investigated using Fourier transform ion cyclotron resonance (FTICR) mass spectrometry. Fragmentation was performed using collisionally activated dissociation (CAD), with, in some cases, additional data being provided by electron capture dissociation (ECD). The primary binding sites were identified as methionine and histidine, with further coordination to phenylalanine, potentially through a π-stacking interaction, which has been observed here for the first time. This initial peptide study was expanded to investigate protein binding through reaction with insulin, on which the binding sites proposed are histidine, glutamic acid, and tyrosine. Further reaction of the ruthenium complexes with the oxidized B chain of insulin, in which two cysteine residues are oxidized to cysteine sulfonic acid (Cys-SO3H), and glutathione, which had been oxidized with hydrogen peroxide to convert the cysteine to cysteine sulfonic acid, provided further support for histidine and glutamic acid binding, respectively.

  5. Characterization of angiotensin-binding sites in the bovine adrenal and the rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogulja, I.

    1989-01-01

    The first study was designed to determine whether systemically administered MSG affects neurons in the CVOs that are potentially important in mediating angiotensin-dependent responses. Rats were pretreated with MSG and the receptors for angiotensin II were assayed by radioligand binding in brain homogenates from the septum anteroventral third ventricular region (AV3V) and the thalamus/hypothalamus region using {sup 125}I-angiotensin II as the radioligand. The results of this experiment indicate that systematically administered MSG in the rat significantly reduced the number (Bmax) of Ang II receptors in a tissue sample which contained both extra blood-brain barrier organs as well as tissue withinmore » the blood-brain barrier with no change in the affinity (Kd) of the binding sites. The second chapter reports the successful solubilization of bovine adrenal {sup 125}I Ang II and {sup 125}I Sar{sup 1},Ile{sup 8}-Ang II binding sites with the detergent CHAPS. The results of our studies indicate the presence of two angiotensin binding sites. The one site is specific for naturally occurring angiotensins as well as sarcosine-1 substituted angiotensin analogues. The other site which can be optimally stabilized be re-addition of 0.3% CHAPS into the incubation assay binds sarcosine-1 substituted angiotensins exclusively. Hydrophobic interaction chromatography experiments suggest that these sites, possibly, represent distinct proteins. The third chapter discusses the successful solubilization and partial characterization of the rat brain angiotensin receptor.« less

  6. Elucidating the druggable interface of protein-protein interactions using fragment docking and coevolutionary analysis.

    PubMed

    Bai, Fang; Morcos, Faruck; Cheng, Ryan R; Jiang, Hualiang; Onuchic, José N

    2016-12-13

    Protein-protein interactions play a central role in cellular function. Improving the understanding of complex formation has many practical applications, including the rational design of new therapeutic agents and the mechanisms governing signal transduction networks. The generally large, flat, and relatively featureless binding sites of protein complexes pose many challenges for drug design. Fragment docking and direct coupling analysis are used in an integrated computational method to estimate druggable protein-protein interfaces. (i) This method explores the binding of fragment-sized molecular probes on the protein surface using a molecular docking-based screen. (ii) The energetically favorable binding sites of the probes, called hot spots, are spatially clustered to map out candidate binding sites on the protein surface. (iii) A coevolution-based interface interaction score is used to discriminate between different candidate binding sites, yielding potential interfacial targets for therapeutic drug design. This approach is validated for important, well-studied disease-related proteins with known pharmaceutical targets, and also identifies targets that have yet to be studied. Moreover, therapeutic agents are proposed by chemically connecting the fragments that are strongly bound to the hot spots.

  7. SPACER: server for predicting allosteric communication and effects of regulation

    PubMed Central

    Goncearenco, Alexander; Mitternacht, Simon; Yong, Taipang; Eisenhaber, Birgit; Eisenhaber, Frank; Berezovsky, Igor N.

    2013-01-01

    The SPACER server provides an interactive framework for exploring allosteric communication in proteins with different sizes, degrees of oligomerization and function. SPACER uses recently developed theoretical concepts based on the thermodynamic view of allostery. It proposes easily tractable and meaningful measures that allow users to analyze the effect of ligand binding on the intrinsic protein dynamics. The server shows potential allosteric sites and allows users to explore communication between the regulatory and functional sites. It is possible to explore, for instance, potential effector binding sites in a given structure as targets for allosteric drugs. As input, the server only requires a single structure. The server is freely available at http://allostery.bii.a-star.edu.sg/. PMID:23737445

  8. SVM prediction of ligand-binding sites in bacterial lipoproteins employing shape and physio-chemical descriptors.

    PubMed

    Kadam, Kiran; Prabhakar, Prashant; Jayaraman, V K

    2012-11-01

    Bacterial lipoproteins play critical roles in various physiological processes including the maintenance of pathogenicity and numbers of them are being considered as potential candidates for generating novel vaccines. In this work, we put forth an algorithm to identify and predict ligand-binding sites in bacterial lipoproteins. The method uses three types of pocket descriptors, namely fpocket descriptors, 3D Zernike descriptors and shell descriptors, and combines them with Support Vector Machine (SVM) method for the classification. The three types of descriptors represent shape-based properties of the pocket as well as its local physio-chemical features. All three types of descriptors, along with their hybrid combinations are evaluated with SVM and to improve classification performance, WEKA-InfoGain feature selection is applied. Results obtained in the study show that the classifier successfully differentiates between ligand-binding and non-binding pockets. For the combination of three types of descriptors, 10 fold cross-validation accuracy of 86.83% is obtained for training while the selected model achieved test Matthews Correlation Coefficient (MCC) of 0.534. Individually or in combination with new and existing methods, our model can be a very useful tool for the prediction of potential ligand-binding sites in bacterial lipoproteins.

  9. eF-seek: prediction of the functional sites of proteins by searching for similar electrostatic potential and molecular surface shape.

    PubMed

    Kinoshita, Kengo; Murakami, Yoichi; Nakamura, Haruki

    2007-07-01

    We have developed a method to predict ligand-binding sites in a new protein structure by searching for similar binding sites in the Protein Data Bank (PDB). The similarities are measured according to the shapes of the molecular surfaces and their electrostatic potentials. A new web server, eF-seek, provides an interface to our search method. It simply requires a coordinate file in the PDB format, and generates a prediction result as a virtual complex structure, with the putative ligands in a PDB format file as the output. In addition, the predicted interacting interface is displayed to facilitate the examination of the virtual complex structure on our own applet viewer with the web browser (URL: http://eF-site.hgc.jp/eF-seek).

  10. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

    PubMed Central

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

    2014-01-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

  11. Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

    PubMed

    Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

    2015-05-19

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

  12. Studies on the regulation of the human E1 subunit of the 2-oxoglutarate dehydrogenase complex, including the identification of a novel calcium-binding site.

    PubMed

    Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M

    2014-04-15

    The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.

  13. Proposed Mode of Binding and Action of Positive Allosteric Modulators at Opioid Receptors

    PubMed Central

    2016-01-01

    Available crystal structures of opioid receptors provide a high-resolution picture of ligand binding at the primary (“orthosteric”) site, that is, the site targeted by endogenous ligands. Recently, positive allosteric modulators of opioid receptors have also been discovered, but their modes of binding and action remain unknown. Here, we use a metadynamics-based strategy to efficiently sample the binding process of a recently discovered positive allosteric modulator of the δ-opioid receptor, BMS-986187, in the presence of the orthosteric agonist SNC-80, and with the receptor embedded in an explicit lipid–water environment. The dynamics of BMS-986187 were enhanced by biasing the potential acting on the ligand–receptor distance and ligand–receptor interaction contacts. Representative lowest-energy structures from the reconstructed free-energy landscape revealed two alternative ligand binding poses at an allosteric site delineated by transmembrane (TM) helices TM1, TM2, and TM7, with some participation of TM6. Mutations of amino acid residues at these proposed allosteric sites were found to either affect the binding of BMS-986187 or its ability to modulate the affinity and/or efficacy of SNC-80. Taken together, these combined experimental and computational studies provide the first atomic-level insight into the modulation of opioid receptor binding and signaling by allosteric modulators. PMID:26841170

  14. Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

    PubMed

    Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

    2015-02-10

    Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

  15. Molecular modeling and structural analysis of nAChR variants uncovers the mechanism of resistance to snake toxins.

    PubMed

    Gunasekaran, D; Sridhar, J; Suryanarayanan, V; Manimaran, N C; Singh, Sanjeev Kumar

    2017-06-01

    Nicotinic acetylcholine receptors (nAChRs) are neuromuscular proteins responsible for muscle contraction upon binding with chemical stimulant acetylcholine (ACh). The α-neurotoxins of snake mimic the structure of ACh and attacks nAChRs, which block the flow of ACh and leads to numbness and paralysis. The toxin-binding site of alpha subunit in the nAChRs is highly conserved throughout chordate lineages with few exceptions in resistance organisms. In this study, we have analyzed the sequence and structures of toxin-binding/resistant nAChRs and their interaction stability with toxins through molecular docking and molecular dynamics simulation (MDS). We have reported the potential glycosylation residues within the toxin-binding cleft adding sugar moieties through N-linked glycosylation in resistant organisms. Residue variations at key positions alter the secondary structure of binding cleft, which might interfere with toxin binding and it could be one of the possible explanations for the resistance to snake venoms. Analysis of nAChR-α-neurotoxin complexes has confirmed the key interacting residues. In addition, drastic variation in the binding stability of Mongoose nAChR-α-Bungarotoxin (α-BTX) and human nAChR-α-BTX complexes were found at specific phase of MDS. Our findings suggest that specific mutations in the binding site of toxin are potentially preventing the formation of stable complex of receptor-toxin, which might lead to mechanism of resistance. This in silico study on the binding cleft of nAChR and the findings of interacting residues will assist in designing potential inhibitors as therapeutic targets.

  16. Functional defect of variants in the adenosine triphosphate-binding sites of ABCB4 and their rescue by the cystic fibrosis transmembrane conductance regulator potentiator, ivacaftor (VX-770).

    PubMed

    Delaunay, Jean-Louis; Bruneau, Alix; Hoffmann, Brice; Durand-Schneider, Anne-Marie; Barbu, Véronique; Jacquemin, Emmanuel; Maurice, Michèle; Housset, Chantal; Callebaut, Isabelle; Aït-Slimane, Tounsia

    2017-02-01

    ABCB4 (MDR3) is an adenosine triphosphate (ATP)-binding cassette (ABC) transporter expressed at the canalicular membrane of hepatocytes, where it mediates phosphatidylcholine (PC) secretion. Variations in the ABCB4 gene are responsible for several biliary diseases, including progressive familial intrahepatic cholestasis type 3 (PFIC3), a rare disease that can be lethal in the absence of liver transplantation. In this study, we investigated the effect and potential rescue of ABCB4 missense variations that reside in the highly conserved motifs of ABC transporters, involved in ATP binding. Five disease-causing variations in these motifs have been identified in ABCB4 (G535D, G536R, S1076C, S1176L, and G1178S), three of which are homologous to the gating mutations of cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7; i.e., G551D, S1251N, and G1349D), that were previously shown to be function defective and corrected by ivacaftor (VX-770; Kalydeco), a clinically approved CFTR potentiator. Three-dimensional structural modeling predicted that all five ABCB4 variants would disrupt critical interactions in the binding of ATP and thereby impair ATP-induced nucleotide-binding domain dimerization and ABCB4 function. This prediction was confirmed by expression in cell models, which showed that the ABCB4 mutants were normally processed and targeted to the plasma membrane, whereas their PC secretion activity was dramatically decreased. As also hypothesized on the basis of molecular modeling, PC secretion activity of the mutants was rescued by the CFTR potentiator, ivacaftor (VX-770). Disease-causing variations in the ATP-binding sites of ABCB4 cause defects in PC secretion, which can be rescued by ivacaftor. These results provide the first experimental evidence that ivacaftor is a potential therapy for selected patients who harbor mutations in the ATP-binding sites of ABCB4. (Hepatology 2017;65:560-570). © 2016 by the American Association for the Study of Liver Diseases.

  17. Botulinum neurotoxin serotype C associates with dual ganglioside receptors to facilitate cell entry.

    PubMed

    Karalewitz, Andrew P-A; Fu, Zhuji; Baldwin, Michael R; Kim, Jung-Ja P; Barbieri, Joseph T

    2012-11-23

    How botulinum neurotoxin serotype C (BoNT/C) enters neurons is unclear. BoNT/C utilizes dual gangliosides as host cell receptors. BoNT/C accesses gangliosides on the plasma membrane. Plasma membrane accessibility of the dual ganglioside receptors suggests synaptic vesicle exocytosis may not be necessary to expose BoNT/C receptors. Botulinum neurotoxins (BoNTs) cleave SNARE proteins in motor neurons that inhibits synaptic vesicle (SV) exocytosis, resulting in flaccid paralysis. There are seven BoNT serotypes (A-G). In current models, BoNTs initially bind gangliosides on resting neurons and upon SV exocytosis associate with the luminal domains of SV-associated proteins as a second receptor. The entry of BoNT/C is less clear. Characterizing the heavy chain receptor binding domain (HCR), BoNT/C was shown to utilize gangliosides as dual host receptors. Crystallographic and biochemical studies showed that the two ganglioside binding sites, termed GBP2 and Sia-1, were independent and utilized unique mechanisms to bind complex gangliosides. The GBP2 binding site recognized gangliosides that contained a sia5 sialic acid, whereas the Sia-1 binding site recognized gangliosides that contained a sia7 sialic acid and sugars within the backbone of the ganglioside. Utilizing gangliosides that uniquely recognized the GBP2 and Sia-1 binding sites, HCR/C entry into Neuro-2A cells required both functional ganglioside binding sites. HCR/C entered cells differently than the HCR of tetanus toxin, which also utilizes dual gangliosides as host receptors. A point-mutated HCR/C that lacked GBP2 binding potential retained the ability to bind and enter Neuro-2A cells. This showed that ganglioside binding at the Sia-1 site was accessible on the plasma membrane, suggesting that SV exocytosis may not be required to expose BoNT/C receptors. These studies highlight the utility of BoNT HCRs as probes to study the role of gangliosides in neurotransmission.

  18. Predicting Nonspecific Ion Binding Using DelPhi

    PubMed Central

    Petukh, Marharyta; Zhenirovskyy, Maxim; Li, Chuan; Li, Lin; Wang, Lin; Alexov, Emil

    2012-01-01

    Ions are an important component of the cell and affect the corresponding biological macromolecules either via direct binding or as a screening ion cloud. Although some ion binding is highly specific and frequently associated with the function of the macromolecule, other ions bind to the protein surface nonspecifically, presumably because the electrostatic attraction is strong enough to immobilize them. Here, we test such a scenario and demonstrate that experimentally identified surface-bound ions are located at a potential that facilitates binding, which indicates that the major driving force is the electrostatics. Without taking into consideration geometrical factors and structural fluctuations, we show that ions tend to be bound onto the protein surface at positions with strong potential but with polarity opposite to that of the ion. This observation is used to develop a method that uses a DelPhi-calculated potential map in conjunction with an in-house-developed clustering algorithm to predict nonspecific ion-binding sites. Although this approach distinguishes only the polarity of the ions, and not their chemical nature, it can predict nonspecific binding of positively or negatively charged ions with acceptable accuracy. One can use the predictions in the Poisson-Boltzmann approach by placing explicit ions in the predicted positions, which in turn will reduce the magnitude of the local potential and extend the limits of the Poisson-Boltzmann equation. In addition, one can use this approach to place the desired number of ions before conducting molecular-dynamics simulations to neutralize the net charge of the protein, because it was shown to perform better than standard screened Coulomb canned routines, or to predict ion-binding sites in proteins. This latter is especially true for proteins that are involved in ion transport, because such ions are loosely bound and very difficult to detect experimentally. PMID:22735539

  19. Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

    PubMed

    Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

    1999-01-01

    Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

  20. Characterization and autoradiographic localization of neurotensin binding sites in human sigmoid colon.

    PubMed

    Azriel, Y; Burcher, E

    2001-06-01

    Radioiodinated neurotensin ((125)I-NT) was used to characterize and localize NT binding sites in normal human sigmoid colon. Specimens were obtained from patients (30-77 years old) undergoing resection for colon carcinoma. Specific binding of (125)I-NT to sigmoid circular muscle membranes was enhanced by o-phenanthroline (1 mM) but other peptidase inhibitors were ineffective. (125)I-NT bound to a high-affinity site of K(d) = 0.88 +/- 0.09 nM and B(max) = 4.03 +/- 0.66 fmol/mg of wet weight tissue (n = 14), although in the majority of patients another site, of low but variable affinity, could also be detected. Specific binding of 50 pM (125)I-NT was inhibited by NT(8-13) > NT > SR142948A > or = neuromedin N > or = SR48692, consistent with binding to the NT1 receptor. In autoradiographic studies, dense specific binding of (125)I-NT was seen over myenteric and submucosal ganglia, moderate binding over circular muscle, and sparse binding over longitudinal muscle and taenia coli. Levocabastine, which has affinity for the NT2 receptor, did not inhibit specific binding of (125)I-NT in membrane competition or autoradiographic studies. NT contracted sigmoid colon circular muscle strips with a pD(2) value of 6.8 +/- 0.2 nM (n = 25). The contractile responses to NT were significantly potentiated in the presence of tetrodotoxin (1 microM), indicating a neural component. Results from functional studies support actions for NT on both muscle and enteric neurons, consistent with the presence of NT receptors on circular muscle and ganglia of human sigmoid colon. The lack of inhibition by levocabastine suggests that the second binding site detected does not correspond to the NT2 receptor.

  1. ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter

    PubMed Central

    Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

    2014-01-01

    One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance. PMID:25089713

  2. ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter.

    PubMed

    Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

    2014-08-01

    One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance.

  3. A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

    PubMed

    De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

    2017-07-01

    Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.

  4. In situ detection of warfarin using time-correlated single-photon counting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosengren, Annika M.; Karlsson, Bjoern C.G.; Naeslund, Inga

    Highlights: {yields} Direct in situ measurement of specific isomeric forms of the anticoagulant warfarin. {yields} TCSPC spectroscopy in conjunction with synthetic Sudlow I binding site receptors. {yields} Development of sensor principle for use in clinical and environmental monitoring. -- Abstract: Here we report on a novel method for the direct in situ measurement of specific isomeric forms of the anticoagulant warfarin using time correlated single-photon counting (TCSPC) spectroscopy in conjunction with synthetic Sudlow I binding site receptors. The method is highly robust over the clinically significant concentration range, and demonstrates the potential of the binding site mimics in conjunction withmore » the spectroscopic strategy employed here for the determination of this important pharmaceutical in clinical or even environmental samples.« less

  5. [Propranolol beta-blocker decrease in the concentration of high-affinity binding sites for calcium ions by sarcolemma membranes of the rat heart].

    PubMed

    Seleznev, Iu M; Martynov, A V; Smirnov, V N

    1982-05-01

    In vivo administration of propranolol considerably inhibits the isoproterenol-stimulated increase in 45Ca accumulation by the myocardium and completely eliminates the potentiation of isoproterenol effect by hydrocortisone. A significant lowering of the concentration of high affinity binding sites for calcium in the sarcolemmal membranes can be produced by propranolol in vitro. Under these conditions, the glucocorticoids do not change the sarcolemmal Ca2+-binding parameters or modulate the propranolol effect. Therefore, for the manifestation of glucocorticoid action to be brought about, the integrity of the cells is apparently required, while propranolol seems to change calcium binding by direct interaction with the sarcolemmal membranes. It is suggested that in vivo propranolol inhibition of catecholamine effect on calcium ion accumulation by the myocardium depends on the interaction with the beta-receptors and direct modulation of the concentration of high affinity binding sites for calcium ions on the surface of the sarcolemma.

  6. Exploring molecular insights into the interaction mechanism of cholesterol derivatives with the Mce4A: A combined spectroscopic and molecular dynamic simulation studies.

    PubMed

    Khan, Shagufta; Khan, Faez Iqbal; Mohammad, Taj; Khan, Parvez; Hasan, Gulam Mustafa; Lobb, Kevin A; Islam, Asimul; Ahmad, Faizan; Imtaiyaz Hassan, Md

    2018-05-01

    Mammalian cell entry protein (Mce4A) is a member of MCE-family, and is being considered as a potential drug target of Mycobacterium tuberculosis infection because it is required for invasion and latent survival of pathogen by utilizing host's cholesterol. In the present study, we performed molecular docking followed by 100 ns MD simulation studies to understand the mechanism of interaction of Mce4A to the cholesterol derivatives and probucol. The selected ligands, cholesterol, 25-hydroxycholesterol, 5-cholesten-3β-ol-7-one and probucol bind to the predicted active site cavity of Mce4A, and complexes remain stable during entire simulation of 100 ns. In silico studies were further validated by fluorescence-binding studies to calculate actual binding affinity and number of binding site(s). The non-toxicity of all ligands was confirmed on human monocytic cell (THP1) by MTT assay. This work provides a deeper insight into the mechanism of interaction of Mce4A to cholesterol derivatives, which may be further exploited to design potential and specific inhibitors to ameliorate the Mycobacterium pathogenesis. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Tauroursodeoxycholic acid binds to the G-protein site on light activated rhodopsin.

    PubMed

    Lobysheva, E; Taylor, C M; Marshall, G R; Kisselev, O G

    2018-05-01

    The heterotrimeric G-protein binding site on G-protein coupled receptors remains relatively unexplored regarding its potential as a new target of therapeutic intervention or as a secondary site of action by the existing drugs. Tauroursodeoxycholic acid bears structural resemblance to several compounds that were previously identified to specifically bind to the light-activated form of the visual receptor rhodopsin and to inhibit its activation of transducin. We show that TUDCA stabilizes the active form of rhodopsin, metarhodopsin II, and does not display the detergent-like effects of common amphiphilic compounds that share the cholesterol scaffold structure, such as deoxycholic acid. Computer docking of TUDCA to the model of light-activated rhodopsin revealed that it interacts using similar mode of binding to the C-terminal domain of transducin alpha subunit. The ring regions of TUDCA made hydrophobic contacts with loop 3 region of rhodopsin, while the tail of TUDCA is exposed to solvent. The results show that TUDCA interacts specifically with rhodopsin, which may contribute to its wide-ranging effects on retina physiology and as a potential therapeutic compound for retina degenerative diseases. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. The High-Affinity Binding Site for Tricyclic Antidepressants Resides in the Outer Vestibule of the Serotonin TransporterⓈ

    PubMed Central

    Sarker, Subhodeep; Weissensteiner, René; Steiner, Ilka; Sitte, Harald H.; Ecker, Gerhard F.; Freissmuth, Michael; Sucic, Sonja

    2015-01-01

    The structure of the bacterial leucine transporter from Aquifex aeolicus (LeuTAa) has been used as a model for mammalian Na+/Cl−-dependent transporters, in particular the serotonin transporter (SERT). The crystal structure of LeuTAa liganded to tricyclic antidepressants predicts simultaneous binding of inhibitor and substrate. This is incompatible with the mutually competitive inhibition of substrates and inhibitors of SERT. We explored the binding modes of tricyclic antidepressants by homology modeling and docking studies. Two approaches were used subsequently to differentiate between three clusters of potential docking poses: 1) a diagnostic SERTY95F mutation, which greatly reduced the affinity for [3H]imipramine but did not affect substrate binding; 2) competition binding experiments in the presence and absence of carbamazepine (i.e., a tricyclic imipramine analog with a short side chain that competes with [3H]imipramine binding to SERT). Binding of releasers (para-chloroamphetamine, methylene-dioxy-methamphetamine/ecstasy) and of carbamazepine were mutually exclusive, but Dixon plots generated in the presence of carbamazepine yielded intersecting lines for serotonin, MPP+, paroxetine, and ibogaine. These observations are consistent with a model, in which 1) the tricyclic ring is docked into the outer vestibule and the dimethyl-aminopropyl side chain points to the substrate binding site; 2) binding of amphetamines creates a structural change in the inner and outer vestibule that precludes docking of the tricyclic ring; 3) simultaneous binding of ibogaine (which binds to the inward-facing conformation) and of carbamazepine is indicative of a second binding site in the inner vestibule, consistent with the pseudosymmetric fold of monoamine transporters. This may be the second low-affinity binding site for antidepressants. PMID:20829432

  9. DFT investigation of the interaction of gold nanoclusters with poly(amidoamine) PAMAM G0 dendrimer

    NASA Astrophysics Data System (ADS)

    Camarada, M. B.

    2016-06-01

    The interaction between PAMAM G0 and gold nanoclusters Aun (n = 2, 4, 6, and 8) was studied theoretically at DFT level. Different coordination sites were explored, including internal and superficial coordination. All stable complexes exhibited external interaction with the amine or carbonyl site, while the core site coordination was not favored. The more stable binding of Aun was registered with the terminal amine group, while the binding at the amide site was relatively weaker. The vertical first ionization potential, electron affinity, Fermi level, and the HOMO-LUMO gap of PAMAM and Aun-PAMAM G0 complexes were also analyzed.

  10. Insight into the mechanism of action and selectivity of caspase-3 reversible inhibitors through in silico studies

    NASA Astrophysics Data System (ADS)

    Minini, Lucía; Ferraro, Florencia; Cancela, Saira; Merlino, Alicia

    2017-11-01

    Alzheimer's disease (AD) is the most prevalent neurodegenerative disorder worldwide for which there is currently no cure. Recently, caspase-3 has been proposed as a potential therapeutic target for treating AD. Since this enzyme is overexpressed in brains from AD patients its selective modulation by non-covalent inhibitors becomes an interesting strategy in the search of potential drugs against this neuropathology. With this in mind, we have combined molecular docking, molecular dynamics simulations and QM calculations of unliganded caspase-3 and caspase-7 and in complex with a series of known inhibitors of caspase-3 described in the literature in order to assess the structural features responsible for good inhibitory activity and selectivity against this potential target. This work has allowed us to identify hotspots for drug binding as well as the importance of shape and charge distribution for interacting into the substrate binding cleft or into the dimer interface in each enzyme. Our results showed that most selective compounds against caspsase-3 bind into the substrate binding cleft acting as competitive inhibitors whereas in caspase-7 they bind close to an allosteric site at the dimer interface but since they are weakly bound their presence would not be affecting enzyme dynamics or function. In addition, for both enzymes we have found evidence indicating that differences in shape and accessibility exist between the substrate binding site of each monomer which could be modulating the binding affinity of non-covalent molecules.

  11. Expression of melatonin receptors in arteries involved in thermoregulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Viswanathan, M.; Laitinen, J.T.; Saavedra, J.M.

    Melatonin binding sites were localized and characterized in the vasculature of the rat by using the melatonin analogue 2-(125I)iodomelatonin (125I-melatonin) and quantitative in vitro autoradiography. The expression of these sites was restricted to the caudal artery and to the arteries that form the circle of Willis at the base of the brain. The arterial 125I-melatonin binding was stable, saturable, and reversible. Saturation studies revealed that the binding represented a single class of high-affinity binding sites with a dissociation constant (Kd) of 3.4 x 10(-11) M in the anterior cerebral artery and 1.05 x 10(-10) M in the caudal artery. Themore » binding capacities (Bmax) in these arteries were 19 and 15 fmol/mg of protein, respectively. The relative order of potency of indoles for inhibition of 125I-melatonin binding at these sites was typical of a melatonin receptor: 2-iodomelatonin greater than melatonin greater than N-acetylserotonin much much greater than 5-hydroxytryptamine. Norepinephrine-induced contraction of the caudal artery in vitro was significantly prolonged and potentiated by melatonin in a concentration-dependent manner, suggesting that these arterial binding sites are functional melatonin receptors. Neither primary steps in smooth muscle contraction (inositol phospholipid hydrolysis) nor relaxation (adenylate cyclase activation) were affected by melatonin. Melatonin, through its action on the tone of these arteries, may cause circulatory adjustments in these arteries, which are believed to be involved in thermoregulation.« less

  12. Validating metal binding sites in macromolecule structures using the CheckMyMetal web server

    PubMed Central

    Zheng, Heping; Chordia, Mahendra D.; Cooper, David R.; Chruszcz, Maksymilian; Müller, Peter; Sheldrick, George M.

    2015-01-01

    Metals play vital roles in both the mechanism and architecture of biological macromolecules. Yet structures of metal-containing macromolecules where metals are misidentified and/or suboptimally modeled are abundant in the Protein Data Bank (PDB). This shows the need for a diagnostic tool to identify and correct such modeling problems with metal binding environments. The "CheckMyMetal" (CMM) web server (http://csgid.org/csgid/metal_sites/) is a sophisticated, user-friendly web-based method to evaluate metal binding sites in macromolecular structures in respect to 7350 metal binding sites observed in a benchmark dataset of 2304 high resolution crystal structures. The protocol outlines how the CMM server can be used to detect geometric and other irregularities in the structures of metal binding sites and alert researchers to potential errors in metal assignment. The protocol also gives practical guidelines for correcting problematic sites by modifying the metal binding environment and/or redefining metal identity in the PDB file. Several examples where this has led to meaningful results are described in the anticipated results section. CMM was designed for a broad audience—biomedical researchers studying metal-containing proteins and nucleic acids—but is equally well suited for structural biologists to validate new structures during modeling or refinement. The CMM server takes the coordinates of a metal-containing macromolecule structure in the PDB format as input and responds within a few seconds for a typical protein structure modeled with a few hundred amino acids. PMID:24356774

  13. Sequence-Based Prediction of RNA-Binding Residues in Proteins.

    PubMed

    Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

  14. Sequence-Based Prediction of RNA-Binding Residues in Proteins

    PubMed Central

    Walia, Rasna R.; EL-Manzalawy, Yasser; Honavar, Vasant G.; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein–RNA complexes is important for understanding the molecular determinants of protein–RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein–RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein–RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner. PMID:27787829

  15. Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

    PubMed

    Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

    2017-09-09

    The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

    PubMed

    Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

    2011-01-30

    During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own promoter suggests the presence of autoregulation for RIN expression. ChIP-based analyses identified a novel RIN-binding CArG-box site that harbors a gene associated with RIN expression in its flanking region. These findings clarify the crucial role of RIN in the transcriptional regulation of ripening initiation and progression.

  17. Stoichiometry for activation of neuronal α7 nicotinic receptors

    PubMed Central

    Andersen, Natalia; Corradi, Jeremías; Sine, Steven M.; Bouzat, Cecilia

    2013-01-01

    Neuronal α7 nicotinic receptors elicit rapid cation influx in response to acetylcholine (ACh) or its hydrolysis product choline. They contribute to cognition, synaptic plasticity, and neuroprotection and have been implicated in neurodegenerative and neuropsychiatric disorders. α7, however, often localizes distal to sites of nerve-released ACh and binds ACh with low affinity, and thus elicits its biological response with low agonist occupancy. To assess the function of α7 when ACh occupies fewer than five of its identical binding sites, we measured the open-channel lifetime of individual receptors in which four of the five ACh binding sites were disabled. To improve the time resolution of the inherently brief α7 channel openings, background mutations or a potentiator was used to increase open duration. We find that, in receptors with only one intact binding site, the open-channel lifetime is indistinguishable from receptors with five intact binding sites, counter to expectations from prototypical neurotransmitter-gated ion channels where the open-channel lifetime increases with the number of binding sites occupied by agonist. Replacing the membrane-embedded domain of α7 by that of the related 5-HT3A receptor increases the number of sites that need to be occupied to achieve the maximal open-channel lifetime, thus revealing a unique interdependence between the detector and actuator domains of these receptors. The distinctive ability of a single occupancy to elicit a full biological response adapts α7 to volume transmission, a prevalent mechanism of ACh-mediated signaling in the nervous system and nonneuronal cells. PMID:24297903

  18. Characterization of interaction between doxycycline and human serum albumin by capillary electrophoresis-frontal analysis.

    PubMed

    Sun, Hanwen; He, Pan

    2009-06-01

    The binding of doxycycline to HSA under simulated physiological conditions (pH 7.4, 67 mM phosphate, I=0.17, drug concentration 100 microM, HSA concentration up to 475 microM, 36.5 degrees C) was studied by CE-frontal analysis. The number of primary binding sites, binding constant and physiological protein-binding percentage were 1.9, 1.51 x 10(3) M(-1) and 59.80%, respectively. In addition, the thermodynamic parameters including enthalpy change (DeltaH), entropy change (DeltaS) and free energy change (DeltaG) of the reaction were obtained in order to characterize the acting forces between doxycycline and HSA. Furthermore, to better understand the nature of doxycycline-HSA binding and to get information about potential interaction with other drugs, displacement experiments were performed. The results showed that doxycycline binds at site II of HSA.

  19. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  20. Exploring the binding pathways of the 14-3-3ζ protein: Structural and free-energy profiles revealed by Hamiltonian replica exchange molecular dynamics with distancefield distance restraints

    PubMed Central

    Nagy, Gabor; Oostenbrink, Chris; Hritz, Jozef

    2017-01-01

    The 14-3-3 protein family performs regulatory functions in eukaryotic organisms by binding to a large number of phosphorylated protein partners. Whilst the binding mode of the phosphopeptides within the primary 14-3-3 binding site is well established based on the crystal structures of their complexes, little is known about the binding process itself. We present a computational study of the process by which phosphopeptides bind to the 14-3-3ζ protein. Applying a novel scheme combining Hamiltonian replica exchange molecular dynamics and distancefield restraints allowed us to map and compare the most likely phosphopeptide-binding pathways to the 14-3-3ζ protein. The most important structural changes to the protein and peptides involved in the binding process were identified. In order to bind phosphopeptides to the primary interaction site, the 14-3-3ζ adopted a newly found wide-opened conformation. Based on our findings we additionally propose a secondary interaction site on the inner surface of the 14-3-3ζ dimer, and a direct interference on the binding process by the flexible C-terminal tail. A minimalistic model was designed to allow for the efficient calculation of absolute binding affinities. Binding affinities calculated from the potential of mean force along the binding pathway are in line with the available experimental estimates for two of the studied systems. PMID:28727767

  1. Ligand deconstruction: Why some fragment binding positions are conserved and others are not

    PubMed Central

    Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

    2015-01-01

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

  2. Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors.

    PubMed

    Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I; Lanciego, José L; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

    2017-01-01

    The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB 2 receptors (CB 2 Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB 2 R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB 2 R. Using membrane preparations from CB 2 R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB 2 R where the synthetic cannabinoid, [ 3 H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB 2 R-selective compound, CM-157. The effect on binding to CB 2 R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the K D . CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB 2 R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities.

  3. Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors

    PubMed Central

    Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I.; Lanciego, José L.; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

    2017-01-01

    The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB2 receptors (CB2Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB2R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB2R. Using membrane preparations from CB2R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB2R where the synthetic cannabinoid, [3H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB2R-selective compound, CM-157. The effect on binding to CB2R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the KD. CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB2R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities. PMID:29109685

  4. Warfarin and Flavonoids Do Not Share the Same Binding Region in Binding to the IIA Subdomain of Human Serum Albumin.

    PubMed

    Rimac, Hrvoje; Dufour, Claire; Debeljak, Željko; Zorc, Branka; Bojić, Mirza

    2017-07-11

    Human serum albumin (HSA) binds a variety of xenobiotics, including flavonoids and warfarin. The binding of another ligand to the IIA binding site on HSA can cause warfarin displacement and potentially the elevation of its free concentration in blood. Studies dealing with flavonoid-induced warfarin displacement from HSA provided controversial results: estimated risk of displacement ranged from none to serious. To resolve these controversies, in vitro study of simultaneous binding of warfarin and eight different flavonoid aglycons and glycosides to HSA was carried out by fluorescence spectroscopy as well as molecular docking. Results show that warfarin and flavonoids do not share the same binding region in binding to HSA. Interactions were only observed at high warfarin concentrations not attainable under recommended dosing regimes. Docking experiments show that flavonoid aglycons and glycosides do not bind at warfarin high affinity sites, but rather to different regions within the IIA HSA subdomain. Thus, the risk of clinically significant warfarin-flavonoid interaction in binding to HSA should be regarded as negligible.

  5. Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

    Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

  6. Sodium ion modulates D2 receptor characteristics of dopamine agonist and antagonist binding sites in striatum and retina

    PubMed Central

    Makman, Maynard H.; Dvorkin, B.; Klein, Patrice N.

    1982-01-01

    Sodium ion (Na+) influences binding of both dopamine agonists and antagonists to D2 receptors in striatum and retina. Also, Na+ markedly potentiates the loss of high-affinity agonist binding due to the GTP analogue p[NH]ppG. 2-Amino-6, 7-dihydroxy-1,2,3,4-tetrahydro[5,8-3H]naphthalene ([3H]ADTN) binds exclusively to an agonist conformation of D2 receptor in both striatum and retina, distinct from the antagonist conformation labeled by [3H]spiroperidol or [3H]domperidone in striatum or by [3H]spiroperidol in retina. Na+ is not required for interaction of [3H]ADTN or antagonist radioligand sites with the selective D2 agonist LY-141865, the D2 antagonist domperidone, or nonselective dopamine agonists or antagonists; however, Na+ is necessary for high affinity interaction of those radioligand sites with the D2 antagonists molindone and metoclopramide. With Na+ present, striatal sites for [3H]ADTN, [3H]spiroperidol, and [3H]domperidone have similar affinities for antagonists but only [3H]ADTN sites have high affinity for agonists. Na+ further decreases the low affinity of dopamine agonists for [3H]spiroperidol binding sites. Also, Na+ enhances [3H]spiroperidol and decreases [3H]ADTN binding. Na+ alone causes bound [3H]ADTN to dissociate from at least 30% of striatal and 50% of retinal sites, and with Na+ present [3H]ADTN rapidly dissociates from the remaining sites upon addition of p[NH]ppG. It is proposed that D2 receptors in striatum and retina exist in distinct but interconvertible conformational states, with different properties depending on the presence or absence of Na+ and of guanine nucleotide. PMID:6213964

  7. Mojo Hand, a TALEN design tool for genome editing applications.

    PubMed

    Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

    2013-01-16

    Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

  8. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

    PubMed

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

    2014-07-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. BiP clustering facilitates protein folding in the endoplasmic reticulum.

    PubMed

    Griesemer, Marc; Young, Carissa; Robinson, Anne S; Petzold, Linda

    2014-07-01

    The chaperone BiP participates in several regulatory processes within the endoplasmic reticulum (ER): translocation, protein folding, and ER-associated degradation. To facilitate protein folding, a cooperative mechanism known as entropic pulling has been proposed to demonstrate the molecular-level understanding of how multiple BiP molecules bind to nascent and unfolded proteins. Recently, experimental evidence revealed the spatial heterogeneity of BiP within the nuclear and peripheral ER of S. cerevisiae (commonly referred to as 'clusters'). Here, we developed a model to evaluate the potential advantages of accounting for multiple BiP molecules binding to peptides, while proposing that BiP's spatial heterogeneity may enhance protein folding and maturation. Scenarios were simulated to gauge the effectiveness of binding multiple chaperone molecules to peptides. Using two metrics: folding efficiency and chaperone cost, we determined that the single binding site model achieves a higher efficiency than models characterized by multiple binding sites, in the absence of cooperativity. Due to entropic pulling, however, multiple chaperones perform in concert to facilitate the resolubilization and ultimate yield of folded proteins. As a result of cooperativity, multiple binding site models used fewer BiP molecules and maintained a higher folding efficiency than the single binding site model. These insilico investigations reveal that clusters of BiP molecules bound to unfolded proteins may enhance folding efficiency through cooperative action via entropic pulling.

  10. The yeast kinesin-5 Cin8 interacts with the microtubule in a noncanonical manner

    PubMed Central

    Bell, Kayla M.; Cha, Hyo Keun; Sindelar, Charles V.; Cochran, Jared C.

    2017-01-01

    Kinesin motors play central roles in establishing and maintaining the mitotic spindle during cell division. Unlike most other kinesins, Cin8, a kinesin-5 motor in Saccharomyces cerevisiae, can move bidirectionally along microtubules, switching directionality according to biochemical conditions, a behavior that remains largely unexplained. To this end, we used biochemical rate and equilibrium constant measurements as well as cryo-electron microscopy methodologies to investigate the microtubule interactions of the Cin8 motor domain. These experiments unexpectedly revealed that, whereas Cin8 ATPase kinetics fell within measured ranges for kinesins (especially kinesin-5 proteins), approximately four motors can bind each αβ-tubulin dimer within the microtubule lattice. This result contrasted with those observations on other known kinesins, which can bind only a single “canonical” site per tubulin dimer. Competition assays with human kinesin-5 (Eg5) only partially abrogated this behavior, indicating that Cin8 binds microtubules not only at the canonical site, but also one or more separate (“noncanonical”) sites. Moreover, we found that deleting the large, class-specific insert in the microtubule-binding loop 8 reverts Cin8 to one motor per αβ-tubulin in the microtubule. The novel microtubule-binding mode of Cin8 identified here provides a potential explanation for Cin8 clustering along microtubules and potentially may contribute to the mechanism for direction reversal. PMID:28701465

  11. Simulation of electron-proton coupling with a Monte Carlo method: application to cytochrome c3 using continuum electrostatics.

    PubMed Central

    Baptista, A M; Martel, P J; Soares, C M

    1999-01-01

    A new method is presented for simulating the simultaneous binding equilibrium of electrons and protons on protein molecules, which makes it possible to study the full equilibrium thermodynamics of redox and protonation processes, including electron-proton coupling. The simulations using this method reflect directly the pH and electrostatic potential of the environment, thus providing a much closer and realistic connection with experimental parameters than do usual methods. By ignoring the full binding equilibrium, calculations usually overlook the twofold effect that binding fluctuations have on the behavior of redox proteins: first, they affect the energy of the system by creating partially occupied sites; second, they affect its entropy by introducing an additional empty/occupied site disorder (here named occupational entropy). The proposed method is applied to cytochrome c3 of Desulfovibrio vulgaris Hildenborough to study its redox properties and electron-proton coupling (redox-Bohr effect), using a continuum electrostatic method based on the linear Poisson-Boltzmann equation. Unlike previous studies using other methods, the full reduction order of the four hemes at physiological pH is successfully predicted. The sites more strongly involved in the redox-Bohr effect are identified by analysis of their titration curves/surfaces and the shifts of their midpoint redox potentials and pKa values. Site-site couplings are analyzed using statistical correlations, a method much more realistic than the usual analysis based on direct interactions. The site found to be more strongly involved in the redox-Bohr effect is propionate D of heme I, in agreement with previous studies; other likely candidates are His67, the N-terminus, and propionate D of heme IV. Even though the present study is limited to equilibrium conditions, the possible role of binding fluctuations in the concerted transfer of protons and electrons under nonequilibrium conditions is also discussed. The occupational entropy contributions to midpoint redox potentials and pKa values are computed and shown to be significant. PMID:10354425

  12. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site

    PubMed Central

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.

    2012-01-01

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882

  13. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site.

    PubMed

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A

    2012-08-21

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.

  14. Solution NMR studies provide structural basis for endotoxin pattern recognition by the innate immune receptor CD14

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Albright, Seth; Chen Bin; Holbrook, Kristen

    CD14 functions as a key pattern recognition receptor for a diverse array of Gram-negative and Gram-positive cell-wall components in the host innate immune response by binding to pathogen-associated molecular patterns (PAMPs) at partially overlapping binding site(s). To determine the potential contribution of CD14 residues in this pattern recognition, we have examined using solution NMR spectroscopy, the binding of three different endotoxin ligands, lipopolysaccharide, lipoteichoic acid, and a PGN-derived compound, muramyl dipeptide to a {sup 15}N isotopically labeled 152-residue N-terminal fragment of sCD14 expressed in Pichia pastoris. Mapping of NMR spectral changes upon addition of ligands revealed that the pattern ofmore » residues affected by binding of each ligand is partially similar and partially different. This first direct structural observation of the ability of specific residue combinations of CD14 to differentially affect endotoxin binding may help explain the broad specificity of CD14 in ligand recognition and provide a structural basis for pattern recognition. Another interesting finding from the observed spectral changes is that the mode of binding may be dynamically modulated and could provide a mechanism for binding endotoxins with structural diversity through a common binding site.« less

  15. Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

    PubMed Central

    Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

  16. Characterization of the binding of 2-mercaptobenzimidazole to bovine serum albumin.

    PubMed

    Teng, Yue; Zou, Luyi; Huang, Ming; Zong, Wansong

    2015-04-01

    2-Mercaptobenzimidazole (MBI) is widely utilized as a corrosion inhibitor, copper-plating brightener and rubber accelerator. The residue of MBI in the environment is potentially harmful to human health. In this article, the interaction of MBI with bovine serum albumin (BSA) was explored using spectroscopic and molecular docking methods under physiological conditions. The positively charged MBI can spontaneously bind with the negatively charged BSA through electrostatic forces with one binding site. The site marker competition experiments and the molecular docking study revealed that MBI bound into site II (subdomain IIIA) of BSA, which further led to some secondary structure and microenvironmental changes of BSA. This work provides useful information on understanding the toxicological actions of MBI at the molecular level. Copyright © 2015 John Wiley & Sons, Ltd.

  17. High Resolution Features from Low Affinity Interactions: Photoactive Analogs of the Haloether Anesthetics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xi,J.; Liu, R.; Rossi, M.

    2006-01-01

    The difficulty in obtaining binding target and site information for low-affinity drugs, like the inhaled anesthetics, has limited identification of their molecular effectors. Because such information can be provided by photoactive analogues, we designed, synthesized, and characterized a novel diazirnyl haloether that closely mimics isoflurane, the most widely used clinical general anesthetic. This compound, H-diaziflurane, is a nontoxic, potent anesthetic that potentiates GABA-gated ion channels in primary cultures of hippocampal neurons. Calorimetric and structural characterizations show that H-diaziflurane binds a model anesthetic host protein with similar energetics as isoflurane and forms photoadducts with residues lining the isoflurane binding site. H-diazifluranemore » will be immediately useful for identifying targets and sites important for the molecular pharmacology of the inhaled haloether anesthetics.« less

  18. Combining solvent thermodynamic profiles with functionality maps of the Hsp90 binding site to predict the displacement of water molecules.

    PubMed

    Haider, Kamran; Huggins, David J

    2013-10-28

    Intermolecular interactions in the aqueous phase must compete with the interactions between the two binding partners and their solvating water molecules. In biological systems, water molecules in protein binding sites cluster at well-defined hydration sites and can form strong hydrogen-bonding interactions with backbone and side-chain atoms. Displacement of such water molecules is only favorable when the ligand can form strong compensating hydrogen bonds. Conversely, water molecules in hydrophobic regions of protein binding sites make only weak interactions, and the requirements for favorable displacement are less stringent. The propensity of water molecules for displacement can be identified using inhomogeneous fluid solvation theory (IFST), a statistical mechanical method that decomposes the solvation free energy of a solute into the contributions from different spatial regions and identifies potential binding hotspots. In this study, we employed IFST to study the displacement of water molecules from the ATP binding site of Hsp90, using a test set of 103 ligands. The predicted contribution of a hydration site to the hydration free energy was found to correlate well with the observed displacement. Additionally, we investigated if this correlation could be improved by using the energetic scores of favorable probe groups binding at the location of hydration sites, derived from a multiple copy simultaneous search (MCSS) method. The probe binding scores were not highly predictive of the observed displacement and did not improve the predictivity when used in combination with IFST-based hydration free energies. The results show that IFST alone can be used to reliably predict the observed displacement of water molecules in Hsp90. However, MCSS can augment IFST calculations by suggesting which functional groups should be used to replace highly displaceable water molecules. Such an approach could be very useful in improving the hit-to-lead process for new drug targets.

  19. The Transcription Factor AlsR Binds and Regulates the Promoter of the alsSD Operon Responsible for Acetoin Formation in Bacillus subtilis

    PubMed Central

    Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter

    2012-01-01

    Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965

  20. Polymorphisms A387P in thrombospondin-4 and N700S in thrombospondin-1 perturb calcium binding sites.

    PubMed

    Stenina, Olga I; Ustinov, Valentin; Krukovets, Irene; Marinic, Tina; Topol, Eric J; Plow, Edward F

    2005-11-01

    Recent genetic studies have associated members of the thrombospondin (TSP) gene family with premature cardiovascular disease. The disease-associated polymorphisms lead to single amino acid changes in TSP-4 (A387P) and TSP-1 (N700S). These substitutions reside in adjacent domains of these highly homologous proteins. Secondary structural predictive programs and the homology of the domains harboring these amino acid substitutions to those in other proteins pointed to potential alterations of putative Ca2+ binding sites that reside in close proximity to the polymorphic amino acids. Since Ca2+ binding is critical for the structure and function of TSP family members, direct evidence for differences in Ca2+ binding by the polymorphic forms was sought. Using synthetic peptides and purified recombinant variant fragments bearing the amino acid substitutions, we measured differences in Tb3+ luminescence as an index of Ca2+ binding. The Tb3+ binding constants placed the TSP-1 region affected by N700S polymorphism among other high-affinity Ca2+ binding sites. The affinity of Ca2+ binding was lower for peptides (3.5-fold) and recombinant fragments (10-fold) containing the S700 vs. the N700 form. In TSP-4, the P387 form acquired an additional Ca2+ binding site absent in the A387 form. The results of our study suggest that both substitutions (A387P in TSP-4 and N700S in TSP-1) alter Ca2+ binding properties. Since these substitutions exert the opposite effects on Ca2+ binding, a decrease in TSP-1 and an increase in TSP-4, the two TSP variants are likely to influence cardiovascular functions in distinct but yet pathogenic ways.

  1. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site

    PubMed Central

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J.

    2016-01-01

    ABSTRACT Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. IMPORTANCE We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. PMID:26764003

  2. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site.

    PubMed

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J; Hogle, James M

    2016-01-13

    Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Investigation of the Binding Profiles of AZD2184 and Thioflavin T with Amyloid-β(1-42) Fibril by Molecular Docking and Molecular Dynamics Methods.

    PubMed

    Kuang, Guanglin; Murugan, N Arul; Tu, Yaoquan; Nordberg, Agneta; Ågren, Hans

    2015-09-03

    Detecting deposits of amyloid β fibrils in the brain is of paramount importance for an early diagnosis of Alzheimer's disease. A number of PET tracers have been developed for amyloid imaging, but many suffer from poor specificity and large signal to background ratio. Design of tracers with specificity and improved binding affinity requires knowledge about various potential binding sites in the amyloid β fibril available for the tracers and the nature of the local microenvironment of these sites. In this study we investigate the local structure of fibrils using two important probes, namely, thioflavin T (a fluorescent probe) and AZD2184 (a PET tracer). The target structures for amyloid-β(1-42) fibril are based on reported NMR solution models. By explicitly considering the effect of fibril flexibility on the available binding sites for all these models, the binding affinity of these probes has been investigated. The binding profiles of AZD2184 and thioflavin T were studied by molecular docking and molecular dynamics simulation methods. The two compounds were found to bind at the same sites of the fibril: three of which are within the fibril, and one is on the two sides of the Met35 residue on the surface. The binding affinity of AZD2184 and thioflavin T is found to be higher at the core sites than on the surface due to more contact residues. The binding affinity of AZD2184 is much higher than that of thioflavin T at every site due to electrostatic interaction and spatial restriction, which is in good agreement with experimental observation. However, the structural change of thioflavin T is much more significant than that of AZD2184, which is the chemical basis for its usage as a fluorescent probe. The ramifications of these results for the design and optimization of PET radioligands and fluorescent probes are briefly discussed.

  4. Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels.

    PubMed

    Elinder, Fredrik; Liin, Sara I

    2017-01-01

    Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (Na V ), potassium (K V ), calcium (Ca V ), and proton (H V ) channels, as well as calcium-activated potassium (K Ca ), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1 : The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2 : The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3 : The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4 : The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5 : The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels.

  5. Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels

    PubMed Central

    Elinder, Fredrik; Liin, Sara I.

    2017-01-01

    Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (NaV), potassium (KV), calcium (CaV), and proton (HV) channels, as well as calcium-activated potassium (KCa), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1: The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2: The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3: The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4: The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5: The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels. PMID:28220076

  6. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  7. Positive selection moments identify potential functional residues in human olfactory receptors

    NASA Technical Reports Server (NTRS)

    Singer, M. S.; Weisinger-Lewin, Y.; Lancet, D.; Shepherd, G. M.

    1996-01-01

    Correlated mutation analysis and molecular models of olfactory receptors have provided evidence that residues in the transmembrane domains form a binding pocket for odor ligands. As an independent test of these results, we have calculated positive selection moments for the alpha-helical sixth transmembrane domain (TM6) of human olfactory receptors. The moments can be used to identify residues that have been preferentially affected by positive selection and are thus likely to interact with odor ligands. The results suggest that residue 622, which is commonly a serine or threonine, could form critical H-bonds. In some receptors a dual-serine subsite, formed by residues 622 and 625, could bind hydroxyl determinants on odor ligands. The potential importance of these residues is further supported by site-directed mutagenesis in the beta-adrenergic receptor. The findings should be of practical value for future physiological studies, binding assays, and site-directed mutagenesis.

  8. Self-assembled nanospheres with multiple endohedral binding sites pre-organize catalysts and substrates for highly efficient reactions

    NASA Astrophysics Data System (ADS)

    Wang, Qi-Qiang; Gonell, Sergio; Leenders, Stefan H. A. M.; Dürr, Maximilian; Ivanović-Burmazović, Ivana; Reek, Joost N. H.

    2016-03-01

    Tuning reagent and catalyst concentrations is crucial in the development of efficient catalytic transformations. In enzyme-catalysed reactions the substrate is bound—often by multiple non-covalent interactions—in a well-defined pocket close to the active site of the enzyme; this pre-organization facilitates highly efficient transformations. Here we report an artificial system that co-encapsulates multiple catalysts and substrates within the confined space defined by an M12L24 nanosphere that contains 24 endohedral guanidinium-binding sites. Cooperative binding means that sulfonate guests are bound much more strongly than carboxylates. This difference has been used to fix gold-based catalysts firmly, with the remaining binding sites left to pre-organize substrates. This strategy was applied to a Au(I)-catalysed cyclization of acetylenic acid to enol lactone in which the pre-organization resulted in much higher reaction rates. We also found that the encapsulated sulfonate-containing Au(I) catalysts did not convert neutral (acid) substrates, and so could have potential in the development of substrate-selective catalysis and base-triggered on/off switching of catalysis.

  9. The binding sites for benztropines and dopamine in the dopamine transporter overlap

    PubMed Central

    Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

    2013-01-01

    Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

  10. Active-Site Hydration and Water Diffusion in Cytochrome P450cam: A Highly Dynamic Process

    PubMed Central

    Miao, Yinglong; Baudry, Jerome

    2011-01-01

    Long-timescale molecular dynamics simulations (300 ns) are performed on both the apo- (i.e., camphor-free) and camphor-bound cytochrome P450cam (CYP101). Water diffusion into and out of the protein active site is observed without biased sampling methods. During the course of the molecular dynamics simulation, an average of 6.4 water molecules is observed in the camphor-binding site of the apo form, compared to zero water molecules in the binding site of the substrate-bound form, in agreement with the number of water molecules observed in crystal structures of the same species. However, as many as 12 water molecules can be present at a given time in the camphor-binding region of the active site in the case of apo-P450cam, revealing a highly dynamic process for hydration of the protein active site, with water molecules exchanging rapidly with the bulk solvent. Water molecules are also found to exchange locations frequently inside the active site, preferentially clustering in regions surrounding the water molecules observed in the crystal structure. Potential-of-mean-force calculations identify thermodynamically favored trans-protein pathways for the diffusion of water molecules between the protein active site and the bulk solvent. Binding of camphor in the active site modifies the free-energy landscape of P450cam channels toward favoring the diffusion of water molecules out of the protein active site. PMID:21943431

  11. Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

    PubMed

    Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

    2017-03-14

    Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

  12. Competitive Inhibition Mechanism of Acetylcholinesterase without Catalytic Active Site Interaction: Study on Functionalized C60 Nanoparticles via in Vitro and in Silico Assays.

    PubMed

    Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian

    2017-06-07

    Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.

  13. Mutagenesis Studies of the H5 Influenza Hemagglutinin Stem Loop Region*

    PubMed Central

    Antanasijevic, Aleksandar; Basu, Arnab; Bowlin, Terry L.; Mishra, Rama K.; Rong, Lijun; Caffrey, Michael

    2014-01-01

    Influenza outbreaks, particularly the pandemic 1918 H1 and avian H5 strains, are of high concern to public health. The hemagglutinin envelope protein of influenza plays a critical role in viral entry and thus is an attractive target for inhibition of virus entry. The highly conserved stem loop region of hemagglutinin has been shown to undergo critically important conformational changes during the entry process and, moreover, to be a site for inhibition of virus entry by antibodies, small proteins, and small drug-like molecules. In this work we probe the structure-function properties of the H5 hemagglutinin stem loop region by site-directed mutagenesis. We find that most mutations do not disrupt expression, proteolytic processing, incorporation into virus, or receptor binding; however, many of the mutations disrupt the entry process. We further assess the effects of mutations on inhibition of entry by a neutralizing monoclonal antibody (C179) and find examples of increased and decreased sensitivity to the antibody, consistent with the antibody binding site observed by x-ray crystallography. In addition, we tested the sensitivity of the mutants to MBX2329, a small molecule inhibitor of influenza entry. Interestingly, the mutants exhibit increased and decreased sensitivities to MBX2329, which gives further insight into the binding site of the compound on HA and potential mechanisms of escape. Finally, we have modeled the binding site of MBX2329 using molecular dynamics and find that the resulting structure is in good agreement with the mutagenesis results. Together these studies underscore the importance of the stem loop region to HA function and suggest potential sites for therapeutic intervention of influenza entry. PMID:24947513

  14. Mutagenesis studies of the H5 influenza hemagglutinin stem loop region.

    PubMed

    Antanasijevic, Aleksandar; Basu, Arnab; Bowlin, Terry L; Mishra, Rama K; Rong, Lijun; Caffrey, Michael

    2014-08-08

    Influenza outbreaks, particularly the pandemic 1918 H1 and avian H5 strains, are of high concern to public health. The hemagglutinin envelope protein of influenza plays a critical role in viral entry and thus is an attractive target for inhibition of virus entry. The highly conserved stem loop region of hemagglutinin has been shown to undergo critically important conformational changes during the entry process and, moreover, to be a site for inhibition of virus entry by antibodies, small proteins, and small drug-like molecules. In this work we probe the structure-function properties of the H5 hemagglutinin stem loop region by site-directed mutagenesis. We find that most mutations do not disrupt expression, proteolytic processing, incorporation into virus, or receptor binding; however, many of the mutations disrupt the entry process. We further assess the effects of mutations on inhibition of entry by a neutralizing monoclonal antibody (C179) and find examples of increased and decreased sensitivity to the antibody, consistent with the antibody binding site observed by x-ray crystallography. In addition, we tested the sensitivity of the mutants to MBX2329, a small molecule inhibitor of influenza entry. Interestingly, the mutants exhibit increased and decreased sensitivities to MBX2329, which gives further insight into the binding site of the compound on HA and potential mechanisms of escape. Finally, we have modeled the binding site of MBX2329 using molecular dynamics and find that the resulting structure is in good agreement with the mutagenesis results. Together these studies underscore the importance of the stem loop region to HA function and suggest potential sites for therapeutic intervention of influenza entry. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Specific phospholipid binding to Na,K-ATPase at two distinct sites.

    PubMed

    Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

    2017-03-14

    Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

  16. Mefloquine inhibits voltage dependent Nav1.4 channel by overlapping the local anaesthetic binding site.

    PubMed

    Paiz-Candia, Bertin; Islas, Angel A; Sánchez-Solano, Alfredo; Mancilla-Simbro, Claudia; Scior, Thomas; Millan-PerezPeña, Lourdes; Salinas-Stefanon, Eduardo M

    2017-02-05

    Mefloquine constitutes a multitarget antimalaric that inhibits cation currents. However, the effect and the binding site of this compound on Na + channels is unknown. To address the mechanism of action of mefloquine, we employed two-electrode voltage clamp recordings on Xenopus laevis oocytes, site-directed mutagenesis of the rat Na + channel, and a combined in silico approach using Molecular Dynamics and docking protocols. We found that mefloquine: i) inhibited Na v 1.4 currents (IC 50 =60μM), ii) significantly delayed fast inactivation but did not affect recovery from inactivation, iii) markedly the shifted steady-state inactivation curve to more hyperpolarized potentials. The presence of the β1 subunit significantly reduced mefloquine potency, but the drug induced a significant frequency-independent rundown upon repetitive depolarisations. Computational and experimental results indicate that mefloquine overlaps the local anaesthetic binding site by docking at a hydrophobic cavity between domains DIII and DIV that communicates the local anaesthetic binding site with the selectivity filter. This is supported by the fact that mefloquine potency significantly decreased on mutant Na v 1.4 channel F1579A and significantly increased on K1237S channels. In silico this compound docked above F1579 forming stable π-π interactions with this residue. We provide structure-activity insights into how cationic amphiphilic compounds may exert inhibitory effects by docking between the local anaesthetic binding site and the selectivity filter of a mammalian Na + channel. Our proposed synergistic cycle of experimental and computational studies may be useful for elucidating binding sites of other drugs, thereby saving in vitro and in silico resources. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Simulation of a model nanopore sensor: Ion competition underlies device behavior.

    PubMed

    Mádai, Eszter; Valiskó, Mónika; Dallos, András; Boda, Dezső

    2017-12-28

    We study a model nanopore sensor with which a very low concentration of analyte molecules can be detected on the basis of the selective binding of the analyte molecules to the binding sites on the pore wall. The bound analyte ions partially replace the current-carrier cations in a thermodynamic competition. This competition depends both on the properties of the nanopore and the concentrations of the competing ions (through their chemical potentials). The output signal given by the device is the current reduction caused by the presence of the analyte ions. The concentration of the analyte ions can be determined through calibration curves. We model the binding site with the square-well potential and the electrolyte as charged hard spheres in an implicit background solvent. We study the system with a hybrid method in which we compute the ion flux with the Nernst-Planck (NP) equation coupled with the Local Equilibrium Monte Carlo (LEMC) simulation technique. The resulting NP+LEMC method is able to handle both strong ionic correlations inside the pore (including finite size of ions) and bulk concentrations as low as micromolar. We analyze the effect of bulk ion concentrations, pore parameters, binding site parameters, electrolyte properties, and voltage on the behavior of the device.

  18. Simulation of a model nanopore sensor: Ion competition underlies device behavior

    NASA Astrophysics Data System (ADS)

    Mádai, Eszter; Valiskó, Mónika; Dallos, András; Boda, Dezső

    2017-12-01

    We study a model nanopore sensor with which a very low concentration of analyte molecules can be detected on the basis of the selective binding of the analyte molecules to the binding sites on the pore wall. The bound analyte ions partially replace the current-carrier cations in a thermodynamic competition. This competition depends both on the properties of the nanopore and the concentrations of the competing ions (through their chemical potentials). The output signal given by the device is the current reduction caused by the presence of the analyte ions. The concentration of the analyte ions can be determined through calibration curves. We model the binding site with the square-well potential and the electrolyte as charged hard spheres in an implicit background solvent. We study the system with a hybrid method in which we compute the ion flux with the Nernst-Planck (NP) equation coupled with the Local Equilibrium Monte Carlo (LEMC) simulation technique. The resulting NP+LEMC method is able to handle both strong ionic correlations inside the pore (including finite size of ions) and bulk concentrations as low as micromolar. We analyze the effect of bulk ion concentrations, pore parameters, binding site parameters, electrolyte properties, and voltage on the behavior of the device.

  19. Hydrogen adsorption in HKUST-1: a combined inelastic neutron scattering and first-principles study.

    PubMed

    Brown, Craig M; Liu, Yun; Yildirim, Taner; Peterson, Vanessa K; Kepert, Cameron J

    2009-05-20

    Hydrogen adsorption in high surface area nanoporous coordination polymers has attracted a great deal of interest in recent years due to the potential applications in energy storage. Here we present combined inelastic neutron scattering measurements and detailed first-principles calculations aimed at unraveling the nature of hydrogen adsorption in HKUST-1 (Cu3(1,3,5-benzenetricarboxylate)2), a metal-organic framework (MOF) with unsaturated metal centers. We reveal that, in this system, the major contribution to the overall binding comes from the classical Coulomb interaction which is not screened due to the open metal site; this explains the relatively high binding energies and short H2-metal distances observed in MOFs with exposed metal sites as compared to traditional ones. Despite the short distances, there is no indication of an elongation of the H-H bond for the bound H2 molecule at the metal site. We find that both the phonon and rotational energy levels of the hydrogen molecule are closely similar, making the interpretation of the inelastic neutron scattering data difficult. Finally, we show that the orientation of H2 has a surprisingly large effect on the binding potential, reducing the classical binding energy by almost 30%. The implication of these results for the development of MOF materials for better hydrogen storage is discussed.

  20. Hydrogen adsorption in HKUST-1: a combined inelastic neutron scattering and first-principles study

    NASA Astrophysics Data System (ADS)

    Brown, Craig M.; Liu, Yun; Yildirim, Taner; Peterson, Vanessa K.; Kepert, Cameron J.

    2009-05-01

    Hydrogen adsorption in high surface area nanoporous coordination polymers has attracted a great deal of interest in recent years due to the potential applications in energy storage. Here we present combined inelastic neutron scattering measurements and detailed first-principles calculations aimed at unraveling the nature of hydrogen adsorption in HKUST-1 (Cu3(1,3,5-benzenetricarboxylate)2), a metal-organic framework (MOF) with unsaturated metal centers. We reveal that, in this system, the major contribution to the overall binding comes from the classical Coulomb interaction which is not screened due to the open metal site; this explains the relatively high binding energies and short H2-metal distances observed in MOFs with exposed metal sites as compared to traditional ones. Despite the short distances, there is no indication of an elongation of the H-H bond for the bound H2 molecule at the metal site. We find that both the phonon and rotational energy levels of the hydrogen molecule are closely similar, making the interpretation of the inelastic neutron scattering data difficult. Finally, we show that the orientation of H2 has a surprisingly large effect on the binding potential, reducing the classical binding energy by almost 30%. The implication of these results for the development of MOF materials for better hydrogen storage is discussed.

  1. Inhibition of cytochrome P450 3A by acetoxylated analogues of resveratrol in in vitro and in silico models

    NASA Astrophysics Data System (ADS)

    Basheer, Loai; Schultz, Keren; Kerem, Zohar

    2016-08-01

    Many dietary compounds, including resveratrol, are potent inhibitors of CYP3A4. Here we examined the potential to predict inhibition capacity of dietary polyphenolics using an in silico and in vitro approaches and synthetic model compounds. Mono, di, and tri-acetoxy resveratrol were synthesized, a cell line of human intestine origin and microsomes from rat liver served to determine their in vitro inhibition of CYP3A4, and compared to that of resveratrol. Docking simulation served to predict the affinity of the synthetic model compounds to the enzyme. Modelling of the enzyme’s binding site revealed three types of interaction: hydrophobic, electrostatic and H-bonding. The simulation revealed that each of the examined acetylations of resveratrol led to the loss of important interactions of all types. Tri-acetoxy resveratrol was the weakest inhibitor in vitro despite being the more lipophilic and having the highest affinity for the binding site. The simulation demonstrated exclusion of all interactions between tri-acetoxy resveratrol and the heme due to distal binding, highlighting the complexity of the CYP3A4 binding site, which may allow simultaneous accommodation of two molecules. Finally, the use of computational modelling may serve as a quick predictive tool to identify potential harmful interactions between dietary compounds and prescribed drugs.

  2. Tension-induced binding of semiflexible biopolymers

    NASA Astrophysics Data System (ADS)

    Benetatos, Panayotis; von der Heydt, Alice; Zippelius, Annette

    2015-03-01

    We investigate theoretically the effect of polymer tension on the collective behaviour of reversible cross-links. We use a model of two parallel-aligned, weakly-bending wormlike chains with a regularly spaced sequence of binding sites subjected to a tensile force. Reversible cross-links attach and detach at the binding sites with an affinity controlled by a chemical potential. In a mean-field approach, we calculate the free energy of the system and we show the emergence of a free energy barrier which controls the reversible (un)binding. The tension affects the conformational entropy of the chains which competes with the binding energy of the cross-links. This competition gives rise to a sudden increase in the fraction of bound sites as the polymer tension increases. The force-induced first-order transition in the number of cross-links implies a sudden force-induced stiffening of the effective stretching modulus of the polymers. This mechanism may be relevant to the formation and stress-induced strengthening of stress fibers in the cytoskeleton. We acknowledge support by the Deutsche Forschungsgemeinschaft (DFG) via grant SFB-937/A1.

  3. Identification of differentially expressed genes affecting hair and cashmere growth in the Laiwu black goat by microarray.

    PubMed

    Zhao, Jinshan; Li, Hegang; Liu, Kaidong; Zhang, Baoxun; Li, Peipei; He, Jianning; Cheng, Ming; De, Wei; Liu, Jifeng; Zhao, Yaofeng; Yang, Lihua; Liu, Nan

    2016-10-01

    Goats are an important source of fibers. In the present study microarray technology was used to investigate the potential genes primarily involved in hair and cashmere growth in the Laiwu black goat. A total of 655 genes differentially expressed in body (hair‑growing) and groin (hairless) skin were identified, and their potential association with hair and cashmere growth was analyzed. The majority of genes associated with hair growth regulation could be assigned to intracellular, intracellular organelle, membrane‑bound vesicle, cytoplasmic vesicle, pattern binding, heparin binding, polysaccharide binding, glycosaminoglycan binding and cytoplasmic membrane‑bound vesicle categories. Numerous genes upregulated in body compared with groin skin contained common motifs for nuclear factor 1A, Yi, E2 factor (E2F) and cyclic adenosine monophosphate response element binding (CREB)/CREBβ binding sites in their promoter region. The promoter region of certain genes downregulated in body compared with groin skin contained three common regions with LF‑A1, Yi, E2F, Collier/Olfactory‑1/early B‑cell factor 1, peroxisome proliferator‑activated receptor α or U sites. Thus, the present study identified molecules in the cashmere‑bearing skin area of the Laiwu black goat, which may contribute to hair and cashmere traits.

  4. Detoxification of cancerogenic compounds by lactic acid bacteria strains.

    PubMed

    Lili, Zhao; Junyan, Wei; Hongfei, Zhao; Baoqing, Zhu; Bolin, Zhang

    2017-10-20

    Carcinogens in food are an important issue that threat people's health right now. Lactic acid bacteria (LAB) strains as well-known probiotics have shown numerous perspectives in being used as a good food additive to confront cancerogenic compounds in recent years. Some LAB strains can remove cancerogenic compounds from medium environment via direct physical binding and avoid re-pollution of poisonous secondary metabolites which are generated from degradation of cancerogenic compounds. This article presents a whole overview of the physical-binding of LAB strains to such common cancerogenic compounds existed in food and feed environments as mycotoxins, polycyclic aromatic hydrocarbons (PAHs), heterocyclic amines (HAs) and pthalic acid esters (PAEs).In most cases, summaries of these published researches show that the binding of LAB strains to cancerogenic compounds is a physical process. Binding sites generally take place in cell wall, and peptidoglycan from LAB cells is the chief binding site. The adsorption of lactic acid bacteria to cancerogenic compounds is strain-specific. Specially, the strains from the two genera Lactobacillus and Bifidobacterium show a better potential in binding cancerogenic compounds. Moreover, we firstly used molecular dynamic computer model as a highly potential tool to simulate the binding behavior of peptidoglycan from Lactobacillus acidophilus to DBP, one of pthalic acid esters with genetic toxicity. It was seen that the theoretical data were quite consistent with the experimental results in terms of the ability of this bacterium to bind DBP. Also, the toxicity reduction of cancerogenic compounds by LAB strains could be achieved either in gastrointestinal model or animal tests and clinical researches as well. In conclusion, carefully selected LAB strains should be a good solution as one of safety strategies to reduce potential risk of cancerogenic compounds from food-based products.

  5. Atomic and molecular adsorption on Au(111)

    DOE PAGES

    Santiago-Rodriguez, Yohaselly; Herron, Jeffrey A.; Curet-Arana, Maria C.; ...

    2014-05-02

    Periodic self-consistent density functional theory (DFT-GGA) calculations were used to study the adsorption of several atomic species, molecular species and molecular fragments on the Au(111) surface with a coverage of 1/4 monolayer (ML). Binding geometries, binding energies, and diffusion barriers were calculated for 27 species. Furthermore, we calculated the surface deformation energy associated with the binding events. The binding strength for all the analyzed species can be ordered as follows: NH 3 < NO < CO < CH 3 < HCO < NH 2 < COOH < OH < HCOO < CNH 2 < H < N < NH

  6. Binding of copper to lysozyme: Spectroscopic, isothermal titration calorimetry and molecular docking studies

    NASA Astrophysics Data System (ADS)

    Jing, Mingyang; Song, Wei; Liu, Rutao

    2016-07-01

    Although copper is essential to all living organisms, its potential toxicity to human health have aroused wide concerns. Previous studies have reported copper could alter physical properties of lysozyme. The direct binding of copper with lysozyme might induce the conformational and functional changes of lysozyme and then influence the body's resistance to bacterial attack. To better understand the potential toxicity and toxic mechanisms of copper, the interaction of copper with lysozyme was investigated by biophysical methods including multi-spectroscopic measurements, isothermal titration calorimetry (ITC), molecular docking study and enzyme activity assay. Multi-spectroscopic measurements proved that copper quenched the intrinsic fluorescence of lysozyme in a static process accompanied by complex formation and conformational changes. The ITC results indicated that the binding interaction was a spontaneous process with approximately three thermodynamical binding sites at 298 K and the hydrophobic force is the predominant driven force. The enzyme activity was obviously inhibited by the addition of copper with catalytic residues Glu 35 and Asp 52 locating at the binding sites. This study helps to elucidate the molecular mechanism of the interaction between copper and lysozyme and provides reference for toxicological studies of copper.

  7. Surface potential-governed cellular osteogenic differentiation on ferroelectric polyvinylidene fluoride trifluoroethylene films.

    PubMed

    Tang, Bolin; Zhang, Bo; Zhuang, Junjun; Wang, Qi; Dong, Lingqing; Cheng, Kui; Weng, Wenjian

    2018-07-01

    Surface potential of biomaterials can dramatically influence cellular osteogenic differentiation. In this work, a wide range of surface potential on ferroelectric polyvinylidene fluoride trifluoroethylene (P(VDF-TrFE)) films was designed to get insight into the interfacial interaction of cell-charged surface. The P(VDF-TrFE) films poled by contact electric poling at various electric fields obtained well stabilized surface potential, with wide range from -3 to 915 mV. The osteogenic differentiation level of cells cultured on the films was strongly dependent on surface potential and reached the optimum at 391 mV in this system. Binding specificity assay indicated that surface potential could effectively govern the binding state of the adsorbed fibronectin (FN) with integrin. Molecular dynamic (MD) simulation further revealed that surface potential brought a significant difference in the relative distance between RGD and synergy PHSRN sites of adsorbed FN, resulting in a distinct integrin-FN binding state. These results suggest that the full binding of integrin α5β1 with both RGD and PHSRN sites of FN possesses a strong ability to activate osteogenic signaling pathway. This work sheds light on the underlying mechanism of osteogenic differentiation behavior on charged material surfaces, and also provides a guidance for designing a reasonable charged surface to enhance osteogenic differentiation. The ferroelectric P(VDF-TrFE) films with steady and a wide range of surface potential were designed to understand underlying mechanism of cell-charged surface interaction. The results showed that the charged surface well favored upregulation of osteogenic differentiation of MC3T3-E1 cells, and more importantly, a highest level occurred on the film with a moderate surface potential. Experiments and molecular dynamics simulation demonstrated that the surface potential could govern fibronectin conformation and then the integrin-fibronectin binding. We propose that a full binding state of integrin α5β1 with fibronectin induces effective activation of integrin-mediated FAK/ERK signaling pathway to upregulate cellular osteogenic differentiation. This work provides a guidance for designing a reasonable charged surface to enhance osteogenic differentiation. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  8. An adventitious interaction of filamin A with RhoGDI2(Tyr153Glu)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Mia; He, Qianjing; Berk, Benjamin-Andreas

    2016-01-15

    Filamin A (FLNA) is an actin filament crosslinking protein with multiple intracellular binding partners. Mechanical force exposes cryptic FLNA binding sites for some of these ligands. To identify new force-dependent binding interactions, we used a fusion construct composed of two FLNA domains, one of which was previously identified as containing a force-dependent binding site as a bait in a yeast two-hybrid system and identified the Rho dissociation inhibitor 2 (RhoGDI2) as a potential interacting partner. A RhoGDI2 truncate with 81 N-terminal amino acid residues and a phosphomimetic mutant, RhoGDI(Tyr153Glu) interacted with the FLNA construct. However, neither wild-type or full-length RhoGDI2 phosphorylatedmore » at Y153 interacted with FLNA. Our interpretation of these contradictions is that truncation and/or mutation of RhoGDI2 perturbs its conformation to expose a site that adventitiously binds FLNA and is not a bona–fide interaction. Therefore, previous studies reporting that a RhoGDI(Y153E) mutant suppresses the metastasis of human bladder cancer cells must be reinvestigated in light of artificial interaction of this point mutant with FLNA. - Highlights: • RhoGDI2 is identified as a potential filamin A (FLNA)-binding partner. • Phosphomimetic mutant, RhoGDI2(Tyr153Glu) interacts with FLNA. • RhoGDI2 phosphorylated (Tyr153) by src kinase does not interact with FLNA. • Mutation of Tyr-153 to Glu of RhoGDI2 does not mimic phosphorylation. • RhoGDI2(Tyr153Glu) provokes an adventitious interaction with FLNA.« less

  9. Computational characterization of how the VX nerve agent binds human serum paraoxonase 1.

    PubMed

    Fairchild, Steven Z; Peterson, Matthew W; Hamza, Adel; Zhan, Chang-Guo; Cerasoli, Douglas M; Chang, Wenling E

    2011-01-01

    Human serum paraoxonase 1 (HuPON1) is an enzyme that can hydrolyze various chemical warfare nerve agents including VX. A previous study has suggested that increasing HuPON1's VX hydrolysis activity one to two orders of magnitude would make the enzyme an effective countermeasure for in vivo use against VX. This study helps facilitate further engineering of HuPON1 for enhanced VX-hydrolase activity by computationally characterizing HuPON1's tertiary structure and how HuPON1 binds VX. HuPON1's structure is first predicted through two homology modeling procedures. Docking is then performed using four separate methods, and the stability of each bound conformation is analyzed through molecular dynamics and solvated interaction energy calculations. The results show that VX's lone oxygen atom has a strong preference for forming a direct electrostatic interaction with HuPON1's active site calcium ion. Various HuPON1 residues are also detected that are in close proximity to VX and are therefore potential targets for future mutagenesis studies. These include E53, H115, N168, F222, N224, L240, D269, I291, F292, and V346. Additionally, D183 was found to have a predicted pKa near physiological pH. Given D183's location in HuPON1's active site, this residue could potentially act as a proton donor or accepter during hydrolysis. The results from the binding simulations also indicate that steered molecular dynamics can potentially be used to obtain accurate binding predictions even when starting with a closed conformation of a protein's binding or active site.

  10. The 5-HT1A Receptor PET Radioligand 11C-CUMI-101 Has Significant Binding to α1-Adrenoceptors in Human Cerebellum, Limiting Its Use as a Reference Region.

    PubMed

    Shrestha, Stal S; Liow, Jeih-San; Jenko, Kimberly; Ikawa, Masamichi; Zoghbi, Sami S; Innis, Robert B

    2016-12-01

    Prazosin, a potent and selective α 1 -adrenoceptor antagonist, displaces 25% of 11 C-CUMI-101 ([O-methyl- 11 C]2-(4-(4-(2-methoxyphenyl)piperazin-1-yl)butyl)-4-methyl-1,2,4-triazine-3,5(2H,4H)dione) binding in monkey cerebellum. We sought to estimate the percentage contamination of 11 C-CUMI-101 binding to α 1 -adrenoceptors in human cerebellum under in vivo conditions. In vitro receptor-binding techniques were used to measure α 1 -adrenoceptor density and the affinity of CUMI-101 for these receptors in human, monkey, and rat cerebellum. Binding potential (maximum number of binding sites × affinity [(1/dissociation constant]) was determined using in vitro homogenate binding assays in human, monkey, and rat cerebellum. 3 H-prazosin was used to determine the maximum number of binding sites, as well as the dissociation constant of 3 H-prazosin and the inhibition constant of CUMI-101. α 1 -adrenoceptor density and the affinity of CUMI-101 for these receptors were similar across species. Cerebellar binding potentials were 3.7 for humans, 2.3 for monkeys, and 3.4 for rats. Reasoning by analogy, 25% of 11 C-CUMI-101 uptake in human cerebellum reflects binding to α 1 -adrenoceptors, suggesting that the cerebellum is of limited usefulness as a reference tissue for quantification in human studies. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  11. Binding site feature description of 2-substituted benzothiazoles as potential AcrAB-TolC efflux pump inhibitors in E. coli.

    PubMed

    Yilmaz, S; Altinkanat-Gelmez, G; Bolelli, K; Guneser-Merdan, D; Ufuk Over-Hasdemir, M; Aki-Yalcin, E; Yalcin, I

    2015-01-01

    The resistance-nodulation-division (RND) family efflux pumps are important in the antibiotic resistance of Gram-negative bacteria. However, although a number of bacterial RND efflux pump inhibitors have been developed, there has been no clinically available RND efflux pump inhibitor to date. A set of BSN-coded 2-substituted benzothiazoles were tested alone and in combinations with ciprofloxacin (CIP) against the AcrAB-TolC overexpressor Escherichia coli AG102 clinical strain. The results indicated that the BSN compounds did not show intrinsic antimicrobial activity when tested alone. However, when used in combinations with CIP, a reversal in the antibacterial activity of CIP with up to 10-fold better MIC values was observed. In order to describe the binding site features of these BSN compounds with AcrB, docking studies were performed using the CDocker method. The performed docking poses and the calculated binding energy scores revealed that the tested compounds BSN-006, BSN-023, and BSN-004 showed significant binding interactions with the phenylalanine-rich region in the distal binding site of the AcrB binding monomer. Moreover, the tested compounds BSN-006 and BSN-023 possessed stronger binding energies than CIP, verifying that BSN compounds are acting as the putative substrates of AcrB.

  12. Deconstructing the DGAT1 enzyme: membrane interactions at substrate binding sites.

    PubMed

    Lopes, Jose L S; Beltramini, Leila M; Wallace, Bonnie A; Araujo, Ana P U

    2015-01-01

    Diacylglycerol acyltransferase 1 (DGAT1) is a key enzyme in the triacylglyceride synthesis pathway. Bovine DGAT1 is an endoplasmic reticulum membrane-bound protein associated with the regulation of fat content in milk and meat. The aim of this study was to evaluate the interaction of DGAT1 peptides corresponding to putative substrate binding sites with different types of model membranes. Whilst these peptides are predicted to be located in an extramembranous loop of the membrane-bound protein, their hydrophobic substrates are membrane-bound molecules. In this study, peptides corresponding to the binding sites of the two substrates involved in the reaction were examined in the presence of model membranes in order to probe potential interactions between them that might influence the subsequent binding of the substrates. Whilst the conformation of one of the peptides changed upon binding several types of micelles regardless of their surface charge, suggesting binding to hydrophobic domains, the other peptide bound strongly to negatively-charged model membranes. This binding was accompanied by a change in conformation, and produced leakage of the liposome-entrapped dye calcein. The different hydrophobic and electrostatic interactions observed suggest the peptides may be involved in the interactions of the enzyme with membrane surfaces, facilitating access of the catalytic histidine to the triacylglycerol substrates.

  13. Identification of an inhibitory Zn2+ binding site on the human glycine receptor α1 subunit

    PubMed Central

    Harvey, Robert J; Thomas, Philip; James, Colin H; Wilderspin, Andrew; Smart, Trevor G

    1999-01-01

    Whole-cell glycine-activated currents were recorded from human embryonic kidney (HEK) cells expressing wild-type and mutant recombinant homomeric glycine receptors (GlyRs) to locate the inhibitory binding site for Zn2+ ions on the human α1 subunit. Glycine-activated currents were potentiated by low concentrations of Zn2+ (<10 μm) and inhibited by higher concentrations (>100 μm) on wild-type α1 subunit GlyRs. Lowering the external pH from 7.4 to 5.4 inhibited the glycine responses in a competitive manner. The inhibition caused by Zn2+ was abolished leaving an overt potentiating effect at 10 μm Zn2+ that was exacerbated at 100 μm Zn2+. The identification of residues involved in the formation of the inhibitory binding site was also assessed using diethylpyrocarbonate (DEPC), which modifies histidines. DEPC (1 mm) abolished Zn2+-induced inhibition and also the potentiation of glycine-activated currents by Zn2+. The reduction in glycine-induced whole-cell currents in the presence of high (100 μm) concentrations of Zn2+ did not increase the rate of glycine receptor desensitisation. Systematic mutation of extracellular histidine residues in the GlyR α1 subunit revealed that mutations H107A or H109A completely abolished inhibition of glycine-gated currents by Zn2+. However, mutation of other external histidines, H210, H215 and H419, failed to prevent inhibition by Zn2+ of glycine-gated currents. Thus, H107 and H109 in the extracellular domain of the human GlyR α1 subunit are major determinants of the inhibitory Zn2+ binding site. An examination of Zn2+ co-ordination in metalloenzymes revealed that the histidine- hydrophobic residue-histidine motif found to be responsible for binding Zn2+ in the human GlyR α1 subunit is also shared by some of these enzymes. Further comparison of the structure and location of this motif with a generic model of the GlyR α1 subunit suggests that H107 and H109 participate in the formation of the inhibitory Zn2+ binding site at the apex of a β sheet in the N-terminal extracellular domain. PMID:10517800

  14. Marked reduction in the number of platelet-tritiated imipramine binding sites in geriatric depression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemeroff, C.B.; Knight, D.L.; Krishnan, R.R.

    The number (Bmax) and affinity (Kd) of platelet-tritiated imipramine binding sites was determined in young and middle-aged controls 50 years of age and younger (n = 25), elderly normal controls over 60 years of age (n = 18), patients who fulfilled DSM-III criteria for major depression who were under 50 years of age (n = 29), patients who fulfilled DSM-III criteria for major depression who were 60 years of age and older (n = 19), and patients who fulfilled both DSM-III criteria for primary degenerative dementia and National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disordersmore » Association criteria for probable Alzheimer's disease (n = 13). Both groups of depressed patients (under 50 and over 60 years of age) exhibited significant reductions (decreases 42%) in the number of platelet-tritiated imipramine binding sites with no change in affinity, when compared with their age-matched controls. There was little overlap in Bmax values between the elderly depressed patients and their controls. The patients with probable Alzheimer's disease showed no alteration in platelet-tritiated imipramine binding. There was no statistically significant relationship between postdexamethasone plasma cortisol concentrations and tritiated imipramine binding. These results indicate that platelet-tritiated imipramine binding may have potential utility as a diagnostic adjunct in geriatric depression, and moreover that the reduction in the number of platelet-tritiated imipramine binding sites is not due to hypercortisolemia.« less

  15. Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

    2016-06-01

    The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  16. Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

    PubMed Central

    Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

    2012-01-01

    One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

  17. A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

    PubMed

    Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

    2017-09-20

    Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

  18. An Iron Reservoir to the Catalytic Metal

    PubMed Central

    Liu, Fange; Geng, Jiafeng; Gumpper, Ryan H.; Barman, Arghya; Davis, Ian; Ozarowski, Andrew; Hamelberg, Donald; Liu, Aimin

    2015-01-01

    The rubredoxin motif is present in over 74,000 protein sequences and 2,000 structures, but few have known functions. A secondary, non-catalytic, rubredoxin-like iron site is conserved in 3-hydroxyanthranilate 3,4-dioxygenase (HAO), from single cellular sources but not multicellular sources. Through the population of the two metal binding sites with various metals in bacterial HAO, the structural and functional relationship of the rubredoxin-like site was investigated using kinetic, spectroscopic, crystallographic, and computational approaches. It is shown that the first metal presented preferentially binds to the catalytic site rather than the rubredoxin-like site, which selectively binds iron when the catalytic site is occupied. Furthermore, an iron ion bound to the rubredoxin-like site is readily delivered to an empty catalytic site of metal-free HAO via an intermolecular transfer mechanism. Through the use of metal analysis and catalytic activity measurements, we show that a downstream metabolic intermediate can selectively remove the catalytic iron. As the prokaryotic HAO is often crucial for cell survival, there is a need for ensuring its activity. These results suggest that the rubredoxin-like site is a possible auxiliary iron source to the catalytic center when it is lost during catalysis in a pathway with metabolic intermediates of metal-chelating properties. A spare tire concept is proposed based on this biochemical study, and this concept opens up a potentially new functional paradigm for iron-sulfur centers in iron-dependent enzymes as transient iron binding and shuttling sites to ensure full metal loading of the catalytic site. PMID:25918158

  19. Mistletoe lectin I in complex with galactose and lactose reveals distinct sugar-binding properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikeska, Ruth; Wacker, Roland; Arni, Raghuvir

    2005-01-01

    The structures of mistletoe lectin I in complex with lactose and galactose reveal differences in binding by the two known sites in subdomains α1 and γ2 and suggest the presence of a third low-affinity site in subdomain β1. The structures of mistletoe lectin I (ML-I) from Viscum album complexed with lactose and galactose have been determined at 2.3 Å resolution and refined to R factors of 20.9% (R{sub free} = 23.6%) and 20.9 (R{sub free} = 24.6%), respectively. ML-I is a heterodimer and belongs to the class of ribosome-inactivating proteins of type II, which consist of two chains. The A-chainmore » has rRNA N-glycosidase activity and irreversibly inhibits eukaryotic ribosomes. The B-chain is a lectin and preferentially binds to galactose-terminated glycolipids and glycoproteins on cell membranes. Saccharide binding is performed by two binding sites in subdomains α1 and γ2 of the ML-I B-chain separated by ∼62 Å from each other. The favoured binding of galactose in subdomain α1 is achieved via hydrogen bonds connecting the 4-hydroxyl and 3-hydroxyl groups of the sugar moiety with the side chains of Asp23B, Gln36B and Lys41B and the main chain of 26B. The aromatic ring of Trp38B on top of the preferred binding pocket supports van der Waals packing of the apolar face of galactose and stabilizes the sugar–lectin complex. In the galactose-binding site II of subdomain γ2, Tyr249B provides the hydrophobic stacking and the side chains of Asp235B, Gln238B and Asn256B are hydrogen-bonding partners for galactose. In the case of the galactose-binding site I, the 2-hydroxyl group also stabilizes the sugar–protein complex, an interaction thus far rarely detected in galactose-specific lectins. Finally, a potential third low-affinity galactose-binding site in subunit β1 was identified in the present ML-I structures, in which a glycerol molecule from the cryoprotectant buffer has bound, mimicking the sugar compound.« less

  20. Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

    PubMed Central

    Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

    2012-01-01

    The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

  1. Myosin binding protein C positioned to play a key role in regulation of muscle contraction: structure and interactions of domain C1.

    PubMed

    Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Le Masurier, Clare; Gautel, Mathias; Pfuhl, Mark

    2008-12-19

    Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1-S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (K(d) of approximately 10-20 microM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1-S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1-C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation.

  2. Myosin Binding Protein C Positioned to Play a Key Role in Regulation of Muscle Contraction: Structure and Interactions of Domain C1

    PubMed Central

    Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Masurier, Clare Le; Gautel, Mathias; Pfuhl, Mark

    2008-01-01

    Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1–S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (Kd of approximately 10–20 μM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1–S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1–C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation. PMID:18926831

  3. CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

    PubMed Central

    Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

    2011-01-01

    The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

  4. Differential Effects of Structural Modifications on the Competition of Chalcones for the PIB Amyloid Imaging Ligand-Binding Site in Alzheimer's Disease Brain and Synthetic Aβ Fibrils.

    PubMed

    Fosso, Marina Y; McCarty, Katie; Head, Elizabeth; Garneau-Tsodikova, Sylvie; LeVine, Harry

    2016-02-17

    Alzheimer's disease (AD) is a complex brain disorder that still remains ill defined. In order to understand the significance of binding of different clinical in vivo imaging ligands to the polymorphic pathological features of AD brain, the molecular characteristics of the ligand interacting with its specific binding site need to be defined. Herein, we observed that tritiated Pittsburgh Compound B ((3)H-PIB) can be displaced from synthetic Aβ(1-40) and Aβ(1-42) fibrils and from the PIB binding complex purified from human AD brain (ADPBC) by molecules containing a chalcone structural scaffold. We evaluated how substitution on the chalcone scaffold alters its ability to displace (3)H-PIB from the synthetic fibrils and ADPBC. By comparing unsubstituted core chalcone scaffolds along with the effects of bromine and methyl substitution at various positions, we found that attaching a hydroxyl group on the ring adjacent to the carbonyl group (ring I) of the parent member of the chalcone family generally improved the binding affinity of chalcones toward ADPBC and synthetic fibrils F40 and F42. Furthermore, any substitution on ring I at the ortho-position of the carbonyl group greatly decreases the binding affinity of the chalcones, potentially as a result of steric hindrance. Together with the finding that neither our chalcones nor PIB interact with the Congo Red/X-34 binding site, these molecules provide new tools to selectively probe the PIB binding site that is found in human AD brain, but not in brains of AD pathology animal models. Our chalcone derivatives also provide important information on the effects of fibril polymorphism on ligand binding.

  5. Molecular Dynamics Simulations of Family 7 Cellobiohydrolase Mutants Aimed at Reducing Product Inhibition.

    PubMed

    Silveira, Rodrigo L; Skaf, Munir S

    2015-07-23

    Enzymatic conversion of lignocellulosic biomass into biofuels and chemicals constitutes a potential route for sustainable development. Cellobiohydrolases are key enzymes used in industrial cocktails for depolymerization of crystalline cellulose, and their mechanism of action has been intensely studied in the past several years. Provided with a tunnel-like substrate-binding cavity, cellobiohydrolases possess the ability to processively hydrolyze glycosidic bonds of crystalline cellulose, yielding one molecule of cellobiose per catalytic cycle. As such, cellobiose expulsion from the product binding site is a necessary step in order to allow for the processive hydrolysis mechanism. However, the high-affinity binding of cellobiose to the enzyme impairs the process and causes activity inhibition due to reaction products. Here, we use molecular dynamics simulations to study the binding of cellobiose to the Trichoderma reesei Cel7A (TrCel7A) cellobiohydrolase and the effects of mutations that reduce cellobiose binding, without affecting the structural and dynamical integrities of the enzyme. We observe that the product binding site exhibits an intrinsic flexibility that can sterically hinder cellobiose release. Several point mutations in the product binding site reduce cellobiose-enzyme interactions, but not all modifications are able to maintain the structural integrity of the enzyme. In particular, mutation of charged residues in the TrCel7A product binding site causes perturbations that affect the structure of the loops that form the substrate-binding tunnel of the enzyme and, hence, may affect TrCel7A function in other steps of the hydrolysis mechanism. Our results suggest there is a trade-off between product inhibition and catalytic efficiency, and they provide directions for cellulases engineering.

  6. Determining Membrane Protein-Lipid Binding Thermodynamics Using Native Mass Spectrometry.

    PubMed

    Cong, Xiao; Liu, Yang; Liu, Wen; Liang, Xiaowen; Russell, David H; Laganowsky, Arthur

    2016-04-06

    Membrane proteins are embedded in the biological membrane where the chemically diverse lipid environment can modulate their structure and function. However, the thermodynamics governing the molecular recognition and interaction of lipids with membrane proteins is poorly understood. Here, we report a method using native mass spectrometry (MS), to determine thermodynamics of individual ligand binding events to proteins. Unlike conventional methods, native MS can resolve individual ligand binding events and, coupled with an apparatus to control the temperature, determine binding thermodynamic parameters, such as for protein-lipid interactions. We validated our approach using three soluble protein-ligand systems (maltose binding protein, lysozyme, and nitrogen regulatory protein) and obtained similar results to those using isothermal titration calorimetry and surface plasmon resonance. We also determined for the first time the thermodynamics of individual lipid binding to the ammonia channel (AmtB), an integral membrane protein from Escherichia coli. Remarkably, we observed distinct thermodynamic signatures for the binding of different lipids and entropy-enthalpy compensation for binding lipids of variable chain length. Additionally, using a mutant form of AmtB that abolishes a specific phosphatidylglycerol (PG) binding site, we observed distinct changes in the thermodynamic signatures for binding PG, implying these signatures can identify key residues involved in specific lipid binding and potentially differentiate between specific lipid binding sites.

  7. Preferential binding of daunomycin to 5'ATCG and 5'ATGC sequences revealed by footprinting titration experiments.

    PubMed

    Chaires, J B; Herrera, J E; Waring, M J

    1990-07-03

    Results from a high-resolution deoxyribonuclease I (DNase I) footprinting titration procedure are described that identify preferred daunomycin binding sites within the 160 bp tyr T DNA fragment. We have obtained single-bond resolution at 65 of the 160 potential binding sites within the tyr T fragment and have examined the effect of 0-3.0 microM total daunomycin concentration on the susceptibility of these sites toward digestion by DNase I. Four types of behavior are observed: (i) protection from DNase I cleavage; (ii) protection, but only after reaching a critical total daunomycin concentration; (iii) enhanced cleavage; (iv) no effect of added drug. Ten sites were identified as the most strongly protected on the basis of the magnitude of the reduction of their digestion product band areas in the presence of daunomycin. These were identified as the preferred daunomycin binding sites. Seven of these 10 sites are found at the end of the triplet sequences 5'ATGC and 5'ATCG, where the notation AT indicates that either A or T may occupy the position. The remaining three strongly protected sites are found at the ends of the triplet sequence 5'ATCAT. Of the preferred daunomycin binding sites we identify in this study, the sequence 5'ATCG is consistent with the specificity predicted by the theoretical studies of Chen et al. [Chen, K.-X., Gresh, N., & Pullman, B. (1985) J. Biomol. Struct. Dyn. 3, 445-466] and is the very sequence to which daunomycin is observed to be bound in two recent X-ray crystallographic studies. Solution studies, theoretical studies, and crystallographic studies have thus converged to provide a consistent and coherent picture of the sequence preference of this important anticancer antibiotic.

  8. NF-Y, a CCAAT box-binding protein, is one of the trans-acting factors necessary for the response of the murine ERp72 gene to protein traffic.

    PubMed

    Marcus, N; Green, M

    1997-09-01

    The accumulation of incompletely assembled immunoglobulin mu heavy chain in transfected COS cells stimulates the cellular response to protein traffic that results in the increased transcription and elevated synthesis of several ER chaperones, including ERP72, a member of the protein disulfide isomerase family of molecular chaperones. The ERp72 promoter contains an 82 bp ER protein traffic response element (ERPTRE) that is sufficient to mediate this response. Previously, it had been shown that the alteration of a putative AP-2 site and a CCAAT and inverted CCAAT site within the ERPTRE significantly decreased the response of ERp72 promoter to mu chain accumulation. We have extended these findings by demonstrating a role for NF-Y and a potentially novel DNA-binding protein in the regulation of transcription from the ERp72 promoter. The fact that NF-Y binding to the ERPTRE is observed in extracts from both control cells and cells in which the response to protein traffic has been activated indicates that the binding of NF-Y, while necessary, is not sufficient to account for the response. Each of the two CCAAT sites in the ERPTRE can bind NF-Y independently, but both sites must be intact for full ERPTRE function. A second protein can bind to the ERPTRE independently of NF-Y and at a site overlapping or close to the 3' end of the reverse CCAAT site. It is possible that interactions between NF-Y, this protein and perhaps other factors are responsible for the regulation of the protein traffic response.

  9. Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

    PubMed Central

    2015-01-01

    ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

  10. Computational Tools for Allosteric Drug Discovery: Site Identification and Focus Library Design.

    PubMed

    Huang, Wenkang; Nussinov, Ruth; Zhang, Jian

    2017-01-01

    Allostery is an intrinsic phenomenon of biological macromolecules involving regulation and/or signal transduction induced by a ligand binding to an allosteric site distinct from a molecule's active site. Allosteric drugs are currently receiving increased attention in drug discovery because drugs that target allosteric sites can provide important advantages over the corresponding orthosteric drugs including specific subtype selectivity within receptor families. Consequently, targeting allosteric sites, instead of orthosteric sites, can reduce drug-related side effects and toxicity. On the down side, allosteric drug discovery can be more challenging than traditional orthosteric drug discovery due to difficulties associated with determining the locations of allosteric sites and designing drugs based on these sites and the need for the allosteric effects to propagate through the structure, reach the ligand binding site and elicit a conformational change. In this study, we present computational tools ranging from the identification of potential allosteric sites to the design of "allosteric-like" modulator libraries. These tools may be particularly useful for allosteric drug discovery.

  11. The photostability of the commonly used biotin-4-fluorescein probe.

    PubMed

    Haack, Richard A; Swift, Kerry M; Ruan, Qiaoqiao; Himmelsbach, Richard J; Tetin, Sergey Y

    2017-08-15

    Biotin-4-fluorescein (B4F) is a commonly used fluorescent probe for studying biotin-(strept)avidin interactions. During a characterization study of an anti-biotin antibody, using B4F as the probe, we noticed a discrepancy in the expected and experimentally determined number of biotin binding sites. Analytical testing showed that the biotin moiety in the probe undergoes a photosensitized oxidation to produce a mixture of biotin sulfoxides which has the potential to impact the quantitation of binding sites using this fluorescent probe. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

    PubMed

    Aslanoglu, Mehmet

    2006-03-01

    The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

  13. [Molecular docking of chlorogenic acid, 3,4-di-O-caffeoylquinic acid and 3,5-di-O-caffeoylquinic acid with human serum albumin].

    PubMed

    Zhou, Jing; Ma, Hong-yue; Fan, Xin-sheng; Xiao, Wei; Wang, Tuan-jie

    2012-10-01

    To investigate the mechanism of binding of human serum albumin (HSA) with potential sensitinogen, including chlorogenic acid and two isochlorogenic acids (3,4-di-O-caffeoylquinic acid and 3,5-di-O-caffeoylquinic acid). By using the docking algorithm of computer-aided molecular design and the Molegro Virtual Docker, the crystal structures of HSA with warfarin and diazepam (Protein Data Bank ID: 2BXD and 2BXF) were selected as molecular docking receptors of HSA sites I and II. According to docking scores, key residues and H-bond, the molecular docking mode was selected and confirmed. The molecular docking of chlorogenic acid and two isochlorogenic acids on sites I and II was compared based on the above design. The results from molecular docking indicated that chlorogenic acid, 3,4-di-O-caffeoylquinic acid and 3,5-di-O-caffeoylquinic acid could bind to HSA site I by high affinity scores of -112.3, -155.3 and -153.1, respectively. They could bind to site II on HSA by high affinity scores of -101.7, -138.5 and -133.4, respectively. In site I, two isochlorogenic acids interacted with the key apolar side-chains of Leu238 and Ala291 by higher affinity scores than chlorogenic acid. Furthermore, the H-bonds of isochlorogenic acids with polar residues inside the pocket and at the entrance of the pocket were different from chlorogenic acid. Moreover, the second coffee acyl of isochlorogenic acid occupied the right-hand apolar compartment in the pocket of HSA site I. In site I, the second coffee acyl of isochlorogenic acid formed the H-bonds with polar side-chains, which contributed isochlorogenic acid to binding with site II of HSA. The isochlorogenic acids with two coffee acyls have higher binding abilities with HSA than chlorogenic acid with one coffee acyl, suggesting that isochlorogenic acids binding with HSA may be sensitinogen.

  14. Snake Cytotoxins Bind to Membranes via Interactions with Phosphatidylserine Head Groups of Lipids

    PubMed Central

    Konshina, Anastasia G.; Boldyrev, Ivan A.; Utkin, Yuri N.; Omel'kov, Anton V.; Efremov, Roman G.

    2011-01-01

    The major representatives of Elapidae snake venom, cytotoxins (CTs), share similar three-fingered fold and exert diverse range of biological activities against various cell types. CT-induced cell death starts from the membrane recognition process, whose molecular details remain unclear. It is known, however, that the presence of anionic lipids in cell membranes is one of the important factors determining CT-membrane binding. In this work, we therefore investigated specific interactions between one of the most abundant of such lipids, phosphatidylserine (PS), and CT 4 of Naja kaouthia using a combined, experimental and modeling, approach. It was shown that incorporation of PS into zwitterionic liposomes greatly increased the membrane-damaging activity of CT 4 measured by the release of the liposome-entrapped calcein fluorescent dye. The CT-induced leakage rate depends on the PS concentration with a maximum at approximately 20% PS. Interestingly, the effects observed for PS were much more pronounced than those measured for another anionic lipid, sulfatide. To delineate the potential PS binding sites on CT 4 and estimate their relative affinities, a series of computer simulations was performed for the systems containing the head group of PS and different spatial models of CT 4 in aqueous solution and in an implicit membrane. This was done using an original hybrid computational protocol implementing docking, Monte Carlo and molecular dynamics simulations. As a result, at least three putative PS-binding sites with different affinities to PS molecule were delineated. Being located in different parts of the CT molecule, these anion-binding sites can potentially facilitate and modulate the multi-step process of the toxin insertion into lipid bilayers. This feature together with the diverse binding affinities of the sites to a wide variety of anionic targets on the membrane surface appears to be functionally meaningful and may adjust CT action against different types of cells. PMID:21559494

  15. The structural basis of secondary active transport mechanisms.

    PubMed

    Forrest, Lucy R; Krämer, Reinhard; Ziegler, Christine

    2011-02-01

    Secondary active transporters couple the free energy of the electrochemical potential of one solute to the transmembrane movement of another. As a basic mechanistic explanation for their transport function the model of alternating access was put forward more than 40 years ago, and has been supported by numerous kinetic, biochemical and biophysical studies. According to this model, the transporter exposes its substrate binding site(s) to one side of the membrane or the other during transport catalysis, requiring a substantial conformational change of the carrier protein. In the light of recent structural data for a number of secondary transport proteins, we analyze the model of alternating access in more detail, and correlate it with specific structural and chemical properties of the transporters, such as their assignment to different functional states in the catalytic cycle of the respective transporter, the definition of substrate binding sites, the type of movement of the central part of the carrier harboring the substrate binding site, as well as the impact of symmetry on fold-specific conformational changes. Besides mediating the transmembrane movement of solutes, the mechanism of secondary carriers inherently involves a mechanistic coupling of substrate flux to the electrochemical potential of co-substrate ions or solutes. Mainly because of limitations in resolution of available transporter structures, this important aspect of secondary transport cannot yet be substantiated by structural data to the same extent as the conformational change aspect. We summarize the concepts of coupling in secondary transport and discuss them in the context of the available evidence for ion binding to specific sites and the impact of the ions on the conformational state of the carrier protein, which together lead to mechanistic models for coupling. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Targeting the disordered C-terminus of PTP1B with an allosteric inhibitor

    PubMed Central

    Krishnan, Navasona; Koveal, Dorothy; Miller, Daniel H.; Xue, Bin; Akshinthala, Sai Dipikaa; Kragelj, Jaka; Jensen, Malene Ringkjøbing; Gauss, Carla-Maria; Page, Rebecca; Blackledge, Martin; Muthuswamy, Senthil K.; Peti, Wolfgang; Tonks, Nicholas K.

    2014-01-01

    PTP1B, a validated therapeutic target for diabetes and obesity, plays a critical positive role in HER2 signaling in breast tumorigenesis. Efforts to develop therapeutic inhibitors of PTP1B have been frustrated by the chemical properties of the active site. We defined a novel mechanism of allosteric inhibition that targets the C-terminal, non-catalytic segment of PTP1B. We present the first ensemble structure of PTP1B containing this intrinsically disordered segment, within which we identified a binding site for the small molecule inhibitor, MSI-1436. We demonstrate binding to a second site close to the catalytic domain, with cooperative effects between the two sites locking PTP1B in an inactive state. MSI-1436 antagonized HER2 signaling, inhibited tumorigenesis in xenografts and abrogated metastasis in the NDL2 mouse model of breast cancer, validating inhibition of PTP1B as a therapeutic strategy in breast cancer. This new approach to inhibition of PTP1B emphasizes the potential of disordered segments of proteins as specific binding sites for therapeutic small molecules. PMID:24845231

  17. An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

    PubMed

    Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

    2014-01-01

    Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

  18. Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors

    PubMed Central

    Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram

    2012-01-01

    The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn91 in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus. PMID:22642577

  19. Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors.

    PubMed

    Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram

    2012-06-15

    The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn(91) in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus.

  20. Sulfated Metabolites of Polychlorinated Biphenyls Are High-Affinity Ligands for the Thyroid Hormone Transport Protein Transthyretin

    PubMed Central

    Grimm, Fabian A.; Lehmler, Hans-Joachim; He, Xianran; Robertson, Larry W.

    2013-01-01

    Background: The displacement of l-thyroxine (T4) from binding sites on transthyretin (TTR) is considered a significant contributing mechanism in polychlorinated biphenyl (PCB)-induced thyroid disruption. Previous research has discovered hydroxylated PCB metabolites (OH-PCBs) as high-affinity ligands for TTR, but the binding potential of conjugated PCB metabolites such as PCB sulfates has not been explored. Objectives: We evaluated the binding of five lower-chlorinated PCB sulfates to human TTR and compared their binding characteristics to those determined for their OH-PCB precursors and for T4. Methods: We used fluorescence probe displacement studies and molecular docking simulations to characterize the binding of PCB sulfates to TTR. The stability of PCB sulfates and the reversibility of these interactions were characterized by HPLC analysis of PCB sulfates after their binding to TTR. The ability of OH-PCBs to serve as substrates for human cytosolic sulfotransferase 1A1 (hSULT1A1) was assessed by OH-PCB–dependent formation of adenosine-3´,5´-diphosphate, an end product of the sulfation reaction. Results: All five PCB sulfates were able to bind to the high-affinity binding site of TTR with equilibrium dissociation constants (Kd values) in the low nanomolar range (4.8–16.8 nM), similar to that observed for T4 (4.7 nM). Docking simulations provided corroborating evidence for these binding interactions and indicated multiple high-affinity modes of binding. All OH-PCB precursors for these sulfates were found to be substrates for hSULT1A1. Conclusions: Our findings show that PCB sulfates are high-affinity ligands for human TTR and therefore indicate, for the first time, a potential relevance for these metabolites in PCB-induced thyroid disruption. PMID:23584369

  1. Stoichiometry and kinetics of mercury uptake by photosynthetic bacteria.

    PubMed

    Kis, Mariann; Sipka, Gábor; Maróti, Péter

    2017-05-01

    Mercury adsorption on the cell surface and intracellular uptake by bacteria represent the key first step in the production and accumulation of highly toxic mercury in living organisms. In this work, the biophysical characteristics of mercury bioaccumulation are studied in intact cells of photosynthetic bacteria by use of analytical (dithizone) assay and physiological photosynthetic markers (pigment content, fluorescence induction, and membrane potential) to determine the amount of mercury ions bound to the cell surface and taken up by the cell. It is shown that the Hg(II) uptake mechanism (1) has two kinetically distinguishable components, (2) includes co-opted influx through heavy metal transporters since the slow component is inhibited by Ca 2+ channel blockers, (3) shows complex pH dependence demonstrating the competition of ligand binding of Hg(II) ions with H + ions (low pH) and high tendency of complex formation of Hg(II) with hydroxyl ions (high pH), and (4) is not a passive but an energy-dependent process as evidenced by light activation and inhibition by protonophore. Photosynthetic bacteria can accumulate Hg(II) in amounts much (about 10 5 ) greater than their own masses by well-defined strong and weak binding sites with equilibrium binding constants in the range of 1 (μM) -1 and 1 (mM) -1 , respectively. The strong binding sites are attributed to sulfhydryl groups as the uptake is blocked by use of sulfhydryl modifying agents and their number is much (two orders of magnitude) smaller than the number of weak binding sites. Biofilms developed by some bacteria (e.g., Rvx. gelatinosus) increase the mercury binding capacity further by a factor of about five. Photosynthetic bacteria in the light act as a sponge of Hg(II) and can be potentially used for biomonitoring and bioremediation of mercury-contaminated aqueous cultures.

  2. Inhibition of cytochrome P450 3A by acetoxylated analogues of resveratrol in in vitro and in silico models

    PubMed Central

    Basheer, Loai; Schultz, Keren; Kerem, Zohar

    2016-01-01

    Many dietary compounds, including resveratrol, are potent inhibitors of CYP3A4. Here we examined the potential to predict inhibition capacity of dietary polyphenolics using an in silico and in vitro approaches and synthetic model compounds. Mono, di, and tri-acetoxy resveratrol were synthesized, a cell line of human intestine origin and microsomes from rat liver served to determine their in vitro inhibition of CYP3A4, and compared to that of resveratrol. Docking simulation served to predict the affinity of the synthetic model compounds to the enzyme. Modelling of the enzyme’s binding site revealed three types of interaction: hydrophobic, electrostatic and H-bonding. The simulation revealed that each of the examined acetylations of resveratrol led to the loss of important interactions of all types. Tri-acetoxy resveratrol was the weakest inhibitor in vitro despite being the more lipophilic and having the highest affinity for the binding site. The simulation demonstrated exclusion of all interactions between tri-acetoxy resveratrol and the heme due to distal binding, highlighting the complexity of the CYP3A4 binding site, which may allow simultaneous accommodation of two molecules. Finally, the use of computational modelling may serve as a quick predictive tool to identify potential harmful interactions between dietary compounds and prescribed drugs. PMID:27530542

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osipiuk, J.; Gornicki, P.; Maj, L.

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less

  4. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

    PubMed

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

    2001-11-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  5. Cd and proton adsorption onto bacterial consortia grown from industrial wastes and contaminated geologic settings.

    PubMed

    Borrok, David M; Fein, Jeremy B; Kulpa, Charles F

    2004-11-01

    To model the effects of bacterial metal adsorption in contaminated environments, results from metal adsorption experiments involving individual pure stains of bacteria must be extrapolated to systems in which potentially dozens of bacterial species are present. This extrapolation may be made easier because bacterial consortia from natural environments appear to exhibit similar metal binding properties. However, bacteria that thrive in highly perturbed contaminated environments may exhibit significantly different adsorptive behavior. Here we measure proton and Cd adsorption onto a range of bacterial consortia grown from heavily contaminated industrial wastes, groundwater, and soils. We model the results using a discrete site surface complexation approach to determine binding constants and site densities for each consortium. The results demonstrate that bacterial consortia from different contaminated environments exhibit a range of total site densities (approximately a 3-fold difference) and Cd-binding constants (approximately a 10-fold difference). These ranges for Cd binding constants may be small enough to suggest that bacteria-metal adsorption in contaminated environments can be described using relatively few "averaged" bacteria-metal binding constants (in conjunction with the necessary binding constants for competing surfaces and ligands). However, if additional precision is necessary, modeling parameters must be developed separately for each contaminated environment of interest.

  6. Species Differences in the Binding of Sodium 4-Phenylbutyrate to Serum Albumin.

    PubMed

    Yamasaki, Keishi; Enokida, Taisuke; Taguchi, Kazuaki; Miyamura, Shigeyuki; Kawai, Akito; Miyamoto, Shuichi; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2017-09-01

    Sodium 4-phenylbutyrate (PB) is clinically used as a drug for treating urea cycle disorders. Recent research has shown that PB also has other pharmacologic activities, suggesting that it has the potential for use as a drug for treating other disorders. In the process of drug development, preclinical testing using experimental animals is necessary to verify the efficacy and safety of PB. Although the binding of PB to human albumin has been studied, our knowledge of its binding to albumin from the other animal species is extremely limited. To address this issue, we characterized the binding of PB to albumin from several species (human, bovine, rabbit, and rat). The results indicated that PB interacts with 1 high-affinity site of albumin from these species, which corresponds to site II of human albumin. The affinities of PB to human and bovine albumins were higher than those to rabbit and rat albumin, and that to rabbit albumin was the lowest. Binding and molecular docking studies using structurally related compounds of PB suggested that species differences in the affinity are attributed to differences in the structural feature of the PB-binding sites on albumins (e.g., charge distribution, hydrophobicity, shape, or size). Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  7. Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors

    PubMed Central

    Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

    2010-01-01

    Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259

  8. Molecular simulations of multimodal ligand-protein binding: elucidation of binding sites and correlation with experiments.

    PubMed

    Freed, Alexander S; Garde, Shekhar; Cramer, Steven M

    2011-11-17

    Multimodal chromatography, which employs more than one mode of interaction between ligands and proteins, has been shown to have unique selectivity and high efficacy for protein purification. To test the ability of free solution molecular dynamics (MD) simulations in explicit water to identify binding regions on the protein surface and to shed light on the "pseudo affinity" nature of multimodal interactions, we performed MD simulations of a model protein ubiquitin in aqueous solution of free ligands. Comparisons of MD with NMR spectroscopy of ubiquitin mutants in solutions of free ligands show a good agreement between the two with regard to the preferred binding region on the surface of the protein and several binding sites. MD simulations also identify additional binding sites that were not observed in the NMR experiments. "Bound" ligands were found to be sufficiently flexible and to access a number of favorable conformations, suggesting only a moderate loss of ligand entropy in the "pseudo affinity" binding of these multimodal ligands. Analysis of locations of chemical subunits of the ligand on the protein surface indicated that electrostatic interaction units were located on the periphery of the preferred binding region on the protein. The analysis of the electrostatic potential, the hydrophobicity maps, and the binding of both acetate and benzene probes were used to further study the localization of individual ligand moieties. These results suggest that water-mediated electrostatic interactions help the localization and orientation of the MM ligand to the binding region with additional stability provided by nonspecific hydrophobic interactions.

  9. Real-time ligand binding pocket database search using local surface descriptors.

    PubMed

    Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

    2010-07-01

    Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.

  10. Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

    NASA Astrophysics Data System (ADS)

    Djordjevic, Marko

    2005-11-01

    Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.

  11. Discovery and Characterization of Non-ATP Site Inhibitors of the Mitogen Activated Protein (MAP) Kinases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites onmore » the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 siRNA and to rosiglitazone treatment. Together, the data suggest that these new ligand series bind to a novel, allosteric, and physiologically relevant site and therefore represent a unique approach to identify kinase inhibitors.« less

  12. Binding Site Configurations Probe the Structure and Dynamics of the Zinc Finger of NEMO (NF-κB Essential Modulator).

    PubMed

    Godwin, Ryan C; Melvin, Ryan L; Gmeiner, William H; Salsbury, Freddie R

    2017-01-31

    Zinc-finger proteins are regulators of critical signaling pathways for various cellular functions, including apoptosis and oncogenesis. Here, we investigate how binding site protonation states and zinc coordination influence protein structure, dynamics, and ultimately function, as these pivotal regulatory proteins are increasingly important for protein engineering and therapeutic discovery. To better understand the thermodynamics and dynamics of the zinc finger of NEMO (NF-κB essential modulator), as well as the role of zinc, we present results of 20 μs molecular dynamics trajectories, 5 μs for each of four active site configurations. Consistent with experimental evidence, the zinc ion is essential for mechanical stabilization of the functional, folded conformation. Hydrogen bond motifs are unique for deprotonated configurations yet overlap in protonated cases. Correlated motions and principal component analysis corroborate the similarity of the protonated configurations and highlight unique relationships of the zinc-bound configuration. We hypothesize a potential mechanism for zinc binding from results of the thiol configurations. The deprotonated, zinc-bound configuration alone predominantly maintains its tertiary structure throughout all 5 μs and alludes rare conformations potentially important for (im)proper zinc-finger-related protein-protein or protein-DNA interactions.

  13. CCProf: exploring conformational change profile of proteins

    PubMed Central

    Chang, Che-Wei; Chou, Chai-Wei; Chang, Darby Tien-Hao

    2016-01-01

    In many biological processes, proteins have important interactions with various molecules such as proteins, ions or ligands. Many proteins undergo conformational changes upon these interactions, where regions with large conformational changes are critical to the interactions. This work presents the CCProf platform, which provides conformational changes of entire proteins, named conformational change profile (CCP) in the context. CCProf aims to be a platform where users can study potential causes of novel conformational changes. It provides 10 biological features, including conformational change, potential binding target site, secondary structure, conservation, disorder propensity, hydropathy propensity, sequence domain, structural domain, phosphorylation site and catalytic site. All these information are integrated into a well-aligned view, so that researchers can capture important relevance between different biological features visually. The CCProf contains 986 187 protein structure pairs for 3123 proteins. In addition, CCProf provides a 3D view in which users can see the protein structures before and after conformational changes as well as binding targets that induce conformational changes. All information (e.g. CCP, binding targets and protein structures) shown in CCProf, including intermediate data are available for download to expedite further analyses. Database URL: http://zoro.ee.ncku.edu.tw/ccprof/ PMID:27016699

  14. Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

    PubMed

    Kel, AlexanderE

    2017-02-01

    Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

  15. The Role of Binding Site on the Mechanical Unfolding Mechanism of Ubiquitin

    NASA Astrophysics Data System (ADS)

    Cao, Penghui; Yoon, Gwonchan; Tao, Weiwei; Eom, Kilho; Park, Harold S.

    2015-03-01

    We apply novel atomistic simulations based on potential energy surface exploration to investigate the constant force-induced unfolding of ubiquitin. At the experimentally-studied force clamping level of 100 pN, we find a new unfolding mechanism starting with the detachment between β5 and β3 involving the binding site of ubiquitin, the Ile44 residue. This new unfolding pathway leads to the discovery of new intermediate configurations, which correspond to the end-to-end extensions previously seen experimentally. More importantly, it demonstrates the novel finding that the binding site of ubiquitin can be responsible not only for its biological functions, but also its unfolding dynamics. We also report in contrast to previous single molecule constant force experiments that when the clamping force becomes smaller than about 300 pN, the number of intermediate configurations increases dramatically, where almost all unfolding events at 100 pN involve an intermediate configuration. By directly calculating the life times of the intermediate configurations from the height of the barriers that were crossed on the potential energy surface, we demonstrate that these intermediate states were likely not observed experimentally due to their lifetimes typically being about two orders of magnitude smaller than the experimental temporal resolution.

  16. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  17. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  18. Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

    PubMed Central

    Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

    2015-01-01

    The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

  19. How Cations Can Assist DNase I in DNA Binding and Hydrolysis

    PubMed Central

    Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

    2010-01-01

    DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

  20. Unconventional binding sites and receptors for VIP and related peptides PACAP and PHI/PHM: an update.

    PubMed

    Muller, Jean-Marc; Debaigt, Colin; Goursaud, Stéphanie; Montoni, Alicia; Pineau, Nicolas; Meunier, Annie-Claire; Janet, Thierry

    2007-09-01

    The 28-amino-acid neuropeptide VIP and related peptides PACAP and PHI/PHM modulate virtually all of the vital functions in the body. These peptides are also commonly recognized as major regulators of cell growth and differentiation. Through their trophic and cytoprotective functions, they appear to play major roles in embryonic development, neurogenesis and the progression of a number of cancer types. These peptides bind to three well-characterized subtypes of G-protein coupled receptors: VPAC1 and VPAC2 share a common high affinity in the nanomolar range for VIP and PACAP; a third receptor type, PAC1, has been characterized for its high affinity for PACAP but its low affinity for VIP. Complex effects and pharmacological behaviors of these peptides suggest that multiple subtypes of binding sites may cooperate to mediate their function in target cells and tissues. In this complex response, some of these binding sites correspond to the definition of the conventional receptors cited above, while others display unexpected pharmacological and functional properties. Here we present potential clues that may lead investigators to further characterize the molecular nature and functions of these atypical binding species.

  1. Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

    PubMed

    Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

    2017-01-01

    The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

  2. The increased binding affinity of curcumin with human serum albumin in the presence of rutin and baicalin: A potential for drug delivery system

    NASA Astrophysics Data System (ADS)

    Liu, Bing-Mi; Zhang, Jun; Hao, Ai-Jun; Xu, Liang; Wang, Dan; Ji, Hui; Sun, Shi-Jie; Chen, Bo-Qi; Liu, Bin

    2016-02-01

    The impacts of rutin and baicalin on the interaction of curcumin (CU) with human serum albumin (HSA) were investigated by fluorescence and circular dichroism (CD) spectroscopies under imitated physiological conditions. The results showed that the fluorescence quenching of HSA by CU was a simultaneous static and dynamic quenching process, irrespective of the presence or absence of flavonoids. The binding constants between CU and HSA in the absence and presence of rutin and baicalin were 2.268 × 105 M- 1, 3.062 × 105 M- 1, and 3.271 × 105 M- 1, indicating that the binding affinity was increased in the case of two flavonoids. Furthermore, the binding distance determined according to Förster's theory was decreased in the presence of flavonoids. Combined with the fact that flavonoids and CU have the same binding site (site I), it can be concluded that they may simultaneously bind in different regions in site I, and formed a ternary complex of flavonoid-HSA-CU. Meanwhile, the results of fluorescence quenching, CD and three-dimensional fluorescence spectra revealed that flavonoids further strengthened the microenvironmental and conformational changes of HSA induced by CU binding. Therefore, it is possible to develop a novel complex involving CU, flavonoid and HSA for CU delivery. The work may provide some valuable information in terms of improving the poor bioavailabiliy of CU.

  3. Photo-isomerization and oxidation of bilirubin in mammals is dependent on albumin binding.

    PubMed

    Goncharova, Iryna; Jašprová, Jana; Vítek, Libor; Urbanová, Marie

    2015-12-01

    The bilirubin (BR) photo-conversion in the human body is a protein-dependent process; an effective photo-isomerization of the potentially neurotoxic Z,Z-BR as well as its oxidation to biliverdin in the antioxidant redox cycle is possible only when BR is bound on serum albumin. We present a novel analytical concept in the study of linear tetrapyrroles metabolic processes based on an in-depth mapping of binding sites in the structure of human serum albumin (HSA). A combination of fluorescence spectroscopy, circular dichroism (CD) spectroscopy, and molecular modeling methods was used for recognition of the binding site for BR, its derivatives (mesobilirubin and bilirubin ditaurate), and the products of the photo-isomerization and oxidation (lumirubin, biliverdin, and xanthobilirubic acid) on HSA. The CD spectra and fluorescent quenching of the Trp-HSA were used to calculate the binding constants. The results of the CD displacement experiments performed with hemin were interpreted together with the findings of molecular docking performed on the pigment-HSA complexes. We estimated that Z,Z-BR and its metabolic products bind on two independent binding sites. Our findings support the existence of a reversible antioxidant redox cycle for BR and explain an additional pathway of the photo-isomerization process (increase of HSA binding capacity; the excess free [unbound] BR can be converted and also bound to HSA). Copyright © 2015 Elsevier Inc. All rights reserved.

  4. A Panoptic Uncovering of the Dynamical Evolution of the Zika Virus NS5 Methyltransferase Binding Site Loops- Zeroing in on the Molecular Landscape.

    PubMed

    Devnarain, Nikita; Soliman, Mahmoud E S

    2018-06-20

    The global threat of the Zika virus to humanity is real. Innovative and potent anti-Zika virus drugs are still at large, due to the lack of anti-Zika virus drugs that have passed phase 1 trials. Experimental research has revealed novel inhibitors of Zika virus NS5 methyltransferase enzyme. This study has taken a step further to provide insight into the molecular dynamics of Zika virus and inhibitor binding, which have not been established experimentally. Movements of the methyltransferase binding site loops have a large role to play in the methylation of the viral mRNA cap, which is essential for Zika virus replication. Here we pinpoint the binding interactions between each potential inhibitor and the methyltransferase, residues that are responsible for binding, as well as which inhibitor-bound complex renders the methyltransferase more stable. We also highlight the conformational changes that occur within the methyltransferase to accommodate binding of inhibitors and consequences of those changes upon the RNA- and cap-binding sites in the methyltransferase. This research will improve the understanding of the Zika virus NS5 methyltransferase enzyme, and will be beneficial in driving the development of anti-Zika virus drugs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. The Sequence-specific Peptide-binding Activity of the Protein Sulfide Isomerase AGR2 Directs Its Stable Binding to the Oncogenic Receptor EpCAM.

    PubMed

    Mohtar, M Aiman; Hernychova, Lenka; O'Neill, J Robert; Lawrence, Melanie L; Murray, Euan; Vojtesek, Borek; Hupp, Ted R

    2018-04-01

    AGR2 is an oncogenic endoplasmic reticulum (ER)-resident protein disulfide isomerase. AGR2 protein has a relatively unique property for a chaperone in that it can bind sequence-specifically to a specific peptide motif (TTIYY). A synthetic TTIYY-containing peptide column was used to affinity-purify AGR2 from crude lysates highlighting peptide selectivity in complex mixtures. Hydrogen-deuterium exchange mass spectrometry localized the dominant region in AGR2 that interacts with the TTIYY peptide to within a structural loop from amino acids 131-135 (VDPSL). A peptide binding site consensus of Tx[IL][YF][YF] was developed for AGR2 by measuring its activity against a mutant peptide library. Screening the human proteome for proteins harboring this motif revealed an enrichment in transmembrane proteins and we focused on validating EpCAM as a potential AGR2-interacting protein. AGR2 and EpCAM proteins formed a dose-dependent protein-protein interaction in vitro Proximity ligation assays demonstrated that endogenous AGR2 and EpCAM protein associate in cells. Introducing a single alanine mutation in EpCAM at Tyr251 attenuated its binding to AGR2 in vitro and in cells. Hydrogen-deuterium exchange mass spectrometry was used to identify a stable binding site for AGR2 on EpCAM, adjacent to the TLIYY motif and surrounding EpCAM's detergent binding site. These data define a dominant site on AGR2 that mediates its specific peptide-binding function. EpCAM forms a model client protein for AGR2 to study how an ER-resident chaperone can dock specifically to a peptide motif and regulate the trafficking a protein destined for the secretory pathway. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Structure of the Mycobacterium tuberculosis D-Alanine:D-Alanine Ligase, a Target of the Antituberculosis Drug D-Cycloserine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bruning, John B.; Murillo, Ana C.; Chacon, Ofelia

    D-Alanine:D-alanine ligase (EC 6.3.2.4; Ddl) catalyzes the ATP-driven ligation of two D-alanine (D-Ala) molecules to form the D-alanyl:D-alanine dipeptide. This molecule is a key building block in peptidoglycan biosynthesis, making Ddl an attractive target for drug development. D-Cycloserine (DCS), an analog of D-Ala and a prototype Ddl inhibitor, has shown promise for the treatment of tuberculosis. Here, we report the crystal structure of Mycobacterium tuberculosis Ddl at a resolution of 2.1 {angstrom}. This structure indicates that Ddl is a dimer and consists of three discrete domains; the ligand binding cavity is at the intersection of all three domains and conjoinedmore » by several loop regions. The M. tuberculosis apo Ddl structure shows a novel conformation that has not yet been observed in Ddl enzymes from other species. The nucleotide and D-alanine binding pockets are flexible, requiring significant structural rearrangement of the bordering regions for entry and binding of both ATP and D-Ala molecules. Solution affinity and kinetic studies showed that DCS interacts with Ddl in a manner similar to that observed for D-Ala. Each ligand binds to two binding sites that have significant differences in affinity, with the first binding site exhibiting high affinity. DCS inhibits the enzyme, with a 50% inhibitory concentration (IC{sub 50}) of 0.37 mM under standard assay conditions, implicating a preferential and weak inhibition at the second, lower-affinity binding site. Moreover, DCS binding is tighter at higher ATP concentrations. The crystal structure illustrates potential drugable sites that may result in the development of more-effective Ddl inhibitors.« less

  7. Alcohol-Binding Sites in Distinct Brain Proteins: The Quest for Atomic Level Resolution

    PubMed Central

    Howard, Rebecca J.; Slesinger, Paul A.; Davies, Daryl L.; Das, Joydip; Trudell, James R.; Harris, R. Adron

    2011-01-01

    Defining the sites of action of ethanol on brain proteins is a major prerequisite to understanding the molecular pharmacology of this drug. The main barrier to reaching an atomic-level understanding of alcohol action is the low potency of alcohols, ethanol in particular, which is a reflection of transient, low-affinity interactions with their targets. These mechanisms are difficult or impossible to study with traditional techniques such as radioligand binding or spectroscopy. However, there has been considerable recent progress in combining X-ray crystallography, structural modeling, and site-directed mutagenesis to define the sites and mechanisms of action of ethanol and related alcohols on key brain proteins. We review such insights for several diverse classes of proteins including inwardly rectifying potassium, transient receptor potential, and neurotransmit-ter-gated ion channels, as well as protein kinase C epsilon. Some common themes are beginning to emerge from these proteins, including hydrogen bonding of the hydroxyl group and van der Waals interactions of the methylene groups of ethanol with specific amino acid residues. The resulting binding energy is proposed to facilitate or stabilize low-energy state transitions in the bound proteins, allowing ethanol to act as a “molecular lubricant” for protein function. We discuss evidence for characteristic, discrete alcohol-binding sites on protein targets, as well as evidence that binding to some proteins is better characterized by an interaction region that can accommodate multiple molecules of ethanol. PMID:21676006

  8. Nanobiological studies on drug design using molecular mechanic method.

    PubMed

    Ghaheh, Hooria Seyedhosseini; Mousavi, Maryam; Araghi, Mahmood; Rasoolzadeh, Reza; Hosseini, Zahra

    2015-01-01

    Influenza H1N1 is very important worldwide and point mutations that occur in the virus gene are a threat for the World Health Organization (WHO) and druggists, since they could make this virus resistant to the existing antibiotics. Influenza epidemics cause severe respiratory illness in 30 to 50 million people and kill 250,000 to 500,000 people worldwide every year. Nowadays, drug design is not done through trial and error because of its cost and waste of time; therefore bioinformatics studies is essential for designing drugs. This paper, infolds a study on binding site of Neuraminidase (NA) enzyme, (that is very important in drug design) in 310K temperature and different dielectrics, for the best drug design. Information of NA enzyme was extracted from Protein Data Bank (PDB) and National Center for Biotechnology Information (NCBI) websites. The new sequences of N1 were downloaded from the NCBI influenza virus sequence database. Drug binding sites were assimilated and homologized modeling using Argus lab 4.0, HyperChem 6.0 and Chem. D3 softwares. Their stability was assessed in different dielectrics and temperatures. Measurements of potential energy (Kcal/mol) of binding sites of NA in different dielectrics and 310K temperature revealed that at time step size = 0 pSec drug binding sites have maximum energy level and at time step size = 100 pSec have maximum stability and minimum energy. Drug binding sites are more dependent on dielectric constants rather than on temperature and the optimum dielectric constant is 39/78.

  9. Mapping structural landmarks, ligand binding sites and missense mutations to the collagen IV heterotrimers predicts major functional domains, novel interactions and variation in phenotypes in inherited diseases affecting basement membranes

    PubMed Central

    Des Parkin, J.; San Antonio, James D.; Pedchenko, Vadim; Hudson, Billy; Jensen, Shane T.; Savige, Judy

    2016-01-01

    Collagen IV is the major protein found in basement membranes. It comprises 3 heterotrimers (α1α1α2, α3α4α5, and α5α5α6) that form distinct networks, and are responsible for membrane strength and integrity. We constructed linear maps of the collagen IV heterotrimers (‘interactomes’) that indicated major structural landmarks, known and predicted ligand-binding sites, and missense mutations, in order to identify functional and disease-associated domains, potential interactions between ligands, and genotype-phenotype relationships. The maps documented more than 30 known ligand-binding sites as well as motifs for integrins, heparin, von Willebrand factor (VWF), decorin and bone morphogenetic protein (BMP). They predicted functional domains for angiogenesis and haemostasis, and disease domains for autoimmunity, tumor growth and inhibition, infection and glycation. Cooperative ligand interactions were indicated by binding site proximity, for example, between integrins, matrix metalloproteinases and heparin. The maps indicated that mutations affecting major ligand-binding sites, for example for Von Hippel Lindau (VHL) protein in the α1 chain or integrins in the α5 chain, resulted in distinctive phenotypes (Hereditary Angiopathy, Nephropathy, Aneurysms and muscle Cramps (HANAC) syndrome, and early onset Alport syndrome respectively). These maps further our understanding of basement membrane biology and disease, and suggest novel membrane interactions, functions, and therapeutic targets. PMID:21280145

  10. Mechanisms and consequences of alternative polyadenylation

    PubMed Central

    Di Giammartino, Dafne Campigli; Nishida, Kensei; Manley, James L.

    2011-01-01

    Summary Alternative polyadenylation (APA) is emerging as a widespread mechanism used to control gene expression. Like alternative splicing, usage of alternative poly(A) sites allows a single gene to encode multiple mRNA transcripts. In some cases, this changes the mRNA coding potential; in other cases, the code remains unchanged but the 3’UTR length is altered, influencing the fate of mRNAs in several ways, for example, by altering the availability of RNA binding protein sites and microRNA binding sites. The mechansims governing both global and gene-specific APA are only starting to be deciphered. Here we review what is known about these mechanisms and the functional consequences of alternative polyadenlyation. PMID:21925375

  11. CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

    PubMed

    László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

    2016-08-01

    The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

  12. Structures of Receptor Complexes of a North American H7N2 Influenza Hemagglutinin with a Loop Deletion in the Receptor Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Hua; Chen, Li-Mei; Carney, Paul J.

    2012-02-21

    Human infections with subtype H7 avian influenza viruses have been reported as early as 1979. In 1996, a genetically stable 24-nucleotide deletion emerged in North American H7 influenza virus hemagglutinins, resulting in an eight amino acid deletion in the receptor-binding site. The continuous circulation of these viruses in live bird markets, as well as its documented ability to infect humans, raises the question of how these viruses achieve structural stability and functionality. Here we report a detailed molecular analysis of the receptor binding site of the North American lineage subtype H7N2 virus A/New York/107/2003 (NY107), including complexes with an avianmore » receptor analog (3'-sialyl-N-acetyllactosamine, 3'SLN) and two human receptor analogs (6'-sialyl-N-acetyllactosamine, 6'SLN; sialyllacto-N-tetraose b, LSTb). Structural results suggest a novel mechanism by which residues Arg220 and Arg229 (H3 numbering) are used to compensate for the deletion of the 220-loop and form interactions with the receptor analogs. Glycan microarray results reveal that NY107 maintains an avian-type ({alpha}2-3) receptor binding profile, with only moderate binding to human-type ({alpha}2-6) receptor. Thus despite its dramatically altered receptor binding site, this HA maintains functionality and confirms a need for continued influenza virus surveillance of avian and other animal reservoirs to define their zoonotic potential.« less

  13. A new design for a green calcium indicator with a smaller size and a reduced number of calcium-binding sites

    PubMed Central

    Barykina, Natalia V.; Subach, Oksana M.; Doronin, Danila A.; Sotskov, Vladimir P.; Roshchina, Marina A.; Kunitsyna, Tatiana A.; Malyshev, Aleksey Y.; Smirnov, Ivan V.; Azieva, Asya M.; Sokolov, Ilya S.; Piatkevich, Kiryl D.; Burtsev, Mikhail S.; Varizhuk, Anna M.; Pozmogova, Galina E.; Anokhin, Konstantin V.; Subach, Fedor V.; Enikolopov, Grigori N.

    2016-01-01

    Genetically encoded calcium indicators (GECIs) are mainly represented by two- or one-fluorophore-based sensors. One type of two-fluorophore-based sensor, carrying Opsanus troponin C (TnC) as the Ca2+-binding moiety, has two binding sites for calcium ions, providing a linear response to calcium ions. One-fluorophore-based sensors have four Ca2+-binding sites but are better suited for in vivo experiments. Herein, we describe a novel design for a one-fluorophore-based GECI with two Ca2+-binding sites. The engineered sensor, called NTnC, uses TnC as the Ca2+-binding moiety, inserted in the mNeonGreen fluorescent protein. Monomeric NTnC has higher brightness and pH-stability in vitro compared with the standard GECI GCaMP6s. In addition, NTnC shows an inverted fluorescence response to Ca2+. Using NTnC, we have visualized Ca2+ dynamics during spontaneous activity of neuronal cultures as confirmed by control NTnC and its mutant, in which the affinity to Ca2+ is eliminated. Using whole-cell patch clamp, we have demonstrated that NTnC dynamics in neurons are similar to those of GCaMP6s and allow robust detection of single action potentials. Finally, we have used NTnC to visualize Ca2+ neuronal activity in vivo in the V1 cortical area in awake and freely moving mice using two-photon microscopy or an nVista miniaturized microscope. PMID:27677952

  14. Thermodynamic Characterization of Hydration Sites from Integral Equation-Derived Free Energy Densities: Application to Protein Binding Sites and Ligand Series.

    PubMed

    Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M

    2017-07-24

    Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.

  15. Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles

    PubMed Central

    Fiorucci, Sébastien; Zacharias, Martin

    2010-01-01

    Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leenheer, J.A.; Brown, G.K.; Cabaniss, S.E.

    Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca{sup 2+}, Cd{sup 2+}, Cu{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca{sup 2+} ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The metal binding fraction was characterized by quantitative {sup 13}C NMR, {sup 1}H NMR, and FT-IR spectrometry andmore » elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca{sup 2+} binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.« less

  17. Toxicity and Binding Studies of Bacillus thuringiensis Cry1Ac, Cry1F, Cry1C, and Cry2A Proteins in the Soybean Pests Anticarsia gemmatalis and Chrysodeixis (Pseudoplusia) includens.

    PubMed

    Bel, Yolanda; Sheets, Joel J; Tan, Sek Yee; Narva, Kenneth E; Escriche, Baltasar

    2017-06-01

    Anticarsia gemmatalis (velvetbean caterpillar) and Chrysodeixis includens (soybean looper, formerly named Pseudoplusia includens ) are two important defoliating insects of soybeans. Both lepidopteran pests are controlled mainly with synthetic insecticides. Alternative control strategies, such as biopesticides based on the Bacillus thuringiensis (Bt) toxins or transgenic plants expressing Bt toxins, can be used and are increasingly being adopted. Studies on the insect susceptibilities and modes of action of the different Bt toxins are crucial to determine management strategies to control the pests and to delay outbreaks of insect resistance. In the present study, the susceptibilities of both soybean pests to the Bt toxins Cry1Ac, Cry1Fa, Cry1Ca, and Cry2Aa have been investigated. Bioassays performed in first-instar larvae showed that both insects are susceptible to all these toxins. Competition-binding studies carried out with Cry1Ac and Cry1Fa 125 -iodine labeled proteins demonstrated the presence of specific binding sites for both of them on the midgut brush border membrane vesicles (BBMVs) of both A. gemmatalis and C. includens Competition-binding experiments and specific-binding inhibition studies performed with selected sugars and lectins indicated that Cry1Ac and Cry1Fa share some, but not all, binding sites in the midguts of both insects. Also, the Cry1Ac- or Cry1Fa-binding sites were not shared with Cry1Ca or Cry2Aa in either soybean pest. This study contributes to the knowledge of Bt toxicity and midgut toxin binding sites in A. gemmatalis and C. includens and sheds light on the cross-resistance potential of Cry1Ac, Cry1Fa, Cry1Ca, and Cry2Aa Bt proteins as candidate proteins for Bt-pyramided crops. IMPORTANCE In the present study, the toxicity and the mode of action of the Bacillus thuringiensis (Bt) toxins Cry1Ac, Cry1Fa, Cry1Ca, and Cry2Aa in Anticarsia gemmatalis and Chrysodeixis includens (important defoliating pests of soybeans) have been investigated. These studies are crucial for determining management strategies for pest control. Bioassays showed that both insects were susceptible to the toxins. Competition-binding studies demonstrated the presence of Cry1Fa- and Cry1Ac-specific binding sites in the midguts of both pests. These results, together with the results from binding inhibition studies performed with sugars and lectins, indicated that Cry1Ac and Cry1Fa share some, but not all, binding sites, and that they were not shared with Cry1Ca or Cry2Aa in either soybean pest. This study contributes to the knowledge of Bt toxicity in A. gemmatalis and C. includens and sheds light on the cross-resistance potential of Cry1Ac, Cry1Fa, Cry1Ca, and Cry2Aa Bt proteins as candidate proteins for Bt-pyramided crops. Copyright © 2017 Bel et al.

  18. Activity of N-coordinated multi-metal-atom active site structures for Pt-free oxygen reduction reaction catalysis: Role of *OH ligands

    DOE PAGES

    Holby, Edward F.; Taylor, Christopher D.

    2015-03-19

    We report calculated oxygen reduction reaction energy pathways on multi-metal-atom structures that have previously been shown to be thermodynamically favorable. We predict that such sites have the ability to spontaneously cleave the O₂ bond and then will proceed to over-bind reaction intermediates. In particular, the *OH bound state has lower energy than the final 2 H₂O state at positive potentials. Contrary to traditional surface catalysts, this *OH binding does not poison the multi-metal-atom site but acts as a modifying ligand that will spontaneously form in aqueous environments leading to new active sites that have higher catalytic activities. These *OH boundmore » structures have the highest calculated activity to date.« less

  19. Positive allosteric modulators as an approach to nicotinic acetylcholine receptor- targeted therapeutics: advantages and limitations

    PubMed Central

    Williams, Dustin K.; Wang, Jingyi; Papke, Roger L.

    2011-01-01

    Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. PMID:21575610

  20. Positive allosteric modulators as an approach to nicotinic acetylcholine receptor-targeted therapeutics: advantages and limitations.

    PubMed

    Williams, Dustin K; Wang, Jingyi; Papke, Roger L

    2011-10-15

    Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high-affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz

    2009-11-18

    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In themore » present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.« less

  2. Size versus polarizability in protein-ligand interactions: binding of noble gases within engineered cavities in phage T4 lysozyme.

    PubMed

    Quillin, M L; Breyer, W A; Griswold, I J; Matthews, B W

    2000-09-29

    To investigate the relative importance of size and polarizability in ligand binding within proteins, we have determined the crystal structures of pseudo wild-type and cavity-containing mutant phage T4 lysozymes in the presence of argon, krypton, and xenon. These proteins provide a representative sample of predominantly apolar cavities of varying size and shape. Even though the volumes of these cavities range up to the equivalent of five xenon atoms, the noble gases bind preferentially at highly localized sites that appear to be defined by constrictions in the walls of the cavities, coupled with the relatively large radii of the noble gases. The cavities within pseudo wild-type and L121A lysozymes each bind only a single atom of noble gas, while the cavities within mutants L133A and F153A have two independent binding sites, and the L99A cavity has three interacting sites. The binding of noble gases within two double mutants was studied to characterize the additivity of binding at such sites. In general, when a cavity in a protein is created by a "large-to-small" substitution, the surrounding residues relax somewhat to reduce the volume of the cavity. The binding of xenon and, to a lesser degree, krypton and argon, tend to expand the volume of the cavity and to return it closer to what it would have been had no relaxation occurred. In nearly all cases, the extent of binding of the noble gases follows the trend xenon>krypton>argon. Pressure titrations of the L99A mutant have confirmed that the crystallographic occupancies accurately reflect fractional saturation of the binding sites. The trend in noble gas affinity can be understood in terms of the effects of size and polarizability on the intermolecular potential. The plasticity of the protein matrix permits repulsion due to increased ligand size to be more than compensated for by attraction due to increased ligand polarizability. These results have implications for the mechanism of general anesthesia, the migration of small ligands within proteins, the detection of water molecules within apolar cavities and the determination of crystallographic phases. Copyright 2000 Academic Press.

  3. Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

    PubMed Central

    Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

    2016-01-01

    Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

  4. Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.

    PubMed

    Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G

    2013-10-23

    We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Mechanisms of zinc binding to the solute-binding protein AztC and transfer from the metallochaperone AztD.

    PubMed

    Neupane, Durga P; Avalos, Dante; Fullam, Stephanie; Roychowdhury, Hridindu; Yukl, Erik T

    2017-10-20

    Bacteria can acquire the essential metal zinc from extremely zinc-limited environments by using ATP-binding cassette (ABC) transporters. These transporters are critical virulence factors, relying on specific and high-affinity binding of zinc by a periplasmic solute-binding protein (SBP). As such, the mechanisms of zinc binding and release among bacterial SBPs are of considerable interest as antibacterial drug targets. Zinc SBPs are characterized by a flexible loop near the high-affinity zinc-binding site. The function of this structure is not always clear, and its flexibility has thus far prevented structural characterization by X-ray crystallography. Here, we present intact structures for the zinc-specific SBP AztC from the bacterium Paracoccus denitrificans in the zinc-bound and apo-states. A comparison of these structures revealed that zinc loss prompts significant structural rearrangements, mediated by the formation of a sodium-binding site in the apo-structure. We further show that the AztC flexible loop has no impact on zinc-binding affinity, stoichiometry, or protein structure, yet is essential for zinc transfer from the metallochaperone AztD. We also found that 3 His residues in the loop appear to temporarily coordinate zinc and then convey it to the high-affinity binding site. Thus, mutation of any of these residues to Ala abrogated zinc transfer from AztD. Our structural and mechanistic findings conclusively identify a role for the AztC flexible loop in zinc acquisition from the metallochaperone AztD, yielding critical insights into metal binding by AztC from both solution and AztD. These proteins are highly conserved in human pathogens, making this work potentially useful for the development of novel antibiotics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Metal stabilization of collagen and de novo designed mimetic peptides

    PubMed Central

    Parmar, Avanish S.; Xu, Fei; Pike, Douglas H.; Belure, Sandeep V.; Hasan, Nida F.; Drzewiecki, Kathryn E.; Shreiber, David I.; Nanda, Vikas

    2017-01-01

    We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix. PMID:26225466

  7. Metal Stabilization of Collagen and de Novo Designed Mimetic Peptides.

    PubMed

    Parmar, Avanish S; Xu, Fei; Pike, Douglas H; Belure, Sandeep V; Hasan, Nida F; Drzewiecki, Kathryn E; Shreiber, David I; Nanda, Vikas

    2015-08-18

    We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo- and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal-specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix.

  8. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  9. A dynamically coupled allosteric network underlies binding cooperativity in Src kinase

    PubMed Central

    Foda, Zachariah H.; Shan, Yibing; Kim, Eric T.; Shaw, David E.; Seeliger, Markus A.

    2015-01-01

    Protein tyrosine kinases are attractive drug targets because many human diseases are associated with the deregulation of kinase activity. However, how the catalytic kinase domain integrates different signals and switches from an active to an inactive conformation remains incompletely understood. Here we identify an allosteric network of dynamically coupled amino acids in Src kinase that connects regulatory sites to the ATP- and substrate-binding sites. Surprisingly, reactants (ATP and peptide substrates) bind with negative cooperativity to Src kinase while products (ADP and phosphopeptide) bind with positive cooperativity. We confirm the molecular details of the signal relay through the allosteric network by biochemical studies. Experiments on two additional protein tyrosine kinases indicate that the allosteric network may be largely conserved among these enzymes. Our work provides new insights into the regulation of protein tyrosine kinases and establishes a potential conduit by which resistance mutations to ATP-competitive kinase inhibitors can affect their activity. PMID:25600932

  10. The Roles of Hemagglutinin Phe-95 in Receptor Binding and Pathogenicity of Influenza B Virus

    PubMed Central

    Ni, Fengyun; Mbawuike, Innocent Nnadi; Kondrashkina, Elena; Wang, Qinghua

    2014-01-01

    Diverged ~4,000 years ago, influenza B virus has several important differences from influenza A virus, including lower receptor-binding affinity and highly restricted host range. Based on our prior structural studies, we hypothesized that a single-residue difference in the receptor-binding site of hemagglutinin (HA), Phe-95 in influenza B virus versus Tyr-98 in influenza A/H1~H15, is possibly a key determinant for the low receptor-binding affinity. Here we demonstrate that the mutation Phe95→Tyr in influenza B virus HA restores all three hydrogen bonds made by Tyr-98 in influenza A/H3 HA and has the potential to enhance receptor binding. However, the full realization of this potential is influenced by the local environment into which the mutation is introduced. The binding and replication of the recombinant viruses correlate well with the receptor-binding capabilities of HA. These results are discussed in relation to the roles of Phe-95 in receptor binding and pathogenicity of influenza B virus. PMID:24503069

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Helmich, Kate E.; Pereira, Jose Henrique; Gall, Daniel L.

    Here, lignin is a combinatorial polymer comprising monoaromatic units that are linked via covalent bonds. Although lignin is a potential source of valuable aromatic chemicals, its recalcitrance to chemical or biological digestion presents major obstacles to both the production of second-generation biofuels and the generation of valuable coproducts from lignin's monoaromatic units. Degradation of lignin has been relatively well characterized in fungi, but it is less well understood in bacteria. A catabolic pathway for the enzymatic breakdown of aromatic oligomers linked via β-aryl ether bonds typically found in lignin has been reported in the bacterium Sphingobium sp. SYK-6. Here, wemore » present x-ray crystal structures and biochemical characterization of the glutathione-dependent β-etherases, LigE and LigF, from this pathway. The crystal structures show that both enzymes belong to the canonical two-domain fold and glutathione binding site architecture of the glutathione S-transferase family. Mutagenesis of the conserved active site serine in both LigE and LigF shows that, whereas the enzymatic activity is reduced, this amino acid side chain is not absolutely essential for catalysis. The results include descriptions of cofactor binding sites, substrate binding sites, and catalytic mechanisms. Because β-aryl ether bonds account for 50–70% of all interunit linkages in lignin, understanding the mechanism of enzymatic β-aryl ether cleavage has significant potential for informing ongoing studies on the valorization of lignin.« less

  12. Substrate and Substrate-Mimetic Chaperone Binding Sites in Human α-Galactosidase A Revealed by Affinity-Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Moise, Adrian; Maeser, Stefan; Rawer, Stephan; Eggers, Frederike; Murphy, Mary; Bornheim, Jeff; Przybylski, Michael

    2016-06-01

    Fabry disease (FD) is a rare metabolic disorder of a group of lysosomal storage diseases, caused by deficiency or reduced activity of the enzyme α-galactosidase. Human α-galactosidase A (hαGAL) hydrolyses the terminal α-galactosyl moiety from glycosphingolipids, predominantly globotriaosylceramide (Gb3). Enzyme deficiency leads to incomplete or blocked breakdown and progressive accumulation of Gb3, with detrimental effects on normal organ functions. FD is successfully treated by enzyme replacement therapy (ERT) with purified recombinant hαGAL. An emerging treatment strategy, pharmacologic chaperone therapy (PCT), employs small molecules that can increase and/or reconstitute the activity of lysosomal enzyme trafficking by stabilizing misfolded isoforms. One such chaperone, 1-deoxygalactonojirimycin (DGJ), is a structural galactose analogue currently validated in clinical trials. DGJ is an active-site-chaperone that binds at the same or similar location as galactose; however, the molecular determination of chaperone binding sites in lysosomal enzymes represents a considerable challenge. Here we report the identification of the galactose and DGJ binding sites in recombinant α-galactosidase through a new affinity-mass spectrometry-based approach that employs selective proteolytic digestion of the enzyme-galactose or -inhibitor complex. Binding site peptides identified by mass spectrometry, [39-49], [83-100], and [141-168], contain the essential ligand-contacting amino acids, in agreement with the known X-ray crystal structures. The inhibitory effect of DGJ on galactose recognition was directly characterized through competitive binding experiments and mass spectrometry. The methods successfully employed in this study should have high potential for the characterization of (mutated) enzyme-substrate and -chaperone interactions, and for identifying chaperones without inhibitory effects.

  13. Structural Basis for the Recognition of Tyrosine-based Sorting Signals by the μ3A Subunit of the AP-3 Adaptor Complex*

    PubMed Central

    Mardones, Gonzalo A.; Burgos, Patricia V.; Lin, Yimo; Kloer, Daniel P.; Magadán, Javier G.; Hurley, James H.; Bonifacino, Juan S.

    2013-01-01

    Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14–19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides. PMID:23404500

  14. Structural basis for the recognition of tyrosine-based sorting signals by the μ3A subunit of the AP-3 adaptor complex.

    PubMed

    Mardones, Gonzalo A; Burgos, Patricia V; Lin, Yimo; Kloer, Daniel P; Magadán, Javier G; Hurley, James H; Bonifacino, Juan S

    2013-03-29

    Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14-19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides.

  15. Comparative analysis of allyl isothiocyanate (AITC)-induced carbohydrate oxidation changes via TRPV1 between mice and chickens.

    PubMed

    Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji

    2017-01-01

    Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.

  16. Neural precursor cell-expressed developmentally down-regulated protein 4-2 (Nedd4-2) regulation by 14-3-3 protein binding at canonical serum and glucocorticoid kinase 1 (SGK1) phosphorylation sites.

    PubMed

    Chandran, Sindhu; Li, Hui; Dong, Wuxing; Krasinska, Karolina; Adams, Chris; Alexandrova, Ludmila; Chien, Allis; Hallows, Kenneth R; Bhalla, Vivek

    2011-10-28

    Regulation of epithelial Na(+) channel (ENaC)-mediated transport in the distal nephron is a critical determinant of blood pressure in humans. Aldosterone via serum and glucocorticoid kinase 1 (SGK1) stimulates ENaC by phosphorylation of the E3 ubiquitin ligase Nedd4-2, which induces interaction with 14-3-3 proteins. However, the mechanisms of SGK1- and 14-3-3-mediated regulation of Nedd4-2 are unclear. There are three canonical SGK1 target sites on Nedd4-2 that overlap phosphorylation-dependent 14-3-3 interaction motifs. Two of these are termed "minor," and one is termed "major," based on weak or strong binding to 14-3-3 proteins, respectively. By mass spectrometry, we found that aldosterone significantly stimulates phosphorylation of a minor, relative to the major, 14-3-3 binding site on Nedd4-2. Phosphorylation-deficient minor site Nedd4-2 mutants bound less 14-3-3 than did wild-type (WT) Nedd4-2, and minor site Nedd4-2 mutations were sufficient to inhibit SGK1 stimulation of ENaC cell surface expression. As measured by pulse-chase and cycloheximide chase assays, a major binding site Nedd4-2 mutant had a shorter cellular half-life than WT Nedd4-2, but this property was not dependent on binding to 14-3-3. Additionally, a dimerization-deficient 14-3-3ε mutant failed to bind Nedd4-2. We conclude that whereas phosphorylation at the Nedd4-2 major site is important for interaction with 14-3-3 dimers, minor site phosphorylation by SGK1 may be the relevant molecular switch that stabilizes Nedd4-2 interaction with 14-3-3 and thus promotes ENaC cell surface expression. We also propose that major site phosphorylation promotes cellular Nedd4-2 protein stability, which potentially represents a novel form of regulation for turnover of E3 ubiquitin ligases.

  17. Evaluation of Cu(i) binding to the E2 domain of the amyloid precursor protein - a lesson in quantification of metal binding to proteins via ligand competition.

    PubMed

    Young, Tessa R; Wedd, Anthony G; Xiao, Zhiguang

    2018-01-24

    The extracellular domain E2 of the amyloid precursor protein (APP) features a His-rich metal-binding site (denoted as the M1 site). In conjunction with surrounding basic residues, the site participates in interactions with components of the extracellular matrix including heparins, a class of negatively charged polysaccharide molecules of varying length. This work studied the chemistry of Cu(i) binding to APP E2 with the probe ligands Bcs, Bca, Fz and Fs. APP E2 forms a stable Cu(i)-mediated ternary complex with each of these anionic ligands. The complex with Bca was selected for isolation and characterization and was demonstrated, by native ESI-MS analysis, to have the stoichiometry E2 : Cu(i) : Bca = 1 : 1 : 1. Formation of these ternary complexes is specific for the APP E2 domain and requires Cu(i) coordination to the M1 site. Mutation of the M1 site was consistent with the His ligands being part of the E2 ligand set. It is likely that interactions between the negatively charged probe ligands and a positively charged patch on the surface of APP E2 are one aspect of the generation of the stable ternary complexes. Their formation prevented meaningful quantification of the affinity of Cu(i) binding to the M1 site with these probe ligands. However, the ternary complexes are disrupted by heparin, allowing reliable determination of a picomolar Cu(i) affinity for the E2/heparin complex with the Fz or Bca probe ligands. This is the first documented example of the formation of stable ternary complexes between a Cu(i) binding protein and a probe ligand. The ready disruption of the complexes by heparin identified clear 'tell-tale' signs for diagnosis of ternary complex formation and allowed a systematic review of conditions and criteria for reliable determination of affinities for metal binding via ligand competition. This study also provides new insights into a potential correlation of APP functions regulated by copper binding and heparin interaction.

  18. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  19. Coarse-Grained Molecular Simulation of Epidermal Growth Factor Receptor Protein Tyrosine Kinase Multi-Site Self-Phosphorylation

    PubMed Central

    Koland, John G.

    2014-01-01

    Upon the ligand-dependent dimerization of the epidermal growth factor receptor (EGFR), the intrinsic protein tyrosine kinase (PTK) activity of one receptor monomer is activated, and the dimeric receptor undergoes self-phosphorylation at any of eight candidate phosphorylation sites (P-sites) in either of the two C-terminal (CT) domains. While the structures of the extracellular ligand binding and intracellular PTK domains are known, that of the ∼225-amino acid CT domain is not, presumably because it is disordered. Receptor phosphorylation on CT domain P-sites is critical in signaling because of the binding of specific signaling effector molecules to individual phosphorylated P-sites. To investigate how the combination of conventional substrate recognition and the unique topological factors involved in the CT domain self-phosphorylation reaction lead to selectivity in P-site phosphorylation, we performed coarse-grained molecular simulations of the P-site/catalytic site binding reactions that precede EGFR self-phosphorylation events. Our results indicate that self-phosphorylation of the dimeric EGFR, although generally believed to occur in trans, may well occur with a similar efficiency in cis, with the P-sites of both receptor monomers being phosphorylated to a similar extent. An exception was the case of the most kinase-proximal P-site-992, the catalytic site binding of which occurred exclusively in cis via an intramolecular reaction. We discovered that the in cis interaction of P-site-992 with the catalytic site was facilitated by a cleft between the N-terminal and C-terminal lobes of the PTK domain that allows the short CT domain sequence tethering P-site-992 to the PTK core to reach the catalytic site. Our work provides several new mechanistic insights into the EGFR self-phosphorylation reaction, and demonstrates the potential of coarse-grained molecular simulation approaches for investigating the complexities of self-phosphorylation in molecules such as EGFR (HER/ErbB) family receptors and growth factor receptor PTKs in general. PMID:24453959

  20. Allosteric regulation of epigenetic modifying enzymes.

    PubMed

    Zucconi, Beth E; Cole, Philip A

    2017-08-01

    Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom.

    PubMed

    Kitchen, Sheila A; Bourdelais, Andrea J; Taylor, Alison R

    2018-01-01

    The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability. Recent biophysical and genomic evidence supports widespread presence of homologous sodium (Na + ) and calcium (Ca 2+ ) permeable VGCs in unicellular algae, including marine phytoplankton. We therefore hypothesized that VGCs of these phytoplankton may be an allelopathic target for waterborne neurotoxins produced by K. brevis blooms that could lead to ion channel dysfunction and disruption of signaling in a similar manner to animal Na + VGCs. We examined the interaction of brevetoxin-3 (PbTx-3), a K. brevis neurotoxin, with the Na + /Ca 2+ VGC of the non-toxic diatom Odontella sinensi s using electrophysiology. Single electrode current- and voltage- clamp recordings from O. sinensis in the presence of PbTx-3 were used to examine the toxin's effect on voltage gated Na + /Ca 2+ currents. In silico analysis was used to identify the putative PbTx binding site in the diatoms. We identified Na + /Ca 2+ VCG homologs from the transcriptomes and genomes of 12 diatoms, including three transcripts from O. sinensis and aligned them with site-5 of Na + VGCs, previously identified as the PbTx binding site in animals. Up to 1 µM PbTx had no effect on diatom resting membrane potential or membrane excitability. The kinetics of fast inward Na + /Ca 2+ currents that underlie diatom action potentials were also unaffected. However, the peak inward current was inhibited by 33%, delayed outward current was inhibited by 25%, and reversal potential of the currents shifted positive, indicating a change in permeability of the underlying channels. Sequence analysis showed a lack of conservation of the PbTx binding site in diatom VGC homologs, many of which share molecular features more similar to single-domain bacterial Na + /Ca 2+ VGCs than the 4-domain eukaryote channels. Although membrane excitability and the kinetics of action potential currents were unaffected, the permeation of the channels underlying the diatom action potential was significantly altered in the presence of PbTx-3. However, at environmentally relevant concentrations the effects of PbTx- on diatom voltage activated currents and interference of cell signaling through this pathway may be limited. The relative insensitivity of phytoplankton VGCs may be due to divergence of site-5 (the putative PbTx binding site), and in some cases, such as O. sinensis , resistance to toxin effects may be because of evolutionary loss of the 4-domain eukaryote channel, while retaining a single domain bacterial-like VGC that can substitute in the generation of fast action potentials.

  2. Effects of hexamethonium, phenothiazines, propranolol and ephedrine on acetylcholinesterase carbamylation by physostigmine, aldicarb and carbaryl: interaction between the active site and the functionally distinct peripheral sites in acetylcholinesterase.

    PubMed

    Singh, A K; Spassova, D

    1998-01-01

    Physostigmine, aldicarb and carbaryl were potent inhibitors of acetylcholinesterase (AChE). The physostigmine-inhibited AChE fluoresced at 300 nm excitation and 500 nm emission wavelengths, but the aldicarb and carbaryl inhibited enzyme did not. This suggests that the carbamylated active center is not the fluorescing site in AChE. The fluorescence intensity of physostigmine-inhibited AChE decreased with increasing the substrate (acetylthiocholine) concentration, thus indicating that physostigmine binding to the active site is essential for the development of fluorescence. Thus, the physostigmine-inhibited AChE fluoresces due to the binding of trimethylpyrrolo[2,3-b]indol (TMPI) moiety, formed by the hydrolysis of physostigmine, to a peripheral site in AChE. The fluorescence intensity of the physostigmine-inhibited enzyme decreased when the inhibited-enzyme was dialyzed for either 30 min that poorly reactivated the enzyme or 180 min that fully reactivated the enzyme. This suggests that dialysis dissociates the AChE-TMPI complex much faster than it reactivates the carbamylated AChE. Ephedrine, propranolol and phenothiazines including trifluoparazine (TPZ) caused non-competitive inhibition, while hexamethonium caused an uncompetitive inhibition of AChE activity. TPZ, upon binding with AChE, formed a fluorescent TPZ-enzyme complex. The fluorescence intensity of TPZ-AChE complex was effectively decreased by ephedrine, but not by propranolol or hexamethonium. This indicates that TPZ and ephedrine bind to the same site in AChE which is different from the site/or sites to which propranolol or hexamethonium bind. Hexamethonium protected AChE from inhibition by carbamates and decreased the fluorescence intensity of the physostigmine-inhibited AChE. Phenothiazines and ephedrine did not modulate the enzyme inhibition or the fluorescence intensity of the physostigmine-inhibited AChE. Propranolol and TPZ potentiated the enzyme inhibition and increased the fluorescence intensity in the presence of physostigmine. These compounds, however, did not affect the inhibition of AChE by carbaryl or aldicarb. Ephedrine blocked the effects of TPZ, but did not alter the effects of propranolol on physostigmine-inhibited AChE. AChE, therefore, contains multiple peripheral binding sites which, upon binding to specific ligands, transduce differential signals to the active center.

  3. Identification of an Inhibitory Alcohol Binding Site in GABAA ρ1 Receptors

    PubMed Central

    Borghese, Cecilia M.; Ruiz, Carlos I.; Lee, Ui S.; Cullins, Madeline A.; Bertaccini, Edward J.; Trudell, James R.; Harris, R. Adron

    2016-01-01

    Alcohols inhibit γ-aminobutyric acid type A ρ1 receptor function. After introducing mutations in several positions of the second transmembrane helix in ρ1, we studied the effects of ethanol and hexanol on GABA responses using two-electrode voltage clamp electrophysiology in Xenopus laevis oocytes. The 6′ mutations produced the following effects on ethanol and hexanol responses: small increase or no change (T6′M), increased inhibition (T6′V) and small potentiation (T6′Y and T6′F). The 5′ mutations produced mainly increases in hexanol inhibition. Other mutations produced small (3′ and 9′) or no changes (2′ and L277 in the first transmembrane domain) in alcohol effects. These results suggest an inhibitory alcohol binding site near the 6′ position. Homology models of ρ1 receptors based on the X-ray structure of GluCl showed that the 2′, 5′, 6’ and 9′ residues were easily accessible from the ion pore, with 5′ and 6′ residues from neighboring subunits facing each other; L3′ and L277 also faced the neighboring subunit. We tested ethanol through octanol on single and double mutated ρ1 receptors [ρ1(I15′S), ρ1(T6′Y) and ρ1(T6′Y,I15′S)] to further characterize the inhibitory alcohol pocket in the wild-type ρ1 receptor. The pocket can only bind relatively short-chain alcohols and is eliminated by introducing Y in the 6’ position. Replacing the bulky 15′ residue with a smaller side chain introduced a potentiating binding site, more sensitive to long-chain than to short-chain alcohols. In conclusion, the net alcohol effect on the ρ1 receptor is determined by the sum of its actions on inhibitory and potentiating sites. PMID:26571107

  4. Phosphorylation-Dependent 14-3-3 Binding to LRRK2 Is Impaired by Common Mutations of Familial Parkinson's Disease

    PubMed Central

    Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu

    2011-01-01

    Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial PD-related mutations provides novel insight into the pathogenic mechanism of LRRK2-linked PD. PMID:21390248

  5. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  6. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    PubMed

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  7. Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases*

    PubMed Central

    Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

    2015-01-01

    Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (PIntr) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a 14C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site −3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. PMID:26468285

  8. Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases.

    PubMed

    Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

    2015-11-27

    Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (P(Intr)) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a (14)C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site -3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Ab initio study of the binding of Trichostatin A (TSA) in the active site of histone deacetylase like protein (HDLP).

    PubMed

    Vanommeslaeghe, Kenno; Van Alsenoy, Christian; De Proft, Frank; Martins, José C; Tourwé, Dirk; Geerlings, Paul

    2003-08-21

    Histone deacetylase (HDAC) inhibitors have recently attracted considerable interest because of their therapeutic potential for the treatment of cell proliferative diseases. An X-ray structure of a very potent inhibitor, Trichostatin A (TSA), bound to HDLP (an HDAC analogue isolated from Aquifex aeolicus), is available. From this structure, an active site model (322 atoms), relevant for the binding of TSA and structural analogues, has been derived, and TSA has been minimized in this active site at HF 3-21G* level. The resulting conformation is in excellent accordance with the X-ray structure, and indicates a deprotonation of the hydroxamic acid in TSA by His 131. Also, a water molecule was minimized in the active site. In addition to a similar deprotonation, in accordance with a possible catalytic mechanism of HDAC as proposed by Finnin et al. (M. S. Finnin, J. R. Donigian, A. Cohen, V. M. Richon, R. A. Rifkind and P. A. Marks, Nature, 1999, 401, 188-193), a displacement of the resulting OH- ion in the active site was observed. Based on these results, the difference in energy of binding between TSA and water was calculated. The resulting value is realistic in respect to experimental binding affinities. Furthermore, the mechanism of action of the His 131-Asp 166 charge relay system was investigated. Although the Asp residue in this motif is known to substantially increase the basicity of the His residue, no proton transfer from His 131 to Asp 166 was observed on binding of TSA or water. However, in the empty protonated active site, this proton transfer does occur.

  10. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  11. A pharmacophore model specific to active site of CYP1A2 with a novel molecular modeling explorer and CoMFA.

    PubMed

    Zhang, Tao; Wei, Dong-Qing; Chou, Kuo-Chen

    2012-03-01

    Comparative molecular field analysis (CoMFA) is a widely used 3D-QSAR method by which we can investigate the potential relation between biological activity of compounds and their structural features. In this study, a new application of this approach is presented by combining the molecular modeling with a new developed pharmacophore model specific to CYP1A2 active site. During constructing the model, we used the molecular dynamics simulation and molecular docking method to select the sensible binding conformations for 17 CYP1A2 substrates based on the experimental data. Subsequently, the results obtained via the alignment of binding conformations of substrates were projected onto the active- site residues, upon which a simple blueprint of active site was produced. It was validated by the experimental and computational results that the model did exhibit the high degree of rationality and provide useful insights into the substrate binding. It is anticipated that our approach can be extended to investigate the protein-ligand interactions for many other enzyme-catalyzed systems as well.

  12. BIPAD: A web server for modeling bipartite sequence elements

    PubMed Central

    Bi, Chengpeng; Rogan, Peter K

    2006-01-01

    Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993

  13. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  14. Modeling protein-small molecule interactions: structure and thermodynamics of noble gases binding in a cavity in mutant phage T4 lysozyme L99A.

    PubMed

    Mann, G; Hermans, J

    2000-09-29

    The complexes of phage T4 lysozyme L99A with noble gases have been studied by molecular dynamics simulation. In a long simulation of the complex with one Xe atom, the structure was found to undergo global conformation change involving a reversible opening and closing of the entrance to the substrate-binding site, during which the conformations of the N and C-terminal domains varied little. The distributions of Xe positions sampled in dynamics simulations were refined in terms of anisotropic Gaussian distributions via least-squares minimization of the difference between Fourier transforms. In addition, molecular transformation simulations have been applied in order to calculate the binding free energies of Xe, Kr and Ar relative to a standard state at a pressure of 1 bar. A single bound Xe is found to assume an equilibrium distribution over three adjacent preferred sites, while in a two-Xe complex, the two Xe atoms preferentially occupy two of these. The positions of the three sites agree closely with the positions of bound Xe determined in the refined crystal structure of a complex formed at a pressure of 8 bar Xe, and the calculated affinities agree well with the observed partial occupancies. At a pressure of 8 bar, a mixture of one-Xe and two-Xe complexes is present, and similarly for complexes with Kr and Ar, with single occupancy relatively more prevalent with Kr and Ar. (Binding of a third Xe atom is found to be quite unfavorable.) A comparison with simulation results for the binding of benzene to the same site leads to the conclusion that binding of Xe within cavities in proteins is common because of several favorable factors: (1) Xe has a large atomic polarizability; (2) Xe can be applied at a relatively high pressure, i.e. high chemical potential; (3) an unfavorable entropic term related to the need to orient the ligand in the binding site is absent. Finally, it is found that the model's binding energy of a water molecule in the cavity is insufficient to overcome the unfavorable binding entropy. Copyright 2000 Academic Press.

  15. Sequence- and Interactome-Based Prediction of Viral Protein Hotspots Targeting Host Proteins: A Case Study for HIV Nef

    PubMed Central

    Sarmady, Mahdi; Dampier, William; Tozeren, Aydin

    2011-01-01

    Virus proteins alter protein pathways of the host toward the synthesis of viral particles by breaking and making edges via binding to host proteins. In this study, we developed a computational approach to predict viral sequence hotspots for binding to host proteins based on sequences of viral and host proteins and literature-curated virus-host protein interactome data. We use a motif discovery algorithm repeatedly on collections of sequences of viral proteins and immediate binding partners of their host targets and choose only those motifs that are conserved on viral sequences and highly statistically enriched among binding partners of virus protein targeted host proteins. Our results match experimental data on binding sites of Nef to host proteins such as MAPK1, VAV1, LCK, HCK, HLA-A, CD4, FYN, and GNB2L1 with high statistical significance but is a poor predictor of Nef binding sites on highly flexible, hoop-like regions. Predicted hotspots recapture CD8 cell epitopes of HIV Nef highlighting their importance in modulating virus-host interactions. Host proteins potentially targeted or outcompeted by Nef appear crowding the T cell receptor, natural killer cell mediated cytotoxicity, and neurotrophin signaling pathways. Scanning of HIV Nef motifs on multiple alignments of hepatitis C protein NS5A produces results consistent with literature, indicating the potential value of the hotspot discovery in advancing our understanding of virus-host crosstalk. PMID:21738584

  16. Molecular Determinants of Phosphatidylinositol 4,5-Bisphosphate (PI(4,5)P2) Binding to Transient Receptor Potential V1 (TRPV1) Channels*

    PubMed Central

    Poblete, Horacio; Oyarzún, Ingrid; Olivero, Pablo; Comer, Jeffrey; Zuñiga, Matías; Sepulveda, Romina V.; Báez-Nieto, David; González Leon, Carlos; González-Nilo, Fernando; Latorre, Ramón

    2015-01-01

    Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) has been recognized as an important activator of certain transient receptor potential (TRP) channels. More specifically, TRPV1 is a pain receptor activated by a wide range of stimuli. However, whether or not PI(4,5)P2 is a TRPV1 agonist remains open to debate. Utilizing a combined approach of mutagenesis and molecular modeling, we identified a PI(4,5)P2 binding site located between the TRP box and the S4-S5 linker. At this site, PI(4,5)P2 interacts with the amino acid residues Arg-575 and Arg-579 in the S4-S5 linker and with Lys-694 in the TRP box. We confirmed that PI(4,5)P2 behaves as a channel agonist and found that Arg-575, Arg-579, and Lys-694 mutations to alanine reduce PI(4,5)P2 binding affinity. Additionally, in silico mutations R575A, R579A, and K694A showed that the reduction in binding affinity results from the delocalization of PI(4,5)P2 in the binding pocket. Molecular dynamics simulations indicate that PI(4,5)P2 binding induces conformational rearrangements of the structure formed by S6 and the TRP domain, which cause an opening of the lower TRPV1 channel gate. PMID:25425643

  17. Tracing Cytoplasmic Ca2+ Ion and Water Access Points in the Ca2+-ATPase

    PubMed Central

    Musgaard, Maria; Thøgersen, Lea; Schiøtt, Birgit; Tajkhorshid, Emad

    2012-01-01

    Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) transports two Ca2+ ions across the membrane of the sarco(endo)plasmic reticulum against the concentration gradient, harvesting the required energy by hydrolyzing one ATP molecule during each transport cycle. Although SERCA is one of the best structurally characterized membrane transporters, it is still largely unknown how the transported Ca2+ ions reach their transmembrane binding sites in SERCA from the cytoplasmic side. Here, we performed extended all-atom molecular dynamics simulations of SERCA. The calculated electrostatic potential of the protein reveals a putative mechanism by which cations may be attracted to and bind to the Ca2+-free state of the transporter. Additional molecular dynamics simulations performed on a Ca2+-bound state of SERCA reveal a water-filled pathway that may be used by the Ca2+ ions to reach their buried binding sites from the cytoplasm. Finally, several residues that are involved in attracting and guiding the cations toward the possible entry channel are identified. The results point to a single Ca2+ entry site close to the kinked part of the first transmembrane helix, in a region loaded with negatively charged residues. From this point, a water pathway outlines a putative Ca2+ translocation pathway toward the transmembrane ion-binding sites. PMID:22339863

  18. Ligand-binding specificity and promiscuity of the main lignocellulolytic enzyme families as revealed by active-site architecture analysis.

    PubMed

    Tian, Li; Liu, Shijia; Wang, Shuai; Wang, Lushan

    2016-03-24

    Biomass can be converted into sugars by a series of lignocellulolytic enzymes, which belong to the glycoside hydrolase (GH) families summarized in CAZy databases. Here, using a structural bioinformatics method, we analyzed the active site architecture of the main lignocellulolytic enzyme families. The aromatic amino acids Trp/Tyr and polar amino acids Glu/Asp/Asn/Gln/Arg occurred at higher frequencies in the active site architecture than in the whole enzyme structure. And the number of potential subsites was significantly different among different families. In the cellulase and xylanase families, the conserved amino acids in the active site architecture were mostly found at the -2 to +1 subsites, while in β-glucosidase they were mainly concentrated at the -1 subsite. Families with more conserved binding amino acid residues displayed strong selectivity for their ligands, while those with fewer conserved binding amino acid residues often exhibited promiscuity when recognizing ligands. Enzymes with different activities also tended to bind different hydroxyl oxygen atoms on the ligand. These results may help us to better understand the common and unique structural bases of enzyme-ligand recognition from different families and provide a theoretical basis for the functional evolution and rational design of major lignocellulolytic enzymes.

  19. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  20. Crystal Structure of the Arginine Repressor Protein in Complex With the DNA Operator From Mycobacterium Tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cherney, L.T.; Cherney, M.M.; Garen, C.R.

    2009-05-12

    The Mycobacterium tuberculosis (Mtb) gene product encoded by open reading frame Rv1657 is an arginine repressor (ArgR). All genes involved in the L-arginine (hereafter arginine) biosynthetic pathway are essential for optimal growth of the Mtb pathogen, thus making MtbArgR a potential target for drug design. The C-terminal domains of arginine repressors (CArgR) participate in oligomerization and arginine binding. Several crystal forms of CArgR from Mtb (MtbCArgR) have been obtained. The X-ray crystal structures of MtbCArgR were determined at 1.85 {angstrom} resolution with bound arginine and at 2.15 {angstrom} resolution in the unliganded form. These structures show that six molecules ofmore » MtbCArgR are arranged into a hexamer having approximate 32 point symmetry that is formed from two trimers. The trimers rotate relative to each other by about 11{sup o} upon binding arginine. All residues in MtbCArgR deemed to be important for hexamer formation and for arginine binding have been identified from the experimentally determined structures presented. The hexamer contains six regular sites in which the arginine molecules have one common binding mode and three sites in which the arginine molecules have two overlapping binding modes. The latter sites only bind the ligand at high (200 mM) arginine concentrations.« less

  1. Redox process is crucial for inhibitory properties of aurintricarboxylic acid against activity of YopH: virulence factor of Yersinia pestis

    PubMed Central

    Kuban-Jankowska, Alicja; Gorska, Magdalena; Tuszynski, Jack A; Ossowski, Tadeusz; Wozniak, Michal

    2015-01-01

    YopH is a bacterial protein tyrosine phosphatase, which is essential for the viability and pathogenic virulence of the plague-causing Yersinia sp. bacteria. Inactivation of YopH activity would lead to the loss of bacterial pathogenicity. We have studied the inhibitory properties of aurintricarboxylic acid (ATA) against YopH phosphatase and found that at nanomolar concentrations ATA reversibly decreases the activity of YopH. Computational docking studies indicated that in all binding poses ATA binds in the YopH active site. Molecular dynamics simulations showed that in the predicted binding pose, ATA binds to the essential Cys403 and Arg409 residues in the active site and has a stronger binding affinity than the natural substrate (pTyr). The cyclic voltammetry experiments suggest that ATA reacts remarkably strongly with molecular oxygen. Additionally, the electrochemical reduction of ATA in the presence of a negative potential from −2.0 to 2.5 V generates a current signal, which is observed for hydrogen peroxide. Here we showed that ATA indicates a unique mechanism of YopH inactivation due to a redox process. We proposed that the potent inhibitory properties of ATA are a result of its strong binding in the YopH active site and in situ generation of hydrogen peroxide near catalytic cysteine residue. PMID:26286963

  2. Smallpox Inhibitor of Complement Enzymes (SPICE): Dissecting Functional Sites and Abrogating Activity1

    PubMed Central

    Liszewski, M. Kathryn; Leung, Marilyn K.; Hauhart, Richard; Fang, Celia J.; Bertram, Paula; Atkinson, John P.

    2010-01-01

    Although smallpox was eradicated as a global illness more than 30 years ago, variola virus and other related pathogenic poxviruses, such as monkeypox, remain potential bioterrorist weapons or could re-emerge as natural infections. Poxviruses express virulence factors that down-modulate the host’s immune system. We previously compared functional profiles of the poxviral complement inhibitors of smallpox, vaccinia, and monkeypox known as SPICE, VCP (or VICE), and MOPICE, respectively. SPICE was the most potent regulator of human complement and attached to cells via glycosaminoglycans. The major goals of the present study were to further characterize the complement regulatory and heparin binding sites of SPICE and to evaluate a mAb that abrogates its function. Using substitution mutagenesis, we established that (1) elimination of the three heparin binding sites severely decreases but does not eliminate glycosaminoglycan binding, (2) there is a hierarchy of activity for heparin binding among the three sites, and (3) complement regulatory sites overlap with each of the three heparin binding motifs. By creating chimeras with interchanges of SPICE and VCP residues, a combination of two SPICE amino acids (H77 plus K120) enhances VCP activity ~200-fold. Also, SPICE residue L131 is critical for both complement regulatory function and accounts for the electrophoretic differences between SPICE and VCP. An evolutionary history for these structure-function adaptations of SPICE is proposed. Finally, we identified and characterized a mAb that inhibits the complement regulatory activity of SPICE, MOPICE, and VCP and thus could be used as a therapeutic agent. PMID:19667083

  3. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene

    PubMed Central

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-01-01

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30–60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. PMID:27006398

  4. Potent neutralization of botulinum neurotoxin/B by synergistic action of antibodies recognizing protein and ganglioside receptor binding domain.

    PubMed

    Chen, Changchun; Wang, Shuhui; Wang, Huajing; Mao, Xiaoyan; Zhang, Tiancheng; Ji, Guanghui; Shi, Xin; Xia, Tian; Lu, Weijia; Zhang, Dapeng; Dai, Jianxin; Guo, Yajun

    2012-01-01

    Botulinum neurotoxins (BoNTs), the causative agents for life-threatening human disease botulism, have been recognized as biological warfare agents. Monoclonal antibody (mAb) therapeutics hold considerable promise as BoNT therapeutics, but the potencies of mAbs against BoNTs are usually less than that of polyclonal antibodies (or oligoclonal antibodies). The confirmation of key epitopes with development of effective mAb is urgently needed. We selected 3 neutralizing mAbs which recognize different non-overlapping epitopes of BoNT/B from a panel of neutralizing antibodies against BoNT/B. By comparing the neutralizing effects among different combination groups, we found that 8E10, response to ganglioside receptor binding site, could synergy with 5G10 and 2F4, recognizing non-overlapping epitopes within Syt II binding sites. However, the combination of 5G10 with 2F4 blocking protein receptor binding sites did not achieve synergistical effects. Moreover, we found that the binding epitope of 8E10 was conserved among BoNT A, B, E, and F, which might cross-protect the challenge of different serotypes of BoNTs in vivo. The combination of two mAbs recognizing different receptors' binding domain in BoNTs has a synergistic effect. 8E10 is a potential universal partner for the synergistical combination with other mAb against protein receptor binding domain in BoNTs of other serotypes.

  5. Structural and Genetic Analyses of the Mycobacterium tuberculosis Protein Kinase B Sensor Domain Identify a Potential Ligand-binding Site.

    PubMed

    Prigozhin, Daniil M; Papavinasasundaram, Kadamba G; Baer, Christina E; Murphy, Kenan C; Moskaleva, Alisa; Chen, Tony Y; Alber, Tom; Sassetti, Christopher M

    2016-10-28

    Monitoring the environment with serine/threonine protein kinases is critical for growth and survival of Mycobacterium tuberculosis, a devastating human pathogen. Protein kinase B (PknB) is a transmembrane serine/threonine protein kinase that acts as an essential regulator of mycobacterial growth and division. The PknB extracellular domain (ECD) consists of four repeats homologous to penicillin-binding protein and serine/threonine kinase associated (PASTA) domains, and binds fragments of peptidoglycan. These properties suggest that PknB activity is modulated by ECD binding to peptidoglycan substructures, however, the molecular mechanisms underpinning PknB regulation remain unclear. In this study, we report structural and genetic characterization of the PknB ECD. We determined the crystal structures of overlapping ECD fragments at near atomic resolution, built a model of the full ECD, and discovered a region on the C-terminal PASTA domain that has the properties of a ligand-binding site. Hydrophobic interaction between this surface and a bound molecule of citrate was observed in a crystal structure. Our genetic analyses in M. tuberculosis showed that nonfunctional alleles were produced either by deletion of any of single PASTA domain or by mutation of individual conserved residues lining the putative ligand-binding surface of the C-terminal PASTA repeat. These results define two distinct structural features necessary for PknB signal transduction, a fully extended ECD and a conserved, membrane-distal putative ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Prediction of the binding site of 1-benzyl-4-[(5,6-dimethoxy-1-indanon-2-yl)methyl]piperidine in acetylcholinesterase by docking studies with the SYSDOC program

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    In the preceding paper we reported on a docking study with the SYSDOC program for predicting the binding sites of huperzine A in acetylcholinesterase (AChE) [Pang, Y.-P. and Kozikowski, A.P., J. Comput.-Aided Mol. Design, 8 (1994) 669]. Here we present a prediction of the binding sites of 1-benzyl-4-[(5,6-dimethoxy-1-indanon-2-yl)methyl]piperidine (E2020) in AChE by the same method. E2020 is one of the most potent and selective reversible inhibitors of AChE, and this molecule has puzzled researchers, partly due to its flexible structure, in understanding how it binds to AChE. Based on the results of docking 1320 different conformers of E2020 into 69 different conformers of AChE and on the pharmacological data reported for E2020 and its analogs, we predict that both the R- and the S-isomer of E2020 span the whole binding cavity of AChE, with the ammonium group interacting mainly with Trp84, Phe330 and Asp72, the phenyl group interacting mainly with Trp84 and Phe330, and the indanone moiety interacting mainly with Tyr70 and Trp279. The topography of the calculated E2020 binding sites provides insights into understanding the high potency of E2020 in the inhibition of AChE and provides hints as to possible structural modifications for identifying improved AChE inhibitors as potential therapeutics for the palliative treatment of Alzheimer's disease.

  7. Integrating docking and molecular dynamics approaches for a series of proline-based 2,5-diketopiperazines as novel αβ-tubulin inhibitors.

    PubMed

    Fani, Najmeh; Bordbar, Abdol-Khalegh; Ghayeb, Yousef; Sepehri, Saghi

    2015-01-01

    In this work, docking tools were utilized in order to study the binding properties of more than five hundred of proline-based 2,5-diketopiperazine in the binding site of αβ-tubulin. Results revealed that 20 compounds among them showed lower binding energies in comparison with Tryprostatin-A, a well known tubulin inhibitor and therefore could be potential inhibitors of tubulin. However, the precise evaluation of binding poses represents the similar binding modes for all of these compounds and Tryprostatin-A. Finally, the best docked complex was subjected to a 25 ns molecular dynamics simulation to further validate the proposed binding mode of this compound.

  8. RNA-dependent RNA polymerase: Addressing Zika outbreak by a phylogeny-based drug target study.

    PubMed

    Stephen, Preyesh; Lin, Sheng-Xiang

    2018-01-01

    Since the first major outbreak of Zika virus (ZIKV) in 2007, ZIKV is spreading explosively through South and Central America, and recent reports in highly populated developing countries alarm the possibility of a more catastrophic outbreak. ZIKV infection in pregnant women leads to embryonic microcephaly and Guillain-Barré syndrome in adults. At present, there is limited understanding of the infectious mechanism, and no approved therapy has been reported. Despite the withdrawal of public health emergency, the WHO still considers the ZIKV as a highly significant and long-term public health challenge that the situation has to be addressed rapidly. Non-structural protein 5 is essential for capping and replication of viral RNA and comprises a methyltransferase and RNA-dependent RNA polymerase (RdRp) domain. We used molecular modeling to obtain the structure of ZIKV RdRp, and by molecular docking and phylogeny analysis, we here demonstrate the potential sites for drug screening. Two metal binding sites and an NS3-interacting region in ZIKV RdRp are demonstrated as potential drug screening sites. The docked structures reveal a remarkable degree of conservation at the substrate binding site and the potential drug screening sites. A phylogeny-based approach is provided for an emergency preparedness, where similar class of ligands could target phylogenetically related proteins. © 2017 John Wiley & Sons A/S.

  9. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  10. Prediction of protein-protein interaction sites using electrostatic desolvation profiles.

    PubMed

    Fiorucci, Sébastien; Zacharias, Martin

    2010-05-19

    Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  11. A Fragment-Based Ligand Screen Against Part of a Large Protein Machine: The ND1 Domains of the AAA+ ATPase p97/VCP.

    PubMed

    Chimenti, Michael S; Bulfer, Stacie L; Neitz, R Jeffrey; Renslo, Adam R; Jacobson, Matthew P; James, Thomas L; Arkin, Michelle R; Kelly, Mark J S

    2015-07-01

    The ubiquitous AAA+ ATPase p97 functions as a dynamic molecular machine driving several cellular processes. It is essential in regulating protein homeostasis, and it represents a potential drug target for cancer, particularly when there is a greater reliance on the endoplasmic reticulum-associated protein degradation pathway and ubiquitin-proteasome pathway to degrade an overabundance of secreted proteins. Here, we report a case study for using fragment-based ligand design approaches against this large and dynamic hexamer, which has multiple potential binding sites for small molecules. A screen of a fragment library was conducted by surface plasmon resonance (SPR) and followed up by nuclear magnetic resonance (NMR), two complementary biophysical techniques. Virtual screening was also carried out to examine possible binding sites for the experimental hits and evaluate the potential utility of fragment docking for this target. Out of this effort, 13 fragments were discovered that showed reversible binding with affinities between 140 µM and 1 mM, binding stoichiometries of 1:1 or 2:1, and good ligand efficiencies. Structural data for fragment-protein interactions were obtained with residue-specific [U-(2)H] (13)CH3-methyl-labeling NMR strategies, and these data were compared to poses from docking. The combination of virtual screening, SPR, and NMR enabled us to find and validate a number of interesting fragment hits and allowed us to gain an understanding of the structural nature of fragment binding. © 2015 Society for Laboratory Automation and Screening.

  12. Peptidomimetic Escape Mechanisms Arise via Genetic Diversity in the Ligand-Binding Site of the Hepatitis C Virus NS3/4A Serine Protease

    PubMed Central

    Welsch, Christoph; Shimakami, Tetsuro; Hartmann, Christoph; Yang, Yan; Domingues, Francisco S.; Lengauer, Thomas; Zeuzem, Stefan; Lemon, Stanley M.

    2011-01-01

    Background & Aims It is a challenge to develop direct-acting antiviral agents (DAAs) that target the NS3/4A protease of hepatitis C virus (HCV) because resistant variants develop. Ketoamide compounds, designed to mimic the natural protease substrate, have been developed as inhibitors. However, clinical trials have revealed rapid selection of resistant mutants, most of which are considered to be pre-existing variants. Methods We identified residues near the ketoamide-binding site in X-ray structures of the genotype 1a protease, co-crystallized with boceprevir or a telaprevir-like ligand, and then identified variants at these positions in 219 genotype 1 sequences from a public database. We used side-chain modeling to assess the potential effects of these variants on the interaction between ketoamide and the protease, and compared these results with the phenotypic effects on ketoamide resistance, RNA replication capacity, and infectious virus yields in a cell culture model of infection. Results Thirteen natural binding-site variants with potential for ketoamide resistance were identified at 10 residues in the protease, near the ketoamide binding site. Rotamer analysis of amino acid side-chain conformations indicated that 2 variants (R155K and D168G) could affect binding of telaprevir more than boceprevir. Measurements of antiviral susceptibility in cell culture studies were consistent with this observation. Four variants (Q41H, I132V, R155K, and D168G) caused low-to-moderate levels of ketoamide resistance; 3 of these were highly fit (Q41H, I132V, and R155K). Conclusions Using a comprehensive sequence and structure-based analysis, we showed how natural variation in the HCV protease NS3/4A sequences might affect susceptibility to first-generation DAAs. These findings increase our understanding of the molecular basis of ketoamide resistance among naturally existing viral variants. PMID:22155364

  13. Structural determinants of species-selective substrate recognition in human and Drosophila serotonin transporters revealed through computational docking studies

    PubMed Central

    Kaufmann, Kristian W.; Dawson, Eric S.; Henry, L. Keith; Field, Julie R.; Blakely, Randy D.; Meiler, Jens

    2009-01-01

    To identify potential determinants of substrate selectivity in serotonin (5-HT) transporters (SERT), models of human and Drosophila serotonin transporters (hSERT, dSERT) were built based on the leucine transporter (LeuTAa) structure reported by Yamashita et al. (Nature 2005;437:215–223), PBDID 2A65. Although the overall amino acid identity between SERTs and the LeuTAa is only 17%, it increases to above 50% in the first shell of the putative 5-HT binding site, allowing de novo computational docking of tryptamine derivatives in atomic detail. Comparison of hSERT and dSERT complexed with substrates pinpoints likely structural determinants for substrate binding. Forgoing the use of experimental transport and binding data of tryptamine derivatives for construction of these models enables us to cHitically assess and validate their predictive power: A single 5-HT binding mode was identified that retains the amine placement observed in the LeuTAa structure, matches site-directed mutagenesis and substituted cysteine accessibility method (SCAM) data, complies with support vector machine derived relations activity relations, and predicts computational binding energies for 5-HT analogs with a significant correlation coefficient (R = 0.72). This binding mode places 5-HT deep in the binding pocket of the SERT with the 5-position near residue hSERT A169/dSERT D164 in transmembrane helix 3, the indole nitrogen next to residue Y176/Y171, and the ethylamine tail under residues F335/F327 and S336/S328 within 4 Å of residue D98. Our studies identify a number of potential contacts whose contribution to substrate binding and transport was previously unsuspected. PMID:18704946

  14. 3H[2-(2-benzofuranyl)-2-imidazoline] (BFI) binding in human platelets: modulation by tranylcypromine.

    PubMed

    Wiest, S A; Steinberg, M I

    1999-08-01

    2-(2-Benzofuranyl)-2-imidazoline (BFI) is a highly selective ligand for imidazoline-type 2 (I2) binding sites that are known to be associated with monoamine oxidase (MAO). Recently we demonstrated a potentiation of 3H-BFI binding in human but not in rat brain by the nonselective MAO inhibitor tranylcypromine. In the present studies, we evaluated the effect of tranylcypromine on the binding of 3H-BFI to human platelet inner membranes. Membranes were incubated with 3H-BFI at 22 degrees C in 50 mM Tris, 1.5 mM EDTA, pH 7.5. Saturation experiments with 3H-BFI (0.5-80 nM) were analyzed using non-linear curve fitting. Addition of tranylcypromine (0.1 mM) increased the number of 3H-BFI binding sites (Bmax=0.35+/-0.06 vs. 1.87+/-0.15 pmol/mg protein for vehicle and tranylcypromine, respectively) and increased 3H-BFI affinity slightly (KD =16.0+/-4.1 vs. 6.5+/-0.3 nM for vehicle and tranylcypromine, respectively). In competitive binding experiments using the less selective I2 ligand, 3H-idazoxan, tranylcypromine only weakly inhibited binding. Preincubation of platelet membranes with tranylcypromine (1 nM-10 microM) enhanced the Bmax of 3H-BFI binding in a concentration-dependent manner peaking at 1 microM (13 x control) and returning to near baseline at 100 microM. 3H-BFI binding was displaced monophasically (in order of decreasing potency) by BFI > or = 2-(4,5-dihydroimidazol-2-yl)quinoline (BU224) > or = cirazoline >idazoxan >(1,4-benzodioxan-2-methoxy-2-yl)-2-imidazoline (RX821002)= moxonidine. Amiloride, clorgyline, guanabenz and clonidine displayed biphasic curves with nanomolar high affinity components. Tranylcypromine altered the competition curves for all ligands (except BFI) by increasing the affinities for clonidine and RX821002 and decreasing affinities for BU224, cirazoline, guanabenz, idazoxan, clorgyline, moxonidine, and amiloride. Thus, in human platelets tranylcypromine exposes a high capacity 3H-BFI binding site distinct from previously described I2 sites that retains high affintiy for BFI but not other I2 ligands. Our results suggest that 3H-BFI and 3H-idazoxan may not be considered as interchangeable probes for the I2 binding site.

  15. HLA-A SNPs and amino acid variants are associated with nasopharyngeal carcinoma in Malaysian Chinese.

    PubMed

    Chin, Yoon-Ming; Mushiroda, Taisei; Takahashi, Atsushi; Kubo, Michiaki; Krishnan, Gopala; Yap, Lee-Fah; Teo, Soo-Hwang; Lim, Paul Vey-Hong; Yap, Yoke-Yeow; Pua, Kin-Choo; Kamatani, Naoyuki; Nakamura, Yusuke; Sam, Choon-Kook; Khoo, Alan Soo-Beng; Ng, Ching-Ching

    2015-02-01

    Nasopharyngeal carcinoma (NPC) arises from the mucosal epithelium of the nasopharynx and is constantly associated with Epstein-Barr virus type 1 (EBV-1) infection. We carried out a genome-wide association study (GWAS) of 575,247 autosomal SNPs in 184 NPC patients and 236 healthy controls of Malaysian Chinese ethnicity. Potential association signals were replicated in a separate cohort of 260 NPC patients and 245 healthy controls. We confirmed the association of HLA-A to NPC with the strongest signal detected in rs3869062 (p = 1.73 × 10(-9)). HLA-A fine mapping revealed associations in the amino acid variants as well as its corresponding SNPs in the antigen peptide binding groove (p(HLA-A-aa-site-99) = 3.79 × 10(-8), p(rs1136697) = 3.79 × 10(-8)) and T-cell receptor binding site (p(HLA-A-aa-site-145) = 1.41 × 10(-4), p(rs1059520) = 1.41 × 10(-4)) of the HLA-A. We also detected strong association signals in the 5'-UTR region with predicted active promoter states (p(rs41545520) = 7.91 × 10(-8)). SNP rs41545520 is a potential binding site for repressor ATF3, with increased binding affinity for rs41545520-G correlated with reduced HLA-A expression. Multivariate logistic regression diminished the effects of HLA-A amino acid variants and SNPs, indicating a correlation with the effects of HLA-A*11:01, and to a lesser extent HLA-A*02:07. We report the strong genetic influence of HLA-A on NPC susceptibility in the Malaysian Chinese. © 2014 UICC.

  16. Long-range electrostatic complementarity governs substrate recognition by human chymotrypsin C, a key regulator of digestive enzyme activation.

    PubMed

    Batra, Jyotica; Szabó, András; Caulfield, Thomas R; Soares, Alexei S; Sahin-Tóth, Miklós; Radisky, Evette S

    2013-04-05

    Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5' subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2' positions of CTRC, although acidic P2' residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels.

  17. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    PubMed

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

    NASA Astrophysics Data System (ADS)

    Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

    2014-07-01

    Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

  19. Tonsil Epithelial Factors May Influence Oropharyngeal Human Immunodeficiency Virus Transmission

    PubMed Central

    Moutsopoulos, Niki M.; Nares, Salvador; Nikitakis, Nikolaos; Rangel, Zoila; Wen, Jie; Munson, Peter; Sauk, John; Wahl, Sharon M.

    2007-01-01

    Tonsil epithelium has been implicated in human immunodeficiency virus (HIV) pathogenesis, but its role in oral transmission remains controversial. To study characteristics of this tissue, which may influence susceptibility or resistance to HIV, we performed microarray analysis of the tonsil epithelium. Our data revealed that genes related to immune functions such as antibody production and antigen processing were increasingly expressed in tonsil compared with the epithelium of another oropharyngeal site, the gingival epithelium. Importantly, tonsil epithelium highly expressed genes associated with HIV entrapment and/or transmission, including the HIV co-receptor CXCR4 and the potential HIV-binding molecules FcRγIII, complement receptor 2, and various complement components. Immunohistochemical staining confirmed the increased presence of CXCR4 in the tonsil epithelium compared with multiple oral epithelial sites, particularly in basal and parabasal layers. This increased expression of molecules involved in viral recognition, binding, and entry may favor virus-epithelium interactions in an environment with reduced innate antiviral mechanisms. Specifically, secretory leukocyte protease inhibitor, an innate molecule with anti-HIV activity, was minimal in the tonsil epithelium, in contrast to oral mucosa. Collectively, our data suggest that increased expression of molecules associated with HIV binding and entry coupled with decreased innate antiviral factors may render the tonsil a potential site for oral transmission. PMID:17620369

  20. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  1. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  2. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  4. Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, Nicole R.; Hecht, Karen A.; Hu, Dehong

    2016-01-08

    The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins incorporating a tetracysteine tag for site-directed labeling with biarsenical affinity probes and either EGFP or single chain antibody to test colocalization of probes with the EGFP-tagged recombinant protein or binding of biosilica-immobilized antibodies to large and small molecule antigens, respectively. Site-directed labeling with the biarsenical probes demonstrated colocalization with EGFP-encoded proteins in nascent and mature biosilica, supporting their use in studying biosilica maturation. Isolated biosilica transformed with a single chain antibody against either the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT) effectively boundmore » the respective antigens. A marked increase in fluorescence lifetime of the TNT surrogate Alexa Fluor 555-trinitrobenzene reflected the high binding specificity of the transformed isolated biosilica. These results demonstrated the potential use of biosilica-immobilized single chain antibodies as binders for large and small molecule antigens in sensing and therapeutics.« less

  5. Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

    PubMed Central

    Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

    2011-01-01

    The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

  6. Modeling the Binding of Neurotransmitter Transporter Inhibitors with Molecular Dynamics and Free Energy Calculations

    NASA Astrophysics Data System (ADS)

    Jean, Bernandie

    The monoamine transporter (MAT) proteins responsible for the reuptake of the neurotransmitter substrates, dopamine, serotonin, and norepinephrine, are drug targets for the treatment of psychiatric disorders including depression, anxiety, and attention deficit hyperactivity disorder. Small molecules that inhibit these proteins can serve as useful therapeutic agents. However, some dopamine transporter (DAT) inhibitors, such as cocaine and methamphetamine, are highly addictive and abusable. Efforts have been made to develop small molecules that will inhibit the transporters and elucidate specific binding site interactions. This work provides knowledge of molecular interactions associated with MAT inhibitors by offering an atomistic perspective that can guide designs of new pharmacotherapeutics with enhanced activity. The work described herein evaluates intermolecular interactions using computational methods to reveal the mechanistic detail of inhibitors binding in the DAT. Because cocaine recognizes the extracellular-facing or outward-facing (OF) DAT conformation and benztropine recognizes the intracellular-facing or inward-facing (IF) conformation, it was postulated that behaviorally "typical" (abusable, locomotor psychostimulant) inhibitors stabilize the OF DAT and "atypical" (little or no abuse potential) inhibitors favor IF DAT. Indeed, behaviorally-atypical cocaine analogs have now been shown to prefer the OF DAT conformation. Specifically, the binding interactions of two cocaine analogs, LX10 and LX11, were studied in the OF DAT using molecular dynamics simulations. LX11 was able to interact with residues of transmembrane helix 8 and bind in a fashion that allowed for hydration of the primary binding site (S1) from the intracellular space, thus impacting the intracellular interaction network capable of regulating conformational transitions in DAT. Additionally, a novel serotonin transporter (SERT) inhibitor previously discovered through virtual screening at the SERT secondary binding site (S2) was studied. Intermolecular interactions between SM11 and SERT have been assessed using binding free energy calculations to predict the ligand-binding site and optimize ligand-binding interactions. Results indicate the addition of atoms to the 4-chlorobenzyl moiety were most energetically favorable. The simulations carried out in DAT and SERT were supported by experimental results. Furthermore, the co-crystal structures of DAT and SERT share similar ligand-binding interactions with the homology models used in this study.

  7. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  8. Identifying potential selective fluorescent probes for cancer-associated protein carbonic anhydrase IX using a computational approach.

    PubMed

    Kamstra, Rhiannon L; Floriano, Wely B

    2014-11-01

    Carbonic anhydrase IX (CAIX) is a biomarker for tumor hypoxia. Fluorescent inhibitors of CAIX have been used to study hypoxic tumor cell lines. However, these inhibitor-based fluorescent probes may have a therapeutic effect that is not appropriate for monitoring treatment efficacy. In the search for novel fluorescent probes that are not based on known inhibitors, a database of 20,860 fluorescent compounds was virtually screened against CAIX using hierarchical virtual ligand screening (HierVLS). The screening database contained 14,862 compounds tagged with the ATTO680 fluorophore plus an additional 5998 intrinsically fluorescent compounds. Overall ranking of compounds to identify hit molecular probe candidates utilized a principal component analysis (PCA) approach. Four potential binding sites, including the catalytic site, were identified within the structure of the protein and targeted for virtual screening. Available sequence information for 23 carbonic anhydrase isoforms was used to prioritize the four sites based on the estimated "uniqueness" of each site in CAIX relative to the other isoforms. A database of 32 known inhibitors and 478 decoy compounds was used to validate the methodology. A receiver-operating characteristic (ROC) analysis using the first principal component (PC1) as predictive score for the validation database yielded an area under the curve (AUC) of 0.92. AUC is interpreted as the probability that a binder will have a better score than a non-binder. The use of first component analysis of binding energies for multiple sites is a novel approach for hit selection. The very high prediction power for this approach increases confidence in the outcome from the fluorescent library screening. Ten of the top scoring candidates for isoform-selective putative binding sites are suggested for future testing as fluorescent molecular probe candidates. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. A NMDA receptor glycine site partial agonist, GLYX-13, simultaneously enhances LTP and reduces LTD at Schaffer collateral-CA1 synapses in hippocampus.

    PubMed

    Zhang, Xiao-lei; Sullivan, John A; Moskal, Joseph R; Stanton, Patric K

    2008-12-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) are a key route for Ca2+ influx into neurons important to both activity-dependent synaptic plasticity and, when uncontrolled, triggering events that cause neuronal degeneration and death. Among regulatory binding sites on the NMDAR complex is a glycine binding site, distinct from the glutamate binding site, which must be co-activated for NMDAR channel opening. We developed a novel glycine site partial agonist, GLYX-13, which is both nootropic and neuroprotective in vivo. Here, we assessed the effects of GLYX-13 on long-term synaptic plasticity and NMDAR transmission at Schaffer collateral-CA1 synapses in hippocampal slices in vitro. GLYX-13 simultaneously enhanced the magnitude of long-term potentiation (LTP) of synaptic transmission, while reducing long-term depression (LTD). GLYX-13 reduced NMDA receptor-mediated synaptic currents in CA1 pyramidal neurons evoked by low frequency Schaffer collateral stimulation, but enhanced NMDAR currents during high frequency bursts of activity, and these actions were occluded by a saturating concentration of the glycine site agonist d-serine. Direct two-photon imaging of Schaffer collateral burst-evoked increases in [Ca2+] in individual dendritic spines revealed that GLYX-13 selectively enhanced burst-induced NMDAR-dependent spine Ca2+ influx. Examining the rate of MK-801 block of synaptic versus extrasynaptic NMDAR-gated channels revealed that GLYX-13 selectively enhanced activation of burst-driven extrasynaptic NMDARs, with an action that was blocked by the NR2B-selective NMDAR antagonist ifenprodil. Our data suggest that GLYX-13 may have unique therapeutic potential as a learning and memory enhancer because of its ability to simultaneously enhance LTP and suppress LTD.

  10. On the Preferred Active Sites of Promoted MoS 2 for Hydrodesulfurization with Minimal Organonitrogen Inhibition

    DOE PAGES

    Rangarajan, Srinivas; Mavrikakis, Manos

    2016-12-14

    Hydrodesulfurization is a process to produce ultralow-sulfur diesel fuel. Although promoted molybdenum sulfide (MoS 2) catalysts have been used industrially for several decades, the active site requirements for selective hydrodesulfurization of organosulfur compounds with minimal inhibition by organonitrogen constituents of a real gasoil feed has not been resolved. By using molecular binding energy descriptors derived from plane wave density functional theory calculations for comparative adsorption of organosulfur and organonitrogen compounds, we analyzed more than 20 potential sites on unpromoted and Ni- and Co-promoted MoS 2. We also found that hydrogen sulfide and ammonia are simple descriptors of adsorption of stericallymore » unhindered organosulfur and organonitrogen compounds such as dibenzothiophene and acridine, respectively. Further, organonitrogen compounds in gasoil bind more strongly than organosulfur compounds on all sites except on sites with exposed metal atoms on the corner and sulfur edges of promoted MoS 2. Consequently, these sites are proposed as required for maximum-hydrodesulfurization minimum-inhibition catalysis.« less

  11. Tricyclic GyrB/ParE (TriBE) Inhibitors: A New Class of Broad-Spectrum Dual-Targeting Antibacterial Agents

    PubMed Central

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael; Bensen, Daniel C.; Chen, Zhiyong; Lam, Thanh; Zhang, Junhu; Lee, Suk Joong; Hough, Grayson; Phillipson, Doug; Akers-Rodriguez, Suzanne; Cunningham, Mark L.; Kwan, Bryan P.; Nelson, Kirk J.; Castellano, Amanda; Locke, Jeff B.; Brown-Driver, Vickie; Murphy, Timothy M.; Ong, Voon S.; Pillar, Chris M.; Shinabarger, Dean L.; Nix, Jay; Lightstone, Felice C.; Wong, Sergio E.; Nguyen, Toan B.; Shaw, Karen J.; Finn, John

    2013-01-01

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. However, growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highly conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models. PMID:24386374

  12. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  13. Flavonol Activation Defines an Unanticipated Ligand-Binding Site in the Kinase-RNase Domain of IRE1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiseman, R. Luke; Zhang, Yuhong; Lee, Kenneth P.K.

    2010-08-18

    Signaling in the most conserved branch of the endoplasmic reticulum (ER) unfolded protein response (UPR) is initiated by sequence-specific cleavage of the HAC1/XBP1 mRNA by the ER stress-induced kinase-endonuclease IRE1. We have discovered that the flavonol quercetin activates yeast IRE1's RNase and potentiates activation by ADP, a natural activating ligand that engages the IRE1 nucleotide-binding cleft. Enzyme kinetics and the structure of a cocrystal of IRE1 complexed with ADP and quercetin reveal engagement by quercetin of an unanticipated ligand-binding pocket at the dimer interface of IRE1's kinase extension nuclease (KEN) domain. Analytical ultracentrifugation and crosslinking studies support the preeminence ofmore » enhanced dimer formation in quercetin's mechanism of action. These findings hint at the existence of endogenous cytoplasmic ligands that may function alongside stress signals from the ER lumen to modulate IRE1 activity and at the potential for the development of drugs that modify UPR signaling from this unanticipated site.« less

  14. Glutamate Ligation in the Ni(II)- and Co(II)-Responsive Escherichia coli Transcriptional Regulator, RcnR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carr, Carolyn E.; Musiani, Francesco; Huang, Hsin-Ting

    Escherichia coli RcnR (resistance to cobalt and nickel regulator, EcRcnR) is a metal-responsive repressor of the genes encoding the Ni(II) and Co(II) exporter proteins RcnAB by binding to PRcnAB. The DNA binding affinity is weakened when the cognate ions Ni(II) and Co(II) bind to EcRcnR in a six-coordinate site that features a (N/O)5S ligand donor-atom set in distinct sites: while both metal ions are bound by the N terminus, Cys35, and His64, Co(II) is additionally bound by His3. On the other hand, the noncognate Zn(II) and Cu(I) ions feature a lower coordination number, have a solvent-accessible binding site, and coordinatemore » protein ligands that do not include the N-terminal amine. A molecular model of apo-EcRcnR suggested potential roles for Glu34 and Glu63 in binding Ni(II) and Co(II) to EcRcnR. The roles of Glu34 and Glu63 in metal binding, metal selectivity, and function were therefore investigated using a structure/function approach. X-ray absorption spectroscopy was used to assess the structural changes in the Ni(II), Co(II), and Zn(II) binding sites of Glu → Ala and Glu → Cys variants at both positions. The effect of these structural alterations on the regulation of PrcnA by EcRcnR in response to metal binding was explored using LacZ reporter assays. These combined studies indicate that while Glu63 is a ligand for both metal ions, Glu34 is a ligand for Co(II) but possibly not for Ni(II). The Glu34 variants affect the structure of the cognate metal sites, but they have no effect on the transcriptional response. In contrast, the Glu63 variants affect both the structure and transcriptional response, although they do not completely abolish the function of EcRcnR. The structure of the Zn(II) site is not significantly perturbed by any of the glutamic acid variations. The spectroscopic and functional data obtained on the mutants were used to calculate models of the metal-site structures of EcRcnR bound to Ni(II), Co(II), and Zn(II). The results are interpreted in terms of a switch mechanism, in which a subset of the metal-binding ligands is responsible for the allosteric response required for DNA release.« less

  15. The heterodimeric sweet taste receptor has multiple potential ligand binding sites.

    PubMed

    Cui, Meng; Jiang, Peihua; Maillet, Emeline; Max, Marianna; Margolskee, Robert F; Osman, Roman

    2006-01-01

    The sweet taste receptor is a heterodimer of two G protein coupled receptors, T1R2 and T1R3. This discovery has increased our understanding at the molecular level of the mechanisms underlying sweet taste. Previous experimental studies using sweet receptor chimeras and mutants show that there are at least three potential binding sites in this heterodimeric receptor. Receptor activity toward the artificial sweeteners aspartame and neotame depends on residues in the amino terminal domain of human T1R2. In contrast, receptor activity toward the sweetener cyclamate and the sweet taste inhibitor lactisole depends on residues within the transmembrane domain of human T1R3. Furthermore, receptor activity toward the sweet protein brazzein depends on the cysteine rich domain of human T1R3. Although crystal structures are not available for the sweet taste receptor, useful homology models can be developed based on appropriate templates. The amino terminal domain, cysteine rich domain and transmembrane helix domain of T1R2 and T1R3 have been modeled based on the crystal structures of metabotropic glutamate receptor type 1, tumor necrosis factor receptor, and bovine rhodopsin, respectively. We have used homology models of the sweet taste receptors, molecular docking of sweet ligands to the receptors, and site-directed mutagenesis of the receptors to identify potential ligand binding sites of the sweet taste receptor. These studies have led to a better understanding of the structure and function of this heterodimeric receptor, and can act as a guide for rational structure-based design of novel non-caloric sweeteners, which can be used in the fighting against obesity and diabetes.

  16. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  17. Generalized theory on the mechanism of site-specific DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-05-01

    We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

  18. Crystal structure analysis of human serum albumin complexed with sodium 4-phenylbutyrate.

    PubMed

    Kawai, Akito; Yamasaki, Keishi; Enokida, Taisuke; Miyamoto, Shuichi; Otagiri, Masaki

    2018-03-01

    Sodium 4-phenylbutyrate (PB) is an orphan drug for the treatment of urea cycle disorders. It also inhibits the development of endoplasmic reticulum stress, the action of histone deacetylases and as a regulator of the hepatocanalicular transporter. PB is generally considered to have the potential for use in the treatment of the diseases such as cancer, neurodegenerative diseases and metabolic diseases. In a previous study, we reported that PB is primarily bound to human serum albumin (HSA) in plasma and its binding site is drug site 2. However, details of the binding mode of PB to HSA remain unknown. To address this issue, we examined the crystal structure of HSA with PB bound to it. The structure of the HSA-PB complex indicates that the binding mode of PB to HSA is quite similar to that for octanoate or drugs that bind to drug site 2, as opposed to that for other medium-chain length of fatty acids. These findings provide useful basic information related to drug-HSA interactions. Moreover, the information presented herein is valuable in terms of providing safe and efficient treatment and diagnosis in clinical settings.

  19. A site-saturated mutagenesis study of pentaerythritol tetranitrate reductase reveals that residues 181 and 184 influence ligand binding, stereochemistry and reactivity.

    PubMed

    Toogood, Helen S; Fryszkowska, Anna; Hulley, Martyn; Sakuma, Michiyo; Mansell, David; Stephens, Gill M; Gardiner, John M; Scrutton, Nigel S

    2011-03-21

    We have conducted a site-specific saturation mutagenesis study of H181 and H184 of flavoprotein pentaerythritol tetranitrate reductase (PETN reductase) to probe the role of these residues in substrate binding and catalysis with a variety of α,β-unsaturated alkenes. Single mutations at these residues were sufficient to dramatically increase the enantiopurity of products formed by reduction of 2-phenyl-1-nitropropene. In addition, many mutants exhibited a switch in reactivity to predominantly catalyse nitro reduction, as opposed to CC reduction. These mutants showed an enhancement in a minor side reaction and formed 2-phenylpropanal oxime from 2-phenyl-1-nitropropene. The multiple binding conformations of hydroxy substituted nitro-olefins in PETN reductase were examined by using both structural and catalytic techniques. These compounds were found to bind in both active and inhibitory complexes; this highlights the plasticity of the active site and the ability of the H181/H184 couple to coordinate with multiple functional groups. These properties demonstrate the potential to use PETN reductase as a scaffold in the development of industrially useful biocatalysts. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  1. Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

    PubMed

    Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

    2006-07-07

    We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

  2. Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri*

    PubMed Central

    Nie, Laiyin; Grell, Ernst; Malviya, Viveka Nand; Xie, Hao; Wang, Jingkang; Michel, Hartmut

    2016-01-01

    Multidrug and toxic compound extrusion (MATE) transporters exist in all three domains of life. They confer multidrug resistance by utilizing H+ or Na+ electrochemical gradients to extrude various drugs across the cell membranes. The substrate binding and the transport mechanism of MATE transporters is a fundamental process but so far not fully understood. Here we report a detailed substrate binding study of NorM_PS, a representative MATE transporter from Pseudomonas stutzeri. Our results indicate that NorM_PS is a proton-dependent multidrug efflux transporter. Detailed binding studies between NorM_PS and 4′,6-diamidino-2-phenylindole (DAPI) were performed by isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectrofluorometry. Two exothermic binding events were observed from ITC data, and the high-affinity event was directly correlated with the extrusion of DAPI. The affinities are about 1 μm and 0.1 mm for the high and low affinity binding, respectively. Based on our homology model of NorM_PS, variants with mutations of amino acids that are potentially involved in substrate binding, were constructed. By carrying out the functional characterization of these variants, the critical amino acid residues (Glu-257 and Asp-373) for high-affinity DAPI binding were determined. Taken together, our results suggest a new substrate-binding site for MATE transporters. PMID:27235402

  3. Structural basis of stereospecificity in the bacterial enzymatic cleavage of β-aryl ether bonds in lignin

    DOE PAGES

    Helmich, Kate E.; Pereira, Jose Henrique; Gall, Daniel L.; ...

    2015-12-04

    Here, lignin is a combinatorial polymer comprising monoaromatic units that are linked via covalent bonds. Although lignin is a potential source of valuable aromatic chemicals, its recalcitrance to chemical or biological digestion presents major obstacles to both the production of second-generation biofuels and the generation of valuable coproducts from lignin's monoaromatic units. Degradation of lignin has been relatively well characterized in fungi, but it is less well understood in bacteria. A catabolic pathway for the enzymatic breakdown of aromatic oligomers linked via β-aryl ether bonds typically found in lignin has been reported in the bacterium Sphingobium sp. SYK-6. Here, wemore » present x-ray crystal structures and biochemical characterization of the glutathione-dependent β-etherases, LigE and LigF, from this pathway. The crystal structures show that both enzymes belong to the canonical two-domain fold and glutathione binding site architecture of the glutathione S-transferase family. Mutagenesis of the conserved active site serine in both LigE and LigF shows that, whereas the enzymatic activity is reduced, this amino acid side chain is not absolutely essential for catalysis. The results include descriptions of cofactor binding sites, substrate binding sites, and catalytic mechanisms. Because β-aryl ether bonds account for 50–70% of all interunit linkages in lignin, understanding the mechanism of enzymatic β-aryl ether cleavage has significant potential for informing ongoing studies on the valorization of lignin.« less

  4. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  5. Structural basis for the antibody neutralization of Herpes simplex virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Cheng-Chung; Lin, Li-Ling; Academia Sinica, Taipei 115, Taiwan

    2013-10-01

    The gD–E317-Fab complex crystal revealed the conformational epitope of human mAb E317 on HSV gD, providing a molecular basis for understanding the viral neutralization mechanism. Glycoprotein D (gD) of Herpes simplex virus (HSV) binds to a host cell surface receptor, which is required to trigger membrane fusion for virion entry into the host cell. gD has become a validated anti-HSV target for therapeutic antibody development. The highly inhibitory human monoclonal antibody E317 (mAb E317) was previously raised against HSV gD for viral neutralization. To understand the structural basis of antibody neutralization, crystals of the gD ectodomain bound to the E317more » Fab domain were obtained. The structure of the complex reveals that E317 interacts with gD mainly through the heavy chain, which covers a large area for epitope recognition on gD, with a flexible N-terminal and C-terminal conformation. The epitope core structure maps to the external surface of gD, corresponding to the binding sites of two receptors, herpesvirus entry mediator (HVEM) and nectin-1, which mediate HSV infection. E317 directly recognizes the gD–nectin-1 interface and occludes the HVEM contact site of gD to block its binding to either receptor. The binding of E317 to gD also prohibits the formation of the N-terminal hairpin of gD for HVEM recognition. The major E317-binding site on gD overlaps with either the nectin-1-binding residues or the neutralizing antigenic sites identified thus far (Tyr38, Asp215, Arg222 and Phe223). The epitopes of gD for E317 binding are highly conserved between two types of human herpesvirus (HSV-1 and HSV-2). This study enables the virus-neutralizing epitopes to be correlated with the receptor-binding regions. The results further strengthen the previously demonstrated therapeutic and diagnostic potential of the E317 antibody.« less

  6. Mass Spectrometry to Identify New Biomarkers of Nerve Agent Exposure

    DTIC Science & Technology

    2010-04-01

    target for oganophosphorus agent (OP) binding to enzymes is the active site serine in the consensus sequence GlyXSerXGly of acetylcholinesterase. By...human plasma. Task 6. Use a second method, for example enzyme activity assays or immunoprecipitation, to confirm the identity of soman-labeled proteins...spectrometry identifies covalent binding of soman, sarin, chlorpyrifos oxon, diisopropyl fluorophosphate, and FP-biotin to tyrosines on tubulin: a potential

  7. Effect of phloretin on the binding of 1-anilino-8-naphtalene sulfonate (ANS) to 1,2-Dimyristoyl-sn-glycero-3-phosphocoline (DMPC) vesicles in the gel and liquid-crystalline state.

    PubMed

    Cutró, Andrea C; Montich, Guillermo; Roveri, Oscar A

    2015-02-01

    Phloretin is a known modifier of the internal dipole potential of lipid membranes. We studied the interaction of phloretin with model lipid membranes and how it influences the membrane dipole organization using ANS as fluorescent probe. The fluorescence increase observed when ANS binds to DMPC liposomes in gel phase (13 °C) was 2.5 times larger in the presence of phloretin. This effect was due to an increase in ANS affinity, which can be related to the known capability of phloretin in decreasing the dipole potential. Conversely, when the experiments were carried out at 33 °C (liquid crystalline phase), phloretin completely inhibited the increase in ANS fluorescence. In addition, phloretin only affected the electrical properties of the membrane in the gel phase, whereas it modifies structural ones in the liquid-crystalline state. We postulate that phloretin was bound only to the DMPC interface in the gel phase decreasing the surface negative charge density without modifying the structural properties of the ANS binding sites. In the liquid-crystalline phase instead, it increased the accessibility of water to the ANS binding sites decreasing the intrinsic affinity and the fluorescence quantum yield of ANS.

  8. CD4-binding site alterations in CCR5-using HIV-1 envelopes influencing gp120-CD4 interactions and fusogenicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sterjovski, Jasminka; Churchill, Melissa J.; Roche, Michael

    2011-02-20

    CD4-binding site (CD4bs) alterations in gp120 contribute to different pathophysiological phenotypes of CCR5-using (R5) HIV-1 strains, but the potential structural basis is unknown. Here, we characterized functionally diverse R5 envelope (Env) clones (n = 16) to elucidate potential structural alterations within the gp120 CD4bs that influence Env function. Initially, we showed that the magnitude of gp120-CD4-binding correlates with increased fusogenicity and reduced CD4 dependence. Analysis of three-dimensional gp120 structural models revealed two CD4bs variants, D279 and N362, that were associated with reduced CD4 dependence. Further structural analysis showed that a wider aperture of the predicted CD4bs cavity, as constrained bymore » the inner-most atoms at the gp120 V1V2 stem and the V5 loop, was associated with amino acid alterations within V5 and correlated with increased gp120-CD4 binding and increased fusogenicity. Our results provide evidence that the gp120 V5 loop may alter CD4bs conformation and contribute to increased gp120-CD4 interactions and Env fusogenicity.« less

  9. Effects of Single Nucleotide Polymorphisms on Human N-Acetyltransferase 2 Structure and Dynamics by Molecular Dynamics Simulation

    PubMed Central

    Rajasekaran, M.; Abirami, Santhanam; Chen, Chinpan

    2011-01-01

    Background Arylamine N-acetyltransferase 2 (NAT2) is an important catalytic enzyme that metabolizes the carcinogenic arylamines, hydrazine drugs and chemicals. This enzyme is highly polymorphic in different human populations. Several polymorphisms of NAT2, including the single amino acid substitutions R64Q, I114T, D122N, L137F, Q145P, R197Q, and G286E, are classified as slow acetylators, whereas the wild-type NAT2 is classified as a fast acetylator. The slow acetylators are often associated with drug toxicity and efficacy as well as cancer susceptibility. The biological functions of these 7 mutations have previously been characterized, but the structural basis behind the reduced catalytic activity and reduced protein level is not clear. Methodology/Principal Findings We performed multiple molecular dynamics simulations of these mutants as well as NAT2 to investigate the structural and dynamical effects throughout the protein structure, specifically the catalytic triad, cofactor binding site, and the substrate binding pocket. None of these mutations induced unfolding; instead, their effects were confined to the inter-domain, domain 3 and 17-residue insert region, where the flexibility was significantly reduced relative to the wild-type. Structural effects of these mutations propagate through space and cause a change in catalytic triad conformation, cofactor binding site, substrate binding pocket size/shape and electrostatic potential. Conclusions/Significance Our results showed that the dynamical properties of all the mutant structures, especially in inter-domain, domain 3 and 17-residue insert region were affected in the same manner. Similarly, the electrostatic potential of all the mutants were altered and also the functionally important regions such as catalytic triad, cofactor binding site, and substrate binding pocket adopted different orientation and/or conformation relative to the wild-type that may affect the functions of the mutants. Overall, our study may provide the structural basis for reduced catalytic activity and protein level, as was experimentally observed for these polymorphisms. PMID:21980537

  10. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    PubMed

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  11. Targeting the Allosteric Site of Oncoprotein BCR-ABL as an Alternative Strategy for Effective Target Protein Degradation.

    PubMed

    Shimokawa, Kenichiro; Shibata, Norihito; Sameshima, Tomoya; Miyamoto, Naoki; Ujikawa, Osamu; Nara, Hiroshi; Ohoka, Nobumichi; Hattori, Takayuki; Cho, Nobuo; Naito, Mikihiko

    2017-10-12

    Protein degradation technology based on hybrid small molecules is an emerging drug modality that has significant potential in drug discovery and as a unique method of post-translational protein knockdown in the field of chemical biology. Here, we report the first example of a novel and potent protein degradation inducer that binds to an allosteric site of the oncogenic BCR-ABL protein. BCR-ABL allosteric ligands were incorporated into the SNIPER (Specific and Nongenetic inhibitor of apoptosis protein [IAP]-dependent Protein Erasers) platform, and a series of in vitro biological assays of binding affinity, target protein modulation, signal transduction, and growth inhibition were carried out. One of the designed compounds, 6 (SNIPER(ABL)-062), showed desirable binding affinities against ABL1, cIAP1/2, and XIAP and consequently caused potent BCR-ABL degradation.

  12. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  13. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  14. Ionotropic GABA receptor antagonism-induced adverse outcome pathways for potential neurotoxicity biomarkers.

    PubMed

    Gong, Ping; Hong, Huixiao; Perkins, Edward J

    2015-01-01

    Antagonism of ionotropic GABA receptors (iGABARs) can occur at three distinct types of receptor binding sites causing chemically induced epileptic seizures. Here we review three adverse outcome pathways, each characterized by a specific molecular initiating event where an antagonist competitively binds to active sites, negatively modulates allosteric sites or noncompetitively blocks ion channel on the iGABAR. This leads to decreased chloride conductance, followed by depolarization of affected neurons, epilepsy-related death and ultimately decreased population. Supporting evidence for causal linkages from the molecular to population levels is presented and differential sensitivity to iGABAR antagonists in different GABA receptors and organisms discussed. Adverse outcome pathways are poised to become important tools for linking mechanism-based biomarkers to regulated outcomes in next-generation risk assessment.

  15. Chemical Rescue of Enzymes: Proton Transfer in Mutants of Human Carbonic Anhydrase II

    PubMed Central

    Maupin, C. Mark; Castillo, Norberto; Taraphder, Srabani; Tu, Chingkuang; McKenna, Robert; Silverman, David N.; Voth, Gregory A.

    2011-01-01

    In human carbonic anhydrase II (HCA II) the mutation of position 64 from histidine to alanine (H64A) disrupts the rate limiting proton transfer (PT) event, resulting in a reduction of the catalytic activity of the enzyme as compared to the wild-type. Potential of mean force (PMF) calculations utilizing the multistate empirical valence bond (MS-EVB) methodology for H64A HCA II give a PT free energy barrier significantly higher than that found in the wild-type enzyme. This high barrier, determined in the absence of exogenous buffer and assuming no additional ionizable residues in the PT pathway, indicates the likelihood of alternate enzyme pathways that utilize either ionizable enzyme residues (self-rescue) and/or exogenous buffers (chemical rescue). It has been shown experimentally that the catalytic activity of H64A HCA II can be chemically rescued to near wild type levels by the addition of the exogenous buffer 4-methylimidazole (4MI). Crystallographic studies have identified two 4MI binding sites, yet site specific mutations intended to disrupt 4MI binding have demonstrated these sites to be non-productive. In the present work MS-EVB simulations show that binding of 4MI near Thr199 in the H64A HCA II mutant, a binding site determined by NMR spectroscopy, results in a viable chemical rescue pathway. Additional viable rescue pathways are also identified where 4MI acts as a proton transport intermediary from the active site to ionizable residues on the rim of the active site, revealing a probable mode of action for the chemical rescue pathway PMID:21452838

  16. Crystallographic Fragment Based Drug Discovery: Use of a Brominated Fragment Library Targeting HIV Protease

    PubMed Central

    Tiefenbrunn, Theresa; Forli, Stefano; Happer, Meaghan; Gonzalez, Ana; Tsai, Yingssu; Soltis, Michael; Elder, John H.; Olson, Arthur J.; Stout, C. David

    2013-01-01

    A library of 68 brominated fragments was screened against a new crystal form of inhibited HIV-1 protease in order to probe surface sites in soaking experiments. Often fragments are weak binders with partial occupancy, resulting in weak, difficult-to-fit electron density. The use of a brominated fragment library addresses this challenge, as bromine can be located unequivocally via anomalous scattering. Data collection was carried out in an automated fashion using AutoDrug at SSRL. Novel hits were identified in the known surface sites: 3-bromo-2,6-dimethoxybenzoic acid (Br6) in the flap site, and 1-bromo-2-naphthoic acid (Br27) in the exosite, expanding the chemistry of known fragments for development of higher affinity potential allosteric inhibitors. At the same time, mapping the binding sites of a number of weaker binding Br-fragments provides further insight into the nature of these surface pockets. PMID:23998903

  17. The complex nature of calcium cation interactions with phospholipid bilayers

    PubMed Central

    Melcrová, Adéla; Pokorna, Sarka; Pullanchery, Saranya; Kohagen, Miriam; Jurkiewicz, Piotr; Hof, Martin; Jungwirth, Pavel; Cremer, Paul S.; Cwiklik, Lukasz

    2016-01-01

    Understanding interactions of calcium with lipid membranes at the molecular level is of great importance in light of their involvement in calcium signaling, association of proteins with cellular membranes, and membrane fusion. We quantify these interactions in detail by employing a combination of spectroscopic methods with atomistic molecular dynamics simulations. Namely, time-resolved fluorescent spectroscopy of lipid vesicles and vibrational sum frequency spectroscopy of lipid monolayers are used to characterize local binding sites of calcium in zwitterionic and anionic model lipid assemblies, while dynamic light scattering and zeta potential measurements are employed for macroscopic characterization of lipid vesicles in calcium-containing environments. To gain additional atomic-level information, the experiments are complemented by molecular simulations that utilize an accurate force field for calcium ions with scaled charges effectively accounting for electronic polarization effects. We demonstrate that lipid membranes have substantial calcium-binding capacity, with several types of binding sites present. Significantly, the binding mode depends on calcium concentration with important implications for calcium buffering, synaptic plasticity, and protein-membrane association. PMID:27905555

  18. Modulating inhibitors of transthyretin fibrillogenesis via sulfation: polychlorinated biphenyl sulfates as models.

    PubMed

    Grimm, Fabian A; Lehmler, Hans-Joachim; He, Xianran; Robertson, Larry W; Duffel, Michael W

    2015-02-25

    Small molecules that bind with high affinity to thyroxine (T4) binding sites on transthyretin (TTR) kinetically stabilize the protein's tetrameric structure, thereby efficiently decreasing the rate of tetramer dissociation in TTR related amyloidoses. Current research efforts aim to optimize the amyloid inhibiting properties of known inhibitors, such as derivatives of biphenyls, dibenzofurans and benzooxazoles, by chemical modification. In order to test the hypothesis that sulfate group substituents can improve the efficiencies of such inhibitors, we evaluated the potential of six polychlorinated biphenyl sulfates to inhibit TTR amyloid fibril formation in vitro. In addition, we determined their binding orientations and molecular interactions within the T4 binding site by molecular docking simulations. Utilizing this combined experimental and computational approach, we demonstrated that sulfation significantly improves the amyloid inhibiting properties as compared to both parent and hydroxylated PCBs. Importantly, several PCB sulfates were of equal or higher potency than some of the most effective previously described inhibitors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Modulating Inhibitors of Transthyretin Fibrillogenesis via Sulfation: Polychlorinated Biphenyl Sulfates as Models1

    PubMed Central

    Grimm, Fabian A.; Lehmler, Hans-Joachim; He, Xianran; Robertson, Larry W.; Duffel, Michael W.

    2015-01-01

    Small molecules that bind with high affinity to thyroxine (T4) binding sites on transthyretin (TTR) kinetically stabilize the protein’s tetrameric structure, thereby efficiently decreasing the rate of tetramer dissociation in TTR related amyloidoses. Current research efforts aim to optimize the amyloid inhibiting properties of known inhibitors, such as derivatives of biphenyls, dibenzofurans and benzooxazoles, by chemical modification. In order to test the hypothesis that sulfate group substituents can improve the efficiencies of such inhibitors, we evaluated the potential of six polychlorinated biphenyl sulfates to inhibit TTR amyloid fibril formation in vitro. In addition, we determined their binding orientations and molecular interactions within the T4 binding site by molecular docking simulations. Utilizing this combined experimental and computational approach, we demonstrated that sulfation significantly improves the amyloid inhibiting properties as compared to both parent and hydroxylated PCBs. Importantly, several PCB sulfates were of equal or higher potency than some of the most effective previously described inhibitors. PMID:25595224

  20. Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

    PubMed Central

    Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

    2012-01-01

    Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

  1. Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

    PubMed

    Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

    2012-01-01

    Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.

  2. Structural and immunologic characterization of bovine, horse, and rabbit serum albumins

    PubMed Central

    Majorek, Karolina A.; Porebski, Przemyslaw J.; Dayal, Arjun; Zimmerman, Matthew D.; Jablonska, Kamila; Stewart, Alan J.; Chruszcz, Maksymilian; Minor, Wladek

    2012-01-01

    Serum albumin (SA) is the most abundant plasma protein in mammals. SA is a multifunctional protein with extraordinary ligand binding capacity, making it a transporter molecule for a diverse range of metabolites, drugs, nutrients, metals and other molecules. Due to its ligand binding properties, albumins have wide clinical, pharmaceutical, and biochemical applications. Albumins are also allergenic, and exhibit a high degree of cross-reactivity due to significant sequence and structure similarity of SAs from different organisms. Here we present crystal structures of albumins from cattle (BSA), horse (ESA) and rabbit (RSA) serums. The structural data are correlated with the results of immunological studies of SAs. We also analyze the conservation or divergence of structures and sequences of SAs in the context of their potential allergenicity and cross-reactivity. In addition, we identified a previously uncharacterized ligand binding site in the structure of RSA, and calcium binding sites in the structure of BSA, which is the first serum albumin structure to contain metal ions. PMID:22677715

  3. The complex nature of calcium cation interactions with phospholipid bilayers

    NASA Astrophysics Data System (ADS)

    Melcrová, Adéla; Pokorna, Sarka; Pullanchery, Saranya; Kohagen, Miriam; Jurkiewicz, Piotr; Hof, Martin; Jungwirth, Pavel; Cremer, Paul S.; Cwiklik, Lukasz

    2016-12-01

    Understanding interactions of calcium with lipid membranes at the molecular level is of great importance in light of their involvement in calcium signaling, association of proteins with cellular membranes, and membrane fusion. We quantify these interactions in detail by employing a combination of spectroscopic methods with atomistic molecular dynamics simulations. Namely, time-resolved fluorescent spectroscopy of lipid vesicles and vibrational sum frequency spectroscopy of lipid monolayers are used to characterize local binding sites of calcium in zwitterionic and anionic model lipid assemblies, while dynamic light scattering and zeta potential measurements are employed for macroscopic characterization of lipid vesicles in calcium-containing environments. To gain additional atomic-level information, the experiments are complemented by molecular simulations that utilize an accurate force field for calcium ions with scaled charges effectively accounting for electronic polarization effects. We demonstrate that lipid membranes have substantial calcium-binding capacity, with several types of binding sites present. Significantly, the binding mode depends on calcium concentration with important implications for calcium buffering, synaptic plasticity, and protein-membrane association.

  4. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  5. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  6. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  7. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  8. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  9. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  10. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  11. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  12. Analysis of in vitro interactions of protein tyrosine phosphatase 1B with insulin receptors.

    PubMed

    Wang, X Y; Bergdahl, K; Heijbel, A; Liljebris, C; Bleasdale, J E

    2001-02-28

    One strategy to treat the insulin resistance that is central to type II diabetes mellitus may be to maintain insulin receptors (IR) in the active (tyrosine phosphorylated) form. Because protein tyrosine phosphatase 1B (PTP1B) binds and subsequently dephosphorylates IR, inhibitors of PTP1B-IR binding are potential insulin 'sensitizers.' A Scintillation Proximity Assay (SPA) was developed to characterize and quantitate PTP1B-IR binding. Human IR were solubilized and captured on wheat germ agglutinin (WGA)-coated SPA beads. Subsequent binding of human, catalytically inactive [35S] PTP1B Cys(215)/Ser (PTP1B(C215S)) to the lectin-anchored IR results in scintillation from the SPA beads that can be quantitated. Binding of PTP1B to IR was pH- and divalent cation-sensitive. Ca(2+) and Mn(2+), but not Mg(2+), dramatically attenuated the loss of PTP1B-IR binding observed when pH was raised from 6.2 to 7.8. PTP1B binding to IR from insulin-stimulated cells was much greater than to IR from unstimulated cells and was inhibited by either an antiphosphotyrosine antibody or treatment of IR with alkaline phosphatase, suggesting that tyrosine phosphorylation of IR is required for PTP1B binding. Phosphopeptides modeled after various IR phosphotyrosine domains each only partially inhibited PTP1B-IR binding, indicating that multiple domains of IR are likely involved in binding PTP1B. However, competitive displacement of [35S]PTP1B(C215S) by PTP1B(C215S) fitted best to a single binding site with a K(d) in the range 100-1000 nM, depending upon pH and divalent cations. PNU-200898, a potent and selective inhibitor of PTP1B whose orientation in the active site of PTP1B has been solved, competitively inhibited catalysis and PTP1B-IR binding with equal potency. The results of this novel assay for PTP1B-IR binding suggest that PTP1B binds preferentially to tyrosine phosphorylated IR through its active site and that binding may be susceptible to therapeutic disruption by small molecules.

  13. Berberine Induces Toxicity in HeLa Cells through Perturbation of Microtubule Polymerization by Binding to Tubulin at a Unique Site.

    PubMed

    Raghav, Darpan; Ashraf, Shabeeba M; Mohan, Lakshmi; Rathinasamy, Krishnan

    2017-05-23

    Berberine has been used traditionally for its diverse pharmacological actions. It exhibits remarkable anticancer activities and is currently under clinical trials. In this study, we report that the anticancer activity of berberine could be partly due to its inhibitory actions on tubulin and microtubule assembly. Berberine inhibited the proliferation of HeLa cells with an IC 50 of 18 μM and induced significant depolymerization of interphase and mitotic microtubules. At its IC 50 , berberine exerted a moderate G2/M arrest and mitotic block as detected by fluorescence-activated cell sorting analysis and fluorescence microscopy, respectively. In a wound closure assay, berberine inhibited the migration of HeLa cells at concentrations lower than its IC 50 , indicating its excellent potential as an anticancer agent. In vitro studies with tubulin isolated from goat brain indicated that berberine binds to tubulin at a single site with a K d of 11 μM. Berberine inhibited the assembly of tubulin into microtubules and also disrupted the preformed microtubules polymerized in the presence of glutamate and paclitaxel. Competition experiments indicated that berberine could partially displace colchicine from its binding site. Results from fluorescence resonance energy transfer, computational docking, and molecular dynamics simulations suggest that berberine forms a stable complex with tubulin and binds at a novel site 24 Å from the colchicine site on the β-tubulin. Data obtained from synchronous fluorescence analysis of the tryptophan residues of tubulin and from the Fourier transform infrared spectroscopy studies revealed that binding of berberine alters the conformation of the tubulin heterodimer, which could be the molecular mechanism behind the depolymerizing effects on tubulin assembly.

  14. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  15. ProBiS-CHARMMing: Web Interface for Prediction and Optimization of Ligands in Protein Binding Sites.

    PubMed

    Konc, Janez; Miller, Benjamin T; Štular, Tanja; Lešnik, Samo; Woodcock, H Lee; Brooks, Bernard R; Janežič, Dušanka

    2015-11-23

    Proteins often exist only as apo structures (unligated) in the Protein Data Bank, with their corresponding holo structures (with ligands) unavailable. However, apoproteins may not represent the amino-acid residue arrangement upon ligand binding well, which is especially problematic for molecular docking. We developed the ProBiS-CHARMMing web interface by connecting the ProBiS ( http://probis.cmm.ki.si ) and CHARMMing ( http://www.charmming.org ) web servers into one functional unit that enables prediction of protein-ligand complexes and allows for their geometry optimization and interaction energy calculation. The ProBiS web server predicts ligands (small compounds, proteins, nucleic acids, and single-atom ligands) that may bind to a query protein. This is achieved by comparing its surface structure against a nonredundant database of protein structures and finding those that have binding sites similar to that of the query protein. Existing ligands found in the similar binding sites are then transposed to the query according to predictions from ProBiS. The CHARMMing web server enables, among other things, minimization and potential energy calculation for a wide variety of biomolecular systems, and it is used here to optimize the geometry of the predicted protein-ligand complex structures using the CHARMM force field and to calculate their interaction energies with the corresponding query proteins. We show how ProBiS-CHARMMing can be used to predict ligands and their poses for a particular binding site, and minimize the predicted protein-ligand complexes to obtain representations of holoproteins. The ProBiS-CHARMMing web interface is freely available for academic users at http://probis.nih.gov.

  16. Structure of a Yeast Dyn2-Nup159 Complex and Molecular Basis for Dynein Light Chain-Nuclear Pore Interaction*

    PubMed Central

    Romes, Erin M.; Tripathy, Ashutosh; Slep, Kevin C.

    2012-01-01

    The nuclear pore complex gates nucleocytoplasmic transport through a massive, eight-fold symmetric channel capped by a nucleoplasmic basket and structurally unique, cytoplasmic fibrils whose tentacles bind and regulate asymmetric traffic. The conserved Nup82 complex, composed of Nsp1, Nup82, and Nup159, forms the unique cytoplasmic fibrils that regulate mRNA nuclear export. Although the nuclear pore complex plays a fundamental, conserved role in nuclear trafficking, structural information about the cytoplasmic fibrils is limited. Here, we investigate the structural and biochemical interactions between Saccharomyces cerevisiae Nup159 and the nucleoporin, Dyn2. We find that Dyn2 is predominantly a homodimer and binds arrayed sites on Nup159, promoting the Nup159 parallel homodimerization. We present the first structure of Dyn2, determined at 1.85 Å resolution, complexed with a Nup159 target peptide. Dyn2 resembles homologous metazoan dynein light chains, forming homodimeric composite substrate binding sites that engage two independent 10-residue target motifs, imparting a β-strand structure to each peptide via antiparallel extension of the Dyn2 core β-sandwich. Dyn2 recognizes a highly conserved QT motif while allowing sequence plasticity in the flanking residues of the peptide. Isothermal titration calorimetric analysis of the comparative binding of Dyn2 to two Nup159 target sites shows similar affinities (18 and 13 μm), but divergent thermal binding modes. Dyn2 homodimers are arrayed in the crystal lattice, likely mimicking the arrayed architecture of Dyn2 on the Nup159 multivalent binding sites. Crystallographic interdimer interactions potentially reflect a cooperative basis for Dyn2-Nup159 complex formation. Our data highlight the determinants that mediate oligomerization of the Nup82 complex and promote a directed, elongated cytoplasmic fibril architecture. PMID:22411995

  17. Low-temperature binding of NO adsorbed on MIL-100(Al)-A case study for the application of high resolution pulsed EPR methods and DFT calculations.

    PubMed

    Mendt, Matthias; Barth, Benjamin; Hartmann, Martin; Pöppl, Andreas

    2017-12-14

    The low-temperature binding of nitric oxide (NO) in the metal-organic framework MIL-100(Al) has been investigated by pulsed electron nuclear double resonance and hyperfine sublevel correlation spectroscopy. Three NO adsorption species have been identified. Among them, one species has been verified experimentally to bind directly to an 27 Al atom and all its relevant 14 N and 27 Al hyperfine interaction parameters have been determined spectroscopically. Those parameters fit well to the calculated ones of a theoretical cluster model, which was derived by density functional theory (DFT) in the present work and describes the low temperature binding of NO to the regular coordinatively unsaturated Al 3+ site of the MIL-100(Al) structure. As a result, the Lewis acidity of that site has been characterized using the NO molecule as an electron paramagnetic resonance active probe. The DFT derived wave function analysis revealed a bent end-on coordination of the NO molecule adsorbed at that site which is almost purely ionic and has a weak binding energy. The calculated flat potential energy surface of this species indicates the ability of the NO molecule to freely rotate at intermediate temperatures while it is still binding to the Al 3+ site. For the other two NO adsorption species, no structural models could be derived, but one of them is indicated to be adsorbed at the organic part of the metal-organic framework. Hyperfine interactions with protons, weakly coupled to the observed NO adsorption species, have also been measured by pulsed electron paramagnetic resonance and found to be consistent with their attribution to protons of the MIL-100(Al) benzenetricarboxylate ligand molecules.

  18. Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

    PubMed Central

    Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

    2009-01-01

    Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

  19. Spectroscopic study of binding of chlorogenic acid with the surface of ZnO nanoparticles

    NASA Astrophysics Data System (ADS)

    Belay, Abebe; Kim, Hyung Kook; Hwang, Yoon-Hwae

    2017-09-01

    Understanding the interaction properties of biological materials with ZnO NPs is fundamental interest in the field of biotechnological applications as well as in the formation of optoelectronic devices. In this research, the binding of ZnO NPs and chlorogenic acid (CGA) were investigated using fluorescence quenching, UV-Vis absorption spectroscopy, Fourier transform infrared (FTIR), Raman spectroscopy, scanning electron microscopy (TEM), and dynamic light scattering (DLS) techniques. The study results indicated the fluorescence quenching between ZnO NPs and CGA rationalized in terms of static quenching mechanism or the formation of nonfluorescent CGA-ZnO. From fluorescence quenching spectral analysis the binding constant ( K a ), number of binding sites ( n), and thermodynamic properties, were determined. The quenching constants ( K sv) and binding constant ( K a ), decrease with increasing the temperature and their binding sites n are 2. The thermodynamic parameters determined using Van't Hoff equation indicated binding occurs spontaneously involving the hydrogen bond and van der Walls forces played the major role in the reaction of ZnO NPs with CGA. The Raman, SEM, DLS, and Zeta potential measurements were also indicated the differences in the structure, morphology and sizes of CGA, ZnO NPs, and their corresponding CGA-ZnO due to adsorption of CGA on the surface of ZnO NPs

  20. ABFs, a family of ABA-responsive element binding factors.

    PubMed

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  1. Highly selective inhibition of myosin motors provides the basis of potential therapeutic application

    PubMed Central

    Sirigu, Serena; Hartman, James J.; Ropars, Virginie; Clancy, Sheila; Wang, Xi; Chuang, Grace; Qian, Xiangping; Lu, Pu-Ping; Barrett, Edward; Rudolph, Karin; Royer, Christopher; Morgan, Bradley P.; Stura, Enrico A.; Malik, Fady I.; Houdusse, Anne M.

    2016-01-01

    Direct inhibition of smooth muscle myosin (SMM) is a potential means to treat hypercontractile smooth muscle diseases. The selective inhibitor CK-2018571 prevents strong binding to actin and promotes muscle relaxation in vitro and in vivo. The crystal structure of the SMM/drug complex reveals that CK-2018571 binds to a novel allosteric pocket that opens up during the “recovery stroke” transition necessary to reprime the motor. Trapped in an intermediate of this fast transition, SMM is inhibited with high selectivity compared with skeletal muscle myosin (IC50 = 9 nM and 11,300 nM, respectively), although all of the binding site residues are identical in these motors. This structure provides a starting point from which to design highly specific myosin modulators to treat several human diseases. It further illustrates the potential of targeting transition intermediates of molecular machines to develop exquisitely selective pharmacological agents. PMID:27815532

  2. Determination of thermodynamic parameters for complexation of calcium and magnesium with chondroitin sulfate isomers using isothermal titration calorimetry: Implications for calcium kidney-stone research

    NASA Astrophysics Data System (ADS)

    Rodgers, Allen L.; Jackson, Graham E.

    2017-04-01

    Chondroitin sulfate (CS) occurs in human urine. It has several potential binding sites for calcium and as such may play an inhibitory role in calcium oxalate and calcium phosphate (kidney stone disease by reducing the supersaturation (SS) and crystallization of these salts. Urinary magnesium is also a role player in determining speciation in stone forming processes. This study was undertaken to determine the thermodynamic parameters for binding of the disaccharide unit of two different CS isomers with calcium and magnesium. These included the binding constant K. Experiments were performed using an isothermal titration calorimeter (ITC) at 3 different pH levels in the physiological range in human urine. Data showed that interactions between the CS isomers and calcium and magnesium occur via one binding site, thought to be sulfate, and that log K values are 1.17-1.93 and 1.77-1.80 for these two metals respectively. Binding was significantly stronger in Mg-CS than in Ca-CS complexes and was found to be dependent on pH in the latter but not in the former. Furthermore, binding in Ca-CS complexes was dependent on the location of the sulfate binding site. This was not the case in the Mg-CS complexes. Interactions were shown to be entropy driven and enthalpy unfavourable. These findings can be used in computational modeling studies to predict the effects of the calcium and magnesium CS complexes on the speciation of calcium and the SS of calcium salts in real urine samples.

  3. A novel reagentless sensing system for measuring glucose based on the galactose/glucose-binding protein

    NASA Technical Reports Server (NTRS)

    Salins, L. L.; Ware, R. A.; Ensor, C. M.; Daunert, S.

    2001-01-01

    The galactose/glucose-binding protein (GBP) is synthesized in the cytoplasm of Escherichia coli in a precursor form and exported into the periplasmic space upon cleavage of a 23-amino-acid leader sequence. GBP binds galactose and glucose in a highly specific manner. The ligand induces a hinge motion in GBP and the resultant protein conformational change constitutes the basis of the sensing system. The mglB gene, which codes for GBP, was isolated from the chromosome of E. coli using the polymerase chain reaction (PCR). Since wild-type GBP lacks cysteines in its structure, introducing this amino acid by site-directed mutagenesis ensures single-label attachment at specific sites with a sulfhydro-specific fluorescent probe. Site-directed mutagenesis by overlap extension PCR was performed to prepare three different mutants to introduce a single cysteine residue at positions 148, 152, and 182. Since these residues are not involved in ligand binding and since they are located at the edge of the binding cleft, they experience a significant change in environment upon binding of galactose or glucose. The sensing system strategy is based on the fluorescence changes of the probe as the protein undergoes a structural change on binding. In this work a reagentless sensing system has been rationally designed that can detect submicromolar concentrations of glucose. The calibration plots have a linear working range of three orders of magnitude. Although the system can sense galactose as well, this epimer is not a potential interfering substance since its concentration in blood is negligible. Copyright 2001 Academic Press.

  4. NFI-Ski interactions mediate transforming growth factor beta modulation of human papillomavirus type 16 early gene expression.

    PubMed

    Baldwin, Amy; Pirisi, Lucia; Creek, Kim E

    2004-04-01

    Human papillomaviruses (HPVs) are present in virtually all cervical cancers. An important step in the development of malignant disease, including cervical cancer, involves a loss of sensitivity to transforming growth factor beta (TGF-beta). HPV type 16 (HPV16) early gene expression, including that of the E6 and E7 oncoprotein genes, is under the control of the upstream regulatory region (URR), and E6 and E7 expression in HPV16-immortalized human epithelial cells is inhibited at the transcriptional level by TGF-beta. While the URR contains a myriad of transcription factor binding sites, including seven binding sites for nuclear factor I (NFI), the specific sequences within the URR or the transcription factors responsible for TGF-beta modulation of the URR remain unknown. To identify potential transcription factors and binding sites involved in TGF-beta modulation of the URR, we performed DNase I footprint analysis on the HPV16 URR using nuclear extracts from TGF-beta-sensitive HPV16-immortalized human keratinocytes (HKc/HPV16) treated with and without TGF-beta. Differentially protected regions were found to be located around NFI binding sites. Electrophoretic mobility shift assays, using the NFI binding sites as probes, showed decreased binding upon TGF-beta treatment. This decrease in binding was not due to reduced NFI protein or NFI mRNA levels. Mutational analysis of individual and multiple NFI binding sites in the URR defined their role in TGF-beta sensitivity of the promoter. Overexpression of the NFI family members in HKc/HPV16 decreased the ability of TGF-beta to inhibit the URR. Since the oncoprotein Ski has been shown to interact with and increase the transcriptional activity of NFI and since cellular Ski levels are decreased by TGF-beta treatment, we explored the possibility that Ski may provide a link between TGF-beta signaling and NFI activity. Anti-NFI antibodies coimmunoprecipitated endogenous Ski in nuclear extracts from HKc/HPV16, confirming that NFI and Ski interact in these cells. Ski levels dramatically decreased upon TGF-beta treatment of HKc/HPV16, and overexpression of Ski eliminated the ability of TGF-beta to inhibit the URR. Based on these studies, we propose that TGF-beta inhibition of HPV16 early gene expression is mediated by a decrease in Ski levels, which in turn dramatically reduces NFI activity.

  5. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  6. Simultaneous addition of two ligands: a potential strategy for estimating divalent ion affinities in EF-hand proteins by isothermal titration calorimetry.

    PubMed

    Henzl, Michael T; Markus, Lindsey A; Davis, Meredith E; McMillan, Andrew T

    2013-03-01

    Capable of providing a detailed thermodynamic picture of noncovalent association reactions, isothermal titration calorimetry (ITC) has become a popular method for studying protein-ligand interactions. We routinely employ the technique to study divalent ion-binding by two-site EF-hand proteins from the parvalbumin- and polcalcin lineages. The combination of high Ca(2+) affinity and relatively low Mg(2+) affinity, and the attendant complication of parameter correlation, conspire to make the simultaneous extraction of binding constants and -enthalpies for both ions challenging. Although global analysis of multiple ITC experiments can overcome these hurdles, our current experimental protocol includes upwards of 10 titrations - requiring a substantial investment in labor, machine time, and material. This paper explores the potential for using a smaller suite of experiments that includes simultaneous titrations with Ca(2+) and Mg(2+) at different ratios of the two ions. The results obtained for four proteins, differing substantially in their divalent ion-binding properties, suggest that the approach has merit. The Ca(2+)- and Mg(2+)-binding constants afforded by the streamlined analysis are in reasonable agreement with those obtained from the standard analysis protocol. Likewise, the abbreviated analysis provides comparable values for the Ca(2+)-binding enthalpies. However, the streamlined analysis can yield divergent values for the Mg(2+)-binding enthalpies - particularly those for lower affinity sites. This shortcoming can be remedied, in large measure, by including data from a direct Ca(2+) titration in the presence of a high, fixed Mg(2+) concentration. Copyright © 2013. Published by Elsevier Inc.

  7. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  8. The natural naphthoquinone plumbagin exhibits antiproliferative activity and disrupts the microtubule network through tubulin binding.

    PubMed

    Acharya, Bipul R; Bhattacharyya, Bhabatarak; Chakrabarti, Gopal

    2008-07-29

    Plumbagin (5-hydroxy-2-methyl-1,4-naphthoquinone), a naphthoquinone isolated from the roots of Plumbaginaceae plants, has potential antiproliferative activity against several tumor types. We have examined the effects of plumbagin on cellular microtubules ex vivo as well as its binding with purified tubulin and microtubules in vitro. Cell viability experiments using human non-small lung epithelium carcinoma cells (A549) indicated that the IC 50 value for plumbagin is 14.6 microM. Immunofluorescence studies using an antitubulin FITC conjugated antibody showed a significant perturbation of the interphase microtubule network in a dose dependent manner. In vitro polymerization of purified tubulin into microtubules is inhibited by plumbagin with an IC 50 value of 38 +/- 0.5 microM. Its binding to tubulin quenches protein tryptophan fluorescence in a time and concentration dependent manner. Binding of plumbagin to tubulin is slow, taking 60 min for equilibration at 25 degrees C. The association reaction kinetics is biphasic in nature, and the association rate constants for fast and slow phases are 235.12 +/- 36 M (-1) s (-1) and 11.63 +/- 11 M (-1) s (-1) at 25 degrees C respectively. The stoichiometry of plumbagin binding to tubulin is 1:1 (mole:mole) with a dissociation constant of 0.936 +/- 0.71 microM at 25 degrees C. Plumbagin competes for the colchicine binding site with a K i of 7.5 microM as determined from a modified Dixon plot. Based on these data we conclude that plumbagin recognizes the colchicine binding site to tubulin. Further study is necessary to locate the pharmacophoric point of attachment of the inhibitor to the colchicine binding site of tubulin.

  9. Assessment of Homology Templates and an Anesthetic Binding Site within the γ-Aminobutyric Acid Receptor

    PubMed Central

    Bertaccini, Edward J.; Yoluk, Ozge; Lindahl, Erik R.; Trudell, James R.

    2013-01-01

    Background Anesthetics mediate portions of their activity via modulation of the γ-aminobutyric acid receptor (GABAaR). While its molecular structure remains unknown, significant progress has been made towards understanding its interactions with anesthetics via molecular modeling. Methods The structure of the torpedo acetylcholine receptor (nAChRα), the structures of the α4 and β2 subunits of the human nAChR, the structures of the eukaryotic glutamate-gated chloride channel (GluCl), and the prokaryotic pH sensing channels, from Gloeobacter violaceus and Erwinia chrysanthemi, were aligned with the SAlign and 3DMA algorithms. A multiple sequence alignment from these structures and those of the GABAaR was performed with ClustalW. The Modeler and Rosetta algorithms independently created three-dimensional constructs of the GABAaR from the GluCl template. The CDocker algorithm docked a congeneric series of propofol derivatives into the binding pocket and scored calculated binding affinities for correlation with known GABAaR potentiation EC50’s. Results Multiple structure alignments of templates revealed a clear consensus of residue locations relevant to anesthetic effects except for torpedo nAChR. Within the GABAaR models generated from GluCl, the residues notable for modulating anesthetic action within transmembrane segments 1, 2, and 3 converged on the intersubunit interface between alpha and beta subunits. Docking scores of a propofol derivative series into this binding site showed strong linear correlation with GABAaR potentiation EC50. Conclusion Consensus structural alignment based on homologous templates revealed an intersubunit anesthetic binding cavity within the transmembrane domain of the GABAaR, which showed correlation of ligand docking scores with experimentally measured GABAaR potentiation. PMID:23770602

  10. Assessment of homology templates and an anesthetic binding site within the γ-aminobutyric acid receptor.

    PubMed

    Bertaccini, Edward J; Yoluk, Ozge; Lindahl, Erik R; Trudell, James R

    2013-11-01

    Anesthetics mediate portions of their activity via modulation of the γ-aminobutyric acid receptor (GABAaR). Although its molecular structure remains unknown, significant progress has been made toward understanding its interactions with anesthetics via molecular modeling. The structure of the torpedo acetylcholine receptor (nAChRα), the structures of the α4 and β2 subunits of the human nAChR, the structures of the eukaryotic glutamate-gated chloride channel (GluCl), and the prokaryotic pH-sensing channels, from Gloeobacter violaceus and Erwinia chrysanthemi, were aligned with the SAlign and 3DMA algorithms. A multiple sequence alignment from these structures and those of the GABAaR was performed with ClustalW. The Modeler and Rosetta algorithms independently created three-dimensional constructs of the GABAaR from the GluCl template. The CDocker algorithm docked a congeneric series of propofol derivatives into the binding pocket and scored calculated binding affinities for correlation with known GABAaR potentiation EC50s. Multiple structure alignments of templates revealed a clear consensus of residue locations relevant to anesthetic effects except for torpedo nAChR. Within the GABAaR models generated from GluCl, the residues notable for modulating anesthetic action within transmembrane segments 1, 2, and 3 converged on the intersubunit interface between α and β subunits. Docking scores of a propofol derivative series into this binding site showed strong linear correlation with GABAaR potentiation EC50. Consensus structural alignment based on homologous templates revealed an intersubunit anesthetic binding cavity within the transmembrane domain of the GABAaR, which showed a correlation of ligand docking scores with experimentally measured GABAaR potentiation.

  11. Identification of protein–protein interfaces by decreased amide proton solvent accessibility

    PubMed Central

    Mandell, Jeffrey G.; Falick, Arnold M.; Komives, Elizabeth A.

    1998-01-01

    Matrix-assisted laser desorption ionization–time-of-flight mass spectrometry was used to identify peptic fragments from protein complexes that retained deuterium under hydrogen exchange conditions due to decreased solvent accessibility at the interface of the complex. Short deuteration times allowed preferential labeling of rapidly exchanging surface amides so that primarily solvent accessibility changes and not conformational changes were detected. A single mass spectrum of the peptic digest mixture was analyzed to determine the deuterium content of all proteolytic fragments of the protein. The protein–protein interface was reliably indicated by those peptides that retained more deuterons in the complex compared with control experiments in which only one protein was present. The method was used to identify the kinase inhibitor [PKI(5–24)] and ATP-binding sites in the cyclic-AMP-dependent protein kinase. Three overlapping peptides identified the ATP-binding site, three overlapping peptides identified the glycine-rich loop, and two peptides identified the PKI(5–24)-binding site. A complex of unknown structure also was analyzed, human α-thrombin bound to an 83-aa fragment of human thrombomodulin [TMEGF(4–5)]. Five peptides from thrombin showed significantly decreased solvent accessibility in the complex. Three peptides identified the anion-binding exosite I, confirming ligand competition experiments. Two peptides identified a new region of thrombin near the active site providing a potential mechanism of how thrombomodulin alters thrombin substrate specificity. PMID:9843953

  12. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  13. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  14. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents.

    PubMed

    Olazaran, Fabián E; Rivera, Gildardo; Pérez-Vázquez, Alondra M; Morales-Reyes, Cynthia M; Segura-Cabrera, Aldo; Balderas-Rentería, Isaías

    2017-01-12

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [ N -( p -methoxy-phenyl)-2-( p -methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site.

  15. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents

    PubMed Central

    2016-01-01

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [N-(p-methoxy-phenyl)-2-(p-methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site. PMID:28105271

  16. Active site similarity between human and Plasmodium falciparum phosphodiesterases: considerations for antimalarial drug design

    NASA Astrophysics Data System (ADS)

    Howard, Brittany L.; Thompson, Philip E.; Manallack, David T.

    2011-08-01

    The similarity between Plasmodium falciparum phosphodiesterase enzymes ( PfPDEs) and their human counterparts have been examined and human PDE9A was found to be a suitable template for the construction of homology models for each of the four PfPDE isoforms. In contrast, the architecture of the active sites of each model was most similar to human PDE1. Molecular docking was able to model cyclic guanosine monophosphate (cGMP) substrate binding in each case but a docking mode supporting cyclic adenosine monophosphate (cAMP) binding could not be found. Anticipating the potential of PfPDE inhibitors as anti-malarial drugs, a range of reported PDE inhibitors including zaprinast and sildenafil were docked into the model of PfPDEα. The results were consistent with their reported biological activities, and the potential of PDE1/9 inhibitor analogues was also supported by docking.

  17. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  18. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  19. Virtual screening and biological evaluation of piperazine derivatives as human acetylcholinesterase inhibitors.

    PubMed

    Varadaraju, Kavitha Raj; Kumar, Jajur Ramanna; Mallesha, Lingappa; Muruli, Archana; Mohana, Kikkeri Narasimha Shetty; Mukunda, Chethan Kumar; Sharanaiah, Umesha

    2013-01-01

    The piperazine derivatives have been shown to inhibit human acetylcholinesterase. Virtual screening by molecular docking of piperazine derivatives 1-(1,4-benzodioxane-2-carbonyl) piperazine (K), 4-(4-methyl)-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S1), and 4-(4-chloro)-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S3) has been shown to bind at peripheral anionic site and catalytic sites, whereas 4-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S4) and 4-(2,5-dichloro)-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S7) do not bind either to peripheral anionic site or catalytic site with hydrogen bond. All the derivatives have differed in number of H-bonds and hydrophobic interactions. The peripheral anionic site interacting molecules have proven to be potential therapeutics in inhibiting amyloid peptides aggregation in Alzheimer's disease. All the piperazine derivatives follow Lipinski's rule of five. Among all the derivatives 1-(1,4-benzodioxane-2-carbonyl) piperazine (K) was found to have the lowest TPSA value.

  20. Virtual Screening and Biological Evaluation of Piperazine Derivatives as Human Acetylcholinesterase Inhibitors

    PubMed Central

    Varadaraju, Kavitha Raj; Kumar, Jajur Ramanna; Mallesha, Lingappa; Muruli, Archana; Mohana, Kikkeri Narasimha Shetty; Mukunda, Chethan Kumar; Sharanaiah, Umesha

    2013-01-01

    The piperazine derivatives have been shown to inhibit human acetylcholinesterase. Virtual screening by molecular docking of piperazine derivatives 1-(1,4-benzodioxane-2-carbonyl) piperazine (K), 4-(4-methyl)-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S1), and 4-(4-chloro)-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S3) has been shown to bind at peripheral anionic site and catalytic sites, whereas 4-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S4) and 4-(2,5-dichloro)-benzenesulfonyl-1-(1,4-benzodioxane-2-carbonyl) piperazine (S7) do not bind either to peripheral anionic site or catalytic site with hydrogen bond. All the derivatives have differed in number of H-bonds and hydrophobic interactions. The peripheral anionic site interacting molecules have proven to be potential therapeutics in inhibiting amyloid peptides aggregation in Alzheimer's disease. All the piperazine derivatives follow Lipinski's rule of five. Among all the derivatives 1-(1,4-benzodioxane-2-carbonyl) piperazine (K) was found to have the lowest TPSA value. PMID:24288651

  1. Structure-based design of bacterial nitric oxide synthase inhibitors

    DOE PAGES

    Holden, Jeffrey K.; Kang, Soosung; Hollingsworth, Scott A.; ...

    2014-12-18

    Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial. Here wemore » present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Lastly, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors.« less

  2. Exploiting protein flexibility to predict the location of allosteric sites

    PubMed Central

    2012-01-01

    Background Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. Results By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. Conclusions We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors. PMID:23095452

  3. Exploiting protein flexibility to predict the location of allosteric sites.

    PubMed

    Panjkovich, Alejandro; Daura, Xavier

    2012-10-25

    Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors.

  4. Using mass spectrometry to study the photo-affinity labeling of protein tyrosine phosphatase 1B

    NASA Astrophysics Data System (ADS)

    Leriche, Tammy; Skorey, Kathryn; Roy, Patrick; McKay, Dan; Bateman, Kevin P.

    2004-11-01

    Protein tyrosine phosphatase 1B (PTP1B) is a potential target for the treatment of Type II diabetes and several companies are developing small molecule inhibitors of this enzyme. Part of the characterization of these compounds as PTP1B inhibitors is the understanding of how they bind in the enzyme active site. The use of photo-activated inhibitors that target the active site can provide such insight. This paper describes the characterization of a photoprobe directed at the active site of PTP1B. Mass spectrometry revealed the specific binding of the probe to the intact protein. Digestion of the labeled protein followed by LC-MS and LC-MS/MS was used to show that the photoprobe binds to a specific active site amino acid. This was confirmed by comparison with the X-ray structure of PTP1B with a PTP1B inhibitor. The probe labels a conserved acidic residue (Asp) that is required for catalytic activity. This photoprobe may prove to be a useful tool for the development of a PTP1B inhibitor or for the study of PTPs in general.

  5. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  6. Lectin-mediated binding and sialoglycans of porcine surfactant protein D synergistically neutralize influenza A virus.

    PubMed

    van Eijk, Martin; Rynkiewicz, Michael J; Khatri, Kshitij; Leymarie, Nancy; Zaia, Joseph; White, Mitchell R; Hartshorn, Kevan L; Cafarella, Tanya R; Van Die, Irma; Hessing, Martin; Seaton, Barbara A; Haagsman, Henk P

    2018-05-16

    Innate immunity is critical in the early containment of influenza A virus (IAV) infection, and surfactant protein D (SP-D) plays a crucial role in the pulmonary defense against IAV. In pigs, which are important intermediate hosts during the generation of pandemic IAVs, SP-D uses its unique carbohydrate recognition domain (CRD) to interact with IAV. An N-linked CRD-glycosylation provides interactions with the sialic acid binding site of IAV, and a tripeptide loop at the lectin binding site facilitates enhanced interactions with IAV glycans. Here, to investigate both mechanisms of IAV neutralization in greater detail, we produced an N-glycosylated neckCRD fragment of porcine SP-D (RpNCRD) in HEK293 cells. X-ray crystallography disclosed that the N-glycan did not alter the CRD backbone structure including the lectin site conformation, but revealed a potential second non-lectin binding site for glycans. IAV hemagglutination inhibition, IAV aggregation and neutralization of IAV infection studies showed that RpNCRD, unlike the human analogue RhNCRD, exhibits potent neutralizing activity against pandemic A/Aichi/68 (H3N2), enabled by both porcine-specific structural features of its CRD. MS analysis revealed an N-glycan site-occupancy of >98% at Asn303 of RpNCRD with complex-type, heterogeneously branched and predominantly α(2,3) sialylated oligosaccharides. Glycan binding array data characterized both RpNCRD and RhNCRD as mannose-type lectins. RpNCRD also bound LewisY structures whereas RhNCRD bound polylactosamine-containing glycans. Presence of the N-glycan in the CRD increases the glycan binding specificity of RpNCRD. These insights increase our understanding of porcine-specific innate defense against pandemic IAV and may inform  the design of  recombinant SP-D-based antiviral drugs. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  8. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy.

    PubMed

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J M; Benoist, Hervé; Rougé, Pierre

    2017-06-09

    Aberrant O -glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O -glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola , and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O -glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors.

  9. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy

    PubMed Central

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J. M.; Benoist, Hervé; Rougé, Pierre

    2017-01-01

    Aberrant O-glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O-glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola, and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O-glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors. PMID:28598369

  10. NMR and molecular modeling of wine tannins binding to saliva proteins: revisiting astringency from molecular and colloidal prospects.

    PubMed

    Cala, Olivier; Pinaud, Noël; Simon, Cécile; Fouquet, Eric; Laguerre, Michel; Dufourc, Erick J; Pianet, Isabelle

    2010-11-01

    In organoleptic science, the association of tannins to saliva proteins leads to the poorly understood phenomenon of astringency. To decipher this interaction at molecular and colloidal levels, the binding of 4 procyanidin dimers (B1-4) and 1 trimer (C2) to a human saliva proline-rich peptide, IB7(14), was studied. Interactions have been characterized by measuring dissociation constants, sizes of complexes, number, and nature of binding sites using NMR (chemical shift variations, diffusion-ordered spectroscopy, and saturation transfer diffusion). The binding sites were identified using molecular mechanics, and the hydrophilic/hydrophobic nature of the interactions was resolved by calculating the molecular lipophilicity potential within the complexes. The following comprehensive scheme can be proposed: 1) below the tannin critical micelle concentration (CMC), interaction is specific, and the procyanidin anchorage always occurs on the same three IB7(14) sites. The tannin 3-dimensional structure plays a key role in the binding force and in the tannin's ability to act as a bidentate ligand: tannins adopting an extended conformation exhibit higher affinity toward protein and initiate the formation of a network. 2) Above the CMC, after the first specific hydrophilic interaction has taken place, a random hydrophobic stacking occurs between tannins and proteins. The whole process is discussed in the general frame of wine tannins eliciting astringency.

  11. X-ray structures of general anaesthetics bound to a pentameric ligand-gated ion channel.

    PubMed

    Nury, Hugues; Van Renterghem, Catherine; Weng, Yun; Tran, Alphonso; Baaden, Marc; Dufresne, Virginie; Changeux, Jean-Pierre; Sonner, James M; Delarue, Marc; Corringer, Pierre-Jean

    2011-01-20

    General anaesthetics have enjoyed long and widespread use but their molecular mechanism of action remains poorly understood. There is good evidence that their principal targets are pentameric ligand-gated ion channels (pLGICs) such as inhibitory GABA(A) (γ-aminobutyric acid) receptors and excitatory nicotinic acetylcholine receptors, which are respectively potentiated and inhibited by general anaesthetics. The bacterial homologue from Gloeobacter violaceus (GLIC), whose X-ray structure was recently solved, is also sensitive to clinical concentrations of general anaesthetics. Here we describe the crystal structures of the complexes propofol/GLIC and desflurane/GLIC. These reveal a common general-anaesthetic binding site, which pre-exists in the apo-structure in the upper part of the transmembrane domain of each protomer. Both molecules establish van der Waals interactions with the protein; propofol binds at the entrance of the cavity whereas the smaller, more flexible, desflurane binds deeper inside. Mutations of some amino acids lining the binding site profoundly alter the ionic response of GLIC to protons, and affect its general-anaesthetic pharmacology. Molecular dynamics simulations, performed on the wild type (WT) and two GLIC mutants, highlight differences in mobility of propofol in its binding site and help to explain these effects. These data provide a novel structural framework for the design of general anaesthetics and of allosteric modulators of brain pLGICs.

  12. Long-range Electrostatic Complementarity Governs Substrate Recognition by Human Chymotrypsin C, a Key Regulator of Digestive Enzyme Activation*

    PubMed Central

    Batra, Jyotica; Szabó, András; Caulfield, Thomas R.; Soares, Alexei S.; Sahin-Tóth, Miklós; Radisky, Evette S.

    2013-01-01

    Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5′ subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2′ positions of CTRC, although acidic P2′ residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels. PMID:23430245

  13. PoSSuM v.2.0: data update and a new function for investigating ligand analogs and target proteins of small-molecule drugs.

    PubMed

    Ito, Jun-ichi; Ikeda, Kazuyoshi; Yamada, Kazunori; Mizuguchi, Kenji; Tomii, Kentaro

    2015-01-01

    PoSSuM (http://possum.cbrc.jp/PoSSuM/) is a database for detecting similar small-molecule binding sites on proteins. Since its initial release in 2011, PoSSuM has grown to provide information related to 49 million pairs of similar binding sites discovered among 5.5 million known and putative binding sites. This enlargement of the database is expected to enhance opportunities for biological and pharmaceutical applications, such as predictions of new functions and drug discovery. In this release, we have provided a new service named PoSSuM drug search (PoSSuMds) at http://possum.cbrc.jp/PoSSuM/drug_search/, in which we selected 194 approved drug compounds retrieved from ChEMBL, and detected their known binding pockets and pockets that are similar to them. Users can access and download all of the search results via a new web interface, which is useful for finding ligand analogs as well as potential target proteins. Furthermore, PoSSuMds enables users to explore the binding pocket universe within PoSSuM. Additionally, we have improved the web interface with new functions, including sortable tables and a viewer for visualizing and downloading superimposed pockets. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. SR proteins are NXF1 adaptors that link alternative RNA processing to mRNA export

    PubMed Central

    Müller-McNicoll, Michaela; Botti, Valentina; de Jesus Domingues, Antonio M.; Brandl, Holger; Schwich, Oliver D.; Steiner, Michaela C.; Curk, Tomaz; Poser, Ina; Zarnack, Kathi; Neugebauer, Karla M.

    2016-01-01

    Nuclear export factor 1 (NXF1) exports mRNA to the cytoplasm after recruitment to mRNA by specific adaptor proteins. How and why cells use numerous different export adaptors is poorly understood. Here we critically evaluate members of the SR protein family (SRSF1–7) for their potential to act as NXF1 adaptors that couple pre-mRNA processing to mRNA export. Consistent with this proposal, >1000 endogenous mRNAs required individual SR proteins for nuclear export in vivo. To address the mechanism, transcriptome-wide RNA-binding profiles of NXF1 and SRSF1–7 were determined in parallel by individual-nucleotide-resolution UV cross-linking and immunoprecipitation (iCLIP). Quantitative comparisons of RNA-binding sites showed that NXF1 and SR proteins bind mRNA targets at adjacent sites, indicative of cobinding. SRSF3 emerged as the most potent NXF1 adaptor, conferring sequence specificity to RNA binding by NXF1 in last exons. Interestingly, SRSF3 and SRSF7 were shown to bind different sites in last exons and regulate 3′ untranslated region length in an opposing manner. Both SRSF3 and SRSF7 promoted NXF1 recruitment to mRNA. Thus, SRSF3 and SRSF7 couple alternative splicing and polyadenylation to NXF1-mediated mRNA export, thereby controlling the cytoplasmic abundance of transcripts with alternative 3′ ends. PMID:26944680

  15. Genetic variations in the DNA replication origins of human papillomavirus family correlate with their oncogenic potential.

    PubMed

    Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2018-04-01

    Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.

  16. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  17. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  18. Lanthanide binding and IgG affinity construct: Potential applications in solution NMR, MRI, and luminescence microscopy

    PubMed Central

    Barb, Adam W; Ho, Tienhuei Grace; Flanagan-Steet, Heather; Prestegard, James H

    2012-01-01

    Paramagnetic lanthanide ions when bound to proteins offer great potential for structural investigations that utilize solution nuclear magnetic resonance spectroscopy, magnetic resonance imaging, or optical microscopy. However, many proteins do not have native metal ion binding sites and engineering a chimeric protein to bind an ion while retaining affinity for a protein of interest represents a significant challenge. Here we report the characterization of an immunoglobulin G-binding protein redesigned to include a lanthanide binding motif in place of a loop between two helices (Z-L2LBT). It was shown to bind Tb3+ with 130 nM affinity. Ions such as Dy3+, Yb3+, and Ce3+ produce paramagnetic effects on NMR spectra and the utility of these effects is illustrated by their use in determining a structural model of the metal-complexed Z-L2LBT protein and a preliminary characterization of the dynamic distribution of IgG Fc glycan positions. Furthermore, this designed protein is demonstrated to be a novel IgG-binding reagent for magnetic resonance imaging (Z-L2LBT:Gd3+ complex) and luminescence microscopy (Z-L2LBT: Tb3+ complex). PMID:22851279

  19. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

    PubMed Central

    Naz, Sadia; Ngo, Tony; Farooq, Umar

    2017-01-01

    Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

  20. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

    PubMed

    Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

    2017-01-01

    The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

  1. Characterization of calmodulin binding domains in TRPV2 and TRPV5 C-tails.

    PubMed

    Holakovska, Blanka; Grycova, Lenka; Bily, Jan; Teisinger, Jan

    2011-02-01

    The transient receptor potential channels TRPV2 and TRPV5 belong to the vanilloid TRP subfamily. TRPV2 is highly similar to TRPV1 and shares many common properties with it. TRPV5 (and also its homolog TRPV6) is a rather distinct member of the TRPV subfamily. It is distant for being strictly Ca(2+)-selective and features quite different properties from the rest of the TRPV subfamily. It is known that TRP channels are regulated by calmodulin in a calcium-dependent manner. In our study we identified a calmodulin binding site on the C-termini of TRPV2 (654-683) and TRPV5 (587-616) corresponding to the consensus CaM binding motif 1-5-10. The R679 and K681 single mutants of TRPV2 caused a 50% decrease in binding affinity and a double mutation of K661/K664 of the same peptide lowered the binding affinity by up to 75%. A double mutation of R606/K607 and triple mutation of R594/R606/R610 in TRPV5 C-terminal peptide resulted in the total loss of binding affinity to calmodulin. These results demonstrate that the TRPV2 C-tail and TRPV5 C-tail contain calmodulin binding sites and that the basic residues are strongly involved in TRP channel binding to calmodulin.

  2. Identification of small molecular ligands as potent inhibitors of fatty acid metabolism in Mycobacterium tuberculosis

    NASA Astrophysics Data System (ADS)

    Malikanti, Ramesh; Vadija, Rajender; Veeravarapu, Hymavathi; Mustyala, Kiran Kumar; Malkhed, Vasavi; Vuruputuri, Uma

    2017-12-01

    Tuberculosis (Tb) is one of the major health challenges for the global scientific community. The 3-hydroxy butyryl-CoA dehydrogenase (Fad B2) protein belongs to 3-hydroxyl acetyl-CoA dehydrogenase family, which plays a key role in the fatty acid metabolism and β-oxidation in the cell membrane of Mycobacterium tuberculosis (Mtb). In the present study the Fad B2 protein is targeted for the identification of potential drug candidates for tuberculosis. The 3D model of the target protein Fad B2, was generated using homology modeling approach and was validated. The plausible binding site of the Fad B2 protein was identified from computational binding pocket prediction tools, which ranges from ASN120 to VAL150 amino acid residues. Virtual screening was carried out with the databases, Ligand box UOS and hit definder, at the binding site region. 133 docked complex structures were generated as an output. The identified ligands show good glide scores and glide energies. All the ligand molecules contain benzyl amine pharmacophore in common, which show specific and selective binding interactions with the SER122 and ASN146 residues of the Fad B2 protein. The ADME properties of all the ligand molecules were observed to be within the acceptable range. It is suggested from the result of the present study that the docked molecular structures with a benzyl amine pharmacophore act as potential ligands for Fad B2 protein binding and as leads in Tb drug discovery.

  3. Fusion proteins of HIV-1 envelope glycoprotein gp120 with CD4-induced antibodies showed enhanced binding to CD4 and CD4 binding site antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Weizao, E-mail: chenw3@mail.nih.gov; Feng, Yang; Wang, Yanping

    Highlights: Black-Right-Pointing-Pointer Some recombinant HIV-1 gp120s do not preserve their conformations on gp140s. Black-Right-Pointing-Pointer We hypothesize that CD4i antibodies could induce conformational changes in gp120. Black-Right-Pointing-Pointer CD4i antibodies enhance binding of CD4 and CD4bs antibodies to gp120. Black-Right-Pointing-Pointer CD4i antibody-gp120 fusion proteins could have potential as vaccine immunogens. -- Abstract: Development of successful AIDS vaccine immunogens continues to be a major challenge. One of the mechanisms by which HIV-1 evades antibody-mediated neutralizing responses is the remarkable conformational flexibility of its envelope glycoprotein (Env) gp120. Some recombinant gp120s do not preserve their conformations on gp140s and functional viral spikes, and exhibitmore » decreased recognition by CD4 and neutralizing antibodies. CD4 binding induces conformational changes in gp120 leading to exposure of the coreceptor-binding site (CoRbs). In this study, we test our hypothesis that CD4-induced (CD4i) antibodies, which target the CoRbs, could also induce conformational changes in gp120 leading to better exposed conserved neutralizing antibody epitopes including the CD4-binding site (CD4bs). We found that a mixture of CD4i antibodies with gp120 only weakly enhanced CD4 binding. However, such interactions in single-chain fusion proteins resulted in gp120 conformations which bound to CD4 and CD4bs antibodies better than the original or mutagenically stabilized gp120s. Moreover, the two molecules in the fusion proteins synergized with each other in neutralizing HIV-1. Therefore, fusion proteins of gp120 with CD4i antibodies could have potential as components of HIV-1 vaccines and inhibitors of HIV-1 entry, and could be used as reagents to explore the conformational flexibility of gp120 and mechanisms of entry and immune evasion.« less

  4. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  5. Tumorigenic Potential of Transit Amplifying Prostate Cells

    DTIC Science & Technology

    2012-06-01

    by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

  6. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    PubMed

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  7. RNA-LIM: a novel procedure for analyzing protein/single-stranded RNA propensity data with concomitant estimation of interface structure.

    PubMed

    Hall, Damien; Li, Songling; Yamashita, Kazuo; Azuma, Ryuzo; Carver, John A; Standley, Daron M

    2015-03-01

    RNA-LIM is a procedure that can analyze various pseudo-potentials describing the affinity between single-stranded RNA (ssRNA) ribonucleotides and surface amino acids to produce a coarse-grained estimate of the structure of the ssRNA at the protein interface. The search algorithm works by evolving an ssRNA chain, of known sequence, as a series of walks between fixed sites on a protein surface. Optimal routes are found by application of a set of minimal "limiting" restraints derived jointly from (i) selective sampling of the ribonucleotide amino acid affinity pseudo-potential data, (ii) limited surface path exploration by prior determination of surface arc lengths, and (iii) RNA structural specification obtained from a statistical potential gathered from a library of experimentally determined ssRNA structures. We describe the general approach using a NAST (Nucleic Acid Simulation Tool)-like approximation of the ssRNA chain and a generalized pseudo-potential reflecting the location of nucleic acid binding residues. Minimum and maximum performance indicators of the methodology are established using both synthetic data, for which the pseudo-potential defining nucleic acid binding affinity is systematically degraded, and a representative real case, where the RNA binding sites are predicted by the amplified antisense RNA (aaRNA) method. Some potential uses and extensions of the routine are discussed. RNA-LIM analysis programs along with detailed instructions for their use are available on request from the authors. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  8. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  9. Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

    PubMed

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-09-08

    Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

  10. Validation of binding of SE-75 labeled sucralfate to sites of gastrointestinal ulceration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maurer, A.H.; Knight, L.C.; Kollman, M.

    1985-05-01

    This study was performed to determine if and for how long sucralfate (SU) binds selectively to sites of gastro-intestinal (GI) ulceration. Se-Su was prepared by sulfating sucrose with tracer Se-75 and precipitating it as the basic Al salt. All patients (pts) had endoscopy to confirm the presence of either: esophagitis (n=5), gastritis (GA) (n=5), gastric ulcers (GU) (n=5), duodenal ulcers (DU) (n=5), or no ulceration (NU) (n=5). Following an overnight fast the pts swallowed 1 gm with 100 ..mu..Ci of Se-SU and were imaged continuously over 24 hours or until no activity remained in the upper GI tract. Pts withmore » GU visually demonstrated focal SU binding at the ulcers for an average of 3.9 +- 1.1 hrs. with a mean GET of 68 +- 25 min. Mean GET for pts with DU was prolonged, 171 +- 63 min, however focal binding at duodenal ulcers was not seen. All pts with GA had diffuse retention of SU in the stomach with a mean GET of 118 +- 34 min. Focal binding of SU at all sites of esophagitis was seen with a T-1/2 of 65 +- 32 min at the ulcerations. In conclusion these data support the theory that the mechanism of ulcer healing with SU is related to its ability to adhere to the ulcer site forming a protective barrier. In addition Se-SU is a potential ulcer imaging agent which can be used to noninvasively assess healing.« less

  11. Novel Triazole-Quinoline Derivatives as Selective Dual Binding Site Acetylcholinesterase Inhibitors.

    PubMed

    Mantoani, Susimaire P; Chierrito, Talita P C; Vilela, Adriana F L; Cardoso, Carmen L; Martínez, Ana; Carvalho, Ivone

    2016-02-05

    Alzheimer's disease (AD) is the most prevalent neurodegenerative disorder worldwide. Currently, the only strategy for palliative treatment of AD is to inhibit acetylcholinesterase (AChE) in order to increase the concentration of acetylcholine in the synaptic cleft. Evidence indicates that AChE also interacts with the β-amyloid (Aβ) protein, acting as a chaperone and increasing the number and neurotoxicity of Aβ fibrils. It is known that AChE has two binding sites: the peripheral site, responsible for the interactions with Aβ, and the catalytic site, related with acetylcholine hydrolysis. In this work, we reported the synthesis and biological evaluation of a library of new tacrine-donepezil hybrids, as a potential dual binding site AChE inhibitor, containing a triazole-quinoline system. The synthesis of hybrids was performed in four steps using the click chemistry strategy. These compounds were evaluated as hAChE and hBChE inhibitors, and some derivatives showed IC50 values in the micro-molar range and were remarkably selective towards hAChE. Kinetic assays and molecular modeling studies confirm that these compounds block both catalytic and peripheral AChE sites. These results are quite interesting since the triazole-quinoline system is a new structural scaffold for AChE inhibitors. Furthermore, the synthetic approach is very efficient for the preparation of target compounds, allowing a further fruitful new chemical library optimization.

  12. Tricyclic GyrB/ParE (TriBE) Inhibitors. A new class of broad-spectrum dual-targeting antibacterial agents

    DOE PAGES

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael; ...

    2013-12-26

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. Growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highlymore » conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Moreover, lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models.« less

  13. Tricyclic GyrB/ParE (TriBE) Inhibitors. A new class of broad-spectrum dual-targeting antibacterial agents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. Growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highlymore » conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Moreover, lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models.« less

  14. Use of tissue-specific microRNA to control pathology of wild-type adenovirus without attenuation of its ability to kill cancer cells.

    PubMed

    Cawood, Ryan; Chen, Hannah H; Carroll, Fionnadh; Bazan-Peregrino, Miriam; van Rooijen, Nico; Seymour, Leonard W

    2009-05-01

    Replicating viruses have broad applications in biomedicine, notably in cancer virotherapy and in the design of attenuated vaccines; however, uncontrolled virus replication in vulnerable tissues can give pathology and often restricts the use of potent strains. Increased knowledge of tissue-selective microRNA expression now affords the possibility of engineering replicating viruses that are attenuated at the RNA level in sites of potential pathology, but retain wild-type replication activity at sites not expressing the relevant microRNA. To assess the usefulness of this approach for the DNA virus adenovirus, we have engineered a hepatocyte-safe wild-type adenovirus 5 (Ad5), which normally mediates significant toxicity and is potentially lethal in mice. To do this, we have included binding sites for hepatocyte-selective microRNA mir-122 within the 3' UTR of the E1A transcription cassette. Imaging versions of these viruses, produced by fusing E1A with luciferase, showed that inclusion of mir-122 binding sites caused up to 80-fold decreased hepatic expression of E1A following intravenous delivery to mice. Animals administered a ten-times lethal dose of wild-type Ad5 (5x10(10) viral particles/mouse) showed substantial hepatic genome replication and extensive liver pathology, while inclusion of 4 microRNA binding sites decreased replication 50-fold and virtually abrogated liver toxicity. This modified wild-type virus retained full activity within cancer cells and provided a potent, liver-safe oncolytic virus. In addition to providing many potent new viruses for cancer virotherapy, microRNA control of virus replication should provide a new strategy for designing safe attenuated vaccines applied across a broad range of viral diseases.

  15. Redox potential tuning through differential quinone binding in the photosynthetic reaction center of Rhodobacter sphaeroides

    DOE PAGES

    Vermaas, Josh V.; Taguchi, Alexander T.; Dikanov, Sergei A.; ...

    2015-03-03

    Ubiquinone forms an integral part of the electron transport chain in cellular respiration and photosynthesis across a vast number of organisms. Prior experimental results have shown that the photosynthetic reaction center (RC) from Rhodobacter sphaeroides is only fully functional with a limited set of methoxy-bearing quinones, suggesting that specific interactions with this substituent are required to drive electron transport and the formation of quinol. The nature of these interactions has yet to be determined. Through parameterization of a CHARMM-compatible quinone force field and subsequent molecular dynamics simulations of the quinone-bound RC, in this paper we have investigated and characterized themore » interactions of the protein with the quinones in the Q A and Q B sites using both equilibrium simulation and thermodynamic integration. In particular, we identify a specific interaction between the 2-methoxy group of ubiquinone in the Q B site and the amide nitrogen of GlyL225 that we implicate in locking the orientation of the 2-methoxy group, thereby tuning the redox potential difference between the quinones occupying the Q A and Q B sites. Finally, disruption of this interaction leads to weaker binding in a ubiquinone analogue that lacks a 2-methoxy group, a finding supported by reverse electron transfer electron paramagnetic resonance experiments of the Q A–Q B– biradical and competitive binding assays.« less

  16. Homology modelling, molecular docking, and molecular dynamics simulations reveal the inhibition of Leishmania donovani dihydrofolate reductase-thymidylate synthase enzyme by Withaferin-A.

    PubMed

    Vadloori, Bharadwaja; Sharath, A K; Prabhu, N Prakash; Maurya, Radheshyam

    2018-04-16

    Present in silico study was carried out to explore the mode of inhibition of Leishmania donovani dihydrofolate reductase-thymidylate synthase (Ld DHFR-TS) enzyme by Withaferin-A, a withanolide isolated from Withania somnifera. Withaferin-A (WA) is known for its profound multifaceted properties, but its antileishmanial activity is not well understood. The parasite's DHFR-TS enzyme is diverse from its mammalian host and could be a potential drug target in parasites. A 3D model of Ld DHFR-TS enzyme was built and verified using Ramachandran plot and SAVES tools. The protein was docked with WA-the ligand, methotrexate (MTX)-competitive inhibitor of DHFR, and dihydrofolic acid (DHFA)-substrate for DHFR-TS. Molecular docking studies reveal that WA competes for active sites of both Hu DHFR and TS enzymes whereas it binds to a site other than active site in Ld DHFR-TS. Moreover, Lys 173 residue of DHFR-TS forms a H-bond with WA and has higher binding affinity to Ld DHFR-TS than Hu DHFR and Hu TS. The MD simulations confirmed the H-bonding interactions were stable. The binding energies of WA with Ld DHFR-TS were calculated using MM-PBSA. Homology modelling, molecular docking and MD simulations of Ld DHFR-TS revealed that WA could be a potential anti-leishmanial drug.

  17. Redox potential tuning through differential quinone binding in the photosynthetic reaction center of Rhodobacter sphaeroides.

    PubMed

    Vermaas, Josh V; Taguchi, Alexander T; Dikanov, Sergei A; Wraight, Colin A; Tajkhorshid, Emad

    2015-03-31

    Ubiquinone forms an integral part of the electron transport chain in cellular respiration and photosynthesis across a vast number of organisms. Prior experimental results have shown that the photosynthetic reaction center (RC) from Rhodobacter sphaeroides is only fully functional with a limited set of methoxy-bearing quinones, suggesting that specific interactions with this substituent are required to drive electron transport and the formation of quinol. The nature of these interactions has yet to be determined. Through parameterization of a CHARMM-compatible quinone force field and subsequent molecular dynamics simulations of the quinone-bound RC, we have investigated and characterized the interactions of the protein with the quinones in the Q(A) and Q(B) sites using both equilibrium simulation and thermodynamic integration. In particular, we identify a specific interaction between the 2-methoxy group of ubiquinone in the Q(B) site and the amide nitrogen of GlyL225 that we implicate in locking the orientation of the 2-methoxy group, thereby tuning the redox potential difference between the quinones occupying the Q(A) and Q(B) sites. Disruption of this interaction leads to weaker binding in a ubiquinone analogue that lacks a 2-methoxy group, a finding supported by reverse electron transfer electron paramagnetic resonance experiments of the Q(A)⁻Q(B)⁻ biradical and competitive binding assays.

  18. Design and Synthesis of Cannabinoid 1 Receptor (CB1R) Allosteric Modulators: Drug Discovery Applications.

    PubMed

    Kulkarni, Abhijit R; Garai, Sumanta; Janero, David R; Thakur, Ganesh A

    2017-01-01

    Also expressed in various peripheral tissues, the type-1 cannabinoid receptor (CB1R) is the predominant G protein-coupled receptor (GPCR) in brain, where it is responsible for retrograde control of neurotransmitter release. Cellular signaling mediated by CB1R is involved in numerous physiological processes, and pharmacological CB1R modulation is considered a tenable therapeutic approach for diseases ranging from substance-use disorders and glaucoma to metabolic syndrome. Despite the design and synthesis of a variety of bioactive small molecules targeted to the CB1R orthosteric ligand-binding site, the potential of CB1R as a therapeutic GPCR has been largely unrealized due to adverse events associated with typical orthosteric CB1R agonists and antagonists/inverse agonists. Modulation of CB1R-mediated signal transmission by targeting alternative allosteric ligand-binding site(s) on the receptor has garnered interest as a potentially safer and more effective therapeutic modality. This chapter highlights the design and synthesis of novel, pharmacologically active CB1R allosteric modulators and emphasizes how their molecular properties and the positive and negative allosteric control they exert can lead to improved CB1R-targeted pharmacotherapeutics, as well as designer covalent probes that can be used to map CB1R allosteric binding domains and inform structure-based drug design. © 2017 Elsevier Inc. All rights reserved.

  19. Distribution of cyclophilin B-binding sites in the subsets of human peripheral blood lymphocytes.

    PubMed

    Denys, A; Allain, F; Foxwell, B; Spik, G

    1997-08-01

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway and released in biological fluids. We have recently demonstrated that both free CyPB and CyPB-CsA complex specifically bind to peripheral blood T lymphocytes and are internalized. These results suggest that CyPB might promote the targeting of the drug into sensitive cells. Peripheral blood lymphocytes are subdivided in several populations according to their biological functions and sensitivity to CsA. We have investigated the binding of CyPB to these different subsets using a CyPB derivatized by fluorescein through its single cysteine which retains its binding properties. We have confirmed that only T cells were involved in the interaction with CyPB. The ligand binding was found to be heterogeneously distributed on the different T-cell subsets and surface-bound CyPB was mainly associated with the CD4-positive cells. No significant difference was noted between the CD45RA and CD45RO subsets, demonstrating that CyPB-binding sites were equally distributed between native and memory T cells. CD3 stimulation of T lymphocytes led to a decrease in the CyPB-binding capacity, that may be explained by a down-regulation of the CyPB-receptor expression upon T-cell activation. Finally, we demonstrated that CyPB-receptor-positive cells, isolated on CyPB sulphydryl-coupled affinity matrices, are more sensitive to CyPB-complexed CsA than mixed peripheral blood lymphocytes, suggesting that CyPB potentiates CsA activity through the binding of the complex. Taken together, our results demonstrate that CyPB-binding sites are mainly associated with resting cells of the helper T lymphocyte, and that CyPB might modulate the distribution of CsA through the drug targeting to sensitive cells.

  20. Ursolic acid derivatives as potential antidiabetic agents: In vitro, in vivo, and in silico studies.

    PubMed

    Guzmán-Ávila, Ricardo; Flores-Morales, Virginia; Paoli, Paolo; Camici, Guido; Ramírez-Espinosa, Juan José; Cerón-Romero, Litzia; Navarrete-Vázquez, Gabriel; Hidalgo-Figueroa, Sergio; Yolanda Rios, Maria; Villalobos-Molina, Rafael; Estrada-Soto, Samuel

    2018-03-01

    Hit, Lead & Candidate Discovery Protein tyrosine phosphatase 1B (PTP-1B) has attracted interest as a novel target for the treatment of type 2 diabetes, this because its role in the insulin-signaling pathway as a negative regulator. Thus, the aim of current work was to obtain seven ursolic acid derivatives as potential antidiabetic agents with PTP-1B inhibition as main mechanism of action. Furthermore, derivatives 1-7 were submitted in vitro to enzymatic PTP-1B inhibition being 3, 5, and 7 the most active compounds (IC 50  = 5.6, 4.7, and 4.6 μM, respectively). In addition, results were corroborated with in silico docking studies with PTP-1B orthosteric site A and extended binding site B, showed that 3 had polar and Van der Waals interactions in both sites with Lys120, Tyr46, Ser216, Ala217, Ile219, Asp181, Phe182, Gln262, Val49, Met258, and Gly259, showing a docking score value of -7.48 Kcal/mol, being more specific for site A. Moreover, compound 7 showed polar interaction with Gln262 and Van der Waals interactions with Ala217, Phe182, Ile219, Arg45, Tyr46, Arg47, Asp48, and Val49 with a predictive docking score of -6.43 kcal/mol, suggesting that the potential binding site could be localized in the site B adjacent to the catalytic site A. Finally, derivatives 2 and 7 (50 mg/kg) were selected to establish their in vivo antidiabetic effect using a noninsulin-dependent diabetes mice model, showing significant blood glucose lowering compared with control group (p < .05). © 2018 Wiley Periodicals, Inc.

  1. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  2. NMR diffusion and relaxation studies of 2-nitroimidazole and albumin interactions

    NASA Astrophysics Data System (ADS)

    Wijesekera, Dj; Willis, Scott A.; Gupta, Abhishek; Torres, Allan M.; Zheng, Gang; Price, William S.

    2018-03-01

    Nitroimidazole derivatives are of current interest in the development of hypoxia targeting agents and show potential in the establishment of quantitative measures of tumor hypoxia. In this study, the binding of 2-nitroimidazole to albumin was probed using NMR diffusion and relaxation measurements. Binding studies were conducted at three different protein concentrations (0.23, 0.30 and 0.38 mM) with drug concentrations ranging from 0.005-0.16 M at 298 K. Quantitative assessments of the binding model were made by evaluating the number of binding sites, n, and association constant, K. These were determined to be 21 ± 3 and 53 ± 4 M- 1, respectively.

  3. Avian pathogenic Escherichia coli bind fibronectin and laminin.

    PubMed

    Ramírez, Rosa María; Almanza, Yolanda; González, Rafael; García, Santos; Heredia, Norma

    2009-04-01

    Avian colisepticemia frequently occurs after respiratory tract damage, the primary site for infection allows bacteria to encounter an exposed basement membrane, where laminin and fibronectin are important components. We investigated the ability of an isolate of avian pathogenic Escherichia coli to bind fibronectin and laminin. Using Far-western dot blot analysis, we demonstrated the ability of this microorganism to bind basement membrane proteins fibronectin and laminin. Results from an ELISA-based approach indicate that the binding to these membrane proteins was bacterial-dose dependent. Furthermore, two specific E. coli polypeptides, of 32 kDa and 130 kDa, reacted with laminin and fibronectin, respectively. Further evaluation of these potential bacterial adhesins may provide insights into the pathogenesis of colibacillosis.

  4. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  5. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  6. Mechanism of potassium ion uptake by the Na+/K+-ATPase

    PubMed Central

    Castillo, Juan P.; Rui, Huan; Basilio, Daniel; Das, Avisek; Roux, Benoît; Latorre, Ramon; Bezanilla, Francisco; Holmgren, Miguel

    2015-01-01

    The Na+/K+-ATPase restores sodium (Na+) and potassium (K+) electrochemical gradients dissipated by action potentials and ion-coupled transport processes. As ions are transported, they become transiently trapped between intracellular and extracellular gates. Once the external gate opens, three Na+ ions are released, followed by the binding and occlusion of two K+ ions. While the mechanisms of Na+ release have been well characterized by the study of transient Na+ currents, smaller and faster transient currents mediated by external K+ have been more difficult to study. Here we show that external K+ ions travelling to their binding sites sense only a small fraction of the electric field as they rapidly and simultaneously become occluded. Consistent with these results, molecular dynamics simulations of a pump model show a wide water-filled access channel connecting the binding site to the external solution. These results suggest a mechanism of K+ gating different from that of Na+ occlusion. PMID:26205423

  7. The T160A hemagglutinin substitution affects not only receptor binding property but also transmissibility of H5N1 clade 2.3.4 avian influenza virus in guinea pigs.

    PubMed

    Gu, Min; Li, Qunhui; Gao, Ruyi; He, Dongchang; Xu, Yunpeng; Xu, Haixu; Xu, Lijun; Wang, Xiaoquan; Hu, Jiao; Liu, Xiaowen; Hu, Shunlin; Peng, Daxin; Jiao, Xinan; Liu, Xiufan

    2017-02-06

    We generated and characterized site-directed HA mutants on the genetic backbone of H5N1 clade 2.3.4 virus preferentially binding to α-2,3 receptors in order to identify the key determinants in hemagglutinin rendering the dual affinity to both α-2,3 (avian-type) and α-2,6 (human-type) linked sialic acid receptors of the current clade 2.3.4.4 H5NX subtype avian influenza reassortants. The results show that the T160A substitution resulted in the loss of a glycosylation site at 158N and led not only to enhanced binding specificity for human-type receptors but also transmissibility among guinea pigs, which could be considered as an important molecular marker for assessing pandemic potential of H5 subtype avian influenza isolates.

  8. Photoaffinity-labeled Cytokinins

    PubMed Central

    Theiler, Jane B.; Leonard, Nelson J.; Schmitz, Ruth Y.; Skoog, Folke

    1976-01-01

    Two new azidopurine derivatives, 2-azido-N6-(Δ2-isopentenyl)adenine and 2-azido-N6-benzyladenine, have been synthesized as potential photoaffinity labels for probing cytokinin-binding sites. The preparation and the biological activity of these compounds are described. PMID:16659772

  9. Allosteric Modulation of Chemoattractant Receptors

    PubMed Central

    Allegretti, Marcello; Cesta, Maria Candida; Locati, Massimo

    2016-01-01

    Chemoattractants control selective leukocyte homing via interactions with a dedicated family of related G protein-coupled receptor (GPCR). Emerging evidence indicates that the signaling activity of these receptors, as for other GPCR, is influenced by allosteric modulators, which interact with the receptor in a binding site distinct from the binding site of the agonist and modulate the receptor signaling activity in response to the orthosteric ligand. Allosteric modulators have a number of potential advantages over orthosteric agonists/antagonists as therapeutic agents and offer unprecedented opportunities to identify extremely selective drug leads. Here, we resume evidence of allosterism in the context of chemoattractant receptors, discussing in particular its functional impact on functional selectivity and probe/concentration dependence of orthosteric ligands activities. PMID:27199992

  10. Investigating the Regulation and Potential Role of Nonhypoxic Hypoxia-Inducible Factor 1 (HIF-1) in Aromatase Inhibitor Resistant Breast Cancer

    DTIC Science & Technology

    2013-10-01

    hypoxia responsive element ( HRE ) to which HIF-1 binds in order to regulate vimentin gene expresson has not been identified. We have currently, analyzed...the vimentin promoter and have identified 2 potential HRE sites, based on sequence (Figure 5). Primers have been designed and ordered, and

  11. On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

    PubMed

    Speranskiy, Kirill; Kurnikova, Maria

    2005-08-30

    Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

  12. Inhalational anaesthetics and n-alcohols share a site of action in the neuronal Shaw2 Kv channel

    PubMed Central

    Bhattacharji, Aditya; Klett, Nathan; Go, Ramon Christopher V; Covarrubias, Manuel

    2010-01-01

    Background and purpose: Neuronal ion channels are key targets of general anaesthetics and alcohol, and binding of these drugs to pre-existing and relatively specific sites is thought to alter channel gating. However, the underlying molecular mechanisms of this action are still poorly understood. Here, we investigated the neuronal Shaw2 voltage-gated K+ (Kv) channel to ask whether the inhalational anaesthetic halothane and n-alcohols share a binding site near the activation gate of the channel. Experimental approach: Focusing on activation gate mutations that affect channel modulation by n-alcohols, we investigated n-alcohol-sensitive and n-alcohol-resistant Kv channels heterologously expressed in Xenopus oocytes to probe the functional modulation by externally applied halothane using two-electrode voltage clamping and a gas-tight perfusion system. Key results: Shaw2 Kv channels are reversibly inhibited by halothane in a dose-dependent and saturable manner (K0.5= 400 µM; nH= 1.2). Also, discrete mutations in the channel's S4S5 linker are sufficient to reduce or confer inhibition by halothane (Shaw2-T330L and Kv3.4-G371I/T378A respectively). Furthermore, a point mutation in the S6 segment of Shaw2 (P410A) converted the halothane-induced inhibition into halothane-induced potentiation. Lastly, the inhibition resulting from the co-application of n-butanol and halothane is consistent with the presence of overlapping binding sites for these drugs and weak binding cooperativity. Conclusions and implications: These observations strongly support a molecular model of a general anaesthetic binding site in the Shaw2 Kv channel. This site may involve the amphiphilic interface between the S4S5 linker and the S6 segment, which plays a pivotal role in Kv channel activation. PMID:20136839

  13. Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

    PubMed

    Nagata, Yuki

    2010-02-01

    A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

  14. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  15. The allosteric site regulates the voltage sensitivity of muscarinic receptors.

    PubMed

    Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas

    2018-01-01

    Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  17. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  18. The naphthoquinone diospyrin is an inhibitor of DNA gyrase with a novel mechanism of action.

    PubMed

    Karkare, Shantanu; Chung, Terence T H; Collin, Frederic; Mitchenall, Lesley A; McKay, Adam R; Greive, Sandra J; Meyer, Jacobus J M; Lall, Namrita; Maxwell, Anthony

    2013-02-15

    Tuberculosis and other bacterial diseases represent a significant threat to human health. The DNA topoisomerases are excellent targets for chemotherapy, and DNA gyrase in particular is a well-validated target for antibacterial agents. Naphthoquinones (e.g. diospyrin and 7-methyljuglone) have been shown to have therapeutic potential, particularly against Mycobacterium tuberculosis. We have found that these compounds are inhibitors of the supercoiling reaction catalyzed by M. tuberculosis gyrase and other gyrases. Our evidence strongly suggests that the compounds bind to the N-terminal domain of GyrB, which contains the ATPase active site, but are not competitive inhibitors of the ATPase reaction. We propose that naphthoquinones bind to GyrB at a novel site close to the ATPase site. This novel mode of action could be exploited to develop new antibacterial agents.

  19. The Naphthoquinone Diospyrin Is an Inhibitor of DNA Gyrase with a Novel Mechanism of Action*

    PubMed Central

    Karkare, Shantanu; Chung, Terence T. H.; Collin, Frederic; Mitchenall, Lesley A.; McKay, Adam R.; Greive, Sandra J.; Meyer, Jacobus J. M.; Lall, Namrita; Maxwell, Anthony

    2013-01-01

    Tuberculosis and other bacterial diseases represent a significant threat to human health. The DNA topoisomerases are excellent targets for chemotherapy, and DNA gyrase in particular is a well-validated target for antibacterial agents. Naphthoquinones (e.g. diospyrin and 7-methyljuglone) have been shown to have therapeutic potential, particularly against Mycobacterium tuberculosis. We have found that these compounds are inhibitors of the supercoiling reaction catalyzed by M. tuberculosis gyrase and other gyrases. Our evidence strongly suggests that the compounds bind to the N-terminal domain of GyrB, which contains the ATPase active site, but are not competitive inhibitors of the ATPase reaction. We propose that naphthoquinones bind to GyrB at a novel site close to the ATPase site. This novel mode of action could be exploited to develop new antibacterial agents. PMID:23275348

  20. The ATP-binding site of type II topoisomerases as a target for antibacterial drugs.

    PubMed

    Maxwell, Anthony; Lawson, David M

    2003-01-01

    DNA topoisomerases are essential enzymes in all cell types and have been found to be valuable drug targets both for antibacterial and anti-cancer chemotherapy. Type II topoisomerases possess a binding site for ATP, which can be exploited as a target for chemo-therapeutic agents. High-resolution structures of protein fragments containing this site complexed with antibiotics or an ATP analogue have provided vital information for the understanding of the action of existing drugs and for the potential development of novel anti-bacterial agents. In this article we have reviewed the structure and function of the ATPase domain of DNA gyrase (bacterial topoisomerase II), particularly highlighting novel information that has been revealed by structural studies. We discuss the efficacy and mode of action of existing drugs and consider the prospects for the development of novel agents.

  1. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  3. Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

    PubMed Central

    McClellan, Michael J.; Wood, C. David; Ojeniyi, Opeoluwa; Cooper, Tim J.; Kanhere, Aditi; Arvey, Aaron; Webb, Helen M.; Palermo, Richard D.; Harth-Hertle, Marie L.; Kempkes, Bettina; Jenner, Richard G.; West, Michelle J.

    2013-01-01

    Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors, we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular basis for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of enhancer-promoter interactions by viral transcription factors. PMID:24068937

  4. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  5. KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.

    PubMed

    Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar

    2009-08-15

    Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.

  6. Exploiting three kinds of interface propensities to identify protein binding sites.

    PubMed

    Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

    2009-08-01

    Predicting the binding sites between two interacting proteins provides important clues to the function of a protein. In this study, we present a building block of proteins called order profiles to use the evolutionary information of the protein sequence frequency profiles and apply this building block to produce a class of propensities called order profile interface propensities. For comparisons, we revisit the usage of residue interface propensities and binary profile interface propensities for protein binding site prediction. Each kind of propensities combined with sequence profiles and accessible surface areas are inputted into SVM. When tested on four types of complexes (hetero-permanent complexes, hetero-transient complexes, homo-permanent complexes and homo-transient complexes), experimental results show that the order profile interface propensities are better than residue interface propensities and binary profile interface propensities. Therefore, order profile is a suitable profile-level building block of the protein sequences and can be widely used in many tasks of computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the protein remote homology detection.

  7. Effects of nano red elemental selenium on sodium currents in rat dorsal root ganglion neurons.

    PubMed

    Yuan, Huijun; Lin, Jiarui; Lan, Tonghan

    2006-01-01

    Nano red elemental selenium (Nano-Se), was demonstrated to be useful in medical and scientific researches. Here, we investigated the effects of Nano-Se on sodium currents on rat dorsal root ganglion neurons (DRG), using the whole-cell patch clamp method. Nano-Se reversibly decrease the I(Na)(TTX-S) in a concentration-dependent, time-dependent and open-channel block manners without affecting I(Na)(TTX-R). It shifted the steady-state activation and inactivation curves for I(Na) to more negative potentials. In the research of recovery from inactivation, the recovery time constant is longer in the present of Nano-Se. Nano-Se had a weaker inhibitory effect on I(Na), compared with marked decrease caused by selenite which indicated that Nano-Se is less neurotoxic than selenite in short-term/large dose treatments and had similar bio availability to sodium selenite. The results of interaction between the effects of Nano-Se and selenite on sodium currents indicated a negative allosteric interaction between the selenite binding site and the Nano-Se binding site or that they have the same competitive binding site.

  8. Insights into distinct modulation of α7 and α7β2 nicotinic acetylcholine receptors by the volatile anesthetic isoflurane.

    PubMed

    Mowrey, David D; Liu, Qiang; Bondarenko, Vasyl; Chen, Qiang; Seyoum, Edom; Xu, Yan; Wu, Jie; Tang, Pei

    2013-12-13

    Nicotinic acetylcholine receptors (nAChRs) are targets of general anesthetics, but functional sensitivity to anesthetic inhibition varies dramatically among different subtypes of nAChRs. Potential causes underlying different functional responses to anesthetics remain elusive. Here we show that in contrast to the α7 nAChR, the α7β2 nAChR is highly susceptible to inhibition by the volatile anesthetic isoflurane in electrophysiology measurements. Isoflurane-binding sites in β2 and α7 were found at the extracellular and intracellular end of their respective transmembrane domains using NMR. Functional relevance of the identified β2 site was validated via point mutations and subsequent functional measurements. Consistent with their functional responses to isoflurane, β2 but not α7 showed pronounced dynamics changes, particularly for the channel gate residue Leu-249(9'). These results suggest that anesthetic binding alone is not sufficient to generate functional impact; only those sites that can modulate channel dynamics upon anesthetic binding will produce functional effects.

  9. G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.

    PubMed

    Lee, Hui Sun; Im, Wonpil

    2017-01-01

    Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.

  10. Structure-Guided Design of Peptides as Tools to Probe the Protein-Protein Interaction between Cullin-2 and Elongin BC Substrate Adaptor in Cullin RING E3 Ubiquitin Ligases.

    PubMed

    Cardote, Teresa A F; Ciulli, Alessio

    2017-09-21

    Cullin RING E3 ubiquitin ligases (CRLs) are large dynamic multi-subunit complexes that control the fate of many proteins in cells. CRLs are attractive drug targets for the development of small-molecule inhibitors and chemical inducers of protein degradation. Herein we describe a structure-guided biophysical approach to probe the protein-protein interaction (PPI) between the Cullin-2 scaffold protein and the adaptor subunits Elongin BC within the context of the von Hippel-Lindau complex (CRL2 VHL ) using peptides. Two peptides were shown to bind at the targeted binding site on Elongin C, named the "EloC site", with micromolar dissociation constants, providing a starting point for future optimization. Our results suggest ligandability of the EloC binding site to short linear peptides, unveiling the opportunity and challenges to develop small molecules that have the potential to target selectively the Cul2-adaptor PPI within CRLs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. STD-NMR experiments identify a structural motif with novel second-site activity against West Nile virus NS2B-NS3 protease.

    PubMed

    Schöne, Tobias; Grimm, Lena Lisbeth; Sakai, Naoki; Zhang, Linlin; Hilgenfeld, Rolf; Peters, Thomas

    2017-10-01

    West Nile virus (WNV) belongs to the genus Flavivirus of the family Flaviviridae. This mosquito-borne virus that is highly pathogenic to humans has been evolving into a global threat during the past two decades. Despite many efforts, neither antiviral drugs nor vaccines are available. The viral protease NS2B-NS3 pro is essential for viral replication, and therefore it is considered a prime drug target. However, success in the development of specific NS2B-NS3 pro inhibitors had been moderate so far. In the search for new structural motifs with binding affinity for NS2B-NS3 pro , we have screened a fragment library, the Maybridge Ro5 library, employing saturation transfer difference (STD) NMR experiments as readout. About 30% of 429 fragments showed binding to NS2B-NS3 pro . Subsequent STD-NMR competition experiments using the known active site fragment A as reporter ligand yielded 14 competitively binding fragments, and 22 fragments not competing with A. In a fluorophore-based protease assay, all of these fragments showed inhibition in the micromolar range. Interestingly, 10 of these 22 fragments showed a notable increase of STD intensities in the presence of compound A suggesting cooperative binding. The most promising non-competitive inhibitors 1 and 2 (IC 50 ∼ 500 μM) share a structural motif that may guide the development of novel second-site (potentially allosteric) inhibitors of NS2B-NS3 pro . To identify the matching protein binding site, chemical shift perturbation studies employing 1 H, 15 N-TROSY-HSQC experiments with uniformly 2 H, 15 N-labeled protease were performed in the presence of 1, and in the concomitant absence or presence of A. The data suggest that 1 interacts with Met 52* of NS2B, identifying a secondary site adjacent to the binding site of A. Therefore, our study paves the way for the synthesis of novel bidentate NS2B-NS3 pro inhibitors. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Fragment-Based Optimization of Small Molecule CXCL12 Inhibitors for Antagonizing the CXCL12/CXCR4 Interaction

    PubMed Central

    Ziarek, Joshua J.; Liu, Yan; Smith, Emmanuel; Zhang, Guolin; Peterson, Francis C.; Chen, Jun; Yu, Yongping; Chen, Yu; Volkman, Brian F.; Li, Rongshi

    2013-01-01

    The chemokine CXCL12 and its G protein-coupled receptor (GPCR) CXCR4 are high-priority clinical targets because of their involvement in metastatic cancers (also implicated in autoimmune disease and cardiovascular disease). Because chemokines interact with two distinct sites to bind and activate their receptors, both the GPCRs and chemokines are potential targets for small molecule inhibition. A number of chemokines have been validated as targets for drug development, but virtually all drug discovery efforts focus on the GPCRs. However, all CXCR4 receptor antagonists with the exception of MSX-122 have failed in clinical trials due to unmanageable toxicities, emphasizing the need for alternative strategies to interfere with CXCL12/CXCR4-guided metastatic homing. Although targeting the relatively featureless surface of CXCL12 was presumed to be challenging, focusing efforts at the sulfotyrosine (sY) binding pockets proved successful for procuring initial hits. Using a hybrid structure-based in silico/NMR screening strategy, we recently identified a ligand that occludes the receptor recognition site. From this initial hit, we designed a small fragment library containing only nine tetrazole derivatives using a fragment-based and bioisostere approach to target the sY binding sites of CXCL12. Compound binding modes and affinities were studied by 2D NMR spectroscopy, X-ray crystallography, molecular docking and cell-based functional assays. Our results demonstrate that the sY binding sites are conducive to the development of high affinity inhibitors with better ligand efficiency (LE) than typical protein-protein interaction inhibitors (LE ≤ 0.24). Our novel tetrazole-based fragment 18 was identified to bind the sY21 site with a Kd of 24 μM (LE = 0.30). Optimization of 18 yielded compound 25 which specifically inhibits CXCL12-induced migration with an improvement in potency over the initial hit 9. The fragment from this library that exhibited the highest affinity and ligand efficiency (11: Kd = 13 μM, LE = 0.33) may serve as a starting point for development of inhibitors targeting the sY12 site. PMID:23368099

  13. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    PubMed

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  14. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  15. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  17. Human 15-LOX-1 active site mutations alter inhibitor binding and decrease potency.

    PubMed

    Armstrong, Michelle; van Hoorebeke, Christopher; Horn, Thomas; Deschamps, Joshua; Freedman, J Cody; Kalyanaraman, Chakrapani; Jacobson, Matthew P; Holman, Theodore

    2016-11-01

    Human 15-lipoxygenase-1 (h15-LOX-1 or h12/15-LOX) reacts with polyunsaturated fatty acids and produces bioactive lipid derivatives that are implicated in many important human diseases. One such disease is stroke, which is the fifth leading cause of death and the first leading cause of disability in America. The discovery of h15-LOX-1 inhibitors could potentially lead to novel therapeutics in the treatment of stroke, however, little is known about the inhibitor/active site interaction. This study utilizes site-directed mutagenesis, guided in part by molecular modeling, to gain a better structural understanding of inhibitor interactions within the active site. We have generated eight mutants (R402L, R404L, F414I, F414W, E356Q, Q547L, L407A, I417A) of h15-LOX-1 to determine whether these active site residues interact with two h15-LOX-1 inhibitors, ML351 and an ML094 derivative, compound 18. IC 50 values and steady-state inhibition kinetics were determined for the eight mutants, with four of the mutants affecting inhibitor potency relative to wild type h15-LOX-1 (F414I, F414W, E356Q and L407A). The data indicate that ML351 and compound 18, bind in a similar manner in the active site to an aromatic pocket close to F414 but have subtle differences in their specific binding modes. This information establishes the binding mode for ML094 and ML351 and will be leveraged to develop next-generation inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Agonist activation of α7 nicotinic acetylcholine receptors via an allosteric transmembrane site

    PubMed Central

    Gill, JasKiran K.; Savolainen, Mari; Young, Gareth T.; Zwart, Ruud; Sher, Emanuele; Millar, Neil S.

    2011-01-01

    Conventional nicotinic acetylcholine receptor (nAChR) agonists, such as acetylcholine, act at an extracellular “orthosteric” binding site located at the interface between two adjacent subunits. Here, we present evidence of potent activation of α7 nAChRs via an allosteric transmembrane site. Previous studies have identified a series of nAChR-positive allosteric modulators (PAMs) that lack agonist activity but are able to potentiate responses to orthosteric agonists, such as acetylcholine. It has been shown, for example, that TQS acts as a conventional α7 nAChR PAM. In contrast, we have found that a compound with close chemical similarity to TQS (4BP-TQS) is a potent allosteric agonist of α7 nAChRs. Whereas the α7 nAChR antagonist metyllycaconitine acts competitively with conventional nicotinic agonists, metyllycaconitine is a noncompetitive antagonist of 4BP-TQS. Mutation of an amino acid (M253L), located in a transmembrane cavity that has been proposed as being the binding site for PAMs, completely blocks agonist activation by 4BP-TQS. In contrast, this mutation had no significant effect on agonist activation by acetylcholine. Conversely, mutation of an amino acid located within the known orthosteric binding site (W148F) has a profound effect on agonist potency of acetylcholine (resulting in a shift of ∼200-fold in the acetylcholine dose-response curve), but had little effect on the agonist dose-response curve for 4BP-TQS. Computer docking studies with an α7 homology model provides evidence that both TQS and 4BP-TQS bind within an intrasubunit transmembrane cavity. Taken together, these findings provide evidence that agonist activation of nAChRs can occur via an allosteric transmembrane site. PMID:21436053

  19. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Top