Transgenic expression of medicago truncatula PR10 and PR5 promoters in alfalfa shows pathogen-induced up-regulation of transgene expression

USDA-ARS?s Scientific Manuscript database

Genetic modification of alfalfa to introduce novel traits requires promoters for controlling gene expression. Promoters that are constitutively activated for expression of genes that enhance disease resistance pose a great energy load on the plant and exert a strong selective pressure on the pathoge...

An Ethylene-Induced Regulatory Module Delays Flower Senescence by Regulating Cytokinin Content.

PubMed

Wu, Lin; Ma, Nan; Jia, Yangchao; Zhang, Yi; Feng, Ming; Jiang, Cai-Zhong; Ma, Chao; Gao, Junping

2017-01-01

In many plant species, including rose (Rosa hybrida), flower senescence is promoted by the gaseous hormone ethylene and inhibited by the cytokinin (CTK) class of hormones. However, the molecular mechanisms underlying these antagonistic effects are not well understood. In this study, we characterized the association between a pathogenesis-related PR-10 family gene from rose (RhPR10.1) and the hormonal regulation of flower senescence. Quantitative reverse transcription PCR analysis showed that RhPR10.1 was expressed at high levels during senescence in different floral organs, including petal, sepal, receptacle, stamen, and pistil, and that expression was induced by ethylene treatment. Silencing of RhPR10.1 expression in rose plants by virus-induced gene silencing accelerated flower senescence, which was accompanied by a higher ion leakage rate in the petals, as well as increased expression of the senescence marker gene RhSAG12 CTK content and the expression of three CTK signaling pathway genes were reduced in RhPR10.1-silenced plants, and the accelerated rate of petal senescence that was apparent in the RhPR10.1-silenced plants was restored to normal levels by CTK treatment. Finally, RhHB6, a homeodomain-Leu zipper I transcription factor, was observed to bind to the RhPR10.1 promoter, and silencing of its expression also promoted flower senescence. Our results reveal an ethylene-induced RhHB6-RhPR10.1 regulatory module that functions as a brake of ethylene-promoted senescence through increasing the CTK content. © 2017 American Society of Plant Biologists. All Rights Reserved.

The Novel Gene VpPR4-1 from Vitis pseudoreticulata Increases Powdery Mildew Resistance in Transgenic Vitis vinifera L.

PubMed Central

Dai, Lingmin; Wang, Dan; Xie, Xiaoqing; Zhang, Chaohong; Wang, Xiping; Xu, Yan; Wang, Yuejin; Zhang, Jianxia

2016-01-01

Pathogenesis-related proteins (PRs) can lead to increased resistance of the whole plant to pathogen attack. Here, we isolate and characterize a PR-4 protein (VpPR4-1) from a wild Chinese grape Vitis pseudoreticulata which shows greatly elevated transcription following powdery mildew infection. Its expression profiles under a number of abiotic stresses were also investigated. Powdery mildew, salicylic acid, and jasmonic acid methyl ester significantly increased the VpPR4-1 induction while NaCl and heat treatments just slightly induced VpPR4-1 expression. Abscisic acid and cold treatment slightly affected the expression level of VpPR4-1. The VpPR4-1 gene was overexpressed in 30 regenerated V. vinifera cv. Red Globe via Agrobacterium tumefaciens-mediated transformation and verified by the Western blot. The 26 transgenic grapevines exhibited higher expression levels of PR-4 protein content than wild-type vines and six of them were inoculated with powdery mildew which showed that the growth of powdery mildew was repressed. The powdery mildew-resistance of Red Globe transformed with VpPR4-1 was enhanced inoculated with powdery mildew. Moreover, other powdery mildew resistant genes were associated with feedback regulation since VpPR4-1 is in abundance. This study demonstrates that PR-4 protein in grapes plays a vital role in defense against powdery mildew invasion. PMID:27303413

The Novel Gene VpPR4-1 from Vitis pseudoreticulata Increases Powdery Mildew Resistance in Transgenic Vitis vinifera L.

PubMed

Dai, Lingmin; Wang, Dan; Xie, Xiaoqing; Zhang, Chaohong; Wang, Xiping; Xu, Yan; Wang, Yuejin; Zhang, Jianxia

2016-01-01

Pathogenesis-related proteins (PRs) can lead to increased resistance of the whole plant to pathogen attack. Here, we isolate and characterize a PR-4 protein (VpPR4-1) from a wild Chinese grape Vitis pseudoreticulata which shows greatly elevated transcription following powdery mildew infection. Its expression profiles under a number of abiotic stresses were also investigated. Powdery mildew, salicylic acid, and jasmonic acid methyl ester significantly increased the VpPR4-1 induction while NaCl and heat treatments just slightly induced VpPR4-1 expression. Abscisic acid and cold treatment slightly affected the expression level of VpPR4-1. The VpPR4-1 gene was overexpressed in 30 regenerated V. vinifera cv. Red Globe via Agrobacterium tumefaciens-mediated transformation and verified by the Western blot. The 26 transgenic grapevines exhibited higher expression levels of PR-4 protein content than wild-type vines and six of them were inoculated with powdery mildew which showed that the growth of powdery mildew was repressed. The powdery mildew-resistance of Red Globe transformed with VpPR4-1 was enhanced inoculated with powdery mildew. Moreover, other powdery mildew resistant genes were associated with feedback regulation since VpPR4-1 is in abundance. This study demonstrates that PR-4 protein in grapes plays a vital role in defense against powdery mildew invasion.

Transcription of PR3 and Related Myelopoiesis Genes in Peripheral Blood Mononuclear Cells in Active Wegener's Granulomatosis

PubMed Central

Cheadle, Chris; Berger, Alan E.; Andrade, Felipe; James, Regina; Johnson, Kristen; Watkins, Tonya; Park, Jin Kyun; Chen, Yu-Chi; Ehrlich, Eva; Mullins, Marissa; Chrest, Francis; Barnes, Kathleen C.; Levine, Stuart M.

2010-01-01

Objective Wegener's granulomatosis (WG) is a systemic inflammatory disease causing substantial morbidity. This study seeks to understand the biology underlying WG, and to discover markers of disease activity useful in prognosis and treatment guidance. Methods Gene expression profiling was performed using total RNA from PBMC and granulocyte fractions from 41 WG patients and 23 healthy controls. Gene set enrichment analysis (GSEA) was performed to search for candidate WG-associated molecular pathways and disease activity biomarkers. Principal component analysis (PCA) was used to visualize relationships between subgroups of WG patients and controls. Longitudinal changes in PR3 expression were evaluated using RT-PCR, and clinical outcomes including remission status and disease activity were determined using the BVAS-WG. Results We identified 86 genes significantly up-regulated in WG PBMCs and 40 in WG PMNs relative to controls. Genes up-regulated in WG PBMCs were involved in myeloid differentiation, and included the WG autoantigen, PR3. The coordinated regulation of myeloid differentiation genes was confirmed by gene set analysis. Median expression values of the 86 WG PBMC genes were associated with disease activity (p=1.3 × 10−4), and patients expressing these genes at a lower level were only modestly different from healthy controls (p=0.07). PR3 transcription was significantly up-regulated in the PBMCs (p=1.3 ×10−5, FDR=0.002), but not in the PMNs (p=0.03, FDR=0.28) of WG patients, and changes in BVAS-WG tracked with PBMC PR3 RNA levels in a preliminary longitudinal analysis. Conclusion Transcription of PR3 and related myeloid differentiation genes in PBMCs may represent novel markers of disease activity in WG. PMID:20155833

Active FOXO1 is a Key Determinant of Isoform-Specific Progesterone Receptor Transactivation and Senescence Programming

PubMed Central

Diep, Caroline H.; Knutson, Todd P.; Lange, Carol A.

2015-01-01

Progesterone promotes differentiation coupled to proliferation and pro-survival in the breast, but inhibits estrogen-driven growth in the reproductive tract and ovaries. Herein, it is demonstrated, using progesterone receptor (PR) isoform-specific ovarian cancer model systems, that PR-A and PR-B promote distinct gene expression profiles that differ from PR-driven genes in breast cancer cells. In ovarian cancer models, PR-A primarily regulates genes independently of progestin, while PR-B is the dominant ligand-dependent isoform. Notably, FOXO1 and the PR/FOXO1 target-gene p21 (CDKN1A) are repressed by PR-A, but induced by PR-B. In the presence of progestin, PR-B, but not PR-A, robustly induced cellular senescence via FOXO1-dependent induction of p21 and p15 (CDKN2B). Chromatin immunoprecipitation (ChIP) assays performed on PR-isoform specific cells demonstrated that while each isoform is recruited to the same PRE-containing region of the p21 promoter in response to progestin, only PR-B elicits active chromatin marks. Overexpression of constitutively active FOXO1 in PR-A-expressing cells conferred robust ligand-dependent upregulation of the PR-B target genes GZMA, IGFBP1, and p21, and induced cellular senescence. In the presence of endogenous active FOXO1, PR-A was phosphorylated on Ser294 and transactivated PR-B at PR-B target genes; these events were blocked by the FOXO1 inhibitor (AS1842856). PR isoform-specific regulation of the FOXO1/p21 axis recapitulated in human primary ovarian tumor explants treated with progestin; loss of progestin sensitivity correlated with high AKT activity. PMID:26577046

Functional genomics identifies regulators of the phototransduction machinery in the Drosophila larval eye and adult ocelli.

PubMed

Mishra, Abhishek Kumar; Bargmann, Bastiaan O R; Tsachaki, Maria; Fritsch, Cornelia; Sprecher, Simon G

2016-02-15

Sensory perception of light is mediated by specialized Photoreceptor neurons (PRs) in the eye. During development all PRs are genetically determined to express a specific Rhodopsin (Rh) gene and genes mediating a functional phototransduction pathway. While the genetic and molecular mechanisms of PR development is well described in the adult compound eye, it remains unclear how the expression of Rhodopsins and the phototransduction cascade is regulated in other visual organs in Drosophila, such as the larval eye and adult ocelli. Using transcriptome analysis of larval PR-subtypes and ocellar PRs we identify and study new regulators required during PR differentiation or necessary for the expression of specific signaling molecules of the functional phototransduction pathway. We found that the transcription factor Krüppel (Kr) is enriched in the larval eye and controls PR differentiation by promoting Rh5 and Rh6 expression. We also identified Camta, Lola, Dve and Hazy as key genes acting during ocellar PR differentiation. Further we show that these transcriptional regulators control gene expression of the phototransduction cascade in both larval eye and adult ocelli. Our results show that PR cell type-specific transcriptome profiling is a powerful tool to identify key transcriptional regulators involved during several aspects of PR development and differentiation. Our findings greatly contribute to the understanding of how combinatorial action of key transcriptional regulators control PR development and the regulation of a functional phototransduction pathway in both larval eye and adult ocelli. Copyright © 2015 Elsevier Inc. All rights reserved.

Expression and Functional Characterization of two Pathogenesis-Related Protein 10 Genes from Zea mays

USDA-ARS?s Scientific Manuscript database

Pathogenesis-related protein 10 (PR10) is one of seventeen PR protein families and plays important roles in plant response to biotic and abiotic stresses. A novel PR10 gene (ZmPR10.1), which shares 89.8% and 85.7% identity to the previous ZmPR10 at the nucleotide and amino acid sequence level, respe...

Theobroma cacao L. pathogenesis-related gene tandem array members show diverse expression dynamics in response to pathogen colonization.

PubMed

Fister, Andrew S; Mejia, Luis C; Zhang, Yufan; Herre, Edward Allen; Maximova, Siela N; Guiltinan, Mark J

2016-05-17

The pathogenesis-related (PR) group of proteins are operationally defined as polypeptides that increase in concentration in plant tissues upon contact with a pathogen. To date, 17 classes of highly divergent proteins have been described that act through multiple mechanisms of pathogen resistance. Characterizing these families in cacao, an economically important tree crop, and comparing the families to those in other species, is an important step in understanding cacao's immune response. Using publically available resources, all members of the 17 recognized pathogenesis-related gene families in the genome of Theobroma cacao were identified and annotated resulting in a set of ~350 members in both published cacao genomes. Approximately 50 % of these genes are organized in tandem arrays scattered throughout the genome. This feature was observed in five additional plant taxa (three dicots and two monocots), suggesting that tandem duplication has played an important role in the evolution of the PR genes in higher plants. Expression profiling captured the dynamics and complexity of PR genes expression at basal levels and after induction by two cacao pathogens (the oomycete, Phytophthora palmivora, and the fungus, Colletotrichum theobromicola), identifying specific genes within families that are more responsive to pathogen challenge. Subsequent qRT-PCR validated the induction of several PR-1, PR-3, PR-4, and PR-10 family members, with greater than 1000 fold induction detected for specific genes. We describe candidate genes that are likely to be involved in cacao's defense against Phytophthora and Colletotrichum infection and could be potentially useful for marker-assisted selection for breeding of disease resistant cacao varieties. The data presented here, along with existing cacao-omics resources, will enable targeted functional genetic screening of defense genes likely to play critical functions in cacao's defense against its pathogens.

Progesterone Receptor Scaffolding Function in Breast Cancer

DTIC Science & Technology

2010-10-28

regulated (BIRC3, HSD11β2, and HbEGF ) expression. We conclude that phospho-Ser81 PR provides a platform for ck2 recruitment and regulation of selected PR...of a subset of PR target genes known to be involved in cell growth and prevention of apoptosis, including BIRC3, HSD11β2 and HbEGF (Appendix A, Fig...genes by PR-B also required Ser81 phosphorylation for basal and/or progestin-regulated (BIRC3, HSD11β2, and HbEGF ) expression. We conclude that phospho

Md-miR156ab and Md-miR395 Target WRKY Transcription Factors to Influence Apple Resistance to Leaf Spot Disease.

PubMed

Zhang, Qiulei; Li, Yang; Zhang, Yi; Wu, Chuanbao; Wang, Shengnan; Hao, Li; Wang, Shengyuan; Li, Tianzhong

2017-01-01

MicroRNAs (miRNAs) are key regulators of gene expression that post-transcriptionally regulate transcription factors involved in plant physiological activities. Little is known about the effects of miRNAs in disease resistance in apple ( Malus × domestica ). We globally profiled miRNAs in the apple cultivar Golden Delicious (GD) infected or not with the apple leaf spot fungus Alternaria alternaria f. sp. mali (ALT1), and identified 58 miRNAs that exhibited more than a 2-fold upregulation upon ALT1 infection. We identified a pair of miRNAs that target protein-coding genes involved in the defense response against fungal pathogens; Md-miR156ab targets a novel WRKY transcription factor, MdWRKYN1, which harbors a TIR and a WRKY domain. Md-miR395 targets another transcription factor, MdWRKY26, which contains two WRKY domains. Real-time PCR analysis showed that Md-miR156ab and Md-miR395 levels increased, while MdWRKYN1 and MdWRKY26 expression decreased in ALT1-inoculated GD leaves; furthermore, the overexpression of Md-miR156ab and Md-miR395 resulted in a significant reduction in MdWRKYN1 and MdWRKY26 expression. To investigate whether these miRNAs and their targets play a crucial role in plant defense, we overexpressed MdWRKYN1 or knocked down Md-miR156ab activity, which in both cases enhanced the disease resistance of the plants by upregulating the expression of the WRKY-regulated pathogenesis-related (PR) protein-encoding genes MdPR3-1, MdPR3-2, MdPR4, MdPR5, MdPR10-1 , and MdPR10-2 . In a similar analysis, we overexpressed MdWRKY26 or suppressed Md-miR395 activity, and found that many PR protein-encoding genes were also regulated by MdWRKY26 . In GD, ALT-induced Md-miR156ab and Md-miR395 suppress MdWRKYN1 and MdWRKY26 expression, thereby decreasing the expression of some PR genes, and resulting in susceptibility to ALT1.

An Acidic PATHOGENESIS-RELATED1 Gene of Oryza grandiglumis is Involved in Disease Resistance Response Against Bacterial Infection

PubMed Central

Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo

2014-01-01

Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005

Cloning and expression analysis of FaPR-1 gene in strawberry

NASA Astrophysics Data System (ADS)

Mo, Fan; Luo, Ya; Ge, Cong; Mo, Qin; Ling, Yajie; Luo, Shu; Tang, Haoru

2018-04-01

The FaPR-1 gene was cloned by RT-PCR from `Benihoppe' strawberry and its bioinformatics analysis was conducted. The results showed that the open reading frame was 483 bp encoding encoding l60 amino acids which protein molecular weight and theoretical isoelectricity were 17854.17 and 8.72 respectively. Subcellular localization prediction shows that this gene is located extracellularly. By comparing strawberry FaPR-l and other plant Pathogenesis-related protein, homology and phylogenetic tree construction showed that the homology with grapes, peach is relatively close. In the treatments of ABA, sucrose and the mixture of the two, the expression of FaPR-1 in strawberry fruit were significantly increased.

The purple cauliflower arises from activation of a MYB transcription factor.

PubMed

Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L; Li, Li

2010-11-01

Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3'-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal.

The Purple Cauliflower Arises from Activation of a MYB Transcription Factor1[W][OA

PubMed Central

Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L.; Li, Li

2010-01-01

Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3’-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal. PMID:20855520

Thyme and Savory Essential Oil Efficacy and Induction of Resistance against Botrytis cinerea through Priming of Defense Responses in Apple

PubMed Central

Banani, Houda; Olivieri, Leone; Santoro, Karin; Garibaldi, Angelo; Gullino, Maria Lodovica

2018-01-01

The efficacy of thyme and savory essential oils were investigated against Botrytis cinerea on apple fruit. Apples treated with thyme and savory essential oils showed significantly lower gray mold severity and incidence. Thyme essential oil at 1% concentration showed the highest efficacy, with lower disease incidence and smaller lesion diameter. The expression of specific pathogenesis-related (PR) genes PR-8 and PR-5 was characterized in apple tissues in response to thyme oil application and B. cinerea inoculation. After 6 h of pathogen inoculation, thyme essential oil induced a 2.5-fold increase of PR-8 gene expression compared to inoculated fruits. After 24 h of inoculation, PR-8 was highly induced (7-fold) in both thyme oil-treated and untreated apples inoculated with B. cinerea. After 48 h of inoculation, PR-8 expression in thyme-treated and inoculated apples was 4- and 6-fold higher than in inoculated and water-treated apples. Neither thyme oil application nor B. cinerea inoculation markedly affected PR-5 expression. These results suggest that thyme oil induces resistance against B. cinerea through the priming of defense responses in apple fruit, and the PR-8 gene of apple may play a key role in the mechanism by which thyme essential oil effectively inhibits gray mold in apple fruit. PMID:29360731

Thyme and Savory Essential Oil Efficacy and Induction of Resistance against Botrytis cinerea through Priming of Defense Responses in Apple.

PubMed

Banani, Houda; Olivieri, Leone; Santoro, Karin; Garibaldi, Angelo; Gullino, Maria Lodovica; Spadaro, Davide

2018-01-23

The efficacy of thyme and savory essential oils were investigated against Botrytis cinerea on apple fruit. Apples treated with thyme and savory essential oils showed significantly lower gray mold severity and incidence. Thyme essential oil at 1% concentration showed the highest efficacy, with lower disease incidence and smaller lesion diameter. The expression of specific pathogenesis-related (PR) genes PR-8 and PR-5 was characterized in apple tissues in response to thyme oil application and B. cinerea inoculation. After 6 h of pathogen inoculation, thyme essential oil induced a 2.5-fold increase of PR-8 gene expression compared to inoculated fruits. After 24 h of inoculation, PR-8 was highly induced (7-fold) in both thyme oil-treated and untreated apples inoculated with B. cinerea . After 48 h of inoculation, PR-8 expression in thyme-treated and inoculated apples was 4- and 6-fold higher than in inoculated and water-treated apples. Neither thyme oil application nor B. cinerea inoculation markedly affected PR-5 expression. These results suggest that thyme oil induces resistance against B. cinerea through the priming of defense responses in apple fruit, and the PR-8 gene of apple may play a key role in the mechanism by which thyme essential oil effectively inhibits gray mold in apple fruit.

Diversity in genomic organisation, developmental regulation and distribution of the murine PR72/B" subunits of protein phosphatase 2A

PubMed Central

Zwaenepoel, Karen; Louis, Justin V; Goris, Jozef; Janssens, Veerle

2008-01-01

Background Protein phosphatase 2A (PP2A) is a serine/threonine-specific phosphatase displaying vital functions in growth and development through its role in various signalling pathways. PP2A holoenzymes comprise a core dimer composed of a catalytic C and a structural A subunit, which can associate with a variable B-type subunit. The importance of the B-type subunits for PP2A regulation cannot be overestimated as they determine holoenzyme localisation, activity and substrate specificity. Three B-type subunit families have been identified: PR55/B, PR61/B' and PR72/B", of which the latter is currently the least characterised. Results We deduced the sequences and genomic organisation of the different murine PR72/B" isoforms: three genes encode nine isoforms, five of which are abundantly expressed and give rise to genuine PP2A subunits. Thereby, one novel subunit was identified. Using Northern blotting, we examined the tissue-specific and developmental expression of these subunits. All subunits are highly expressed in heart, suggesting an important cardiac function. Immunohistochemical analysis revealed a striated expression pattern of PR72 and PR130 in heart and skeletal muscle, but not in bladder smooth muscle. The subcellular localisation and cell cycle regulatory ability of several PR72/B" isoforms were determined, demonstrating differences as well as similarities. Conclusion In contrast to PR55/B and PR61/B', the PR72/B" family seems evolutionary more divergent, as only two of the murine genes have a human orthologue. We have integrated these results in a more consistent nomenclature of both human and murine PR72/B" genes and their transcripts/proteins. Our results provide a platform for the future generation of PR72/B" knockout mice. PMID:18715506

Gene and protein expression of oestrogen-β and progesterone receptors in facial melasma and adjacent healthy skin in women.

PubMed

Tamega, A de A; Miot, H A; Moço, N P; Silva, M G; Marques, M E A; Miot, L D B

2015-04-01

Compare gene and protein expression for oestrogen receptor-β (ER-β) and progesterone receptor (PR) in facial melasma and adjacent healthy skin. A cross-sectional study including 42 women with facial melasma, conducted at the Dermatology Service of Botucatu Medical School of São Paulo State University, Brazil. Biopsies of the melasma skin were performed, together with healthy surrounding skin. The gene expression (real-time PCR) of the hormone receptors in the tissue was evaluated. Subsequently, skin fragments were immunostained for nuclear ER-β and PR, evaluated according to their HSCORE (epidermis) and percentage of staining per microscopic field (dermis). Messenger RNA tissue expression for ER-β and PR showed no difference between melasma-affected skin fragments and the healthy perilesional areas (P > 0.2). Median nuclear epithelial expression for ER-β and PR was higher in lesioned skin (HSCORE 157 and 58) than in the healthy perilesional skin (HSCORE 97 and 19; P < 0.01), with no difference in dermal immunostaining. Nuclear histological expression for ER-β was associated to sun-induced melasma and negative familiar background; PR expression was associated to sun-induced melasma and darker phototypes. No difference was observed in gene expression for oestrogen-β and progesterone receptors in melasma-affected skin compared with adjacent healthy skin. However, the higher protein expression of these receptors in melasma-affected epithelia suggests hormonal participation in the pathogenesis of this disease. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

A PR-4 gene identified from Malus domestica is involved in the defense responses against Botryosphaeria dothidea.

PubMed

Bai, Suhua; Dong, Chaohua; Li, Baohua; Dai, Hongyi

2013-01-01

Pathogenesis-related protein-4 (PR-4) family is a group of proteins with a Barwin domain in C-terminus and generally thought to be involved in plant defense responses. However, their detailed roles are poorly understood in defense of apple plant against pathogenic infection. In the present study, a new PR-4 gene (designated as MdPR-4) was identified from Malus domestica, and its roles in defense responses of apple were investigated. The open reading frame of MdPR-4 gene is of 447 bp encoding a protein of 148 amino acids with a Barwin domain in C-terminus and a signal peptide of 26 amino acids in N-terminus. Sequence and structural analysis indicated that MdPR-4 protein belongs to class II of PR-4 family. The high-level expression of MdPR-4 was observed in flowers and leaves as revealed by quantitative real time PCR. The temporal expression analysis demonstrated that MdPR-4 expression could be up-regulated by Botryosphaeria dothidea infection and salicylic acid (SA) or methyl jasmonate (MeJA) treatment, but suppressed by diethyldithiocarbamic acid (DIECA). In vitro assays, recombinant MdPR-4 protein exhibited ribonuclease activity specific for single strand RNA and significant inhibition to hyphal growth of three apple pathogenic fungi B. dothidea, Valsa ceratosperma and Glomerella cingulata. Moreover, the inhibition was reduced by the presence of 5'-ADP. Taken all together, the results indicate that MdPR-4 protein is involved in the defense responses of apple against pathogenic attack by directly inhibiting hyphal growth, and the inhibition is correlated with its ribonuclease activity, where as MdPR-4 expression is regulated by both SA and JA signaling pathway. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Modulation of Progesterone Receptor Isoform Expression in Pregnant Human Myometrium

PubMed Central

2017-01-01

Background. Regulation of myometrial progesterone receptor (PR) expression is an unresolved issue central to understanding the mechanism of functional progesterone withdrawal and initiation of labor in women. Objectives. To determine whether pregnant human myometrium undergoes culture-induced changes in PR isoform expression ex situ and, further, to determine if conditions approaching the in vivo environment stabilise PR isoform expression in culture. Methods. Term nonlaboring human myometrial tissues were cultured under specific conditions: serum supplementation, steroids, stretch, cAMP, PMA, PGF2α, NF-κB inhibitors, or TSA. Following 48 h culture, PR-T, PR-A, and PR-B mRNA levels were determined using qRT-PCR. PR-A/PR-B ratios were calculated. Results. PR-T and PR-A expression and the PR-A/PR-B ratio significantly increased in culture. Steroids prevented the culture-induced increase in PR-T and PR-A expression. Stretch blocked the effects of steroids on PR-T and PR-A expression. PMA further increased the PR-A/PR-B ratio, while TSA blocked culture-induced increases of PR-A expression and the PR-A/PR-B ratio. Conclusion. Human myometrial tissue in culture undergoes changes in PR gene expression consistent with transition toward a laboring phenotype. TSA maintained the nonlaboring PR isoform expression pattern. This suggests that preserving histone and/or nonhistone protein acetylation is critical for maintaining the progesterone dependent quiescent phenotype of human myometrium in culture. PMID:28540297

Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

Treesearch

Caroline M. Press; Niklaus J. Grunwald

2008-01-01

The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

Global gene expression analysis of transgenic, mannitol-producing, and salt-tolerant Arabidopsis thaliana indicates widespread changes in abiotic and biotic stress-related genes

PubMed Central

Chan, Zhulong; Grumet, Rebecca; Loescher, Wayne

2011-01-01

Mannitol is a putative osmoprotectant contributing to salt tolerance in several species. Arabidopsis plants transformed with the mannose-6-phosphate reductase (M6PR) gene from celery were dramatically more salt tolerant (at 100 mM NaCl) as exhibited by reduced salt injury, less inhibition of vegetative growth, and increased seed production relative to the wild type (WT). When treated with 200 mM NaCl, transformants produced no seeds, but did bolt, and exhibited less chlorosis/necrosis and greater survival and dry weights than the WT. Without salt there were no M6PR effects on growth or phenotype, but expression levels of 2272 genes were altered. Many fewer differences (1039) were observed between M6PR and WT plants in the presence of salt, suggesting that M6PR pre-conditioned the plants to stress. Previous work suggested that mannitol is an osmoprotectant, but mannitol levels are invariably quite low, perhaps inadequate for osmoprotectant effects. In this study, transcriptome analysis reveals that the M6PR transgene activated the downstream abscisic acid (ABA) pathway by up-regulation of ABA receptor genes (PYL4, PYL5, and PYL6) and down-regulation of protein phosphatase 2C genes (ABI1 and ABI2). In the M6PR transgenic lines there were also increases in transcripts related to redox and cell wall-strengthening pathways. These data indicate that mannitol-enhanced stress tolerance is due at least in part to increased expression of a variety of stress-inducible genes. PMID:21821598

Blood pathway analyses reveal differences between prediabetic subjects with or without dyslipidaemia. The Cardiovascular Risk in Young Finns Study.

PubMed

Laaksonen, Jaakko; Taipale, Tuukka; Seppälä, Ilkka; Raitoharju, Emma; Mononen, Nina; Lyytikäinen, Leo-Pekka; Waldenberger, Melanie; Illig, Thomas; Hutri-Kähönen, Nina; Rönnemaa, Tapani; Juonala, Markus; Viikari, Jorma; Kähönen, Mika; Raitakari, Olli; Lehtimäki, Terho

2017-10-01

Prediabetes often occurs together with dyslipidaemia, which is paradoxically treated with statins predisposing to type 2 diabetes mellitus. We examined peripheral blood pathway profiles in prediabetic subjects with (PR D ) and without dyslipidaemia (PR 0 ) and compared these to nonprediabetic controls without dyslipidaemia (C 0 ). The participants were from the Cardiovascular Risk in Young Finns Study, including 1240 subjects aged 34 to 49 years. Genome-wide expression data of peripheral blood and gene set enrichment analysis were used to investigate the differentially expressed genes and enriched pathways between different subtypes of prediabetes. Pathways for cholesterol synthesis, interleukin-12-mediated signalling events, and downstream signalling in naïve CD8+ T-cells were upregulated in the PR 0 group in comparison with controls (C 0 ). The upregulation of these pathways was independent of waist circumference, blood pressure, smoking status, and insulin. Adjustment for CRP left the CD8+ T-cell signalling and interleukin-12-mediated signalling event pathway upregulated. The cholesterol synthesis pathway was also upregulated when all prediabetic subjects (PR 0 and PR D ) were compared with the nonprediabetic control group. No pathways were upregulated or downregulated when the PR D group was compared with the C 0 group. Five genes in the PR 0 group and 1 in the PR D group were significantly differentially expressed in comparison with the C 0 group. Blood cell gene expression profiles differ significantly between prediabetic subjects with and without dyslipidaemia. Whether this classification may be used in detection of prediabetic individuals at a high risk of cardiovascular complications remains to be examined. Copyright © 2017 John Wiley & Sons, Ltd.

A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors.

PubMed

van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

2008-04-01

PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.

Stat3-induced S1PR1 expression is critical for persistent Stat3 activation in tumors

PubMed Central

Lee, Heehyoung; Deng, Jiehui; Kujawski, Maciej; Yang, Chunmei; Liu, Yong; Herrmann, Andreas; Kortylewski, Marcin; Horne, David; Somlo, George; Forman, Stephen; Jove, Richard; Yu, Hua

2011-01-01

IL-6/Jak2 signaling is viewed critical for persistent Stat3 activation in cancer. However, IL-6-induced Stat3 activity is transient in normal physiology. Here we identify a mechanism important for persistent Stat3 activation in tumor cells and the tumor microenvironment. We show that sphingosine-1-phosphate receptor 1 (S1PR1), a G-protein-coupled receptor for lysophospholipid sphingosine-1-phosphate (S1P), is elevated in Stat3-positive tumors. Stat3 is a transcription factor for the S1pr1 gene. Enhanced S1pr1 expression activates Stat3 and upregulates Il6 gene expression, thereby accelerating tumor growth and metastasis. Conversely, silencing S1pr1 in tumor cells or immune cells inhibits tumor Stat3 activity, tumor growth and metastasis. S1P/S1PR1-induced Stat3 activation is persistent, in contrast to transient Stat3 activation by IL-6. S1PR1 activates Stat3 in part by upregulating Jak2 tyrosine kinase activity. We demonstrate that Stat3-induced S1pr1 expression, as well as S1P/S1PR1 pathway, is important for persistent Stat3 activation in cancer cells and the tumor microenvironment and for malignant progression. PMID:21102457

Characterization of Withania somnifera Leaf Transcriptome and Expression Analysis of Pathogenesis – Related Genes during Salicylic Acid Signaling

PubMed Central

Ghosh Dasgupta, Modhumita; George, Blessan Santhosh; Bhatia, Anil; Sidhu, Om Prakash

2014-01-01

Withania somnifera (L.) Dunal is a valued medicinal plant with pharmaceutical applications. The present study was undertaken to analyze the salicylic acid induced leaf transcriptome of W. somnifera. A total of 45.6 million reads were generated and the de novo assembly yielded 73,523 transcript contig with average transcript contig length of 1620 bp. A total of 71,062 transcripts were annotated and 53,424 of them were assigned GO terms. Mapping of transcript contigs to biological pathways revealed presence of 182 pathways. Seventeen genes representing 12 pathogenesis-related (PR) families were mined from the transcriptome data and their pattern of expression post 17 and 36 hours of salicylic acid treatment was documented. The analysis revealed significant up-regulation of all families of PR genes by 36 hours post treatment except WsPR10. The relative fold expression of transcripts ranged from 1 fold to 6,532 fold. The two families of peroxidases including the lignin-forming anionic peroxidase (WsL-PRX) and suberization-associated anionic peroxidase (WsS-PRX) recorded maximum expression of 377 fold and 6532 fold respectively, while the expression of WsPR10 was down-regulated by 14 fold. Additionally, the most stable reference gene for normalization of qRT-PCR data was also identified. The effect of SA on the accumulation of major secondary metabolites of W. somnifera including withanoside V, withaferin A and withanolide A was also analyzed and an increase in content of all the three metabolites were detected. This is the first report on expression patterns of PR genes during salicylic acid signaling in W. somnifera. PMID:24739900

Induction of salicylic acid-mediated defense response in perennial ryegrass against infection by Magnaporthe oryzae.

PubMed

Rahman, Alamgir; Kuldau, Gretchen A; Uddin, Wakar

2014-06-01

Incorporation of plant defense activators is an innovative approach to development of an integrated strategy for the management of turfgrass diseases. The effects of salicylic acid (SA), benzothiadiazole (BTH, chemical analog of SA), jasmonic acid (JA), and ethephon (ET, an ethylene-releasing compound) on development of gray leaf spot in perennial ryegrass (Lolium perenne L.) caused by Magnaporthe oryzae were evaluated. Gray leaf spot disease incidence and severity were significantly decreased when plants were treated prior to inoculation with SA, BTH, and partially by ET but not by JA. Accumulation of endogenous SA and elevated expression of pathogenesis-related (PR)-1, PR-3.1, and PR-5 genes were associated with inoculation of plants by M. oryzae. Treatment of plants with SA enhanced expression levels of PR-3.1 and PR-5 but did not affect the PR-1 level, whereas BTH treatment enhanced relative expression levels of all three PR genes. Microscopic observations of leaves inoculated with M. oryzae revealed higher frequencies of callose deposition at the penetration sites in SA- and BTH-treated plants compared with the control plants (treated with water). These results suggest that early and higher induction of these genes by systemic resistance inducers may provide perennial ryegrass with a substantial advantage to defend against infection by M. oryzae.

PrP(C) regulates epidermal growth factor receptor function and cell shape dynamics in Neuro2a cells.

PubMed

Llorens, Franc; Carulla, Patricia; Villa, Ana; Torres, Juan M; Fortes, Puri; Ferrer, Isidre; del Río, José A

2013-10-01

The prion protein (PrP) plays a key role in prion disease pathogenesis. Although the misfolded and pathologic variant of this protein (PrP(SC)) has been studied in depth, the physiological role of PrP(C) remains elusive and controversial. PrP(C) is a cell-surface glycoprotein involved in multiple cellular functions at the plasma membrane, where it interacts with a myriad of partners and regulates several intracellular signal transduction cascades. However, little is known about the gene expression changes modulated by PrP(C) in animals and in cellular models. In this article, we present PrP(C)-dependent gene expression signature in N2a cells and its implication in the most overrepresented functions: cell cycle, cell growth and proliferation, and maintenance of cell shape. PrP(C) over-expression enhances cell proliferation and cell cycle re-entrance after serum stimulation, while PrP(C) silencing slows down cell cycle progression. In addition, MAP kinase and protein kinase B (AKT) pathway activation are under the regulation of PrP(C) in asynchronous cells and following mitogenic stimulation. These effects are due in part to the modulation of epidermal growth factor receptor (EGFR) by PrP(C) in the plasma membrane, where the two proteins interact in a multimeric complex. We also describe how PrP(C) over-expression modulates filopodia formation by Rho GTPase regulation mainly in an AKT-Cdc42-N-WASP-dependent pathway. © 2013 International Society for Neurochemistry.

Pepper pathogenesis-related protein 4c is a plasma membrane-localized cysteine protease inhibitor that is required for plant cell death and defense signaling.

PubMed

Kim, Nak Hyun; Hwang, Byung Kook

2015-01-01

Xanthomonas campestris pv. vesicatoria (Xcv) type III effector AvrBsT triggers programmed cell death (PCD) and activates the hypersensitive response (HR) in plants. Here, we isolated and identified the plasma membrane localized pathogenesis-related (PR) protein 4c gene (CaPR4c) from pepper (Capsicum annuum) leaves undergoing AvrBsT-triggered HR cell death. CaPR4c encodes a protein with a signal peptide and a Barwin domain. Recombinant CaPR4c protein expressed in Escherichia coli exhibited cysteine protease-inhibitor activity and ribonuclease (RNase) activity. Subcellular localization analyses revealed that CaPR4c localized to the plasma membrane in plant cells. CaPR4c expression was rapidly and specifically induced by avirulent Xcv (avrBsT) infection. Transient expression of CaPR4c caused HR cell death in pepper leaves, which was accompanied by enhanced accumulation of H2 O2 and significant induction of some defense-response genes. Deletion of the signal peptide from CaPR4c abolished the induction of HR cell death, indicating a requirement for plasma membrane localization of CaPR4c for HR cell death. CaPR4c silencing in pepper disrupted both basal and AvrBsT-triggered resistance responses, and enabled Xcv proliferation in infected leaves. H2 O2 accumulation, cell-death induction, and defense-response gene expression were distinctly reduced in CaPR4c-silenced pepper. CaPR4c overexpression in transgenic Arabidopsis plants conferred greater resistance against infection by Pseudomonas syringae pv. tomato and Hyaloperonospora arabidopsidis. These results collectively suggest that CaPR4c plays an important role in plant cell death and defense signaling. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Divergent prion strain evolution driven by PrPC expression level in transgenic mice

PubMed Central

Le Dur, Annick; Laï, Thanh Lan; Stinnakre, Marie-George; Laisné, Aude; Chenais, Nathalie; Rakotobe, Sabine; Passet, Bruno; Reine, Fabienne; Soulier, Solange; Herzog, Laetitia; Tilly, Gaëlle; Rézaei, Human; Béringue, Vincent; Vilotte, Jean-Luc; Laude, Hubert

2017-01-01

Prions induce a fatal neurodegenerative disease in infected host brain based on the refolding and aggregation of the host-encoded prion protein PrPC into PrPSc. Structurally distinct PrPSc conformers can give rise to multiple prion strains. Constrained interactions between PrPC and different PrPSc strains can in turn lead to certain PrPSc (sub)populations being selected for cross-species transmission, or even produce mutation-like events. By contrast, prion strains are generally conserved when transmitted within the same species, or to transgenic mice expressing homologous PrPC. Here, we compare the strain properties of a representative sheep scrapie isolate transmitted to a panel of transgenic mouse lines expressing varying levels of homologous PrPC. While breeding true in mice expressing PrPC at near physiological levels, scrapie prions evolve consistently towards different strain components in mice beyond a certain threshold of PrPC overexpression. Our results support the view that PrPC gene dosage can influence prion evolution on homotypic transmission. PMID:28112164

Nerve Growth Factor Increases mRNA Levels for the Prion Protein and the β -amyloid Protein Precursor in Developing Hamster Brain

NASA Astrophysics Data System (ADS)

Mobley, William C.; Neve, Rachael L.; Prusiner, Stanley B.; McKinley, Michael P.

1988-12-01

Deposition of amyloid filaments serves as a pathologic hallmark for some neurodegenerative disorders. The prion protein (PrP) is found in amyloid of animals with scrapie and humans with Creutzfeldt-Jakob disease; the β protein is present in amyloid deposits in Alzheimer disease and Down syndrome patients. These two proteins are derived from precursors that in the brain are expressed primarily in neurons and are membrane bound. We found that gene expression for PrP and the β -protein precursor (β -PP) is regulated in developing hamster brain. Specific brain regions showed distinct patterns of ontogenesis for PrP and β -PP mRNAs. The increases in PrP and β -PP mRNAs in developing basal forebrain coincided with an increase in choline acetyltransferase activity, raising the possibility that these markers might be coordinately controlled in cholinergic neurons and regulated by nerve growth factor (NGF). Injections of NGF into the brains of neonatal hamsters increased both PrP and β -PP mRNA levels. Increased PrP and β -PP mRNA levels induced by NGF were confined to regions that contain NGF-responsive cholinergic neurons and were accompanied by elevations in choline acetyltransferase. It remains to be established whether or not exogenous NGF acts to increase PrP and β -PP gene expression selectively in forebrain cholinergic neurons in the developing hamster and endogenous NGF regulates expression of these genes.

Progesterone receptor isoforms, agonists and antagonists differentially reprogram estrogen signaling

PubMed Central

Singhal, Hari; Greene, Marianne E.; Zarnke, Allison L.; Laine, Muriel; Al Abosy, Rose; Chang, Ya-Fang; Dembo, Anna G.; Schoenfelt, Kelly; Vadhi, Raga; Qiu, Xintao; Rao, Prakash; Santhamma, Bindu; Nair, Hareesh B.; Nickisch, Klaus J.; Long, Henry W.; Becker, Lev; Brown, Myles; Greene, Geoffrey L.

2018-01-01

Major roadblocks to developing effective progesterone receptor (PR)-targeted therapies in breast cancer include the lack of highly-specific PR modulators, a poor understanding of the pro- or anti-tumorigenic networks for PR isoforms and ligands, and an incomplete understanding of the cross talk between PR and estrogen receptor (ER) signaling. Through genomic analyses of xenografts treated with various clinically-relevant ER and PR-targeting drugs, we describe how the activation or inhibition of PR differentially reprograms estrogen signaling, resulting in the segregation of transcriptomes into separate PR agonist and antagonist-mediated groups. These findings address an ongoing controversy regarding the clinical utility of PR agonists and antagonists, alone or in combination with tamoxifen, for breast cancer management. Additionally, the two PR isoforms PRA and PRB, bind distinct but overlapping genomic sites and interact with different sets of co-regulators to differentially modulate estrogen signaling to be either pro- or anti-tumorigenic. Of the two isoforms, PRA inhibited gene expression and ER chromatin binding significantly more than PRB. Differential gene expression was observed in PRA and PRB-rich patient tumors and PRA-rich gene signatures had poorer survival outcomes. In support of antiprogestin responsiveness of PRA-rich tumors, gene signatures associated with PR antagonists, but not PR agonists, predicted better survival outcomes. The better patient survival associated with PR antagonists versus PR agonists treatments was further reflected in the higher in vivo anti-tumor activity of therapies that combine tamoxifen with PR antagonists and modulators. This study suggests that distinguishing common effects observed due to concomitant interaction of another receptor with its ligand (agonist or antagonist), from unique isoform and ligand-specific effects will inform the development of biomarkers for patient selection and translation of PR-targeted therapies to the clinic. PMID:29435103

Coexistence of the loss of heterozygosity at the PTEN locus and HER2 overexpression enhances the Akt activity thus leading to a negative progesterone receptor expression in breast carcinoma.

PubMed

Tokunaga, Eriko; Oki, Eiji; Kimura, Yasue; Yamanaka, Takeharu; Egashira, Akinori; Nishida, Kojiro; Koga, Tadashi; Morita, Masaru; Kakeji, Yoshihiro; Maehara, Yoshihiko

2007-03-01

Serine/threonine kinase Akt/PKB is known to regulate divergent cellular processes, including apoptosis, proliferation, differentiation, and metabolism. Akt is activated by a variety of stimuli, through such growth factor receptors as HER2, in phosphoinositide-3-OH kinase (PI3K)-dependent manner. A loss of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) function also activates Akt. It has recently been shown that Akt activation is associated with a worse outcome among endocrine treated breast cancer patients and that it also inhibits the progesterone receptor (PR) expression via the PI3K/Akt pathway in breast cancer cells. Therefore, the PI3K/Akt signaling pathway has recently attracted considerable attention as a new target for effective therapeutic strategies. In the present study, we investigated the relationship between Akt activation and either HER2 overexpression or PTEN gene alteration, as well as the PR expression. We analyzed the incidence of LOH at the PTEN locus in 138 breast cancer patients, using our new system for microsatellite analysis, called high-resolution fluorescent microsatellite analysis (HRFMA). We showed Akt activation to significantly correlate with HER2 overexpression or LOH at the PTEN gene locus while inversely correlating with the PR expression. In addition, when LOH at the PTEN gene locus and HER2 overexpression occurred simultaneously, the incidence of Akt activation and reduced PR expression was significant. The association between Akt activation and PR negative expression was observed even in the ER-positive cases. Our results suggest that simultaneous PTEN LOH and HER2 overexpression enhances Akt activation and may thus lead to a negative PR expression.

GmWRKY31 and GmHDL56 Enhances Resistance to Phytophthora sojae by Regulating Defense-Related Gene Expression in Soybean.

PubMed

Fan, Sujie; Dong, Lidong; Han, Dan; Zhang, Feng; Wu, Junjiang; Jiang, Liangyu; Cheng, Qun; Li, Rongpeng; Lu, Wencheng; Meng, Fanshan; Zhang, Shuzhen; Xu, Pengfei

2017-01-01

Phytophthora root and stem rot of soybean [ Glycine max (L.) Merr.] caused by the oomycete Phytophthora sojae , is a destructive disease worldwide. The molecular mechanism of the soybean response to P. sojae is largely unclear. We report a novel WRKY transcription factor (TF) in soybean, GmWRKY31, in the host response to P. sojae . Overexpression and RNA interference analysis demonstrated that GmWRKY31 enhanced resistance to P. sojae in transgenic soybean plants. GmWRKY31 was targeted to the nucleus, where it bound to the W-box and acted as an activator of gene transcription. Moreover, we determined that GmWRKY31 physically interacted with GmHDL56, which improved resistance to P. sojae in transgenic soybean roots. GmWRKY31 and GmHDL56 shared a common target GmNPR1 which was induced by P. sojae . Overexpression and RNA interference analysis demonstrated that GmNPR1 enhanced resistance to P. sojae in transgenic soybean plants. Several pathogenesis-related ( PR ) genes were constitutively activated, including GmPR1a , GmPR2 , GmPR3 , GmPR4 , GmPR5a , and GmPR10 , in soybean plants overexpressing GmNPR1 transcripts. By contrast, the induction of PR genes was compromised in transgenic GmNPR1 -RNAi lines. Taken together, these findings suggested that the interaction between GmWRKY31 and GmHDL56 enhances resistance to P. sojae by regulating defense-related gene expression in soybean.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Functional analysis of a pathogenesis-related thaumatin-like protein gene TaLr35PR5 from wheat induced by leaf rust fungus.

PubMed

Zhang, Jiarui; Wang, Fei; Liang, Fang; Zhang, Yanjun; Ma, Lisong; Wang, Haiyan; Liu, Daqun

2018-05-04

Plants have evolved multifaceted defence mechanisms to resist pathogen infection. Production of the pathogenesis-related (PR) proteins in response to pathogen attack has been implicated in plant disease resistance specialized in systemic-acquired resistance (SAR). Our earlier studies have reported that a full length TaLr35PR5 gene, encoding a protein exhibiting amino acid and structural similarity to a sweet protein thaumatin, was isolated from wheat near-isogenic line TcLr35. The present study aims to understand the function of TaLr35PR5 gene in Lr35-mediated adult resistance to Puccinia triticina. We determined that the TaLr35PR5 protein contained a functional secretion peptide by utilizing the yeast signal sequence trap system. Using a heterologous expression assay on onion epidermal cells we found that TaLr35PR5 protein was secreted into the apoplast of onion cell. Expression of TaLr35PR5 was significantly reduced in BSMV-induced gene silenced wheat plants, and pathology test on these silenced plants revealed that Lr35-mediated resistance phenotype was obviously altered, indicating that Lr35-mediated resistance was compromised. All these findings strongly suggest that TaLr35PR5 is involved in Lr35-mediated adult wheat defense in response to leaf rust attack.

Integrity of the LXXLL motif in Stat6 is required for the inhibition of breast cancer cell growth and enhancement of differentiation in the context of progesterone

PubMed Central

2014-01-01

Background Progesterone is essential for the proliferation and differentiation of mammary gland epithelium. Studies of breast cancer cells have demonstrated a biphasic progesterone response consisting of an initial proliferative burst followed by sustained growth arrest. However, the transcriptional factors acting with the progesterone receptor (PR) to mediate the effects of progesterone on mammary cell growth and differentiation remain to be determined. Recently, it was demonstrated that signal transducer and activator of transcription 6 (Stat6) is a cell growth suppressor. Similar to progesterone-bound PR, Stat6 acts by inducing the expression of the G1 cyclin-dependent kinase inhibitors p21 and p27. The possible interaction between Stat6 and progesterone pathways in mammary cells was therefore investigated in the present study. Methods ChIP and luciferase were assayed to determine whether Stat6 induces p21 and p27 expression by recruitment at the proximal Sp1-binding sites of the gene promoters. Immunoprecipitation and Western blotting were performed to investigate the interaction between Stat6 and PR-B. The cellular DNA content and cell cycle distribution in breast cancer cells were analyzed by FACS. Results We found that Stat6 interacts with progesterone-activated PR in T47D cells. Stat6 synergizes with progesterone-bound PR to transactivate the p21 and p27 gene promoters at the proximal Sp1-binding sites. Moreover, Stat6 overexpression and knockdown, respectively, increased or prevented the induction of p21 and p27 gene expression by progesterone. Stat6 knockdown also abolished the inhibitory effects of progesterone on pRB phosphorylation, G1/S cell cycle progression, and cell proliferation. In addition, knockdown of Stat6 expression prevented the induction of breast cell differentiation markers, previously identified as progesterone target genes. Finally, Stat6 gene expression levels increased following progesterone treatment, indicating a positive auto-regulatory loop between PR and Stat6. Conclusions Taken together, these data identify Stat6 as a coactivator of PR mediating the growth-inhibitory and differentiation effects of progesterone on breast cancer cells. PMID:24401087

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease

PubMed Central

SUN, LIJUN; HAO, YUEWEN; NIE, XIAOWEI; ZHANG, XUEXIN; YANG, GUANGXIAO; WANG, QUANYING

2012-01-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function. PMID:23226731

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease.

PubMed

Sun, Lijun; Hao, Yuewen; Nie, Xiaowei; Zhang, Xuexin; Yang, Guangxiao; Wang, Quanying

2012-11-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function.

Deep sequencing of small RNA libraries from human prostate epithelial and stromal cells reveal distinct pattern of microRNAs primarily predicted to target growth factors.

PubMed

Singh, Savita; Zheng, Yun; Jagadeeswaran, Guru; Ebron, Jey Sabith; Sikand, Kavleen; Gupta, Sanjay; Sunker, Ramanjulu; Shukla, Girish C

2016-02-28

Complex epithelial and stromal cell interactions are required during the development and progression of prostate cancer. Regulatory small non-coding microRNAs (miRNAs) participate in the spatiotemporal regulation of messenger RNA (mRNA) and regulation of translation affecting a large number of genes involved in prostate carcinogenesis. In this study, through deep-sequencing of size fractionated small RNA libraries we profiled the miRNAs of prostate epithelial (PrEC) and stromal (PrSC) cells. Over 50 million reads were obtained for PrEC in which 860,468 were unique sequences. Similarly, nearly 76 million reads for PrSC were obtained in which over 1 million were unique reads. Expression of many miRNAs of broadly conserved and poorly conserved miRNA families were identified. Sixteen highly expressed miRNAs with significant change in expression in PrSC than PrEC were further analyzed in silico. ConsensusPathDB showed the target genes of these miRNAs were significantly involved in adherence junction, cell adhesion, EGRF, TGF-β and androgen signaling. Let-7 family of tumor-suppressor miRNAs expression was highly pervasive in both, PrEC and PrSC cells. In addition, we have also identified several miRNAs that are unique to PrEC or PrSC cells and their predicted putative targets are a group of transcription factors. This study provides perspective on the miRNA expression in PrEC and PrSC, and reveals a global trend in miRNA interactome. We conclude that the most abundant miRNAs are potential regulators of development and differentiation of the prostate gland by targeting a set of growth factors. Additionally, high level expression of the most members of let-7 family miRNAs suggests their role in the fine tuning of the growth and proliferation of prostate epithelial and stromal cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

PubMed

Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

2006-10-01

We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

Expression and Function of the Progesterone Receptor in Human Prostate Stroma Provide Novel Insights to Cell Proliferation Control

PubMed Central

Yu, Yue; Liu, Liangliang; Xie, Ning; Xue, Hui; Fazli, Ladan; Buttyan, Ralph; Wang, Yuzhuo; Gleave, Martin

2013-01-01

Context: Like other tissues, the prostate is an admixture of many different cell types that can be segregated into components of the epithelium or stroma. Reciprocal interactions between these 2 types of cells are critical for maintaining prostate homeostasis, whereas aberrant stromal cell proliferation can disrupt this balance and result in diseases such as benign prostatic hyperplasia. Although the androgen and estrogen receptors are relatively well studied for their functions in controlling stromal cell proliferation and differentiation, the role of the progesterone receptor (PR) remains unclear. Objective: The aim of the study was to investigate the expression and function of the PR in the prostate. Design and Setting: Human prostate biopsies, renal capsule xenografts, and prostate stromal cells were used. Immunohistochemistry, Western blotting, real-time quantitative PCR, cell proliferation, flow cytometry, and gene microarray analyses were performed. Results: Two PR isoforms, PRA and PRB, are expressed in prostate stromal fibroblasts and smooth muscle cells, but not in epithelial cells. Both PR isoforms suppress prostate stromal cell proliferation through inhibition of the expression of cyclinA, cyclinB, and cdc25c, thus delaying cell cycling through S and M phases. Gene microarray analyses further demonstrated that PRA and PRB regulated different transcriptomes. However, one of the major gene groups commonly regulated by both PR isoforms was the one associated with regulation of cell proliferation. Conclusion: PR plays an inhibitory role in prostate stromal cell proliferation. PMID:23666965

CDC2 Mediates Progestin Initiated Endometrial Stromal Cell Proliferation: A PR Signaling to Gene Expression Independently of Its Binding to Chromatin

PubMed Central

Vallejo, Griselda; Mestre-Citrinovitz, Ana C.; Ballaré, Cecilia; Beato, Miguel; Saragüeta, Patricia

2014-01-01

Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the peri-implantation phase of pregnancy. We showed that picomolar concentration of progestin R5020 mimics this control in UIII endometrial stromal cells via ERK1-2 and AKT activation mediated by interaction of Progesterone Receptor (PR) with Estrogen Receptor beta (ERb) and without transcriptional activity of endogenous PR and ER. Here we identify early downstream targets of cytoplasmic PR signaling and their possible role in endometrial stromal cell proliferation. Microarray analysis of global gene expression changes in UIII cells treated for 45 min with progestin identified 97 up- and 341 down-regulated genes. The most over-represented molecular functions were transcription factors and regulatory factors associated with cell proliferation and cell cycle, a large fraction of which were repressors down-regulated by hormone. Further analysis verified that progestins regulate Ccnd1, JunD, Usf1, Gfi1, Cyr61, and Cdkn1b through PR-mediated activation of ligand-free ER, ERK1-2 or AKT, in the absence of genomic PR binding. ChIP experiments show that progestin promoted the interaction of USF1 with the proximal promoter of the Cdc2 gene. Usf1 knockdown abolished Cdc2 progestin-dependent transcriptional regulation and cell proliferation, which also blocked Cdc2 knockdown. We conclude that progestin-induced proliferation of endometrial stromal cells is mediated by ERK1-2 and AKT dependent early regulation of USF1, which directly induces Cdc2. To our knowledge, this is the first description of early target genes of progestin-activated classical PR via crosstalk with protein kinases and independently of hormone receptor binding to the genomic targets. PMID:24859236

Proline-rich antimicrobial peptide, PR-39 gene transduction altered invasive activity and actin structure in human hepatocellular carcinoma cells

PubMed Central

Ohtake, T; Fujimoto, Y; Ikuta, K; Saito, H; Ohhira, M; Ono, M; Kohgo, Y

1999-01-01

PR-39 is an endogenous proline-rich antimicrobial peptide which induces the synthesis of syndecan-1, a transmembrane heparan sulphate proteoglycan involved in cell-to-matrix interactions and wound healing. Previously, we revealed that the expression of syndecan-1 was reduced in human hepatocellular carcinomas with high metastatic potential and speculated that syndecan-1 played an important role in inhibition of invasion and metastasis. It is assumed that a modification of this process with PR-39 and syndecan-1 may result in a new strategy by which it can inhibit the invasion and metastasis. Therefore, we transduced a gene of PR-39 into human hepatocellular carcinoma cell line HLF, which shows a low expression of syndecan-1 and a high in vitro invasive activity, and examined whether this procedure could reduce the invasive activity of tumour cells. In two transfectants with PR-39 gene, the syndecan-1 expression was induced and the invasive activity in type I collagen-coated chamber was inhibited. Moreover, these transfectants showed the suppression of motile activity assayed by phagokinetic tracks in addition to the disorganization of actin filaments observed by a confocal imaging system. In contrast, five transfectants with syndecan-1 gene in the HLF cells revealed suppression of invasive activity but did not alter the motile activity and actin structures of the cell. These results suggest that PR-39 has functions involved in the suppression of motile activity and alteration of actin structure on human hepatocellular carcinoma cells in addition to the suppression of invasive activity which might result from the induction of syndecan-1 expression. © 1999 Cancer Research Campaign PMID:10507762

Defense Responses to Mycotoxin-Producing Fungi Fusarium proliferatum, F. subglutinans, and Aspergillus flavus in Kernels of Susceptible and Resistant Maize Genotypes.

PubMed

Lanubile, Alessandra; Maschietto, Valentina; De Leonardis, Silvana; Battilani, Paola; Paciolla, Costantino; Marocco, Adriano

2015-05-01

Developing kernels of resistant and susceptible maize genotypes were inoculated with Fusarium proliferatum, F. subglutinans, and Aspergillus flavus. Selected defense systems were investigated using real-time reverse transcription-polymerase chain reaction to monitor the expression of pathogenesis-related (PR) genes (PR1, PR5, PRm3, PRm6) and genes protective from oxidative stress (peroxidase, catalase, superoxide dismutase and ascorbate peroxidase) at 72 h postinoculation. The study was also extended to the analysis of the ascorbate-glutathione cycle and catalase, superoxide dismutase, and cytosolic and wall peroxidases enzymes. Furthermore, the hydrogen peroxide and malondialdehyde contents were studied to evaluate the oxidation level. Higher gene expression and enzymatic activities were observed in uninoculated kernels of resistant line, conferring a major readiness to the pathogen attack. Moreover expression values of PR genes remained higher in the resistant line after inoculation, demonstrating a potentiated response to the pathogen invasions. In contrast, reactive oxygen species-scavenging genes were strongly induced in the susceptible line only after pathogen inoculation, although their enzymatic activity was higher in the resistant line. Our data provide an important basis for further investigation of defense gene functions in developing kernels in order to improve resistance to fungal pathogens. Maize genotypes with overexpressed resistance traits could be profitably utilized in breeding programs focused on resistance to pathogens and grain safety.

GmWRKY31 and GmHDL56 Enhances Resistance to Phytophthora sojae by Regulating Defense-Related Gene Expression in Soybean

PubMed Central

Fan, Sujie; Dong, Lidong; Han, Dan; Zhang, Feng; Wu, Junjiang; Jiang, Liangyu; Cheng, Qun; Li, Rongpeng; Lu, Wencheng; Meng, Fanshan; Zhang, Shuzhen; Xu, Pengfei

2017-01-01

Phytophthora root and stem rot of soybean [Glycine max (L.) Merr.] caused by the oomycete Phytophthora sojae, is a destructive disease worldwide. The molecular mechanism of the soybean response to P. sojae is largely unclear. We report a novel WRKY transcription factor (TF) in soybean, GmWRKY31, in the host response to P. sojae. Overexpression and RNA interference analysis demonstrated that GmWRKY31 enhanced resistance to P. sojae in transgenic soybean plants. GmWRKY31 was targeted to the nucleus, where it bound to the W-box and acted as an activator of gene transcription. Moreover, we determined that GmWRKY31 physically interacted with GmHDL56, which improved resistance to P. sojae in transgenic soybean roots. GmWRKY31 and GmHDL56 shared a common target GmNPR1 which was induced by P. sojae. Overexpression and RNA interference analysis demonstrated that GmNPR1 enhanced resistance to P. sojae in transgenic soybean plants. Several pathogenesis-related (PR) genes were constitutively activated, including GmPR1a, GmPR2, GmPR3, GmPR4, GmPR5a, and GmPR10, in soybean plants overexpressing GmNPR1 transcripts. By contrast, the induction of PR genes was compromised in transgenic GmNPR1-RNAi lines. Taken together, these findings suggested that the interaction between GmWRKY31 and GmHDL56 enhances resistance to P. sojae by regulating defense-related gene expression in soybean. PMID:28553307

C/EBPβ LIP and c-Jun synergize to regulate expression of the murine progesterone receptor.

PubMed

Wang, Weizhong; Do, Han Ngoc; Aupperlee, Mark D; Durairaj, Srinivasan; Flynn, Emily E; Miksicek, Richard J; Haslam, Sandra Z; Schwartz, Richard C

2018-06-02

CCAAT/enhancer binding protein β (C/EBPβ) is required for murine mammary ductal morphogenesis and alveologenesis. Progesterone is critical for proliferation and alveologenesis in adult mammary glands, and there is a similar requirement for progesterone receptor isoform B (PRB) in alveologenesis. We examined C/EBPβ regulation of PR expression. All three C/EBPβ isoforms, including typically inhibitory LIP, transactivated the PR promoter. LIP, particularly, strongly synergized with c-Jun to drive PR transcription. Endogenous C/EBPβ and c-Jun stimulated a PR promoter-reporter and these two factors showed promoter occupancy on the endogenous PR gene. Additionally, LIP overexpression elevated endogenous PR protein expression. In pregnancy, both PRB and the relative abundance of LIP among C/EBPβ isoforms increase. Consistent with a role in PRB expression, in vivo C/EBPβ and PR isoform A expression showed mutually exclusive localization in mammary epithelium, while C/EBPβ and PRB largely co-localized. We suggest a critical role for C/EBPβ, particularly LIP, in PRB expression. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Familial CJD Associated PrP Mutants within Transmembrane Region Induced Ctm-PrP Retention in ER and Triggered Apoptosis by ER Stress in SH-SY5Y Cells

PubMed Central

Wang, Xin; Shi, Qi; Xu, Kun; Gao, Chen; Chen, Cao; Li, Xiao-Li; Wang, Gui-Rong; Tian, Chan; Han, Jun; Dong, Xiao-Ping

2011-01-01

Background Genetic prion diseases are linked to point and inserted mutations in the prion protein (PrP) gene that are presumed to favor conversion of the cellular isoform of PrP (PrPC) to the pathogenic one (PrPSc). The pathogenic mechanisms and the subcellular sites of the conversion are not completely understood. Here we introduce several PRNP gene mutations (such as, PrP-KDEL, PrP-3AV, PrP-A117V, PrP-G114V, PrP-P102L and PrP-E200K) into the cultured cells in order to explore the pathogenic mechanism of familial prion disease. Methodology/Principal Findings To address the roles of aberrant retention of PrP in endoplasmic reticulum (ER), the recombinant plasmids expressing full-length human PrP tailed with an ER signal peptide at the COOH-terminal (PrP-KDEL) and PrP with three amino acids exchange in transmembrane region (PrP-3AV) were constructed. In the preparations of transient transfections, 18-kD COOH-terminal proteolytic resistant fragments (Ctm-PrP) were detected in the cells expressing PrP-KDEL and PrP-3AV. Analyses of the cell viabilities in the presences of tunicamycin and brefeldin A revealed that expressions of PrP-KDEL and PrP-3AV sensitized the transfected cells to ER stress stimuli. Western blots and RT-PCR identified the clear alternations of ER stress associated events in the cells expressing PrP-KDEL and PrP-3AV that induced ER mediated apoptosis by CHOP and capase-12 apoptosis pathway. Moreover, several familial CJD related PrP mutants were transiently introduced into the cultured cells. Only the mutants within the transmembrane region (G114V and A117V) induced the formation of Ctm-PrP and caused the ER stress, while the mutants outside the transmembrane region (P102L and E200K) failed. Conclusions/Significance The data indicate that the retention of PrP in ER through formation of Ctm-PrP results in ER stress and cell apoptosis. The cytopathic activities caused by different familial CJD associated PrP mutants may vary, among them the mutants within the transmembrane region undergo an ER-stress mediated cell apoptosis. PMID:21298055

Genetic variation of the prion protein gene (PRNP) in alpaca (Vicugna pacos)

USDA-ARS?s Scientific Manuscript database

Transmissible spongiform encephalopathies (TSE) are caused by accumulation of a misfolded form of the prion protein (PrP). The normal cellular isoform of PrP is produced by the prion gene (PRNP) and is highly expressed in the central nervous system. Currently, there is an absence of information rega...

The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

PubMed

Ren, Jun; Prescott, John F

2004-11-15

An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

Molecular characterization of the PR-toxin gene cluster in Penicillium roqueforti and Penicillium chrysogenum: cross talk of secondary metabolite pathways.

PubMed

Hidalgo, Pedro I; Ullán, Ricardo V; Albillos, Silvia M; Montero, Olimpio; Fernández-Bodega, María Ángeles; García-Estrada, Carlos; Fernández-Aguado, Marta; Martín, Juan-Francisco

2014-01-01

The PR-toxin is a potent mycotoxin produced by Penicillium roqueforti in moulded grains and grass silages and may contaminate blue-veined cheese. The PR-toxin derives from the 15 carbon atoms sesquiterpene aristolochene formed by the aristolochene synthase (encoded by ari1). We have cloned and sequenced a four gene cluster that includes the ari1 gene from P. roqueforti. Gene silencing of each of the four genes (named prx1 to prx4) resulted in a reduction of 65-75% in the production of PR-toxin indicating that the four genes encode enzymes involved in PR-toxin biosynthesis. Interestingly the four silenced mutants overproduce large amounts of mycophenolic acid, an antitumor compound formed by an unrelated pathway suggesting a cross-talk of PR-toxin and mycophenolic acid production. An eleven gene cluster that includes the above mentioned four prx genes and a 14-TMS drug/H(+) antiporter was found in the genome of Penicillium chrysogenum. This eleven gene cluster has been reported to be very poorly expressed in a transcriptomic study of P. chrysogenum genes under conditions of penicillin production (strongly aerated cultures). We found that this apparently silent gene cluster is able to produce PR-toxin in P. chrysogenum under static culture conditions on hydrated rice medium. Noteworthily, the production of PR-toxin was 2.6-fold higher in P. chrysogenum npe10, a strain deleted in the 56.8kb amplifiable region containing the pen gene cluster, than in the parental strain Wisconsin 54-1255 providing another example of cross-talk between secondary metabolite pathways in this fungus. A detailed PR-toxin biosynthesis pathway is proposed based on all available evidence. Copyright © 2013 Elsevier Inc. All rights reserved.

Ectopic Expression of JcWRKY Confers Enhanced Resistance in Transgenic Tobacco Against Macrophomina phaseolina.

PubMed

Agarwal, Parinita; Patel, Khantika; Agarwal, Pradeep K

2018-04-01

Plants possess an innate immune system comprising of a complex network of closely regulated defense responses involving differential gene expression mediated by transcription factors (TFs). The WRKYs comprise of an important plant-specific TF family, which is involved in regulation of biotic and abiotic defenses. The overexpression of JcWRKY resulted in improved resistance in transgenic tobacco against Macrophomina phaseolina. The production of reactive oxygen species (ROS) and its detoxification through antioxidative system in the transgenics facilitates defense against Macrophomina. The enhanced catalase activity on Macrophomina infection limits the spread of infection. The transcript expression of antioxidative enzymes gene (CAT and SOD) and salicylic acid (SA) biosynthetic gene ICS1 showed upregulation during Macrophomina infection and combinatorial stress. The enhanced transcript of pathogenesis-related genes PR-1 indicates the accumulation of SA during different stresses. The PR-2 and PR-5 highlight the activation of defense responses comprising of activation of hydrolytic cleavage of glucanases and thaumatin-like proteins causing disruption of fungal cells. The ROS homeostasis in coordination with signaling molecules regulate the defense responses and inhibit fungal growth.

Prognostic Significance of Progesterone Receptor–Positive Tumor Cells Within Immunohistochemically Defined Luminal A Breast Cancer

PubMed Central

Prat, Aleix; Cheang, Maggie Chon U.; Martín, Miguel; Parker, Joel S.; Carrasco, Eva; Caballero, Rosalía; Tyldesley, Scott; Gelmon, Karen; Bernard, Philip S.; Nielsen, Torsten O.; Perou, Charles M.

2013-01-01

Purpose Current immunohistochemical (IHC)-based definitions of luminal A and B breast cancers are imperfect when compared with multigene expression-based assays. In this study, we sought to improve the IHC subtyping by examining the pathologic and gene expression characteristics of genomically defined luminal A and B subtypes. Patients and Methods Gene expression and pathologic features were collected from primary tumors across five independent cohorts: British Columbia Cancer Agency (BCCA) tamoxifen-treated only, Grupo Español de Investigación en Cáncer de Mama 9906 trial, BCCA no systemic treatment cohort, PAM50 microarray training data set, and a combined publicly available microarray data set. Optimal cutoffs of percentage of progesterone receptor (PR) –positive tumor cells to predict survival were derived and independently tested. Multivariable Cox models were used to test the prognostic significance. Results Clinicopathologic comparisons among luminal A and B subtypes consistently identified higher rates of PR positivity, human epidermal growth factor receptor 2 (HER2) negativity, and histologic grade 1 in luminal A tumors. Quantitative PR gene and protein expression were also found to be significantly higher in luminal A tumors. An empiric cutoff of more than 20% of PR-positive tumor cells was statistically chosen and proved significant for predicting survival differences within IHC-defined luminal A tumors independently of endocrine therapy administration. Finally, no additional prognostic value within hormonal receptor (HR) –positive/HER2-negative disease was observed with the use of the IHC4 score when intrinsic IHC-based subtypes were used that included the more than 20% PR-positive tumor cells and vice versa. Conclusion Semiquantitative IHC expression of PR adds prognostic value within the current IHC-based luminal A definition by improving the identification of good outcome breast cancers. The new proposed IHC-based definition of luminal A tumors is HR positive/HER2 negative/Ki-67 less than 14%, and PR more than 20%. PMID:23233704

Malus hupehensis NPR1 induces pathogenesis-related protein gene expression in transgenic tobacco.

PubMed

Zhang, J-Y; Qiao, Y-S; Lv, D; Gao, Z-H; Qu, S-C; Zhang, Z

2012-03-01

Most commercially grown apple cultivars are susceptible to fungal diseases. Malus hupehensis has high resistance to many diseases affecting apple cultivars. Understanding innate defence mechanisms would help to develop disease-resistant apple crops. Non-expressor of pathogenesis-related genes 1 (NPR1) plays a key role in regulating salicylic acid (SA)-mediated systemic acquired resistance (SAR). MhNPR1 cDNA, corresponding to genomic DNA and its 5' flanking sequences, was isolated from M. hupehensis. Sequence analysis showed that the regulatory mechanism for oligomer-monomer transition of the MhNPR1 protein in apple might be similar to that of GmNPR1 in soybean, but different from that of AtNPR1 in Arabidopsis. No significant differences in MhNPR1 expression were found in M. hupehensis after infection with Botryosphaeria berengeriana, showing that MhNPR1 might be regulated by pathogens at the protein level, as described for Arabidopsis and grapevine. SA treatment significantly induced MhNPR1 expression in leaves, stems and roots, while methyl jasmonate (MeJA) treatment induced MhNPR1 expression in roots, but not in leaves or stems. The expression of MhNPR1 was highly increased in roots, moderately in leaves, and did not change in stems after treatment with 1-aminocyclopropane-1-carboxylic acid (ACC). SAR marker genes (MhPR1 and MhPR5) were induced by SA, MeJA and ACC in leaves, stems and roots. Overexpression of MhNPR1 significantly induced the expression of pathogenesis-related genes (NtPR1, NtPR3 and NtPR5) in transgenic tobacco plants and resistance to the fungus Botrytis cinerea, suggesting that MhNPR1 orthologues are a component of the SA defence signalling pathway and SAR is induced in M. hupehensis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

Scutellarin-graft cationic β-cyclodextrin-polyrotaxane: Synthesis, characterization and DNA condensation.

PubMed

Qin, Qi; Ma, Xue; Liao, Xiali; Yang, Bo

2017-02-01

As a prerequisite of gene delivery in living cells, DNA condensation has attracted more and more attention. In order to improve the efficiencies of polyamine-β-cyclodextrin-based cationic polyrotaxanes (PR-EDA and PR-DETA) as DNA condensation materials, we have designed and prepared two novel scutellarin-grafted cationic polyrotaxanes (PR-EDA-SCU and PR-DETA-SCU), in which scutellarins (SCU), the planar molecules, were conjugated on the cyclodextrin molecules of PR-EDA and PR-DETA. These materials were characterized by 1D and 2D NMR, XRD, TG and DSC. The electrophoresis assays showed that pDNA condensation efficiencies of PR-EDA and PR-DETA were better than that of PR-EDA and PR-DETA. The complexes of PR-EDA, PR-DETA, PR-EDA-SCU and PR-DETA-SCU with pDNA were further investigated by zeta potential and atomic force microscopy analysis. The results indicated that the planar structure of SCU played an important role in improvement of pDNA condensation efficiencies of PR-EDA-SCU and PR-DETA-SCU. The satisfactory pDNA condensation abilities of PR-EDA-SCU and PR-DETA-SCU could be helpful in designing non-viral gene delivery vectors to control gene expression and delivery. Copyright © 2016 Elsevier B.V. All rights reserved.

Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression

PubMed Central

Kote-Jarai, Zsofia; Saunders, Edward J.; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Jugurnauth-Little, Sarah; Ross-Adams, Helen; Al Olama, Ali Amin; Benlloch, Sara; Halim, Silvia; Russel, Roslin; Dunning, Alison M.; Luccarini, Craig; Dennis, Joe; Neal, David E.; Hamdy, Freddie C.; Donovan, Jenny L.; Muir, Ken; Giles, Graham G.; Severi, Gianluca; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Lindstrom, Sara; Kraft, Peter; Hunter, David J.; Gapstur, Susan; Chanock, Stephen; Berndt, Sonja I.; Albanes, Demetrius; Andriole, Gerald; Schleutker, Johanna; Weischer, Maren; Canzian, Federico; Riboli, Elio; Key, Tim J.; Travis, Ruth C.; Campa, Daniele; Ingles, Sue A.; John, Esther M.; Hayes, Richard B.; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Ostrander, Elaine A.; Signorello, Lisa B.; Thibodeau, Stephen N.; Schaid, Dan; Maier, Christiane; Vogel, Walther; Kibel, Adam S.; Cybulski, Cezary; Lubinski, Jan; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y.; Kaneva, Radka; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Dicks, Ed; Baynes, Caroline; Conroy, Don; Bojesen, Stig E.; Kaaks, Rudolf; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Easton, Douglas F.; Eeles, Rosalind A.

2013-01-01

Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that encodes TERT. To comprehensively evaluate the association between genetic variation across this region and PrCa, we performed a fine-mapping analysis by genotyping 134 SNPs using a custom Illumina iSelect array or Sequenom MassArray iPlex, followed by imputation of 1094 SNPs in 22 301 PrCa cases and 22 320 controls in The PRACTICAL consortium. Multiple stepwise logistic regression analysis identified four signals in the promoter or intronic regions of TERT that independently associated with PrCa risk. Gene expression analysis of normal prostate tissue showed evidence that SNPs within one of these regions also associated with TERT expression, providing a potential mechanism for predisposition to disease. PMID:23535824

Low p16INK4a Expression in Early Passage Human Prostate Basal Epithelial Cells Enables Immortalization by Telomerase Expression Alone.

PubMed

Graham, Mindy Kim; Principessa, Lorenzo; Antony, Lizamma; Meeker, Alan K; Isaacs, John T

2017-03-01

There are two principal senescence barriers that must be overcome to successfully immortalize primary human epithelial cells in culture, stress-induced senescence, and replicative senescence. The p16 INK4a /retinoblastoma protein (p16/Rb) pathway mediates stress-induced senescence, and is generally upregulated by primary epithelial cells in response to the artificial conditions from tissue culture. Replicative senescence is associated with telomere loss. Following each round of cell division, telomeres progressively shorten. Once telomeres shorten to a critical length, the DNA damage response pathway is activated, and the tumor suppressor p53 pathway triggers replicative senescence. Exogenous expression of telomerase in normal human epithelial cells extends the replicative capacity of cells, and in some cases, immortalizes cells. However reliable immortalization of epithelial cells usually requires telomerase activity coupled with inactivation of the p16/Rb pathway. A lentiviral vector, pLOX-TERT-iresTK (Addgene #12245), containing a CMV promoter upstream of a bicistronic coding cassette that includes loxP sites flanking the catalytic subunit of human telomerase gene (TERT) and herpes simplex virus type-1 thymidine kinase gene (HSV1-tk) was used to transduce normal prostate basal epithelial cells (PrECs) initiated in cell culture from prostate cancer patients undergoing radical prostatectomies. Transduction of early (i.e., <7) passage PrECs with TERT led to successful immortalization. However, attempts to immortalize late (i.e., >7) passage PrECs were unsuccessful. Late passage PrECs, which acquired elevated p16, were unable to overcome the senescence barrier. Immortalized PrECs (TERT-PrECs) retained a normal male karyotype and low p16 expression. Additionally, TERT-PrECs were non-tumorigenic when inoculated into intact male immunodeficient NSG mice. The present studies document that early passage human PrECs have sufficiently low p16 to permit immortalization by TERT expression alone. TERT-PrECs developed using this transduction approach provides an appropriate and experimentally facile model for clarifying the molecular mechanism(s) involved in both immortalization of human PrECs, as well as identifying genetic/epigenetic "drivers" for conversion of these immortalized non-tumorigenic cells into fully lethal prostate cancers. Notably, loxP sites flank the exogenous TERT gene in the TERT-PrECs. Cre recombinase can be used to excise TERT, and resolve whether TERT expression is required for these cells to be fully transformed into lethal cancer. Prostate 77: 374-384, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Neutrophil-Related Gene Expression And Low-Density Granulocytes Associated with Disease Activity and Response to Treatment in ANCA-Associated Vasculitis

PubMed Central

Grayson, Peter C.; Carmona-Rivera, Carmelo; Xu, Lijing; Lim, Noha; Gao, Zhong; Asare, Adam L.; Specks, Ulrich; Stone, John H.; Seo, Philip; Spiera, Robert F.; Langford, Carol A.; Hoffman, Gary S.; Kallenberg, Cees G.M.; St Clair, E. William; Tchao, Nadia K.; Ytterberg, Steven R.; Phippard, Deborah J.; Merkel, Peter A.; Kaplan, Mariana J.; Monach, Paul A.

2015-01-01

Objectives To discover biomarkers involved in the pathophysiology of ANCA-associated vasculitis (AAV) and determine if low-density granulocytes (LDGs) contribute to gene expression signatures in AAV. Methods The source of clinical data and linked biospecimens was a randomized controlled treatment trial in AAV. RNA-sequencing of whole blood from patients with AAV was performed during active disease at the baseline visit (BL) and during remission 6 months later (6M). Gene expression was compared between patients who met versus did not meet the primary trial outcome of clinical remission at 6M (responders vs. nonresponders). Measurement of neutrophil-related gene expression was confirmed in PBMCs to validate findings in whole blood. A negative selection strategy isolated LDGs from PBMC fractions. Results Differential expression between responders (n=77) and nonresponders (n=35) was detected in 2,346 transcripts at BL visit (p<0.05). Unsupervised hierarchical clustering demonstrated a cluster of granulocyte-related genes, including myeloperoxidase (MPO) and proteinase 3 (PR3). A granulocyte multi-gene composite score was significantly higher in nonresponders than responders (p<0.01) and during active disease compared to remission (p<0.01). This signature strongly overlapped an LDG signature identified previously in lupus (FDRGSEA<0.01). Transcription of PR3 measured in PBMCs was associated with active disease and treatment response (p<0.01). LDGs isolated from patients with AAV spontaneously formed neutrophil extracellular traps containing PR3 and MPO. Conclusions In AAV an increased expression of a granulocyte gene signature is associated with disease activity and decreased response to treatment. The source of this signature is likely LDGs, a potentially pathogenic cell type in AAV. PMID:25891759

Moss Pathogenesis-Related-10 Protein Enhances Resistance to Pythium irregulare in Physcomitrella patens and Arabidopsis thaliana

PubMed Central

Castro, Alexandra; Vidal, Sabina; Ponce de León, Inés

2016-01-01

Plants respond to pathogen infection by activating signaling pathways leading to the accumulation of proteins with diverse roles in defense. Here, we addressed the functional role of PpPR-10, a pathogenesis-related (PR)-10 gene, of the moss Physcomitrella patens, in response to biotic stress. PpPR-10 belongs to a multigene family and encodes a protein twice the usual size of PR-10 proteins due to the presence of two Bet v1 domains. Moss PR-10 genes are differentially regulated during development and inoculation with the fungal pathogen Botrytis cinerea. Specifically, PpPR-10 transcript levels increase significantly by treatments with elicitors of Pectobacterium carotovorum subsp. carotovorum, spores of B. cinerea, and the defense hormone salicylic acid. To characterize the role of PpPR-10 in plant defense against pathogens, we conducted overexpression analysis in P. patens and in Arabidopsis thaliana. We demonstrate that constitutive expression of PpPR-10 in moss tissues increased resistance against the oomycete Pythium irregulare. PpPR-10 overexpressing moss plants developed less symptoms and decreased mycelium growth than wild type plants. In addition, PpPR-10 overexpressing plants constitutively produced cell wall depositions in protonemal tissue. Ectopic expression of PpPR-10 in Arabidopsis resulted in increased resistance against P. irregulare as well, evidenced by smaller lesions and less cellular damage compared to wild type plants. These results indicate that PpPR-10 is functionally active in the defense against the pathogen P. irregulare, in both P. patens and Arabidopsis, two evolutionary distant plants. Thus, P. patens can serve as an interesting source of genes to improve resistance against pathogen infection in flowering plants. PMID:27200053

Development and characterization of a packaging cell line for pseudo-infectious yellow fever virus particle generation.

PubMed

Queiroz, Sabrina Ribeiro de Almeida; Silva Júnior, José Valter Joaquim; Silva, Andréa Nazaré Monteiro Rangel da; Carvalho, Amanda Gomes de Oliveira; Santos, Jefferson José da Silva; Gil, Laura Helena Vega Gonzales

2018-01-01

Pseudo-infectious yellow fever viral particles (YFV-PIVs) have been used to study vaccines and viral packaging. Here, we report the development of a packaging cell line, which expresses the YFV prM/E proteins. HEK293 cells were transfected with YFV prM/E and C (84 nt) genes to generate HEK293-YFV-PrM/E-opt. The cells were evaluated for their ability to express the heterologous proteins and to package the replicon repYFV-17D-LucIRES, generating YFV-PIVs. The expression of prM/E proteins was confirmed, and the cell line trans-packaged the replicon for recovery of a reporter for the YFV-PIVs. HEK293-YFV-prM/E-opt trans-packaging capacity demonstrates its possible biotechnology application.

S1PR1 drives a feedforward signalling loop to regulate BATF3 and the transcriptional programme of Hodgkin lymphoma cells

PubMed Central

Vrzalikova, K; Ibrahim, M; Vockerodt, M; Perry, T; Margielewska, S; Lupino, L; Nagy, E; Soilleux, E; Liebelt, D; Hollows, R; Last, A; Reynolds, G; Abdullah, M; Curley, H; Care, M; Krappmann, D; Tooze, R; Allegood, J; Spiegel, S; Wei, W; Woodman, C B J; Murray, P G

2018-01-01

The Hodgkin/Reed–Sternberg cells of classical Hodgkin lymphoma (HL) are characterised by the aberrant activation of multiple signalling pathways. Here we show that a subset of HL displays altered expression of sphingosine-1-phosphate (S1P) receptors (S1PR)s. S1P activates phosphatidylinositide 3-kinase (PI3-K) in these cells that is mediated by the increased expression of S1PR1 and the decreased expression of S1PR2. We also showed that genes regulated by the PI3-K signalling pathway in HL cell lines significantly overlap with the transcriptional programme of primary HRS cells. Genes upregulated by the PI3-K pathway included the basic leucine zipper transcription factor, ATF-like 3 (BATF3), which is normally associated with the development of dendritic cells. Immunohistochemistry confirmed that BATF3 was expressed in HRS cells of most HL cases. In contrast, in normal lymphoid tissues, BATF3 expression was confined to a small fraction of CD30-positive immunoblasts. Knockdown of BATF3 in HL cell lines revealed that BATF3 contributed to the transcriptional programme of primary HRS cells, including the upregulation of S1PR1. Our data suggest that disruption of this potentially oncogenic feedforward S1P signalling loop could provide novel therapeutic opportunities for patients with HL. PMID:28878352

The CNS glycoprotein Shadoo has PrPC-like protective properties and displays reduced levels in prion infections

PubMed Central

Watts, Joel C; Drisaldi, Bettina; Ng, Vivian; Yang, Jing; Strome, Bob; Horne, Patrick; Sy, Man-Sun; Yoong, Larry; Young, Rebecca; Mastrangelo, Peter; Bergeron, Catherine; Fraser, Paul E; Carlson, George A; Mount, Howard T J; Schmitt-Ulms, Gerold; Westaway, David

2007-01-01

The cellular prion protein, PrPC, is neuroprotective in a number of settings and in particular prevents cerebellar degeneration mediated by CNS-expressed Doppel or internally deleted PrP (‘ΔPrP'). This paradigm has facilitated mapping of activity determinants in PrPC and implicated a cryptic PrPC-like protein, ‘π'. Shadoo (Sho) is a hypothetical GPI-anchored protein encoded by the Sprn gene, exhibiting homology and domain organization similar to the N-terminus of PrP. Here we demonstrate Sprn expression and Sho protein in the adult CNS. Sho expression overlaps PrPC, but is low in cerebellar granular neurons (CGNs) containing PrPC and high in PrPC-deficient dendritic processes. In Prnp0/0 CGNs, Sho transgenes were PrPC-like in their ability to counteract neurotoxic effects of either Doppel or ΔPrP. Additionally, prion-infected mice exhibit a dramatic reduction in endogenous Sho protein. Sho is a candidate for π, and since it engenders a PrPC-like neuroprotective activity, compromised neuroprotective activity resulting from reduced levels may exacerbate damage in prion infections. Sho may prove useful in deciphering several unresolved facets of prion biology. PMID:17703189

Screening and analysis of genes expressed upon infection of broad bean with Clover yellow vein virus causing lethal necrosis.

PubMed

Nakahara, Kenji S; Kitazawa, Hiroaki; Atsumi, Go; Choi, Sun Hee; Suzuki, Yuji; Uyeda, Ichiro

2011-07-18

Clover yellow vein virus (ClYVV) causes lethal systemic necrosis in legumes, including broad bean (Vicia faba) and pea (Pisum sativum). To identify host genes involved in necrotic symptom expression after ClYVV infection, we screened cDNA fragments in which expression was changed in advance of necrotic symptom expression in broad bean (V. faba cv. Wase) using the differential display technique and secondarily with Northern blot analysis. Expression changes were confirmed in 20 genes, and the six that exhibited the most change were analyzed further. These six genes included a gene that encodes a putative nitrate-induced NOI protein (VfNOI), and another was homologous to an Arabidopsis gene that encodes a glycine- and proline-rich protein GPRP (VfGPRP). We recently reported that necrotic symptom development in ClYVV-infected pea is associated with expression of salicylic acid (SA)-dependent pathogenesis-related (PR) proteins and requires SA-dependent host responses. Interestingly, VfNOI and VfGPRP expression was correlated with that of the putative SA-dependent PR proteins in ClYVV-infected broad bean. However, broad bean infected with a recombinant ClYVV expressing the VfGPRP protein showed weaker symptoms and less viral multiplication than that infected with ClYVV expressing the GFP protein. These results imply that VfGPRP plays a role in defense against ClYVV rather than in necrotic symptom expression.

Posttranslationally modified progesterone receptors direct ligand-specific expression of breast cancer stem cell-associated gene programs.

PubMed

Knutson, Todd P; Truong, Thu H; Ma, Shihong; Brady, Nicholas J; Sullivan, Megan E; Raj, Ganesh; Schwertfeger, Kathryn L; Lange, Carol A

2017-04-17

Estrogen and progesterone are potent breast mitogens. In addition to steroid hormones, multiple signaling pathways input to estrogen receptor (ER) and progesterone receptor (PR) actions via posttranslational events. Protein kinases commonly activated in breast cancers phosphorylate steroid hormone receptors (SRs) and profoundly impact their activities. To better understand the role of modified PRs in breast cancer, we measured total and phospho-Ser294 PRs in 209 human breast tumors represented on 2754 individual tissue spots within a tissue microarray and assayed the regulation of this site in human tumor explants cultured ex vivo. To complement this analysis, we assayed PR target gene regulation in T47D luminal breast cancer models following treatment with progestin (promegestone; R5020) and antiprogestins (mifepristone, onapristone, or aglepristone) in conditions under which the receptor is regulated by Lys388 SUMOylation (K388 intact) or is SUMO-deficient (via K388R mutation to mimic persistent Ser294 phosphorylation). Selected phospho-PR-driven target genes were validated by qRT-PCR and following RUNX2 shRNA knockdown in breast cancer cell lines. Primary and secondary mammosphere assays were performed to implicate phospho-Ser294 PRs, epidermal growth factor signaling, and RUNX2 in breast cancer stem cell biology. Phospho-Ser294 PR species were abundant in a majority (54%) of luminal breast tumors, and PR promoter selectivity was exquisitely sensitive to posttranslational modifications. Phospho-PR expression and target gene programs were significantly associated with invasive lobular carcinoma (ILC). Consistent with our finding that activated phospho-PRs undergo rapid ligand-dependent turnover, unique phospho-PR gene signatures were most prevalent in breast tumors clinically designated as PR-low to PR-null (luminal B) and included gene sets associated with cancer stem cell biology (HER2, PAX2, AHR, AR, RUNX). Validation studies demonstrated a requirement for RUNX2 in the regulation of selected phospho-PR target genes (SLC37A2). In vitro mammosphere formation assays support a role for phospho-Ser294-PRs via growth factor (EGF) signaling as well as RUNX2 as potent drivers of breast cancer stem cell fate. We conclude that PR Ser294 phosphorylation is a common event in breast cancer progression that is required to maintain breast cancer stem cell fate, in part via cooperation with growth factor-initiated signaling pathways and key phospho-PR target genes including SLC37A2 and RUNX2. Clinical measurement of phosphorylated PRs should be considered a useful marker of breast tumor stem cell potential. Alternatively, unique phospho-PR target gene sets may provide useful tools with which to identify patients likely to respond to selective PR modulators that block PR Ser294 phosphorylation as part of rational combination (i.e., with antiestrogens) endocrine therapies designed to durably block breast cancer recurrence.

Progesterone receptor modulates estrogen receptor-α action in breast cancer

PubMed Central

Mohammed, Hisham; Russell, I. Alasdair; Stark, Rory; Rueda, Oscar M.; Hickey, Theresa E.; Tarulli, Gerard A.; Serandour, Aurelien A. A.; Birrell, Stephen N.; Bruna, Alejandra; Saadi, Amel; Menon, Suraj; Hadfield, James; Pugh, Michelle; Raj, Ganesh V.; Brown, Gordon D.; D’Santos, Clive; Robinson, Jessica L. L.; Silva, Grace; Launchbury, Rosalind; Perou, Charles M.; Stingl, John; Caldas, Carlos; Tilley, Wayne D.; Carroll, Jason S.

2015-01-01

Summary Progesterone receptor (PR) expression is employed as a biomarker of estrogen receptor-α (ERα) function and breast cancer prognosis. We now show that PR is not merely an ERα-induced gene target, but is also an ERα-associated protein that modulates its behaviour. In the presence of agonist ligands, PR associates with ERα to direct ERα chromatin binding events within breast cancer cells, resulting in a unique gene expression programme that is associated with good clinical outcome. Progesterone inhibited estrogen-mediated growth of ERα+ cell line xenografts and primary ERα+ breast tumour explants and had increased anti-proliferative effects when coupled with an ERα antagonist. Copy number loss of PgR is a common feature in ERα+ breast cancers, explaining lower PR levels in a subset of cases. Our findings indicate that PR functions as a molecular rheostat to control ERα chromatin binding and transcriptional activity, which has important implications for prognosis and therapeutic interventions. PMID:26153859

Progesterone receptor isoforms in the mammary gland of cats and dogs.

PubMed

Gracanin, A; de Gier, J; Zegers, K; Bominaar, M; Rutteman, G R; Schaefers-Okkens, A C; Kooistra, H S; Mol, J A

2012-12-01

Progesterone exerts its effect by binding to specific progesterone receptors (PR) within the cell. In dogs and cats, no data are available on PR isoforms as found in other species. We therefore investigated the sequence of the PR gene and encoded protein in dogs and cats, the expression of PR isoforms in mammary tissue using Western blots and the presence of PR in mammary tissue using immunohistochemistry. Comparison of the amino acid sequence of the canine and feline PR with human PR revealed major differences in the PR-B-specific upstream segment (BUS). However, the essential activation function 3 (AF3) domain was intact in the cat but mutated in the dog. The DNA and ligand-binding domains were highly similar among the species. In cats with fibroadenomatous hyperplasia (FAH), high expression of PR mRNA together with growth hormone (GH), GH receptor (GHR) and IGF-I mRNA was found in comparison with feline mammary carcinomas. Immunohistochemical analysis showed strong nuclear as well as cytoplasmic staining for PR in FAH. Western blot analysis revealed expression of the PR-A and PR-B isoforms in the feline mammary gland. In canine mammary tissue, the most abundant PR staining was found in proliferative zones of the mammary gland. Western blot analyses showed mainly staining for PR-A with lower PR-B staining. It is concluded that in dogs and cats both PR isoforms are expressed. The role of mutations found in the canine PR-B is discussed. © 2012 Blackwell Verlag GmbH.

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

PubMed

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-12-01

Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

Structural recovery of the retina in a retinoschisin-deficient mouse after gene replacement therapy by solid lipid nanoparticles.

PubMed

Apaolaza, P S; Del Pozo-Rodríguez, A; Solinís, M A; Rodríguez, J M; Friedrich, U; Torrecilla, J; Weber, B H F; Rodríguez-Gascón, A

2016-06-01

X-linked juvenile retinoschisis (XLRS) is a retinal degenerative disorder caused by mutations in the RS1 gene encoding a protein termed retinoschisin. The disease is an excellent candidate for gene replacement therapy as the majority of mutations have been shown to lead to a complete deficiency of the secreted protein in the retinal structures. In this work, we have studied the ability of non-viral vectors based on solid lipid nanoparticles (SLN) to induce the expression of retinoschisin in photoreceptors (PR) after intravitreal administration to Rs1h-deficient mice. We designed two vectors prepared with SLN, protamine, and dextran (DX) or hyaluronic acid (HA), bearing a plasmid containing the human RS1 gene under the control of the murin opsin promoter (mOPS). In vitro, the nanocarriers were able to induce the expression of retinoschisin in a PR cell line. After injection into the murine vitreous, the formulation prepared with HA induced a higher transfection level in PR than the formulation prepared with DX. Moreover, the level of retinoschisin in the inner nuclear layer (INL), where bipolar cells are located, was also higher. Two weeks after vitreal administration into Rs1h-deficient mice, both formulations showed significant improvement of the retinal structure by inducing a decrease of cavities and PR loss, and an increase of retinal and outer nuclear layer (ONL) thickness. HA-SLN resulted in a significant higher increase in the thickness of both retina and ONL, which can be explained by the higher transfection level of PR. In conclusion, we have shown the structural improvement of the retina of Rs1h-deficient mice with PR specific expression of the RS1 gene driven by the specific promoter mOPS, after successful delivery via SLN-based non-viral vectors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genes with mutation significance were highly associated with the clinical pattern of patients with breast cancer.

PubMed

Ding, Wan-Jun; Zeng, Tao; Wang, Li-Jun; Lei, Hong-Bo; Ge, Wei; Wang, Zhi

2017-11-17

In the United States, breast cancer is the second leading cause of cancer death in women. Over the past 20 years, breast cancer incidence and mortality rates increased rapidly in developing regions. We aimed to identify the gene mutation patterns that associated with the clinical patterns, including survival status, histo-pathological classes and so forth, of breast cancer. We retrieved 1098 cases of the clinical information, and level-3 legacy data of mRNA expression level, protein expression data and mutation files from GDC data portal. The genes with mutation significance were obtained. We studied the impacts of mutation types on the expression levels of mRNA and protein. Different statistics methods were used to calculate the correlation between the mutation types and the expression data or histo-clinical measures. There were 24 genes with mutation significance identified. The most mutated genes were selected to study the role of specific mutations played on the patients with breast cancer. One interesting finding was the missense mutations on TP53 were related with high expression levels of mRNA and protein. The missense mutations on TP53 were highly related with the morphology, race, ER status, PR status and HER2 Status, while the truncated mutations were only related with the morphology, ER status and PR status. The missense mutation on PIK3CA was highly associated with the morphology, race, ER status and PR status. The mutants with different mutants and the wild type of the most mutated genes had different impacts on the histo-clinical measures that might help personalized therapy.

Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance.

PubMed

Ali, Sajad; Ganai, Bashir Ahmad; Kamili, Azra N; Bhat, Ajaz Ali; Mir, Zahoor Ahmad; Bhat, Javaid Akhter; Tyagi, Anshika; Islam, Sheikh Tajamul; Mushtaq, Muntazir; Yadav, Prashant; Rawat, Sandhya; Grover, Anita

Pathogenesis-related (PR) proteins and antimicrobial peptides (AMPs) are a group of diverse molecules that are induced by phytopathogens as well as defense related signaling molecules. They are the key components of plant innate immune system especially systemic acquired resistance (SAR), and are widely used as diagnostic molecular markers of defense signaling pathways. Although, PR proteins and peptides have been isolated much before but their biological function remains largely enigmatic despite the availability of new scientific tools. The earlier studies have demonstrated that PR genes provide enhanced resistance against both biotic and abiotic stresses, which make them one of the most promising candidates for developing multiple stress tolerant crop varieties. In this regard, plant genetic engineering technology is widely accepted as one of the most fascinating approach to develop the disease resistant transgenic crops using different antimicrobial genes like PR genes. Overexpression of PR genes (chitinase, glucanase, thaumatin, defensin and thionin) individually or in combination have greatly uplifted the level of defense response in plants against a wide range of pathogens. However, the detailed knowledge of signaling pathways that regulates the expression of these versatile proteins is critical for improving crop plants to multiple stresses, which is the future theme of plant stress biology. Hence, this review provides an overall overview on the PR proteins like their classification, role in multiple stresses (biotic and abiotic) as well as in various plant defense signaling cascades. We also highlight the success and snags of transgenic plants expressing PR proteins and peptides. Copyright © 2018 Elsevier GmbH. All rights reserved.

Stimulation of growth by proteorhodopsin phototrophy involves regulation of central metabolic pathways in marine planktonic bacteria.

PubMed

Palovaara, Joakim; Akram, Neelam; Baltar, Federico; Bunse, Carina; Forsberg, Jeremy; Pedrós-Alió, Carlos; González, José M; Pinhassi, Jarone

2014-09-02

Proteorhodopsin (PR) is present in half of surface ocean bacterioplankton, where its light-driven proton pumping provides energy to cells. Indeed, PR promotes growth or survival in different bacteria. However, the metabolic pathways mediating the light responses remain unknown. We analyzed growth of the PR-containing Dokdonia sp. MED134 (where light-stimulated growth had been found) in seawater with low concentrations of mixed [yeast extract and peptone (YEP)] or single (alanine, Ala) carbon compounds as models for rich and poor environments. We discovered changes in gene expression revealing a tightly regulated shift in central metabolic pathways between light and dark conditions. Bacteria showed relatively stronger light responses in Ala compared with YEP. Notably, carbon acquisition pathways shifted toward anaplerotic CO2 fixation in the light, contributing 31 ± 8% and 24 ± 6% of the carbon incorporated into biomass in Ala and YEP, respectively. Thus, MED134 was a facultative double mixotroph, i.e., photo- and chemotrophic for its energy source and using both bicarbonate and organic matter as carbon sources. Unexpectedly, relative expression of the glyoxylate shunt genes (isocitrate lyase and malate synthase) was >300-fold higher in the light--but only in Ala--contributing a more efficient use of carbon from organic compounds. We explored these findings in metagenomes and metatranscriptomes and observed similar prevalence of the glyoxylate shunt compared with PR genes and highest expression of the isocitrate lyase gene coinciding with highest solar irradiance. Thus, regulatory interactions between dissolved organic carbon quality and central metabolic pathways critically determine the fitness of surface ocean bacteria engaging in PR phototrophy.

Comparative Digital Gene Expression Analysis of Tissue-Cultured Plantlets of Highly Resistant and Susceptible Banana Cultivars in Response to Fusarium oxysporum

PubMed Central

Niu, Yuqing; Hu, Bei; Li, Xiaoquan; Chen, Houbin; Šamaj, Jozef; Xu, Chunxiang

2018-01-01

Banana Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc) is one of the most destructive soil-borne diseases. In this study, young tissue-cultured plantlets of banana (Musa spp. AAA) cultivars differing in Foc susceptibility were used to reveal their differential responses to this pathogen using digital gene expression (DGE). Data were evaluated by various bioinformatic tools (Venn diagrams, gene ontology (GO) annotation and Kyoto encyclopedia of genes and genomes (KEGG) pathway analyses) and immunofluorescence labelling method to support the identification of gene candidates determining the resistance of banana against Foc. Interestingly, we have identified MaWRKY50 as an important gene involved in both constitutive and induced resistance. We also identified new genes involved in the resistance of banana to Foc, including several other transcription factors (TFs), pathogenesis-related (PR) genes and some genes related to the plant cell wall biosynthesis or degradation (e.g., pectinesterases, β-glucosidases, xyloglucan endotransglucosylase/hydrolase and endoglucanase). The resistant banana cultivar shows activation of PR-3 and PR-4 genes as well as formation of different constitutive cell barriers to restrict spreading of the pathogen. These data suggest new mechanisms of banana resistance to Foc. PMID:29364855

Molecular cloning and functional characterization of an antifungal PR-5 protein from Ocimum basilicum.

PubMed

Rather, Irshad Ahmad; Awasthi, Praveen; Mahajan, Vidushi; Bedi, Yashbir S; Vishwakarma, Ram A; Gandhi, Sumit G

2015-03-01

Pathogenesis-related (PR) proteins are involved in biotic and abiotic stress responses of plants and are grouped into 17 families (PR-1 to PR-17). PR-5 family includes proteins related to thaumatin and osmotin, with several members possessing antimicrobial properties. In this study, a PR-5 gene showing a high degree of homology with osmotin-like protein was isolated from sweet basil (Ocimum basilicum L.). A complete open reading frame consisting of 675 nucleotides, coding for a precursor protein, was obtained by PCR amplification. Based on sequence comparisons with tobacco osmotin and other osmotin-like proteins (OLPs), this protein was named ObOLP. The predicted mature protein is 225 amino acids in length and contains 16 cysteine residues that may potentially form eight disulfide bonds, a signature common to most PR-5 proteins. Among the various abiotic stress treatments tested, including high salt, mechanical wounding and exogenous phytohormone/elicitor treatments; methyl jasmonate (MeJA) and mechanical wounding significantly induced the expression of ObOLP gene. The coding sequence of ObOLP was cloned and expressed in a bacterial host resulting in a 25kDa recombinant-HIS tagged protein, displaying antifungal activity. The ObOLP protein sequence appears to contain an N-terminal signal peptide with signatures of secretory pathway. Further, our experimental data shows that ObOLP expression is regulated transcriptionally and in silico analysis suggests that it may be post-transcriptionally and post-translationally regulated through microRNAs and post-translational protein modifications, respectively. This study appears to be the first report of isolation and characterization of osmotin-like protein gene from O. basilicum. Copyright © 2014 Elsevier B.V. All rights reserved.

Transcriptome analysis provides insights into the delayed sticky disease symptoms in Carica papaya.

PubMed

Madroñero, Johana; Rodrigues, Silas P; Antunes, Tathiana F S; Abreu, Paolla M V; Ventura, José A; Fernandes, A Alberto R; Fernandes, Patricia Machado Bueno

2018-03-21

Global gene expression analysis indicates host stress responses, mainly those mediated by SA, associated to the tolerance to sticky disease symptoms at pre-flowering stage in Carica papaya. Carica papaya plants develop the papaya sticky disease (PSD) as a result of the combined infection of papaya meleira virus (PMeV) and papaya meleira virus 2 (PMeV2), or PMeV complex. PSD symptoms appear only after C. papaya flowers. To understand the mechanisms involved in this phenomenon, the global gene expression patterns of PMeV complex-infected C. papaya at pre-and post-flowering stages were assessed by RNA-Seq. The result was 633 and 88 differentially expressed genes at pre- and post-flowering stages, respectively. At pre-flowering stage, genes related to stress and transport were up-regulated while metabolism-related genes were down-regulated. It was observed that induction of several salicylic acid (SA)-activated genes, including PR1, PR2, PR5, WRKY transcription factors, ROS and callose genes, suggesting SA signaling involvement in the delayed symptoms. In fact, pre-flowering C. papaya treated with exogenous SA showed a tendency to decrease the PMeV and PMeV2 loads when compared to control plants. However, pre-flowering C. papaya also accumulated transcripts encoding a NPR1-inhibitor (NPR1-I/NIM1-I) candidate, genes coding for UDP-glucosyltransferases (UGTs) and several genes involved with ethylene pathway, known to be negative regulators of SA signaling. At post-flowering, when PSD symptoms appeared, the down-regulation of PR-1 encoding gene and the induction of BSMT1 and JA metabolism-related genes were observed. Hence, SA signaling likely operates at the pre-flowering stage of PMeV complex-infected C. papaya inhibiting the development of PSD symptoms, but the induction of its negative regulators prevents the full-scale and long-lasting tolerance.

LPS-induced systemic inflammation reveals an immunomodulatory role for the prion protein at the blood-brain interface.

PubMed

Salvesen, Ø; Reiten, M R; Espenes, A; Bakkebø, M K; Tranulis, M A; Ersdal, C

2017-05-22

The cellular prion protein (PrP C ) is an evolutionary conserved protein abundantly expressed not only in the central nervous system but also peripherally including the immune system. A line of Norwegian dairy goats naturally devoid of PrP C (PRNP Ter/Ter ) provides a novel model for studying PrP C physiology. In order to explore putative roles for PrP C in acute inflammatory responses, we performed a lipopolysaccharide (LPS, Escherichia coli O26:B6) challenge of 16 goats (8 PRNP +/+ and 8 PRNP Ter/Ter ) and included 10 saline-treated controls (5 of each PRNP genotype). Clinical examinations were performed continuously, and blood samples were collected throughout the trial. Genome-wide transcription profiles of the choroid plexus, which is at the blood-brain interface, and the hippocampus were analyzed by RNA sequencing, and the same tissues were histologically evaluated. All LPS-treated goats displayed clinical signs of sickness behavior, which were of significantly (p < 0.01) longer duration in animals without PrP C . In the choroid plexus, a substantial alteration of the transcriptome and activation of Iba1-positive cells were observed. This response included genotype-dependent differential expression of several genes associated with the immune response, such as ISG15, CXCL12, CXCL14, and acute phase proteins, among others. Activation of cytokine-responsive genes was skewed towards a more profound type I interferon response, and a less obvious type II response, in PrP C -deficient goats. The magnitude of gene expression in response to LPS was smaller in the hippocampus than in the choroid plexus. Resting state expression profiles revealed a few differences between the PRNP genotypes. Our data suggest that PrP C acts as a modulator of certain pathways of innate immunity signaling, particularly downstream of interferons, and probably contributes to protection of vulnerable tissues against inflammatory damage.

Sphingosine-1-Phosphate Signaling and Metabolism Gene Signature in Pediatric Inflammatory Bowel Disease: A Matched-case Control Pilot Study

PubMed Central

Suh, Jung H.; Degagné, Émilie; Gleghorn, Elizabeth E.; Setty, Mala; Rodriguez, Alexis; Park, K. T.; Verstraete, Sofia G.; Heyman, Melvin B.; Patel, Ashish S.; Irek, Melissa; Gildengorin, Ginny L.; Hubbard, Neil E.; Borowsky, Alexander D.; Saba, Julie D.

2018-01-01

Goal The aim of this study was to investigate gene expression levels of proteins involved in sphingosine-1-phosphate (S1P) metabolism and signaling in a pediatric inflammatory bowel disease (IBD) patient population. Background IBD is a debilitating disease affecting 0.4% of the US population. The incidence of IBD in childhood is rising. Identifying effective targeted therapies that can be used safely in young patients and developing tools for selecting specific candidates for targeted therapies are important goals. Clinical IBD trials now underway target S1PR1, a receptor for the pro-inflammatory sphingolipid S1P. However, circulating and tissue sphingolipid levels and S1P-related gene expression have not been characterized in pediatric IBD. Methods Pediatric IBD patients and controls were recruited in a four-site study. Patients received a clinical score using PUCAI or PCDAI evaluation. Colon biopsies were collected during endoscopy. Gene expression was measured by qRT-PCR. Plasma and gut tissue sphingolipids were measured by LC-MS/MS. Results Genes of S1P synthesis (SPHK1, SPHK2), degradation (SGPL1), and signaling (S1PR1, S1PR2, and S1PR4) were significantly upregulated in colon biopsies of IBD patients with moderate/severe symptoms compared with controls or patients in remission. Tissue ceramide, dihydroceramide, and ceramide-1-phosphate (C1P) levels were significantly elevated in IBD patients compared with controls. Conclusions A signature of elevated S1P-related gene expression in colon tissues of pediatric IBD patients correlates with active disease and normalizes in remission. Biopsied gut tissue from symptomatic IBD patients contains high levels of pro-apoptotic and pro-inflammatory sphingolipids. A combined analysis of gut tissue sphingolipid profiles with this S1P-related gene signature may be useful for monitoring response to conventional therapy. PMID:29788359

The Tomato Transcription Factor Pti4 Regulates Defense-Related Gene Expression via GCC Box and Non-GCC Box cis ElementsW⃞

PubMed Central

Chakravarthy, Suma; Tuori, Robert P.; D'Ascenzo, Mark D.; Fobert, Pierre R.; Després, Charles; Martin, Gregory B.

2003-01-01

The tomato transcription factor Pti4, an ethylene-responsive factor (ERF), interacts physically with the disease resistance protein Pto and binds the GCC box cis element that is present in the promoters of many pathogenesis-related (PR) genes. We reported previously that Arabidopsis plants expressing Pti4 constitutively express several GCC box–containing PR genes and show reduced disease symptoms compared with wild-type plants after inoculation with Pseudomonas syringae pv tomato or Erysiphe orontii. To gain insight into how genome-wide gene expression is affected by Pti4, we used serial analysis of gene expression (SAGE) to compare transcripts in wild-type and Pti4-expressing Arabidopsis plants. SAGE provided quantitative measurements of >20,000 transcripts and identified the 50 most highly expressed genes in Arabidopsis vegetative tissues. Comparison of the profiles from wild-type and Pti4-expressing Arabidopsis plants revealed 78 differentially abundant transcripts encoding defense-related proteins, protein kinases, ribosomal proteins, transporters, and two transcription factors (TFs). Many of the genes identified were expressed differentially in wild-type Arabidopsis during infection by Pseudomonas syringae pv tomato, supporting a role for them in defense-related processes. Unexpectedly, the promoters of most Pti4-regulated genes did not have a GCC box. Chromatin immunoprecipitation experiments confirmed that Pti4 binds in vivo to promoters lacking this cis element. Potential binding sites for ERF, MYB, and GBF TFs were present in statistically significantly increased numbers in promoters regulated by Pti4. Thus, Pti4 appears to regulate gene expression directly by binding the GCC box and possibly a non-GCC box element and indirectly by either activating the expression of TF genes or interacting physically with other TFs. PMID:14630974

Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

2008-02-01

The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

Light-promoted rhodopsin expression and starvation survival in the marine dinoflagellate Oxyrrhis marina.

PubMed

Guo, Zhiling; Zhang, Huan; Lin, Senjie

2014-01-01

The discovery of microbial rhodopsins in marine proteobacteria changed the dogma that photosynthesis is the only pathway to use the solar energy for biological utilization in the marine environment. Although homologs of these rhodopsins have been identified in dinoflagellates, the diversity of the encoding genes and their physiological roles remain unexplored. As an initial step toward addressing the gap, we conducted high-throughput transcriptome sequencing on Oxyrrhis marina to retrieve rhodopsin transcripts, rapid amplification of cDNA ends to isolate full-length cDNAs of dominant representatives, and quantitative reverse-transcription PCR to investigate their expression under varying conditions. Our phylogenetic analyses showed that O. marina contained both the proton-pumping type (PR) and sensory type (SR) rhodopsins, and the transcriptome data showed that the PR type dominated over the SR type. We compared rhodopsin gene expression for cultures kept under light: dark cycle and continuous darkness in a time course of 24 days without feeding. Although both types of rhodopsin were expressed under the two conditions, the expression levels of PR were much higher than SR, consistent with the transcriptomic data. Furthermore, relative to cultures kept in the dark, rhodopsin expression levels and cell survival rate were both higher in cultures grown in the light. This is the first report of light-dependent promotion of starvation survival and concomitant promotion of PR expression in a eukaryote. While direct evidence needs to come from functional test on rhodopsins in vitro or gene knockout/knockdown experiments, our results suggest that the proton-pumping rhodopsin might be responsible for the light-enhanced survival of O. marina, as previously demonstrated in bacteria.

A 2.5-Kilobase Deletion Containing a Cluster of Nine MicroRNAs in the Latency-Associated-Transcript Locus of the Pseudorabies Virus Affects the Host Response of Porcine Trigeminal Ganglia during Established Latency

PubMed Central

Mahjoub, Nada; Dhorne-Pollet, Sophie; Fuchs, Walter; Endale Ahanda, Marie-Laure; Lange, Elke; Klupp, Barbara; Arya, Anoop; Loveland, Jane E.; Lefevre, François; Mettenleiter, Thomas C.

2014-01-01

ABSTRACT The alphaherpesvirus pseudorabies virus (PrV) establishes latency primarily in neurons of trigeminal ganglia when only the transcription of the latency-associated transcript (LAT) locus is detected. Eleven microRNAs (miRNAs) cluster within the LAT, suggesting a role in establishment and/or maintenance of latency. We generated a mutant (M) PrV deleted of nine miRNA genes which displayed properties that were almost identical to those of the parental PrV wild type (WT) during propagation in vitro. Fifteen pigs were experimentally infected with either WT or M virus or were mock infected. Similar levels of virus excretion and host antibody response were observed in all infected animals. At 62 days postinfection, trigeminal ganglia were excised and profiled by deep sequencing and quantitative RT-PCR. Latency was established in all infected animals without evidence of viral reactivation, demonstrating that miRNAs are not essential for this process. Lower levels of the large latency transcript (LLT) were found in ganglia infected by M PrV than in those infected by WT PrV. All PrV miRNAs were expressed, with highest expression observed for prv-miR-LLT1, prv-miR-LLT2 (in WT ganglia), and prv-miR-LLT10 (in both WT and M ganglia). No evidence of differentially expressed porcine miRNAs was found. Fifty-four porcine genes were differentially expressed between WT, M, and control ganglia. Both viruses triggered a strong host immune response, but in M ganglia gene upregulation was prevalent. Pathway analyses indicated that several biofunctions, including those related to cell-mediated immune response and the migration of dendritic cells, were impaired in M ganglia. These findings are consistent with a function of the LAT locus in the modulation of host response for maintaining a latent state. IMPORTANCE This study provides a thorough reference on the establishment of latency by PrV in its natural host, the pig. Our results corroborate the evidence obtained from the study of several LAT mutants of other alphaherpesviruses encoding miRNAs from their LAT regions. Neither PrV miRNA expression nor high LLT expression levels are essential to achieve latency in trigeminal ganglia. Once latency is established by PrV, the only remarkable differences are found in the pattern of host response. This indicates that, as in herpes simplex virus, LAT functions as an immune evasion locus. PMID:25320324

Structure and polymorphism of the mouse prion protein gene.

PubMed Central

Westaway, D; Cooper, C; Turner, S; Da Costa, M; Carlson, G A; Prusiner, S B

1994-01-01

Missense mutations in the prion protein (PrP) gene, overexpression of the cellular isoform of PrP (PrPC), and infection with prions containing the scrapie isoform of PrP (PrPSc) all cause neurodegenerative disease. To understand better the physiology and expression of PrPC, we retrieved mouse PrP gene (Prn-p) yeast artificial chromosome (YAC), cosmid, phage, and cDNA clones. Physical mapping positions Prn-p approximately 300 kb from ecotropic virus integration site number 4 (Evi-4), compatible with failure to detect recombination between Prn-p and Evi-4 in genetic crosses. The Prn-pa allele encompasses three exons, with exons 1 and 2 encoding the mRNA 5' untranslated region. Exon 2 has no equivalent in the Syrian hamster and human PrP genes. The Prn-pb gene shares this intron/exon structure but harbors an approximately 6-kb deletion within intron 2. While the Prn-pb open reading frame encodes two amino acid substitutions linked to prolonged scrapie incubation periods, a deletion of intron 2 sequences also characterizes inbred strains such as RIII/S and MOLF/Ei with shorter incubation periods, making a relationship between intron 2 size and scrapie pathogenesis unlikely. The promoter regions of a and b Prn-p alleles include consensus Sp1 and AP-1 sites, as well as other conserved motifs which may represent binding sites for as yet unidentified transcription factors. Images PMID:7912827

Regulation of GABAA and Glutamate Receptor Expression, Synaptic Facilitation and Long-Term Potentiation in the Hippocampus of Prion Mutant Mice

PubMed Central

Rangel, Alejandra; Madroñal, Noelia; Massó, Agnès Gruart i.; Gavín, Rosalina; Llorens, Franc; Sumoy, Lauro; Torres, Juan María; Delgado-García, José María; Río, José Antonio Del

2009-01-01

Background Prionopathies are characterized by spongiform brain degeneration, myoclonia, dementia, and periodic electroencephalographic (EEG) disturbances. The hallmark of prioniopathies is the presence of an abnormal conformational isoform (PrPsc) of the natural cellular prion protein (PrPc) encoded by the Prnp gene. Although several roles have been attributed to PrPc, its putative functions in neuronal excitability are unknown. Although early studies of the behavior of Prnp knockout mice described minor changes, later studies report altered behavior. To date, most functional PrPc studies on synaptic plasticity have been performed in vitro. To our knowledge, only one electrophysiological study has been performed in vivo in anesthetized mice, by Curtis and coworkers. They reported no significant differences in paired-pulse facilitation or LTP in the CA1 region after Schaffer collateral/commissural pathway stimulation. Methodology/Principal Findings Here we explore the role of PrPc expression in neurotransmission and neural excitability using wild-type, Prnp −/− and PrPc-overexpressing mice (Tg20 strain). By correlating histopathology with electrophysiology in living behaving mice, we demonstrate that both Prnp −/− mice but, more relevantly Tg20 mice show increased susceptibility to KA, leading to significant cell death in the hippocampus. This finding correlates with enhanced synaptic facilitation in paired-pulse experiments and hippocampal LTP in living behaving mutant mice. Gene expression profiling using Illumina™ microarrays and Ingenuity pathways analysis showed that 129 genes involved in canonical pathways such as Ubiquitination or Neurotransmission were co-regulated in Prnp −/− and Tg20 mice. Lastly, RT-qPCR of neurotransmission-related genes indicated that subunits of GABAA and AMPA-kainate receptors are co-regulated in both Prnp −/− and Tg20 mice. Conclusions/Significance Present results demonstrate that PrPc is necessary for the proper homeostatic functioning of hippocampal circuits, because of its relationships with GABAA and AMPA-Kainate neurotransmission. New PrPc functions have recently been described, which point to PrPc as a target for putative therapies in Alzheimer's disease. However, our results indicate that a “gain of function” strategy in Alzheimer's disease, or a “loss of function” in prionopathies, may impair PrPc function, with devastating effects. In conclusion, we believe that present data should be taken into account in the development of future therapies. PMID:19855845

Inverse Relationship between Progesterone Receptor and Myc in Endometrial Cancer

PubMed Central

Dai, Donghai; Meng, Xiangbing; Thiel, Kristina W.; Leslie, Kimberly K.; Yang, Shujie

2016-01-01

Endometrial cancer, the most common gynecologic malignancy, is a hormonally-regulated disease. Response to progestin therapy positively correlates with hormone receptor expression, in particular progesterone receptor (PR). However, many advanced tumors lose PR expression. We recently reported that the efficacy of progestin therapy can be significantly enhanced by combining progestin with epigenetic modulators, which we term “molecularly enhanced progestin therapy.” What remained unclear was the mechanism of action and if estrogen receptor α (ERα), the principle inducer of PR, is necessary to restore functional expression of PR via molecularly enhanced progestin therapy. Therefore, we modeled advanced endometrial tumors that have lost both ERα and PR expression by generating ERα-null endometrial cancer cell lines. CRISPR-Cas9 technology was used to delete ERα at the genomic level. Our data demonstrate that treatment with a histone deacetylase inhibitor (HDACi) was sufficient to restore functional PR expression, even in cells devoid of ERα. Our studies also revealed that HDACi treatment results in marked downregulation of the oncogene Myc. We established that PR is a negative transcriptional regulator of Myc in endometrial cancer in the presence or absence of ERα, which is in contrast to studies in breast cancer cells. First, estrogen stimulation augmented PR expression and decreased Myc in endometrial cancer cell lines. Second, progesterone increased PR activity yet blunted Myc mRNA and protein expression. Finally, overexpression of PR by adenoviral transduction in ERα-null endometrial cancer cells significantly decreased expression of Myc and Myc-regulated genes. Analysis of the Cancer Genome Atlas (TCGA) database of endometrial tumors identified an inverse correlation between PR and Myc mRNA levels, with a corresponding inverse correlation between PR and Myc downstream transcriptional targets SRD5A1, CDK2 and CCNB1. Together, these data reveal a previously unanticipated inverse relationship between the tumor suppressor PR and the oncogene Myc in endometrial cancer. PMID:26859414

Cellular prion protein controls stem cell-like properties of human glioblastoma tumor-initiating cells.

PubMed

Corsaro, Alessandro; Bajetto, Adriana; Thellung, Stefano; Begani, Giulia; Villa, Valentina; Nizzari, Mario; Pattarozzi, Alessandra; Solari, Agnese; Gatti, Monica; Pagano, Aldo; Würth, Roberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

2016-06-21

Prion protein (PrPC) is a cell surface glycoprotein whose misfolding is responsible for prion diseases. Although its physiological role is not completely defined, several lines of evidence propose that PrPC is involved in self-renewal, pluripotency gene expression, proliferation and differentiation of neural stem cells. Moreover, PrPC regulates different biological functions in human tumors, including glioblastoma (GBM). We analyzed the role of PrPC in GBM cell pathogenicity focusing on tumor-initiating cells (TICs, or cancer stem cells, CSCs), the subpopulation responsible for development, progression and recurrence of most malignancies. Analyzing four GBM CSC-enriched cultures, we show that PrPC expression is directly correlated with the proliferation rate of the cells. To better define its role in CSC biology, we knocked-down PrPC expression in two of these GBM-derived CSC cultures by specific lentiviral-delivered shRNAs. We provide evidence that CSC proliferation rate, spherogenesis and in vivo tumorigenicity are significantly inhibited in PrPC down-regulated cells. Moreover, PrPC down-regulation caused loss of expression of the stemness and self-renewal markers (NANOG, Sox2) and the activation of differentiation pathways (i.e. increased GFAP expression). Our results suggest that PrPC controls the stemness properties of human GBM CSCs and that its down-regulation induces the acquisition of a more differentiated and less oncogenic phenotype.

Cellular prion protein controls stem cell-like properties of human glioblastoma tumor-initiating cells

PubMed Central

Corsaro, Alessandro; Bajetto, Adriana; Thellung, Stefano; Begani, Giulia; Villa, Valentina; Nizzari, Mario; Pattarozzi, Alessandra; Solari, Agnese; Gatti, Monica; Pagano, Aldo; Würth, Roberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

2016-01-01

Prion protein (PrPC) is a cell surface glycoprotein whose misfolding is responsible for prion diseases. Although its physiological role is not completely defined, several lines of evidence propose that PrPC is involved in self-renewal, pluripotency gene expression, proliferation and differentiation of neural stem cells. Moreover, PrPC regulates different biological functions in human tumors, including glioblastoma (GBM). We analyzed the role of PrPC in GBM cell pathogenicity focusing on tumor-initiating cells (TICs, or cancer stem cells, CSCs), the subpopulation responsible for development, progression and recurrence of most malignancies. Analyzing four GBM CSC-enriched cultures, we show that PrPC expression is directly correlated with the proliferation rate of the cells. To better define its role in CSC biology, we knocked-down PrPC expression in two of these GBM-derived CSC cultures by specific lentiviral-delivered shRNAs. We provide evidence that CSC proliferation rate, spherogenesis and in vivo tumorigenicity are significantly inhibited in PrPC down-regulated cells. Moreover, PrPC down-regulation caused loss of expression of the stemness and self-renewal markers (NANOG, Sox2) and the activation of differentiation pathways (i.e. increased GFAP expression). Our results suggest that PrPC controls the stemness properties of human GBM CSCs and that its down-regulation induces the acquisition of a more differentiated and less oncogenic phenotype. PMID:27229535

The diphenylether herbicide lactofen induces cell death and expression of defense-related genes in soybean.

PubMed

Graham, Madge Y

2005-12-01

Lactofen belongs to the diphenylether class of herbicides, which targets protoporphyrinogen oxidase, which in turn causes singlet oxygen generation. In tolerant plants like soybean (Glycine max), the chemical nonetheless causes necrotic patches called "bronzing" in contact areas. Here it is shown that such bronzing is accompanied by cell death, which was quantified from digital microscopic images using Assess Software. Cellular autofluorescence accompanied cell death, and a homolog of the cell death marker gene, Hsr203j, was induced by lactofen in treated soybean tissues. Thus, this form of chemically induced cell death shares some hallmarks of certain types of programmed cell death. In addition to the cell death phenotype, lactofen caused enhanced expressions of chalcone synthase and chalcone reductase genes, mainly in the exposed and immediately adjacent (proximal) cells. Furthermore, isoflavone synthase genes, which are wound inducible in soybean, were up-regulated by lactofen in both proximal and distal cell zones in minimally wounded cotyledons and further enhanced in wounded tissues. Moreover, if the wall glucan elicitor from Phytophthora sojae was present during lactofen treatment, the induction of isoflavone synthase was even more rapid. These results are consistent with the fact that lactofen triggers massive isoflavone accumulations and activates the capacity for glyceollin elicitation competency. In addition, lactofen induces late expression of a selective set of pathogenesis-related (PR) protein genes, including PR-1a, PR-5, and PR-10, mainly in treated proximal tissues. These various results are discussed in the context of singlet oxygen-induced responses and lactofen's potential as a disease resistance-inducing agent.

SSH reveals a linkage between a senescence-associated protease and Verticillium wilt symptom development in lettuce (Lactuca sativa)

USDA-ARS?s Scientific Manuscript database

Suppression subtractive hybridization (SSH) was employed to identify lettuce (Lactuca sativa) genes that are differentially expressed in symptomatic leaves infected with Verticillium dahliae. Genes expressed only in symptomatic leaves included those with homology to pathogenesis-related (PR) protei...

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

PubMed Central

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-01-01

BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

Impact of pr-10a overexpression on the cryopreservation success of Solanum tuberosum suspension cultures.

PubMed

Vaas, Lea A I; Marheine, Maja; Seufert, Stephanie; Schumacher, Heinz Martin; Kiesecker, Heiko; Heine-Dobbernack, Elke

2012-06-01

Although many genes are supposed to be a part of plant cell tolerance mechanisms against osmotic or salt stress, their influence on tolerance towards stress during cryopreservation procedures has rarely been investigated. For instance, the overexpression of the pathogenesis-related gene 10a (pr-10a) leads to improved osmotic tolerance in a transgenic cell culture of Solanum tuberosum cv. Désirée. In this study, a cryopreservation method, consisting of osmotic pretreatment, cryoprotection with DMSO and controlled-rate freezing, was used to characterize the relation between cryopreservation success and pr-10a expression in suspension cultures of S. tuberosum wild-type cells and cells overexpressing pathogenesis-related protein 10a (Pr-10a). By varying the sorbitol concentration, thus modifying the strength of the osmotic stress during the pretreatment phase, it can be shown that the wild type can successfully be cryopreserved only in a relatively narrow range of sorbitol concentrations, while the pr-10a overexpression leads to an enhanced cryopreservation success over the whole range of applied sorbitol concentrations. Together with transcription data we show that the pr-10a overexpression causes an enhanced osmotic tolerance, which in turn leads to enhanced cryopreservability, but also indicates a role of pr-10a in signal transduction. An increased cryopreservability of the transgenic cell line occurs for pretreatments longer than 24 h. Since both genotypes, characterized by distinct baseline levels of expression, exhibited similar patterns of expression induction, the induction of pr-10a appears to be a key step in the stress signal transduction of plant cells under osmotic stress.

NanoString nCounter® Approach in Breast Cancer: A Comparative Analysis with Quantitative Real-Time Polymerase Chain Reaction, In Situ Hybridization, and Immunohistochemistry.

PubMed

Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon

2017-09-01

Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.

Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

PubMed

Yu, Yue; Lee, Jennifer Suehyun; Xie, Ning; Li, Estelle; Hurtado-Coll, Antonio; Fazli, Ladan; Cox, Michael; Plymate, Stephen; Gleave, Martin; Dong, Xuesen

2014-01-01

Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR) was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1) and interlukin-6 (IL-6) by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

A Novel GABRG2 Mutation, p.R136*, in a family with GEFS+ and extended phenotypes

PubMed Central

Shen, Wangzhen; Pickrell, William O.; Cushion, Thomas D.; Davies, Jeffrey S.; Baer, Kristin; Mullins, Jonathan G.L.; Hammond, Carrie L.; Chung, Seo-Kyung; Thomas, Rhys H.; White, Cathy; Smith, Phil E.M.

2014-01-01

Genetic mutations in voltage-gated and ligand-gated ion channel genes have been identified in a small number of Mendelian families with genetic generalised epilepsies (GGEs). They are commonly associated with febrile seizures (FS), childhood absence epilepsy (CAE) and particularly with generalised or genetic epilepsy with febrile seizures plus (GEFS+). In clinical practice, despite efforts to categorise epilepsy and epilepsy families into syndromic diagnoses, many generalised epilepsies remain unclassified with a presumed genetic basis. During the systematic collection of epilepsy families, we assembled a cohort of families with evidence of GEFS+ and screened for variations in the γ2 subunit of the γ-aminobutyric acid (GABA) type A receptor gene (GABRG2). We detected a novel GABRG2(p.R136*) premature translation termination codon in one index-case from a two-generation nuclear family, presenting with an unclassified GGE, a borderline GEFS+ phenotype with learning difficulties and autism spectrum disorder (ASD). The GABRG2(p.R136*) mutation segregates with the febrile seizure component of this family's GGE and is absent in 190 healthy control samples. In vitro expression assays demonstrated that γ2(p.R136*) subunits were produced, but had reduced cell-surface and total expression. When γ2(p.R136*) subunits were co-expressed with α1 and β2 subunits in HEK 293T cells, GABA–evoked currents were reduced. Furthermore, γ2(p.R136*) subunits were highly-expressed in intracellular aggregations surrounding the nucleus and endoplasmic reticulum (ER), suggesting compromised receptor trafficking. A novel GABRG2(p.R136*) mutation extends the spectrum of GABRG2 mutations identified in GEFS+ and GGE phenotypes, causes GABAA receptor dysfunction, and represents a putative epilepsy mechanism. PMID:24407264

Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda.

PubMed Central

Zabeau, M; Stanley, K K

1982-01-01

Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257

In vivo binding of hot pepper bZIP transcription factor CabZIP1 to the G-box region of pathogenesis-related protein 1 promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Boo-Ja; Park, Chang-Jin; Kim, Sung-Kyu

2006-05-26

We find that salicylic acid and ethephon treatment in hot pepper increases the expression of a putative basic/leucine zipper (bZIP) transcription factor gene, CabZIP1. CabZIP1 mRNA is expressed ubiquitously in various organs. The green fluorescent protein-fused transcription factor, CabZIP1::GFP, can be specifically localized to the nucleus, an action that is consistent with the presence of a nuclear localization signal in its protein sequence. Transient overexpression of the CabZIP1 transcription factor results in an increase in PR-1 transcripts level in Nicotiana benthamiana leaves. Using chromatin immunoprecipitation, we demonstrate that CabZIP1 binds to the G-box elements in native promoter of the hotmore » pepper pathogenesis-related protein 1 (CaPR-1) gene in vivo. Taken together, our results suggest that CabZIP1 plays a role as a transcriptional regulator of the CaPR-1 gene.« less

Tracking Progesterone Receptor-Mediated Actions in Breast Cancer

PubMed Central

Knutson, Todd P.; Lange, Carol A.

2014-01-01

Ovarian steroid hormones contribute to breast cancer initiation and progression primarily through the actions of their nuclear transcription factors, the estrogen receptor alpha (ERα) and progesterone receptors (PRs). These receptors are important drivers of the luminal A and B subtypes of breast cancer, where estrogen-blocking drugs have been effective endocrine therapies for patients with these tumors. However, many patients do not respond, or become resistant to treatment. When endocrine therapies fail, the luminal subtypes of breast cancer are more difficult to treat because these subtypes are among the most heterogeneous in terms of mutation diversity and gene expression profiles. Recent evidence suggests that progestin and PR actions may be important drivers of luminal breast cancers. Clinical trial data has demonstrated that hormone replacement therapy with progestins drives invasive breast cancer and results in greater mortality. PR transcriptional activity is dependent upon cross-talk with growth factor signaling pathways that alter PR phosphorylation, acetylation, or SUMOylation as mechanisms for regulating PR target gene selection required for increased cell proliferation and survival. Site-specific PR phosphorylation is the primary driver of gene-selective PR transcriptional activity. However, PR phosphorylation and heightened transcriptional activity is coupled to rapid PR protein degradation; the range of active PR detected in tumors is likely to be dynamic. Thus, PR target gene signatures may provide a more accurate means of tracking PR’s contribution to tumor progression rather than standard clinical protein-based (IHC) assays. Further development of antiprogestin therapies should be considered along side antiestrogens and aromatase inhibitors. PMID:24291072

Expression profiling of marker genes responsive to the defence-associated phytohormones salicylic acid, jasmonic acid and ethylene in Brachypodium distachyon.

PubMed

Kouzai, Yusuke; Kimura, Mamiko; Yamanaka, Yurie; Watanabe, Megumi; Matsui, Hidenori; Yamamoto, Mikihiro; Ichinose, Yuki; Toyoda, Kazuhiro; Onda, Yoshihiko; Mochida, Keiichi; Noutoshi, Yoshiteru

2016-03-02

Brachypodium distachyon is a promising model plants for grasses. Infections of Brachypodium by various pathogens that severely impair crop production have been reported, and the species accordingly provides an alternative platform for investigating molecular mechanisms of pathogen virulence and plant disease resistance. To date, we have a broad picture of plant immunity only in Arabidopsis and rice; therefore, Brachypodium may constitute a counterpart that displays the commonality and uniqueness of defence systems among plant species. Phytohormones play key roles in plant biotic stress responses, and hormone-responsive genes are used to qualitatively and quantitatively evaluate disease resistance responses during pathogen infection. For these purposes, defence-related phytohormone marker genes expressed at time points suitable for defence-response monitoring are needed. Information about their expression profiles over time as well as their response specificity is also helpful. However, useful marker genes are still rare in Brachypodium. We selected 34 candidates for Brachypodium marker genes on the basis of protein-sequence similarity to known marker genes used in Arabidopsis and rice. Brachypodium plants were treated with the defence-related phytohormones salicylic acid, jasmonic acid and ethylene, and their transcription levels were measured 24 and 48 h after treatment. Two genes for salicylic acid, 7 for jasmonic acid and 2 for ethylene were significantly induced at either or both time points. We then focused on 11 genes encoding pathogenesis-related (PR) 1 protein and compared their expression patterns with those of Arabidopsis and rice. Phylogenetic analysis suggested that Brachypodium contains several PR1-family genes similar to rice genes. Our expression profiling revealed that regulation patterns of some PR1 genes as well as of markers identified for defence-related phytohormones are closely related to those in rice. We propose that the Brachypodium immune hormone marker genes identified in this study will be useful to plant pathologists who use Brachypodium as a model pathosystem, because the timing of their transcriptional activation matches that of the disease resistance response. Our results using Brachypodium also suggest that monocots share a characteristic immune system, defined as the common defence system, that is different from that of dicots.

Hox proteins activate the IGFBP-1 promoter and suppress the function of hPR in human endometrial cells.

PubMed

Gao, Jiaguo; Mazella, James; Tseng, Linda

2002-11-01

Previous studies have shown that progestin activates the transcription of IGFBP-1 (insulin-like growth factor binding protein-1). Four regions in the IGFBP-1 promotor have been identified to enhance the transcription. Two of the regions, located at -73 to -65 bp and -319 to -311 bp formed identical DNA-protein complexes with the nuclear extracts of endometrial stromal/decidual cells. To identify the binding protein(s) in endometrial cells that interact with these two regions, we have used the TGTCAATTA repeats (-319 to -11 bp of the IGFBP-1 promoter) to screen the human decidual cDNA library by yeast one-hybrid system. We found that Hox A10, HoxA11, HoxB2, HoxB4, and HoxD11 interacted with the TGTCAATTA repeats in yeast cells. Among these hox genes, the full-length coding region of HoxA10, HoxA11, and HoxB4 were used for functional analysis in three types of endometrial cells, undifferentiated endometrial stromal cells, decidual cells (differentiated stromal cells) and endometrial adenocarcinoma cell line (HEC1-B). All these endometrial cells produce IGFBP-1. Transient transfection assay showed that HoxA10 expression vector increased the promoter activity (the IGFBP-1 proximal promoter containing TGC/TCAATTA and two functional PRE sites) in endometrial stromal cells and in HEC-1B cells, but not in decidual cells. HoxB4 enhanced the promoter activity only in decidual cells, while HoxA11 had no apparent effect in all three types of cells. To evaluate whether Hox proteins would interact with progesterone receptor (hPR), cells were transfected with the promoter construct, Hox and hPR expression vectors. hPR alone activated the IGFBP-1 promoter activity, but expression of Hox gene suppressed the activation. Hox proteins also suppressed the hPR enhanced promoter activities of MMTV (containing consensus-PRE sites) and glycodelin (GdA, containing Sp1 site which mediates the hPR function). These data showed that Hox genes selectively activate the transcription of the IGFBP-1 and GdA genes in different types of endometrial cells. Hox genes, however, suppress the hPR enhanced activities. In addition, we found that HoxB4 expression was induced by estrogen and progestin. Other investigators have shown that HoxA10 and 11 were stimulated by progestin. These findings show that Hox proteins are molecular mediators of the steroid hormones during endometrial cell development.

Pathogen Infection and MORC Proteins Affect Chromatin Accessibility of Transposable Elements and Expression of Their Proximal Genes in Arabidopsis.

PubMed

Bordiya, Yogendra; Zheng, Yi; Nam, Ji-Chul; Bonnard, April C; Choi, Hyong Woo; Lee, Bum-Kyu; Kim, Jonghwan; Klessig, Daniel F; Fei, Zhangjun; Kang, Hong-Gu

2016-09-01

To assess the role of MORC1 in epigenetics in relation to plant immunity, genome-wide chromatin accessibility was compared between mock- or Pseudomonas syringae pv. tomato-inoculated wild type (WT) Arabidopsis, the morc1/2 double mutant, or both. Most changes in chromatin accessibility, scored by DNase I hypersensitive sites (DHSs), were located in the promoters of genes and transposable elements (TEs). Comparisons between morc1/2 and WT receiving the same treatment revealed differential DHSs (dDHSs) predominantly associated with heterochromatic TEs. By contrast, comparisons between mock- and P. syringae pv. tomato-inoculated plants from the same genotype showed dDHSs associated with biotic and abiotic stress-related genes; a smaller but significant population was in TEs. Moreover, many defense genes, including PR-1, PR-2, and PR-5, were proximal to P. syringae pv. tomato-induced, TE-associated dDHSs. A random subset of these defense genes showed moderately delayed or reduced expression or both in P. syringae pv. tomato-infected morc1/2 as compared with WT. MORC1 was physically bound to chromatin in a P. syringae pv. tomato infection-responsive manner at sites dispersed throughout the genome. Notably, silencing of TE-associated dDHSs proximal to these infection-induced, MORC1-interacting sites led to significant suppression of P. syringae pv. tomato-induced transcription of adjacent defense genes, including PR-1. These results provide evidence that MORC1 is associated with TEs and suggest that a subset of these TEs may help regulate their proximal defense genes.

Binding characteristics of the ovine membrane progesterone receptor alpha and expression of the receptor during the estrous cycle

PubMed Central

Ashley, Ryan L; Arreguin-Arevalo, J Alejandro; Nett, Terry M

2009-01-01

Background Classically, progesterone has been thought to act only through the well-known genomic pathway involving hormone binding to nuclear receptors and subsequent modulation of gene expression. However, there is increasing evidence for rapid, non-genomic effects of progesterone in a variety of mammalian tissues and it is possible that a membrane PR (mPR) is causing these events. We recently isolated and characterized an ovine mPR referred to as mPR-alpha, distinct from the nuclear PR. Based on predicted structural analysis, the ovine mPR-alpha possesses seven transmembrane domains typical of G protein-coupled receptors. Despite the homology to other reported mPRs, information pertaining to the steroid binding characteristics of the ovine mPR-alpha was lacking. Additionally, the ovine mPR-alpha transcript has been identified in the hypothalamus, pituitary, uterus, ovary and corpus luteum, yet changes in expression of the ovine mPR-alpha in these tissues were not known. Consequently, the purpose of this work was to determine the steroid binding characteristics of the ovine mPR-alpha and to investigate possible changes in expression of the ovine mPR-alpha in reproductive tissues throughout the estrous cycle. Methods Binding studies were performed using crude membrane fractions from CHO cells expressing the mPR-alpha. Using quantitative Real-time PCR we determined the expression pattern of mRNA for the ovine mPR-alpha during the ovine estrous cycle in tissues known to express the mPR-alpha. Jugular blood samples were also collected and analyzed for serum concentrations of P4 to ensure ewes were at the appropriate stage of their cycle. Results Only progesterone, 20alpha-hydroxyprogesterone and 17alpha-hydroxyprogesterone were able to displace binding of 3H-P4 (P < 0.001) to membrane fractions from CHO cells expressing ovine mPR-alpha. The average B-max and Kd values for three separate experiments were 624 +/- 119 fmol/micro gram protein and 122 +/- 50 nM, respectively. Significant changes in expression of mRNA for the mPR-alpha during the estrous cycle were noted in the corpus luteum and uterus. Conclusion The mPR-alpha specifically binds progestins and its expression was correlated to progesterone secretion during the ovine estrous cycle. Results from the present studies suggest that mPR-alpha may have an important physiological role during the ovine estrous cycle. PMID:19432978

Inactivation of the Progesterone Receptor in Mx1+ Cells Potentiates Osteogenesis in Calvaria but Not in Long Bone.

PubMed

Zhong, Zhendong A; Sun, Weihua; Chen, Haiyan; Zhang, Hongliang; Lane, Nancy E; Yao, Wei

2015-01-01

The effect of progesterone on bone remains elusive. We previously reported that global progesterone receptor (PR) knockout mice displayed high bone mass phenotype, suggesting that PR influences bone growth and modeling. Recently, Mx1+ cells were characterized to be mesenchymal stem cell-like pluripotent Cells. The aim of this study was to evaluate whether the PR in Mx1+ cells regulates osteogenesis. Using the Mx1-Cre;mT/mG reporter mouse model, we found that the calvarial cells exhibited minimal background Mx1-Cre activity prior to Cre activation by IFNα treatment as compared to the bone marrow stromal cells. IFNα treatment significantly activated Mx1-Cre in the calvarial cells. When the PR gene was deleted in the Mx1-Cre;PR-flox calvarial cells in vitro, significantly higher levels of expression of osteoblast maturation marker genes (RUNX2, Osteocalcin, and Dmp1) and osteogenic potential were detected. The PR-deficient calvariae exhibited greater bone volume, especially in the males. Although Mx1-Cre activity could be induced on the bone surface in vivo, the Mx1+ cells did not differentiate into osteocytes in long bones. Bone volumes at the distal femurs and the bone turnover marker serum Osteocalcin were similar between the Mx1-Cre;PR-flox mutant mice and the corresponding wild types in both sexes. In conclusion, our data demonstrates that blocking progesterone signaling via PRs in calvarial Mx1+ cells promoted osteoblast differentiation in the calvaria. Mx1+ was expressed by heterogeneous cells in bone marrow and did not differentiate into osteocyte during long bone development in vivo. Selectively inactivating the PR gene in Mx1+ cells affected the membrane bone formation but did not affect peripheral skeletal homeostasis.

Tobacco PR-2d promoter is induced in transgenic cucumber in response to biotic and abiotic stimuli.

PubMed

Yin, Zhimin; Hennig, Jacek; Szwacka, Maria; Malepszy, Stefan

2004-05-01

The PR-2d promoter/uidA (GUS) gene construct was introduced into the cucumber (Cucumis sativus L.) genome and several transgenic lines were produced. Activation of the PR-2d promoter was investigated in these plants in response to inoculation with fungal pathogens and after salicylic acid (SA) or cold treatments. Treatment with exogenous SA increased GUS activity 2 to 11 fold over that of the control. Endogenous SA and its conjugate salicylic acid glucoside (SAG) rose in parallel after inoculation with the fungal pathogen Pseudoperonospora cubensis, with SAG becoming the predominant form. The free SA levels increased 15 fold above the basal level at 5 dpi and preceded the induction of the PR-2d promoter by five days, which occurred at 10 dpi with a 12 fold increase over the control. Inoculation with another fungal pathogen, Erysiphe polyphage, increased GUS activity 4 to 44 fold over that of the control. During normal development of flowers in the cucumber, the PR-2d/uidA gene expressed in the floral organs was similar to that of the primary host. In addition, we present the first evidence that the PR-2d promoter was induced (624 fold) under cold stress. We demonstrate that in the heterologous state the gene construct was expressed according to the signalling pattern of the native species and was stably transmitted to progeny over four generations.

Systemic Resistance to Powdery Mildew in Brassica napus (AACC) and Raphanus alboglabra (RRCC) by Trichoderma harzianum TH12

PubMed Central

Alkooranee, Jawadayn Talib; Yin, Yongtai; Aledan, Tamarah Raad; Jiang, Yingfen; Lu, Guangyuan; Wu, Jiangsheng; Li, Maoteng

2015-01-01

Trichoderma harzianum TH12 is a microbial pesticide for certain rapeseed diseases. The mechanism of systemic resistance induced by TH12 or its cell-free culture filtrate (CF) in Brassica napus (AACC) and Raphanus alboglabra (RRCC) to powdery mildew disease caused by ascomycete Erysiphe cruciferarum was investigated. In this study, we conducted the first large-scale global study on the cellular and molecular aspects of B. napus and R. alboglabra infected with E. cruciferarum. The histological study showed the resistance of R. alboglabra to powdery mildew disease. The growth of fungal colonies was not observed on R. alboglabra leaves at 1, 2, 4, 6, 8, and 10 days post-inoculation (dpi), whereas this was clearly observed on B. napus leaves after 6 dpi. In addition, the gene expression of six plant defense-related genes, namely, PR-1, PR-2 (a marker for SA signaling), PR-3, PDF 1.2 (a marker for JA/ET signaling), CHI620, and CHI570, for both genotypes were analyzed in the leaves of B. napus and R. alboglabra after treatment with TH12 or CF and compared with the non-treated ones. The qRT-PCR results showed that the PR-1 and PR-2 expression levels increased in E. cruciferarum-infected leaves, but decreased in the TH12-treated leaves compared with leaves treated with CF. The expression levels of PR-3 and PDF1.2 decreased in plants infected by E. cruciferarum. However, expression levels increased when the leaves were treated with TH12. For the first time, we disclosed the nature of gene expression in B. napus and R. alboglabra to explore the resistance pathways in the leaves of both genotypes infected and non-infected by powdery mildew and inoculated or non-inoculated with elicitor factors. Results suggested that R. alboglabra exhibited resistance to powdery mildew disease, and the application of T. harzianum and its CF are a useful tool to facilitate new protection methods for resist or susceptible plants. PMID:26540161

Systemic Resistance to Powdery Mildew in Brassica napus (AACC) and Raphanus alboglabra (RRCC) by Trichoderma harzianum TH12.

PubMed

Alkooranee, Jawadayn Talib; Yin, Yongtai; Aledan, Tamarah Raad; Jiang, Yingfen; Lu, Guangyuan; Wu, Jiangsheng; Li, Maoteng

2015-01-01

Trichoderma harzianum TH12 is a microbial pesticide for certain rapeseed diseases. The mechanism of systemic resistance induced by TH12 or its cell-free culture filtrate (CF) in Brassica napus (AACC) and Raphanus alboglabra (RRCC) to powdery mildew disease caused by ascomycete Erysiphe cruciferarum was investigated. In this study, we conducted the first large-scale global study on the cellular and molecular aspects of B. napus and R. alboglabra infected with E. cruciferarum. The histological study showed the resistance of R. alboglabra to powdery mildew disease. The growth of fungal colonies was not observed on R. alboglabra leaves at 1, 2, 4, 6, 8, and 10 days post-inoculation (dpi), whereas this was clearly observed on B. napus leaves after 6 dpi. In addition, the gene expression of six plant defense-related genes, namely, PR-1, PR-2 (a marker for SA signaling), PR-3, PDF 1.2 (a marker for JA/ET signaling), CHI620, and CHI570, for both genotypes were analyzed in the leaves of B. napus and R. alboglabra after treatment with TH12 or CF and compared with the non-treated ones. The qRT-PCR results showed that the PR-1 and PR-2 expression levels increased in E. cruciferarum-infected leaves, but decreased in the TH12-treated leaves compared with leaves treated with CF. The expression levels of PR-3 and PDF1.2 decreased in plants infected by E. cruciferarum. However, expression levels increased when the leaves were treated with TH12. For the first time, we disclosed the nature of gene expression in B. napus and R. alboglabra to explore the resistance pathways in the leaves of both genotypes infected and non-infected by powdery mildew and inoculated or non-inoculated with elicitor factors. Results suggested that R. alboglabra exhibited resistance to powdery mildew disease, and the application of T. harzianum and its CF are a useful tool to facilitate new protection methods for resist or susceptible plants.

Stimulus-Dependent, Promoter-Specific Binding of Transcription Factor WRKY1 to Its Native Promoter and the Defense-Related Gene PcPR1-1 in ParsleyW⃞

PubMed Central

Turck, Franziska; Zhou, Aifen; Somssich, Imre E.

2004-01-01

WRKY transcription factors form a large family that plays a role in plant responses to biotic stress and during senescence. Defining in vivo relevant WRKY/promoter relationships has been hampered by the factors' indiscriminate binding to known W box DNA elements and their possible genetic redundance. Employing chromatin immunoprecipitations (ChIP) of cultured cells, we show that parsley (Petroselinum crispum) WRKY1 protein binds to the W boxes of its native promoter as well as to that of PcWRKY3 and the defense-related PR10-class marker gene Pathogenesis-Related1-1 (PcPR1-1). Although present at low concentrations in resting cells, WRKY1 does not appear to play a role in the immediate early gene response upon elicitation because it does not bind to the promoter at this time. Paradoxically, in vivo binding at the PcWRKY1 promoter correlates more with downregulation of gene expression, whereas previous overexpression studies suggested an activating function of WRKY1 on PcWRKY1 expression. By contrast, PcPR1-1 expression remains strong when its promoter is occupied in vivo by WRKY1. Unexpectedly, ChIP revealed that W boxes at promoter sites are constitutively occupied by other WRKY transcription factors, indicating that site recruitment does not seem to play a major role in their regulation. Rather, WRKY proteins very likely act in a network of mutually competing participants with temporal displacement occurring at defined preoccupied sites by other family members in a stimulus-dependent manner. PMID:15367720

Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

PubMed

Kaurilind, Eve; Brosché, Mikael

2017-01-01

Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

Prion Strain Differences in Accumulation of PrPSc on Neurons and Glia Are Associated with Similar Expression Profiles of Neuroinflammatory Genes: Comparison of Three Prion Strains

PubMed Central

Carroll, James A.; Striebel, James F.; Rangel, Alejandra; Woods, Tyson; Phillips, Katie; Peterson, Karin E.; Race, Brent; Chesebro, Bruce

2016-01-01

Misfolding and aggregation of host proteins are important features of the pathogenesis of neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia and prion diseases. In all these diseases, the misfolded protein increases in amount by a mechanism involving seeded polymerization. In prion diseases, host prion protein is misfolded to form a pathogenic protease-resistant form, PrPSc, which accumulates in neurons, astroglia and microglia in the CNS. Here using dual-staining immunohistochemistry, we compared the cell specificity of PrPSc accumulation at early preclinical times post-infection using three mouse scrapie strains that differ in brain regional pathology. PrPSc from each strain had a different pattern of cell specificity. Strain 22L was mainly associated with astroglia, whereas strain ME7 was mainly associated with neurons and neuropil. In thalamus and cortex, strain RML was similar to 22L, but in substantia nigra, RML was similar to ME7. Expression of 90 genes involved in neuroinflammation was studied quantitatively using mRNA from thalamus at preclinical times. Surprisingly, despite the cellular differences in PrPSc accumulation, the pattern of upregulated genes was similar for all three strains, and the small differences observed correlated with variations in the early disease tempo. Gene upregulation correlated with activation of both astroglia and microglia detected in early disease prior to vacuolar pathology or clinical signs. Interestingly, the profile of upregulated genes in scrapie differed markedly from that seen in two acute viral CNS diseases (LaCrosse virus and BE polytropic Friend retrovirus) that had reactive gliosis at levels similar to our prion-infected mice. PMID:27046083

Simultaneous ATM/BRCA1/RAD51 expression variations associated with prognostic factors in Iranian sporadic breast cancer patients.

PubMed

Hallajian, Zeinab; Mahjoubi, Frouzandeh; Nafissi, Nahid

2017-07-01

DNA double-strand breaks (DSBs) as a serious lesion are repaired by non-homologous end-joining and homologous recombination pathways. ATM, BRCA1, RAD51 genes are involved in HR pathways. While some studies have revealed individual expression changes of these genes in different types of cancer, there are limited studies attempting to evaluate correlation of expression variations of these genes in breast cancer pathogenesis. This study aimed to determine RAD51, ATM and BRCA1 gene expression level and its association with clinicopathological factors in fresh breast cancer tissues. Moreover, this study evaluates potential correlations among expression levels of these genes. 50 breast cancer tissues were collected and examined for BRCA1, RAD51 and ATM gene expression by Real Time PCR. Expression changes were analyzed with REST software version 2009. mRNA expression was reduced in all these three genes when compared with β-Actin as a control gene (P value  < 0.001). Spearman's test demonstrated a significant positive correlation among ATM, BRCA1 and RAD51 gene down expression (P value  < 0.0001). There was a significant association between down expression of ATM with stage (P value  < 0.05), necrosis (P value  < 0.05), perineural invasion (P value  < 0.05), vascular invasion (P value  < 0.01), malignancy (P value  ≤ 0.001), PR (P value  < 0.05) and ER status (P value  < 0.01). In addition, there was a significant association between down expression of BRCA1 with Ki67 (P value  ≤ 0.001). Moreover, there was a significant association between down expression of RAD51 with lymph node involvement (P value  < 0.01), auxiliary lymph node metastasis (P value  = 0.01), age (P = 0.001), grade (P value  < 0.05) and PR status (P value  < 0.05). This study suggests association between expression changes in several DSB repair genes in a common functional pathway in breast cancer and the significant association between abnormal expression of these genes and important clinical prognostic factors.

PAM50 Breast Cancer Subtyping by RT-qPCR and Concordance with Standard Clinical Molecular Markers

PubMed Central

2012-01-01

Background Many methodologies have been used in research to identify the “intrinsic” subtypes of breast cancer commonly known as Luminal A, Luminal B, HER2-Enriched (HER2-E) and Basal-like. The PAM50 gene set is often used for gene expression-based subtyping; however, surrogate subtyping using panels of immunohistochemical (IHC) markers are still widely used clinically. Discrepancies between these methods may lead to different treatment decisions. Methods We used the PAM50 RT-qPCR assay to expression profile 814 tumors from the GEICAM/9906 phase III clinical trial that enrolled women with locally advanced primary invasive breast cancer. All samples were scored at a single site by IHC for estrogen receptor (ER), progesterone receptor (PR), and Her2/neu (HER2) protein expression. Equivocal HER2 cases were confirmed by chromogenic in situ hybridization (CISH). Single gene scores by IHC/CISH were compared with RT-qPCR continuous gene expression values and “intrinsic” subtype assignment by the PAM50. High, medium, and low expression for ESR1, PGR, ERBB2, and proliferation were selected using quartile cut-points from the continuous RT-qPCR data across the PAM50 subtype assignments. Results ESR1, PGR, and ERBB2 gene expression had high agreement with established binary IHC cut-points (area under the curve (AUC) ≥ 0.9). Estrogen receptor positivity by IHC was strongly associated with Luminal (A and B) subtypes (92%), but only 75% of ER negative tumors were classified into the HER2-E and Basal-like subtypes. Luminal A tumors more frequently expressed PR than Luminal B (94% vs 74%) and Luminal A tumors were less likely to have high proliferation (11% vs 77%). Seventy-seven percent (30/39) of ER-/HER2+ tumors by IHC were classified as the HER2-E subtype. Triple negative tumors were mainly comprised of Basal-like (57%) and HER2-E (30%) subtypes. Single gene scoring for ESR1, PGR, and ERBB2 was more prognostic than the corresponding IHC markers as shown in a multivariate analysis. Conclusions The standard immunohistochemical panel for breast cancer (ER, PR, and HER2) does not adequately identify the PAM50 gene expression subtypes. Although there is high agreement between biomarker scoring by protein immunohistochemistry and gene expression, the gene expression determinations for ESR1 and ERBB2 status was more prognostic. PMID:23035882

Conserved Epigenetic Mechanisms Could Play a Key Role in Regulation of Photosynthesis and Development-Related Genes during Needle Development of Pinus radiata.

PubMed

Valledor, Luis; Pascual, Jesús; Meijón, Mónica; Escandón, Mónica; Cañal, María Jesús

2015-01-01

Needle maturation is a complex process that involves cell growth, differentiation and tissue remodelling towards the acquisition of full physiological competence. Leaf induction mechanisms are well known; however, those underlying the acquisition of physiological competence are still poorly understood, especially in conifers. We studied the specific epigenetic regulation of genes defining organ function (PrRBCS and PrRBCA) and competence and stress response (PrCSDP2 and PrSHMT4) during three stages of needle development and one de-differentiated control. Gene-specific changes in DNA methylation and histone were analysed by bisulfite sequencing and chromatin immunoprecipitation (ChIP). The expression of PrRBCA and PrRBCS increased during needle maturation and was associated with the progressive loss of H3K9me3, H3K27me3 and the increase in AcH4. The maturation-related silencing of PrSHMT4 was correlated with increased H3K9me3 levels, and the repression of PrCSDP2, to the interplay between AcH4, H3K27me3, H3K9me3 and specific DNA methylation. The employ of HAT and HDAC inhibitors led to a further determination of the role of histone acetylation in the regulation of our target genes. The integration of these results with high-throughput analyses in Arabidopsis thaliana and Populus trichocarpa suggests that the specific epigenetic mechanisms that regulate photosynthetic genes are conserved between the analysed species.

Conserved Epigenetic Mechanisms Could Play a Key Role in Regulation of Photosynthesis and Development-Related Genes during Needle Development of Pinus radiata

PubMed Central

Meijón, Mónica; Escandón, Mónica; Cañal, María Jesús

2015-01-01

Needle maturation is a complex process that involves cell growth, differentiation and tissue remodelling towards the acquisition of full physiological competence. Leaf induction mechanisms are well known; however, those underlying the acquisition of physiological competence are still poorly understood, especially in conifers. We studied the specific epigenetic regulation of genes defining organ function (PrRBCS and PrRBCA) and competence and stress response (PrCSDP2 and PrSHMT4) during three stages of needle development and one de-differentiated control. Gene-specific changes in DNA methylation and histone were analysed by bisulfite sequencing and chromatin immunoprecipitation (ChIP). The expression of PrRBCA and PrRBCS increased during needle maturation and was associated with the progressive loss of H3K9me3, H3K27me3 and the increase in AcH4. The maturation-related silencing of PrSHMT4 was correlated with increased H3K9me3 levels, and the repression of PrCSDP2, to the interplay between AcH4, H3K27me3, H3K9me3 and specific DNA methylation. The employ of HAT and HDAC inhibitors led to a further determination of the role of histone acetylation in the regulation of our target genes. The integration of these results with high-throughput analyses in Arabidopsis thaliana and Populus trichocarpa suggests that the specific epigenetic mechanisms that regulate photosynthetic genes are conserved between the analysed species. PMID:25965766

Gene expression profiling of mesenteric lymph nodes from sheep with natural scrapie

PubMed Central

2014-01-01

Background Prion diseases are characterized by the accumulation of the pathogenic PrPSc protein, mainly in the brain and the lymphoreticular system. Although prions multiply/accumulate in the lymph nodes without any detectable pathology, transcriptional changes in this tissue may reflect biological processes that contribute to the molecular pathogenesis of prion diseases. Little is known about the molecular processes that occur in the lymphoreticular system in early and late stages of prion disease. We performed a microarray-based study to identify genes that are differentially expressed at different disease stages in the mesenteric lymph node of sheep naturally infected with scrapie. Oligo DNA microarrays were used to identify gene-expression profiles in the early/middle (preclinical) and late (clinical) stages of the disease. Results In the clinical stage of the disease, we detected 105 genes that were differentially expressed (≥2-fold change in expression). Of these, 43 were upregulated and 62 downregulated as compared with age-matched negative controls. Fewer genes (50) were differentially expressed in the preclinical stage of the disease. Gene Ontology enrichment analysis revealed that the differentially expressed genes were largely associated with the following terms: glycoprotein, extracellular region, disulfide bond, cell cycle and extracellular matrix. Moreover, some of the annotated genes could be grouped into 3 specific signaling pathways: focal adhesion, PPAR signaling and ECM-receptor interaction. We discuss the relationship between the observed gene expression profiles and PrPSc deposition and the potential involvement in the pathogenesis of scrapie of 7 specific differentially expressed genes whose expression levels were confirmed by real time-PCR. Conclusions The present findings identify new genes that may be involved in the pathogenesis of natural scrapie infection in the lymphoreticular system, and confirm previous reports describing scrapie-induced alterations in the expression of genes involved in protein misfolding, angiogenesis and the oxidative stress response. Further studies will be necessary to determine the role of these genes in prion replication, dissemination and in the response of the organism to this disease. PMID:24450868

HIV-1 Protease in the Fission Yeast Schizosaccharomyces pombe.

PubMed

Benko, Zsigmond; Elder, Robert T; Li, Ge; Liang, Dong; Zhao, Richard Y

2016-01-01

HIV-1 protease (PR) is an essential viral enzyme. Its primary function is to proteolyze the viral Gag-Pol polyprotein for production of viral enzymes and structural proteins and for maturation of infectious viral particles. Increasing evidence suggests that PR cleaves host cellular proteins. However, the nature of PR-host cellular protein interactions is elusive. This study aimed to develop a fission yeast (Schizosaccharomyces pombe) model system and to examine the possible interaction of HIV-1 PR with cellular proteins and its potential impact on cell proliferation and viability. A fission yeast strain RE294 was created that carried a single integrated copy of the PR gene in its chromosome. The PR gene was expressed using an inducible nmt1 promoter so that PR-specific effects could be measured. HIV-1 PR from this system cleaved the same indigenous viral p6/MA protein substrate as it does in natural HIV-1 infections. HIV-1 PR expression in fission yeast cells prevented cell proliferation and induced cellular oxidative stress and changes in mitochondrial morphology that led to cell death. Both these PR activities can be prevented by a PR-specific enzymatic inhibitor, indinavir, suggesting that PR-mediated proteolytic activities and cytotoxic effects resulted from enzymatic activities of HIV-1 PR. Through genome-wide screening, a serine/threonine kinase, Hhp2, was identified that suppresses HIV-1 PR-induced protease cleavage and cell death in fission yeast and in mammalian cells, where it prevented PR-induced apoptosis and cleavage of caspase-3 and caspase-8. This is the first report to show that HIV-1 protease is functional as an enzyme in fission yeast, and that it behaves in a similar manner as it does in HIV-1 infection. HIV-1 PR-induced cell death in fission yeast could potentially be used as an endpoint for mechanistic studies, and this system could be used for developing a high-throughput system for drug screenings.

Expression of an additional cathelicidin antimicrobial peptide protects against bacterial skin infection.

PubMed

Lee, Phillip H A; Ohtake, Takaaki; Zaiou, Mohamed; Murakami, Masamoto; Rudisill, Jennifer A; Lin, Kenneth H; Gallo, Richard L

2005-03-08

Cathelicidin antimicrobial peptides are effectors of innate immune defense in mammals. Humans and mice have only one cathelicidin gene, whereas domesticated mammals such as the pig, cow, and horse have multiple cathelicidin genes. We hypothesized that the evolution of multiple cathelicidin genes provides these animals with enhanced resistance to infection. To test this, we investigated the effects of the addition of cathelicidins by combining synthetic cathelicidin peptides in vitro, by producing human keratinocytes that overexpress cathelicidins in culture, or by producing transgenic mice that constitutively overexpress cathelicidins in vivo. The porcine cathelicidin peptide PR-39 acted additively with human cathelicidin LL-37 to kill group A Streptococcus (GAS). Lentiviral delivery of PR-39 enhanced killing of GAS by human keratinocytes. Finally, transgenic mice expressing PR-39 under the influence of a K14 promoter showed increased resistance to GAS skin infection (50% smaller necrotic ulcers and 60% fewer surviving bacteria). Similarly constructed transgenic mice designed to overexpress their native cathelicidin did not show increased resistance. These findings demonstrate that targeted gene transfer of a xenobiotic cathelicidin confers resistance against infection and suggests the benefit of duplication and divergence in the evolution of antimicrobial peptides.

Tumor gene expression and prognosis in breast cancer patients with 10 or more positive lymph nodes.

PubMed

Cobleigh, Melody A; Tabesh, Bita; Bitterman, Pincas; Baker, Joffre; Cronin, Maureen; Liu, Mei-Lan; Borchik, Russell; Mosquera, Juan-Miguel; Walker, Michael G; Shak, Steven

2005-12-15

This study, along with two others, was done to develop the 21-gene Recurrence Score assay (Oncotype DX) that was validated in a subsequent independent study and is used to aid decision making about chemotherapy in estrogen receptor (ER)-positive, node-negative breast cancer patients. Patients with >or=10 nodes diagnosed from 1979 to 1999 were identified. RNA was extracted from paraffin blocks, and expression of 203 candidate genes was quantified using reverse transcription-PCR (RT-PCR). Seventy-eight patients were studied. As of August 2002, 77% of patients had distant recurrence or breast cancer death. Univariate Cox analysis of clinical and immunohistochemistry variables indicated that HER2/immunohistochemistry, number of involved nodes, progesterone receptor (PR)/immunohistochemistry (% cells), and ER/immunohistochemistry (% cells) were significantly associated with distant recurrence-free survival (DRFS). Univariate Cox analysis identified 22 genes associated with DRFS. Higher expression correlated with shorter DRFS for the HER2 adaptor GRB7 and the macrophage marker CD68. Higher expression correlated with longer DRFS for tumor protein p53-binding protein 2 (TP53BP2) and the ER axis genes PR and Bcl2. Multivariate methods, including stepwise variable selection and bootstrap resampling of the Cox proportional hazards regression model, identified several genes, including TP53BP2 and Bcl2, as significant predictors of DRFS. Tumor gene expression profiles of archival tissues, some more than 20 years old, provide significant information about risk of distant recurrence even among patients with 10 or more nodes.

High humidity suppresses ssi4-mediated cell death and disease resistance upstream of MAP kinase activation, H2O2 production and defense gene expression.

PubMed

Zhou, Fasong; Menke, Frank L H; Yoshioka, Keiko; Moder, Wolfgang; Shirano, Yumiko; Klessig, Daniel F

2004-09-01

The Arabidopsis ssi4 mutant, which exhibits spontaneous lesion formation, constitutive expression of pathogenesis-related (PR) genes and enhanced resistance to virulent bacterial and oomycete pathogens, contains a gain-of-function mutation in a TIR-NBS-LRR type R gene. Epistatic analyses revealed that both PR gene expression and disease resistance are activated via a salicylic acid (SA)- and EDS1-dependent, but NPR1- and NDR1-independent signaling pathway. In this study, we demonstrate that in moderate relative humidity (RH; 60%), the ssi4 mutant accumulates H(2)O(2) and SA prior to lesion formation and displays constitutive activation of the MAP kinases AtMPK6 and AtMPK3. It also constitutively expresses a variety of defense-associated genes, including those encoding the WRKY transcription factors AtWRKY29 and AtWRKY6, the MAP kinases AtMPK6 and AtMPK3, the powdery mildew R proteins RPW8.1 and RPW8.2, EDS1 and PR proteins. All of these ssi4-induced responses, as well as the chlorotic, stunted morphology and enhanced disease resistance phenotype, are suppressed by high RH (95%) growth conditions. Thus, a humidity sensitive factor (HSF) appears to function at an early point in the ssi4 signaling pathway. All ssi4 phenotypes, except for MAP kinase activation, also were suppressed by the eds1-1 mutation. Thus, ssi4-induced MAP kinase activation occurs downstream of the HSF but either upstream of EDS1 or on a separate branch of the ssi4 signaling pathway. SA is a critical signaling component in ssi4-mediated defense responses. However, exogenously supplied SA failed to restore lesion formation in high RH-grown ssi4 plants, although it induced defense gene expression. Thus, additional signals also are involved.

Systemic resistance induced in Arabidopsis thaliana by Trichoderma asperellum SKT-1, a microbial pesticide of seedborne diseases of rice.

PubMed

Yoshioka, Yohei; Ichikawa, Haruki; Naznin, Hushna Ara; Kogure, Atsushi; Hyakumachi, Mitsuro

2012-01-01

Trichoderma asperellum SKT-1 is a microbial pesticide of seedborne diseases of rice. To investigate the mechanisms of disease suppression in SKT-1, the ability to induce systemic resistance by SKT-1, or its cell-free culture filtrate (CF), was tested using Arabidopsis thaliana Col-0 plants. Both SKT-1 and its CF elicit an induced systemic resistance against the bacterial leaf speck pathogen Pseudomonas syringae pv. tomato DC3000 in Col-0 plants. Involvement of plant hormones in the induced resistance by SKT-1 and CF was assessed using Arabidopsis genotypes such as the jasmonic acid (JA)-resistant mutant jar1, the ethylene (ET)-resistant mutant etr1, the plant impaired in salicylic acid (SA) signalling transgenic NahG and the mutant npr1 impaired in NPR1 activity. In soil experiments using SKT-1, no significant disease suppression effect was observed in NahG transgenic plants or npr1 mutant plants. Expression levels of SA-inducible genes such as PR-1, PR-2 and PR-5 increased substantially in the leaves of Col-0 plants. Expression levels of JA/ET-induced genes such as PDF1.2a, PR-3, PR-4 and AtVsp1 were also induced, but the levels were not as high as for SA-inducible genes. In a hydroponic experiment using CF from SKT-1, all Arabidopsis genotypes showed an induced systemic resistance by CF and increased expression levels of JA/ET- and SA-inducible genes in leaves of CF-treated plants. The SA signalling pathway is important in inducing systemic resistance to colonisation by SKT-1, and both SA and JA/ET signalling pathways combine in the signalling of induced resistance by CF. These results indicate that the response of A. thaliana is different from that found in root treatments with barley grain inoculum and CF from SKT-1. Copyright © 2011 Society of Chemical Industry.

Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

PubMed

Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

2008-05-20

Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

A GFP Expressing Influenza A Virus to Report In Vivo Tropism and Protection by a Matrix Protein 2 Ectodomain-Specific Monoclonal Antibody

PubMed Central

Van den Hoecke, Silvie; Smet, Anouk; Schotsaert, Michael; Job, Emma R.; Roose, Kenny; Schepens, Bert; Fiers, Walter; Saelens, Xavier

2015-01-01

The severity of influenza-related illness is mediated by many factors, including in vivo cell tropism, timing and magnitude of the immune response, and presence of pre-existing immunity. A direct way to study cell tropism and virus spread in vivo is with an influenza virus expressing a reporter gene. However, reporter gene-expressing influenza viruses are often attenuated in vivo and may be genetically unstable. Here, we describe the generation of an influenza A virus expressing GFP from a tri-cistronic NS segment. To reduce the size of this engineered gene segment, we used a truncated NS1 protein of 73 amino acids combined with a heterologous dimerization domain to increase protein stability. GFP and nuclear export protein coding information were fused in frame with the truncated NS1 open reading frame and separated from each other by 2A self-processing sites. The resulting PR8-NS1(1–73)GFP virus was successfully rescued and replicated as efficiently as the parental PR8 virus in vitro and was slightly attenuated in vivo. Flow cytometry-based monitoring of cells isolated from PR8-NS1(1–73)GFP virus infected BALB/c mice revealed that GFP expression peaked on day two in all cell types tested. In particular respiratory epithelial cells and myeloid cells known to be involved in antigen presentation, including dendritic cells (CD11c+) and inflammatory monocytes (CD11b+ GR1+), became GFP positive following infection. Prophylactic treatment with anti-M2e monoclonal antibody or oseltamivir reduced GFP expression in all cell types studied, demonstrating the usefulness of this reporter virus to analyze the efficacy of antiviral treatments in vivo. Finally, deep sequencing analysis, serial in vitro passages and ex vivo analysis of PR8-NS1(1–73)GFP virus, indicate that this virus is genetically and phenotypically stable. PMID:25816132

A GFP expressing influenza A virus to report in vivo tropism and protection by a matrix protein 2 ectodomain-specific monoclonal antibody.

PubMed

De Baets, Sarah; Verhelst, Judith; Van den Hoecke, Silvie; Smet, Anouk; Schotsaert, Michael; Job, Emma R; Roose, Kenny; Schepens, Bert; Fiers, Walter; Saelens, Xavier

2015-01-01

The severity of influenza-related illness is mediated by many factors, including in vivo cell tropism, timing and magnitude of the immune response, and presence of pre-existing immunity. A direct way to study cell tropism and virus spread in vivo is with an influenza virus expressing a reporter gene. However, reporter gene-expressing influenza viruses are often attenuated in vivo and may be genetically unstable. Here, we describe the generation of an influenza A virus expressing GFP from a tri-cistronic NS segment. To reduce the size of this engineered gene segment, we used a truncated NS1 protein of 73 amino acids combined with a heterologous dimerization domain to increase protein stability. GFP and nuclear export protein coding information were fused in frame with the truncated NS1 open reading frame and separated from each other by 2A self-processing sites. The resulting PR8-NS1(1-73)GFP virus was successfully rescued and replicated as efficiently as the parental PR8 virus in vitro and was slightly attenuated in vivo. Flow cytometry-based monitoring of cells isolated from PR8-NS1(1-73)GFP virus infected BALB/c mice revealed that GFP expression peaked on day two in all cell types tested. In particular respiratory epithelial cells and myeloid cells known to be involved in antigen presentation, including dendritic cells (CD11c+) and inflammatory monocytes (CD11b+ GR1+), became GFP positive following infection. Prophylactic treatment with anti-M2e monoclonal antibody or oseltamivir reduced GFP expression in all cell types studied, demonstrating the usefulness of this reporter virus to analyze the efficacy of antiviral treatments in vivo. Finally, deep sequencing analysis, serial in vitro passages and ex vivo analysis of PR8-NS1(1-73)GFP virus, indicate that this virus is genetically and phenotypically stable.

Nicotiana tabacum overexpressing γ-ECS exhibits biotic stress tolerance likely through NPR1-dependent salicylic acid-mediated pathway.

PubMed

Ghanta, Srijani; Bhattacharyya, Dipto; Sinha, Ragini; Banerjee, Anindita; Chattopadhyay, Sharmila

2011-05-01

The elaborate networks and the crosstalk of established signaling molecules like salicylic acid (SA), jasmonic acid (JA), ethylene (ET), abscisic acid (ABA), reactive oxygen species (ROS) and glutathione (GSH) play key role in plant defense response. To obtain further insight into the mechanism through which GSH is involved in this crosstalk to mitigate biotic stress, transgenic Nicotiana tabacum overexpressing Lycopersicon esculentum gamma-glutamylcysteine synthetase (LeECS) gene (NtGB lines) were generated with enhanced level of GSH in comparison with wild-type plants exhibiting resistance to pathogenesis as well. The expression levels of non-expressor of pathogenesis-related genes 1 (NPR1)-dependent genes like pathogenesis-related gene 1 (NtPR1), mitogen-activated protein kinase kinase (NtMAPKK), glutamine synthetase (NtGLS) were significantly enhanced along with NtNPR1. However, the expression levels of NPR1-independent genes like NtPR2, NtPR5 and short-chain dehydrogenase/reductase family protein (NtSDRLP) were either insignificant or were downregulated. Additionally, increase in expression of thioredoxin (NtTRXh), S-nitrosoglutathione reductase 1 (NtGSNOR1) and suppression of isochorismate synthase 1 (NtICS1) was noted. Comprehensive analysis of GSH-fed tobacco BY2 cell line in a time-dependent manner reciprocated the in planta results. Better tolerance of NtGB lines against biotrophic Pseudomonas syringae pv. tabaci was noted as compared to necrotrophic Alternaria alternata. Through two-dimensional gel electrophoresis (2-DE) and image analysis, 48 differentially expressed spots were identified and through identification as well as functional categorization, ten proteins were found to be SA-related. Collectively, our results suggest GSH to be a member in cross-communication with other signaling molecules in mitigating biotic stress likely through NPR1-dependent SA-mediated pathway.

Cloning and Characterization of the Gene Encoding Alpha-Pinene Oxide Lyase Enzyme (Prα-POL) from Pseudomonas rhodesiae CIP 107491 and Production of the Recombinant Protein in Escherichia coli.

PubMed

Dubessay, Pascal; Larroche, Christian; Fontanille, Pierre

2017-12-28

The alpha-pinene oxide lyase (Prα-POL) from Pseudomonas rhodesiae CIP107491 belongs to catabolic alpha-pinene degradation pathway. In this study, the gene encoding Prα-POL has been identified using mapping approach combined to inverse PCR (iPCR) strategy. The Prα-POL gene included a 609-bp open reading frame encoding 202 amino acids and giving rise to a 23.7 kDa protein, with a theoretical isoelectric point (pI) of 5.23. The amino acids sequence analysis showed homologies with those of proteins with unknown function from GammaProteobacteria group. Identification of a conserved domain in amino acid in positions 18 to 190 permitted to classify Prα-POL among the nuclear transport factor 2 (NTF2) protein superfamily. Heterologous expression of Prα-POL, both under its native form and with a histidin tag, was successfully performed in Escherichia coli, and enzymatic kinetics were analyzed. Bioconversion assay using recombinant E. coli strain allowed to reach a rate of isonovalal production per gramme of biomass about 40-fold higher than the rate obtained with P. rhodesiae.

Expression of glycine-rich protein genes, AtGRP5 and AtGRP23, induced by the cutin monomer 16-hydroxypalmitic acid in Arabidopsis thaliana.

PubMed

Park, Jong Ho; Suh, Mi Chung; Kim, Tae Hyun; Kim, Moon Chul; Cho, Sung Ho

2008-11-01

Glycine-rich proteins (GRPs) belong to a large family of heterogenous proteins that are enriched in glycine residues. The expression of two GRP genes of Arabidopsis thaliana, AtGRP5 and AtGRP23, was induced by 16-hydroxypalmitic acid (HPA), a major component of cutin. The expression of AtGRP3, which encodes a GRP protein that is structurally different from AtGRP5 and AtGRP23, was not responsive to HPA application. Treatment with HPA also induced expression of the pathogen-related PR-1 and PR-4 genes. Abscisic acid and salicylic acid treatments enhanced the transcript levels of AtGRP5 and AtGRP23 as well as those of AtGRP3. It was also demonstrated that HPA effectively elicited the accumulation of H2O2 in rosette leaves of Arabidopsis. Results suggest the possible role of some species of GRPs, such as AtGRP5 and AtGRP23, in response to the pathogenic invasion mediated by cutin monomers in plants.

Immunization of pigs with an attenuated pseudorabies virus recombinant expressing the haemagglutinin of pandemic swine origin H1N1 influenza A virus.

PubMed

Klingbeil, Katharina; Lange, Elke; Teifke, Jens P; Mettenleiter, Thomas C; Fuchs, Walter

2014-04-01

Pigs can be severely harmed by influenza, and represent important reservoir hosts, in which new human pathogens such as the recent pandemic swine-origin H1N1 influenza A virus can arise by mutation and reassortment of genome segments. To obtain novel, safe influenza vaccines for pigs, and to investigate the antigen-specific immune response, we modified an established live-virus vaccine against Aujeszky's disease of swine, pseudorabies virus (PrV) strain Bartha (PrV-Ba), to serve as vector for the expression of haemagglutinin (HA) of swine-origin H1N1 virus. To facilitate transgene insertion, the genome of PrV-Ba was cloned as a bacterial artificial chromosome. HA expression occurred under control of the human or murine cytomegalovirus immediate early promoters (P-HCMV, P-MCMV), but could be substantially enhanced by synthetic introns and adaptation of the codon usage to that of PrV. However, despite abundant expression, the heterologous glycoprotein was not detectably incorporated into mature PrV particles. Replication of HA-expressing PrV in cell culture was only slightly affected compared to that of the parental virus strain. A single immunization of pigs with the PrV vector expressing the codon-optimized HA gene under control of P-MCMV induced high levels of HA-specific antibodies. The vaccinated animals were protected from clinical signs after challenge with a related swine-origin H1N1 influenza A virus, and challenge virus shedding was significantly reduced.

Is There a Link between Human Herpesvirus Infection and Toll-like Receptors in the Pathogenesis of Pityriasis Rosea? A Case-control Study.

PubMed

El-Ela, Mostafa Abou; Shaarawy, Eman; El-Komy, Mohamed; Fawzy, Marwa; Hay, Rania Abdel; Hegazy, Rehab; Sharobim, Amin; Moustafa, Nadine; Rashed, Laila; Sayed Amr, Khalda Sayed

2016-12-01

Human herpesvirus (HHV) 6 and 7 are involved in the pathogenesis of pityriasis rosea (PR). Our aim was to evaluate the role of the innate immune response in PR through the detection of Toll-like receptors (TLR) 2, 3, 4, 7, 8, and 9 expression in the skin of affected patients and to detect the possibility of being induced by HHV-6 and/or HHV-7 viral coexistence in these patients. Twenty-four patients with PR and 24 healthy controls were included in this case-control study. Biopsy was obtained from the PR lesion and from the healthy skin of controls for detection of HHV-6 and 7 as well as TLRs 2, 3, 4, 7, 8, and 9 gene expression using real-time polymerase chain reaction (PCR). Significantly elevated expression of all studied TLRs and significantly higher viral load of HHV-6 and 7 in PR cases were detected. A significant higher expression of TLR2 and 4 in HHV-7 positive cases and a significant positive correlation between TLR9 and HHV-7 viral load were documented. HHV6 and 7 may also be involved in the pathogenesis of PR via TLR pathways.

Prenatal Ethanol Exposure and Neocortical Development: A Transgenerational Model of FASD.

PubMed

Abbott, Charles W; Rohac, David J; Bottom, Riley T; Patadia, Sahil; Huffman, Kelly J

2017-07-06

Fetal Alcohol Spectrum Disorders, or FASD, represent a range of adverse developmental conditions caused by prenatal ethanol exposure (PrEE) from maternal consumption of alcohol. PrEE induces neurobiological damage in the developing brain leading to cognitive-perceptual and behavioral deficits in the offspring. Alcohol-mediated alterations to epigenetic function may underlie PrEE-related brain dysfunction, with these changes potentially carried across generations to unexposed offspring. To determine the transgenerational impact of PrEE on neocortical development, we generated a mouse model of FASD and identified numerous stable phenotypes transmitted via the male germline to the unexposed third generation. These include alterations in ectopic intraneocortical connectivity, upregulation of neocortical Rzrβ and Id2 expression accompanied by both promoter hypomethylation of these genes and decreased global DNA methylation levels. DNMT expression was also suppressed in newborn PrEE cortex, providing further insight into how ethanol perturbs DNA methylation leading to altered regulation of gene transcription. These PrEE-induced, transgenerational phenotypes may be responsible for cognitive, sensorimotor, and behavioral deficits seen in humans with FASD. Thus, understanding the possible epigenetic mechanisms by which these phenotypes are generated may reveal novel targets for therapeutic intervention of FASD and lead to advances in human health. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Progesterone receptor blockade in human breast cancer cells decreases cell cycle progression through G2/M by repressing G2/M genes.

PubMed

Clare, Susan E; Gupta, Akash; Choi, MiRan; Ranjan, Manish; Lee, Oukseub; Wang, Jun; Ivancic, David Z; Kim, J Julie; Khan, Seema A

2016-05-23

The synthesis of specific, potent progesterone antagonists adds potential agents to the breast cancer prevention and treatment armamentarium. The identification of individuals who will benefit from these agents will be a critical factor for their clinical success. We utilized telapristone acetate (TPA; CDB-4124) to understand the effects of progesterone receptor (PR) blockade on proliferation, apoptosis, promoter binding, cell cycle progression, and gene expression. We then identified a set of genes that overlap with human breast luteal-phase expressed genes and signify progesterone activity in both normal breast cells and breast cancer cell lines. TPA administration to T47D cells results in a 30 % decrease in cell number at 24 h, which is maintained over 72 h only in the presence of estradiol. Blockade of progesterone signaling by TPA for 24 h results in fewer cells in G2/M, attributable to decreased expression of genes that facilitate the G2/M transition. Gene expression data suggest that TPA affects several mechanisms that progesterone utilizes to control gene expression, including specific post-translational modifications, and nucleosomal organization and higher order chromatin structure, which regulate access of PR to its DNA binding sites. By comparing genes induced by the progestin R5020 in T47D cells with those increased in the luteal-phase normal breast, we have identified a set of genes that predict functional progesterone signaling in tissue. These data will facilitate an understanding of the ways in which drugs such as TPA may be utilized for the prevention, and possibly the therapy, of human breast cancer.

Tomato Pathogenesis-related Protein Genes are Expressed in Response to Trialeurodes vaporariorum and Bemisia tabaci Biotype B Feeding

PubMed Central

Puthoff, David P.; Holzer, Frances M.; Perring, Thomas M.

2010-01-01

The temporal and spatial expression of tomato wound- and defense-response genes to Bemisia tabaci biotype B (the silverleaf whitefly) and Trialeurodes vaporariorum (the greenhouse whitefly) feeding were characterized. Both species of whiteflies evoked similar changes in tomato gene expression. The levels of RNAs for the methyl jasmonic acid (MeJA)- or ethylene-regulated genes that encode the basic β-1,3-glucanase (GluB), basic chitinase (Chi9), and Pathogenesis-related protein-1 (PR-1) were monitored. GluB and Chi9 RNAs were abundant in infested leaves from the time nymphs initiated feeding (day 5). In addition, GluB RNAs accumulated in apical non-infested leaves. PR-1 RNAs also accumulated after whitefly feeding. In contrast, the ethylene- and salicylic acid (SA)-regulated Chi3 and PR-4 genes had RNAs that accumulated at low levels and GluAC RNAs that were undetectable in whitefly-infested tomato leaves. The changes in Phenylalanine ammonia lyase5 (PAL5) were variable; in some, but not all infestations, PAL5 RNAs increased in response to whitefly feeding. PAL5 RNA levels increased in response to MeJA, ethylene, and abscisic acid, and declined in response to SA. Transcripts from the wound-response genes, leucine aminopeptidase (LapA1) and proteinase inhibitor 2 (pin2), were not detected following whitefly feeding. Furthermore, whitefly infestation of transgenic LapA1:GUS tomato plants showed that whitefly feeding did not activate the LapA1 promoter, although crushing of the leaf lamina increased GUS activity up to 40 fold. These studies indicate that tomato plants perceive B. tabaci and T. vaporariorum in a manner similar to baterical pathogens and distinct from tissue-damaging insects. PMID:20927641

Gestation-related gene expression and protein localization in endometrial tissue of Suffolk and Cheviot ewes at gestation Day 19, after transfer of Suffolk or Cheviot embryos.

PubMed

Sequeira, M; Pain, S J; de Brun, V; Meikle, A; Kenyon, P R; Blair, H T

2016-10-01

The objective of this study was to investigate the gene expression of progesterone and estrogen receptor α (PR, ERα), insulin-like growth factor (IGF) 1, IGF-2, their receptor (IGFR1), IGF-binding proteins (BP) 1 to 6, insulin receptor, adiponectin receptors (AdipoR1/2), cyclooxygenase 2 (PTGS2), mucin 1 and to localize PR, ERα, IGF-1, IGFR1, PTGS2, and proliferating cellular nuclear antigen (PCNA) in the endometrium of pregnant (Day 19) Suffolk and Cheviot ewes carrying Suffolk and Cheviot embryos transferred within and reciprocally between breeds. Gene expression was determined by real-time quantitative polymerase chain reaction (RT-qPCR), and antigen determination was measured by immunohistochemistry in the luminal epithelium (LE), superficial and deep glands (SG, DG, respectively) and superficial and deep stroma. Gene expression of PR, IGF-1, IGFBP2, and IGFBP5 was higher in Suffolk than that in Cheviot ewes (P < 0.05). Greater abundance of IGF-2 and IGBP3 expression was found in Cheviot ewes carrying Cheviot embryos than Cheviot ewes carrying Suffolk embryos (P < 0.05). No staining for PR and ERα was observed in the LE, very scarce staining in SG and DG, whereas positive staining was observed in both superficial and deep stroma. No differences were found for PR staining, but Cheviot ewes had higher ERα staining intensity than Suffolk ewes (P < 0.05). Positive staining for IGF-1 was observed in all cell types except DG, and staining of IGFR1 was observed in all cell types. No differences among groups in staining were found for IGF-1 or IGFR1 in any cell type. Positive staining of PTGS2 was observed in LE and SG in all groups. An interaction between ewe and embryo breed affected PTGS2 staining (P < 0.05), whereby Cheviot ewes carrying Suffolk embryos had a lower PTGS2 staining than Suffolk ewes carrying Suffolk embryos. Positive staining of PCNA was found in LE and SG. Suffolk ewes carrying Suffolk embryos showed lower PCNA immunostaining than Cheviot ewes carrying Suffolk embryos (P < 0.05), whereas no differences were observed in ewes carrying Cheviot embryos. This study showed that gestation-related protein expression in the endometrium of Suffolk and Cheviot ewes is affected by both ewe and embryo breed at Day 19 of pregnancy. Copyright © 2016 Elsevier Inc. All rights reserved.

Early induced protein 1 (PrELIP1) and other photosynthetic, stress and epigenetic regulation genes are involved in Pinus radiata D. don UV-B radiation response.

PubMed

Valledor, Luis; Cañal, María Jesús; Pascual, Jesús; Rodríguez, Roberto; Meijón, Mónica

2012-11-01

The continuous atmospheric and environmental deterioration is likely to increase, among others, the influx of ultraviolet B (UV-B) radiation. The plants have photoprotective responses, which are complex mechanisms involving different physiological responses, to avoid the damages caused by this radiation that may lead to plant death. We have studied the adaptive responses to UV-B in Pinus radiata, given the importance of this species in conifer forests and reforestation programs. We analyzed the photosynthetic activity, pigments content, and gene expression of candidate genes related to photosynthesis, stress and gene regulation in needles exposed to UV-B during a 96 h time course. The results reveal a clear increase of pigments under UV-B stress while photosynthetic activity decreased. The expression levels of the studied genes drastically changed after UV-B exposure, were stress related genes were upregulated while photosynthesis (RBCA and RBCS) and epigenetic regulation were downregulated (MSI1, CSDP2, SHM4). The novel gene PrELIP1, fully sequenced for this work, was upregulated and expressed mainly in the palisade parenchyma of needles. This gene has conserved domains related to the dissipation of the UV-B radiation that give to this protein a key role during photoprotection response of the needles in Pinus radiata. Copyright © Physiologia Plantarum 2012.

Higher Expression of Toll-like Receptors 3, 7, 8, and 9 in Pityriasis Rosea.

PubMed

El-Ela, Mostafa Abou; El-Komy, Mohamed; Hay, Rania Abdel; Hegazy, Rehab; Sharobim, Amin; Rashed, Laila; Amr, Khalda

2017-03-01

Pityriasis rosea (PR) is a common papulosquamous skin disease in which an infective agent may be implicated. Toll-like receptors (TLRs) play an important role in immune responses and in the pathophysiology of inflammatory skin diseases. Our aim was to determine the possible roles of TLRs 3, 7, 8, and 9 in the pathogenesis of PR. Twenty-four PR patients and 24 healthy individuals (as controls) were included in this case control study. All recruits were subjected to routine laboratory investigations. Biopsies were obtained from one active PR lesion and from healthy skin of controls for the detection of TLR 3, 7, 8, and 9 gene expression using real-time polymerase chain reaction. This study included 24 patients (8 females and 16 males) with active PR lesions, with a mean age of 28.62 years. Twenty four healthy age- and sex-matched individuals were included as controls (8 females and 16 males, with a mean age of 30.83 years). The results of the routine laboratory tests revealed no significant differences between both groups. Significantly elevated expression of all studied TLRs were detected in PR patients relative to healthy controls (p < .001). TLRs 3, 7, 8, and 9 might be involved in the pathogenesis of PR.

Higher Expression of Toll-like Receptors 3, 7, 8, and 9 in Pityriasis Rosea

PubMed Central

El-Ela, Mostafa Abou; El-Komy, Mohamed; Hay, Rania Abdel; Hegazy, Rehab; Sharobim, Amin; Rashed, Laila; Amr, Khalda

2017-01-01

Background Pityriasis rosea (PR) is a common papulosquamous skin disease in which an infective agent may be implicated. Toll-like receptors (TLRs) play an important role in immune responses and in the pathophysiology of inflammatory skin diseases. Our aim was to determine the possible roles of TLRs 3, 7, 8, and 9 in the pathogenesis of PR. Methods Twenty-four PR patients and 24 healthy individuals (as controls) were included in this case control study. All recruits were subjected to routine laboratory investigations. Biopsies were obtained from one active PR lesion and from healthy skin of controls for the detection of TLR 3, 7, 8, and 9 gene expression using real-time polymerase chain reaction. Results This study included 24 patients (8 females and 16 males) with active PR lesions, with a mean age of 28.62 years. Twenty four healthy age- and sex-matched individuals were included as controls (8 females and 16 males, with a mean age of 30.83 years). The results of the routine laboratory tests revealed no significant differences between both groups. Significantly elevated expression of all studied TLRs were detected in PR patients relative to healthy controls (p < .001). Conclusions TLRs 3, 7, 8, and 9 might be involved in the pathogenesis of PR. PMID:28192646

Co-Inoculation with Rhizobia and AMF Inhibited Soybean Red Crown Rot: From Field Study to Plant Defense-Related Gene Expression Analysis

PubMed Central

Gao, Xiang; Lu, Xing; Wu, Man; Zhang, Haiyan; Pan, Ruqian; Tian, Jiang; Li, Shuxian; Liao, Hong

2012-01-01

Background Soybean red crown rot is a major soil-borne disease all over the world, which severely affects soybean production. Efficient and sustainable methods are strongly desired to control the soil-borne diseases. Principal Findings We firstly investigated the disease incidence and index of soybean red crown rot under different phosphorus (P) additions in field and found that the natural inoculation of rhizobia and arbuscular mycorrhizal fungi (AMF) could affect soybean red crown rot, particularly without P addition. Further studies in sand culture experiments showed that inoculation with rhizobia or AMF significantly decreased severity and incidence of soybean red crown rot, especially for co-inoculation with rhizobia and AMF at low P. The root colony forming unit (CFU) decreased over 50% when inoculated by rhizobia and/or AMF at low P. However, P addition only enhanced CFU when inoculated with AMF. Furthermore, root exudates of soybean inoculated with rhizobia and/or AMF significantly inhibited pathogen growth and reproduction. Quantitative RT-PCR results indicated that the transcripts of the most tested pathogen defense-related (PR) genes in roots were significantly increased by rhizobium and/or AMF inoculation. Among them, PR2, PR3, PR4 and PR10 reached the highest level with co-inoculation of rhizobium and AMF. Conclusions Our results indicated that inoculation with rhizobia and AMF could directly inhibit pathogen growth and reproduction, and activate the plant overall defense system through increasing PR gene expressions. Combined with optimal P fertilization, inoculation with rhizobia and AMF could be considered as an efficient method to control soybean red crown rot in acid soils. PMID:22442737

Expression profiling during arabidopsis/downy mildew interaction reveals a highly-expressed effector that attenuates responses to salicylic acid.

PubMed

Asai, Shuta; Rallapalli, Ghanasyam; Piquerez, Sophie J M; Caillaud, Marie-Cécile; Furzer, Oliver J; Ishaque, Naveed; Wirthmueller, Lennart; Fabro, Georgina; Shirasu, Ken; Jones, Jonathan D G

2014-10-01

Plants have evolved strong innate immunity mechanisms, but successful pathogens evade or suppress plant immunity via effectors delivered into the plant cell. Hyaloperonospora arabidopsidis (Hpa) causes downy mildew on Arabidopsis thaliana, and a genome sequence is available for isolate Emoy2. Here, we exploit the availability of genome sequences for Hpa and Arabidopsis to measure gene-expression changes in both Hpa and Arabidopsis simultaneously during infection. Using a high-throughput cDNA tag sequencing method, we reveal expression patterns of Hpa predicted effectors and Arabidopsis genes in compatible and incompatible interactions, and promoter elements associated with Hpa genes expressed during infection. By resequencing Hpa isolate Waco9, we found it evades Arabidopsis resistance gene RPP1 through deletion of the cognate recognized effector ATR1. Arabidopsis salicylic acid (SA)-responsive genes including PR1 were activated not only at early time points in the incompatible interaction but also at late time points in the compatible interaction. By histochemical analysis, we found that Hpa suppresses SA-inducible PR1 expression, specifically in the haustoriated cells into which host-translocated effectors are delivered, but not in non-haustoriated adjacent cells. Finally, we found a highly-expressed Hpa effector candidate that suppresses responsiveness to SA. As this approach can be easily applied to host-pathogen interactions for which both host and pathogen genome sequences are available, this work opens the door towards transcriptome studies in infection biology that should help unravel pathogen infection strategies and the mechanisms by which host defense responses are overcome.

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Genome-Wide Progesterone Receptor Binding: Cell Type-Specific and Shared Mechanisms in T47D Breast Cancer Cells and Primary Leiomyoma Cells

PubMed Central

Huang, Lei; Owen, Jonas K.; Xie, Anna; Navarro, Antonia; Monsivais, Diana; Coon V, John S.; Kim, J. Julie; Dai, Yang; Bulun, Serdar E.

2012-01-01

Background Progesterone, via its nuclear receptor (PR), exerts an overall tumorigenic effect on both uterine fibroid (leiomyoma) and breast cancer tissues, whereas the antiprogestin RU486 inhibits growth of these tissues through an unknown mechanism. Here, we determined the interaction between common or cell-specific genome-wide binding sites of PR and mRNA expression in RU486-treated uterine leiomyoma and breast cancer cells. Principal Findings ChIP-sequencing revealed 31,457 and 7,034 PR-binding sites in breast cancer and uterine leiomyoma cells, respectively; 1,035 sites overlapped in both cell types. Based on the chromatin-PR interaction in both cell types, we statistically refined the consensus progesterone response element to G•ACA• • •TGT•C. We identified two striking differences between uterine leiomyoma and breast cancer cells. First, the cis-regulatory elements for HSF, TEF-1, and C/EBPα and β were statistically enriched at genomic RU486/PR-targets in uterine leiomyoma, whereas E2F, FOXO1, FOXA1, and FOXF sites were preferentially enriched in breast cancer cells. Second, 51.5% of RU486-regulated genes in breast cancer cells but only 6.6% of RU486-regulated genes in uterine leiomyoma cells contained a PR-binding site within 5 kb from their transcription start sites (TSSs), whereas 75.4% of RU486-regulated genes contained a PR-binding site farther than 50 kb from their TSSs in uterine leiomyoma cells. RU486 regulated only seven mRNAs in both cell types. Among these, adipophilin (PLIN2), a pro-differentiation gene, was induced via RU486 and PR via the same regulatory region in both cell types. Conclusions Our studies have identified molecular components in a RU486/PR-controlled gene network involved in the regulation of cell growth, cell migration, and extracellular matrix function. Tissue-specific and common patterns of genome-wide PR binding and gene regulation may determine the therapeutic effects of antiprogestins in uterine fibroids and breast cancer. PMID:22272226

Cutin monomer induces expression of the rice OsLTP5 lipid transfer protein gene.

PubMed

Kim, Tae Hyun; Park, Jong Ho; Kim, Moon Chul; Cho, Sung Ho

2008-01-01

Treatment with the cutin monomer 16-hydroxypalmitic acid (HPA), a major component of cutin, elicited the synthesis of hydrogen peroxide (H2O2) in rice leaves and induced the expression of the lipid transfer protein gene OsLTP5. Treatment with HPA also induced expression of OsLTP1, OsLTP2, and the pathogen-related PR-10 genes to a lesser extent. The OsLTP5 transcript was expressed prominently in stems and flowers, but was barely detectable in leaves. Expression of OsLTP5 was induced in shoots in response to ABA and salicylic acid. It is proposed that HPA is perceived by rice as a signal, inducing defense reactions.

Genomic assessment of the evolution of the prion protein gene family in vertebrates.

PubMed

Harrison, Paul M; Khachane, Amit; Kumar, Manish

2010-05-01

Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long, interspersed elements. These annotations and evolutionary analyses will be of further use for functional characterisation of the PrP-GF, and will be updatable in a semi-automated fashion as more genomes accumulate. Copyright 2010 Elsevier Inc. All rights reserved.

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

PubMed Central

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

PubMed

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

Poorly expressed endogenous ecotropic provirus of DBA/2 mice encodes a mutant Pr65gag protein that is not myristylated.

PubMed Central

Copeland, N G; Jenkins, N A; Nexø, B; Schultz, A M; Rein, A; Mikkelsen, T; Jørgensen, P

1988-01-01

DBA/2 mice carry a single endogenous ecotropic murine leukemia provirus designated Emv-3. Although this provirus appears to be nondefective by genomic restriction enzyme mapping, weanling mice do not produce virus and only about one-third of adult mice ever express virus. 5-Iododeoxyuridine and 5-azacytidine, two potent inducers of ecotropic virus expression, are relatively ineffective at inducing Emv-3 expression. However, the chemical carcinogen 7,12-dimethylbenz(a)anthracene can induce ecotropic virus expression in approximately 95% of treated DBA/2 mice. Previous experiments involving DNA transfection and marker rescue analysis of molecularly cloned Emv-3 DNA suggested that Emv-3 carries a small defect(s) in the gag gene, not detectable by restriction enzyme mapping, that inhibits virus expression in vivo and in vitro. Using a combination of approaches, including DNA sequencing, peptide mapping, and metabolic labeling of cells with [3H]myristate, we have demonstrated that the defect in Emv-3 most likely results from a single nucleotide substitution within the gene for p15gag that inhibits myristylation of the Pr65gag N terminus. Myristylation of Pr65gag is thought to be required for this protein to associate with the plasma membrane and is essential for virus particle formation. These results provide a conceptual framework for understanding how Emv-3 expression is regulated during development and after chemical induction. Images PMID:2826810

A small molecule modulator of prion protein increases human mesenchymal stem cell lifespan, ex vivo expansion, and engraftment to bone marrow in NOD/SCID mice.

PubMed

Mohanty, Sindhu T; Cairney, Claire J; Chantry, Andrew D; Madan, Sanjeev; Fernandes, James A; Howe, Steven J; Moore, Harry D; Thompson, Mark J; Chen, Beining; Thrasher, Adrian; Keith, W Nicol; Bellantuono, Ilaria

2012-06-01

Human mesenchymal stem cells (hMSCs) have been shown to have potential in regenerative approaches in bone and blood. Most protocols rely on their in vitro expansion prior to clinical use. However, several groups including our own have shown that hMSCs lose proliferation and differentiation ability with serial passage in culture, limiting their clinical applications. Cellular prion protein (PrP) has been shown to enhance proliferation and promote self-renewal of hematopoietic, mammary gland, and neural stem cells. Here we show, for the first time, that expression of PrP decreased in hMSC following ex vivo expansion. When PrP expression was knocked down, hMSC showed significant reduction in proliferation and differentiation. In contrast, hMSC expanded in the presence of small molecule 3/689, a modulator of PrP expression, showed retention of PrP expression with ex vivo expansion and extended lifespan up to 10 population doublings. Moreover, cultures produced a 300-fold increase in the number of cells generated. These cells showed a 10-fold increase in engraftment levels in bone marrow 5 weeks post-transplant. hMSC treated with 3/689 showed enhanced protection from DNA damage and enhanced cell cycle progression, in line with data obtained by gene expression profiling. Moreover, upregulation of superoxide dismutase-2 (SOD2) was also observed in hMSC expanded in the presence of 3/689. The increase in SOD2 was dependent on PrP expression and suggests increased scavenging of reactive oxygen species as mechanism of action. These data point to PrP as a good target for chemical intervention in stem cell regenerative medicine. Copyright © 2012 AlphaMed Press.

Oxytocin, vasopressin and estrogen receptor gene expression in relation to social recognition in female mice

PubMed Central

Clipperton-Allen, Amy E.; Lee, Anna W.; Reyes, Anny; Devidze, Nino; Phan, Anna; Pfaff, Donald W.; Choleris, Elena

2012-01-01

Inter- and intra-species differences in social behavior and recognition-related hormones and receptors suggest that different distribution and/or expression patterns may relate to social recognition. We used qRT-PCR to investigate naturally occurring differences in expression of estrogen receptor-alpha (ERα), ER-beta (ERβ), progesterone receptor (PR), oxytocin (OT) and receptor, and vasopressin (AVP) and receptors in proestrous female mice. Following four 5 min exposures to the same two conspecifics, one was replaced with a novel mouse in the final trial (T5). Gene expression was examined in mice showing high (85–100%) and low (40–60%) social recognition scores (i.e., preferential novel mouse investigation in T5) in eight socially-relevant brain regions. Results supported OT and AVP involvement in social recognition, and suggest that in the medial preoptic area, increased OT and AVP mRNA, together with ERα and ERβ gene activation, relate to improved social recognition. Initial social investigation correlated with ERs, PR and OTR in the dorsolateral septum, suggesting that these receptors may modulate social interest without affecting social recognition. Finally, increased lateral amygdala gene activation in the LR mice may be associated with general learning impairments, while decreased lateral amygdala activity may indicate more efficient cognitive mechanisms in the HR mice. PMID:22079582

The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation ▿

PubMed Central

Fiedler, Tomas; Mix, Maren; Meyer, Uta; Mikkat, Stefan; Glocker, Michael O.; Bahl, Hubert; Fischer, Ralf-Jörg

2008-01-01

The phoPR gene locus of Clostridium acetobutylicum ATCC 824 comprises two genes, phoP and phoR. Deduced proteins are predicted to represent a response regulator and sensor kinase of a phosphate-dependent two-component regulatory system. We analyzed the expression patterns of phoPR in Pi-limited chemostat cultures and in response to Pi pulses. A basic transcription level under high-phosphate conditions was shown, and a significant increase in mRNA transcript levels was found when external Pi concentrations dropped below 0.3 mM. In two-dimensional gel electrophoresis experiments, a 2.5-fold increase in PhoP was observed under Pi-limiting growth conditions compared to growth with an excess of Pi. At least three different transcription start points for phoP were determined by primer extension analyses. Proteins PhoP and an N-terminally truncated *PhoR were individually expressed heterologously in Escherichia coli and purified. Autophosphorylation of *PhoR and phosphorylation of PhoP were shown in vitro. Electromobility shift assays proved that there was a specific binding of PhoP to the promoter region of the phosphate-regulated pst operon of C. acetobutylicum. PMID:18689481

Mapping PrBn and Other Quantitative Trait Loci Responsible for the Control of Homeologous Chromosome Pairing in Oilseed Rape (Brassica napus L.) Haploids

PubMed Central

Liu, Zhiqian; Adamczyk, Katarzyna; Manzanares-Dauleux, Maria; Eber, Frédérique; Lucas, Marie-Odile; Delourme, Régine; Chèvre, Anne Marie; Jenczewski, Eric

2006-01-01

In allopolyploid species, fair meiosis could be challenged by homeologous chromosome pairing and is usually achieved by the action of homeologous pairing suppressor genes. Oilseed rape (Brassica napus) haploids (AC, n = 19) represent an attractive model for studying the mechanisms used by allopolyploids to ensure the diploid-like meiotic pairing pattern. In oilseed rape haploids, homeologous chromosome pairing at metaphase I was found to be genetically based and controlled by a major gene, PrBn, segregating in a background of polygenic variation. In this study, we have mapped PrBn within a 10-cM interval on the C genome linkage group DY15 and shown that PrBn displays incomplete penetrance or variable expressivity. We have identified three to six minor QTL/BTL that have slight additive effects on the amount of pairing at metaphase I but do not interact with PrBn. We have also detected a number of other loci that interact epistatically, notably with PrBn. Our results support the idea that, as in other polyploid species, metaphase I homeologous pairing in oilseed rape haploids is controlled by an integrated system of several genes, which function in a complex manner. PMID:16951054

Baseline blood immunological profiling differentiates between Her2-breast cancer molecular subtypes: implications for immunomediated mechanisms of treatment response.

PubMed

Tudoran, Oana; Virtic, Oana; Balacescu, Loredana; Lisencu, Carmen; Fetica, Bogdan; Gherman, Claudia; Balacescu, Ovidiu; Berindan-Neagoe, Ioana

2015-01-01

Breast cancer patients' response to treatment is highly dependent on the primary tumor molecular features, with triple-negative breast tumors having the worst prognosis of all subtypes. According to the molecular features, tumors stimulate the microenvironment to induce distinct immune responses, baseline immune activation being associated with higher likelihood of pathologic response. In this study, we investigated the deconvolution of the immunological status of triple-negative tumors in comparison with luminal tumors and the association with patients' clinicopathological characteristics. Gene expression of 84 inflammatory molecules and their receptors were analyzed in 40 peripheral blood samples from patients with Her2- primary breast cancer tumors. We studied the association of triple-negative phenotype with age, clinical stage, tumor size, lymph nodes, and menopausal status. We observed that more patients with estrogen (ER)/progesterone (PR)-negative tumors had grade III, while more patients with ER/PR-positive tumors had grade II tumors. Gene expression analysis revealed a panel of 14 genes to have differential expression between the two groups: several interleukins: IL13, IL16, IL17C and IL17F, IL1A, IL3; interleukin receptors: IL10RB, IL5RA; chemokines: CXCL13 and CCL26; and cytokines: CSF2, IFNA2, OSM, TNSF13. The expression levels of these genes have been previously shown to be associated with reduced immunological status; indeed, the triple-negative breast cancer patients presented with lower counts of lymphocytes and eosinophils than the ER/PR-positive ones. These results contribute to a better understanding of the possible role of antitumor immune responses in mediating the clinical outcome.

Transcriptomic variation of eyestalk reveals the genes and biological processes associated with molting in Portunus trituberculatus

PubMed Central

Zhang, Longtao; Liu, Ping; Li, Jian

2017-01-01

Background Molting is an essential biological process throughout the life history of crustaceans, which is regulated by many neuropeptide hormones expressed in the eyestalk. To better understand the molting mechanism in Portunus trituberculatus, we used digital gene expression (DGE) to analyze single eyestalk samples during the molting cycle by high-throughput sequencing. Results We obtained 14,387,942, 12,631,508 and 13,060,062 clean sequence reads from inter-molt (InM), pre-molt (PrM) and post-molt (PoM) cDNA libraries, respectively. A total of 1,394 molt-related differentially expressed genes (DEGs) were identified. GO and KEGG enrichment analysis identified some important processes and pathways with key roles in molting regulation, such as chitin metabolism, peptidase inhibitor activity, and the ribosome. We first observed a pattern associated with the neuromodulator-related pathways during the molting cycle, which were up-regulated in PrM and down-regulated in PoM. Four categories of important molting-related transcripts were clustered and most of them had similar expression patterns, which suggests that there is a connection between these genes throughout the molt cycle. Conclusion Our work is the first molt-related investigation of P. trituberculatus focusing on the eyestalk at the whole transcriptome level. Together, our results, including DEGs, identification of molting-related biological processes and pathways, and observed expression patterns of important genes, provide a novel insight into the function of the eyestalk in molting regulation. PMID:28394948

Vitamin B1 Functions as an Activator of Plant Disease Resistance1

PubMed Central

Ahn, Il-Pyung; Kim, Soonok; Lee, Yong-Hwan

2005-01-01

Vitamin B1 (thiamine) is an essential nutrient for humans. Vitamin B1 deficiency causes beriberi, which disturbs the central nervous and circulatory systems. In countries in which rice (Oryza sativa) is a major food, thiamine deficiency is prevalent because polishing of rice removes most of the thiamine in the grain. We demonstrate here that thiamine, in addition to its nutritional value, induces systemic acquired resistance (SAR) in plants. Thiamine-treated rice, Arabidopsis (Arabidopsis thaliana), and vegetable crop plants showed resistance to fungal, bacterial, and viral infections. Thiamine treatment induces the transient expression of pathogenesis-related (PR) genes in rice and other plants. In addition, thiamine treatment potentiates stronger and more rapid PR gene expression and the up-regulation of protein kinase C activity. The effects of thiamine on disease resistance and defense-related gene expression mobilize systemically throughout the plant and last for more than 15 d after treatment. Treatment of Arabidopsis ecotype Columbia-0 plants with thiamine resulted in the activation of PR-1 but not PDF1.2. Furthermore, thiamine prevented bacterial infection in Arabidopsis mutants insensitive to jasmonic acid or ethylene but not in mutants impaired in the SAR transduction pathway. These results clearly demonstrate that thiamine induces SAR in plants through the salicylic acid and Ca2+-related signaling pathways. The findings provide a novel paradigm for developing alternative strategies for the control of plant diseases. PMID:15980201

Signalling of Arabidopsis thaliana response to Pieris brassicae eggs shares similarities with PAMP-triggered immunity

PubMed Central

Reymond, Philippe

2013-01-01

Insect egg deposition activates plant defence, but very little is known about signalling events that control this response. In Arabidopsis thaliana, oviposition by Pieris brassicae triggers salicylic acid (SA) accumulation and induces the expression of defence genes. This is similar to the recognition of pathogen-associated molecular patterns (PAMPs), which are involved in PAMP-triggered immunity (PTI). Here, the involvement of known signalling components of PTI in response to oviposition was studied. Treatment with P. brassicae egg extract caused a rapid induction of early PAMP-responsive genes. In addition, expression of the defence gene PR-1 required EDS1, SID2, and, partially, NPR1, thus implicating the SA pathway downstream of egg recognition. PR-1 expression was triggered by a non-polar fraction of egg extract and by an oxidative burst modulated through the antagonistic action of EDS1 and NUDT7, but which did not depend on the NADPH oxidases RBOHD and RBOHF. Searching for receptors of egg-derived elicitors, a receptor-like kinase mutant, lecRK-I.8, was identified which shows a much reduced induction of PR-1 in response to egg extract treatment. These results demonstrate the importance of the SA pathway in response to egg-derived elicitor(s) and unravel intriguing similarities between the detection of insect eggs and PTI in Arabidopsis. PMID:23264520

Control of Citrus Huanglongbing via Trunk Injection of Plant Defense Activators and Antibiotics.

PubMed

Hu, J; Jiang, J; Wang, N

2018-02-01

Citrus huanglongbing (HLB) or greening is a devastating disease of citrus worldwide and no effective control measure is currently available. Plant defense activators environmentally friendly compounds capable of inducing resistance against many plant pathogens. Earlier studies showed that foliar spray of plant defense inducers could slow down HLB disease progress. In this study, eight plant defense activators and three antibiotics were evaluated in three field trials for their effect to control HLB by trunk injection of young and mature sweet orange trees. Results showed that four trunk injections of several activators, including salicylic acid, oxalic acid, acibenzolar-S-methyl, and potassium phosphate, provided significant control of HLB by suppressing 'Candidatus Liberibacter asiaticus' titer and disease progress. Trunk injection of penicillin, streptomycin, and oxytetracycline hydrochloride resulted in excellent control of HLB. In general, antibiotics were more effective in reduction of 'Ca. L. asiaticus' titer and HLB symptom expressions than plant defense activators. These treatments also resulted in increased yield and better fruit quality. Injection of both salicylic acid and acibenzolar-S-methyl led to significant induction of pathogenesis-related (PR) genes PR-1 and PR-2 genes. Meanwhile, injection of either potassium phosphate or oxalic acid resulted in significant induction of PR-2 or PR-15 gene expression, respectively. These results suggested that HLB diseased trees remained inducible for systemic acquired resistance under field conditions. In summary, this study presents information regarding controlling HLB via trunk injection of plant defense activators and antibiotics, which helps citrus growers in decision making regarding developing an effective HLB management program.

Overexpression of miR169o, an Overlapping microRNA in Response to Both Nitrogen Limitation and Bacterial Infection, Promotes Nitrogen Use Efficiency and Susceptibility to Bacterial Blight in Rice.

PubMed

Chao, Yu; Chen, Yutong; Cao, Yaqian; Chen, Huamin; Wang, Jichun; Bi, Yong-Mei; Tian, Fang; Yang, Fenghuan; Rothstein, Steven J; Zhou, Xueping; He, Chenyang

2018-03-15

Limiting nitrogen (N) supply contributes to improved resistance to bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) in susceptible rice (Oryza sativa). To understand the regulatory roles of microRNAs in this phenomenon, sixty-three differentially-expressed overlapping miRNAs in response to Xoo infection and N-limitation stress in rice were identified through deep RNA-sequence and stem loop qRT-PCR. Among these, miR169o was further assessed as a typical overlapping miRNA through the overexpression of the miR169o primary gene. Osa-miR169o-OX plants were taller, and had more biomass accumulation with significantly increased nitrate and total amino acid contents in roots than wild type (WT). Transcript level assays showed that under different N supply conditions miR169o opposite regulated NRT2 which is reduced under normal N supply condition but remarkably induced under N limiting stress. On the other hand, osa-miR169o-OX plants also displayed increased disease lesion lengths and reduced transcriptional levels of defense gene (PR1b, PR10a, PR10b and PAL) compared with WT after inoculation with Xoo. In addition, miR169o impeded Xoo-mediated NRT transcription. Therefore, the overlapping miR169o contributes to increase N use efficiency and negatively regulates the resistance to bacterial blight in rice. Consistently, transient expression of NF-YAs in rice protoplast promoted the transcripts of PR genes and NRT2 genes, while reduced the transcripts of NRT1 genes. Our results provide novel and additional insights into the coordinated regulatory mechanisms of crosstalk between Xoo infection and N-deficiency responses in rice.

Dual RNA-Sequencing of Eucalyptus nitens during Phytophthora cinnamomi Challenge Reveals Pathogen and Host Factors Influencing Compatibility

PubMed Central

Meyer, Febé E.; Shuey, Louise S.; Naidoo, Sitha; Mamni, Thandekile; Berger, Dave K.; Myburg, Alexander A.; van den Berg, Noëlani; Naidoo, Sanushka

2016-01-01

Damage caused by Phytophthora cinnamomi Rands remains an important concern on forest tree species. The pathogen causes root and collar rot, stem cankers, and dieback of various economically important Eucalyptus spp. In South Africa, susceptible cold tolerant Eucalyptus plantations have been affected by various Phytophthora spp. with P. cinnamomi considered one of the most virulent. The molecular basis of this compatible interaction is poorly understood. In this study, susceptible Eucalyptus nitens plants were stem inoculated with P. cinnamomi and tissue was harvested five days post inoculation. Dual RNA-sequencing, a technique which allows the concurrent detection of both pathogen and host transcripts during infection, was performed. Approximately 1% of the reads mapped to the draft genome of P. cinnamomi while 78% of the reads mapped to the Eucalyptus grandis genome. The highest expressed P. cinnamomi gene in planta was a putative crinkler effector (CRN1). Phylogenetic analysis indicated the high similarity of this P. cinnamomi CRN1 to that of Phytophthora infestans. Some CRN effectors are known to target host nuclei to suppress defense. In the host, over 1400 genes were significantly differentially expressed in comparison to mock inoculated trees, including suites of pathogenesis related (PR) genes. In particular, a PR-9 peroxidase gene with a high similarity to a Carica papaya PR-9 ortholog previously shown to be suppressed upon infection by Phytophthora palmivora was down-regulated two-fold. This PR-9 gene may represent a cross-species effector target during P. cinnamomi infection. This study identified pathogenicity factors, potential manipulation targets, and attempted host defense mechanisms activated by E. nitens that contributed to the susceptible outcome of the interaction. PMID:26973660

Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight.

PubMed

Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi

2016-01-01

Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.

Development of marker genes for jasmonic acid signaling in shoots and roots of wheat

PubMed Central

Liu, Hongwei; Carvalhais, Lilia Costa; Kazan, Kemal; Schenk, Peer M.

2016-01-01

ABSTRACT The jasmonic acid (JA) signaling pathway plays key roles in a diverse array of plant development, reproduction, and responses to biotic and abiotic stresses. Most of our understanding of the JA signaling pathway derives from the dicot model plant Arabidopsis thaliana, while corresponding knowledge in wheat is somewhat limited. In this study, the expression of 41 genes implicated in the JA signaling pathway has been assessed on 10 day-old bread wheat seedlings, 24 h, 48 h, and 72 h after methyl-jasmonate (MeJA) treatment using quantitative real-time PCR. The examined genes have been previously reported to be involved in JA biosynthesis and catabolism, JA perception and signaling, and pathogen defense in wheat shoots and roots. This study provides evidence to suggest that the effect of MeJA treatment is more prominent in shoots than roots of wheat seedlings, and substantial regulation of the JA pathway-dependent defense genes occurs at 72 h after MeJA treatment. Results show that the expression of 22 genes was significantly affected by MeJA treatment in wheat shoots. However, only PR1.1 and PR3 were significantly differentially expressed in wheat roots, both at 24 h post-MeJA treatment, with other genes showing large variation in their gene expression in roots. While providing marker genes on JA signaling in wheat, future work may focus on elucidating the regulatory function of JA-modulated transcription factors, some of which have well-studied potential orthologs in Arabidopsis. PMID:27115051

Water extracts from winery by-products as tobacco defense inducers.

PubMed

Benouaret, Razik; Goujon, Eric; Trivella, Aurélien; Richard, Claire; Ledoigt, Gérard; Joubert, Jean-Marie; Mery-Bernardon, Aude; Goupil, Pascale

2014-10-01

Water extracts from winery by-products exhibited significant plant defense inducer properties. Experiments were conducted on three marc extracts containing various amounts of polyphenols and anthocyanins. Infiltration of red, white and seed grape marc extracts into tobacco leaves induced hypersensitive reaction-like lesions with cell death evidenced by Evans Blue staining. The infiltration zones and the surrounding areas revealed accumulation of autofluorescent compounds under UV light. Leaf infiltration of the three winery by-product extracts induced defense gene expression. The antimicrobial PR1, β-1,3-glucanase PR2, and chitinase PR3 target genes were upregulated locally in tobacco plants following grape marc extract treatments. The osmotin PR5 transcripts accumulated as well in red marc extract treated-tobacco leaves. Overall, the winery by-product extracts elicited an array of plant defense responses making the grape residues a potential use of high value compounds.

Prunus domestica Pathogenesis-Related Protein-5 Activates the Defense Response Pathway and Enhances the Resistance to Fungal Infection

PubMed Central

El-kereamy, Ashraf; El-sharkawy, Islam; Ramamoorthy, Rengasamy; Taheri, Ali; Errampalli, Deena; Kumar, Prakash; Jayasankar, Subramanian

2011-01-01

Pathogenesis-related protein-5 (PR-5) has been implicated in plant disease resistance and its antifungal activity has been demonstrated in some fruit species. However, their roles, especially their interactions with the other defense responses in plant cells, are still not fully understood. In this study, we have cloned and characterized a new PR-5 cDNA named PdPR5-1 from the European plum (Prunus domestica). Expression of PdPR5-1 was studied in different cultivars varying in resistance to the brown rot disease caused by the necrotrophic fungus Monilinia fructicola. In addition transgenic Arabidopsis, ectopically expressing PdPR5-1 was used to study its role in other plant defense responses after fungal infection. We show that the resistant cultivars exhibited much higher levels of transcripts than the susceptible cultivars during fruit ripening. However, significant rise in the transcript levels after infection with M. fructicola was observed in the susceptible cultivars too. Transgenic Arabidopsis plants exhibited more resistance to Alternaria brassicicola. Further, there was a significant increase in the transcripts of genes involved in the phenylpropanoid biosynthesis pathway such as phenylalanine ammonia-lyase (PAL) and phytoalexin (camalexin) pathway leading to an increase in camalexin content after fungal infection. Our results show that PdPR5-1 gene, in addition to its anti-fungal properties, has a possible role in activating other defense pathways, including phytoalexin production. PMID:21448276

Systemic surfaceome profiling identifies target antigens for immune-based therapy in subtypes of advanced prostate cancer

PubMed Central

Lee, John K.; Bangayan, Nathanael J.; Chai, Timothy; Smith, Bryan A.; Pariva, Tiffany E.; Yun, Sangwon; Vashisht, Ajay; Zhang, Qingfu; Park, Jung Wook; Corey, Eva; Huang, Jiaoti; Wohlschlegel, James; Witte, Owen N.

2018-01-01

Prostate cancer is a heterogeneous disease composed of divergent molecular and histologic subtypes, including prostate adenocarcinoma (PrAd) and neuroendocrine prostate cancer (NEPC). While PrAd is the major histology in prostate cancer, NEPC can evolve from PrAd as a mechanism of treatment resistance that involves a transition from an epithelial to a neurosecretory cancer phenotype. Cell surface markers are often associated with specific cell lineages and differentiation states in normal development and cancer. Here, we show that PrAd and NEPC can be broadly discriminated by cell-surface profiles based on the analysis of prostate cancer gene expression datasets. To overcome a dependence on predictions of human cell-surface genes and an assumed correlation between mRNA levels and protein expression, we integrated transcriptomic and cell-surface proteomic data generated from a panel of prostate cancer cell lines to nominate cell-surface markers associated with these cancer subtypes. FXYD3 and CEACAM5 were validated as cell-surface antigens enriched in PrAd and NEPC, respectively. Given the lack of effective treatments for NEPC, CEACAM5 appeared to be a promising target for cell-based immunotherapy. As a proof of concept, engineered chimeric antigen receptor T cells targeting CEACAM5 induced antigen-specific cytotoxicity in NEPC cell lines. Our findings demonstrate that the surfaceomes of PrAd and NEPC reflect unique cancer differentiation states and broadly represent vulnerabilities amenable to therapeutic targeting. PMID:29686080

Regulation of disease-responsive genes mediated by epigenetic factors: interaction of Arabidopsis-Pseudomonas.

PubMed

De-La-Peña, Clelia; Rangel-Cano, Alicia; Alvarez-Venegas, Raúl

2012-05-01

Genes in eukaryotic organisms function within the context of chromatin, and the mechanisms that modulate the structure of chromatin are defined as epigenetic. In Arabidopsis, pathogen infection induces the expression of at least one histone deacetylase, suggesting that histone acetylation/deacetylation has an important role in the pathogenic response in plants. How/whether histone methylation affects gene response to pathogen infection is unknown. To gain a better understanding of the epigenetic mechanisms regulating the interaction between Pseudomonas syringae and Arabidopsis thaliana, we analysed three different Arabidopsis ash1-related (absent, small or homeotic discs 1) mutants. We found that the loss of function of ASHH2 and ASHR1 resulted in faster hypersensitive responses (HRs) to both mutant (hrpA) and pathogenic (DC3000) strains of P. syringae, whereas control (Col-0) and ashr3 mutants appeared to be more resistant to the infection after 2 days. Furthermore, we showed that, in the ashr3 background, the PR1 gene (PATHOGENESIS-RELATED GENE 1) displayed the highest expression levels on infection with DC3000, correlating with increased resistance against this pathogen. Our results show that, in both the ashr1 and ashh2 backgrounds, the histone H3 lysine 4 dimethylation (H3K4me2) levels decreased at the promoter region of PR1 on infection with the DC3000 strain, suggesting that an epigenetically regulated PR1 expression is involved in the plant defence. Our results suggest that histone methylation in response to pathogen infection may be a critical component in the signalling and defence processes occurring between plants and microbes. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

PubMed Central

Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

1992-01-01

cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

Dengue subgenomic RNA binds TRIM25 to inhibit interferon expression for epidemiological fitness

PubMed Central

Manokaran, Gayathri; Finol, Esteban; Wang, Chunling; Gunaratne, Jayantha; Bahl, Justin; Ong, Eugenia Z.; Tan, Hwee Cheng; Sessions, October M.; Ward, Alex M.; Gubler, Duane J.; Harris, Eva; Garcia-Blanco, Mariano A.; Ooi, Eng Eong

2016-01-01

The global spread of dengue virus (DENV) infections has increased viral genetic diversity, some of which appears associated with greater epidemic potential. The mechanisms governing viral fitness in epidemiological settings, however, remain poorly defined. We identified a determinant of fitness in a foreign dominant (PR-2B) DENV serotype 2 (DENV-2) clade, which emerged during the 1994 epidemic in Puerto Rico and replaced an endemic (PR-1) DENV-2 clade. The PR-2B DENV-2 produced increased levels of subgenomic flavivirus RNA (sfRNA) relative to genomic RNA during replication. PR-2B sfRNA showed sequence-dependent binding to and prevention of tripartite motif 25 (TRIM25) deubiquitylation, which is critical for sustained and amplified retinoic acid–inducible gene 1 (RIG-I)–induced type I interferon expression. Our findings demonstrate a distinctive viral RNA–host protein interaction to evade the innate immune response for increased epidemiological fitness. PMID:26138103

Heat shock transcription factor 3 regulates plant immune response through modulation of salicylic acid accumulation and signaling in cassava.

PubMed

Wei, Yunxie; Liu, Guoyin; Chang, Yanli; He, Chaozu; Shi, Haitao

2018-04-16

As the terminal components of signal transduction, heat stress transcription factors (Hsfs) mediate the activation of multiple genes responsive to various stresses. However, the information and functional analysis are very limited in non-model plants, especially in cassava (Manihot esculenta), one of the most important crops in the tropical area. In this study, 32 MeHsfs were identified from cassava genome, the evolutionary tree, gene structures and motifs were also analyzed. Gene expression analysis found that MeHsfs were commonly regulated by Xanthomonas axonopodis pv manihotis (Xam). Among these MeHsfs, MeHsf3 was specifically located in the cell nucleus and had transcriptional activated activity on HSEs. Through transient expression in Nicotiana benthamiana leaves and virus-induced gene silencing (VIGS) in cassava, we identified the essential role of MeHsf3 in plant disease resistance, by regulating the transcripts of Enhanced Disease Susceptibility 1 (EDS1) and pathogen-related gene 4 (PR4). Notably, as regulators of defense susceptibility, MeEDS1 and MePR4 were identified as direct targets of MeHsf3. Moreover, the disease sensitivity of MeHsf3- and MeEDS1-silenced plants could be restored by exogenous salicylic acid (SA) treatment. Taken together, this study highlights the involvement of MeHsf3 in defense resistance through the transcription activation on MeEDS1 and MePR4. This article is protected by copyright. All rights reserved. © 2018 BSPP and John Wiley & Sons Ltd.

Genes encoding the vacuolar Na+/H+ exchanger and flower coloration.

PubMed

Yamaguchi, T; Fukada-Tanaka, S; Inagaki, Y; Saito, N; Yonekura-Sakakibara, K; Tanaka, Y; Kusumi, T; Iida, S

2001-05-01

Vacuolar pH plays an important role in flower coloration: an increase in the vacuolar pH causes blueing of flower color. In the Japanese morning glory (Ipomoea nil or Pharbitis nil), a shift from reddish-purple buds to blue open flowers correlates with an increase in the vacuolar pH. We describe details of the characterization of a mutant that carries a recessive mutation in the Purple (Pr) gene encoding a vacuolar Na+/H+ exchanger termed InNHX1. The genome of I. nil carries one copy of the Pr (or InNHX1) gene and its pseudogene, and it showed functional complementation to the yeast nhx1 mutation. The mutant of I. nil, called purple (pr), showed a partial increase in the vacuolar pH during flower-opening and its reddish-purple buds change into purple open flowers. The vacuolar pH in the purple open flowers of the mutant was significantly lower than that in the blue open flowers. The InNHX1 gene is most abundantly expressed in the petals at around 12 h before flower-opening, accompanying the increase in the vacuolar pH for the blue flower coloration. No such massive expression was observed in the petunia flowers. Since the NHX1 genes that promote the transport of Na+ into the vacuoles have been regarded to be involved in salt tolerance by accumulating Na+ in the vacuoles, we can add a new biological role for blue flower coloration in the Japanese morning glory by the vacuolar alkalization.

Transcriptomic analysis and mutational status of IDH1 in paired primary-recurrent intrahepatic cholangiocarcinoma.

PubMed

Peraldo-Neia, C; Ostano, P; Cavalloni, G; Pignochino, Y; Sangiolo, D; De Cecco, L; Marchesi, E; Ribero, D; Scarpa, A; De Rose, A M; Giuliani, A; Calise, F; Raggi, C; Invernizzi, P; Aglietta, M; Chiorino, G; Leone, F

2018-06-05

Effective target therapies for intrahepatic cholangiocarcinoma (ICC) have not been identified so far. One of the reasons may be the genetic evolution from primary (PR) to recurrent (REC) tumors. We aim to identify peculiar characteristics and to select potential targets specific for recurrent tumors. Eighteen ICC paired PR and REC tumors were collected from 5 Italian Centers. Eleven pairs were analyzed for gene expression profiling and 16 for mutational status of IDH1. For one pair, deep mutational analysis by Next Generation Sequencing was also carried out. An independent cohort of patients was used for validation. Two class-paired comparison yielded 315 differentially expressed genes between REC and PR tumors. Up-regulated genes in RECs are involved in RNA/DNA processing, cell cycle, epithelial to mesenchymal transition (EMT), resistance to apoptosis, and cytoskeleton remodeling. Down-regulated genes participate to epithelial cell differentiation, proteolysis, apoptotic, immune response, and inflammatory processes. A 24 gene signature is able to discriminate RECs from PRs in an independent cohort; FANCG is statistically associated with survival in the chol-TCGA dataset. IDH1 was mutated in the RECs of five patients; 4 of them displayed the mutation only in RECs. Deep sequencing performed in one patient confirmed the IDH1 mutation in REC. RECs are enriched for genes involved in EMT, resistance to apoptosis, and cytoskeleton remodeling. Key players of these pathways might be considered druggable targets in RECs. IDH1 is mutated in 30% of RECs, becoming both a marker of progression and a target for therapy.

Oxytocin, vasopressin and estrogen receptor gene expression in relation to social recognition in female mice.

PubMed

Clipperton-Allen, Amy E; Lee, Anna W; Reyes, Anny; Devidze, Nino; Phan, Anna; Pfaff, Donald W; Choleris, Elena

2012-02-28

Inter- and intra-species differences in social behavior and recognition-related hormones and receptors suggest that different distribution and/or expression patterns may relate to social recognition. We used qRT-PCR to investigate naturally occurring differences in expression of estrogen receptor-alpha (ERα), ER-beta (ERβ), progesterone receptor (PR), oxytocin (OT) and receptor, and vasopressin (AVP) and receptors in proestrous female mice. Following four 5 min exposures to the same two conspecifics, one was replaced with a novel mouse in the final trial (T5). Gene expression was examined in mice showing high (85-100%) and low (40-60%) social recognition scores (i.e., preferential novel mouse investigation in T5) in eight socially-relevant brain regions. Results supported OT and AVP involvement in social recognition, and suggest that in the medial preoptic area, increased OT and AVP mRNA, together with ERα and ERβ gene activation, relate to improved social recognition. Initial social investigation correlated with ERs, PR and OTR in the dorsolateral septum, suggesting that these receptors may modulate social interest without affecting social recognition. Finally, increased lateral amygdala gene activation in the LR mice may be associated with general learning impairments, while decreased lateral amygdala activity may indicate more efficient cognitive mechanisms in the HR mice. Copyright © 2011 Elsevier Inc. All rights reserved.

AucPR: an AUC-based approach using penalized regression for disease prediction with high-dimensional omics data.

PubMed

Yu, Wenbao; Park, Taesung

2014-01-01

It is common to get an optimal combination of markers for disease classification and prediction when multiple markers are available. Many approaches based on the area under the receiver operating characteristic curve (AUC) have been proposed. Existing works based on AUC in a high-dimensional context depend mainly on a non-parametric, smooth approximation of AUC, with no work using a parametric AUC-based approach, for high-dimensional data. We propose an AUC-based approach using penalized regression (AucPR), which is a parametric method used for obtaining a linear combination for maximizing the AUC. To obtain the AUC maximizer in a high-dimensional context, we transform a classical parametric AUC maximizer, which is used in a low-dimensional context, into a regression framework and thus, apply the penalization regression approach directly. Two kinds of penalization, lasso and elastic net, are considered. The parametric approach can avoid some of the difficulties of a conventional non-parametric AUC-based approach, such as the lack of an appropriate concave objective function and a prudent choice of the smoothing parameter. We apply the proposed AucPR for gene selection and classification using four real microarray and synthetic data. Through numerical studies, AucPR is shown to perform better than the penalized logistic regression and the nonparametric AUC-based method, in the sense of AUC and sensitivity for a given specificity, particularly when there are many correlated genes. We propose a powerful parametric and easily-implementable linear classifier AucPR, for gene selection and disease prediction for high-dimensional data. AucPR is recommended for its good prediction performance. Beside gene expression microarray data, AucPR can be applied to other types of high-dimensional omics data, such as miRNA and protein data.

Vinegar residue compost as a growth substrate enhances cucumber resistance against the Fusarium wilt pathogen Fusarium oxysporum by regulating physiological and biochemical responses.

PubMed

Shi, Lu; Du, Nanshan; Yuan, Yinghui; Shu, Sheng; Sun, Jin; Guo, Shirong

2016-09-01

Fusarium wilt caused by the fungus Fusarium oxysporum f. sp. cucumerinum (FOC) is the most severe soil-borne disease attacking cucumber. To assess the positive effects of vinegar residue substrate (VRS) on the growth and incidence of Fusarium wilt on cucumber, we determined the cucumber growth parameters, disease severity, defense-related enzyme and pathogenesis-related (PR) protein activities, and stress-related gene expression levels. In in vitro and pot experiments, we demonstrated the following results: (i) the VRS extract exhibited a higher biocontrol activity than that of peat against FOC, and significantly improved the growth inhibition of FOC, with values of 48.3 %; (ii) in response to a FOC challenge, antioxidant enzymes and the key enzymes of phenylpropanoid metabolic activities, as well as the PR protein activities in the roots of cucumber, were significantly increased. Moreover, the activities of these proteins were higher in VRS than in peat; (iii) the expression levels of stress-related genes (including glu, pal, and ethylene receptor) elicited responses to the pathogens inoculated in cucumber leaves; and (iv) the FOC treatment significantly inhibited the growth of cucumber seedlings. Moreover, all of the growth indices of plants grown in VRS were significantly higher than those grown in peat. These results offer a new strategy to control cucumber Fusarium wilt, by upregulating the activity levels of defense-related enzymes and PR proteins and adjusting gene expression levels. They also provide a theoretical basis for VRS applications.

The T47D cell line is an ideal experimental model to elucidate the progesterone-specific effects of a luminal A subtype of breast cancer.

PubMed

Yu, Sungryul; Kim, Taemook; Yoo, Kyung Hyun; Kang, Keunsoo

2017-05-06

Cell lines are often used as in vitro tools to mimic certain types of in vivo system; several cell lines, including MCF-7 and T47D, have been widely used in breast cancer studies without investigating the cell lines' characteristics. In this study, we compared the genome-wide binding profiles of ERα, PR, and P300, and the gene expression changes between MCF-7 and T47D cell lines that represent the luminal A subtype of breast cancer. Surprisingly, several thousand genes were differentially expressed under estrogenic condition. In addition, ERα, PR, and P300 binding to regulatory elements showed distinct genomic landscapes between MCF-7 and T47D cell lines in the same hormonal states. In particular, the T47D cell line was markedly susceptible to progesterone, whereas the MCF-7 cell line did not respond to progesterone in the presence of estrogen. Consistently, changes in the expression level of the PR-target gene, STAT5A, were only observed in the T47D cell line, not the MCF-7 cell line, when treated with progesterone. Overall, the results highlight the importance of selecting appropriate cell lines for breast cancer studies and suggest that T47D cell lines can be an ideal experimental model to elucidate the progesterone-specific effects of a luminal A subtype of breast cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

Constitutive expression of the poplar WRKY transcription factor PtoWRKY60 enhances resistance to Dothiorella gregaria Sacc. in transgenic plants.

PubMed

Ye, Shenglong; Jiang, Yuanzhong; Duan, Yanjiao; Karim, Abdul; Fan, Di; Yang, Li; Zhao, Xin; Yin, Jia; Luo, Keming

2014-10-01

WRKY proteins are involved in various physiological processes in plants, especially in coping with diverse biotic and abiotic stresses. However, limited information is available on the roles of specific WRKY transcription factors in poplar defense. In this study, we reported the characterization of PtoWRKY60, a Group IIa WRKY member, from Populus tomentosa Carr. The gene expression profile of PtoWRKY60 in various tissues showed that it significantly accumulated in old leaves. Phylogenetic analyses revealed that PtoWRKY60 had a close relationship with AtWRKY18, AtWRKY40 and AtWRKY60. PtoWRKY60 was induced mainly by salicylic acid (SA) and slightly by Dothiorella gregaria Sacc., jasmonic acid, wounding treatment, low temperature and salinity stresses. Overexpression of PtoWRKY60 in poplar resulted in increased resistance to D. gregaria. The defense-associated genes, such as PR5.1, PR5.2, PR5.4, PR5.5 and CPR5, were markedly up-regulated in transgenic plants overexpressing PtoWRKY60. These results indicate that PtoWRKY60 might be partly involved in the signal transduction pathway initiated by SA in Populus. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Over-expression of the Pseudomonas syringae harpin-encoding gene hrpZm confers enhanced tolerance to Phytophthora root and stem rot in transgenic soybean.

PubMed

Du, Qian; Yang, Xiangdong; Zhang, Jinhua; Zhong, Xiaofang; Kim, Kyung Seok; Yang, Jing; Xing, Guojie; Li, Xiaoyu; Jiang, Zhaoyuan; Li, Qiyun; Dong, Yingshan; Pan, Hongyu

2018-06-01

Phytophthora root and stem rot (PRR) caused by Phytophthora sojae is one of the most devastating diseases reducing soybean (Glycine max) production all over the world. Harpin proteins in many plant pathogenic bacteria were confirmed to enhance disease and insect resistance in crop plants. Here, a harpin protein-encoding gene hrpZpsta from the P. syringae pv. tabaci strain Psta218 was codon-optimized (renamed hrpZm) and introduced into soybean cultivars Williams 82 and Shennong 9 by Agrobacterium-mediated transformation. Three independent transgenic lines over-expressing hrpZm were obtained and exhibited stable and enhanced tolerance to P. sojae infection in T 2 -T 4 generations compared to the non-transformed (NT) and empty vector (EV)-transformed plants. Quantitative real-time PCR (qRT-PCR) analysis revealed that the expression of salicylic acid-dependent genes PR1, PR12, and PAL, jasmonic acid-dependent gene PPO, and hypersensitive response (HR)-related genes GmNPR1 and RAR was significantly up-regulated after P. sojae inoculation. Moreover, the activities of defense-related enzymes such as phenylalanine ammonia lyase (PAL), polyphenoloxidase (PPO), peroxidase, and superoxide dismutase also increased significantly in the transgenic lines compared to the NT and EV-transformed plants after inoculation. Our results suggest that over-expression of the hrpZm gene significantly enhances PRR tolerance in soybean by eliciting resistance responses mediated by multiple defense signaling pathways, thus providing an alternative approach for development of soybean varieties with improved tolerance against the soil-borne pathogen PRR.

Benzoylsalicylic acid derivatives as defense activators in tobacco and Arabidopsis.

PubMed

Kamatham, Samuel; Pallu, Reddanna; Pasupulati, Anil Kumar; Singh, Surya Satyanarayana; Gudipalli, Padmaja

2017-11-01

Systemic acquired resistance (SAR) is a long lasting inducible whole plant immunity often induced by either pathogens or chemical elicitors. Salicylic acid (SA) is a known SAR signal against a broad spectrum of pathogens in plants. In a recent study, we have reported that benzoylsalicylic acid (BzSA) is a SAR inducer in tobacco and Arabidopsis plants. Here, we have synthesized BzSA derivatives using SA and benzoyl chlorides of various moieties as substrates. The chemical structures of BzSA derivatives were elucidated using Infrared spectroscopy (IR), Nuclear magnetic spectroscopy (NMR) and High-resolution mass spectrometer (HRMS) analysis. The bioefficacy of BzSA derivatives in inducing defense response against tobacco mosaic virus (TMV) was investigated in tobacco and SA abolished transgenic NahG Arabidopsis plants. Interestingly, pre-treatment of local leaves of tobacco with BzSA derivatives enhanced the expression of SAR genes such as NPR1 [Non-expressor of pathogenesis-related (PR) genes 1], PR and other defense marker genes (HSR203, SIPK, WIPK) in systemic leaves. Pre-treatment of BzSA derivatives reduced the spread of TMV infection to uninfected areas by restricting lesion number and diameter both in local and systemic leaves of tobacco in a dose-dependent manner. Furthermore, pre-treatment of BzSA derivatives in local leaves of SA deficient Arabidopsis NahG plants induced SAR through AtPR1 and AtPR5 gene expression and reduced leaf necrosis and curling symptoms in systemic leaves as compared to BzSA. These results suggest that BzSA derivatives are potent SAR inducers against TMV in tobacco and Arabidopsis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Stent-based delivery of adeno-associated viral vectors with sustained vascular transduction and iNOS-mediated inhibition of in-stent restenosis

PubMed Central

Fishbein, Ilia; Guerrero, David T.; Alferiev, Ivan S.; Foster, Jonathan B.; Minutolo, Nicholas G.; Chorny, Michael; Mas Monteys, Alejandro; Driesbaugh, Kathryn H.; Nagaswami, Chandrasekaran; Levy, Robert J.

2017-01-01

In-stent restenosis remains an important clinical problem in the era of drug eluting stents. Development of clinical gene therapy protocols for the prevention and treatment of in-stent restenosis is hampered by the lack of adequate local delivery systems. Herein we describe a novel stent-based gene delivery platform capable of providing local arterial gene transfer with adeno-associated viral (AAV) vectors. This system exploits the natural affinity of protein G (PrG) to bind to the Fc region of mammalian IgG, making PrG a universal adaptor for surface immobilization of vector-capturing antibodies (Ab). Our results: 1) demonstrate the feasibility of reversible immobilization of AAV2 vectors using vector tethering by AAV2-specific Ab appended to the stent surface through covalently attached PrG, 2) show sustained release kinetics of PrG/Ab-immobilized AAV2 vector particles into simulated physiological medium in vitro and site-specific transduction of cultured cells, 3) provide evidence of long-term (12 weeks) arterial expression of luciferase with PrG/Ab-tethered AAV2Luc, and 4) show anti-proliferative activity and anti-restenotic efficacy of stent-immobilized AAV2iNOS in the rat carotid artery model of stent angioplasty. PMID:28832561

Gbvdr6, a Gene Encoding a Receptor-Like Protein of Cotton (Gossypium barbadense), Confers Resistance to Verticillium Wilt in Arabidopsis and Upland Cotton

PubMed Central

Yang, Yuwen; Chen, Tianzi; Ling, Xitie; Ma, Zhengqiang

2018-01-01

Verticillium wilt is a soil-borne disease that can cause devastating losses in cotton production. Because there is no effective chemical means to combat the disease, the only effective way to control Verticillium wilt is through genetic improvement. Therefore, the identification of additional disease-resistance genes will benefit efforts toward the genetic improvement of cotton resistance to Verticillium wilt. Based on screening of a BAC library with a partial Ve homologous fragment and expression analysis, a V. dahliae-induced gene, Gbvdr6, was isolated and cloned from the Verticillium wilt-resistant cotton G. barbadense cultivar Hai7124. The gene was located in the gene cluster containing Gbve1 and Gbvdr5 and adjacent to the Verticillium wilt-resistance QTL hotspot. Gbvdr6 was induced by Verticillium dahliae Kleb and by the plant hormones salicylic acid (SA), methyl jasmonate (MeJA) and ethephon (ETH) but not by abscisic acid (ABA). Gbvdr6 was localized to the plasma membrane. Overexpression of Gbvdr6 in Arabidopsis and cotton enhanced resistance to V. dahliae. Moreover, the JA/ET signaling pathway-related genes PR3, PDF 1.2, ERF1 and the SA-related genes PR1 and PR2 were constitutively expressed in transgenic plants. Gbvdr6-overexpressing Arabidopsis was less sensitive than the wild-type plant to MeJA. Furthermore, the accumulation of reactive oxygen species and callose was triggered at early time points after V. dahliae infection. These results suggest that Gbvdr6 confers resistance to V. dahliae through regulation of the JA/ET and SA signaling pathways. PMID:29387078

The Epiphytic Fungus Pseudozyma aphidis Induces Jasmonic Acid- and Salicylic Acid/Nonexpressor of PR1-Independent Local and Systemic Resistance1[C][W

PubMed Central

Buxdorf, Kobi; Rahat, Ido; Gafni, Aviva; Levy, Maggie

2013-01-01

Pseudozyma spp. are yeast-like fungi, classified in the Ustilaginales, which are mostly epiphytic or saprophytic and are not pathogenic to plants. Several Pseudozyma species have been reported to exhibit biological activity against powdery mildews. However, previous studies have reported that Pseudozyma aphidis, which can colonize plant surfaces, is not associated with the ‎‎collapse of powdery ‎mildew colonies. In this report, we describe a novel P. aphidis strain and study its interactions with its plant host and the plant pathogen Botrytis cinerea. This isolate was found to secrete extracellular metabolites that inhibit various fungal pathogens in vitro and significantly reduce B. cinerea infection in vivo. Moreover, P. aphidis sensitized Arabidopsis (Arabidopsis thaliana) plants’ defense machinery via local and systemic induction of PATHOGENESIS-RELATED1 (PR1) and PLANT DEFENSIN1.2 (PDF1.2) expression. P. aphidis also reduced B. cinerea infection, locally and systemically, in Arabidopsis mutants impaired in jasmonic acid (JA) or salicylic acid (SA) signaling. Thus, in addition to direct inhibition, P. aphidis may inhibit B. cinerea infection via induced resistance in a manner independent of SA, JA, and Nonexpressor of PR1 (NPR1). P. aphidis primed the plant defense machinery and induced stronger activation of PDF1.2 after B. cinerea infection. Finally, P. aphidis fully or partially reconstituted PR1 and PDF1.2 expression in npr1-1 mutant and in plants with the SA hydroxylase NahG transgene, but not in a jasmonate resistant1-1 mutant, after B. cinerea infection, suggesting that P. aphidis can bypass the SA/NPR1, but not JA, pathway to activate PR genes. Thus, either partial gene activation is sufficient to induce resistance, or the resistance is not directed solely through PR1 and PDF1.2 but probably through other pathogen-resistance genes or pathways as well. PMID:23388119

The epiphytic fungus Pseudozyma aphidis induces jasmonic acid- and salicylic acid/nonexpressor of PR1-independent local and systemic resistance.

PubMed

Buxdorf, Kobi; Rahat, Ido; Gafni, Aviva; Levy, Maggie

2013-04-01

Pseudozyma spp. are yeast-like fungi, classified in the Ustilaginales, which are mostly epiphytic or saprophytic and are not pathogenic to plants. Several Pseudozyma species have been reported to exhibit biological activity against powdery mildews. However, previous studies have reported that Pseudozyma aphidis, which can colonize plant surfaces, is not associated with the collapse of powdery mildew colonies. In this report, we describe a novel P. aphidis strain and study its interactions with its plant host and the plant pathogen Botrytis cinerea. This isolate was found to secrete extracellular metabolites that inhibit various fungal pathogens in vitro and significantly reduce B. cinerea infection in vivo. Moreover, P. aphidis sensitized Arabidopsis (Arabidopsis thaliana) plants' defense machinery via local and systemic induction of pathogenesis-related1 (PR1) and plant defensin1.2 (PDF1.2) expression. P. aphidis also reduced B. cinerea infection, locally and systemically, in Arabidopsis mutants impaired in jasmonic acid (JA) or salicylic acid (SA) signaling. Thus, in addition to direct inhibition, P. aphidis may inhibit B. cinerea infection via induced resistance in a manner independent of SA, JA, and Nonexpressor of PR1 (NPR1). P. aphidis primed the plant defense machinery and induced stronger activation of PDF1.2 after B. cinerea infection. Finally, P. aphidis fully or partially reconstituted PR1 and PDF1.2 expression in npr1-1 mutant and in plants with the SA hydroxylase NahG transgene, but not in a jasmonate resistant1-1 mutant, after B. cinerea infection, suggesting that P. aphidis can bypass the SA/NPR1, but not JA, pathway to activate PR genes. Thus, either partial gene activation is sufficient to induce resistance, or the resistance is not directed solely through PR1 and PDF1.2 but probably through other pathogen-resistance genes or pathways as well.

Changes of sperm quality and hormone receptors in the rat testis after exposure to methamphetamine.

PubMed

Nudmamud-Thanoi, Sutisa; Sueudom, Wanvipa; Tangsrisakda, Nareelak; Thanoi, Samur

2016-10-01

Methamphetamine (METH) is known to damage neurons and induce psychosis. It can also induce apoptosis in seminiferous tubules and affect sperm quality. The present study was carried out to investigate the effect of a rat model of METH addiction on sperm quality and expression of progesterone receptors (PR) and estrogen receptors (ER) in the testis. Sperm quality parameters including sperm motility, sperm morphology and sperm concentration were examined. Protein and gene expressions PR, ERα and ERβ were studied using immunohistochemistry and reverse transcriptase-polymerase chain reaction, respectively. The percentages of normal sperm motility and normal sperm morphology were significantly decreased in animals receiving METH, especially in escalating dose (ED METH) and escalating dose-binge (ED-binge METH) groups when compared with control. In addition, sperm concentrations in ED METH and ED-binge METH groups were numerically decreased. PR, ERα and ERβ immunoreactive cells were significantly decreased in spermatogonia, spermatogenic cells and especially in Sertoli cells in all METH-treated groups. Furthermore, messenger RNA expression of PR, ERα and ERβ were also significantly decreased in all METH-treated animals. These results indicate that METH can induce abnormal sperm quality. These changes of sperm quality may relate to the reduction of PR, ERα and ERβ expressions in male germ cells and Sertoli cells which are essential for spermatogenesis and development of sperm.

Characterization of resistance to pine wood nematode infection in Pinus thunbergii using suppression subtractive hybridization.

PubMed

Hirao, Tomonori; Fukatsu, Eitaro; Watanabe, Atsushi

2012-01-24

Pine wilt disease is caused by the pine wood nematode, Bursaphelenchus xylophilus, which threatens pine forests and forest ecosystems worldwide and causes serious economic losses. In the 40 years since the pathogen was identified, the physiological changes occurring as the disease progresses have been characterized using anatomical and biochemical methods, and resistant trees have been selected via breeding programs. However, no studies have assessed the molecular genetics, e.g. transcriptional changes, associated with infection-induced physiological changes in resistant or susceptible trees. We constructed seven subtractive suppression hybridization (SSH) cDNA libraries using time-course sampling of trees inoculated with pine wood nematode at 1, 3, or 7 days post-inoculation (dpi) in susceptible trees and at 1, 3, 7, or 14 dpi in resistant trees. A total of 3,299 sequences was obtained from these cDNA libraries, including from 138 to 315 non-redundant sequences in susceptible SSH libraries and from 351 to 435 in resistant SSH libraries. Using Gene Ontology hierarchy, those non-redundant sequences were classified into 15 subcategories of the biological process Gene Ontology category and 17 subcategories of the molecular function category. The transcriptional components revealed by the Gene Ontology classification clearly differed between resistant and susceptible libraries. Some transcripts were discriminative: expression of antimicrobial peptide and putative pathogenesis-related genes (e.g., PR-1b, 2, 3, 4, 5, 6) was much higher in susceptible trees than in resistant trees at every time point, whereas expression of PR-9, PR-10, and cell wall-related genes (e.g., for hydroxyproline-rich glycoprotein precursor and extensin) was higher in resistant trees than in susceptible trees at 7 and 14 dpi. Following inoculation with pine wood nematode, there were marked differences between resistant and susceptible trees in transcript diversity and the timing and level of transcripts expressed in common; in particular, expression of stress response and defense genes differed. This study provided new insight into the differences in the physiological changes between resistant and susceptible trees that have been observed in anatomical and biochemical studies.

Production of cattle lacking prion protein

PubMed Central

Richt, Jürgen A; Kasinathan, Poothappillai; Hamir, Amir N; Castilla, Joaquin; Sathiyaseelan, Thillai; Vargas, Francisco; Sathiyaseelan, Janaki; Wu, Hua; Matsushita, Hiroaki; Koster, Julie; Kato, Shinichiro; Ishida, Isao; Soto, Claudio; Robl, James M; Kuroiwa, Yoshimi

2010-01-01

Prion diseases are caused by propagation of misfolded forms of the normal cellular prion protein PrPC, such as PrPBSE in bovine spongiform encephalopathy (BSE) in cattle and PrPCJD in Creutzfeldt-Jakob disease (CJD) in humans1. Disruption of PrPC expression in mice, a species that does not naturally contract prion diseases, results in no apparent developmental abnormalities2–5. However, the impact of ablating PrPC function in natural host species of prion diseases is unknown. Here we report the generation and characterization of PrPC-deficient cattle produced by a sequential gene-targeting system6. At over 20 months of age, the cattle are clinically, physiologically, histopathologically, immunologically and reproductively normal. Brain tissue homogenates are resistant to prion propagation in vitro as assessed by protein misfolding cyclic amplification7. PrPC-deficient cattle may be a useful model for prion research and could provide industrial bovine products free of prion proteins. PMID:17195841

Investigation of the interaction between bta-miR-222 and the estrogen receptor alpha gene in the bovine ovarium.

PubMed

Özdemir, Selçuk; Çomaklı, Selim

2018-06-28

The aim of the present study was to investigate the posttranscriptional regulation of bta-miR-222 and the estrogen receptor (ER)-alpha gene in cows. The preovulatory follicles (POFs) were detected and ER-alpha levels in the corpus luteum (CL) were measured via immunofluorescent method. Afterwards, an ELISA test was performed to detect estradiol- and progesterone-active follicles, and the expression levels of ER-alpha, progesterone receptor (PR), and bta-miR-222 were measured via qRT-PCR. Finally, a western blot analysis was performed to determine ER-alpha protein levels. Immunofluorescence staining was highly positive in the follicular phase, showing ER-alpha and PR immunopositivity. In the luteal phase, ER-alpha immunopositivity decreased in lutein cells, whereas the PRs were observed to be similar in intensity to those in follicular phase. While the estradiol levels were higher in the POFs, the progesterone level was higher in the CL. In the CL, the transcription levels of ER-alpha and PR mRNA were observed to be the same as in the POFs; however, the expression of bta-miR-222 was lower. In the CL, the transcription level of ER-alpha mRNA was lower than that of PR mRNA, and the expression level of bta-miR-222 was higher than that of PR mRNA. The results of the western blot analysis show that the ER-alpha protein level in the CL was lower than that in the POFs. Taken together, our results here suggest that there is a negative correlation between bta-miR-222 and ER-alpha expression during follicular development in cow ovaries. Copyright © 2018 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier B.V. All rights reserved.

Estrogen receptor-beta expression in invasive breast cancer in relation to molecular phenotype: results from the Nurses' Health Study.

PubMed

Marotti, Jonathan D; Collins, Laura C; Hu, Rong; Tamimi, Rulla M

2010-02-01

The expression of estrogen receptor-alpha (ER-alpha) and related genes has emerged as one of the major determinants of molecular classification of invasive breast cancers. Expression of a second ER, estrogen receptor-beta (ER-beta), has not been previously evaluated in a large population-based study. Therefore, we examined ER-beta expression in a large population of women with breast cancer to assess its relationship to molecular categories of invasive breast cancer. We constructed tissue microarrays from paraffin blocks of 3093 breast cancers that developed in women enrolled in the Nurses' Health Study. Tissue microarray sections were immunostained for ER-alpha, progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), cytokeratin 5/6, epidermal growth factor receptor (EGFR) and with a monoclonal antibody to ER-beta. Cancers were categorized as luminal A (ER-alpha+ and/or PR+ and HER2-); luminal B (ER-alpha+ and/or PR+ and HER2+); HER2 (ER-alpha- and PR- and HER2+); and basal-like (ER-alpha-, PR-, HER2- and EGFR or cytokeratin 5/6+). The relationship between expression of ER-beta and molecular class of invasive breast cancer was analyzed. Overall, 68% of breast carcinomas were ER-beta+. Expression of ER-beta was significantly associated with expression of ER-alpha (P<0.0001) and PR (P<0.0001), and was inversely related to expression of HER2 (P=0.004), CK5/6 (P=0.02) and EGFR (P=0.006). Among 2170 invasive cancers with complete immunophenotypic data, 73% were luminal A, 5% luminal B, 6 % HER2 and 11% basal-like. ER-beta expression was significantly related to molecular category (P<0.0001) and was more common in luminal A (72% of cases) and B (68% of cases) than in HER2 or basal-like types. However, despite their being defined by the absence of ER-alpha expression, 55% of HER2-type and 60% of basal-like cancers showed expression of ER-beta. The role of ER-beta in the development and progression of breast cancers defined by lack of expression of ER-alpha merits further investigation.

Goats without Prion Protein Display Enhanced Proinflammatory Pulmonary Signaling and Extracellular Matrix Remodeling upon Systemic Lipopolysaccharide Challenge.

PubMed

Salvesen, Øyvind; Reiten, Malin R; Kamstra, Jorke H; Bakkebø, Maren K; Espenes, Arild; Tranulis, Michael A; Ersdal, Cecilie

2017-01-01

A naturally occurring mutation in the PRNP gene of Norwegian dairy goats terminates synthesis of the cellular prion protein (PrP C ), rendering homozygous goats ( PRNP Ter/Ter ) devoid of the protein. Although PrP C has been extensively studied, particularly in the central nervous system, the biological role of PrP C remains incompletely understood. Here, we examined whether loss of PrP C affects the initial stage of lipopolysaccharide (LPS)-induced acute lung injury (ALI). Acute pulmonary inflammation was induced by intravenous injection of LPS ( Escherichia coli O26:B6) in 16 goats (8 PRNP Ter/Ter and 8 PRNP +/+ ). A control group of 10 goats (5 PRNP Ter/Ter and 5 PRNP +/+ ) received sterile saline. Systemic LPS challenge induced sepsis-like clinical signs including tachypnea and respiratory distress. Microscopic examination of lungs revealed multifocal areas with alveolar hemorrhages, edema, neutrophil infiltration, and higher numbers of alveolar macrophages, with no significant differences between PRNP genotypes. A total of 432 ( PRNP +/+ ) and 596 ( PRNP Ter/Ter ) genes were differentially expressed compared with the saline control of the matching genotype. When assigned to gene ontology categories, biological processes involved in remodeling of the extracellular matrix (ECM), were exclusively enriched in PrP C -deficient goats. These genes included a range of collagen-encoding genes, and proteases such as matrix metalloproteinases ( MMP1, MMP2, MMP14, ADAM15 ) and cathepsins. Several proinflammatory upstream regulators (TNF-α, interleukin-1β, IFN-γ) showed increased activation scores in goats devoid of PrP C . In conclusion, LPS challenge induced marked alterations in the lung tissue transcriptome that corresponded with histopathological and clinical findings in both genotypes. The increased activation of upstream inflammatory regulators and enrichment of ECM components could reflect increased inflammation in the absence of PrP C . Further studies are required to elucidate whether these alterations may affect the later reparative phase of ALI.

Fusion-Related Host Proteins Are Actively Regulated by NA during Influenza Infection as Revealed by Quantitative Proteomics Analysis

PubMed Central

Sui, Zhiwei; Wen, Bo; Gao, Zhimin; Chen, Quanjiao

2014-01-01

Three recombinant influenza A viruses with different neuraminidases (NAs) in the background of A/PR/8/34 (PR8), named rPR8-H5N1NA, rPR8-H9N2NA, and rPR8-H1N1NA, derived from H5N1, H9N2, H1N1 (swine) viruses, respectively, were constructed. We performed a quantitative proteomics analysis to investigate differential protein expression in Madin-Darby canine kidney (MDCK) cells infected with recombinant and wild-type influenza viruses to determine whether NA replacement would alter host cell gene expression. Using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-TOF MS) and two-dimensional gel electrophoresis (2-DE), we identified 12 up-regulated and 49 down-regulated protein spots, including cytoskeletal proteins, molecular biosynthesis proteins, ubiquitin-proteasome pathway proteins, and heat shock proteins. The most significant changes in infected cells were observed for molecular biosynthesis proteins. We found more differentially expressed protein spots in cells infected with rPR8-H5N1NA or rPR8-H9N2NA viruses than cells infected with wild-type virus. Many of those proteins are postulated to be involved in cell-cell fusion, but the full mechanism remains to be explored. Meanwhile, our data demonstrate that the wild-type virus has evolutionary advantages over recombinant viruses. PMID:25153908

OsBIRH1, a DEAD-box RNA helicase with functions in modulating defence responses against pathogen infection and oxidative stress

PubMed Central

Li, Dayong; Liu, Huizhi; Zhang, Huijuan; Wang, Xiaoe; Song, Fengming

2008-01-01

DEAD-box proteins comprise a large protein family with members from all kingdoms and play important roles in all types of processes in RNA metabolism. In this study, a rice gene OsBIRH1, which encodes a DEAD-box RNA helicase protein, was cloned and characterized. The predicted OsBIRH1 protein contains a DEAD domain and all conserved motifs that are common characteristics of DEAD-box RNA helicases. Recombinant OsBIRH1 protein purified from Escherichia coli was shown to have both RNA-dependent ATPase and ATP-dependent RNA helicase activities in vitro. Expression of OsBIRH1 was activated in rice seedling leaves after treatment with defence-related signal chemicals, for example benzothiadiazole, salicylic acid, l-aminocyclopropane-1-carboxylic acid, and jasmonic acid, and was also up-regulated in an incompatible interaction between a resistant rice genotype and the blast fungus, Magnaporthe grisea. Transgenic Arabidopsis plants that overexpress the OsBIRH1 gene were generated. Disease resistance phenotype assays revealed that the OsBIRH1-overexpressing transgenic plants showed an enhanced disease resistance against Alternaria brassicicola and Pseudomonas syringae pv. tomato DC3000. Meanwhile, defence-related genes, for example PR-1, PR-2, PR-5, and PDF1.2, showed an up-regulated expression in the transgenic plants. Moreover, the OsBIRH1 transgenic Arabidopsis plants also showed increased tolerance to oxidative stress and elevated expression levels of oxidative defence genes, AtApx1, AtApx2, and AtFSD1. The results suggest that OsBIRH1 encodes a functional DEAD-box RNA helicase and plays important roles in defence responses against biotic and abiotic stresses. PMID:18441339

Enhanced Host-Parasite Resistance Based on Down-Regulation of Phelipanche aegyptiaca Target Genes Is Likely by Mobile Small RNA

PubMed Central

Dubey, Neeraj K.; Eizenberg, Hanan; Leibman, Diana; Wolf, Dalia; Edelstein, Menahem; Abu-Nassar, Jackline; Marzouk, Sally; Gal-On, Amit; Aly, Radi

2017-01-01

RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp.) are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma): transient expression using Tobacco rattle virus (TRV:pma) as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill.) plants harboring a hairpin construct (pBINPLUS35:pma). siRNA-mediated transgene-silencing (20–24 nt) was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes. PMID:28955363

Expression of flavonoid 3'-hydroxylase is controlled by P1, the regulator of 3-deoxyflavonoid biosynthesis in maize.

PubMed

Sharma, Mandeep; Chai, Chenglin; Morohashi, Kengo; Grotewold, Erich; Snook, Maurice E; Chopra, Surinder

2012-11-01

The maize (Zea mays) red aleurone1 (pr1) encodes a CYP450-dependent flavonoid 3'-hydroxylase (ZmF3'H1) required for the biosynthesis of purple and red anthocyanin pigments. We previously showed that Zmf3'h1 is regulated by C1 (Colorless1) and R1 (Red1) transcription factors. The current study demonstrates that, in addition to its role in anthocyanin biosynthesis, the Zmf3'h1 gene also participates in the biosynthesis of 3-deoxyflavonoids and phlobaphenes that accumulate in maize pericarps, cob glumes, and silks. Biosynthesis of 3-deoxyflavonoids is regulated by P1 (Pericarp color1) and is independent from the action of C1 and R1 transcription factors. In maize, apiforol and luteoforol are the precursors of condensed phlobaphenes. Maize lines with functional alleles of pr1 and p1 (Pr1;P1) accumulate luteoforol, while null pr1 lines with a functional or non-functional p1 allele (pr1;P1 or pr1;p1) accumulate apiforol. Apiforol lacks a hydroxyl group at the 3'-position of the flavylium B-ring, while luteoforol has this hydroxyl group. Our biochemical analysis of accumulated compounds in different pr1 genotypes showed that the pr1 encoded ZmF3'H1 has a role in the conversion of mono-hydroxylated to bi-hydroxylated compounds in the B-ring. Steady state RNA analyses demonstrated that Zmf3'h1 mRNA accumulation requires a functional p1 allele. Using a combination of EMSA and ChIP experiments, we established that the Zmf3'h1 gene is a direct target of P1. Highlighting the significance of the Zmf3'h1 gene for resistance against biotic stress, we also show here that the p1 controlled 3-deoxyanthocyanidin and C-glycosyl flavone (maysin) defence compounds accumulate at significantly higher levels in Pr1 silks as compared to pr1 silks. By virtue of increased maysin synthesis in Pr1 plants, corn ear worm larvae fed on Pr1; P1 silks showed slower growth as compared to pr1; P1 silks. Our results show that the Zmf3'h1 gene participates in the biosynthesis of phlobaphenes and agronomically important 3-deoxyflavonoid compounds under the regulatory control of P1.

PtrWRKY73, a salicylic acid-inducible poplar WRKY transcription factor, is involved in disease resistance in Arabidopsis thaliana.

PubMed

Duan, Yanjiao; Jiang, Yuanzhong; Ye, Shenglong; Karim, Abdul; Ling, Zhengyi; He, Yunqiu; Yang, Siqi; Luo, Keming

2015-05-01

A salicylic acid-inducible WRKY gene, PtrWRKY73, from Populus trichocarpa , was isolated and characterized. Overexpression of PtrWRKY73 in Arabidopsis thaliana increased resistance to biotrophic pathogens but reduced resistance against necrotrophic pathogens. WRKY transcription factors are commonly involved in plant defense responses. However, limited information is available about the roles of the WRKY genes in poplar defense. In this study, we isolated a salicylic acid (SA)-inducible WRKY gene, PtrWRKY73, from Populus trichocarpa, belonging to group I family and containing two WRKY domains, a D domain and an SP cluster. PtrWRKY73 was expressed predominantly in roots, old leaves, sprouts and stems, especially in phloem and its expression was induced in response to treatment with exogenous SA. PtrWRKY73 was localized to the nucleus of plant cells and exhibited transcriptional activation. Overexpression of PtrWRKY73 in Arabidopsis thaliana resulted in increased resistance to a virulent strain of the bacterial pathogen Pseudomonas syringae (PstDC3000), but more sensitivity to the necrotrophic fungal pathogen Botrytis cinerea. The SA-mediated defense-associated genes, such as PR1, PR2 and PAD4, were markedly up-regulated in transgenic plants overexpressing PtrWRKY73. Arabidopsis non-expressor of PR1 (NPR1) was not affected, whereas a defense-related gene PAL4 had reduced in PtrWRKY73 overexpressor plants. Together, these results indicated that PtrWRKY73 plays a positive role in plant resistance to biotrophic pathogens but a negative effect on resistance against necrotrophic pathogens.

The importance of propolis in alleviating the negative physiological effects of heat stress in quail chicks

PubMed Central

Ibrahim, Rania M.; Desoky, Adel A.; Safaa, Hosam M.; El-Sayed, Osama A.; Abass, Ahmed O.

2017-01-01

Heat stress is one of the most detrimental confrontations in tropical and subtropical regions of the world, causing considerable economic losses in poultry production. Propolis, a resinous product of worker honeybees, possesses several biological activities that could be used to alleviate the deleterious effects of high environmental temperature on poultry production. The current study was aimed at evaluating the effects of propolis supplementation to Japanese quail (Coturnix coturnix japonica) diets on the production performance, intestinal histomorphology, relative physiological and immunological parameters, and selected gene expression under heat stress conditions. Three hundred one-day-old Japanese quail chicks were randomly distributed into 20 wired-cages. At 28 d of age, the birds were divided into 2 temperature treatment groups; a normal at 24°C (C group) and a heat stress at 35°C (HS group). The birds in each group were further assigned to 2 subgroups; one of them was fed on a basal diet without propolis supplementation (-Pr subgroup) while the other was supplemented with propolis (+Pr subgroup). Production performance including body weight gain, feed intake and feed conversion ratio were measured. The intestinal histomorphological measurements were also performed for all treatment groups. Relative physiological parameters including body temperature, corticosterone hormone level, malondialdehyde (MDA) and free triiodothyronine hormone (fT3), as well as the relative immunological parameters including the total white blood cells count (TWBC’s), heterophil/lymphocyte (H/L) ratio and lymphocyte proliferation index, were also measured. Furthermore, the mRNA expression for toll like receptor 5 (TLR5), cysteine-aspartic protease-6 (CASP6) and heat shock proteins 70 and 90 (Hsp70 and Hsp90) genes was quantified in this study. The quail production performance was significantly (P<0.05) impaired by HS treatment, while Pr treatment significantly improved the quail production performance. The villus width and area were significantly (P<0.05) lower in the HS compared to the C group, while Pr treatment significantly increased crypts depth of quail. A negative impact of HS treatment was observed on the physiological status of quail; however, propolis significantly alleviated this negative effect. Moreover, quail of the HS group expressed lower immunological parameters than C group, while propolis enhanced the immune status of the quail. The relative mRNA expression of TLR5 gene was down-regulated by HS treatment while it was up-regulated by the Pr treatment. Furthermore, the positive effects of propolis in HS-quail were evidenced by normalizing the high expressions of CASP6 and Hsp70 genes when compared to the C group. Based on these results, the addition of propolis to quail diets as a potential nutritional strategy in order to improve their performance, especially under heat stress conditions, is recommended. PMID:29053741

The importance of propolis in alleviating the negative physiological effects of heat stress in quail chicks.

PubMed

Mehaisen, Gamal M K; Ibrahim, Rania M; Desoky, Adel A; Safaa, Hosam M; El-Sayed, Osama A; Abass, Ahmed O

2017-01-01

Heat stress is one of the most detrimental confrontations in tropical and subtropical regions of the world, causing considerable economic losses in poultry production. Propolis, a resinous product of worker honeybees, possesses several biological activities that could be used to alleviate the deleterious effects of high environmental temperature on poultry production. The current study was aimed at evaluating the effects of propolis supplementation to Japanese quail (Coturnix coturnix japonica) diets on the production performance, intestinal histomorphology, relative physiological and immunological parameters, and selected gene expression under heat stress conditions. Three hundred one-day-old Japanese quail chicks were randomly distributed into 20 wired-cages. At 28 d of age, the birds were divided into 2 temperature treatment groups; a normal at 24°C (C group) and a heat stress at 35°C (HS group). The birds in each group were further assigned to 2 subgroups; one of them was fed on a basal diet without propolis supplementation (-Pr subgroup) while the other was supplemented with propolis (+Pr subgroup). Production performance including body weight gain, feed intake and feed conversion ratio were measured. The intestinal histomorphological measurements were also performed for all treatment groups. Relative physiological parameters including body temperature, corticosterone hormone level, malondialdehyde (MDA) and free triiodothyronine hormone (fT3), as well as the relative immunological parameters including the total white blood cells count (TWBC's), heterophil/lymphocyte (H/L) ratio and lymphocyte proliferation index, were also measured. Furthermore, the mRNA expression for toll like receptor 5 (TLR5), cysteine-aspartic protease-6 (CASP6) and heat shock proteins 70 and 90 (Hsp70 and Hsp90) genes was quantified in this study. The quail production performance was significantly (P<0.05) impaired by HS treatment, while Pr treatment significantly improved the quail production performance. The villus width and area were significantly (P<0.05) lower in the HS compared to the C group, while Pr treatment significantly increased crypts depth of quail. A negative impact of HS treatment was observed on the physiological status of quail; however, propolis significantly alleviated this negative effect. Moreover, quail of the HS group expressed lower immunological parameters than C group, while propolis enhanced the immune status of the quail. The relative mRNA expression of TLR5 gene was down-regulated by HS treatment while it was up-regulated by the Pr treatment. Furthermore, the positive effects of propolis in HS-quail were evidenced by normalizing the high expressions of CASP6 and Hsp70 genes when compared to the C group. Based on these results, the addition of propolis to quail diets as a potential nutritional strategy in order to improve their performance, especially under heat stress conditions, is recommended.

Requirement of the Cytosolic Interaction between PATHOGENESIS-RELATED PROTEIN10 and LEUCINE-RICH REPEAT PROTEIN1 for Cell Death and Defense Signaling in Pepper[W

PubMed Central

Choi, Du Seok; Hwang, In Sun; Hwang, Byung Kook

2012-01-01

Plants recruit innate immune receptors such as leucine-rich repeat (LRR) proteins to recognize pathogen attack and activate defense genes. Here, we identified the pepper (Capsicum annuum) pathogenesis-related protein10 (PR10) as a leucine-rich repeat protein1 (LRR1)–interacting partner. Bimolecular fluorescence complementation and coimmunoprecipitation assays confirmed the specific interaction between LRR1 and PR10 in planta. Avirulent Xanthomonas campestris pv vesicatoria infection induces PR10 expression associated with the hypersensitive cell death response. Transient expression of PR10 triggers hypersensitive cell death in pepper and Nicotiana benthamiana leaves, which is amplified by LRR1 coexpression as a positive regulator. LRR1 promotes the ribonuclease activity and phosphorylation of PR10, leading to enhanced cell death signaling. The LRR1-PR10 complex is formed in the cytoplasm, resulting in its secretion into the apoplastic space. Engineered nuclear confinement of both proteins revealed that the cytoplasmic localization of the PR10-LRR1 complex is essential for cell death–mediated defense signaling. PR10/LRR1 silencing in pepper compromises resistance to avirulent X. campestris pv vesicatoria infection. By contrast, PR10/LRR1 overexpression in Arabidopsis thaliana confers enhanced resistance to Pseudomonas syringae pv tomato and Hyaloperonospora arabidopsidis. Together, these results suggest that the cytosolic LRR-PR10 complex is responsible for cell death–mediated defense signaling. PMID:22492811

Development of Inhibitors of Salicylic Acid Signaling.

PubMed

Jiang, Kai; Kurimoto, Tetsuya; Seo, Eun-kyung; Miyazaki, Sho; Nakajima, Masatoshi; Nakamura, Hidemitsu; Asami, Tadao

2015-08-19

Salicylic acid (SA) plays important roles in the induction of systemic acquired resistance (SAR) in plants. Determining the mechanism of SAR will extend our understanding of plant defenses against pathogens. We recently reported that PAMD is an inhibitor of SA signaling, which suppresses the expression of the pathogenesis-related PR genes and is expected to facilitate the understanding of SA signaling. However, PAMD strongly inhibits plant growth. To minimize the side effects of PAMD, we synthesized a number of PAMD derivatives, and identified compound 4 that strongly suppresses the expression of the PR genes with fewer adverse effects on plant growth than PAMD. We further showed that the adverse effects on plant growth were partially caused the stabilization of DELLA, which is also related to the pathogen responses. These results indicate that compound 4 would facilitate our understanding of SA signaling and its cross talk with other plant hormones.

Dengue subgenomic RNA binds TRIM25 to inhibit interferon expression for epidemiological fitness.

PubMed

Manokaran, Gayathri; Finol, Esteban; Wang, Chunling; Gunaratne, Jayantha; Bahl, Justin; Ong, Eugenia Z; Tan, Hwee Cheng; Sessions, October M; Ward, Alex M; Gubler, Duane J; Harris, Eva; Garcia-Blanco, Mariano A; Ooi, Eng Eong

2015-10-09

The global spread of dengue virus (DENV) infections has increased viral genetic diversity, some of which appears associated with greater epidemic potential. The mechanisms governing viral fitness in epidemiological settings, however, remain poorly defined. We identified a determinant of fitness in a foreign dominant (PR-2B) DENV serotype 2 (DENV-2) clade, which emerged during the 1994 epidemic in Puerto Rico and replaced an endemic (PR-1) DENV-2 clade. The PR-2B DENV-2 produced increased levels of subgenomic flavivirus RNA (sfRNA) relative to genomic RNA during replication. PR-2B sfRNA showed sequence-dependent binding to and prevention of tripartite motif 25 (TRIM25) deubiquitylation, which is critical for sustained and amplified retinoic acid-inducible gene 1 (RIG-I)-induced type I interferon expression. Our findings demonstrate a distinctive viral RNA-host protein interaction to evade the innate immune response for increased epidemiological fitness. Copyright © 2015, American Association for the Advancement of Science.

Prostate cancer risk regions at 8q24 and 17q24 are differentially associated with somatic TMPRSS2:ERG fusion status

PubMed Central

Luedeke, Manuel; Rinckleb, Antje E.; FitzGerald, Liesel M.; Geybels, Milan S.; Schleutker, Johanna; Eeles, Rosalind A.; Teixeira, Manuel R.; Cannon-Albright, Lisa; Ostrander, Elaine A.; Weikert, Steffen; Herkommer, Kathleen; Wahlfors, Tiina; Visakorpi, Tapio; Leinonen, Katri A.; Tammela, Teuvo L.J.; Cooper, Colin S.; Kote-Jarai, Zsofia; Edwards, Sandra; Goh, Chee L.; McCarthy, Frank; Parker, Chris; Flohr, Penny; Paulo, Paula; Jerónimo, Carmen; Henrique, Rui; Krause, Hans; Wach, Sven; Lieb, Verena; Rau, Tilman T.; Vogel, Walther; Kuefer, Rainer; Hofer, Matthias D.; Perner, Sven; Rubin, Mark A.; Agarwal, Archana M.; Easton, Doug F.; Al Olama, Ali Amin; Benlloch, Sara; Hoegel, Josef; Stanford, Janet L.

2016-01-01

Abstract Molecular and epidemiological differences have been described between TMPRSS2:ERG fusion-positive and fusion-negative prostate cancer (PrCa). Assuming two molecularly distinct subtypes, we have examined 27 common PrCa risk variants, previously identified in genome-wide association studies, for subtype specific associations in a total of 1221 TMPRSS2:ERG phenotyped PrCa cases. In meta-analyses of a discovery set of 552 cases with TMPRSS2:ERG data and 7650 unaffected men from five centers we have found support for the hypothesis that several common risk variants are associated with one particular subtype rather than with PrCa in general. Risk variants were analyzed in case-case comparisons (296 TMPRSS2:ERG fusion-positive versus 256 fusion-negative cases) and an independent set of 669 cases with TMPRSS2:ERG data was established to replicate the top five candidates. Significant differences (P < 0.00185) between the two subtypes were observed for rs16901979 (8q24) and rs1859962 (17q24), which were enriched in TMPRSS2:ERG fusion-negative (OR = 0.53, P = 0.0007) and TMPRSS2:ERG fusion-positive PrCa (OR = 1.30, P = 0.0016), respectively. Expression quantitative trait locus analysis was performed to investigate mechanistic links between risk variants, fusion status and target gene mRNA levels. For rs1859962 at 17q24, genotype dependent expression was observed for the candidate target gene SOX9 in TMPRSS2:ERG fusion-positive PrCa, which was not evident in TMPRSS2:ERG negative tumors. The present study established evidence for the first two common PrCa risk variants differentially associated with TMPRSS2:ERG fusion status. TMPRSS2:ERG phenotyping of larger studies is required to determine comprehensive sets of variants with subtype-specific roles in PrCa. PMID:27798103

The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking

PubMed Central

Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M.; Baehr, Wolfgang

2012-01-01

Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d−/− mouse. PMID:22960045

ESR1 gene amplification in endometrial carcinomas: a clinicopathological analysis.

PubMed

Rahman, Mohammed Tanjimur; Nakayama, Kentaro; Rahman, Munmun; Ishikawa, Masako; Katagiri, Hiroshi; Katagiri, Atsuko; Ishibashi, Tomoka; Sato, Emi; Iida, Kouji; Ishikawa, Noriyuki; Nakayama, Naomi; Miyazaki, Kohji

2013-09-01

This study investigated the clinicopathological significance of estrogen receptor 1 (ESR1) gene amplification and its relationship to phosphatase and tensin homolog (PTEN), human epidermal growth factor receptor 2 (HER2), MutL homolog 1 (MLH1), p53, and AT rich interactive domain 1A (ARID1A) expression in endometrial carcinomas. ESR1 amplification and expression were assessed by fluorescence in situ hybridization and immunohistochemistry. Clinical data were collected by retrospective chart review. ESR1 amplification was identified in 13 out of 111 (11.7%) endometrial carcinomas. No significant association was observed between ESR1 amplification and International Federation of Gynecology and Obstetrics (FIGO) stage (p=0.17), histological grade (p=0.35), lymph node metastasis (p=0.51), or deep myometrial invasion (p=0.46). ESR1 amplification was independent of PTEN, p53, HER2, MLH1, and ARID1A protein expression. Patients without estrogen receptor (ER) or progesterone receptor (PR) expression had shorter progression-free and overall survival than those with ER or PR expression (p<0.01). ESR1 amplification is independent of known clinicopathological factors related to poor prognosis and PTEN, p53, HER2, MLH1, and ARID1A protein expression, suggesting ESR1 amplification may be an early event in endometrial carcinoma development.

Alterations in gene expression profiles during prostate cancer progression: functional correlations to tumorigenicity and down-regulation of selenoprotein-P in mouse and human tumors.

PubMed

Calvo, Alfonso; Xiao, Nianqing; Kang, Jason; Best, Carolyn J M; Leiva, Isabel; Emmert-Buck, Michael R; Jorcyk, Cheryl; Green, Jeffrey E

2002-09-15

To identify molecular changes that occur during prostate tumor progression, we have characterized a series of prostate cancer cell lines isolated at different stages of tumorigenesis from C3(1)/Tag transgenic mice. Cell lines derived from low- and high-grade prostatic intraepithelial neoplasia, invasive carcinoma, and a lung metastasis exhibited significant differences in cell growth, tumorigenicity, invasiveness, and angiogenesis. cDNA microarray analysis of 8700 features revealed correlations between the tumorigenicity of the C3(1)/Tag-Pr cells and changes in the expression levels of genes regulating cell growth, angiogenesis, and invasion. Many changes observed in transcriptional regulation in this in vitro system are similar to those reported for human prostate cancer, as well as other types of human tumors. This analysis of expression patterns has also identified novel genes that may be involved in mechanisms of prostate oncogenesis or serve as potential biomarkers or therapeutic targets for prostate cancer. Examples include the L1-cell adhesion molecule, metastasis-associated gene (MTA-2), Rab-25, tumor-associated signal transducer-2 (Trop-2), and Selenoprotein-P, a gene that binds selenium and prevents oxidative stress. Many genes identified in the Pr-cell line model have been shown to be altered in human prostate cancer. The comprehensive microarray data provides a rational basis for using this model system for studies where alterations of specific genes or pathways are of particular interest. Quantitative real-time reverse transcription-PCR for Selenoprotein-P demonstrated a similar down-regulation of the transcript of this gene in a subset of human prostate tumors, mouse tumors, and prostate carcinoma cell lines. This work demonstrates that expression profiling in animal models may lead to the identification of novel genes involved in human prostate cancer biology.

The Xanthomonas campestris pv. vesicatoria Type-3 Effector XopB Inhibits Plant Defence Responses by Interfering with ROS Production

PubMed Central

Priller, Johannes Peter Roman; Reid, Stephen; Konein, Patrick; Dietrich, Petra

2016-01-01

The bacterial pathogen Xanthomonas campestris pv. vesicatoria 85–10 (Xcv) translocates about 30 type-3 effector proteins (T3Es) into pepper plants (Capsicum annuum) to suppress plant immune responses. Among them is XopB which interferes with PTI, ETI and sugar-mediated defence responses, but the underlying molecular mechanisms and direct targets are unknown so far. Here, we examined the XopB-mediated suppression of plant defence responses in more detail. Infection of susceptible pepper plants with Xcv lacking xopB resulted in delayed symptom development compared to Xcv wild type infection concomitant with an increased formation of salicylic acid (SA) and expression of pathogenesis-related (PR) genes. Expression of xopB in Arabidopsis thaliana promoted the growth of the virulent Pseudomonas syringae pv. tomato (Pst) DC3000 strain. This was paralleled by a decreased SA-pool and a lower induction of SA-dependent PR gene expression. The expression pattern of early flg22-responsive marker genes indicated that MAPK signalling was not altered in the presence of XopB. However, XopB inhibited the flg22-triggered burst of reactive oxygen species (ROS). Consequently, the transcript accumulation of AtOXI1, a ROS-dependent marker gene, was reduced in xopB-expressing Arabidopsis plants as well as callose deposition. The lower ROS production correlated with a low level of basal and flg22-triggered expression of apoplastic peroxidases and the NADPH oxidase RBOHD. Conversely, deletion of xopB in Xcv caused a higher production of ROS in leaves of susceptible pepper plants. Together our results demonstrate that XopB modulates ROS responses and might thereby compromise plant defence. PMID:27398933

Central and peripheral effects of chronic food restriction and weight restoration in the rat.

PubMed

Kinzig, Kimberly P; Hargrave, Sara L; Tao, Erin E

2009-02-01

Previous studies have demonstrated that some endocrine consequences of long-term caloric restriction persist after weight restoration in human subjects. Here we evaluate effects of chronic food restriction in rats that were restricted to 70% of control kcal for 4 wk and subsequently weight restored. Measures were taken from rats at 80% (chronically restricted; CR), 90% (partially weight restored; PR), 100% (fully weight restored; FR), and after 4 wk at 100% body weight of controls (extended weight restored; ER). Plasma insulin and leptin were decreased, and ghrelin was increased in CR compared with controls. Leptin and ghrelin normalized with weight restoration at PR, FR, and ER; however, baseline insulin was not normalized until the ER state. Hypothalamic mRNA expression levels for proopiomelanocortin (POMC), agouti-related protein (AgRP), and neuropeptide Y (NPY) revealed significantly less POMC mRNA expression in CR and PR rats, and significantly less arcuate NPY mRNA in PR and FR. In the dorsomedial hypothalamus, CR, PR, and FR rats had significantly increased NPY expression that was not normalized until the ER state. In response to a test meal, insulin and ghrelin release patterns were altered through the FR stage, and ghrelin remained affected at ER. Collectively, these data demonstrate that mere weight restoration is not sufficient to normalize hypothalamic gene expression levels and endocrine responses to a meal, and that meal-related ghrelin responses persist despite weight restoration for up to 4 wk.

RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug

PubMed Central

2012-01-01

Background Bed bugs (Cimex lectularius) are hematophagous nocturnal parasites of humans that have attained high impact status due to their worldwide resurgence. The sudden and rampant resurgence of C. lectularius has been attributed to numerous factors including frequent international travel, narrower pest management practices, and insecticide resistance. Results We performed a next-generation RNA sequencing (RNA-Seq) experiment to find differentially expressed genes between pesticide-resistant (PR) and pesticide-susceptible (PS) strains of C. lectularius. A reference transcriptome database of 51,492 expressed sequence tags (ESTs) was created by combining the databases derived from de novo assembled mRNA-Seq tags (30,404 ESTs) and our previous 454 pyrosequenced database (21,088 ESTs). The two-way GLMseq analysis revealed ~15,000 highly significant differentially expressed ESTs between the PR and PS strains. Among the top 5,000 differentially expressed ESTs, 109 putative defense genes (cuticular proteins, cytochrome P450s, antioxidant genes, ABC transporters, glutathione S-transferases, carboxylesterases and acetyl cholinesterase) involved in penetration resistance and metabolic resistance were identified. Tissue and development-specific expression of P450 CYP3 clan members showed high mRNA levels in the cuticle, Malpighian tubules, and midgut; and in early instar nymphs, respectively. Lastly, molecular modeling and docking of a candidate cytochrome P450 (CYP397A1V2) revealed the flexibility of the deduced protein to metabolize a broad range of insecticide substrates including DDT, deltamethrin, permethrin, and imidacloprid. Conclusions We developed significant molecular resources for C. lectularius putatively involved in metabolic resistance as well as those participating in other modes of insecticide resistance. RNA-Seq profiles of PR strains combined with tissue-specific profiles and molecular docking revealed multi-level insecticide resistance in C. lectularius. Future research that is targeted towards RNA interference (RNAi) on the identified metabolic targets such as cytochrome P450s and cuticular proteins could lay the foundation for a better understanding of the genetic basis of insecticide resistance in C. lectularius. PMID:22226239

A rare sugar, d-allose, confers resistance to rice bacterial blight with upregulation of defense-related genes in Oryza sativa.

PubMed

Kano, Akihito; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Satoh, Masaru; Fukumoto, Takeshi; Ohtani, Kouhei; Tajima, Shigeyuki; Izumori, Ken; Tanaka, Keiji; Ishida, Yutaka; Tada, Yasuomi; Nishizawa, Yoko; Akimitsu, Kazuya

2010-01-01

We investigated responses of rice plant to three rare sugars, d-altrose, d-sorbose, and d-allose, due to establishment of mass production methods for these rare sugars. Root growth and shoot growth were significantly inhibited by d-allose but not by the other rare sugars. A large-scale gene expression analysis using a rice microarray revealed that d-allose treatment causes a high upregulation of many defense-related, pathogenesis-related (PR) protein genes in rice. The PR protein genes were not upregulated by other rare sugars. Furthermore, d-allose treatment of rice plants conferred limited resistance of the rice against the pathogen Xanthomonas oryzae pv. oryzae but the other tested sugars did not. These results indicate that d-allose has a growth inhibitory effect but might prove to be a candidate elicitor for reducing disease development in rice.

Cloning of the Pseudomonas aeruginosa outer membrane porin protein P gene: evidence for a linked region of DNA homology.

PubMed Central

Siehnel, R J; Worobec, E A; Hancock, R E

1988-01-01

The gene encoding the outer membrane phosphate-selective porin protein P from Pseudomonas aeruginosa was cloned into Escherichia coli. The protein product was expressed and transported to the outer membrane of an E. coli phoE mutant and assembled into functional trimers. Expression of a product of the correct molecular weight was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot (immunoblot) analysis, using polyclonal antibodies to protein P monomer and trimer forms. Protein P trimers were partially purified from the E. coli clone and shown to form channels with the same conductance as those formed by protein P from P. aeruginosa. The location and orientation of the protein P-encoding (oprP) gene on the cloned DNA was identified by three methods: (i) mapping the insertion point of transposon Tn501 in a previously isolated P. aeruginosa protein P-deficient mutant; (ii) hybridization of restriction fragments from the cloned DNA to an oligonucleotide pool synthesized on the basis of the amino-terminal protein sequence of protein P; and (iii) fusion of a PstI fragment of the cloned DNA to the amino terminus of the beta-galactosidase gene of pUC8, producing a fusion protein that contained protein P-antigenic epitopes. Structural analysis of the cloned DNA and P. aeruginosa chromosomal DNA revealed the presence of two adjacent PstI fragments which cross-hybridized, suggesting a possible gene duplication. The P-related (PR) region hybridized to the oligonucleotide pool described above. When the PstI fragment which contained the PR region was fused to the beta-galactosidase gene of pUC8, a fusion protein was produced which reacted with a protein P-specific antiserum. However, the restriction endonuclease patterns of the PR region and the oprP gene differed significantly beyond the amino-terminal one-third of the two genes. Images PMID:2834340

Anatomy of a nonhost disease resistance response of pea to Fusarium solani: PR gene elicitation via DNase, chitosan and chromatin alterations

PubMed Central

Hadwiger, Lee A.

2015-01-01

Of the multiplicity of plant pathogens in nature, only a few are virulent on a given plant species. Conversely, plants develop a rapid “nonhost” resistance response to the majority of the pathogens. The anatomy of the nonhost resistance of pea endocarp tissue against a pathogen of bean, Fusarium solani f.sp. phaseoli (Fsph) and the susceptibility of pea to F. solani f sp. pisi (Fspi) has been described cytologically, biochemically and molecular-biologically. Cytological changes have been followed by electron microscope and stain differentiation under white and UV light. The induction of changes in transcription, protein synthesis, expression of pathogenesis-related (PR) genes, and increases in metabolic pathways culminating in low molecular weight, antifungal compounds are described biochemically. Molecular changes initiated by fungal signals to host organelles, primarily to chromatin within host nuclei, are identified according to source of the signal and the mechanisms utilized in activating defense genes. The functions of some PR genes are defined. A hypothesis based on this data is developed to explain both why fungal growth is suppressed in nonhost resistance and why growth can continue in a susceptible reaction. PMID:26124762

Anatomy of a nonhost disease resistance response of pea to Fusarium solani: PR gene elicitation via DNase, chitosan and chromatin alterations.

PubMed

Hadwiger, Lee A

2015-01-01

Of the multiplicity of plant pathogens in nature, only a few are virulent on a given plant species. Conversely, plants develop a rapid "nonhost" resistance response to the majority of the pathogens. The anatomy of the nonhost resistance of pea endocarp tissue against a pathogen of bean, Fusarium solani f.sp. phaseoli (Fsph) and the susceptibility of pea to F. solani f sp. pisi (Fspi) has been described cytologically, biochemically and molecular-biologically. Cytological changes have been followed by electron microscope and stain differentiation under white and UV light. The induction of changes in transcription, protein synthesis, expression of pathogenesis-related (PR) genes, and increases in metabolic pathways culminating in low molecular weight, antifungal compounds are described biochemically. Molecular changes initiated by fungal signals to host organelles, primarily to chromatin within host nuclei, are identified according to source of the signal and the mechanisms utilized in activating defense genes. The functions of some PR genes are defined. A hypothesis based on this data is developed to explain both why fungal growth is suppressed in nonhost resistance and why growth can continue in a susceptible reaction.

Salicylic acid-dependent and -independent impact of an RNA-binding protein on plant immunity.

PubMed

Hackmann, Christian; Korneli, Christin; Kutyniok, Magdalene; Köster, Tino; Wiedenlübbert, Matthias; Müller, Caroline; Staiger, Dorothee

2014-03-01

Plants overexpressing the RNA-binding protein AtGRP7 (AtGRP7-ox plants) constitutively express the PR-1 (PATHOGENESIS-RELATED-1), PR-2 and PR-5 transcripts associated with salicylic acid (SA)-mediated immunity and show enhanced resistance against Pseudomonas syringae pv. tomato (Pto) DC3000. Here, we investigated whether the function of AtGRP7 in plant immunity depends on SA. Endogenous SA was elevated fivefold in AtGRP7-ox plants. The elevated PR-1, PR-2 and PR-5 levels were eliminated upon expression of the salicylate hydroxylase nahG in AtGRP7-ox plants and elevated PR-1 levels were suppressed by sid (salicylic acid deficient) 2-1 that is impaired in SA biosynthesis. RNA immunoprecipitation showed that AtGRP7 does not bind the PR-1 transcript in vivo, whereas it binds PDF1.2. Constitutive or inducible AtGRP7 overexpression increases PR-1 promoter activity, indicating that AtGRP7 affects PR-1 transcription. In line with this, the effect of AtGRP7 on PR-1 is suppressed by npr (non-expressor of PR genes) 1. Whereas AtGRP7-ox plants restricted growth of Pto DC3000 compared with wild type (wt), sid2-1 AtGRP7-ox plants allowed more growth than AtGRP7-ox plants. Furthermore, we show an enhanced hypersensitive response triggered by avirulent Pto DC3000 (AvrRpt2) in AtGRP7-ox compared with wt. In sid2-1 AtGRP7-ox, an intermediate phenotype was observed. Thus, AtGRP7 has both SA-dependent and SA-independent effects on plant immunity. © 2013 John Wiley & Sons Ltd.

Generation of a reassortant avian influenza virus H5N2 vaccine strain capable of protecting chickens against infection with Egyptian H5N1 and H9N2 viruses.

PubMed

Kandeil, Ahmed; Moatasim, Yassmin; Gomaa, Mokhtar R; Shehata, Mahmoud M; El-Shesheny, Rabeh; Barakat, Ahmed; Webby, Richard J; Ali, Mohamed A; Kayali, Ghazi

2016-01-04

Avian influenza H5N1 viruses have been enzootic in Egyptian poultry since 2006. Avian influenza H9N2 viruses which have been circulating in Egyptian poultry since 2011 showed high replication rates in embryonated chicken eggs and mammalian cells. To investigate which gene segment was responsible for increasing replication, we constructed reassortant influenza viruses using the low pathogenic H1N1 PR8 virus as backbone and included individual genes from A/chicken/Egypt/S4456B/2011(H9N2) virus. Then, we invested this finding to improve a PR8-derived H5N1 influenza vaccine strain by incorporation of the NA segment of H9N2 virus instead of the NA of H5N1. The growth properties of this virus and several other forms of reassortant H5 viruses were compared. Finally, we tested the efficacy of this reassortant vaccine strain in chickens. We observed an increase in replication for a reassortant virus expressing the neuraminidase gene (N2) of H9N2 virus relative to that of either parental viruses or reassortant PR8 viruses expressing other genes. Then, we generated an H5N2 vaccine strain based on the H5 from an Egyptian H5N1 virus and the N2 from an Egyptian H9N2 virus on a PR8 backbone. This strain had better replication rates than an H5N2 reassortant strain on an H9N2 backbone and an H5N1 reassortant on a PR8 backbone. This virus was then used to develop a killed, oil-emulsion vaccine and tested for efficacy against H5N1 and H9N2 viruses in chickens. Results showed that this vaccine was immunogenic and reduced mortality and shedding. Our findings suggest that an inactivated PR8-derived H5N2 influenza vaccine is efficacious in poultry against H5N1 and H9N2 viruses and the vaccine seed replicates at a high rate thus improving vaccine production. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization by Suppression Subtractive Hybridization of Transcripts That Are Differentially Expressed in Leaves of Anthracnose-Resistant Ramie Cultivar.

PubMed

Xuxia, Wang; Jie, Chen; Bo, Wang; Lijun, Liu; Hui, Jiang; Diluo, Tang; Dingxiang, Peng

2012-01-01

For the purpose of screening putative anthracnose resistance-related genes of ramie ( Boehmeria nivea L. Gaud), a cDNA library was constructed by suppression subtractive hybridization using anthracnose-resistant cultivar Huazhu no. 4. The cDNAs from Huazhu no. 4, which were infected with Colletotrichum gloeosporioides , were used as the tester and cDNAs from uninfected Huazhu no. 4 as the driver. Sequencing analysis and homology searching showed that these clones represented 132 single genes, which were assigned to functional categories, including 14 putative cellular functions, according to categories established for Arabidopsis . These 132 genes included 35 disease resistance and stress tolerance-related genes including putative heat-shock protein 90, metallothionein, PR-1.2 protein, catalase gene, WRKY family genes, and proteinase inhibitor-like protein. Partial disease-related genes were further analyzed by reverse transcription PCR and RNA gel blot. These expressed sequence tags are the first anthracnose resistance-related expressed sequence tags reported in ramie.

Genomic and Expression Profiling of Benign and Malignant Nerve Sheath Tumors in Neurofibromatosis Patients

DTIC Science & Technology

2008-05-01

DAMD17-03-1-0297 Title: Genomic and Expression Pr ofiling of Benign and Malignant Nerve Sheath Tumors in Neurofibromatosis Patients...have determined the gene expression signature for benign and malignant peripheral nerve sheath tumors and found that the major trend in transformation...However, EGFR data in soft tissue neoplasms is limited. Using a variety of benign and malignant spindle cell neoplasms, we assessed EGFR status by

Cyclooxygenase and lipoxygenase gene expression in the inflammogenesis of breast cancer.

PubMed

Kennedy, Brian M; Harris, Randall E

2018-05-07

We examined the expression of major inflammatory genes, cyclooxygenase-1 and 2 (COX1, COX2) and arachidonate 5-lipoxygenase (ALOX5) in 1090 tumor samples of invasive breast cancer from The Cancer Genome Atlas (TCGA). Mean cyclooxygenase expression (COX1 + COX2) ranked in the upper 99th percentile of all 20,531 genes and surprisingly, the mean expression of COX1 was more than tenfold higher than COX2. Highly significant correlations were observed between COX2 with eight tumor-promoting genes (EGR2, IL6, RGS2, B3GNT5, SGK1, SLC2A3, SFRP1 and ETS2) and between ALOX5 and ten tumor promoter genes (CD33, MYOF1, NLRP1, GAB3, CD4, IFR8, CYTH4, BTK, FGR, CD37). Expression of CYP19A1 (aromatase) was significantly correlated with COX2, but only in tumors positive for ER, PR and HER2. Tumor-promoting genes correlated with the expression of COX1, COX2, and ALOX5 are known to effectively increase mitogenesis, mutagenesis, angiogenesis, cell survival, immunosuppression and metastasis in the pathogenesis of breast cancer.

Genome-Wide Identification of Differentially Expressed Genes Associated with the High Yielding of Oleoresin in Secondary Xylem of Masson Pine (Pinus massoniana Lamb) by Transcriptomic Analysis

PubMed Central

Liu, Qinghua; Zhou, Zhichun; Wei, Yongcheng; Shen, Danyu; Feng, Zhongping; Hong, Shanping

2015-01-01

Masson pine is an important timber and resource for oleoresin in South China. Increasing yield of oleoresin in stems can raise economic benefits and enhance the resistance to bark beetles. However, the genetic mechanisms for regulating the yield of oleoresin were still unknown. Here, high-throughput sequencing technology was used to investigate the transcriptome and compare the gene expression profiles of high and low oleoresin-yielding genotypes. A total of 40,690,540 reads were obtained and assembled into 137,499 transcripts from the secondary xylem tissues. We identified 84,842 candidate unigenes based on sequence annotation using various databases and 96 unigenes were candidates for terpenoid backbone biosynthesis in pine. By comparing the expression profiles of high and low oleoresin-yielding genotypes, 649 differentially expressed genes (DEGs) were identified. GO enrichment analysis of DEGs revealed that multiple pathways were related to high yield of oleoresin. Nine candidate genes were validated by QPCR analysis. Among them, the candidate genes encoding geranylgeranyl diphosphate synthase (GGPS) and (-)-alpha/beta-pinene synthase were up-regulated in the high oleoresin-yielding genotype, while tricyclene synthase revealed lower expression level, which was in good agreement with the GC/MS result. In addition, DEG encoding ABC transporters, pathogenesis-related proteins (PR5 and PR9), phosphomethylpyrimidine synthase, non-specific lipid-transfer protein-like protein and ethylene responsive transcription factors (ERFs) were also confirmed to be critical for the biosynthesis of oleoresin. The next-generation sequencing strategy used in this study has proven to be a powerful means for analyzing transcriptome variation related to the yield of oleoresin in masson pine. The candidate genes encoding GGPS, (-)-alpha/beta-pinene, tricyclene synthase, ABC transporters, non-specific lipid-transfer protein-like protein, phosphomethylpyrimidine synthase, ERFs and pathogen responses may play important roles in regulating the yield of oleoresin. These DEGs are worthy of special attention in future studies. PMID:26167875

Expression of flavonoid 3’-hydroxylase is controlled by P1, the regulator of 3-deoxyflavonoid biosynthesis in maize

PubMed Central

2012-01-01

Background The maize (Zea mays) red aleurone1 (pr1) encodes a CYP450-dependent flavonoid 3’-hydroxylase (ZmF3’H1) required for the biosynthesis of purple and red anthocyanin pigments. We previously showed that Zmf3’h1 is regulated by C1 (Colorless1) and R1 (Red1) transcription factors. The current study demonstrates that, in addition to its role in anthocyanin biosynthesis, the Zmf3’h1 gene also participates in the biosynthesis of 3-deoxyflavonoids and phlobaphenes that accumulate in maize pericarps, cob glumes, and silks. Biosynthesis of 3-deoxyflavonoids is regulated by P1 (Pericarp color1) and is independent from the action of C1 and R1 transcription factors. Results In maize, apiforol and luteoforol are the precursors of condensed phlobaphenes. Maize lines with functional alleles of pr1 and p1 (Pr1;P1) accumulate luteoforol, while null pr1 lines with a functional or non-functional p1 allele (pr1;P1 or pr1;p1) accumulate apiforol. Apiforol lacks a hydroxyl group at the 3’-position of the flavylium B-ring, while luteoforol has this hydroxyl group. Our biochemical analysis of accumulated compounds in different pr1 genotypes showed that the pr1 encoded ZmF3’H1 has a role in the conversion of mono-hydroxylated to bi-hydroxylated compounds in the B-ring. Steady state RNA analyses demonstrated that Zmf3’h1 mRNA accumulation requires a functional p1 allele. Using a combination of EMSA and ChIP experiments, we established that the Zmf3’h1 gene is a direct target of P1. Highlighting the significance of the Zmf3’h1 gene for resistance against biotic stress, we also show here that the p1 controlled 3-deoxyanthocyanidin and C-glycosyl flavone (maysin) defence compounds accumulate at significantly higher levels in Pr1 silks as compared to pr1 silks. By virtue of increased maysin synthesis in Pr1 plants, corn ear worm larvae fed on Pr1; P1 silks showed slower growth as compared to pr1; P1 silks. Conclusions Our results show that the Zmf3’h1 gene participates in the biosynthesis of phlobaphenes and agronomically important 3-deoxyflavonoid compounds under the regulatory control of P1. PMID:23113982

Involvement of Cellular Prion Protein in α-Synuclein Transport in Neurons.

PubMed

Urrea, Laura; Segura-Feliu, Miriam; Masuda-Suzukake, Masami; Hervera, Arnau; Pedraz, Lucas; García Aznar, José Manuel; Vila, Miquel; Samitier, Josep; Torrents, Eduard; Ferrer, Isidro; Gavín, Rosalina; Hagesawa, Masato; Del Río, José Antonio

2018-03-01

The cellular prion protein, encoded by the gene Prnp, has been reported to be a receptor of β-amyloid. Their interaction is mandatory for neurotoxic effects of β-amyloid oligomers. In this study, we aimed to explore whether the cellular prion protein participates in the spreading of α-synuclein. Results demonstrate that Prnp expression is not mandatory for α-synuclein spreading. However, although the pathological spreading of α-synuclein can take place in the absence of Prnp, α-synuclein expanded faster in PrP C -overexpressing mice. In addition, α-synuclein binds strongly on PrP C -expressing cells, suggesting a role in modulating the effect of α-synuclein fibrils.

Identification and comprehensive evaluation of reference genes for RT-qPCR analysis of host gene-expression in Brassica juncea-aphid interaction using microarray data.

PubMed

Ram, Chet; Koramutla, Murali Krishna; Bhattacharya, Ramcharan

2017-07-01

Brassica juncea is a chief oil yielding crop in many parts of the world including India. With advancement of molecular techniques, RT-qPCR based study of gene-expression has become an integral part of experimentations in crop breeding. In RT-qPCR, use of appropriate reference gene(s) is pivotal. The virtue of the reference genes, being constant in expression throughout the experimental treatments, needs to be validated case by case. Appropriate reference gene(s) for normalization of gene-expression data in B. juncea during the biotic stress of aphid infestation is not known. In the present investigation, 11 reference genes identified from microarray database of Arabidopsis-aphid interaction at a cut off FDR ≤0.1, along with two known reference genes of B. juncea, were analyzed for their expression stability upon aphid infestation. These included 6 frequently used and 5 newly identified reference genes. Ranking orders of the reference genes in terms of expression stability were calculated using advanced statistical approaches such as geNorm, NormFinder, delta Ct and BestKeeper. The analysis suggested CAC, TUA and DUF179 as the most suitable reference genes. Further, normalization of the gene-expression data of STP4 and PR1 by the most and the least stable reference gene, respectively has demonstrated importance and applicability of the recommended reference genes in aphid infested samples of B. juncea. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Mucinous cystadenocarcinoma of the breast with amplification of the HER2-gene confirmed by FISH: The first case reported.

PubMed

Petersson, Fredrik; Pang, Brendan; Thamboo, Thomas P; Putti, Thomas Choudary

2010-06-01

We present the first case of a primary mucinous cystadenocarcinoma of the breast that, in addition to the characteristic immunophenotype (CK7(+), CK20(-), ER(-), PR(-), and cdx2(-)), showed a strong membranous HER2-protein expression and HER2-gene amplification documented by fluorescence in situ hybridization. Copyright 2010 Elsevier Inc. All rights reserved.

AtMYB44 regulates WRKY70 expression and modulates antagonistic interaction between salicylic acid and jasmonic acid signaling.

PubMed

Shim, Jae Sung; Jung, Choonkyun; Lee, Sangjoon; Min, Kyunghun; Lee, Yin-Won; Choi, Yeonhee; Lee, Jong Seob; Song, Jong Tae; Kim, Ju-Kon; Choi, Yang Do

2013-02-01

The role of AtMYB44, an R2R3 MYB transcription factor, in signaling mediated by jasmonic acid (JA) and salicylic acid (SA) is examined. AtMYB44 is induced by JA through CORONATINE INSENSITIVE 1 (COI1). AtMYB44 over-expression down-regulated defense responses against the necrotrophic pathogen Alternaria brassicicola, but up-regulated WRKY70 and PR genes, leading to enhanced resistance to the biotrophic pathogen Pseudomonas syringae pv. tomato DC3000. The knockout mutant atmyb44 shows opposite effects. Induction of WRKY70 by SA is reduced in atmyb44 and npr1-1 mutants, and is totally abolished in atmyb44 npr1-1 double mutants, showing that WRKY70 is regulated independently through both NPR1 and AtMYB44. AtMYB44 over-expression does not change SA content, but AtMYB44 over-expression phenotypes, such as retarded growth, up-regulated PR1 and down-regulated PDF1.2 are reversed by SA depletion. The wrky70 mutation suppressed AtMYB44 over-expression phenotypes, including up-regulation of PR1 expression and down-regulation of PDF1.2 expression. β-estradiol-induced expression of AtMYB44 led to WRKY70 activation and thus PR1 activation. AtMYB44 binds to the WRKY70 promoter region, indicating that AtMYB44 acts as a transcriptional activator of WRKY70 by directly binding to a conserved sequence element in the WRKY70 promoter. These results demonstrate that AtMYB44 modulates antagonistic interaction by activating SA-mediated defenses and repressing JA-mediated defenses through direct control of WRKY70. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

In vitro effects of sex hormones in human meibomian gland epithelial cells.

PubMed

Schröder, Antje; Abrar, Daniel B; Hampel, Ulrike; Schicht, Martin; Paulsen, Friedrich; Garreis, Fabian

2016-10-01

Meibomian gland dysfunction (MGD) is considered the most common cause of dry eye disease (DED). Sex hormones seem to play a role in the pathogenesis of MGD although their involvement is not completely understood. Therefore, in the present study we evaluated the effect of dihydrotestosteron (DHT) and estradiol (β-Est) on an immortalized human meibomian gland epithelial cell line (HMGEC). Protein expression of sex hormone receptors in HMGEC was investigated by western blot. Ultrastructural morphology, Sudan III lipid staining, cell proliferation as well as vitality assays were performed. Furthermore, expression of MGD-associated markers for keratinization (hornerin, involucrin and CK6), proliferation (CK5 and CK14) and lipid synthesis (fatty acid synthase and stearoyl-CoA desaturase) were analyzed by real time RT-PCR. Western blot revealed presence of androgen receptor (AR), estrogen receptors α and -β (ERα, ERβ) and progesterone receptor (PR) in HMGEC. PR, ERα and ERβ expression was significantly induced under cultivation with serum, whereas sex hormones stimulation showed no further effect on protein expression of PR, ERα and ERβ. Our results showed no impact of MGD-associated sex hormones to cellular morphology and lipid accumulation in HMGEC. Cell proliferation was slightly induced through application of sex hormones and supplementation of calcium. However, both sex hormones and calcium altered gene expression of MGD-associated markers. Especially keratinization genes hornerin (HRNR) and cornulin (COR) were induced after application of sex hormones and calcium in serum-free cultivated HMGEC. This may promote keratinization processes that are associated with MGD. Further investigations are necessary to analyze the (hyper)keratinization processes that occur during MGD and using HMGEC as an in vitro model. Copyright © 2016 Elsevier Ltd. All rights reserved.

Progesterone inhibits proliferation and modulates expression of proliferation-Related genes in classical progesterone receptor-negative human BxPC3 pancreatic adenocarcinoma cells.

PubMed

Goncharov, Alexey I; Maslakova, Aitsana A; Polikarpova, Anna V; Bulanova, Elena A; Guseva, Alexandra A; Morozov, Ivan A; Rubtsov, Petr M; Smirnova, Olga V; Shchelkunova, Tatiana A

2017-01-01

Recent studies suggest that progesterone may possess anti-tumorigenic properties. However, a growth-modulatory role of progestins in human cancer cells remains obscure. With the discovery of a new class of membrane progesterone receptors (mPRs) belonging to the progestin and adipoQ receptor gene family, it becomes important to study the effect of this hormone on proliferation of tumor cells that do not express classical nuclear progesterone receptors (nPRs). To identify a cell line expressing high levels of mPRs and lacking nPRs, we examined mRNA levels of nPRs and three forms of mPRs in sixteen human tumor cell lines of different origin. High expression of mPR mRNA has been found in pancreatic adenocarcinoma BxPC3 cells, while nPR mRNA has not been detected in these cells. Western blot analysis confirmed these findings at the protein level. We revealed specific binding of labeled progesterone in these cells with affinity constant similar to that of human mPR expressed in yeast cells. Progesterone at high concentration of 20 μM significantly reduced the mRNA levels of proliferation markers Ki67 and PCNA, as well as of cyclin D1, and increased the mRNA levels of cyclin dependent kinase inhibitors p21 and p27. Progesterone (1 μM and 20 μM) significantly inhibited proliferative activity of BxPC3 cells. These results point to anti-proliferative effects of the progesterone high concentrations on BxPC3 cells and suggest that activation of mPRs may mediate this action. Our data are a starting point for further investigations regarding the application of progesterone in pancreatic cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

In situ light responses of the proteorhodopsin-bearing Antarctic sea-ice bacterium, Psychroflexus torques.

PubMed

Burr, David J; Martin, Andrew; Maas, Elizabeth W; Ryan, Ken G

2017-09-01

Proteorhodopsin (PR) is a wide-spread protein found in many marine prokaryotes. PR allows for the potential conversion of solar energy to ATP, possibly assisting in cellular growth and survival during periods of high environmental stress. PR utilises either blue or green light through a single amino acid substitution. We incubated the PR-bearing bacterium Psychroflexus torquis 50 cm deep within Antarctic sea ice for 13 days, exposing cultures to diurnal fluctuations in light and temperature. Enhanced growth occurred most prominently in cultures incubated under irradiance levels of ∼50 μmol photons m -2  s -1 , suggesting PR provides a strong selective advantage. In addition, cultures grown under blue light yielded over 5.5 times more live cells per photon compared to green-light incubations. Because P. torquis expresses an apparently 'green-shifted' PR gene variant, this finding infers that the spectral tuning of PR is more complex than previously thought. This study supports the theory that PR provides additional energy to bacteria under sub-optimal conditions, and raises several points of interest to be addressed by future research.

Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

PubMed

Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

2012-06-26

Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

Novel receptor-like kinases in cacao contain PR-1 extracellular domains.

PubMed

Teixeira, Paulo José Pereira Lima; Costa, Gustavo Gilson Lacerda; Fiorin, Gabriel Lorencini; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

2013-08-01

Members of the pathogenesis-related protein 1 (PR-1) family are well-known markers of plant defence responses, forming part of the arsenal of the secreted proteins produced on pathogen recognition. Here, we report the identification of two cacao (Theobroma cacao L.) PR-1s that are fused to transmembrane regions and serine/threonine kinase domains, in a manner characteristic of receptor-like kinases (RLKs). These proteins (TcPR-1f and TcPR-1g) were named PR-1 receptor kinases (PR-1RKs). Phylogenetic analysis of RLKs and PR-1 proteins from cacao indicated that PR-1RKs originated from a fusion between sequences encoding PR-1 and the kinase domain of a LecRLK (Lectin Receptor-Like Kinase). Retrotransposition marks surround TcPR-1f, suggesting that retrotransposition was involved in the origin of PR-1RKs. Genes with a similar domain architecture to cacao PR-1RKs were found in rice (Oryza sativa), barrel medic (Medicago truncatula) and a nonphototrophic bacterium (Herpetosiphon aurantiacus). However, their kinase domains differed from those found in LecRLKs, indicating the occurrence of convergent evolution. TcPR-1g expression was up-regulated in the biotrophic stage of witches' broom disease, suggesting a role for PR-1RKs during cacao defence responses. We hypothesize that PR-1RKs transduce a defence signal by interacting with a PR-1 ligand. © 2013 BSPP AND JOHN WILEY & SONS LTD.

Wnt signaling pathway involvement in genotypic and phenotypic variations in Waardenburg syndrome type 2 with MITF mutations.

PubMed

Wang, Xue-Ping; Liu, Ya-Lan; Mei, Ling-Yun; He, Chu-Feng; Niu, Zhi-Jie; Sun, Jie; Zhao, Yu-Lin; Feng, Yong; Zhang, Hua

2018-05-01

Mutation in the gene encoding microphthalmia-associated transcription factor (MITF) lead to Waardenburg syndrome 2 (WS2), an autosomal dominantly inherited syndrome with auditory-pigmentary abnormalities, which is clinically and genetically heterogeneous. Haploinsufficiency may be the underlying mechanism for WS2. However, the mechanisms explaining the genotypic and phenotypic variations in WS2 caused by MITF mutations are unclear. A previous study revealed that MITF interacts with LEF-1, an important factor in the Wnt signaling pathway, to regulate its own transcription through LEF-1-binding sites on the MITF promoter. In this study, four different WS2-associated MITF mutations (p.R217I, p.R217G, p.R255X, p.R217del) that are associated with highly variable clinical features were chosen. According to the results, LEF-1 can activate the expression of MITF on its own, but MITF proteins inhibited the activation. This inhibition weakens when the dosage of MITF is reduced. Except for p.R217I, p.R255X, p.R217G, and p.R217del lose the ability to activate TYR completely and do not inhibit the LEF-1-mediated activation of the MITF-M promoter, and the haploinsufficiency created by mutant MITF can be overcome; correspondingly, the mutants' associated phenotypes are less severe than that of p.R217I. The dominant negative of p.R217del made it have a second-most severe phenotype. This study's data imply that MITF has a negative feedback loop of regulation to stabilize MITF gene dosage that involves the Wnt signaling pathway and that the interaction of MITF mutants with this pathway drives the genotypic and phenotypic differences observed in Waardenburg syndrome type 2 associated with MITF mutations.

Efficacy and mechanism of action of Proellex, an antiprogestin in aromatase overexpressing and Letrozole resistant T47D breast cancer cells.

PubMed

Gupta, Akash; Mehta, Rajeshwari; Alimirah, Fatouma; Peng, Xinjian; Murillo, Genoveva; Wiehle, Ronald; Mehta, Rajendra G

2013-01-01

Aromatase inhibitors (AI) are considered as a first line therapy for ER+PR+ breast cancers. However, many patients acquire resistance to AI. In this study, we determined the response of antiprogestin CDB-4124 (Proellex) on the aromatase overexpressing and Letrozole resistant cell lines and also studies its mechanism of action in inhibition of breast cancer cell proliferation. For these studies we generated aromatase overexpressing T47D (T47Darom) and respective control (T47Dcon) breast cancer cell lines by stable transfection with plasmid containing CYP19A1 gene, or empty vector respectively. Letrozole resistant cell line (T47DaromLR) was generated by incubating T47Darom for 75 weeks in the presence of 10 μM Letrozole. Cell proliferation was determined by MTT or crystal violet assays. Gene expressions were quantified by QRT-PCR whereas proteins were identified by western blot analyses, flow cytometry and immunofluorescence staining. Aromatase activity was determined by estradiol ELISA. The effects of Proellex on the anchorage independent growth were measured by soft agar colony formation. Statistical differences between the various groups were determined by Student's 't' test or ANOVA followed by Bonferroni's post hoc test. Results showed that T47Darom and T47DaromLR cell lines had significantly higher aromatase expression (mRNA; 80-90 fold and protein) and as a result exhibited increased aromatization of testosterone to estradiol as compared to T47Dcon. Both these cell lines showed enhanced growth in the presence of Testosterone (50-60%). In T47DaromLR cells increased PR-B and EGFR expression as compared to T47Dcon cells was observed. Proellex and other known aromatase inhibitors (Letrozole, Anastrozole, and Exemestane) inhibited testosterone induced cell proliferation and anchorage independent growth of T47Darom cells. Cell growth inhibition was significantly greater when cells were treated with Proellex alone or in combination with other AIs as compared to AIs alone. Proellex inhibited mRNA and protein levels of PR-B, reduced PRB/p300 complex formation in the nuclei and significantly reduced EGFR expression in T47Darom cells. Our results in the present study indicate that antiproliferative effect of Proellex is probably due to PR-B/EGFR modulation in ER+PR+, aromatase expressing cells. Overall these results suggest that antiprogestin, Proellex can be developed as a possible treatment strategy for aromatase overexpressing ER+/PR+ breast cancer patients as well as for aromatase inhibitor resistant breast cancer patients. Copyright © 2012 Elsevier Ltd. All rights reserved.

Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum.

PubMed

Tang, Yuanman; Liu, Qiuping; Liu, Ying; Zhang, Linli; Ding, Wei

2017-01-01

Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA)-responsive genes NtPR1a/c , NtPR2 and NtCHN50 , JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26 . Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum . Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

Altered AIB1 or AIB1Δ3 Expression Impacts ERα Effects on Mammary Gland Stromal and Epithelial Content

PubMed Central

Nakles, Rebecca E.; Shiffert, Maddalena Tilli; Díaz-Cruz, Edgar S.; Cabrera, M. Carla; Alotaiby, Maram; Miermont, Anne M.; Riegel, Anna T.

2011-01-01

Amplified in breast cancer 1 (AIB1) (also known as steroid receptor coactivator-3) is a nuclear receptor coactivator enhancing estrogen receptor (ER)α and progesterone receptor (PR)-dependent transcription in breast cancer. The splice variant AIB1Δ3 demonstrates increased ability to promote ERα and PR-dependent transcription. Both are implicated in breast cancer risk and antihormone resistance. Conditional transgenic mice tested the in vivo impact of AIB1Δ3 overexpression compared with AIB1 on histological features of increased breast cancer risk and growth response to estrogen and progesterone in the mammary gland. Combining expression of either AIB1 or AIB1Δ3 with ERα overexpression, we investigated in vivo cooperativity. AIB1 and AIB1Δ3 overexpression equivalently increased the prevalence of hyperplastic alveolar nodules but not ductal hyperplasia or collagen content. When AIB1 or AIB1Δ3 overexpression was combined with ERα, both stromal collagen content and ductal hyperplasia prevalence were significantly increased and adenocarcinomas appeared. Overexpression of AIB1Δ3, especially combined with overexpressed ERα, led to an abnormal response to estrogen and progesterone with significant increases in stromal collagen content and development of a multilayered mammary epithelium. AIB1Δ3 overexpression was associated with a significant increase in PR expression and PR downstream signaling genes. AIB1 overexpression produced less marked growth abnormalities and no significant change in PR expression. In summary, AIB1Δ3 overexpression was more potent than AIB1 overexpression in increasing stromal collagen content, inducing abnormal mammary epithelial growth, altering PR expression levels, and mediating the response to estrogen and progesterone. Combining ERα overexpression with either AIB1 or AIB1Δ3 overexpression augmented abnormal growth responses in both epithelial and stromal compartments. PMID:21292825

Identifying key genes in glaucoma based on a benchmarked dataset and the gene regulatory network.

PubMed

Chen, Xi; Wang, Qiao-Ling; Zhang, Meng-Hui

2017-10-01

The current study aimed to identify key genes in glaucoma based on a benchmarked dataset and gene regulatory network (GRN). Local and global noise was added to the gene expression dataset to produce a benchmarked dataset. Differentially-expressed genes (DEGs) between patients with glaucoma and normal controls were identified utilizing the Linear Models for Microarray Data (Limma) package based on benchmarked dataset. A total of 5 GRN inference methods, including Zscore, GeneNet, context likelihood of relatedness (CLR) algorithm, Partial Correlation coefficient with Information Theory (PCIT) and GEne Network Inference with Ensemble of Trees (Genie3) were evaluated using receiver operating characteristic (ROC) and precision and recall (PR) curves. The interference method with the best performance was selected to construct the GRN. Subsequently, topological centrality (degree, closeness and betweenness) was conducted to identify key genes in the GRN of glaucoma. Finally, the key genes were validated by performing reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A total of 176 DEGs were detected from the benchmarked dataset. The ROC and PR curves of the 5 methods were analyzed and it was determined that Genie3 had a clear advantage over the other methods; thus, Genie3 was used to construct the GRN. Following topological centrality analysis, 14 key genes for glaucoma were identified, including IL6 , EPHA2 and GSTT1 and 5 of these 14 key genes were validated by RT-qPCR. Therefore, the current study identified 14 key genes in glaucoma, which may be potential biomarkers to use in the diagnosis of glaucoma and aid in identifying the molecular mechanism of this disease.

Oil palm EgCBF3 conferred stress tolerance in transgenic tomato plants through modulation of the ethylene signaling pathway.

PubMed

Ebrahimi, Mortaza; Abdullah, Siti Nor Akmar; Abdul Aziz, Maheran; Namasivayam, Parameswari

2016-09-01

CBF/DREB1 is a group of transcription factors that are mainly involved in abiotic stress tolerance in plants. They belong to the AP2/ERF superfamily of plant-specific transcription factors. A gene encoding a new member of this group was isolated from ripening oil palm fruit and designated as EgCBF3. The oil palm fruit demonstrates the characteristics of a climacteric fruit like tomato, in which ethylene has a major impact on the ripening process. A transgenic approach was used for functional characterization of the EgCBF3, using tomato as the model plant. The effects of ectopic expression of EgCBF3 were analyzed based on expression profiling of the ethylene biosynthesis-related genes, anti-freeze proteins (AFPs), abiotic stress tolerance and plant growth and development. The EgCBF3 tomatoes demonstrated altered phenotypes compared to the wild type tomatoes. Delayed leaf senescence and flowering, increased chlorophyll content and abnormal flowering were the consequences of overexpression of EgCBF3 in the transgenic tomatoes. The EgCBF3 tomatoes demonstrated enhanced abiotic stress tolerance under in vitro conditions. Further, transcript levels of ethylene biosynthesis-related genes, including three SlACSs and two SlACOs, were altered in the transgenic plants' leaves and roots compared to that in the wild type tomato plant. Among the eight AFPs studied in the wounded leaves of the EgCBF3 tomato plants, transcript levels of SlOSM-L, SlNP24, SlPR5L and SlTSRF1 decreased, while expression of the other four, SlCHI3, SlPR1, SlPR-P2 and SlLAP2, were up-regulated. These findings indicate the possible functions of EgCBF3 in plant growth and development as a regulator of ethylene biosynthesis-related and AFP genes, and as a stimulator of abiotic stress tolerance. Copyright © 2016 Elsevier GmbH. All rights reserved.

The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking.

PubMed

Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M; Baehr, Wolfgang

2012-12-15

Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d(-/-) mouse. Copyright © 2012 Elsevier Ltd. All rights reserved.

Phytohormone priming elevates the accumulation of defense-related gene transcripts and enhances bacterial blight disease resistance in cassava.

PubMed

Yoodee, Sunisa; Kobayashi, Yohko; Songnuan, Wisuwat; Boonchird, Chuenchit; Thitamadee, Siripong; Kobayashi, Issei; Narangajavana, Jarunya

2018-01-01

Cassava bacterial blight (CBB) disease caused by Xanthomonas axonopodis pv. manihotis (Xam) is a severe disease in cassava worldwide. In addition to causing significant cassava yield loss, CBB disease has not been extensively studied, especially in terms of CBB resistance genes. The present research demonstrated the molecular mechanisms underlining the defense response during Xam infection in two cassava cultivars exhibiting different degrees of disease resistance, Huay Bong60 (HB60) and Hanatee (HN). Based on gene expression analysis, ten of twelve putative defense-related genes including, leucine-rich repeat receptor-like kinases (LRR-RLKs), resistance (R), WRKY and pathogenesis-related (PR) genes, were differentially expressed between these two cassava cultivars during Xam infection. The up-regulation of defense-related genes observed in HB60 may be the mechanism required for the reduction of disease severity in the resistant cultivar. Interestingly, priming with salicylic acid (SA) or methyl jasmonate (MeJA) for 24 h before Xam inoculation could enhance the defense response in both cassava cultivars. The disease severity was decreased 10% in the resistant cultivar (HB60) and was remarkably reduced 21% in the susceptible cultivar (HN) by SA/MeJA priming. Priming with Xam inoculation modulated cassava4.1_013417, cassava4.1_030866 and cassava4.1_020555 (highest similarity to MeWRKY59, MePR1 and AtPDF2.2, respectively) expression and led to enhanced resistance of the susceptible cultivar in the second infection. The putative cis-regulatory elements were predicted in an upstream region of these three defense-related genes. The different gene expression levels in these genes between the two cultivars were due to the differences in cis-regulatory elements in their promoter regions. Taken together, our study strongly suggested that the induction of defense-related genes correlated with defense resistance against Xam infection, and exogenous application of SA or MeJA could elevate the defense response in both cultivars of cassava. This finding should pave the way for management to reduce yield loss from disease and genetic improvement in cassava. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.

PubMed

An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin

2016-05-01

Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.

Silencing of an α-dioxygenase gene, Ca-DOX, retards growth and suppresses basal disease resistance responses in Capsicum annum.

PubMed

Hong, Chi Eun; Ha, Young-Im; Choi, Hyoju; Moon, Ju Yeon; Lee, Jiyoung; Shin, Ah-Young; Park, Chang Jin; Yoon, Gyeong Mee; Kwon, Suk-Yoon; Jo, Ick-Hyun; Park, Jeong Mee

2017-03-01

Alpha-dioxygenases (α-DOX) catalyzing the primary oxygenation of fatty acids to oxylipins were recently found in plants. Here, the biological roles of the pepper α-DOX (Ca-DOX) gene, which is strongly induced during non-host pathogen infection in chili pepper, were examined. Virus-induced gene silencing demonstrated that down-regulation of Ca-DOX enhanced susceptibility to bacterial pathogens and suppressed the hypersensitive response via the suppression of pathogenesis-related genes such as PR4, proteinase inhibitor II and lipid transfer protein (PR14). Ca-DOX-silenced pepper plants also exhibited more retarded growth with lower epidermal cell numbers and reduced cell wall thickness than control plants. To better understand regulation of Ca-DOX, transgenic Arabidopsis plants harboring the β-glucuronidase (GUS) reporter gene driven from a putative Ca-DOX promoter were generated. GUS expression was significantly induced upon avirulent pathogen infection in transgenic Arabidopsis leaves, whereas GUS induction was relatively weak upon virulent pathogen treatment. After treatment with plant hormones, early and strong GUS expression was seen after treatment of salicylic acid, whereas ethylene and methyl jasmonate treatments produced relatively weak and late GUS signals. These results will enable us to further understand the role of α-DOX, which is important in lipid metabolism, defense responses, and growth development in plants.

The baculovirus-integrated retrotransposon TED encodes gag and pol proteins that assemble into viruslike particles with reverse transcriptase.

PubMed Central

Lerch, R A; Friesen, P D

1992-01-01

TED is a lepidopteran retrotransposon found inserted within the DNA genome of the Autographa californica nuclear polyhedrosis virus mutant, FP-D. To examine the proteins and functions encoded by this representative of the gypsy family of retrotransposons, the gag- and pol-like open reading frames (ORFs 1 and 2) were expressed in homologous lepidopteran cells by using recombinant baculovirus vectors. Expression of ORF 1 resulted in synthesis of an abundant TED-specific protein (Pr55gag) that assembled into viruslike particles with a diameter of 55 to 60 nm. Expression of ORF 2, requiring a -1 translational frameshift, resulted in synthesis of a protease that mediated cleavage of Pr55gag to generate p37, the major protein component of the resulting particles. Expression of ORF 2 also produced reverse transcriptase that associated with these particles. Both protease and reverse transcriptase activities mapped to domains within ORF 2 that contain sequence similarities with the corresponding functional domains of the pol gene of the vertebrate retroviruses. These results indicated that TED ORFs 1 and 2 functionally resemble the retrovirus gag and pol genes and demonstrated for the first time that an invertebrate member of the gypsy family of elements encodes active forms of the structural and enzymatic functions necessary for transposition via an RNA intermediate. TED integration within the baculovirus genome thus represents one of the first examples of transposon-mediated transfer of host-derived genes to an eukaryotic virus. Images PMID:1371168

The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways.

PubMed

Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather

2012-07-01

• Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Functional variants of the sphingosine-1-phosphate receptor 1 gene associate with asthma susceptibility.

PubMed

Sun, Xiaoguang; Ma, Shwu-Fan; Wade, Michael S; Flores, Carlos; Pino-Yanes, Maria; Moitra, Jaideep; Ober, Carole; Kittles, Rick; Husain, Aliya N; Ford, Jean G; Garcia, Joe G N

2010-08-01

The genetic mechanisms underlying asthma remain unclear. Increased permeability of the microvasculature is a feature of asthma, and the sphingosine-1-phosphate receptor (S1PR1) is an essential participant regulating lung vascular integrity and responses to lung inflammation. We explored the contribution of polymorphisms in the S1PR1 gene to asthma susceptibility. A combination of gene resequencing for single nucleotide polymorphism (SNP) discovery, case-control association, functional evaluation of associated SNPs, and protein immunochemistry studies was used. Immunohistochemistry studies demonstrated significantly decreased S1PR1 protein expression in pulmonary vessels in lungs of asthmatic patients compared with those of nonasthmatic subjects (P < .05). Direct DNA sequencing of 27 multiethnic samples identified 39 S1PR1 variants (18 novel SNPs). Association studies were performed based on genotyping results from cosmopolitan tagging SNPs in 3 case-control cohorts from Chicago and New York totaling 1,061 subjects (502 cases and 559 control subjects). The promoter SNP rs2038366 (-1557G/T) was found to be associated with asthma (P = .03) in European Americans. In African Americans an association was found for both asthma and severe asthma for intronic SNP rs3753194 (c.-164+170A/G; P = .006 and P = .040, respectively) and for promoter SNP rs59317557 (-532C/G) with severe asthma (P = .028). Consistent with predicted in silico functionality, alleles of the promoter SNPs rs2038366 (-1557G/T) and rs59317557 (-532C/G) influenced the activity of a luciferase S1PR1 reporter vector in transfected endothelial cells exposed to growth factors (epidermal growth factor, platelet-derived growth factor, and vascular endothelial growth factor) known to be increased in asthmatic airways. These data provide strong support for a role for S1PR1 gene variants in asthma susceptibility and severity. Copyright 2010 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Altered expression of genes involved in progesterone biosynthesis, metabolism and action in endometrial cancer.

PubMed

Sinreih, Maša; Hevir, Neli; Rižner, Tea Lanišnik

2013-02-25

Endometrial cancer (EC) is one of the most common gynecological malignancies worldwide. It is associated with prolonged exposure to estrogens that is unopposed by the protective effects of progesterone, which suggests that altered progesterone biosynthesis, metabolism and actions might be implicated in the development of EC. Our aim was to evaluate these processes through quantitative real-time PCR expression analysis in up to 47 pairs of EC tissue and adjacent control endometrium. First, we examined the expression of genes encoding proteins associated with progesterone biosynthesis: steroidogenic acute regulatory protein (STAR); a side chain cleavage enzyme (CYP11A1); and 3β-hydroxysteroid dehydrogenase/ketosteroid isomerase (HSD3B). There were 1.9- and 10.0-fold decreased expression of STAR and CYP11A1, respectively, in EC versus adjacent control endometrium, with no significant differences in the expression of HSD3B1 and HSD3B2. Next, we examined expression of genes encoding five progesterone metabolizing enzymes: the 3-keto and 20-ketosteroid reductases (AKR1C1-AKR1C3) and 5α-reductases (SRD5A1 and SRD5A2); and the opposing 20α-hydroxysteroid dehydrogenase (HSD17B2). These genes are expressed in EC and adjacent control endometrium. No statistically significant differences were seen in mRNA levels of AKR1C1, AKR1C2, AKR1C3 and SRD5A1. Expression of HSD17B2 was 3.0-fold increased, and expression of SRD5A2 was 3.7-fold decreased, in EC versus adjacent control endometrium. We also examined mRNA levels of progesterone receptors A and B (PGR), and separately the expression of progesterone receptor B (PR-B). Here we saw 1.8- and 2.0-fold lower mRNA levels of PGR and PR-B, respectively, in EC versus adjacent control endometrium. This down-regulation of STAR, CYP11A1 and PGR in endometrial cancer may lead to decreased progesterone biosynthesis and actions although the effects on progesterone levels should be further studied. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Neuroinflammation, hyperphosphorylated tau, diffuse amyloid plaques, and down-regulation of the cellular prion protein in air pollution exposed children and young adults.

PubMed

Calderón-Garcidueñas, Lilian; Kavanaugh, Michael; Block, Michelle; D'Angiulli, Amedeo; Delgado-Chávez, Ricardo; Torres-Jardón, Ricardo; González-Maciel, Angelica; Reynoso-Robles, Rafael; Osnaya, Norma; Villarreal-Calderon, Rodolfo; Guo, Ruixin; Hua, Zhaowei; Zhu, Hongtu; Perry, George; Diaz, Philippe

2012-01-01

Air pollution exposures have been linked to neuroinflammation and neuropathology. Autopsy samples of the frontal cortex from control (n = 8) and pollution-exposed (n = 35) children and young adults were analyzed by RT-PCR (n = 43) and microarray analysis (n = 12) for gene expression changes in oxidative stress, DNA damage signaling, NFκB signaling, inflammation, and neurodegeneration pathways. The effect of apolipoprotein E (APOE) genotype on the presence of protein aggregates associated with Alzheimer's disease (AD) pathology was also explored. Exposed urbanites displayed differential (>2-fold) regulation of 134 genes. Forty percent exhibited tau hyperphosphorylation with pre-tangle material and 51% had amyloid-β (Aβ) diffuse plaques compared with 0% in controls. APOE4 carriers had greater hyperphosphorylated tau and diffuse Aβ plaques versus E3 carriers (Q = 7.82, p = 0.005). Upregulated gene network clusters included IL1, NFκB, TNF, IFN, and TLRs. A 15-fold frontal down-regulation of the prion-related protein (PrP(C)) was seen in highly exposed subjects. The down-regulation of the PrP(C) is critical given its important roles for neuroprotection, neurodegeneration, and mood disorder states. Elevation of indices of neuroinflammation and oxidative stress, down-regulation of the PrP(C) and AD-associated pathology are present in young megacity residents. The inducible regulation of gene expression suggests they are evolving different mechanisms in an attempt to cope with the constant state of inflammation and oxidative stress related to their environmental exposures. Together, these data support a role for air pollution in CNS damage and its impact upon the developing brain and the potential etiology of AD and mood disorders.

Electrophysiological properties of prion-positive cardiac progenitors derived from murine embryonic stem cells.

PubMed

Fujii, Hiroshi; Ikeuchi, Yu; Kurata, Yasutaka; Ikeda, Nobuhito; Bahrudin, Udin; Li, Peili; Nakayama, Yuji; Endo, Ryo; Hasegawa, Akira; Morikawa, Kumi; Miake, Junichiro; Yoshida, Akio; Hidaka, Kyoko; Morisaki, Takayuki; Ninomiya, Haruaki; Shirayoshi, Yasuaki; Yamamoto, Kazuhiro; Hisatome, Ichiro

2012-01-01

The prion protein (PrP) has been reported to serve as a surface maker for isolation of cardiomyogenic progenitors from murine embryonic stem (ES) cells. Although PrP-positive cells exhibited automaticity, their electrophysiological characteristics remain unresolved. The aim of the present study was therefore to investigate the electrophysiological properties of PrP-positive cells in comparison with those of HCN4p-or Nkx2.5-positive cells. Differentiation of AB1, HCN5p-EGFP and hcgp7 ES cells into cardiac progenitors was induced by embryoid body (EB) formation. EBs were dissociated and cells expressing PrP, HCN4-EGFP and/or Nkx2.5-GFP were collected via flow cytometry. Sorted cells were subjected to reverse transcriptase-polymerase chain reaction, immunostaining and patch-clamp experiments. PrP-positive cells expressed mRNA of undifferentiation markers, first and second heart field markers, and cardiac-specific genes and ion channels, indicating their commitment to cardiomyogenic progenitors. PrP-positive cells with automaticity showed positive and negative chronotropic responses to isoproterenol and carbamylcholine, respectively. Hyperpolarization-activated cation current (I(f)) was barely detectable, whereas Na(+) and L-type Ca(2+) channel currents were frequently observed. Their spontaneous activity was slowed by inhibition of sarcoplasmic reticulum Ca(2+) uptake and release but not by blocking I(f). The maximum diastolic potential of their spontaneous firings was more depolarized than that of Nkx2.5-GFP-positive cells. PrP-positive cells contained cardiac progenitors that separated from the lineage of sinoatrial node cells. PrP can be used as a marker to enrich nascent cardiac progenitors.

Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

USDA-ARS?s Scientific Manuscript database

Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes.

PubMed

Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

2016-07-01

The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat.

The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes

PubMed Central

Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

2016-01-01

The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

The PR/SET Domain Zinc Finger Protein Prdm4 Regulates Gene Expression in Embryonic Stem Cells but Plays a Nonessential Role in the Developing Mouse Embryo

PubMed Central

Bogani, Debora; Morgan, Marc A. J.; Nelson, Andrew C.; Costello, Ita; McGouran, Joanna F.; Kessler, Benedikt M.

2013-01-01

Prdm4 is a highly conserved member of the Prdm family of PR/SET domain zinc finger proteins. Many well-studied Prdm family members play critical roles in development and display striking loss-of-function phenotypes. Prdm4 functional contributions have yet to be characterized. Here, we describe its widespread expression in the early embryo and adult tissues. We demonstrate that DNA binding is exclusively mediated by the Prdm4 zinc finger domain, and we characterize its tripartite consensus sequence via SELEX (systematic evolution of ligands by exponential enrichment) and ChIP-seq (chromatin immunoprecipitation-sequencing) experiments. In embryonic stem cells (ESCs), Prdm4 regulates key pluripotency and differentiation pathways. Two independent strategies, namely, targeted deletion of the zinc finger domain and generation of a EUCOMM LacZ reporter allele, resulted in functional null alleles. However, homozygous mutant embryos develop normally and adults are healthy and fertile. Collectively, these results strongly suggest that Prdm4 functions redundantly with other transcriptional partners to cooperatively regulate gene expression in the embryo and adult animal. PMID:23918801

miR-888: A Novel Cancer-Testis Antigen that Targets the Progesterone Receptor in Endometrial Cancer12

PubMed Central

Hovey, Adriann M.; Devor, Eric J.; Breheny, Patrick J.; Mott, Sarah L.; Dai, Donghai; Thiel, Kristina W.; Leslie, Kimberly K.

2015-01-01

Cancer-testis (CT) antigens are a large family of genes that are selectively expressed in human testis germ cells, overexpressed in a variety of tumors and predominantly located on the X chromosome. To date, all known CT antigens are protein-coding genes. Here, we identify miR-888 as the first miRNA with features characteristic of a CT antigen. In a panel of 21 normal human tissues, miR-888 expression was high in testes and minimal or absent in all other examined tissues. In situ hybridization localized miR-888 expression specifically to the early stages of sperm development within the testes. Using The Cancer Genome Atlas database, we discovered that miR-888 was predominately expressed in endometrial tumors, with a significant association to high-grade tumors and increased percent invasion. In a separate panel of endometrial tumor specimens, we validated overexpression of miR-888 by real-time polymerase chain reaction. In addition, miR-888 expression was highest in endometrial carcinosarcoma, a rare and aggressive type of endometrial tumor. Moreover, we identified the progesterone receptor (PR), a potent endometrial tumor suppressor, as a direct target of miR-888. These data define miR-888 as the first miRNA CT antigen and a potential mediator of an aggressive endometrial tumor phenotype through down-regulation of PR. PMID:25926074

Effects of Cholesterol-altering Pharmaceuticals on Cholesterol Metabolism, Steroidogenesis, and Gene Expression in the Fathead Minnow (Pimephales promelas)

EPA Science Inventory

Pharmaceuticals that target cholesterol biosynthesis and uptake are among the most widely prescribed drugs and have been detected in the aquatic environment. Fibrates are a class of pharmaceuticals that indirectly modulate cholesterol biosynthesis through effects on peroxisome pr...

Use of a Simple, Colorimetric Assay to Demonstrate Conditions for Induction of Nitrate Reductase in Plants.

ERIC Educational Resources Information Center

Harley, Suzanne M.

1993-01-01

Nitrate assimilation by plants provides an excellent system for demonstrating control of gene expression in a eukaryotic organism. Describes an assay method that allows students to complete experiments designed around the measurement of nitrate reductase within a three-hour laboratory experiment. (PR)

The PR-Set7 binding domain of Riz1 is required for the H4K20me1-H3K9me1 trans-tail 'histone code' and Riz1 tumor suppressor function.

PubMed

Congdon, Lauren M; Sims, Jennifer K; Tuzon, Creighton T; Rice, Judd C

2014-04-01

PR-Set7/Set8/KMT5a is the sole histone H4 lysine 20 monomethyltransferase (H4K20me1) in metazoans and is essential for proper cell division and genomic stability. We unexpectedly discovered that normal cellular levels of monomethylated histone H3 lysine 9 (H3K9me1) were also dependent on PR-Set7, but independent of its catalytic activity. This observation suggested that PR-Set7 interacts with an H3K9 monomethyltransferase to establish the previously reported H4K20me1-H3K9me1 trans-tail 'histone code'. Here we show that PR-Set7 specifically and directly binds the C-terminus of the Riz1/PRDM2/KMT8 tumor suppressor and demonstrate that the N-terminal PR/SET domain of Riz1 preferentially monomethylates H3K9. The PR-Set7 binding domain was required for Riz1 nuclear localization and maintenance of the H4K20me1-H3K9me1 trans-tail 'histone code'. Although Riz1 can function as a repressor, Riz1/H3K9me1 was dispensable for the repression of genes regulated by PR-Set7/H4K20me1. Frameshift mutations resulting in a truncated Riz1 incapable of binding PR-Set7 occur frequently in various aggressive cancers. In these cancer cells, expression of wild-type Riz1 restored tumor suppression by decreasing proliferation and increasing apoptosis. These phenotypes were not observed in cells expressing either the Riz1 PR/SET domain or PR-Set7 binding domain indicating that Riz1 methyltransferase activity and PR-Set7 binding domain are both essential for Riz1 tumor suppressor function.

Fetal growth restriction and the programming of heart growth and cardiac insulin-like growth factor 2 expression in the lamb.

PubMed

Wang, Kimberley C W; Zhang, Lei; McMillen, I Caroline; Botting, Kimberley J; Duffield, Jaime A; Zhang, Song; Suter, Catherine M; Brooks, Doug A; Morrison, Janna L

2011-10-01

Reduced growth in fetal life together with accelerated growth in childhood, results in a ~50% greater risk of coronary heart disease in adult life. It is unclear why changes in patterns of body and heart growth in early life can lead to an increased risk of cardiovascular disease in adulthood. We aimed to investigate the role of the insulin-like growth factors in heart growth in the growth-restricted fetus and lamb. Hearts were collected from control and placentally restricted (PR) fetuses at 137-144 days gestation and from average (ABW) and low (LBW) birth weight lambs at 21 days of age. We quantified cardiac mRNA expression of IGF-1, IGF-2 and their receptors, IGF-1R and IGF-2R, using real-time RT-PCR and protein expression of IGF-1R and IGF-2R using Western blotting. Combined bisulphite restriction analysis was used to assess DNA methylation in the differentially methylated region (DMR) of the IGF-2/H19 locus and of the IGF-2R gene. In PR fetal sheep, IGF-2, IGF-1R and IGF-2R mRNA expression was increased in the heart compared to controls. LBW lambs had a greater left ventricle weight relative to body weight as well as increased IGF-2 and IGF-2R mRNA expression in the heart, when compared to ABW lambs. No changes in the percentage of methylation of the DMRs of IGF-2/H19 or IGF-2R were found between PR and LBW when compared to their respective controls. In conclusion, a programmed increased in cardiac gene expression of IGF-2 and IGF-2R may represent an adaptive response to reduced substrate supply (e.g. glucose and/or oxygen) in order to maintain heart growth and may be the underlying cause for increased ventricular hypertrophy and the associated susceptibility of cardiomyocytes to ischaemic damage later in life.

Negative Effects of SRD5A1 on Nuclear Activity of Progesterone Receptor Isoform B in JEG3 Cells.

PubMed

Miao, Zhuo; Sun, Min; Jiang, Feng; Yao, Yuanqing; Li, Yi

2016-02-01

Progesterone withdrawal signals labor in mammals. Elevated intracellular metabolism contributes to progesterone functional withdrawal through unknown mechanism, which is thought to act via progesterone receptor (PR). This study aims to investigate molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. We investigated the role of 5α-reductase type I (SRD5A1) in enzymatic catalysis of progesterone and loss of PR function in a human trophoblast choriocarcinoma cell line JEG3. The PR isoform B (PR-B) was robustly expressed in JEG3 cells. The SRD5A1 small-interfering RNA knockdown led to significant increase in PR-B nuclear import, ectopic, whereas SRD5A1 overexpression resulted in remarkable inhibition of nuclear PR-B in P4-treated cells. Repression of SRD5A1 activated PR-B responsive gene, whereas overexpression of SRD5A1 possessed an inhibitory effect. JEG3 cell line is a valuable tool to study mechanisms responsible for loss of PR function and screening of drugs for preterm birth treatment. Our study aims to investigate the molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. © The Author(s) 2015.

Inter-laboratory quality control for hormone-dependent gene expression in human breast tumors using real-time reverse transcription-polymerase chain reaction.

PubMed

de Cremoux, P; Bieche, I; Tran-Perennou, C; Vignaud, S; Boudou, E; Asselain, B; Lidereau, R; Magdelénat, H; Becette, V; Sigal-Zafrani, B; Spyratos, F

2004-09-01

Quantitative reverse transcription-polymerase chain reaction (RT-PCR) used to detect minor changes in specific mRNA concentrations may be associated with poor reproducibility. Stringent quality control is therefore essential at each step of the protocol, including the PCR procedure. We performed inter-laboratory quality control of quantitative PCR between two independent laboratories, using in-house RT-PCR assays on a series of hormone-related target genes in a retrospective consecutive series of 79 breast tumors. Total RNA was reverse transcribed in a single center. Calibration curves were performed for five target genes (estrogen receptor (ER)alpha, ERbeta, progesterone receptor (PR), CYP19 (aromatase) and Ki 67) and for two reference genes (human acidic ribosomal phosphoprotein PO (RPLPO) and TATA box-binding protein (TBP)). Amplification efficiencies of the calibrator were determined for each run and used to calculate mRNA expression. Correlation coefficients were evaluated for each target and each reference gene. A good correlation was observed for all target and reference genes in both centers using their own protocols and kits (P < 0.0001). The correlation coefficients ranged from 0.90 to 0.98 for the various target genes in the two centers. A good correlation was observed between the level of expression of the ERalpha and the PR transcripts (P < 0.001). A weak inverse correlation was observed in both centers between ERalpha and ERbeta levels, but only when TBP was the reference gene. No other correlation was observed with other parameters. Real-time PCR assays allow convenient quantification of target mRNA transcripts and quantification of target-derived nucleic acids in clinical specimens. This study addresses the importance of inter-laboratory quality controls for the use of a panel of real-time PCR assays devoted to clinical samples and protocols and to ensure their appropriate accuracy. This can also facilitate exchanges and multicenter comparison of data.

Ozanimod (RPC1063), a selective S1PR1 and S1PR5 modulator, reduces chronic inflammation and alleviates kidney pathology in murine systemic lupus erythematosus.

PubMed

Taylor Meadows, Kristen R; Steinberg, Marcos W; Clemons, Bryan; Stokes, Matthew E; Opiteck, Gregory J; Peach, Robert; Scott, Fiona L

2018-01-01

Ozanimod (RPC1063) is a specific and potent small molecule modulator of the sphingosine 1-phosphate receptor 1 (S1PR1) and receptor 5 (S1PR5), which has shown therapeutic benefit in clinical trials of relapsing multiple sclerosis and ulcerative colitis. Ozanimod and its active metabolite, RP-101075, exhibit a similar specificity profile at the S1P receptor family in vitro and pharmacodynamic profile in vivo. The NZBWF1 mouse model was used in therapeutic dosing mode to assess the potential benefit of ozanimod and RP-101075 in an established animal model of systemic lupus erythematosus. Compared with vehicle-treated animals, ozanimod and RP-101075 reduced proteinuria over the duration of the study and serum blood urea nitrogen at termination. Additionally, ozanimod and RP-101075 reduced kidney disease in a dose-dependent manner, as measured by histological assessment of mesangial expansion, endo- and exo-capillary proliferation, interstitial infiltrates and fibrosis, glomerular deposits, and tubular atrophy. Further exploration into gene expression changes in the kidney demonstrate that RP-101075 also significantly reduced expression of fibrotic and immune-related genes in the kidneys. Of note, RP-101075 lowered the number of plasmacytoid dendritic cells, a major source of interferon alpha in lupus patients, and reduced all B and T cell subsets in the spleen. Given the efficacy demonstrated by ozanimod and its metabolite RP-101075 in the NZBWF1 preclinical animal model, ozanimod may warrant clinical evaluation as a potential treatment for systemic lupus erythematosus.

Ozanimod (RPC1063), a selective S1PR1 and S1PR5 modulator, reduces chronic inflammation and alleviates kidney pathology in murine systemic lupus erythematosus

PubMed Central

Taylor Meadows, Kristen R.; Steinberg, Marcos W.; Clemons, Bryan; Stokes, Matthew E.; Opiteck, Gregory J.; Peach, Robert; Scott, Fiona L.

2018-01-01

Ozanimod (RPC1063) is a specific and potent small molecule modulator of the sphingosine 1-phosphate receptor 1 (S1PR1) and receptor 5 (S1PR5), which has shown therapeutic benefit in clinical trials of relapsing multiple sclerosis and ulcerative colitis. Ozanimod and its active metabolite, RP-101075, exhibit a similar specificity profile at the S1P receptor family in vitro and pharmacodynamic profile in vivo. The NZBWF1 mouse model was used in therapeutic dosing mode to assess the potential benefit of ozanimod and RP-101075 in an established animal model of systemic lupus erythematosus. Compared with vehicle-treated animals, ozanimod and RP-101075 reduced proteinuria over the duration of the study and serum blood urea nitrogen at termination. Additionally, ozanimod and RP-101075 reduced kidney disease in a dose-dependent manner, as measured by histological assessment of mesangial expansion, endo- and exo-capillary proliferation, interstitial infiltrates and fibrosis, glomerular deposits, and tubular atrophy. Further exploration into gene expression changes in the kidney demonstrate that RP-101075 also significantly reduced expression of fibrotic and immune-related genes in the kidneys. Of note, RP-101075 lowered the number of plasmacytoid dendritic cells, a major source of interferon alpha in lupus patients, and reduced all B and T cell subsets in the spleen. Given the efficacy demonstrated by ozanimod and its metabolite RP-101075 in the NZBWF1 preclinical animal model, ozanimod may warrant clinical evaluation as a potential treatment for systemic lupus erythematosus. PMID:29608575

Structure-Specific Effects of Short-Chain Fatty Acids on Plasma Cholesterol Concentration in Male Syrian Hamsters.

PubMed

Zhao, Yimin; Liu, Jianhui; Hao, Wangjun; Zhu, Hanyue; Liang, Ning; He, Zouyan; Ma, Ka Ying; Chen, Zhen-Yu

2017-12-20

Previous studies have shown that short-chain fatty acids (SCFAs) are capable of decreasing plasma cholesterol. However, the relative plasma-cholesterol-lowering activity of individual SCFAs and the underlying mechanisms by which SCFAs decrease plasma cholesterol remain largely unknown. The present study was done to compare the plasma-cholesterol-lowering potencies of four common SCFAs with 2-5 carbons and to investigate their interactions with gene expressions of key regulatory factors involved in cholesterol metabolism. For 6 weeks, five groups of male Golden hamsters were fed either a control high-cholesterol diet (HCD) or one of the four experimental HCDs containing 0.5 mol of acetate (Ac), propionate (Pr), butyrate (Bu), or valerate (Va) per kilogram of the diet. The results showed that Ac, Pr, and Bu significantly reduced plasma total cholesterol (TC) by 24, 18, and 17% (P < 0.05), respectively. All four SCFAs could decrease non-HDL cholesterol (non-HDL-C) and the non-HDL-C/HDL-C ratio. The addition of Ac, Pr, or Bu into the diet significantly promoted fecal excretion of bile acids by 121, 113, or 120% (P < 0.05), respectively, and upregulated the gene expressions of sterol-regulatory-element-binding protein 2 (SREBP2), low-density-lipoprotein receptor (LDLR), and cholesterol 7α-hydroxylase (CYP7A1) in the liver. It was concluded that SCFAs with 2-4 carbons (Ac, Pr, and Bu) are more hypocholesterolemic than Va, which has 5 carbons, via enhancing fecal excretion of bile acids and promoting the hepatic uptake of cholesterol from the blood.

Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

PubMed

Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

2015-12-01

The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Application of Glycerol for Induced Powdery Mildew Resistance in Triticum aestivum L.

PubMed

Li, Yinghui; Song, Na; Zhao, Chuanzhi; Li, Feng; Geng, Miaomiao; Wang, Yuhui; Liu, Wanhui; Xie, Chaojie; Sun, Qixin

2016-01-01

Previous work has demonstrated that glycerol-3-phosphate (G3P) and oleic acid (18:1) are two important signal molecules associated with plant resistance to fungi. In this article, we provide evidence that a 3% glycerol spray application 1-2 days before powdery mildew infection and subsequent applications once every 4 days was sufficient to stimulate the plant defense responses without causing any significant damage to wheat leaves. We found that G3P and oleic acid levels were markedly induced by powdery mildew infection. In addition, TaGLI1 (encoding a glycerol kinase) and TaSSI2 (encoding a stearoylacyl carrier protein fatty acid desaturase), two genes associated with the glycerol and fatty acid (FA) pathways, respectively, were induced by powdery mildew infection, and their promoter regions contain some fungal response elements. Moreover, exogenous application of glycerol increased the G3P level and decreased the level of oleic acid (18:1). Glycerol application induced the expression of pathogenesis-related ( PR ) genes ( TaPR-1, TaPR-2, TaPR-3, TaPR-4 , and TaPR-5 ), induced the generation of reactive oxygen species (ROS) before powdery mildew infection, and induced salicylic acid (SA) accumulation in wheat leaves. Further, we sprayed glycerol in a wheat field and found that it significantly ( p < 0.05) reduced the severity of powdery mildew disease and lessened disease-associated kernel weight loss, all without causing any noticeable degradation in wheat seed quality.

Application of Glycerol for Induced Powdery Mildew Resistance in Triticum aestivum L.

PubMed Central

Li, Yinghui; Song, Na; Zhao, Chuanzhi; Li, Feng; Geng, Miaomiao; Wang, Yuhui; Liu, Wanhui; Xie, Chaojie; Sun, Qixin

2016-01-01

Previous work has demonstrated that glycerol-3-phosphate (G3P) and oleic acid (18:1) are two important signal molecules associated with plant resistance to fungi. In this article, we provide evidence that a 3% glycerol spray application 1–2 days before powdery mildew infection and subsequent applications once every 4 days was sufficient to stimulate the plant defense responses without causing any significant damage to wheat leaves. We found that G3P and oleic acid levels were markedly induced by powdery mildew infection. In addition, TaGLI1 (encoding a glycerol kinase) and TaSSI2 (encoding a stearoylacyl carrier protein fatty acid desaturase), two genes associated with the glycerol and fatty acid (FA) pathways, respectively, were induced by powdery mildew infection, and their promoter regions contain some fungal response elements. Moreover, exogenous application of glycerol increased the G3P level and decreased the level of oleic acid (18:1). Glycerol application induced the expression of pathogenesis-related (PR) genes (TaPR-1, TaPR-2, TaPR-3, TaPR-4, and TaPR-5), induced the generation of reactive oxygen species (ROS) before powdery mildew infection, and induced salicylic acid (SA) accumulation in wheat leaves. Further, we sprayed glycerol in a wheat field and found that it significantly (p < 0.05) reduced the severity of powdery mildew disease and lessened disease-associated kernel weight loss, all without causing any noticeable degradation in wheat seed quality. PMID:27708588

A novel homozygous mutation in the FSHR gene is causative for primary ovarian insufficiency.

PubMed

Liu, Hongli; Xu, Xiaofei; Han, Ting; Yan, Lei; Cheng, Lei; Qin, Yingying; Liu, Wen; Zhao, Shidou; Chen, Zi-Jiang

2017-12-01

To identify the potential FSHR mutation in a Chinese woman with primary ovarian insufficiency (POI). Genetic and functional studies. University-based reproductive medicine center. A POI patient, her family members, and another 192 control women with regular menstruation. Ovarian biopsy was performed in the patient. Sanger sequencing was carried out for the patient, her sister, and parents. The novel variant identified was further confirmed with the use of control subjects. Sanger sequencing and genotype analysis to identify the potential variant of the FSHR gene; hematoxylin and eosin staining of the ovarian section to observe the follicular development; Western blotting and immunofluorescence to detect FSH receptor (FSHR) expression; and cyclic adenosine monophosphate (cAMP) assay to monitor FSH-induced signaling. Histologic examination of the ovaries in the patient revealed follicular development up to the early antral stage. Mutational screening and genotype analysis of the FSHR gene identified a novel homozygous mutation c.175C>T (p.R59X) in exon 2, which was inherited in the autosomal recessive mode from her heterozygous parents but was absent in her sister and the 192 control women. Functional studies demonstrated that in vitro the nonsense mutation caused the loss of full-length FSHR expression and that p.R59X mutant showed no response to FSH stimulation in the cAMP level. The mutation p.R59X in FSHR is causative for POI by means of arresting folliculogenesis. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Partition resampling and extrapolation averaging: approximation methods for quantifying gene expression in large numbers of short oligonucleotide arrays.

PubMed

Goldstein, Darlene R

2006-10-01

Studies of gene expression using high-density short oligonucleotide arrays have become a standard in a variety of biological contexts. Of the expression measures that have been proposed to quantify expression in these arrays, multi-chip-based measures have been shown to perform well. As gene expression studies increase in size, however, utilizing multi-chip expression measures is more challenging in terms of computing memory requirements and time. A strategic alternative to exact multi-chip quantification on a full large chip set is to approximate expression values based on subsets of chips. This paper introduces an extrapolation method, Extrapolation Averaging (EA), and a resampling method, Partition Resampling (PR), to approximate expression in large studies. An examination of properties indicates that subset-based methods can perform well compared with exact expression quantification. The focus is on short oligonucleotide chips, but the same ideas apply equally well to any array type for which expression is quantified using an entire set of arrays, rather than for only a single array at a time. Software implementing Partition Resampling and Extrapolation Averaging is under development as an R package for the BioConductor project.

The lipodystrophic hotspot lamin A p.R482W mutation deregulates the mesodermal inducer T/Brachyury and early vascular differentiation gene networks.

PubMed

Briand, Nolwenn; Guénantin, Anne-Claire; Jeziorowska, Dorota; Shah, Akshay; Mantecon, Matthieu; Capel, Emilie; Garcia, Marie; Oldenburg, Anja; Paulsen, Jonas; Hulot, Jean-Sebastien; Vigouroux, Corinne; Collas, Philippe

2018-04-15

The p.R482W hotspot mutation in A-type nuclear lamins causes familial partial lipodystrophy of Dunnigan-type (FPLD2), a lipodystrophic syndrome complicated by early onset atherosclerosis. Molecular mechanisms underlying endothelial cell dysfunction conferred by the lamin A mutation remain elusive. However, lamin A regulates epigenetic developmental pathways and mutations could perturb these functions. Here, we demonstrate that lamin A R482W elicits endothelial differentiation defects in a developmental model of FPLD2. Genome modeling in fibroblasts from patients with FPLD2 caused by the lamin A R482W mutation reveals repositioning of the mesodermal regulator T/Brachyury locus towards the nuclear center relative to normal fibroblasts, suggesting enhanced activation propensity of the locus in a developmental model of FPLD2. Addressing this issue, we report phenotypic and transcriptional alterations in mesodermal and endothelial differentiation of induced pluripotent stem cells we generated from a patient with R482W-associated FPLD2. Correction of the LMNA mutation ameliorates R482W-associated phenotypes and gene expression. Transcriptomics links endothelial differentiation defects to decreased Polycomb-mediated repression of the T/Brachyury locus and over-activation of T target genes. Binding of the Polycomb repressor complex 2 to T/Brachyury is impaired by the mutated lamin A network, which is unable to properly associate with the locus. This leads to a deregulation of vascular gene expression over time. By connecting a lipodystrophic hotspot lamin A mutation to a disruption of early mesodermal gene expression and defective endothelial differentiation, we propose that the mutation rewires the fate of several lineages, resulting in multi-tissue pathogenic phenotypes.

Transmission Characteristics of Variably Protease-Sensitive Prionopathy

PubMed Central

Notari, Silvio; Xiao, Xiangzhu; Espinosa, Juan Carlos; Cohen, Yvonne; Qing, Liuting; Aguilar-Calvo, Patricia; Kofskey, Diane; Cali, Ignazio; Cracco, Laura; Kong, Qingzhong; Torres, Juan Maria

2014-01-01

Variably protease-sensitive prionopathy (VPSPr), a recently identified and seemingly sporadic human prion disease, is distinct from Creutzfeldt-Jakob disease (CJD) but shares features of Gerstmann-Sträussler-Scheinker disease (GSS). However, contrary to exclusively inherited GSS, no prion protein (PrP) gene variations have been detected in VPSPr, suggesting that VPSPr might be the long-sought sporadic form of GSS. The VPSPr atypical features raised the issue of transmissibility, a prototypical property of prion diseases. We inoculated VPSPr brain homogenate into transgenic mice expressing various levels of human PrP (PrPC). On first passage, 54% of challenged mice showed histopathologic lesions, and 34% harbored abnormal PrP similar to that of VPSPr. Surprisingly, no prion disease was detected on second passage. We concluded that VPSPr is transmissible; thus, it is an authentic prion disease. However, we speculate that normal human PrPC is not an efficient conversion substrate (or mouse brain not a favorable environment) and therefore cannot sustain replication beyond the first passage. PMID:25418590

Selection of reference genes for gene expression studies in virus-infected monocots using quantitative real-time PCR.

PubMed

Zhang, Kun; Niu, Shaofang; Di, Dianping; Shi, Lindan; Liu, Deshui; Cao, Xiuling; Miao, Hongqin; Wang, Xianbing; Han, Chenggui; Yu, Jialin; Li, Dawei; Zhang, Yongliang

2013-10-10

Both genome-wide transcriptomic surveys of the mRNA expression profiles and virus-induced gene silencing-based molecular studies of target gene during virus-plant interaction involve the precise estimation of the transcript abundance. Quantitative real-time PCR (qPCR) is the most widely adopted technique for mRNA quantification. In order to obtain reliable quantification of transcripts, identification of the best reference genes forms the basis of the preliminary work. Nevertheless, the stability of internal controls in virus-infected monocots needs to be fully explored. In this work, the suitability of ten housekeeping genes (ACT, EF1α, FBOX, GAPDH, GTPB, PP2A, SAND, TUBβ, UBC18 and UK) for potential use as reference genes in qPCR were investigated in five different monocot plants (Brachypodium, barley, sorghum, wheat and maize) under infection with different viruses including Barley stripe mosaic virus (BSMV), Brome mosaic virus (BMV), Rice black-streaked dwarf virus (RBSDV) and Sugarcane mosaic virus (SCMV). By using three different algorithms, the most appropriate reference genes or their combinations were identified for different experimental sets and their effectiveness for the normalisation of expression studies were further validated by quantitative analysis of a well-studied PR-1 gene. These results facilitate the selection of desirable reference genes for more accurate gene expression studies in virus-infected monocots. Copyright © 2013 Elsevier B.V. All rights reserved.

Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

PubMed

Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

2013-01-01

Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

Role of IKK-alpha in EGFR Signaling Regulation

DTIC Science & Technology

2013-09-01

correlated with IKKα expression using CCLE. Nonsupervised hierarchical clustering analysis was performed based on Erbb2, ERα ( ESR1 ), PR (PgR...signature (ERBB2, ESR1 , and PGR) genes. A subset of 4 genes showing distinct expression pattern in TNBC versus non-TNBC cell lines is shown in the...AKT2 AKT3 CDH1 MYB CDH2 VIM ERBB2 ESR1 PGR H C C 11 87 C A L- 85 -1 H C C 11 43 H D Q -P 1 C A L- 51 H C C 38 H C C 21 57 C A L- 12 0 B T- 54 9 H C C

The induction of tomato leucine aminopeptidase genes (LapA) after Pseudomonas syringae pv. tomato infection is primarily a wound response triggered by coronatine.

PubMed

Pautot, V; Holzer, F M; Chaufaux, J; Walling, L L

2001-02-01

Tomato plants constitutively express a neutral leucine aminopeptidase (LAP-N) and an acidic LAP (LAP-A) during floral development and in leaves in response to insect infestation, wounding, and Pseudomonas syringae pv. tomato infection. To assess the physiological roles of LAP-A, a LapA-antisense construct (35S:asLapA1) was introduced into tomato. The 35S:asLapA1 plants had greatly reduced or showed undetectable levels of LAP-A and LAP-N proteins in healthy and wounded leaves and during floral development. Despite the loss of these aminopeptidases, no global changes in protein profiles were noted. The 35S:asLapA1 plants also exhibited no significant alteration in floral development and did not impact the growth and development of Manduca sexta and P. syringae pv. tomato growth rates during compatible or incompatible infections. To investigate the mechanism underlying the strong induction of LapA upon P. syringae pv. tomato infection, LapA expression was monitored after infection with coronatine-producing and -deficient P. syringae pv. tomato strains. LapA RNA and activity were detected only with the coronatine-producing P. syringae pv. tomato strain. Coronatine treatment of excised shoots caused increases in RNAs for jasmonic acid (JA)-regulated wound-response genes (LapA and pin2) but did not influence expression of a JA-regulated pathogenesis-related protein gene (PR-1). These results indicated that coronatine mimicked the wound response but was insufficient to activate JA-regulated PR genes.

Growth regulation by estrogen in breast cancer 1 (GREB1) is a novel progesterone-responsive gene required for human endometrial stromal decidualization.

PubMed

Camden, Alison J; Szwarc, Maria M; Chadchan, Sangappa B; DeMayo, Francesco J; O'Malley, Bert W; Lydon, John P; Kommagani, Ramakrishna

2017-09-01

Is Growth Regulation by Estrogen in Breast Cancer 1 (GREB1) required for progesterone-driven endometrial stromal cell decidualization? GREB1 is a novel progesterone-responsive gene required for progesterone-driven human endometrial stromal cell (HESC) decidualization. Successful establishment of pregnancy requires HESCs to transform from fibroblastic to epithelioid cells in a process called decidualization. This process depends on the hormone progesterone, but the molecular mechanisms by which it occurs have not been determined. Primary and transformed HESCs in which GREB1 expression was knocked down were decidualized in culture for up to 6 days. Wild-type and progesterone receptor (PR) knockout mice were treated with progesterone, and their uteri were assessed for levels of GREB1 expression. Analysis of previous data included data mining of expression profile data sets and in silico transcription factor-binding analysis. Endometrial biopsies obtained from healthy women of reproductive age during the proliferative phase (Days 8-12) of their menstrual cycle were used for isolating HESCs. Experiments were carried out with early passage (no more than four passages) HESCs isolated from at least three subjects. Transcript levels of decidualization markers prolactin (PRL) and insulin-like growth factor-binding protein-1 (IGFBP-1) were detected by quantitative RT-PCR as readouts for HESC decidualization. Cells were also imaged by phase-contrast microscopy. To assess the requirement for GREB1, PR and SRC-2, cells were transfected with specifically targeted small interfering RNAs. Results are shown as mean and SE from three replicates of one representative patient-derived primary endometrial cell line. Experiments were also conducted with transformed HESCs. Progesterone treatment of mice and transformed HESCs led to an ~5-fold (5.6 ± 0.81, P < 0.05, and 5.2 ± 0.26, P < 0.01, respectively) increase in GREB1 transcript levels. This increase was significantly reduced in the uteri of PR knock-out mice (P < 0.01), in HESCs treated with the PR antagonist RU486 (P < 0.01), or in HESCs in which PR expression was knocked down (P < 0.05). When GREB1 expression was knocked down, progesterone-driven decidualization markers in both immortalized and primary HESCs was significantly reduced (P < 0.05 and P < 0.01). Finally, GREB1 knock down signficantly reduced expression of the PR target genes WNT4 and FOXOA1 (P < 0.05 and P < 0.01, respectively). This study used the Nuclear Receptor Signaling Atlas. Although in vitro cell culture studies indicate that GREB1 is required for endoemtrial decidualization, the in vivo role of GREB1 in endometrial function and dysfunction should be assessed by using knock-out mouse models. Identification and functional analysis of GREB1 as a key molecular mediator of decidualization may lead to improved diagnosis and clinical management of women with peri-implantation loss due to inadequate endometrial decidualization. This research was funded in part by: a National Institutes of Health (NIH)/ National Institute of Child Health and Human Development (NICHD) grant (R00 HD080742) and Washington University School of Medicine start-up funds to R.K., an NIH/NICHD grant (RO1 HD-07857) to B.W.O.M., and a NIH/NICHD grant (R01 HD-042311) to J.P.L. The authors declare no conflicts of interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Progesterone action in breast, uterine, and ovarian cancers

PubMed Central

Diep, Caroline H.; Daniel, Andrea R.; Mauro, Laura J.; Knutson, Todd P.; Lange, Carol A.

2015-01-01

Progesterone and progesterone receptors (PR) are essential for the development and cyclical regulation of hormone-responsive tissues including the breast and reproductive tract. Altered functions of PR isoforms contribute to the pathogenesis of tumors that arise in these tissues. In the breast, progesterone acts in concert with estrogen to promote proliferative and pro-survival gene programs. In sharp contrast, progesterone inhibits estrogen-driven growth in the uterus and protects the ovary from neoplastic transformation. Progesterone-dependent actions and associated biology in diverse tissues and tumors are mediated by two progesterone receptor isoforms, PR-A and PR-B. These isoforms are subject to altered transcriptional activity or expression levels, differential cross-talk with growth factor signaling pathways, and distinct post-translational modifications and cofactor binding partners. Herein, we summarize and discuss the recent literature focused on progesterone and PR isoform-specific actions in breast, uterine, and ovarian cancers. Understanding the complexity of context-dependent PR actions in these tissues is critical to developing new models that will allow us to advance our knowledge base with the goal of revealing novel and efficacious therapeutic regimens for these hormone-responsive diseases. PMID:25587053

SlMAPK3 enhances tolerance to tomato yellow leaf curl virus (TYLCV) by regulating salicylic acid and jasmonic acid signaling in tomato (Solanum lycopersicum)

PubMed Central

Li, Yunzhou; Qin, Lei; Zhao, Jingjing; Muhammad, Tayeb; Cao, Hehe; Li, Hailiang; Zhang, Yan; Liang, Yan

2017-01-01

Several recent studies have reported on the role of mitogen-activated protein kinase (MAPK3) in plant immune responses. However, little is known about how MAPK3 functions in tomato (Solanum lycopersicum L.) infected with tomato yellow leaf curl virus (TYLCV). There is also uncertainty about the connection between plant MAPK3 and the salicylic acid (SA) and jasmonic acid (JA) defense-signaling pathways. The results of this study indicated that SlMAPK3 participates in the antiviral response against TYLCV. Tomato seedlings were inoculated with TYLCV to investigate the possible roles of SlMAPK1, SlMAPK2, and SlMAPK3 against this virus. Inoculation with TYLCV strongly induced the expression and the activity of all three genes. Silencing of SlMAPK1, SlMAPK2, and SlMAPK3 reduced tolerance to TYLCV, increased leaf H2O2 concentrations, and attenuated expression of defense-related genes after TYLCV infection, especially in SlMAPK3-silenced plants. Exogenous SA and methyl jasmonic acid (MeJA) both significantly induced SlMAPK3 expression in tomato leaves. Over-expression of SlMAPK3 increased the transcript levels of SA/JA-mediated defense-related genes (PR1, PR1b/SlLapA, SlPI-I, and SlPI-II) and enhanced tolerance to TYLCV. After TYLCV inoculation, the leaves of SlMAPK3 over-expressed plants compared with wild type plants showed less H2O2 accumulation and greater superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) activity. Overall, the results suggested that SlMAPK3 participates in the antiviral response of tomato to TYLCV, and that this process may be through either the SA or JA defense-signaling pathways. PMID:28222174

SlMAPK3 enhances tolerance to tomato yellow leaf curl virus (TYLCV) by regulating salicylic acid and jasmonic acid signaling in tomato (Solanum lycopersicum).

PubMed

Li, Yunzhou; Qin, Lei; Zhao, Jingjing; Muhammad, Tayeb; Cao, Hehe; Li, Hailiang; Zhang, Yan; Liang, Yan

2017-01-01

Several recent studies have reported on the role of mitogen-activated protein kinase (MAPK3) in plant immune responses. However, little is known about how MAPK3 functions in tomato (Solanum lycopersicum L.) infected with tomato yellow leaf curl virus (TYLCV). There is also uncertainty about the connection between plant MAPK3 and the salicylic acid (SA) and jasmonic acid (JA) defense-signaling pathways. The results of this study indicated that SlMAPK3 participates in the antiviral response against TYLCV. Tomato seedlings were inoculated with TYLCV to investigate the possible roles of SlMAPK1, SlMAPK2, and SlMAPK3 against this virus. Inoculation with TYLCV strongly induced the expression and the activity of all three genes. Silencing of SlMAPK1, SlMAPK2, and SlMAPK3 reduced tolerance to TYLCV, increased leaf H2O2 concentrations, and attenuated expression of defense-related genes after TYLCV infection, especially in SlMAPK3-silenced plants. Exogenous SA and methyl jasmonic acid (MeJA) both significantly induced SlMAPK3 expression in tomato leaves. Over-expression of SlMAPK3 increased the transcript levels of SA/JA-mediated defense-related genes (PR1, PR1b/SlLapA, SlPI-I, and SlPI-II) and enhanced tolerance to TYLCV. After TYLCV inoculation, the leaves of SlMAPK3 over-expressed plants compared with wild type plants showed less H2O2 accumulation and greater superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) activity. Overall, the results suggested that SlMAPK3 participates in the antiviral response of tomato to TYLCV, and that this process may be through either the SA or JA defense-signaling pathways.

Ethylene-responsive genes are differentially regulated during abscission, organ senescence and wounding in peach (Prunus persica).

PubMed

Ruperti, Benedetto; Cattivelli, Luigi; Pagni, Silvana; Ramina, Angelo

2002-03-01

Ethylene-responsive genes from peach (Prunus persica, L. Batsch) were isolated by differential screening of a cDNA library constructed from abscission zones in which cell separation had been evoked by treatment with the ethylene analogue propylene. DNA and deduced protein sequences of four selected clones, termed Prunus persica Abscission zone (PpAz), revealed homology to thaumatin-like proteins (PpAz8 and PpAz44), to proteins belonging to the PR4 class of pathogenesis-related (PR) proteins (PpAz89), and to fungal and plant beta-D-xylosidases (PpAz152). Expression analyses conducted on embrioctomized and CEPA-treated fruitlets as well as on fruit explants have shown that PpAz8, PpAz44 and PpAz89 are preferentially transcribed in the cells of the fruit abscission zone rather than in the non-zone tissues. The PpAz152 transcript showed a different accumulation pattern being consistently and promptly induced by wounding and only slightly stimulated by propylene. By contrast, a complex pattern of transcript accumulation was found for the four genes in response to the wounding of leaves and during organ development and senescence. Based on this evidence, the existence of multiple regulatory pathways underlying the differential expression of the four PpAz genes in the different tissues and physiological processes is hypothesized.

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

Effect of maternal protein restriction during pregnancy and postweaning high-fat feeding on diet-induced thermogenesis in adult mouse offspring.

PubMed

Sellayah, Dyan; Dib, Lea; Anthony, Frederick W; Watkins, Adam J; Fleming, Tom P; Hanson, Mark A; Cagampang, Felino R

2014-10-01

Prenatal undernutrition followed by postweaning feeding of a high-fat diet results in obesity in the adult offspring. In this study, we investigated whether diet-induced thermogenesis is altered as a result of such nutritional mismatch. Female MF-1 mice were fed a normal protein (NP, 18% casein) or a protein-restricted (PR, 9% casein) diet throughout pregnancy and lactation. After weaning, male offspring of both groups were fed either a high-fat diet (HF; 45% kcal fat) or standard chow (C, 7% kcal fat) to generate the NP/C, NP/HF, PR/C and PR/HF adult offspring groups (n = 7-11 per group). PR/C and NP/C offspring have similar body weights at 30 weeks of age. Postweaning HF feeding resulted in significantly heavier NP/HF offspring (P < 0.01), but not in PR/HF offspring, compared with their chow-fed counterparts. However, the PR/HF offspring exhibited greater adiposity (P < 0.01) v the NP/HF group. The NP/HF offspring had increased energy expenditure and increased mRNA expression of uncoupling protein-1 and β-3 adrenergic receptor in the interscapular brown adipose tissue (iBAT) compared with the NP/C mice (both at P < 0.01). No such differences in energy expenditure and iBAT gene expression were observed between the PR/HF and PR/C offspring. These data suggest that a mismatch between maternal diet during pregnancy and lactation, and the postweaning diet of the offspring, can attenuate diet-induced thermogenesis in the iBAT, resulting in the development of obesity in adulthood.

LIF supports primitive endoderm expansion during pre-implantation development.

PubMed

Morgani, Sophie M; Brickman, Joshua M

2015-10-15

Embryonic stem cells (ESCs) are pluripotent cell lines that can be maintained indefinitely in an early developmental state. ESC culture conditions almost always require the cytokine LIF to maintain self-renewal. As ESCs are not homogeneous but contain multiple populations reminiscent of the blastocyst, identifying the target cells of LIF is necessary to understand the propagation of pluripotency. We recently found that LIF acts under self-renewing conditions to stimulate the fraction of ESCs that express extraembryonic markers, but has little impact on pluripotent gene expression. Here, we report that LIF has two distinct roles: it blocks early epiblast (Epi) differentiation, and it supports the expansion of primitive endoderm (PrE)-primed ESCs and PrE in vivo. We find that activation of JAK/STAT signalling downstream of LIF occurs initially throughout the pre-implantation embryo, but later marks the PrE. Moreover, the addition of LIF to cultured embryos increases the GATA6(+) PrE population, whereas inhibition of JAK/STAT signalling reduces both NANOG(+) epiblast and GATA6(+) PrE. The reduction of the NANOG(+) Epi might be explained by its precocious differentiation to later Epi derivatives, whereas the increase in PrE is mediated both by an increase in proliferation and inhibition of PrE apoptosis that is normally triggered in embryos with an excess of GATA6(+) cells. Thus, it appears that the relative size of the PrE is determined by the number of LIF-producing cells in the embryo. This suggests a mechanism by which the embryo adjusts the relative ratio of the primary lineages in response to experimental manipulation. © 2015. Published by The Company of Biologists Ltd.

Arabidopsis serotonin N-acetyltransferase knockout mutant plants exhibit decreased melatonin and salicylic acid levels resulting in susceptibility to an avirulent pathogen.

PubMed

Lee, Hyoung Yool; Byeon, Yeong; Tan, Dun-Xian; Reiter, Russel J; Back, Kyoungwhan

2015-04-01

Serotonin N-acetyltransferase (SNAT) is the penultimate enzyme in the melatonin biosynthesis pathway in plants. We examined the effects of SNAT gene inactivation in two Arabidopsis T-DNA insertion mutant lines. After inoculation with the avirulent pathogen Pseudomonas syringe pv. tomato DC3000 harboring the elicitor avrRpt2 (Pst-avrRpt2), melatonin levels in the snat knockout mutant lines were 50% less than in wild-type Arabidopsis Col-0 plants. The snat knockout mutant lines exhibited susceptibility to pathogen infection that coincided with decreased induction of defense genes including PR1, ICS1, and PDF1.2. Because melatonin acts upstream of salicylic acid (SA) synthesis, the reduced melatonin levels in the snat mutant lines led to decreased SA levels compared to wild-type, suggesting that the increased pathogen susceptibility of the snat mutant lines could be attributed to decreased SA levels and subsequent attenuation of defense gene induction. Exogenous melatonin treatment failed to induce defense gene expression in nahG Arabidopsis plants, but restored the induction of defense gene expression in the snat mutant lines. In addition, melatonin caused translocation of NPR1 (nonexpressor of PR1) protein from the cytoplasm into the nucleus indicating that melatonin-elicited pathogen resistance in response to avirulent pathogen attack is SA-dependent in Arabidopsis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Tight junction gene expression in gastrointestinal tract of dairy calves with coccidiosis and treated with glucagon-like peptide-2

USDA-ARS?s Scientific Manuscript database

Selective permeability of the intestinal epithelium and efficient nutrient absorption are important functions for proper growth and development of calves. Damage to the intestinal mucosa can give rise to harmful long-term health effects and reduce productivity of the mature animal. Tight junction pr...

The TREM2 variant p.R47H is a risk factor for sporadic amyotrophic lateral sclerosis

PubMed Central

Cady, Janet; Koval, Erica D.; Benitez, Bruno A.; Zaidman, Craig; Jockel-Balsarotti, Jennifer; Allred, Peggy; Baloh, Robert H.; Ravits, John; Simpson, Ericka; Appel, Stanley H.; Pestronk, Alan; Goate, Alison M.; Miller, Timothy M.; Cruchaga, Carlos; Harms, Matthew B.

2014-01-01

Importance Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which microglia play a significant and active role. Recently, a rare missense variant (p.R47H) in the microglial activating gene TREM2 was found to increase the risk of several neurodegenerative diseases, including Alzheimer’s disease. Whether the p.R47H variant is a risk factor for ALS is not currently known. Objective To determine if p.R47H (rs75932628) in TREM2 is a risk factor for ALS and assess whether TREM2 expression is dysregulated in disease. Design, setting, and participants 923 sporadic ALS subjects and 1854 normal controls self-reported as non-Hispanic white were collected from ALS clinics in the United States and genotyped for the p.R47H variant in TREM2. Clinical data was obtained on ALS subjects for genotype/phenotype correlations. Expression of TREM2 was measured by quantitative PCR and compared in spinal cord from 18 ALS subjects, 12 neurologically normal controls, as well as from wildtype and transgenic SOD1G93A mice. Main outcome measures Minor allele frequency of rs75932628 and relative expression of TREM2. Results The TREM2 variant p. R47H was more common in subject with ALS than in controls and is therefore a significant risk factor for ALS (OR=2.40; 95%CI=1.29-4.15; p=4.1×10-3). Furthermore, TREM2 expression was increased in spinal cords from ALS patients and SOD1G93A mice (p=2.8×10-4, p=2.8×10-9 respectively), confirming dysregulated TREM2 in disease. TREM2 expression in human spinal cord was negatively correlated with survival (p=0.04), but not other phenotypic aspects of disease. Conclusion and relevance This study demonstrates that the TREM2 p.R47H variant is a potent risk factor for sporadic amyotrophic lateral sclerosis. These findings identify the first genetic influence on neuro-inflammation in ALS and highlight the TREM2 signaling pathway as a therapeutic target in ALS and other neurodegenerative diseases. PMID:24535663

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

PubMed

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Exploring of the molecular mechanism of rhinitis via bioinformatics methods

PubMed Central

Song, Yufen; Yan, Zhaohui

2018-01-01

The aim of this study was to analyze gene expression profiles for exploring the function and regulatory network of differentially expressed genes (DEGs) in pathogenesis of rhinitis by a bioinformatics method. The gene expression profile of GSE43523 was downloaded from the Gene Expression Omnibus database. The dataset contained 7 seasonal allergic rhinitis samples and 5 non-allergic normal samples. DEGs between rhinitis samples and normal samples were identified via the limma package of R. The webGestal database was used to identify enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of the DEGs. The differentially co-expressed pairs of the DEGs were identified via the DCGL package in R, and the differential co-expression network was constructed based on these pairs. A protein-protein interaction (PPI) network of the DEGs was constructed based on the Search Tool for the Retrieval of Interacting Genes database. A total of 263 DEGs were identified in rhinitis samples compared with normal samples, including 125 downregulated ones and 138 upregulated ones. The DEGs were enriched in 7 KEGG pathways. 308 differential co-expression gene pairs were obtained. A differential co-expression network was constructed, containing 212 nodes. In total, 148 PPI pairs of the DEGs were identified, and a PPI network was constructed based on these pairs. Bioinformatics methods could help us identify significant genes and pathways related to the pathogenesis of rhinitis. Steroid biosynthesis pathway and metabolic pathways might play important roles in the development of allergic rhinitis (AR). Genes such as CDC42 effector protein 5, solute carrier family 39 member A11 and PR/SET domain 10 might be also associated with the pathogenesis of AR, which provided references for the molecular mechanisms of AR. PMID:29257233

Erwinia amylovora Expresses Fast and Simultaneously hrp/dsp Virulence Genes during Flower Infection on Apple Trees

PubMed Central

Pester, Doris; Milčevičová, Renáta; Schaffer, Johann; Wilhelm, Eva; Blümel, Sylvia

2012-01-01

Background Pathogen entry through host blossoms is the predominant infection pathway of the Gram-negative bacterium Erwinia amylovora leading to manifestation of the disease fire blight. Like in other economically important plant pathogens, E. amylovora pathogenicity depends on a type III secretion system encoded by hrp genes. However, timing and transcriptional order of hrp gene expression during flower infections are unknown. Methodology/Principal Findings Using quantitative real-time PCR analyses, we addressed the questions of how fast, strong and uniform key hrp virulence genes and the effector dspA/E are expressed when bacteria enter flowers provided with the full defense mechanism of the apple plant. In non-invasive bacterial inoculations of apple flowers still attached to the tree, E. amylovora activated expression of key type III secretion genes in a narrow time window, mounting in a single expression peak of all investigated hrp/dspA/E genes around 24–48 h post inoculation (hpi). This single expression peak coincided with a single depression in the plant PR-1 expression at 24 hpi indicating transient manipulation of the salicylic acid pathway as one target of E. amylovora type III effectors. Expression of hrp/dspA/E genes was highly correlated to expression of the regulator hrpL and relative transcript abundances followed the ratio: hrpA>hrpN>hrpL>dspA/E. Acidic conditions (pH 4) in flower infections led to reduced virulence/effector gene expression without the typical expression peak observed under natural conditions (pH 7). Conclusion/Significance The simultaneous expression of hrpL, hrpA, hrpN, and the effector dspA/E during early floral infection indicates that speed and immediate effector transmission is important for successful plant invasion. When this delicate balance is disturbed, e.g., by acidic pH during infection, virulence gene expression is reduced, thus partly explaining the efficacy of acidification in fire blight control on a molecular level. PMID:22412891

Targeted next generation sequencing identifies functionally deleterious germline mutations in novel genes in early-onset/familial prostate cancer.

PubMed

Paulo, Paula; Maia, Sofia; Pinto, Carla; Pinto, Pedro; Monteiro, Augusta; Peixoto, Ana; Teixeira, Manuel R

2018-04-01

Considering that mutations in known prostate cancer (PrCa) predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS) in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.

Comparative Temporal Transcriptome Profiling of Wheat near Isogenic Line Carrying Lr57 under Compatible and Incompatible Interactions

PubMed Central

Yadav, Inderjit S.; Sharma, Amandeep; Kaur, Satinder; Nahar, Natasha; Bhardwaj, Subhash C.; Sharma, Tilak R.; Chhuneja, Parveen

2016-01-01

Leaf rust caused by Puccinia triticina (Pt) is one of the most important diseases of bread wheat globally. Recent advances in sequencing technologies have provided opportunities to analyse the complete transcriptomes of the host as well as pathogen for studying differential gene expression during infection. Pathogen induced differential gene expression was characterized in a near isogenic line carrying leaf rust resistance gene Lr57 and susceptible recipient genotype WL711. RNA samples were collected at five different time points 0, 12, 24, 48, and 72 h post inoculation (HPI) with Pt 77-5. A total of 3020 transcripts were differentially expressed with 1458 and 2692 transcripts in WL711 and WL711+Lr57, respectively. The highest number of differentially expressed transcripts was detected at 12 HPI. Functional categorization using Blast2GO classified the genes into biological processes, molecular function and cellular components. WL711+Lr57 showed much higher number of differentially expressed nucleotide binding and leucine rich repeat genes and expressed more protein kinases and pathogenesis related proteins such as chitinases, glucanases and other PR proteins as compared to susceptible genotype. Pathway annotation with KEGG categorized genes into 13 major classes with carbohydrate metabolism being the most prominent followed by amino acid, secondary metabolites, and nucleotide metabolism. Gene co-expression network analysis identified four and eight clusters of highly correlated genes in WL711 and WL711+Lr57, respectively. Comparative analysis of the differentially expressed transcripts led to the identification of some transcripts which were specifically expressed only in WL711+Lr57. It was apparent from the whole transcriptome sequencing that the resistance gene Lr57 directed the expression of different genes involved in building the resistance response in the host to combat invading pathogen. The RNAseq data and differentially expressed transcripts identified in present study is a genomic resource which can be used for further studying the host pathogen interaction for Lr57 and wheat transcriptome in general. PMID:28066494

Androgen receptor expression in the human vagina under different physiological and treatment conditions.

PubMed

Baldassarre, M; Perrone, A M; Giannone, F A; Armillotta, F; Battaglia, C; Costantino, A; Venturoli, S; Meriggiola, M C

2013-01-01

Recent data report an important role of testosterone (T) in modulating female sexual responses, but little is known about the expression and distribution of androgen receptor (AR) in the human vagina. Therefore, the aims of our study were to evaluate the expression of AR in the human vagina in premenopausal (PrM) and menopausal (M) women and in T-treated women. Vaginal biopsies were obtained from PrM and postmenopausal women and from women with gender identity disorder (female to male (FtM)) receiving exogenous T. AR gene and protein expression levels in vaginal tissues were determined by real-time PCR and western blot analysis, respectively, whereas the localization of AR in vaginal mucosa and stroma was performed by immunohistochemistry. ARs were detected by immunostaining both in the mucosa and stroma. In vaginal mucosa, AR density score decreases with age but does not change with T administration. In stromal tissue, AR density score does not change with age but significantly increases with T administration (P<0.01). AR protein expression was significantly increased in FtM subjects (P<0.001). The expression of AR messenger RNA (mRNA) evaluated by Real-time PCR showed a significantly higher mRNA expression in FtM versus M patients (P<0.01) and in PrM versus M subjects (P<0.05). In conclusion, we found AR protein and mRNA expression both in the epithelium and stroma of the human vagina in all groups of women. A negative correlation exists between age and AR expression in the vaginal mucosa. T administration increases AR expression in both the mucosa and stroma.

Detecting the Hormonal Pathways in Oilseed Rape behind Induced Systemic Resistance by Trichoderma harzianum TH12 to Sclerotinia sclerotiorum.

PubMed

Alkooranee, Jawadayn Talib; Aledan, Tamarah Raad; Ali, Ali Kadhim; Lu, Guangyuan; Zhang, Xuekun; Wu, Jiangsheng; Fu, Chunhua; Li, Maoteng

2017-01-01

Plants have the ability to resist pathogen attack after infection or treatment with biotic and abiotic elicitors. In oilseed rape plant Brassica napus AACC and in the artificially synthesized Raphanus alboglabra RRCC, the root-colonizing Trichoderma harzianum TH12 fungus triggers induced systemic resistance (ISR), and its culture filtrate (CF) triggers a systemic acquired resistance (SAR) response against infection by the Sclerotinia sclerotiorum. Salicylic acid (SA) and jasmonic acid/ethylene (JA/ET) are plant hormone signals that play important roles in the regulation of ISR and SAR. In this study, at six different time points (1, 2, 4, 6, 8 and 10 days post-infection [dpi]), six resistance genes were used as markers of signaling pathways: JA/ET signaling used AOC3, PDF1.2 and ERF2 genes, while PR-1, TGA5 and TGA6 genes were used as markers of SA signaling. The results of quantitative real-time polymerase chain reaction (qRT-PCR) showed that AOC3, PDF1.2 and ERF2 expression levels in infected leaves of AACC and RRCC increase at 1 and 2 dpi with S. sclerotiorum or inoculation with TH12. PR-1, TGA5 and TGA6 expression levels increased at 8 and 10 dpi in infected leaves. PR-1, TGA5 and TGA6 expression levels increased early in plants treated with CF in both of the healthy genotypes. Furthermore, induction of SA- and JA/ET-dependent defense decreased disease symptoms in infected leaves at different times. The results suggest that the RRCC genotype exhibits resistance to disease and that the ability of TH12 and its CF to induce systemic resistance in susceptible and resistant oilseed rape genotypes exists. In addition, the results indicate for the first time that in RRCC the SA signaling pathway is involved in resistance to necrotrophic pathogens.

Progestins Upregulate FKBP51 Expression in Human Endometrial Stromal Cells to Induce Functional Progesterone and Glucocorticoid Withdrawal: Implications for Contraceptive- Associated Abnormal Uterine Bleeding.

PubMed

Guzeloglu Kayisli, Ozlem; Kayisli, Umit A; Basar, Murat; Semerci, Nihan; Schatz, Frederick; Lockwood, Charles J

2015-01-01

Use of long-acting progestin only contraceptives (LAPCs) offers a discrete and highly effective family planning method. Abnormal uterine bleeding (AUB) is the major side effect of, and cause for, discontinuation of LAPCs. The endometria of LAPC-treated women display abnormally enlarged, fragile blood vessels, decreased endometrial blood flow and oxidative stress. To understanding to mechanisms underlying AUB, we propose to identify LAPC-modulated unique gene cluster(s) in human endometrial stromal cells (HESCs). Protein and RNA isolated from cultured HESCs treated 7 days with estradiol (E2) or E2+ medroxyprogesterone acetate (MPA) or E2+ etonogestrel (ETO) or E2+ progesterone (P4) were analyzed by quantitative Real-time (q)-PCR and immunoblotting. HSCORES were determined for immunostained-paired endometria of pre-and 3 months post-Depot MPA (DMPA) treated women and ovariectomized guinea pigs (GPs) treated with placebo or E2 or MPA or E2+MPA for 21 days. In HESCs, whole genome analysis identified a 67 gene group regulated by all three progestins, whereas a 235 gene group was regulated by E2+ETO and E2+MPA, but not E2+P4. Ingenuity pathway analysis identified glucocorticoid receptor (GR) activation as one of upstream regulators of the 235 MPA and ETO-specific genes. Among these, microarray results demonstrated significant enhancement of FKBP51, a repressor of PR/GR transcriptional activity, by both MPA and ETO. q-PCR and immunoblot analysis confirmed the microarray results. In endometria of post-DMPA versus pre-DMPA administered women, FKBP51 expression was significantly increased in endometrial stromal and glandular cells. In GPs, E2+MPA or MPA significantly increased FKBP51 immunoreactivity in endometrial stromal and glandular cells versus placebo- and E2-administered groups. MPA or ETO administration activates GR signaling and increases endometrial FKBP51 expression, which could be one of the mechanisms causing AUB by inhibiting PR and GR-mediated transcription. The resultant PR and/or GR-mediated functional withdrawal may contribute to associated endometrial inflammation, aberrant angiogenesis, and bleeding.

Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

2013-01-01

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

Involvement of plant endogenous ABA in Bacillus megaterium PGPR activity in tomato plants.

PubMed

Porcel, Rosa; Zamarreño, Ángel María; García-Mina, José María; Aroca, Ricardo

2014-01-25

Plant growth-promoting rhizobacteria (PGPR) are naturally occurring soil bacteria which benefit plants by improving plant productivity and immunity. The mechanisms involved in these processes include the regulation of plant hormone levels such as ethylene and abscisic acid (ABA). The aim of the present study was to determine whether the activity of Bacillus megaterium PGPR is affected by the endogenous ABA content of the host plant. The ABA-deficient tomato mutants flacca and sitiens and their near-isogenic wild-type parental lines were used. Growth, stomatal conductance, shoot hormone concentration, competition assay for colonization of tomato root tips, and root expression of plant genes expected to be modulated by ABA and PGPR were examined. Contrary to the wild-type plants in which PGPR stimulated growth rates, PGPR caused growth inhibition in ABA-deficient mutant plants. PGPR also triggered an over accumulation of ethylene in ABA-deficient plants which correlated with a higher expression of the pathogenesis-related gene Sl-PR1b. Positive correlation between over-accumulation of ethylene and a higher expression of Sl-PR1b in ABA-deficient mutant plants could indicate that maintenance of normal plant endogenous ABA content may be essential for the growth promoting action of B. megaterium by keeping low levels of ethylene production.

Prion potency in stem cells biology.

PubMed

Lopes, Marilene H; Santos, Tiago G

2012-01-01

Prion protein (PrP) can be considered a pivotal molecule because it interacts with several partners to perform a diverse range of critical biological functions that might differ in embryonic and adult cells. In recent years, there have been major advances in elucidating the putative role of PrP in the basic biology of stem cells in many different systems. Here, we review the evidence indicating that PrP is a key molecule involved in driving different aspects of the potency of embryonic and tissue-specific stem cells in self-perpetuation and differentiation in many cell types. It has been shown that PrP is involved in stem cell self-renewal, controlling pluripotency gene expression, proliferation, and neural and cardiomyocyte differentiation. PrP also has essential roles in distinct processes that regulate tissue-specific stem cell biology in nervous and hematopoietic systems and during muscle regeneration. Results from our own investigations have shown that PrP is able to modulate self-renewal and proliferation in neural stem cells, processes that are enhanced by PrP interactions with stress inducible protein 1 (STI1). Thus, the available data reveal the influence of PrP in acting upon the maintenance of pluripotent status or the differentiation of stem cells from the early embryogenesis through adulthood.

TITER AND PRODUCT AFFECTS THE DISTRIBUTION OF GENE EXPRESSION AFTER INTRAPUTAMINAL CONVECTION-ENHANCED DELIVERY

PubMed Central

Emborg, Marina E.; Hurley, Samuel A.; Joers, Valerie; Tromp, Do P.M.; Swanson, Christine R.; Ohshima-Hosoyama, Sachiko; Bondarenko, Viktorya; Cummisford, Kyle; Sonnemans, Marc; Hermening, Stephan; Blits, Bas; Alexander, Andrew L.

2014-01-01

Background Efficacy and safety of intracerebral gene therapy for brain disorders, like Parkinson’s disease, depends on appropriate distribution of gene expression. Objectives To assess if the distribution of gene expression is affected by vector titer and protein type. Methods Four adult macaque monkeys seronegative for adeno-associated virus 5 (AAV5) received in the right and left ventral postcommisural putamen 30μl inoculation of a high or low titer suspension of AAV5 encoding glial derived neurotrophic factor (GDNF) or green fluorescent protein (GFP). Inoculations were performed using convection enhanced delivery and intraoperative MRI (IMRI). Results IMRI confirmed targeting and infusion cloud irradiating from the catheter tip into surrounding area. Postmortem analysis six weeks after surgery revealed GFP and GDNF expression ipsilateral to the injection side that had a titer-dependent distribution. GFP and GDNF expression was also observed in fibers in the Substantia Nigra (SN) pars reticulata (pr), demonstrating anterograde transport. Few GFP-positive neurons were present in the SN pars compacta (pc), possibly by direct retrograde transport of the vector. GDNF was present in many SNpc and SNpr neurons. Conclusions After controlling for target and infusate volume, intracerebral distribution of gene product is affected by vector titer and product biology. PMID:24943657

One-Carbon Metabolism and Breast Cancer Survival in a Population-Based Study

DTIC Science & Technology

2005-06-01

etc.) but also is a primary target for treatment of the disease (e.g. 5-FU, methotrexate , etc.). We propose to utilize the resources of the Long...influencing methylation of prognosis- related genes . Results from this study would help clarify mechanisms of disease progression as well as contribute to the...group for regulating expression of genes that have prognostic values (e.g. ER, PR, BRCA1, etc.) but also is a primary target for treatment of the disease

The PROGINS polymorphism of the human progesterone receptor diminishes the response to progesterone.

PubMed

Romano, Andrea; Delvoux, Bert; Fischer, Dagmar-Christiane; Groothuis, Patrick

2007-02-01

The human progesterone receptor (PR) is a ligand-dependent transcription factor and two isoforms, (PRA and PRB), can be distinguished. PROGINS, a PR polymorphic variant, affects PRA and PRB and acts as a risk-modulating factor in several gynaecological disorders. Little is known about the functional consequences of this variant. Here, we characterise the properties of PROGINS with respect to transcription, mRNA maturation, protein activity and proliferation. PROGINS is characterised by a 320 bp PV/HS-1 Alu insertion in intron G and two point mutations, V660L in exon 4 and H770H (silent substitution) in exon 5. The Alu element contains a half oestrogen-response element/Sp1-binding site (Alu-ERE/Sp1), which acts as an in-cis intronic enhancer leading to increased transcription of the PROGINS allele in response to 17beta-oestradiol. Moreover, Alu insertions in the human genome are frequently methylated. Our data indicate that the PROGINS-Alu does not affect gene transcription due to DNA methylation. However, the Alu element reduced the stability of the PROGINS transcript compared with the CP allele and does not generate splice variants. The amino acid substitution (V600L) in exon 4 leads to differences in PR phosphorylation and degradation in the two PR variants upon ligand binding, most likely as a result of differences in the three-dimensional structures of the two PR variants. As a consequence, the PR-L660 (PROGINS) variant (1) displays decreased transactivation activity in a luciferase reporter system and (2) is less efficient in opposing cell proliferation in hamster ovarian cells expressing human PRA, when compared with the PR-V660 (most common variant). Taken together, our results indicate that the PROGINS variant of PR is less responsive to progestin compared with the most common PR because of (i) reduced amounts of gene transcript and (ii) decreased protein activity.

Epigenetic silencing of triple negative breast cancer hallmarks by Withaferin A.

PubMed

Szarc Vel Szic, Katarzyna; Declerck, Ken; Crans, René A J; Diddens, Jolien; Scherf, David B; Gerhäuser, Clarissa; Vanden Berghe, Wim

2017-06-20

Triple negative breast cancer (TNBC) is characterized by poor prognosis and a DNA hypomethylation profile. Withaferin A (WA) is a plant derived steroidal lactone which holds promise as a therapeutic agent for treatment of breast cancer (BC). We determined genome-wide DNA methylation changes in weakly-metastatic and aggressive, metastatic BC cell lines, following 72h treatment to a sub-cytotoxic concentration of WA. In contrast to the DNA demethylating agent 5-aza-2'-deoxycytidine (DAC), WA treatment of MDA-MB-231 cells rather tackles an epigenetic cancer network through gene-specific DNA hypermethylation of tumor promoting genes including ADAM metallopeptidase domain 8 (ADAM8), urokinase-type plasminogen activator (PLAU), tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), and genes related to detoxification (glutathione S-transferase mu 1, GSTM1), or mitochondrial metabolism (malic enzyme 3, ME3). Gene expression and pathway enrichment analysis further reveals epigenetic suppression of multiple cancer hallmarks associated with cell cycle regulation, cell death, cancer cell metabolism, cell motility and metastasis. Remarkably, DNA hypermethylation of corresponding CpG sites in PLAU, ADAM8, TNSF12, GSTM1 and ME3 genes correlates with receptor tyrosine-protein kinase erbB-2 amplification (HER2)/estrogen receptor (ESR)/progesterone receptor (PR) status in primary BC tumors. Moreover, upon comparing differentially methylated WA responsive target genes with DNA methylation changes in different clinical subtypes of breast cancer patients in the cancer genome atlas (TCGA), we found that WA silences HER2/PR/ESR-dependent gene expression programs to suppress aggressive TNBC characteristics in favor of luminal BC hallmarks, with an improved therapeutic sensitivity. In this respect, WA may represent a novel and attractive phyto-pharmaceutical for TNBC treatment.

PrPC expression and prion seeding activity in the alimentary tract and lymphoid tissue of deer

PubMed Central

Davenport, Kristen A.; Hoover, Clare E.; Bian, Jifeng; Telling, Glenn C.; Mathiason, Candace K.; Hoover, Edward A.

2017-01-01

The agent responsible for prion diseases is a misfolded form of a normal protein (PrPC). The prion hypothesis stipulates that PrPC must be present for the disease to manifest. Cervid populations across the world are infected with chronic wasting disease, a horizontally-transmissible prion disease that is likely spread via oral exposure to infectious prions (PrPCWD). Though PrPCWD has been identified in many tissues, there has been little effort to characterize the overall PrPC expression in cervids and its relationship to PrPCWD accumulation. We used immunohistochemistry (IHC), western blot and enzyme-linked immunosorbent assay to describe PrPC expression in naïve white-tailed deer. We used real-time, quaking-induced conversion (RT-QuIC) to detect prion seeding activity in CWD-infected deer. We assessed tissues comprising the alimentary tract, alimentary-associated lymphoid tissue and systemic lymphoid tissue from 5 naïve deer. PrPC was expressed in all tissues, though expression was often very low compared to the level in the CNS. IHC identified specific cell types wherein PrPC expression is very high. To compare the distribution of PrPC to PrPCWD, we examined 5 deer with advanced CWD infection. Using RT-QuIC, we detected prion seeding activity in all 21 tissues. In 3 subclinical deer sacrificed 4 months post-inoculation, we detected PrPCWD consistently in alimentary-associated lymphoid tissue, irregularly in alimentary tract tissues, and not at all in the brain. Contrary to our hypothesis that PrPC levels dictate prion accumulation, PrPC expression was higher in the lower gastrointestinal tissues than in the alimentary-associated lymphoid system and was higher in salivary glands than in the oropharyngeal lymphoid tissue. These data suggest that PrPC expression is not the sole driver of prion accumulation and that alimentary tract tissues accumulate prions before centrifugal spread from the brain occurs. PMID:28880938

Expression of pathogenesis-related protein PR-10 in sorghum floral tissues in response to inoculation with Fusarium thapsinum and Curvularia lunata

USDA-ARS?s Scientific Manuscript database

Differences in grain mold levels among different sorghum varieties grown in the same environment imply that genes play a role in controlling mold severity. The fungi most often recovered from naturally infected sorghum grain, Fusarium thapsinum and Curvularia lunata, were inoculated on a set of res...

Evaluations of methods for the isolation of high quality RNA from bovine and cervine hide biopsies for use in gene expression studies

USDA-ARS?s Scientific Manuscript database

Molecular investigations of the ruminant response to ectoparasites at the parasite-host interface are critically dependent upon the quality of RNA. The complexity of ruminant skin decreases the capacity to obtain high quality RNA from biopsy samples, which directly affects the reliability of data pr...

Characterization of Vitis vinifera NPR1 homologs involved in the regulation of Pathogenesis-Related gene expression

PubMed Central

Le Henanff, Gaëlle; Heitz, Thierry; Mestre, Pere; Mutterer, Jerôme; Walter, Bernard; Chong, Julie

2009-01-01

Background Grapevine protection against diseases needs alternative strategies to the use of phytochemicals, implying a thorough knowledge of innate defense mechanisms. However, signalling pathways and regulatory elements leading to induction of defense responses have yet to be characterized in this species. In order to study defense response signalling to pathogens in Vitis vinifera, we took advantage of its recently completed genome sequence to characterize two putative orthologs of NPR1, a key player in salicylic acid (SA)-mediated resistance to biotrophic pathogens in Arabidopsis thaliana. Results Two cDNAs named VvNPR1.1 and VvNPR1.2 were isolated from Vitis vinifera cv Chardonnay, encoding proteins showing 55% and 40% identity to Arabidopsis NPR1 respectively. Constitutive expression of VvNPR1.1 and VvNPR1.2 monitored in leaves of V. vinifera cv Chardonnay was found to be enhanced by treatment with benzothiadiazole, a SA analog. In contrast, VvNPR1.1 and VvNPR1.2 transcript levels were not affected during infection of resistant Vitis riparia or susceptible V. vinifera with Plasmopara viticola, the causal agent of downy mildew, suggesting regulation of VvNPR1 activity at the protein level. VvNPR1.1-GFP and VvNPR1.2-GFP fusion proteins were transiently expressed by agroinfiltration in Nicotiana benthamiana leaves, where they localized predominantly to the nucleus. In this system, VvNPR1.1 and VvNPR1.2 expression was sufficient to trigger the accumulation of acidic SA-dependent Pathogenesis-Related proteins PR1 and PR2, but not of basic chitinases (PR3) in the absence of pathogen infection. Interestingly, when VvNPR1.1 or AtNPR1 were transiently overexpressed in Vitis vinifera leaves, the induction of grapevine PR1 was significantly enhanced in response to P. viticola. Conclusion In conclusion, our data identified grapevine homologs of NPR1, and their functional analysis showed that VvNPR1.1 and VvNPR1.2 likely control the expression of SA-dependent defense genes. Overexpression of VvNPR1 has thus the potential to enhance grapevine defensive capabilities upon fungal infection. As a consequence, manipulating VvNPR1 and other signalling elements could open ways to strengthen disease resistance mechanisms in this crop species. PMID:19432948

A peptidogalactomannan isolated from Cladosporium herbarum induces defense-related genes in BY-2 tobacco cells.

PubMed

Mattos, Bianca Braz; Montebianco, Caroline; Romanel, Elisson; da Franca Silva, Tatiane; Bernabé, Renato Barroso; Simas-Tosin, Fernanda; Souza, Lauro M; Sassaki, Guilherme L; Vaslin, Maite F S; Barreto-Bergter, Eliana

2018-05-01

Cladosporium herbarum is a plant pathogen associated with passion fruit scab and mild diseases in pea and soybean. In this study, a peptidogalactomannan (pGM) of C. herbarum mycelium was isolated and structurally characterized, and its role in plant-fungus interactions was evaluated. C. herbarum pGM is composed of carbohydrates (76%) and contains mannose, galactose and glucose as its main monosaccharides (molar ratio, 52:36:12). Methylation and 13 C-nuclear magnetic resonance ( 13 C-NMR) spectroscopy analysis have shown the presence of a main chain containing (1 → 6)-linked α-D-Manp residues, and β-D-Galf residues are present as (1 → 5)-interlinked side chains. β-Galactofuranose containing similar structures were characterized by our group in A. fumigatus, A. versicolor, A. flavus and C. resinae. Tobacco BY-2 cells were used as a model system to address the question of the role of C. herbarum pGM in cell viability and induction of the expression of plant defense-related genes. Native and partially acid hydrolyzed pGMs (lacking galactofuranosyl side-chain residues) were incubated with BY-2 cell suspensions at different concentrations. Cell viability drastically decreased after exposure to more than 400 μg ml -1 pGM; however no cell viability effect was observed after exposure to a partially acid hydrolyzed pGM. BY-2 cell contact with pGM strongly induce the expression of plant defense-related genes, such as phenylalanine ammonia lyase (PAL) and lipoxygenase (LOX), as well as the pathogen-related PR-1a, PR-2 and PR-3 genes, suggesting that pGM activates defense responses in tobacco cells. Interestingly, contact with partially hydrolyzed pGM also induced defense-related gene expression at earlier times than native pGM. These results show that the side chains of the (1 → 5)-linked β-D-galactofuranosyl units from pGM play an important role in the first line fungus-plant interactions mediating plant responses against C. herbarum. In addition, it was observed that pGM and/or C. herbarum conidia are able to induced HR when in contact with tobacco leaves and in vitro plantlets roots, producing necrotic lesions and peroxidase and NO burst, respectively. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

PubMed

Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

2010-01-01

Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

Estrogen receptor-α, progesterone receptor, and c-erbB/HER-family receptor mRNA detection and phenotype analysis in spontaneous canine models of breast cancer

PubMed Central

Kabir, Farruk M. Lutful; DeInnocentes, Patricia; Agarwal, Payal; Mill, Christopher P.; Riese, David J.

2017-01-01

Well characterized, stable, p16-defective canine mammary cancer (CMT) cell lines and normal canine mammary epithelial cells were used to investigate expression of the major breast cancer-specific hormone receptors estrogen receptor alpha (ER1) and progesterone receptor (PR) as well as luminal epithelial-specific proto-oncogenes encoding c-erbB-1 (epidermal growth factor receptor/EGFr), c-erbB-2/HER2, c-erbB-3, and c-erbB-4 receptors. The investigation developed and validated quantitative reverse transcriptase polymerase chain reaction assays for each transcript to provide rapid assessment of breast cancer phenotypes for canine cancers, based on ER1, PR, and c-erbB-2/HER2 expressions, similar to those in human disease. Roles for relatively underexplored c-erbB-3 and c-erbB-4 receptor expressions in each of these breast cancer phenotypes were also evaluated. Each quantitative assay was validated by assessment of amplicon size and DNA sequencing following amplification. Differential expression of ER1, PR, and c-erbB-2 in CMT cell lines clearly defined distinct human-like breast cancer phenotypes for a selection of CMT-derived cell lines. Expression profiles for EGFr family genes c-erbB-3 and c-erbB-4 in CMT models also provided an enriched classification of canine breast cancer identifying new extended phenotypes beyond the conventional luminal-basal characterization used in human breast cancer. PMID:27515268

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

PubMed

Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

2003-12-19

SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

Homeobox A7 stimulates breast cancer cell proliferation by up-regulating estrogen receptor-alpha

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yu; Department of Obstetrics and Gynaecology, Child and Family Research Institute, University of British Columbia, Vancouver, British Columbia V5Z 4H4; Cheng, Jung-Chien

2013-11-01

Highlights: •HOXA7 regulates MCF7 cell proliferation. •HOXA7 up-regulates ERα expression. •HOXA7 mediates estrogen-induced MCF7 cell proliferation. -- Abstract: Breast cancer is the most common hormone-dependent malignancy in women. Homeobox (HOX) transcription factors regulate many cellular functions, including cell migration, proliferation and differentiation. The aberrant expression of HOX genes has been reported to be associated with human reproductive cancers. Estradiol (E2) and its nuclear receptors, estrogen receptor (ER)-alpha and ER-beta, are known to play critical roles in the regulation of breast cancer cell growth. However, an understanding of the potential relationship between HOXA7 and ER in breast cancer cells is limited.more » In this study, our results demonstrate that knockdown of HOXA7 in MCF7 cells significantly decreased cell proliferation and ERα expression. In addition, HOXA7 knockdown attenuated E2-induced cell proliferation as well as progesterone receptor (PR) expression. The stimulatory effects of E2 on cell proliferation and PR expression were abolished by co-treatment with ICI 182780, a selective ERα antagonist. In contrast, overexpression of HOXA7 significantly stimulated cell proliferation and ERα expression. Moreover, E2-induced cell proliferation, as well as PR expression, was enhanced by the overexpression of HOXA7. Neither knockdown nor overexpression of HOXA7 affected the ER-beta levels. Our results demonstrate a novel mechanistic role for HOXA7 in modulating breast cancer cell proliferation via regulation of ERα expression. This finding contributes to our understanding of the role HOXA7 plays in regulating the proliferation of ER-positive cancer cells.« less

In-silico analysis of cis-acting regulatory elements of pathogenesis-related proteins of Arabidopsis thaliana and Oryza sativa

PubMed Central

Kaur, Amritpreet; Pati, Pratap Kumar; Pati, Aparna Maitra; Nagpal, Avinash Kaur

2017-01-01

Pathogenesis related (PR) proteins are low molecular weight family of proteins induced in plants under various biotic and abiotic stresses. They play an important role in plant-defense mechanism. PRs have wide range of functions, acting as hydrolases, peroxidases, chitinases, anti-fungal, protease inhibitors etc. In the present study, an attempt has been made to analyze promoter regions of PR1, PR2, PR5, PR9, PR10 and PR12 of Arabidopsis thaliana and Oryza sativa. Analysis of cis-element distribution revealed the functional multiplicity of PRs and provides insight into the gene regulation. CpG islands are observed only in rice PRs, which indicates that monocot genome contains more GC rich motifs than dicots. Tandem repeats were also observed in 5’ UTR of PR genes. Thus, the present study provides an understanding of regulation of PR genes and their versatile roles in plants. PMID:28910327

In-silico analysis of cis-acting regulatory elements of pathogenesis-related proteins of Arabidopsis thaliana and Oryza sativa.

PubMed

Kaur, Amritpreet; Pati, Pratap Kumar; Pati, Aparna Maitra; Nagpal, Avinash Kaur

2017-01-01

Pathogenesis related (PR) proteins are low molecular weight family of proteins induced in plants under various biotic and abiotic stresses. They play an important role in plant-defense mechanism. PRs have wide range of functions, acting as hydrolases, peroxidases, chitinases, anti-fungal, protease inhibitors etc. In the present study, an attempt has been made to analyze promoter regions of PR1, PR2, PR5, PR9, PR10 and PR12 of Arabidopsis thaliana and Oryza sativa. Analysis of cis-element distribution revealed the functional multiplicity of PRs and provides insight into the gene regulation. CpG islands are observed only in rice PRs, which indicates that monocot genome contains more GC rich motifs than dicots. Tandem repeats were also observed in 5' UTR of PR genes. Thus, the present study provides an understanding of regulation of PR genes and their versatile roles in plants.

Transient expression of progesterone receptor and cathepsin-l in human granulosa cells during the periovulatory period.

PubMed

García, Víctor; Kohen, Paulina; Maldonado, Carola; Sierralta, Walter; Muñoz, Alex; Villarroel, Claudio; Strauss, Jerome F; Devoto, Luigi

2012-03-01

To study in vivo the progesterone receptor (PR) expression levels in human granulosa cells (GCs) during the periovulatory period and the affect of the protein kinase A (PKA) pathway on PR expression and cathepsin-L expression-activation. Experimental study. University research unit. Twenty-five women of reproductive age. Follicular fluid and GCs obtained from spontaneous cycles before and during the normal luteinizing hormone surge, and samples obtained 36 hours after human chorionic gonadotropin (hCG) administration in patients undergoing in vitro fertilization. To determine PR, cathepsin-L messenger RNA (mRNA) analysis via real-time polymerase chain reaction, and protein of PR, cathepsin-L, and PKA in human GCs. The Western blot analysis revealed that bands of PR (isoform A) were the most abundant and that mRNA (PR-A and PR-B) have a temporal pattern of expression throughout the periovulatory period. The protein levels of PR and cathepsin-L were up-regulated by hCG. The abundance of PR was diminished in the presence of PKA inhibitor, and cathepsin-L with PR receptor antagonist. The transient expression of PR in human GCs of the preovulatory follicle suggests that PR and its ligand play a role in the activation of cathepsin-L, which is presumably involved in the degradation of the follicular extracellular matrix during human ovulation. Copyright © 2012 American Society for Reproductive Medicine. All rights reserved.

Precise Correction of Disease Mutations in Induced Pluripotent Stem Cells Derived From Patients With Limb Girdle Muscular Dystrophy.

PubMed

Turan, Soeren; Farruggio, Alfonso P; Srifa, Waracharee; Day, John W; Calos, Michele P

2016-04-01

Limb girdle muscular dystrophies types 2B (LGMD2B) and 2D (LGMD2D) are degenerative muscle diseases caused by mutations in the dysferlin and alpha-sarcoglycan genes, respectively. Using patient-derived induced pluripotent stem cells (iPSC), we corrected the dysferlin nonsense mutation c.5713C>T; p.R1905X and the most common alpha-sarcoglycan mutation, missense c.229C>T; p.R77C, by single-stranded oligonucleotide-mediated gene editing, using the CRISPR/Cas9 gene-editing system to enhance the frequency of homology-directed repair. We demonstrated seamless, allele-specific correction at efficiencies of 0.7-1.5%. As an alternative, we also carried out precise gene addition strategies for correction of the LGMD2B iPSC by integration of wild-type dysferlin cDNA into the H11 safe harbor locus on chromosome 22, using dual integrase cassette exchange (DICE) or TALEN-assisted homologous recombination for insertion precise (THRIP). These methods employed TALENs and homologous recombination, and DICE also utilized site-specific recombinases. With DICE and THRIP, we obtained targeting efficiencies after selection of ~20%. We purified iPSC corrected by all methods and verified rescue of appropriate levels of dysferlin and alpha-sarcoglycan protein expression and correct localization, as shown by immunoblot and immunocytochemistry. In summary, we demonstrate for the first time precise correction of LGMD iPSC and validation of expression, opening the possibility of cell therapy utilizing these corrected iPSC.

Vitamin D3 supplementation alleviates rotavirus infection in pigs and IPEC-J2 cells via regulating the autophagy signaling pathway.

PubMed

Tian, Gang; Liang, Xiaofang; Chen, Daiwen; Mao, Xiangbing; Yu, Jie; Zheng, Ping; He, Jun; Huang, Zhiqing; Yu, Bing

2016-10-01

Vitamin D had an anti-infection effect and benefited to the intestinal health. Autophagy signaling pathway was regulated by vitamin D3 to inhibit the infection of human immunodeficiency virus type-1. Rotavirus (RV) was a major cause of the severe diarrheal disease in young children and young animals. Although evidence suggested that vitamin D3 attenuates the negative effects of RV infection via the retinoic acid-inducible gene I signaling pathway, little is known of its antiviral effect whether through the regulation of autophagy. The present study was performed to investigate whether vitamin D3 alleviates RV infection in pig and porcine small intestinal epithelial cell line (IPEC-J2) models via regulating the autophagy signaling pathway. RV administration increased the Beclin 1 mRNA abundance in porcine jejunum and ileum. 5000 IU/kg dietary vitamin D3 supplementation greatly up-regulated LC3-II/LC3-I ratios and PR-39 mRNA expression under the condition of RV challenged. The viability of IPEC-J2 was significantly inhibited by RV infection. Incubation with 25-hydroxyvitamin D3 significantly decreased the concentrations of RV antigen and non-structural protein 4 (NSP4), and up-regulated the mRNA expression of Beclin 1 and PR-39 in the RV-infected IPEC-J2 cells. And then, based on the 25-hydroxyvitamin D3 treatment and RV infection, LC3-II mRNA expression in cells was inhibited by an autophagy inhibitor 3-methyladenine (3-MA). Bafilomycin A1 (Baf A1, a class of inhibitors of membrane ATPases, inhibits maturation of autophagic vacuoles) treatment numerically enhanced the LC3-II mRNA abundance, but had no effect on NSP4 concentration. Furthermore, 25-hydroxyvitamin D3 decreased the p62 mRNA expression and increased porcine cathelicidins (PMAP23, PG1-5 and PR-39) mRNA expression in the RV-infected cells. Taken together, these results indicated that vitamin D3 attenuates RV infection through regulating autophagic maturation and porcine cathelicidin genes expression. Copyright © 2016 Elsevier Ltd. All rights reserved.

The effects of estradiol and selective estrogen receptor modulators on gene expression and messenger RNA stability in immortalized sheep endometrial stromal cells and human endometrial adenocarcinoma cells.

PubMed

Farnell, Yuhua Z; Ing, Nancy H

2003-03-01

The purpose of this study was to identify an endometrial cell line that maintained the E2 up-regulation of estrogen receptor (ER) mRNA by enhanced message stability and to assess its dependence on ER protein. Estradiol (E2) effects on gene expression were measured in three cell lines: one immortalized from sheep endometrial stroma (ST) and two from human endometrial adenocarcinomas (Ishikawa and ECC-1). E2 up-regulated ER mRNA levels in ST and Ishikawa cells, but down-regulated ER mRNA levels in ECC-1 cells. E2 up-regulated progesterone receptor (PR), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and transforming growth factor-alpha (TGF-alpha) in both Ishikawa and ECC-1 cells. The selective estrogen receptor modulator ICI 182,780 antagonized the E2-induced up-regulation of ER and/or PR mRNA levels in all three cells, while another, GW 5638, antagonized the up-regulation of PR mRNA in Ishikawa and ECC-1 cells. In mechanistic studies, E2 had no effect on ER mRNA stability in ST cells and it destabilized ER mRNA in ECC-1 cells. Thus, Ishikawa cells appear to be the most physiologically relevant cell line in which to study the up-regulation of ER mRNA levels by enhanced mRNA stability. Its antagonism by ICI 182,780 reveals that ER protein is involved in this E2 response.

Functional characterization of a novel jasmonate ZIM-domain interactor (NINJA) from upland cotton (Gossypium hirsutum).

PubMed

Wang, Le; Wu, Shu-Ming; Zhu, Yue; Fan, Qiang; Zhang, Zhen-Nan; Hu, Guang; Peng, Qing-Zhong; Wu, Jia-He

2017-03-01

The jasmonic acid (JA) signalling pathway plays roles in plant development and defence against biotic and abiotic stresses. We isolated a cotton NINJA (novel interactor of JA ZIM-domain) gene, designated GhNINJA, which contains a 1305 bp open read frame. The GhNINJA gene encodes a 434 amino acid peptide. According to quantitative real-time PCR analysis, GhNINJA is preferentially expressed in roots, and its expression level is greatly induced by Verticillium dahliae infection. Through a virus-induced gene silencing technique, we developed GhNINJA-silenced cotton plants, which had significantly decreased expression of the target gene with an average expression of 6% of the control. The regenerating lateral root growth of silenced plants was largely inhibited compared to the control. Analysis by microscopy demonstrated that the cell length of the root differentiation zone in GhNINJA-silenced plants is significantly shorter than those of the control. Moreover, the silenced plants exhibited higher tolerance to V. dahliae infection compared to the control, which was linked to the increased expression of the defence marker genes PDF1.2 and PR4. Together, these data indicated that knockdown of GhNINJA represses the root growth and enhances the tolerance to V. dahliae. Therefore, GhNINJA gene can be used as a candidate gene to breed the new cultivars for improving cotton yield and disease resistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Spindle assembly checkpoint gene expression in childhood adrenocortical tumors (ACT): Overexpression of Aurora kinases A and B is associated with a poor prognosis.

PubMed

Borges, Kleiton Silva; Moreno, Daniel Antunes; Martinelli, Carlos Eduardo; Antonini, Sonir Roberto Rauber; de Castro, Margaret; Tucci, Silvio; Neder, Luciano; Ramalho, Leandra Naira Zambelli; Seidinger, Ana Luiza; Cardinalli, Izilda; Mastellaro, Maria José; Yunes, José Andres; Brandalise, Silvia Regina; Tone, Luiz Gonzaga; Scrideli, Carlos Alberto

2013-11-01

Pediatric adrenocortical tumors (ACT) are rare malignancies and treatment has a small impact on survival in advanced disease and the discovery of potential target genes could be important in new therapeutic approaches. The mRNA expression levels of spindle checkpoint genes AURKA, AURKB, BUB, and BUBR1 were analyzed in 60 children with ACT by quantitative real time PCR. The anticancer effect of ZM447439, an experimental AURK inhibitor, was analyzed in a primary childhood ACT culture carrying the TP53 p.R337H mutation. A significant association was observed between malignancy as defined by Weiss score ≥3 and higher AURKA (2.0-fold, P = 0.01), AURKB (7.0-fold, P = 0.007), and BUBR1 (5.8-fold, P = 0.007) gene expression, and between unfavorable event (death or relapse) and higher expression of AURKA (6.0-fold, P = 0.034) and AURKB (17-fold, P = 0.013). Overexpression of AURKA and AURKB was associated with lower event-free survival in uni- (P < 0.001 and P = 0.006, respectively) and multivariate (P = 0.002 and P = 0.03, respectively) analysis. Significant lower Event free survival (EFS) was also observed in patients with moderate/strong immunostaining to AURKA (P = 0.012) and AURKB (P = 0.045). ZM447439 was able to induce inhibition of proliferation and colony formation in a primary childhood ACT culture carrying the TP53 p.R337H mutation. Our results suggest that AURKA and AURKB overexpression in pediatric ACT may be related to more aggressive disease and the inhibition of these proteins could be an interesting approach for the treatment of these tumors. Copyright © 2013 Wiley Periodicals, Inc.

Similar, but different: structurally related azelaic acid and hexanoic acid trigger differential metabolomic and transcriptomic responses in tobacco cells.

PubMed

Djami-Tchatchou, Arnaud T; Ncube, Efficient N; Steenkamp, Paul A; Dubery, Ian A

2017-11-29

Plants respond to various stress stimuli by activating an enhanced broad-spectrum defensive ability. The development of novel resistance inducers represents an attractive, alternative crop protection strategy. In this regard, hexanoic acid (Hxa, a chemical elicitor) and azelaic acid (Aza, a natural signaling compound) have been proposed as inducers of plant defense, by means of a priming mechanism. Here, we investigated both the mode of action and the complementarity of Aza and Hxa as priming agents in Nicotiana tabacum cells in support of enhanced defense. Metabolomic analyses identified signatory biomarkers involved in the establishment of a pre-conditioned state following Aza and Hxa treatment. Both inducers affected the metabolomes in a similar manner and generated common biomarkers: caffeoylputrescine glycoside, cis-5-caffeoylquinic acid, feruloylglycoside, feruloyl-3-methoxytyramine glycoside and feruloyl-3-methoxytyramine conjugate. Subsequently, quantitative real time-PCR was used to investigate the expression of inducible defense response genes: phenylalanine ammonia lyase, hydroxycinnamoyl CoA quinate transferase and hydroxycinnamoyl transferase to monitor activation of the early phenylpropanoid pathway and chlorogenic acids metabolism, while ethylene response element-binding protein, small sar1 GTPase, heat shock protein 90, RAR1, SGT1, non-expressor of PR genes 1 and thioredoxin were analyzed to report on signal transduction events. Pathogenesis-related protein 1a and defensin were quantified to investigate the activation of defenses regulated by salicylic acid and jasmonic acid respectively. The qPCR results revealed differential expression kinetics and, in general (except for NPR1, Thionin and PR1a), the relative gene expression ratios observed in the Hxa-treated cells were significantly greater than the expression observed in the cells treated with Aza. The results indicate that Aza and Hxa have a similar priming effect through activation of genes involved in the establishment of systemic acquired resistance, associated with enhanced synthesis of hydroxycinnamic acids and related conjugates.

Melatonin counteracts changes in hypothalamic gene expression of signals regulating feeding behavior in high-fat fed rats.

PubMed

Ríos-Lugo, María J; Jiménez-Ortega, Vanesa; Cano-Barquilla, Pilar; Mateos, Pilar Fernández; Spinedi, Eduardo J; Cardinali, Daniel P; Esquifino, Ana I

2015-03-01

Previous studies indicate that the administration of melatonin caused body weight and abdominal visceral fat reductions in rodent models of hyperadiposity. The objective of the present study performed in high-fat fed rats was to evaluate the activity of melatonin on gene expression of some medial basal hypothalamus (MBH) signals involved in feeding behavior regulation, including neuropeptide Y (NPY), proopiomelanocortin (POMC), prolactin-releasing peptide (PrRP), leptin- and insulin-receptors (R) and insulin-R substrate (IRS)-1 and -2. Blood levels of leptin and adiponectin were also measured. Adult Wistar male rats were divided into four groups (n=16 per group): (i) control diet (3% fat); (ii) high-fat (35%) diet; (iii) high-fat diet+melatonin; (iv) control diet+melatonin. Rats had free access to high-fat or control chow and one of the following drinking solutions: (a) tap water; (b) 25 μg/mL of melatonin. After 10 weeks, the high-fat fed rats showed augmented MBH mRNA levels of NPY, leptin-R, PrRP, insulin-R, IRS-1 and IRS-2. The concomitant administration of melatonin counteracted this increase. Feeding of rats with a high-fat diet augmented expression of the MBH POMC gene through an effect insensitive to melatonin treatment. The augmented levels of circulating leptin and adiponectin seen in high-fat fed rats were counteracted by melatonin as was the augmented body weight: melatonin significantly attenuated a body weight increase in high-fat fed rats without affecting chow or water consumption. Melatonin augmented plasma leptin and adiponectin in control rats. The results indicate that an effect on gene expression of feeding behavior signals at the central nervous system (CNS) may complement a peripheral rise of the energy expenditure produced by melatonin to decrease body weight in high-fat fed rats.

Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

PubMed

Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

2018-03-01

The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

Genomic agonism and phenotypic antagonism between estrogen and progesterone receptors in breast cancer

PubMed Central

Singhal, Hari; Greene, Marianne E.; Tarulli, Gerard; Zarnke, Allison L.; Bourgo, Ryan J.; Laine, Muriel; Chang, Ya-Fang; Ma, Shihong; Dembo, Anna G.; Raj, Ganesh V.; Hickey, Theresa E.; Tilley, Wayne D.; Greene, Geoffrey L.

2016-01-01

The functional role of progesterone receptor (PR) and its impact on estrogen signaling in breast cancer remain controversial. In primary ER+ (estrogen receptor–positive)/PR+ human tumors, we report that PR reprograms estrogen signaling as a genomic agonist and a phenotypic antagonist. In isolation, estrogen and progestin act as genomic agonists by regulating the expression of common target genes in similar directions, but at different levels. Similarly, in isolation, progestin is also a weak phenotypic agonist of estrogen action. However, in the presence of both hormones, progestin behaves as a phenotypic estrogen antagonist. PR remodels nucleosomes to noncompetitively redirect ER genomic binding to distal enhancers enriched for BRCA1 binding motifs and sites that link PR and ER/PR complexes. When both hormones are present, progestin modulates estrogen action, such that responsive transcriptomes, cellular processes, and ER/PR recruitment to genomic sites correlate with those observed with PR alone, but not ER alone. Despite this overall correlation, the transcriptome patterns modulated by dual treatment are sufficiently different from individual treatments, such that antagonism of oncogenic processes is both predicted and observed. Combination therapies using the selective PR modulator/antagonist (SPRM) CDB4124 in combination with tamoxifen elicited 70% cytotoxic tumor regression of T47D tumor xenografts, whereas individual therapies inhibited tumor growth without net regression. Our findings demonstrate that PR redirects ER chromatin binding to antagonize estrogen signaling and that SPRMs can potentiate responses to antiestrogens, suggesting that cotargeting of ER and PR in ER+/PR+ breast cancers should be explored. PMID:27386569

Systemic distribution, subcellular localization and differential expression of sphingosine-1-phosphate receptors in benign and malignant human tissues.

PubMed

Wang, Chunyi; Mao, Jinghe; Redfield, Samantha; Mo, Yinyuan; Lage, Janice M; Zhou, Xinchun

2014-10-01

Five sphingosine-1-phosphate receptors (S1PR): S1PR1, S1PR2, S1PR3, S1PR4 and S1PR5 (S1PR1-5) have been shown to be involved in the proliferation and progression of various cancers. However, none of the S1PRs have been systemically investigated. In this study, we performed immunohistochemistry (IHC) for S1PR1-S1PR5 on different tissues, in order to simultaneously determine the systemic distribution, subcellular localization and expression level of all five S1PRs. We constructed tissue microarrays (TMAs) from 384 formalin-fixed paraffin-embedded (FFPE) blocks containing 183 benign and 201 malignant tissues from 34 human organs/systems. Then we performed IHC for all five S1PRs simultaneously on these TMA slides. The distribution, subcellular localization and expression of each S1PR were determined for each tissue. The data in benign and malignant tissues from the same organ/tissue were then compared using the Student's t-test. In order to reconfirm the subcellular localization of each S1PR as determined by IHC, immunocytochemistry (ICC) was performed on several malignant cell lines. We found that all five S1PRs are widely distributed in multiple human organs/systems. All S1PRs are expressed in both the cytoplasm and nucleus, except S1PR3, whose IHC signals are only seen in the nucleus. Interestingly, the S1PRs are rarely expressed on cellular membranes. Each S1PR is unique in its organ distribution, subcellular localization and expression level in benign and malignant tissues. Among the five S1PRs, S1PR5 has the highest expression level (in either the nucleus or cytoplasm), with S1PR1, 3, 2 and 4 following in descending order. Strong nuclear expression was seen for S1PR1, S1PR3 and S1PR5, whereas S1PR2 and S1PR4 show only weak staining. Four organs/tissues (adrenal gland, liver, brain and colon) show significant differences in IHC scores for the multiple S1PRs (nuclear and/or cytoplasmic), nine (stomach, lymphoid tissues, lung, ovary, cervix, pancreas, skin, soft tissues and uterus) show differences for only one S1PR (cytoplasmic or nuclear), and twenty three organs/tissues show no significant difference in IHC scores for any S1PR (cytoplasmic or nuclear) between benign and malignant changes. This is the first study to evaluate the expression level of all S1PRs in benign and malignant tissues from multiple human organs. This study provides data regarding the systemic distribution, subcellular localization and differences in expression of all five S1PRs in benign and malignant changes for each organ/tissue. Copyright © 2014 Elsevier Inc. All rights reserved.

Systemic distribution, subcellular localization and differential expression of sphingosine-1-phosphate receptors in benign and malignant human tissues

PubMed Central

Wang, Chunyi; Mao, Jinghe; Redfield, Samantha; Mo, Yinyuan; Lage, Janice M.; Zhou, Xinchun

2014-01-01

Aims Five sphingosine-1-phosphate receptors (S1PR): S1PR1, S1PR2, S1PR3, S1PR4 and S1PR5 (S1PR1-5) have been shown to be involved in the proliferation and progression of various cancers. However, none of the S1PRs have been systemically investigated. In this study, we performed immunohistochemistry (IHC) for S1PR1-S1PR5 on different tissues, in order to simultaneously determine the systemic distribution, subcellular localization and expression level of all five S1PRs. Methods We constructed tissue microarrays (TMAs) from 384 formalin-fixed paraffin-embedded (FFPE) blocks containing 183 benign and 201 malignant tissues from 34 human organs/systems. Then we performed IHC for all five S1PRs simultaneously on these TMA slides. The distribution, subcellular localization and expression of each S1PR were determined for each tissue. The data were then compared in benign and malignant tissues from the same organ/tissue using the student t-test. In order to reconfirm the subcellular localization of each S1PR as determined by IHC, immunocytochemistry (ICC) was performed on several malignant cell lines. Results We found that all five S1PRs are widely distributed in multiple human organs/systems. All S1PRs are expressed in both the cytoplasm and nucleus, except S1PR3, whose IHC signals are only seen in the nucleus. Interestingly, the S1PRs are rarely expressed on cellular membranes. Each S1PR is unique in its organ distribution, subcellular localization and expression level in benign and malignant tissues. Among the five S1PRs, S1PR5 has the highest expression level (either in nucleus or cytoplasm), with S1PR1, 3, 2 and 4 following in descending order. Strong nuclear expression was seen for S1PR1, S1PR3 and S1PR5, whereas S1PR2 and S1PR4 show only weak staining. Four organs/tissues (adrenal gland, liver, brain and colon) show significant differences in IHC scores for the multiple S1PRs (nuclear and/or cytoplasmic), nine (stomach, lymphoid tissues, lung, ovary, cervix, pancreas, skin, soft tissues and uterus) show differences for only one S1PR (cytoplasmic or nuclear), and twenty three organs/tissues show no significant difference in IHC score of any S1PR (cytoplasmic or nuclear) between benign and malignant changes. Conclusion This is the first study to evaluate the expression level of all S1PRs in benign and malignant tissues from multiple human organs. This study provides data regarding the systemic distribution, subcellular localization and differences in expression of all five S1PRs in benign and malignant changes for each organ/tissue. PMID:25084322

Identification of the Pr1 Gene Product Completes the Anthocyanin Biosynthesis Pathway of Maize

PubMed Central

Sharma, Mandeep; Cortes-Cruz, Moises; Ahern, Kevin R.; McMullen, Michael; Brutnell, Thomas P.; Chopra, Surinder

2011-01-01

In maize, mutations in the pr1 locus lead to the accumulation of pelargonidin (red) rather than cyanidin (purple) pigments in aleurone cells where the anthocyanin biosynthetic pathway is active. We characterized pr1 mutation and isolated a putative F3′H encoding gene (Zmf3′h1) and showed by segregation analysis that the red kernel phenotype is linked to this gene. Genetic mapping using SNP markers confirms its position on chromosome 5L. Furthermore, genetic complementation experiments using a CaMV 35S::ZmF3′H1 promoter–gene construct established that the encoded protein product was sufficient to perform a 3′-hydroxylation reaction. The Zmf3′h1-specific transcripts were detected in floral and vegetative tissues of Pr1 plants and were absent in pr1. Four pr1 alleles were characterized: two carry a 24 TA dinucleotide repeat insertion in the 5′-upstream promoter region, a third has a 17-bp deletion near the TATA box, and a fourth contains a Ds insertion in exon1. Genetic and transcription assays demonstrated that the pr1 gene is under the regulatory control of anthocyanin transcription factors red1 and colorless1. The cloning and characterization of pr1 completes the molecular identification of all genes encoding structural enzymes of the anthocyanin pathway of maize. PMID:21385724

Role of nuclear progesterone receptor isoforms in uterine pathophysiology

PubMed Central

Patel, Bansari; Elguero, Sonia; Thakore, Suruchi; Dahoud, Wissam; Bedaiwy, Mohamed; Mesiano, Sam

2015-01-01

BACKGROUND Progesterone is a key hormonal regulator of the female reproductive system. It plays a major role to prepare the uterus for implantation and in the establishment and maintenance of pregnancy. Actions of progesterone on the uterine tissues (endometrium, myometrium and cervix) are mediated by the combined effects of two progesterone receptor (PR) isoforms, designated PR-A and PR-B. Both receptors function primarily as ligand-activated transcription factors. Progesterone action on the uterine tissues is qualitatively and quantitatively determined by the relative levels and transcriptional activities of PR-A and PR-B. The transcriptional activity of the PR isoforms is affected by specific transcriptional coregulators and by PR post-translational modifications that affect gene promoter targeting. In this context, appropriate temporal and cell-specific expression and function of PR-A and PR-B are critical for normal uterine function. METHODS Relevant studies describing the role of PRs in uterine physiology and pathology (endometriosis, uterine leiomyoma, endometrial cancer, cervical cancer and recurrent pregnancy loss) were comprehensively searched using PubMed, Cochrane Library, Web of Science, and Google Scholar and critically reviewed. RESULTS Progesterone, acting through PR-A and PR-B, regulates the development and function of the endometrium and induces changes in cells essential for implantation and the establishment and maintenance of pregnancy. During pregnancy, progesterone via the PRs promotes myometrial relaxation and cervical closure. Withdrawal of PR-mediated progesterone signaling triggers menstruation and parturition. PR-mediated progesterone signaling is anti-mitogenic in endometrial epithelial cells, and as such, mitigates the tropic effects of estrogen on eutopic normal endometrium, and on ectopic implants in endometriosis. Similarly, ligand-activated PRs function as tumor suppressors in endometrial cancer cells through inhibition of key cellular signaling pathways required for growth. In contrast, progesterone via PR activation appears to increase leiomyoma growth. The exact role of PRs in cervical cancer is unclear. PRs regulate implantation and therefore aberrant PR function may be implicated in recurrent pregnancy loss (RPL). PRs likely regulate key immunogenic factors involved in RPL. However, the exact role of PRs in the pathophysiology of RPL and the use of progesterone for therapeutic benefit remains uncertain. CONCLUSIONS PRs are key mediators of progesterone action in uterine tissues and are essential for normal uterine function. Aberrant PR function (due to abnormal expression and/or function) is a major cause of uterine pathophysiology. Further investigation of the underlying mechanisms of PR isoform action in the uterus is required, as this knowledge will afford the opportunity to create progestin/PR-based therapeutics to treat various uterine pathologies. PMID:25406186

Suppression of DS1 Phosphatidic Acid Phosphatase Confirms Resistance to Ralstonia solanacearum in Nicotiana benthamiana

PubMed Central

Nakano, Masahito; Nishihara, Masahiro; Yoshioka, Hirofumi; Takahashi, Hirotaka; Sawasaki, Tatsuya; Ohnishi, Kouhei; Hikichi, Yasufumi; Kiba, Akinori

2013-01-01

Nicotiana benthamiana is susceptible to Ralstonia solanacearum. To analyze molecular mechanisms for disease susceptibility, we screened a gene-silenced plant showing resistance to R. solanacearum, designated as DS1 (Disease suppression 1). The deduced amino acid sequence of DS1 cDNA encoded a phosphatidic acid phosphatase (PAP) 2. DS1 expression was induced by infection with a virulent strain of R. solanacearum in an hrp-gene-dependent manner. DS1 rescued growth defects of the temperature-sensitive ∆lpp1∆dpp1∆pah1 mutant yeast. Recombinant DS1 protein showed Mg2+-independent PAP activity. DS1 plants showed reduced PAP activity and increased phosphatidic acid (PA) content. After inoculation with R. solanacearum, DS1 plants showed accelerated cell death, over-accumulation of reactive oxygen species (ROS), and hyper-induction of PR-4 expression. In contrast, DS1-overexpressing tobacco plants showed reduced PA content, greater susceptibility to R. solanacearum, and reduced ROS production and PR-4 expression. The DS1 phenotype was partially compromised in the plants in which both DS1 and NbCoi1 or DS1 and NbrbohB were silenced. These results show that DS1 PAP may affect plant immune responses related to ROS and JA cascades via regulation of PA levels. Suppression of DS1 function or DS1 expression could rapidly activate plant defenses to achieve effective resistance against Ralstonia solanacearum. PMID:24073238

Isolating of Target Genes for NKX3.1 in Prostate Carcinogenesis

DTIC Science & Technology

2005-03-01

stainin on e te o tesr prostate hist log .(Band - . (C a .. ( 2 (M -P) Ki6 s shows . celula pr lf rto in c( ssi Fg1.prosthate cane r progresin is enh...prostate tumorigenicity. s{ LA Finally, to assess the significance of Cyclin D1 for prostatea ,. 0 tumorigenicity, we used RNAi to knock-down its expression

Expression of pathogenesis-related (PR) genes in avocados fumigated with thyme oil vapours and control of anthracnose.

PubMed

Bill, Malick; Sivakumar, Dharini; Beukes, Mervyn; Korsten, Lise

2016-03-01

Thyme oil (TO) fumigation (96μll(-1)) to cv. Hass and Ryan avocados significantly reduced anthracnose incidence compared to prochloraz and the untreated control. Also, enhanced activities of β-1,3-glucanase, chitinase were noted in both cultivars. TO fumigation induced the expression of both β-1,3-glucanase and chitinase genes in naturally infected fruit of both cultivars, during storage at 7 or 7.5°C for up to 21d and during subsequent simulated market shelf conditions at 20°C for 5d. However, the impact of TO fumigation on the β-1,3-glucanase gene expression was higher in both cultivars. Higher gene regulation and β-1,3-glucanase, chitinase activities were observed in cv. Ryan compared to Hass. Although TO fumigation significantly reduced anthracnose incidence in both naturally infected cultivars, the inhibitory effect was slightly higher in cv. Ryan than Hass. Thus, postharvest TO fumigation had positive effects on enhancing anthracnose disease resistance during storage and also gave a residual effect during the simulated shelf life. Copyright © 2015 Elsevier Ltd. All rights reserved.

Role of ERRF, a Novel ER-Related Nuclear Factor, in the Growth Control of ER-Positive Human Breast Cancer Cells

PubMed Central

Su, Dan; Fu, Xiaoying; Fan, Songqing; Wu, Xiao; Wang, Xin-Xin; Fu, Liya; Dong, Xue-Yuan; Ni, Jianping Jenny; Fu, Li; Zhu, Zhengmao; Dong, Jin-Tang

2012-01-01

Whereas estrogen–estrogen receptor α (ER) signaling plays an important role in breast cancer growth, it is also necessary for the differentiation of normal breast epithelial cells. How this functional conversion occurs, however, remains unknown. Based on a genome-wide sequencing study that identified mutations in several breast cancer genes, we examined some of the genes for mutations, expression levels, and functional effects on cell proliferation and tumorigenesis. We present the data for C1orf64 or ER-related factor (ERRF) from 31 cell lines and 367 primary breast cancer tumors. Whereas mutation of ERRF was infrequent (1 of 79 or 1.3%), its expression was up-regulated in breast cancer, and the up-regulation was more common in lower-stage tumors. In addition, increased ERRF expression was significantly associated with ER and/or progesterone receptor (PR) positivity, which was still valid in human epidermal growth factor receptor 2 (HER2)–negative tumors. In ER-positive tumors, ERRF expression was inversely correlated with HER2 status. Furthermore, higher ERRF protein expression was significantly associated with better disease-free survival and overall survival, particularly in ER- and/or PR-positive and HER2-negative tumors (luminal A subtype). Functionally, knockdown of ERRF in two ER-positive breast cancer cell lines, T-47D and MDA-MB-361, suppressed cell growth in vitro and tumorigenesis in xenograft models. These results suggest that ERRF plays a role in estrogen-ER–mediated growth of breast cancer cells and could, thus, be a potential therapeutic target. PMID:22341523

Recombinant Measles AIK-C Vaccine Strain Expressing the prM-E Antigen of Japanese Encephalitis Virus.

PubMed

Higuchi, Akira; Toriniwa, Hiroko; Komiya, Tomoyoshi; Nakayama, Tetsuo

2016-01-01

An inactivated Japanese encephalitis virus (JEV) vaccine, which induces neutralizing antibodies, has been used for many years in Japan. In the present study, the JEV prM-E protein gene was cloned, inserted at the P/M junction of measles AIK-C cDNA, and an infectious virus was recovered. The JEV E protein was expressed in B95a cells infected with the recombinant virus. Cotton rats were inoculated with recombinant virus. Measles PA antibodies were detected three weeks after immunization. Neutralizing antibodies against JEV developed one week after inoculation, and EIA antibodies were detected three weeks after immunization. The measles AIK-C-based recombinant virus simultaneously induced measles and JEV immune responses, and may be a candidate for infant vaccines. Therefore, the present strategy of recombinant viruses based on a measles vaccine vector would be applicable to the platform for vaccine development.

A Venom Serpin Splicing Isoform of the Endoparasitoid Wasp Pteromalus puparum Suppresses Host Prophenoloxidase Cascade by Forming Complexes with Host Hemolymph Proteinases*

PubMed Central

Yan, Zhichao; Fang, Qi; Liu, Yang; Xiao, Shan; Yang, Lei; Wang, Fei; An, Chunju; Werren, John H.; Ye, Gongyin

2017-01-01

To ensure successful parasitism, parasitoid wasps inject venom along with their eggs into their hosts. The venom serves to suppress host immune responses, including melanization. Venom from Pteromalus puparum, a pupal endoparasitoid, inhibits melanization of host hemolymph in vitro in a dose-dependent manner. Using assay-guided fractionation, a serpin splicing isoform with phenoloxidase inhibitory activity was identified as P. puparum serpin-1, venom isoform (PpS1V). This serpin gene has 16 predicted splicing isoforms that differ only in the C-terminal region. RT-PCR results show that the specific serpin isoform is differentially expressed in the venom gland. Recombinant PpS1V (rPpS1V) suppresses host prophenoloxidase (PPO) activation rather than inhibiting the phenoloxidase directly. Pulldown assays show that PpS1V forms complexes with two host hemolymph proteins, here named Pieris rapae hemolymph proteinase 8 (PrHP8) and P. rapae prophenoloxidase-activating proteinase 1 (PrPAP1), based on gene sequence blasting and phylogenetic analysis. The role of rPrPAP1 in the PPO activation cascade and its interaction with rPpS1V were confirmed. The stoichiometry of inhibition of PrPAP1 by PpS1V is 2.3. PpS1V also inhibits PPO activation in a non-natural host, Ostrinia furnacalis, through forming a complex with O. furnacalis serine protease 13 (OfSP13), an ortholog to PrPAP1. Our results identify a venom-enriched serpin isoform in P. puparum that inhibits host PPO activation, probably by forming a complex with host hemolymph proteinase PrPAP1. PMID:27913622

Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

PubMed

Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A; Arnemo, Jon M; Tryland, Morten; Girling, Simon; Miller, Michael W; Tranulis, Michael A; Goldmann, Wilfred

2012-01-01

Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrP(C)) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C) protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

Genetic Predictions of Prion Disease Susceptibility in Carnivore Species Based on Variability of the Prion Gene Coding Region

PubMed Central

Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred

2012-01-01

Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380

Acetate alters expression of genes involved in beige adipogenesis in 3T3-L1 cells and obese KK-Ay mice

PubMed Central

Hanatani, Satoko; Motoshima, Hiroyuki; Takaki, Yuki; Kawasaki, Shuji; Igata, Motoyuki; Matsumura, Takeshi; Kondo, Tatsuya; Senokuchi, Takafumi; Ishii, Norio; Kawashima, Junji; Kukidome, Daisuke; Shimoda, Seiya; Nishikawa, Takeshi; Araki, Eiichi

2016-01-01

The induction of beige adipogenesis within white adipose tissue, known as “browning”, has received attention as a novel potential anti-obesity strategy. The expression of some characteristic genes including PR domain containing 16 is induced during the browning process. Although acetate has been reported to suppress weight gain in both rodents and humans, its potential effects on beige adipogenesis in white adipose tissue have not been fully characterized. We examined the effects of acetate treatment on 3T3-L1 cells and in obese diabetic KK-Ay mice. The mRNA expression levels of genes involved in beige adipocyte differentiation and genes selectively expressed in beige adipocytes were significantly elevated in both 3T3-L1 cells incubated with 1.0 mM acetate and the visceral white adipose tissue from mice treated with 0.6% acetate for 16 weeks. In KK-Ay mice, acetate reduced the food efficiency ratio and increased the whole-body oxygen consumption rate. Additionally, reduction of adipocyte size and uncoupling protein 1-positive adipocytes and interstitial areas with multilocular adipocytes appeared in the visceral white adipose tissue of acetate-treated mice, suggesting that acetate induced initial changes of “browning”. In conclusion, acetate alters the expression of genes involved in beige adipogenesis and might represent a potential therapeutic agent to combat obesity. PMID:27895388

Augmented sphingosine 1 phosphate receptor-1 signaling in cardiac fibroblasts induces cardiac hypertrophy and fibrosis through angiotensin II and interleukin-6

PubMed Central

Ohkura, Sei-ichiro; Takashima, Shin-ichiro; Yoshioka, Kazuaki; Okamoto, Yasuo; Inagaki, Yutaka; Sugimoto, Naotoshi; Kitano, Teppei; Takamura, Masayuki; Wada, Takashi; Kaneko, Shuichi; Takuwa, Yoh

2017-01-01

Background: Cardiac fibroblasts, together with cardiomyocytes, occupy the majority of cells in the myocardium and are involved in myocardial remodeling. The lysophospholipid mediator sphigosine-1-phosphate (S1P) regulates functions of cardiovascular cells through multiple receptors including S1PR1–S1PR3. S1PR1 but not other S1P receptors was upregulated in angiotensin II-induced hypertrophic hearts. Therefore, we investigated a role of S1PR1 in fibroblasts for cardiac remodeling by employing transgenic mice that overexpressed S1PR1 under the control of α-smooth muscle actin promoter. In S1PR1-transgenic mouse heart, fibroblasts and/or myofibroblasts were hyperplastic, and those cells as well as vascular smooth muscle cells overexpressed S1PR1. Transgenic mice developed bi-ventricular hypertrophy by 12-week-old and diffuse interstitial fibrosis by 24-week-old without hemodynamic stress. Cardiac remodeling in transgenic mice was associated with greater ERK phosphorylation, upregulation of fetal genes, and systolic dysfunction. Transgenic mouse heart showed increased mRNA expression of angiotensin-converting enzyme and interleukin-6 (IL-6). Isolated fibroblasts from transgenic mice exhibited enhanced generation of angiotensin II, which in turn stimulated IL-6 release. Either an AT1 blocker or angiotensin-converting enzyme inhibitor prevented development of cardiac hypertrophy and fibrosis, systolic dysfunction and increased IL-6 expression in transgenic mice. Finally, administration of anti-IL-6 antibody abolished an increase in tyrosine phosphorylation of STAT3, a major signaling molecule downstream of IL-6, in the transgenic mouse heart and prevented development of cardiac hypertrophy in transgenic mice. These results demonstrate a promoting role of S1PR1 in cardiac fibroblasts for cardiac remodeling, in which angiotensin II—AT1 and IL-6 are involved. PMID:28771545

Expression of cellular prion protein in the frontal and occipital lobe in Alzheimer's disease, diffuse Lewy body disease, and in normal brain: an immunohistochemical study.

PubMed

Rezaie, Payam; Pontikis, Charlie C; Hudson, Lance; Cairns, Nigel J; Lantos, Peter L

2005-08-01

Cellular prion protein (PrP(c)) is a glycoprotein expressed at low to moderate levels within the nervous system. Recent studies suggest that PrP(c) may possess neuroprotective functions and that its expression is upregulated in certain neurodegenerative disorders. We investigated whether PrP(c) expression is altered in the frontal and occipital cortex in two well-characterized neurodegenerative disorders--Alzheimer's disease (AD) and diffuse Lewy body disease (DLBD)--compared with that in normal human brain using immunohistochemistry and computerized image analysis. The distribution of PrP(c) was further tested for correlation with glial reactivity. We found that PrP(c) was localized mainly in the gray matter (predominantly in neurons) and expressed at higher levels within the occipital cortex in the normal human brain. Image analysis revealed no significant variability in PrP(c) expression between DLBD and control cases. However, blood vessels within the white matter of DLBD cases showed immunoreactivity to PrP(c). By contrast, this protein was differentially expressed in the frontal and occipital cortex of AD cases; it was markedly overexpressed in the former and significantly reduced in the latter. Epitope specificity of antibodies appeared important when detecting PrP(c). The distribution of PrP(c) did not correlate with glial immunoreactivity. In conclusion, this study supports the proposal that regional changes in expression of PrP(c) may occur in certain neurodegenerative disorders such as AD, but not in other disorders such as DLBD.

A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean

PubMed Central

Zhao, Yuanling; Chang, Xin; Qi, Dongyue; Dong, Lidong; Wang, Guangjin; Fan, Sujie; Jiang, Liangyu; Cheng, Qun; Chen, Xi; Han, Dan; Xu, Pengfei; Zhang, Shuzhen

2017-01-01

Phytophthora root and stem rot of soybean caused by the oomycete Phytophthora sojae, is a destructive disease worldwide. Ethylene response factors (ERFs) play important roles in regulating plant biotic and abiotic stress tolerance. In this study, a new ERF gene, GmERF113, was isolated from the highly resistant soybean ‘Suinong 10.’ Sequence analysis suggested that the protein encoded by GmERF113 contained a conserved AP2/ERF domain of 58 amino acid and belonged to the B-4 subgroup of the ERF subfamily. Expression of GmERF113 was significantly induced by P. sojae, ethylene, and methyl jasmonate. GmERF113 protein localized to the nucleus when transiently expressed in Arabidopsis protoplasts, could bind to the GCC-box, and acted as a transcription activator. In addition, a region of the full-length GmERF113, GmERF113-II, interacted with a basic helix-loop-helix transcription factor (GmbHLH) in yeast cells. Full-length GmERF113 also interacted with GmbHLH in planta. GmERF113-overexpressing transgenic plants in susceptible cultivar ‘Dongnong 50’ soybean exhibited increased resistance to P. sojae and positively regulated the expression of the pathogenesis-related genes, PR1 and PR10-1. These results indicate that GmERF113 may play a crucial role in the defense of soybean against P. sojae infection. PMID:28326092

Solar-panel and parasol strategies shape the proteorhodopsin distribution pattern in marine Flavobacteriia.

PubMed

Kumagai, Yohei; Yoshizawa, Susumu; Nakajima, Yu; Watanabe, Mai; Fukunaga, Tsukasa; Ogura, Yoshitoshi; Hayashi, Tetsuya; Oshima, Kenshiro; Hattori, Masahira; Ikeuchi, Masahiko; Kogure, Kazuhiro; DeLong, Edward F; Iwasaki, Wataru

2018-05-01

Proteorhodopsin (PR) is a light-driven proton pump that is found in diverse bacteria and archaea species, and is widespread in marine microbial ecosystems. To date, many studies have suggested the advantage of PR for microorganisms in sunlit environments. The ecophysiological significance of PR is still not fully understood however, including the drivers of PR gene gain, retention, and loss in different marine microbial species. To explore this question we sequenced 21 marine Flavobacteriia genomes of polyphyletic origin, which encompassed both PR-possessing as well as PR-lacking strains. Here, we show that the possession or alternatively the lack of PR genes reflects one of two fundamental adaptive strategies in marine bacteria. Specifically, while PR-possessing bacteria utilize light energy ("solar-panel strategy"), PR-lacking bacteria exclusively possess UV-screening pigment synthesis genes to avoid UV damage and would adapt to microaerobic environment ("parasol strategy"), which also helps explain why PR-possessing bacteria have smaller genomes than those of PR-lacking bacteria. Collectively, our results highlight the different strategies of dealing with light, DNA repair, and oxygen availability that relate to the presence or absence of PR phototrophy.

A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression

PubMed Central

Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel

2014-01-01

Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene activity should be considered among the mechanisms underlying Bamforth–Lazarus syndrome. PMID:24219130

Progesterone receptor expression during prostate cancer progression suggests a role of this receptor in stromal cell differentiation.

PubMed

Yu, Yue; Yang, Ou; Fazli, Ladan; Rennie, Paul S; Gleave, Martin E; Dong, Xuesen

2015-07-01

The progesterone receptor, like the androgen receptor, belongs to the steroid receptor superfamily. Our previous studies have reported that the PR is expressed specifically in prostate stroma. PR inhibits proliferation of, and regulates cytokine secretion by stromal cells. However, PR protein expression in cancer-associated stroma during prostate cancer progression has not been profiled. Since the phenotypes of prostate stromal cells change dynamically as tumors progress, whether the PR plays a role in regulating stromal cell differentiation needs to be investigated. Immunohistochemistry assays measured PR protein levels on human prostate tissue microarrays containing 367 tissue cores from benign prostate, prostate tumors with different Gleason scores, tumors under various durations of castration therapy, and tumors at the castration-resistant stage. Immunoblotting assays determined whether PR regulated the expression of alpha smooth muscle actin (α-SMA), vimentin, and fibroblast specific protein (FSP) in human prostate stromal cells. PR protein levels decreased in cancer-associated stroma when compared with that in benign prostate stroma. This reduction in PR expression was not correlated with Gleason scores. PR protein levels were elevated by castration therapy, but reduced to pre-castration levels when tumors progressed to the castration-resistant stage. Enhanced PR expression in human prostate stromal cells increased α-SMA, but decreased vimentin and FSP protein levels ligand-independently. These results suggest that PR plays an active role in regulating stromal cell phenotypes during prostate cancer progression. © 2015 Wiley Periodicals, Inc.

Expression Profiles and DNA-Binding Affinity of Five ERF Genes in Bunches of Vitis vinifera cv. Cardinal Treated with High Levels of CO2 at Low Temperature

PubMed Central

Romero, Irene; Vazquez-Hernandez, Maria; Escribano, M. I.; Merodio, Carmen; Sanchez-Ballesta, M. T.

2016-01-01

Ethylene response factors (ERFs) play an important role in plants by regulating defense response through interaction with various stress pathways. After harvest, table grapes (Vitis vinifera L.) are subject to a range of problems associated with postharvest storage at 0°C, such as fungal attack, water loss and rachis browning. The application of a 3-day high CO2 treatment maintained fruit quality and activated the induction of transcription factors belonging to different families such as ERF. In this paper, we have isolated five VviERFs from table grapes cv. Cardinal, whose deduced amino acid sequence contained the conserved apetalous (AP2)/ERF domain. The phylogeny and putative conserved motifs in VviERFs were analyzed and compared with those previously reported in Vitis. VviERFs-c gene expression was studied by quantitative real-time RT-PCR in the different tissues of bunches stored at low temperature and treated with high levels of CO2. The results showed that in most of the tissues analyzed, VviERFs-c gene expression was induced by the storage under normal atmosphere although the application of high levels of CO2 caused a greater increase in the VviERFs-c transcript accumulation. The promoter regions of two PRs (pathogenesis related proteins), Vcchit1b and Vcgns1, were obtained and the in silico analysis revealed the presence of a cis-acting ethylene response element (GCC box). In addition, expression of these two PR genes was analyzed in the pulp and rachis of CO2-treated and non-treated table grapes stored at 0°C and results showed significant correlations with VviERF2-c and VviERF6L7-c gene expression in rachis, and between VviERF11-c and Vcchit1b in pulp. Finally by using electro mobility shift assays, we denoted differences in binding of VviERFs to the GCC sequences present in the promoters of both PRs, with VviERF6L7-c being the only member which did not bind to any tested probe. Overall, our results suggest that the beneficial effect of high CO2 treatment maintaining table grape quality seems to be mediated by the regulation of ERFs and in particular VviERF2-c might play an important role by modulating the expression of PR genes. PMID:27965678

Unique inflammatory RNA profiles of microglia in Creutzfeldt-Jakob disease

NASA Astrophysics Data System (ADS)

Baker, Christopher A.; Manuelidis, Laura

2003-01-01

Previous studies in Creutzfeldt-Jakob disease (CJD) have shown that myeloid cells in the periphery as well as derivative microglial cells in the brain are infectious. Microglia can show an activated phenotype before prion protein (PrP) pathology is detectable in brain, and isolated infectious microglia contain very little PrP. To find whether a set of inflammatory genes are significantly induced or suppressed with infection, we analyzed RNA from isolated microglia with relevant cDNA arrays, and identified 30 transcripts not previously examined in any transmissible spongiform encephalopathy. This CJD expression profile contrasted with that of uninfected microglia exposed to prototypic inflammatory stimuli such as lipopolysaccharide and IFN-, as well as PrP amyloid. These findings underscore inflammatory pathways evoked by the infectious agent in brain. Transcript profiles unique for CJD microglia and other myeloid cells provide opportunities for more sensitive preclinical diagnoses of infectious and noninfectious neurodegenerative diseases.

Alzheimer's amyloid-β oligomers rescue cellular prion protein induced tau reduction via the Fyn pathway.

PubMed

Chen, Rong-Jie; Chang, Wei-Wei; Lin, Yu-Chun; Cheng, Pei-Lin; Chen, Yun-Ru

2013-09-18

Amyloid-β (Aβ) and tau are the pathogenic hallmarks in Alzheimer's disease (AD). Aβ oligomers are considered the actual toxic entities, and the toxicity relies on the presence of tau. Recently, Aβ oligomers have been shown to specifically interact with cellular prion protein (PrP(C)) where the role of PrP(C) in AD is still not fully understood. To investigate the downstream mechanism of PrP(C) and Aβ oligomer interaction and their possible relationships to tau, we examined tau expression in human neuroblastoma BE(2)-C cells transfected with murine PrP(C) and studied the effect under Aβ oligomer treatment. By Western blotting, we found that PrP(C) overexpression down-regulated tau protein and Aβ oligomer binding alleviated the tau reduction induced by wild type but not M128V PrP(C), the high AD risk polymorphic allele in human prion gene. PrP(C) lacking the Aβ oligomer binding site was incapable of rescuing the level of tau reduction. Quantitative RT-PCR showed the PrP(C) effect was attributed to tau reduction at the transcription level. Treatment with Fyn pathway inhibitors, Fyn kinase inhibitor PP2 and MEK inhibitor U0126, reversed the PrP(C)-induced tau reduction and Aβ oligomer treatment modulated Fyn kinase activity. The results suggested Fyn pathway regulated Aβ-PrP(C)-tau signaling. Overall, our results demonstrated that PrP(C) down-regulated tau via the Fyn pathway and the effect can be regulated by Aβ oligomers. Our study facilitated the understanding of molecular mechanisms among PrP(C), tau, and Aβ oligomers.

PrPc Does Not Mediate Internalization of PrPSc but Is Required at an Early Stage for De Novo Prion Infection of Rov Cells▿

PubMed Central

Paquet, Sophie; Daude, Nathalie; Courageot, Marie-Pierre; Chapuis, Jérôme; Laude, Hubert; Vilette, Didier

2007-01-01

We have studied the interactions of exogenous prions with an epithelial cell line inducibly expressing PrPc protein and permissive to infection by a sheep scrapie agent. We demonstrate that abnormal PrP (PrPSc) and prion infectivity are efficiently internalized in Rov cells, whether or not PrPc is expressed. At odds with earlier studies implicating cellular heparan sulfates in PrPSc internalization, we failed to find any involvement of such molecules in Rov cells, indicating that prions can enter target cells by several routes. We further show that PrPSc taken up in the absence of PrPc was unable to promote efficient prion multiplication once PrPc expression was restored in the cells. This observation argues that interaction of PrPSc with PrPc has to occur early, in a specific subcellular compartment(s), and is consistent with the view that the first prion multiplication events may occur at the cell surface. PMID:17626095

TaMAPK4 Acts as a Positive Regulator in Defense of Wheat Stripe-Rust Infection

PubMed Central

Wang, Bing; Song, Na; Zhang, Qiong; Wang, Ning; Kang, Zhensheng

2018-01-01

Highly conserved mitogen-activated protein kinase (MAPK) cascades regulate numerous plant processes, including hormonal responses, stress, and innate immunity. In this research, TaMAPK4 was predicted to be a target of tae-miR164. We verified the binding and suppression of TaMAPK4 by co-expression in Nicotiana benthamiana. Moreover, we found TaMAPK4 was localized in the cytoplasm and nucleus using transient expression analyses. TaMAPK4 transcripts increased following salicylic acid (SA) treatment and when host plants were infected with an avirulent race of the stripe-rust pathogen. Silencing of TaMAPK4 by virus-induced gene silencing permitted increased colonization by the avirulent pathogen race. Detailed histological results showed increased Puccinia striiformis (Pst) hyphal length, hyphal branches, and infection uredinial size compared to the non-silenced control. SA accumulation and the transcript levels of TaPR1, TaPR2, and TaPR5 were significantly down-regulated in TaMAPK4 knockdown plants. Overall, these results suggest that TaMAPK4 plays an important role in signaling during the wheat-Pst interaction. These results present new insights into MAPK signaling in wheat defense to rust pathogen. PMID:29527215

Progesterone receptor isoforms expression pattern in the rat brain during the estrous cycle.

PubMed

Guerra-Araiza, C; Cerbón, M A; Morimoto, S; Camacho-Arroyo, I

2000-03-24

Progesterone receptor (PR) isoforms expression was determined in the hypothalamus, the preoptic area, the hippocampus and the frontal cerebral cortex of the rat at 12:00 h on each day of the estrous cycle by using reverse transcription coupled to polymerase chain reaction. Rats under a 14:10 h light-dark cycle, with lights on at 06:00 h were used. We found that PR-B isoform was predominant in the hypothalamus, the preoptic area and the frontal cerebral cortex. Both PR isoforms were similarly expressed in the hippocampus. The highest PR-B expression was found on proestrus day in the hypothalamus; on metestrus in the preoptic area; and on diestrus in the frontal cortex. We observed no changes in PR isoforms expression in the hippocampus during the estrous cycle. These results indicate that PR isoforms expression is differentially regulated during the estrous cycle in distinct brain regions and that PR-B may be involved in progesterone actions upon the hypothalamus, the preoptic area and the frontal cortex of the rat.

Identification of the anti-terminator qO111:H)- gene in Norwegian sorbitol-fermenting Escherichia coli O157:NM.

PubMed

Haugum, Kjersti; Lindstedt, Bjørn-Arne; Løbersli, Inger; Kapperud, Georg; Brandal, Lin Thorstensen

2012-04-01

Sorbitol-fermenting Escherichia coli O157:NM (SF O157) is an emerging pathogen suggested to be more virulent than nonsorbitol-fermenting Escherichia coli O157:H7 (NSF O157). Important virulence factors are the Shiga toxins (stx), encoded by stx1 and/or stx2 located within prophages integrated in the bacterial genome. The stx genes are expressed from p(R) (') as a late protein, and anti-terminator activity from the Q protein is necessary for read through of the late terminator t(R) (') and activation of p(R) (') . We investigated the regulation of stx2(EDL933) expression at the genomic level in 17 Norwegian SF O157. Sequencing of three selected SF O157 strains revealed that the anti-terminator q gene and genes upstream of stx2(EDL933) were identical or similar to the ones observed in the E. coli O111:H- strain AP010960, but different from the ones observed in the NSF O157 strain EDL933 (AE005174). This suggested divergent stx2(EDL933) -encoding bacteriophages between NSF O157 and the SF O157 strains (FR874039-41). Furthermore, different DNA structures were detected in the SF O157 strains, suggesting diversity among bacteriophages also within the SF O157 group. Further investigations are needed to elucidate whether the q(O111:H) (-) gene observed in all our SF O157 contributes to the increased virulence seen in SF O157 compared to NSF O157. An assay for detecting q(O111:H) (-) was developed. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Dual regulation of gene expression mediated by extended MAPK activation and salicylic acid contributes to robust innate immunity in Arabidopsis thaliana.

PubMed

Tsuda, Kenichi; Mine, Akira; Bethke, Gerit; Igarashi, Daisuke; Botanga, Christopher J; Tsuda, Yayoi; Glazebrook, Jane; Sato, Masanao; Katagiri, Fumiaki

2013-01-01

Network robustness is a crucial property of the plant immune signaling network because pathogens are under a strong selection pressure to perturb plant network components to dampen plant immune responses. Nevertheless, modulation of network robustness is an area of network biology that has rarely been explored. While two modes of plant immunity, Effector-Triggered Immunity (ETI) and Pattern-Triggered Immunity (PTI), extensively share signaling machinery, the network output is much more robust against perturbations during ETI than PTI, suggesting modulation of network robustness. Here, we report a molecular mechanism underlying the modulation of the network robustness in Arabidopsis thaliana. The salicylic acid (SA) signaling sector regulates a major portion of the plant immune response and is important in immunity against biotrophic and hemibiotrophic pathogens. In Arabidopsis, SA signaling was required for the proper regulation of the vast majority of SA-responsive genes during PTI. However, during ETI, regulation of most SA-responsive genes, including the canonical SA marker gene PR1, could be controlled by SA-independent mechanisms as well as by SA. The activation of the two immune-related MAPKs, MPK3 and MPK6, persisted for several hours during ETI but less than one hour during PTI. Sustained MAPK activation was sufficient to confer SA-independent regulation of most SA-responsive genes. Furthermore, the MPK3 and SA signaling sectors were compensatory to each other for inhibition of bacterial growth as well as for PR1 expression during ETI. These results indicate that the duration of the MAPK activation is a critical determinant for modulation of robustness of the immune signaling network. Our findings with the plant immune signaling network imply that the robustness level of a biological network can be modulated by the activities of network components.

A thaumatin-like protein of Ocimum basilicum confers tolerance to fungal pathogen and abiotic stress in transgenic Arabidopsis

PubMed Central

Misra, Rajesh Chandra; Sandeep; Kamthan, Mohan; Kumar, Santosh; Ghosh, Sumit

2016-01-01

Plant often responds to fungal pathogens by expressing a group of proteins known as pathogenesis-related proteins (PRs). The expression of PR is mediated through pathogen-induced signal-transduction pathways that are fine-tuned by phytohormones such as methyl jasmonate (MeJA). Here, we report functional characterization of an Ocimum basilicum PR5 family member (ObTLP1) that was identified from a MeJA-responsive expression sequence tag collection. ObTLP1 encodes a 226 amino acid polypeptide that showed sequence and structural similarities with a sweet-tasting protein thaumatin of Thaumatococcus danielli and also with a stress-responsive protein osmotin of Nicotiana tabacum. The expression of ObTLP1 in O. basilicum was found to be organ-preferential under unstressed condition, and responsive to biotic and abiotic stresses, and multiple phytohormone elicitations. Bacterially-expressed recombinant ObTLP1 inhibited mycelial growth of the phytopathogenic fungi, Scleretonia sclerotiorum and Botrytis cinerea; thereby, suggesting its antifungal activity. Ectopic expression of ObTLP1 in Arabidopsis led to enhanced tolerance to S. sclerotiorum and B. cinerea infections, and also to dehydration and salt stress. Moreover, induced expression of the defense marker genes suggested up-regulation of the defense-response pathways in ObTLP1-expressing Arabidopsis upon fungal challenge. Thus, ObTLP1 might be useful for providing tolerance to the fungal pathogens and abiotic stresses in crops. PMID:27150014

A thaumatin-like protein of Ocimum basilicum confers tolerance to fungal pathogen and abiotic stress in transgenic Arabidopsis.

PubMed

Misra, Rajesh Chandra; Sandeep; Kamthan, Mohan; Kumar, Santosh; Ghosh, Sumit

2016-05-06

Plant often responds to fungal pathogens by expressing a group of proteins known as pathogenesis-related proteins (PRs). The expression of PR is mediated through pathogen-induced signal-transduction pathways that are fine-tuned by phytohormones such as methyl jasmonate (MeJA). Here, we report functional characterization of an Ocimum basilicum PR5 family member (ObTLP1) that was identified from a MeJA-responsive expression sequence tag collection. ObTLP1 encodes a 226 amino acid polypeptide that showed sequence and structural similarities with a sweet-tasting protein thaumatin of Thaumatococcus danielli and also with a stress-responsive protein osmotin of Nicotiana tabacum. The expression of ObTLP1 in O. basilicum was found to be organ-preferential under unstressed condition, and responsive to biotic and abiotic stresses, and multiple phytohormone elicitations. Bacterially-expressed recombinant ObTLP1 inhibited mycelial growth of the phytopathogenic fungi, Scleretonia sclerotiorum and Botrytis cinerea; thereby, suggesting its antifungal activity. Ectopic expression of ObTLP1 in Arabidopsis led to enhanced tolerance to S. sclerotiorum and B. cinerea infections, and also to dehydration and salt stress. Moreover, induced expression of the defense marker genes suggested up-regulation of the defense-response pathways in ObTLP1-expressing Arabidopsis upon fungal challenge. Thus, ObTLP1 might be useful for providing tolerance to the fungal pathogens and abiotic stresses in crops.

Bone growth and turnover in progesterone receptor knockout mice.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rickard, David J.; Iwaniec, Urszula T.; Evans, Glenda

2008-05-01

The role of progesterone receptor (PR) signaling in skeletal metabolism is controversial. To address whether signaling through the PR is necessary for normal bone growth and turnover, we performed histomorphometric and mCT analyses of bone from homozygous female PR knockout (PRKO) mice at 6, 12, and 26 weeks of age. These mice possess a null mutation of the PR locus, which blocks the gene expression of A and B isoforms of PR. Body weight gain, uterine weight gain and tibia longitudinal bone growth was normal in PRKO mice. In contrast, total and cortical bone mass were increased in long bonesmore » of post-pubertal (12 and 26-week-old) PRKO mice, whereas cancellous bone mass was normal in the tibia but increased in the humerus. The striking 57% decrease in cancellous bone from the proximal tibia metaphysis which occurred between 6 and 26 weeks in WT mice was abolished in PRKO mice. The improved bone balance in aging PRKO mice was associated with elevated bone formation and a tendency toward reduced osteoclast perimeter. Taken together, these findings suggest that PR signaling in mice attenuates the accumulation of cortical bone mass during adolescence and is required for early age-related loss of cancellous bone.« less

Propagation of prion strains through specific conformers of the prion protein.

PubMed Central

Scott, M R; Groth, D; Tatzelt, J; Torchia, M; Tremblay, P; DeArmond, S J; Prusiner, S B

1997-01-01

Two prion strains with identical incubation periods in mice exhibited distinct incubation periods and different neuropathological profiles upon serial transmission to transgenic mice expressing chimeric Syrian hamster/mouse (MH2M) prion protein (PrP) genes [Tg(MH2M) mice] and subsequent transmission to Syrian hamsters. After transmission to Syrian hamsters, the Me7 strain was indistinguishable from the previously established Syrian hamster strain Sc237, despite having been derived from an independent ancestral source. This apparent convergence suggests that prion diversity may be limited. The Me7 mouse strain could also be transmitted directly to Syrian hamsters, but when derived in this way, its properties were distinct from those of Me7 passaged through Tg(MH2M) mice. The Me7 strain did not appear permanently altered in either case, since the original incubation period could be restored by effectively reversing the series of passages. Prion diversity enciphered in the conformation of the scrapie isoform of PrP (PrP(Sc)) (G. C. Telling et al., Science 274:2079-2082, 1996) seems to be limited by the sequence of the PrP substrates serially converted into PrP(Sc), while prions are propagated through interactions between the cellular and scrapie isoforms of PrP. PMID:9371560

Inferring nonlinear gene regulatory networks from gene expression data based on distance correlation.

PubMed

Guo, Xiaobo; Zhang, Ye; Hu, Wenhao; Tan, Haizhu; Wang, Xueqin

2014-01-01

Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs). It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC) has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI)-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC) curve and the precision-recall (PR) curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference.

Inferring Nonlinear Gene Regulatory Networks from Gene Expression Data Based on Distance Correlation

PubMed Central

Guo, Xiaobo; Zhang, Ye; Hu, Wenhao; Tan, Haizhu; Wang, Xueqin

2014-01-01

Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs). It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC) has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI)-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC) curve and the precision-recall (PR) curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference. PMID:24551058

Feeding by whiteflies suppresses downstream jasmonic acid signaling by eliciting salicylic acid signaling.

PubMed

Zhang, Peng-Jun; Li, Wei-Di; Huang, Fang; Zhang, Jin-Ming; Xu, Fang-Cheng; Lu, Yao-Bin

2013-05-01

Phloem-feeding whiteflies in the species complex Bemisia tabaci cause extensive crop damage worldwide. One of the reasons for their "success" is their ability to suppress the effectual jasmonic acid (JA) defenses of the host plant. However, little is understood about the mechanisms underlying whitefly suppression of JA-regulated defenses. Here, we showed that the expression of salicylic acid (SA)-responsive genes (EDS1 and PR1) in Arabidopsis thaliana was significantly enhanced during feeding by whitefly nymphs. Whereas upstream JA-responsive genes (LOX2 and OPR3) also were induced, the downstream JA-responsive gene (VSP1) was repressed, i.e., whiteflies only suppressed downstream JA signaling. Gene-expression analyses with various Arabidopsis mutants, including NahG, npr-1, ein2-1, and dde2-2, revealed that SA signaling plays a key role in the suppression of downstream JA defenses by whitefly feeding. Assays confirmed that SA activation enhanced whitefly performance by suppressing downstream JA defenses.

Proteinase 3 Is a Phosphatidylserine-binding Protein That Affects the Production and Function of Microvesicles.

PubMed

Martin, Katherine R; Kantari-Mimoun, Chahrazade; Yin, Min; Pederzoli-Ribeil, Magali; Angelot-Delettre, Fanny; Ceroi, Adam; Grauffel, Cédric; Benhamou, Marc; Reuter, Nathalie; Saas, Philippe; Frachet, Philippe; Boulanger, Chantal M; Witko-Sarsat, Véronique

2016-05-13

Proteinase 3 (PR3), the autoantigen in granulomatosis with polyangiitis, is expressed at the plasma membrane of resting neutrophils, and this membrane expression increases during both activation and apoptosis. Using surface plasmon resonance and protein-lipid overlay assays, this study demonstrates that PR3 is a phosphatidylserine-binding protein and this interaction is dependent on the hydrophobic patch responsible for membrane anchorage. Molecular simulations suggest that PR3 interacts with phosphatidylserine via a small number of amino acids, which engage in long lasting interactions with the lipid heads. As phosphatidylserine is a major component of microvesicles (MVs), this study also examined the consequences of this interaction on MV production and function. PR3-expressing cells produced significantly fewer MVs during both activation and apoptosis, and this reduction was dependent on the ability of PR3 to associate with the membrane as mutating the hydrophobic patch restored MV production. Functionally, activation-evoked MVs from PR3-expressing cells induced a significantly larger respiratory burst in human neutrophils compared with control MVs. Conversely, MVs generated during apoptosis inhibited the basal respiratory burst in human neutrophils, and those generated from PR3-expressing cells hampered this inhibition. Given that membrane expression of PR3 is increased in patients with granulomatosis with polyangiitis, MVs generated from neutrophils expressing membrane PR3 may potentiate oxidative damage of endothelial cells and promote the systemic inflammation observed in this disease. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Proteinase 3 Is a Phosphatidylserine-binding Protein That Affects the Production and Function of Microvesicles*

PubMed Central

Martin, Katherine R.; Kantari-Mimoun, Chahrazade; Yin, Min; Pederzoli-Ribeil, Magali; Angelot-Delettre, Fanny; Ceroi, Adam; Grauffel, Cédric; Benhamou, Marc; Reuter, Nathalie; Saas, Philippe; Frachet, Philippe; Boulanger, Chantal M.; Witko-Sarsat, Véronique

2016-01-01

Proteinase 3 (PR3), the autoantigen in granulomatosis with polyangiitis, is expressed at the plasma membrane of resting neutrophils, and this membrane expression increases during both activation and apoptosis. Using surface plasmon resonance and protein-lipid overlay assays, this study demonstrates that PR3 is a phosphatidylserine-binding protein and this interaction is dependent on the hydrophobic patch responsible for membrane anchorage. Molecular simulations suggest that PR3 interacts with phosphatidylserine via a small number of amino acids, which engage in long lasting interactions with the lipid heads. As phosphatidylserine is a major component of microvesicles (MVs), this study also examined the consequences of this interaction on MV production and function. PR3-expressing cells produced significantly fewer MVs during both activation and apoptosis, and this reduction was dependent on the ability of PR3 to associate with the membrane as mutating the hydrophobic patch restored MV production. Functionally, activation-evoked MVs from PR3-expressing cells induced a significantly larger respiratory burst in human neutrophils compared with control MVs. Conversely, MVs generated during apoptosis inhibited the basal respiratory burst in human neutrophils, and those generated from PR3-expressing cells hampered this inhibition. Given that membrane expression of PR3 is increased in patients with granulomatosis with polyangiitis, MVs generated from neutrophils expressing membrane PR3 may potentiate oxidative damage of endothelial cells and promote the systemic inflammation observed in this disease. PMID:26961880

Defense Response and Suppression of Phytophthora Blight Disease of Pepper by Water Extract from Spent Mushroom Substrate of Lentinula edodes

PubMed Central

Kang, Dae-Sun; Min, Kyong-Jin; Kwak, A-Min; Lee, Sang-Yeop; Kang, Hee-Wan

2017-01-01

The spent mushroom substrate (SMS) of Lentinula edodes that was derived from sawdust bag cultivation was used as materials for controlling Phytophthora blight disease of pepper. Water extract from SMS (WESMS) of L. edodes inhibited mycelial growth of Phytophthora capsici, suppressed Phytophthora blight disease of pepper seedlings by 65% and promoted growth of the plant over 30%. In high performance liquid chromatography (HPLC) analysis, oxalic acid was detected as the main organic acid compound in WESMS and inhibited the fungal mycelium at a minimum concentration of 200 mg/l. In quantitative real-time PCR, the transcriptional expression of CaBPR1 (PR protein 1), CaBGLU (β-1,3-glucanase), CaPR-4 (PR protein 4), and CaPR-10 (PR protein 10) were significantly enhanced on WESMS and DL-β-aminobutyric acid (BABA) treated pepper leaves. In addition, the salicylic acid content was also increased 4 to 6 folds in the WESMS and BABA treated pepper leaves compared to water treated leaf sample. These findings suggest that WESMS of L. edodes suppress Phytophthora blight disease of pepper through multiple effects including antifungal activity, plant growth promotion, and defense gene induction. PMID:28592945

Defense Response and Suppression of Phytophthora Blight Disease of Pepper by Water Extract from Spent Mushroom Substrate of Lentinula edodes.

PubMed

Kang, Dae-Sun; Min, Kyong-Jin; Kwak, A-Min; Lee, Sang-Yeop; Kang, Hee-Wan

2017-06-01

The spent mushroom substrate (SMS) of Lentinula edodes that was derived from sawdust bag cultivation was used as materials for controlling Phytophthora blight disease of pepper. Water extract from SMS (WESMS) of L. edodes inhibited mycelial growth of Phytophthora capsici , suppressed Phytophthora blight disease of pepper seedlings by 65% and promoted growth of the plant over 30%. In high performance liquid chromatography (HPLC) analysis, oxalic acid was detected as the main organic acid compound in WESMS and inhibited the fungal mycelium at a minimum concentration of 200 mg/l. In quantitative real-time PCR, the transcriptional expression of CaBPR1 (PR protein 1), CaBGLU (β-1,3-glucanase), CaPR-4 (PR protein 4), and CaPR-10 (PR protein 10) were significantly enhanced on WESMS and DL-β-aminobutyric acid (BABA) treated pepper leaves. In addition, the salicylic acid content was also increased 4 to 6 folds in the WESMS and BABA treated pepper leaves compared to water treated leaf sample. These findings suggest that WESMS of L. edodes suppress Phytophthora blight disease of pepper through multiple effects including antifungal activity, plant growth promotion, and defense gene induction.

Multi-chaperone function modulation and association with cytoskeletal proteins are key features of the function of AIP in the pituitary gland

PubMed Central

Hernández-Ramírez, Laura C.; Morgan, Rhodri M.L.; Barry, Sayka; D’Acquisto, Fulvio; Prodromou, Chrisostomos; Korbonits, Márta

2018-01-01

Despite the well-recognized role of loss-of-function mutations of the aryl hydrocarbon receptor interacting protein gene (AIP) predisposing to pituitary adenomas, the pituitary-specific function of this tumor suppressor remains an enigma. To determine the repertoire of interacting partners for the AIP protein in somatotroph cells, wild-type and variant AIP proteins were used for pull-down/quantitative mass spectrometry experiments against lysates of rat somatotropinoma-derived cells; relevant findings were validated by co-immunoprecipitation and co-localization. Global gene expression was studied in AIP mutation positive and negative pituitary adenomas via RNA microarrays. Direct interaction with AIP was confirmed for three known and six novel partner proteins. Novel interactions with HSPA5 and HSPA9, together with known interactions with HSP90AA1, HSP90AB1 and HSPA8, indicate that the function/stability of multiple chaperone client proteins could be perturbed by a deficient AIP co-chaperone function. Interactions with TUBB, TUBB2A, NME1 and SOD1 were also identified. The AIP variants p.R304* and p.R304Q showed impaired interactions with HSPA8, HSP90AB1, NME1 and SOD1; p.R304* also displayed reduced binding to TUBB and TUBB2A, and AIP-mutated tumors showed reduced TUBB2A expression. Our findings suggest that cytoskeletal organization, cell motility/adhesion, as well as oxidative stress responses, are functions that are likely to be involved in the tumor suppressor activity of AIP. PMID:29507682

Colonic mucosal gene expression and genotype in irritable bowel syndrome patients with normal or elevated fecal bile acid excretion

PubMed Central

Carlson, Paula; Acosta, Andres; Busciglio, Irene

2015-01-01

The mucosal gene expression in rectosigmoid mucosa (RSM) in irritable bowel syndrome with diarrhea (IBS-D) is unknown. Our objectives were, first, to study mRNA expression [by RT2 PCR of 19 genes pertaining to tight junctions, immune activation, intestinal ion transport and bile acid (BA) homeostasis] in RSM in IBS-D patients (n = 47) and healthy controls (n = 17) and study expression of a selected protein (PDZD3) in 10 IBS-D patients and 4 healthy controls; second, to assess RSM mRNA expression according to genotype and fecal BA excretion (high ≥2,337 μmol/48 h); and third, to determine whether genotype or mucosal mRNA expression is associated with colonic transit or BA parameters. Fold changes were corrected for false detection rate for 19 genes studied (P < 0.00263). In RSM in IBS-D patients compared with controls, mRNA expression of GUC2AB, PDZD3, and PR2Y4 was increased, whereas CLDN1 and FN1 were decreased. One immune-related gene was upregulated (C4BP4) and one downregulated (CCL20). There was increased expression of a selected ion transport protein (PDZD3) on immunohistochemistry and Western blot in IBS-D compared with controls (P = 0.02). There were no significant differences in mucosal mRNA in 20 IBS-D patients with high compared with 27 IBS-D patients with normal BA excretion. GPBAR1 (P < 0.05) was associated with colonic transit. We concluded that mucosal ion transport mRNA (for several genes and PDZD3 protein) is upregulated and barrier protein mRNA downregulated in IBS-D compared with healthy controls, independent of genotype. There are no differences in gene expression in IBS-D with high compared with normal fecal BA excretion. PMID:25930081

Colonic mucosal gene expression and genotype in irritable bowel syndrome patients with normal or elevated fecal bile acid excretion.

PubMed

Camilleri, Michael; Carlson, Paula; Acosta, Andres; Busciglio, Irene

2015-07-01

The mucosal gene expression in rectosigmoid mucosa (RSM) in irritable bowel syndrome with diarrhea (IBS-D) is unknown. Our objectives were, first, to study mRNA expression [by RT(2) PCR of 19 genes pertaining to tight junctions, immune activation, intestinal ion transport and bile acid (BA) homeostasis] in RSM in IBS-D patients (n = 47) and healthy controls (n = 17) and study expression of a selected protein (PDZD3) in 10 IBS-D patients and 4 healthy controls; second, to assess RSM mRNA expression according to genotype and fecal BA excretion (high ≥ 2,337 μmol/48 h); and third, to determine whether genotype or mucosal mRNA expression is associated with colonic transit or BA parameters. Fold changes were corrected for false detection rate for 19 genes studied (P < 0.00263). In RSM in IBS-D patients compared with controls, mRNA expression of GUC2AB, PDZD3, and PR2Y4 was increased, whereas CLDN1 and FN1 were decreased. One immune-related gene was upregulated (C4BP4) and one downregulated (CCL20). There was increased expression of a selected ion transport protein (PDZD3) on immunohistochemistry and Western blot in IBS-D compared with controls (P = 0.02). There were no significant differences in mucosal mRNA in 20 IBS-D patients with high compared with 27 IBS-D patients with normal BA excretion. GPBAR1 (P < 0.05) was associated with colonic transit. We concluded that mucosal ion transport mRNA (for several genes and PDZD3 protein) is upregulated and barrier protein mRNA downregulated in IBS-D compared with healthy controls, independent of genotype. There are no differences in gene expression in IBS-D with high compared with normal fecal BA excretion. Copyright © 2015 the American Physiological Society.

Vector platforms for gene therapy of inherited retinopathies

PubMed Central

Trapani, Ivana; Puppo, Agostina; Auricchio, Alberto

2014-01-01

Inherited retinopathies (IR) are common untreatable blinding conditions. Most of them are inherited as monogenic disorders, due to mutations in genes expressed in retinal photoreceptors (PR) and in retinal pigment epithelium (RPE). The retina’s compatibility with gene transfer has made transduction of different retinal cell layers in small and large animal models via viral and non-viral vectors possible. The ongoing identification of novel viruses as well as modifications of existing ones based either on rational design or directed evolution have generated vector variants with improved transduction properties. Dozens of promising proofs of concept have been obtained in IR animal models with both viral and non-viral vectors, and some of them have been relayed to clinical trials. To date, recombinant vectors based on the adeno-associated virus (AAV) represent the most promising tool for retinal gene therapy, given their ability to efficiently deliver therapeutic genes to both PR and RPE and their excellent safety and efficacy profiles in humans. However, AAVs’ limited cargo capacity has prevented application of the viral vector to treatments requiring transfer of genes with a coding sequence larger than 5 kb. Vectors with larger capacity, i.e. nanoparticles, adenoviral and lentiviral vectors are being exploited for gene transfer to the retina in animal models and, more recently, in humans. This review focuses on the available platforms for retinal gene therapy to fight inherited blindness, highlights their main strengths and examines the efforts to overcome some of their limitations. PMID:25124745

Progesterone receptor (PR) polyproline domain (PPD) mediates inhibition of epidermal growth factor receptor (EGFR) signaling in non-small cell lung cancer cells.

PubMed

Kawprasertsri, Sornsawan; Pietras, Richard J; Marquez-Garban, Diana C; Boonyaratanakornkit, Viroj

2016-05-01

Recent evidence has suggested a possible role for progesterone receptor (PR) in the progression of non-small cell lung cancer (NSCLC). However, little is known concerning roles of PR in NSCLC. PR contains a polyproline domain (PPD), which directly binds to the SH3 domain of signaling molecules. Because PPD-SH3 interactions are essential for EGFR signaling, we hypothesized that the presence of PR-PPD interfered with EGFR-mediated signaling and cell proliferation. We examined the role of PR-PPD in cell proliferation and signaling by stably expressing PR-B, or PR-B with disrupting mutations in the PPD (PR-BΔSH3), from a tetracycline-regulated promoter in A549 NSCLC cells. PR-B dose-dependently inhibited cell growth in the absence of ligand, and progestin (R5020) treatment further suppressed the growth. Treatment with RU486 abolished PR-B- and R5020-mediated inhibition of cell proliferation. Expression of PR-BΔSH3 and treatment with R5020 or RU486 had no effect on cell proliferation. Furthermore, PR-B expression but not PR-BΔSH3 expression reduced EGF-induced A549 proliferation and activation of ERK1/2, in the absence of ligand. Taken together, our data demonstrated the significance of PR extranuclear signaling through PPD interactions in EGFR-mediated proliferation and signaling in NSCLC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Spontaneous Generation of Infectious Prion Disease in Transgenic Mice

PubMed Central

Castilla, Joaquín; Pintado, Belén; Gutiérrez-Adan, Alfonso; Andréoletti, Olivier; Aguilar-Calvo, Patricia; Arroba, Ana-Isabel; Parra-Arrondo, Beatriz; Ferrer, Isidro; Manzanares, Jorge; Espinosa, Juan-Carlos

2013-01-01

We generated transgenic mice expressing bovine cellular prion protein (PrPC) with a leucine substitution at codon 113 (113L). This protein is homologous to human protein with mutation 102L, and its genetic link with Gerstmann–Sträussler–Scheinker syndrome has been established. This mutation in bovine PrPC causes a fully penetrant, lethal, spongiform encephalopathy. This genetic disease was transmitted by intracerebral inoculation of brain homogenate from ill mice expressing mutant bovine PrP to mice expressing wild-type bovine PrP, which indicated de novo generation of infectious prions. Our findings demonstrate that a single amino acid change in the PrPC sequence can induce spontaneous generation of an infectious prion disease that differs from all others identified in hosts expressing the same PrPC sequence. These observations support the view that a variety of infectious prion strains might spontaneously emerge in hosts displaying random genetic PrPC mutations. PMID:24274622

Identification and functional characterization of the soybean GmaPPO12 promoter conferring Phytophthora sojae induced expression.

PubMed

Chai, Chunyue; Lin, Yanling; Shen, Danyu; Wu, Yuren; Li, Hongjuan; Dou, Daolong

2013-01-01

Identification of pathogen-inducible promoters largely lags behind cloning of the genes for disease resistance. Here, we cloned the soybean GmaPPO12 gene and found that it was rapidly and strongly induced by Phytophthorasojae infection. Computational analysis revealed that its promoter contained many known cis-elements, including several defense related transcriptional factor-binding boxes. We showed that the promoter could mediate induction of GUS expression upon infection in both transient expression assays in Nicotianabenthamiana and stable transgenic soybean hairy roots. Importantly, we demonstrated that pathogen-induced expression of the GmaPPO12 promoter was higher than that of the soybean GmaPR1a promoter. A progressive 5' and 3' deletion analysis revealed two fragments that were essential for promoter activity. Thus, the cloned promoter could be used in transgenic plants to enhance resistance to phytophthora pathogens, and the identified fragment could serve as a candidate to produce synthetic pathogen-induced promoters.

Gene and pathway level analyses of germline DNA-repair gene variants and prostate cancer susceptibility using the iCOGS-genotyping array.

PubMed

Saunders, Edward J; Dadaev, Tokhir; Leongamornlert, Daniel A; Al Olama, Ali Amin; Benlloch, Sara; Giles, Graham G; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A; Schleutker, Johanna; Nordestgaard, Borge G; Travis, Ruth C; Neal, David; Pasayan, Nora; Khaw, Kay-Tee; Stanford, Janet L; Blot, William J; Thibodeau, Stephen N; Maier, Christiane; Kibel, Adam S; Cybulski, Cezary; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y; Kaneva, Radka; Batra, Jyotsna; Teixeira, Manuel R; Pandha, Hardev; Govindasami, Koveela; Muir, Ken; Easton, Douglas F; Eeles, Rosalind A; Kote-Jarai, Zsofia

2016-04-12

Germline mutations within DNA-repair genes are implicated in susceptibility to multiple forms of cancer. For prostate cancer (PrCa), rare mutations in BRCA2 and BRCA1 give rise to moderately elevated risk, whereas two of B100 common, low-penetrance PrCa susceptibility variants identified so far by genome-wide association studies implicate RAD51B and RAD23B. Genotype data from the iCOGS array were imputed to the 1000 genomes phase 3 reference panel for 21 780 PrCa cases and 21 727 controls from the Prostate Cancer Association Group to Investigate Cancer Associated Alterations in the Genome (PRACTICAL) consortium. We subsequently performed single variant, gene and pathway-level analyses using 81 303 SNPs within 20 Kb of a panel of 179 DNA-repair genes. Single SNP analyses identified only the previously reported association with RAD51B. Gene-level analyses using the SKAT-C test from the SNP-set (Sequence) Kernel Association Test (SKAT) identified a significant association with PrCa for MSH5. Pathway-level analyses suggested a possible role for the translesion synthesis pathway in PrCa risk and Homologous recombination/Fanconi Anaemia pathway for PrCa aggressiveness, even though after adjustment for multiple testing these did not remain significant. MSH5 is a novel candidate gene warranting additional follow-up as a prospective PrCa-risk locus. MSH5 has previously been reported as a pleiotropic susceptibility locus for lung, colorectal and serous ovarian cancers.

Cloning and functional characterization of three new pheromone receptors from the diamondback moth, Plutella xylostella.

PubMed

Liu, Yipeng; Liu, Yang; Jiang, Xingchuan; Wang, Guirong

The highly specialized olfactory receptor neurons (ORNs) on the antennae of male moths can recognize blends of several pheromone components. In previous studies, a total of six candidate pheromone receptor (PR) genes were cloned and functionally characterized in the diamondback moth, Plutella xylostella. In the present work, we report on three novel candidate pheromone receptor genes: PxylOR8, PxylOR41, and PxylOR45 in the same species. Gene expression analysis revealed that PxylOR8 is specifically expressed in female adult antennae, while PxylOR41 and PxylOR45 are expressed in antennae in both sexes, but with a male bias. In situ hybridization revealed that PxylOR8, PxylOR41 and PxylOR45 are localized in long trichoid sensilla. Functional analyses on the three pheromone receptor genes were then performed using the heterologous expression system of Xenopus oocytes. PxylOR41 was tuned to two minor pheromone components Z9-14:Ac, Z9-14:OH, and their analog Z9-14:Ald. PxylOR8 and PxylOR45 did not respond to any tested pheromone components and analogs. These results may contribute to clarifying how pheromone detection works in P. xylostella. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genome Wide Methylome Alterations in Lung Cancer.

PubMed

Mullapudi, Nandita; Ye, Bin; Suzuki, Masako; Fazzari, Melissa; Han, Weiguo; Shi, Miao K; Marquardt, Gaby; Lin, Juan; Wang, Tao; Keller, Steven; Zhu, Changcheng; Locker, Joseph D; Spivack, Simon D

2015-01-01

Aberrant cytosine 5-methylation underlies many deregulated elements of cancer. Among paired non-small cell lung cancers (NSCLC), we sought to profile DNA 5-methyl-cytosine features which may underlie genome-wide deregulation. In one of the more dense interrogations of the methylome, we sampled 1.2 million CpG sites from twenty-four NSCLC tumor (T)-non-tumor (NT) pairs using a methylation-sensitive restriction enzyme- based HELP-microarray assay. We found 225,350 differentially methylated (DM) sites in adenocarcinomas versus adjacent non-tumor tissue that vary in frequency across genomic compartment, particularly notable in gene bodies (GB; p<2.2E-16). Further, when DM was coupled to differential transcriptome (DE) in the same samples, 37,056 differential loci in adenocarcinoma emerged. Approximately 90% of the DM-DE relationships were non-canonical; for example, promoter DM associated with DE in the same direction. Of the canonical changes noted, promoter (PR) DM loci with reciprocal changes in expression in adenocarcinomas included HBEGF, AGER, PTPRM, DPT, CST1, MELK; DM GB loci with concordant changes in expression included FOXM1, FERMT1, SLC7A5, and FAP genes. IPA analyses showed adenocarcinoma-specific promoter DMxDE overlay identified familiar lung cancer nodes [tP53, Akt] as well as less familiar nodes [HBEGF, NQO1, GRK5, VWF, HPGD, CDH5, CTNNAL1, PTPN13, DACH1, SMAD6, LAMA3, AR]. The unique findings from this study include the discovery of numerous candidate The unique findings from this study include the discovery of numerous candidate methylation sites in both PR and GB regions not previously identified in NSCLC, and many non-canonical relationships to gene expression. These DNA methylation features could potentially be developed as risk or diagnostic biomarkers, or as candidate targets for newer methylation locus-targeted preventive or therapeutic agents.

Plant hormones in defense response of Brassica napus to Sclerotinia sclerotiorum - reassessing the role of salicylic acid in the interaction with a necrotroph.

PubMed

Nováková, Miroslava; Sašek, Vladimír; Dobrev, Petre I; Valentová, Olga; Burketová, Lenka

2014-07-01

According to general model, jasmonic acid (JA) and ethylene (ET) signaling pathways are induced in Arabidopsis after an attack of necrotroph, Sclerotinia sclerotiorum (Lib.) de Bary. However, abscisic acid (ABA) and salicylic acid (SA) also seem to play a role. While signaling events in Arabidopsis have been intensively studied recently, information for the natural host Brassica napus is limited. In this study, multiple plant hormone quantification and expression analysis of marker genes of the signaling pathways was used to gain a complete view of the interaction of B. napus with S. sclerotiorum. Strong response of ET biosynthetic gene ACS2 was observed, accompanied by increases of SA and JA levels that correspond to the elevated expression of marker genes PR1 and LOX3. Interestingly, the level of ABA and the expression of its marker gene RD26 were also elevated. Furthermore, induction of the SA-dependent defense decreased disease symptoms. In addition, SA signaling is suggested as a possible target for manipulation by S. sclerotiorum. A gene for putative chorismate mutase SS1G_14320 was identified that is highly expressed during infection but not in vitro. Our results bring the evidence of SA involvement in the interaction of plant with the necrotroph that conflict with the current model. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Cellular Prion Protein Combined with Galectin-3 and -6 Affects the Infectivity Titer of an Endogenous Retrovirus Assayed in Hippocampal Neuronal Cells

PubMed Central

Shin, Hae-Young; Goto, Joy J.; Carp, Richard I.; Choi, Eun-Kyoung; Kim, Yong-Sun

2016-01-01

Prion diseases are infectious and fatal neurodegenerative diseases which require the cellular prion protein, PrPC, for development of diseases. The current study shows that the PrPC augments infectivity and plaque formation of a mouse endogenous retrovirus, MuLV. We have established four neuronal cell lines expressing mouse PrPC, PrP+/+; two express wild type PrPC (MoPrPwild) and the other two express mutant PrPC (MoPrPmut). Infection of neuronal cells from various PrP+/+ and PrP-/- (MoPrPKO) lines with MuLV yielded at least three times as many plaques in PrP+/+ than in PrP-/-. Furthermore, among the four PrP+/+ lines, one mutant line, P101L, had at least 2.5 times as many plaques as the other three PrP+/+ lines. Plaques in P101L were four times larger than those in other PrP+/+ lines. Colocalization of PrP and CAgag was seen in MuLV-infected PrP+/+ cells. In the PrP-MuLV interaction, the involvement of galectin-3 and -6 was observed by immunoprecipitation with antibody to PrPC. These results suggest that PrPC combined with galectin-3 and -6 can act as a receptor for MuLV. P101L, the disease form of mutant PrPC results suggest the genetic mutant form of PrPC may be more susceptible to viral infection. PMID:27936017

Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection.

PubMed

Wang, Yiming; Kwon, Soon Jae; Wu, Jingni; Choi, Jaeyoung; Lee, Yong-Hwan; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Rakwal, Randeep; Park, Sang-Ryeol; Kim, Beom-Gi; Jung, Ki-Hong; Kang, Kyu Young; Kim, Sang Gon; Kim, Sun Tae

2014-12-01

Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L.) in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10) by RT-PCR, and phytoalexins (sakuranetin and momilactone A) with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05) in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

[Regulatory effect and mechanism of RNA binding motif protein 38 on the expression of progesterone receptor in human breast cancer ZR-75-1 cells].

PubMed

Lou, P P; Li, C L; Xia, T S; Shi, L; Wu, J; Zhou, X J; Wang, Y; Ding, Q

2016-06-23

To investigate the regulatory mechanism of RNA binding motif protein 38 (RNPC1) on the expression of progesterone receptor (PR) in breast cancer cell line ZR-75-1. Lentiviral vector was used to induce overexpression of RNPC1 in ZR-75-1 cells. qRT-PCR and Western blot were used to assess the regulatory effect of RNPC1 on PR expression. Actinomycin was used to detect the regulatory mechanism involved. Immunohistochemical (IHC) staining was used to determine the protein expression of RNPC1 and PR in 80 breast cancer tissues. IHC staining showed that the expression of RNPC1 was significantly higher in the PR positive breast cancer tissues than that in the PR negative breast cancer tissues (P<0.05). The qRT-PCR results showed that overexpression of RNPC1 in ZR-75-1 cells significantly upregulated the mRNA level of PR (1.764±0.028 vs. 1.001±0.037, P<0.01), whereas knockdown of RNPC1 did the opposite (0.579± 0.007 vs. 1.000±0.002, P<0.01). The Western blot results also showed that overexpression of RNPC1 up-regulated PR levels, while knockdown of RNPC1 resulted in down-regulation of PR levels in the ZR-75-1 cells.The actinomycin assay showed that overexpression of RNPC1 increased the mRNA stability of PR. The half-life of PR mRNA was increased from 4.0 h to 6.5 h. Knockdown of RNPC1 decreased the mRNA stability of PR and the half-life of PR transcript was decreased from 4.1 h to 3.0 h. RNPC1 plays a crucial role in regulating the expression of PR in breast cancer ZR-75-1 cells.

Silencing of sterol glycosyltransferases modulates the withanolide biosynthesis and leads to compromised basal immunity of Withania somnifera

PubMed Central

Singh, Gaurav; Tiwari, Manish; Singh, Surendra Pratap; Singh, Surendra; Trivedi, Prabodh Kumar; Misra, Pratibha

2016-01-01

Sterol glycosyltransferases (SGTs) catalyse transfer of glycon moiety to sterols and their related compounds to produce diverse glyco-conjugates or steryl glycosides with different biological and pharmacological activities. Functional studies of SGTs from Withania somnifera indicated their role in abiotic stresses but details about role under biotic stress are still unknown. Here, we have elucidated the function of SGTs by silencing SGTL1, SGTL2 and SGTL4 in Withania somnifera. Down-regulation of SGTs by artificial miRNAs led to the enhanced accumulation of withanolide A, withaferin A, sitosterol, stigmasterol and decreased content of withanoside V in Virus Induced Gene Silencing (VIGS) lines. This was further correlated with increased expression of WsHMGR, WsDXR, WsFPPS, WsCYP710A1, WsSTE1 and WsDWF5 genes, involved in withanolide biosynthesis. These variations of withanolide concentrations in silenced lines resulted in pathogen susceptibility as compared to control plants. The infection of Alternaria alternata causes increased salicylic acid, callose deposition, superoxide dismutase and H2O2 in aMIR-VIGS lines. The expression of biotic stress related genes, namely, WsPR1, WsDFS, WsSPI and WsPR10 were also enhanced in aMIR-VIGS lines in time dependent manner. Taken together, our observations revealed that a positive feedback regulation of withanolide biosynthesis occurred by silencing of SGTLs which resulted in reduced biotic tolerance. PMID:27146059

Positive and negative roles for soybean MPK6 in regulating defense responses.

PubMed

Liu, Jian-Zhong; Braun, Edward; Qiu, Wen-Li; Shi, Ya-Fei; Marcelino-Guimarães, Francismar C; Navarre, Duroy; Hill, John H; Whitham, Steven A

2014-08-01

It has been well established that MPK6 is a positive regulator of defense responses in model plants such as Arabidopsis and tobacco. However, the functional importance of soybean MPK6 in disease resistance has not been investigated. Here, we showed that silencing of GmMPK6 in soybean using virus-induced gene silencing mediated by Bean pod mottle virus (BPMV) caused stunted growth and spontaneous cell death on the leaves, a typical phenotype of activated defense responses. Consistent with this phenotype, expression of pathogenesis-related (PR) genes and the conjugated form of salicylic acid were significantly increased in GmMPK6-silenced plants. As expected, GmMPK6-silenced plants were more resistant to downy mildew and Soybean mosaic virus compared with vector control plants, indicating a negative role of GmMPK6 in disease resistance. Interestingly, overexpression of GmMPK6, either transiently in Nicotiana benthamiana or stably in Arabidopsis, resulted in hypersensitive response (HR)-like cell death. The HR-like cell death was accompanied by increased PR gene expression, suggesting that GmMPK6, like its counterpart in other plant species, also plays a positive role in cell death induction and defense response. Using bimolecular fluorescence complementation analysis, we determined that GmMKK4 might function upstream of GmMPK6 and GmMKK4 could interact with GmMPK6 independent of its phosphorylation status. Taken together, our results indicate that GmMPK6 functions as both repressor and activator in defense responses of soybean.

Ethanolic extract of dandelion (Taraxacum mongolicum) induces estrogenic activity in MCF-7 cells and immature rats.

PubMed

Oh, Seung Min; Kim, Ha Ryong; Park, Yong Joo; Lee, Yong Hwa; Chung, Kyu Hyuck

2015-11-01

Plants of the genus Taraxacum, commonly known as dandelions, are used to treat breast cancer in traditional folk medicine. However, their use has mainly been based on empirical findings without sufficient scientific evidence. Therefore, we hypothesized that dandelions would behave as a Selective estrogen receptor modulator (SERM) and be effective as hormone replacement therapy (HRT) in the postmenopausal women. In the present study, in vitro assay systems, including cell proliferation assay, reporter gene assay, and RT-PCR to evaluate the mRNA expression of estrogen-related genes (pS2 and progesterone receptor, PR), were performed in human breast cancer cells. Dandelion ethanol extract (DEE) significantly increased cell proliferation and estrogen response element (ERE)-driven luciferase activity. DEE significantly induced the expression of estrogen related genes such as pS2 and PR, which was inhibited by tamoxifen at 1 μmol·L(-1). These results indicated that DEE could induce estrogenic activities mediated by a classical estrogen receptor pathway. In addition, immature rat uterotrophic assay was carried out to identify estrogenic activity of DEE in vivo. The lowest concentration of DEE slightly increased the uterine wet weight, but there was no significant effect with the highest concentration of DEE. The results demonstrate the potential estrogenic activities of DEE, providing scientific evidence supporting their use in traditional medicine. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR-Positive Mammary Tumors Connecting Metabolism and Carcinogenesis Mitochondrial Tumor Suppressor. Revision

DTIC Science & Technology

2013-11-01

dependent gene expression, as shown by co-transfection assays using an HRE luciferase reporter (Fig. 4b, bar 1 vs. 2). In addition, exposure to NAC...transfected with p3x- HRE -luciferase with or without NAC or stigmatellin and 40 hours afterwards luciferase levels were determined. (c) MTCLT3

SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR Positive Mammary Tumors Connecting Metabolism and Carcinogenesis

DTIC Science & Technology

2011-09-01

as well as HIF-1 dependent gene expression, as shown by co-transfection assays using an HRE luciferase reporter (Fig. 4b, bar 1 vs. 2). In...antibody. (b) MEFs were co-transfected with p3x- HRE -luciferase with or without NAC or stigmatellin and 40 hours afterwards luciferase levels were

Gestational Protein Restriction Reduces Expression of Hsd17b2 in Rat Placental Labyrinth1

PubMed Central

Gao, Haijun; Yallampalli, Uma; Yallampalli, Chandra

2012-01-01

ABSTRACT Accumulating evidence strongly supports the premise that testosterone may be a key player in fetal programming on hypertension. Studies have shown that gestational protein restriction doubles the plasma testosterone levels in pregnant rats. In this study, we hypothesized that elevated testosterone levels in response to gestational protein restriction were caused by enhanced expression of steroidogenic enzymes or impaired expression of Hsd17b2, a known testosterone inactivator that converts testosterone to androstenedione in placenta. Pregnant Sprague-Dawley rats were fed normal (20% protein, control; n = 10) or a low-protein diet (6% protein, PR; n = 10) from Day 1 of pregnancy until killed at Days 14, 18, or 21. Junctional (JZ) and labyrinth (LZ) zones of placenta were collected for expression assay on steroidogenic genes (Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b2, and Srd5a1) by real-time PCR. The main findings include the following: 1) expressions of Cyp11a1, Hsd3b1, and Cyp17a1 in JZ were not affected by diet but were affected by day of pregnancy; 2) expression of Hsd17b2 in both female and male JZs was remarkably increased by PR at Days 18 and 21 of pregnancy; 3) expressions of Hsd17b2 were reduced by PR in both female and male LZ at Day 18 of pregnancy and in female LZ at Day 21 of pregnancy; and 4) expression of Srd5a1in LZ was not affected by day of pregnancy, gender, or diet. These results indicate that in response to gestational protein restriction, Hsd17b2 may be a key regulator of testosterone levels and associated activities in placental zones, apparently in a paradoxical manner. PMID:22837477

A novel PRNP Y218N mutation in Gerstmann-Sträussler-Scheinker disease with neurofibrillary degeneration.

PubMed

Alzualde, Ainhoa; Indakoetxea, Begoña; Ferrer, Isidre; Moreno, Fermin; Barandiaran, Myriam; Gorostidi, Ana; Estanga, Ainara; Ruiz, Irune; Calero, Miguel; van Leeuwen, Fred W; Atares, Begoña; Juste, Ramón; Rodriguez-Martínez, Ana Belén; López de Munain, Adolfo

2010-08-01

Gerstmann-Sträussler-Scheinker (GSS) disease is a prion disease associated with prion protein gene (PRNP) mutations. We report a novel PRNP mutation (Y218N) associated with GSS disease in a pathologically confirmed case and in two other affected family members. The clinical features of these cases met criteria for possible Alzheimer disease and possible frontotemporal dementia. Neuropathologic analysis revealed deposition of proteinase K-resistant prion protein (PrP(res)), widespread hyperphosphorylated tau pathology, abnormal accumulation of mitochondria in the vicinity of PrP deposits, and expression of mutant ubiquitin (UBB(+1)) in neurofibrillary tangles and dystrophic neurites. Prion protein immunoblotting using 3F4 and 1E4 antibodies disclosed multiple bands ranging from approximately 20 kd to 80 kd and lower bands of 15 kd and approximately 10 kd, the latter only seen after a long incubation. These bands were partially resistant to proteinase K pretreatment. This pattern differs from those seen in Creutzfeldt-Jakob disease andresembles those reported in other GSS cases. The approximately 10kd band was recognized with anti-PrP C-terminus antibodies but not with anti-N terminus antibodies, suggesting PrP truncation at the N terminal. This new mutation extends the list of known mutations responsible for GSS disease and reinforces its clinical heterogeneity. Genetic examination of the PRNP gene should be included in the workup of patients with poorly classifiable dementia.

Hydrogen peroxide generation by the pepper extracellular peroxidase CaPO2 activates local and systemic cell death and defense response to bacterial pathogens.

PubMed

Choi, Hyong Woo; Kim, Young Jin; Lee, Sung Chul; Hong, Jeum Kyu; Hwang, Byung Kook

2007-11-01

Reactive oxygen species (ROS) are responsible for mediating cellular defense responses in plants. Controversy has existed over the origin of ROS in plant defense. We have isolated a novel extracellular peroxidase gene, CaPO2, from pepper (Capsicum annuum). Local or systemic expression of CaPO2 is induced in pepper by avirulent Xanthomonas campestris pv vesicatoria (Xcv) infection. We examined the function of the CaPO2 gene in plant defense using the virus-induced gene silencing technique and gain-of-function transgenic plants. CaPO2-silenced pepper plants were highly susceptible to Xcv infection. Virus-induced gene silencing of the CaPO2 gene also compromised hydrogen peroxide (H(2)O(2)) accumulation and hypersensitive cell death in leaves, both locally and systemically, during avirulent Xcv infection. In contrast, overexpression of CaPO2 in Arabidopsis (Arabidopsis thaliana) conferred enhanced disease resistance accompanied by cell death, H(2)O(2) accumulation, and PR gene induction. In CaPO2-overexpression Arabidopsis leaves infected by Pseudomonas syringae pv tomato, H(2)O(2) generation was sensitive to potassium cyanide (a peroxidase inhibitor) but insensitive to diphenylene iodonium (an NADPH oxidase inhibitor), suggesting that H(2)O(2) generation depends on peroxidase in Arabidopsis. Together, these results indicate that the CaPO2 peroxidase is involved in ROS generation, both locally and systemically, to activate cell death and PR gene induction during the defense response to pathogen invasion.

Entry of Herpes Simplex Virus Type 1 (HSV-1) into the Distal Axons of Trigeminal Neurons Favors the Onset of Nonproductive, Silent Infection

PubMed Central

Eing, Bodo R.; Müller, Marcus; King, Nicholas J. C.; Klupp, Barbara; Mettenleiter, Thomas C.; Kühn, Joachim E.

2012-01-01

Following productive, lytic infection in epithelia, herpes simplex virus type 1 (HSV-1) establishes a lifelong latent infection in sensory neurons that is interrupted by episodes of reactivation. In order to better understand what triggers this lytic/latent decision in neurons, we set up an organotypic model based on chicken embryonic trigeminal ganglia explants (TGEs) in a double chamber system. Adding HSV-1 to the ganglion compartment (GC) resulted in a productive infection in the explants. By contrast, selective application of the virus to distal axons led to a largely nonproductive infection that was characterized by the poor expression of lytic genes and the presence of high levels of the 2.0-kb major latency-associated transcript (LAT) RNA. Treatment of the explants with the immediate-early (IE) gene transcriptional inducer hexamethylene bisacetamide, and simultaneous co-infection of the GC with HSV-1, herpes simplex virus type 2 (HSV-2) or pseudorabies virus (PrV) helper virus significantly enhanced the ability of HSV-1 to productively infect sensory neurons upon axonal entry. Helper-virus-induced transactivation of HSV-1 IE gene expression in axonally-infected TGEs in the absence of de novo protein synthesis was dependent on the presence of functional tegument protein VP16 in HSV-1 helper virus particles. After the establishment of a LAT-positive silent infection in TGEs, HSV-1 was refractory to transactivation by superinfection of the GC with HSV-1 but not with HSV-2 and PrV helper virus. In conclusion, the site of entry appears to be a critical determinant in the lytic/latent decision in sensory neurons. HSV-1 entry into distal axons results in an insufficient transactivation of IE gene expression and favors the establishment of a nonproductive, silent infection in trigeminal neurons. PMID:22589716

The evolutionary dynamics of variant antigen genes in Babesia reveal a history of genomic innovation underlying host–parasite interaction

PubMed Central

Jackson, Andrew P.; Otto, Thomas D.; Darby, Alistair; Ramaprasad, Abhinay; Xia, Dong; Echaide, Ignacio Eduardo; Farber, Marisa; Gahlot, Sunayna; Gamble, John; Gupta, Dinesh; Gupta, Yask; Jackson, Louise; Malandrin, Laurence; Malas, Tareq B.; Moussa, Ehab; Nair, Mridul; Reid, Adam J.; Sanders, Mandy; Sharma, Jyotsna; Tracey, Alan; Quail, Mike A.; Weir, William; Wastling, Jonathan M.; Hall, Neil; Willadsen, Peter; Lingelbach, Klaus; Shiels, Brian; Tait, Andy; Berriman, Matt; Allred, David R.; Pain, Arnab

2014-01-01

Babesia spp. are tick-borne, intraerythrocytic hemoparasites that use antigenic variation to resist host immunity, through sequential modification of the parasite-derived variant erythrocyte surface antigen (VESA) expressed on the infected red blood cell surface. We identified the genomic processes driving antigenic diversity in genes encoding VESA (ves1) through comparative analysis within and between three Babesia species, (B. bigemina, B. divergens and B. bovis). Ves1 structure diverges rapidly after speciation, notably through the evolution of shortened forms (ves2) from 5′ ends of canonical ves1 genes. Phylogenetic analyses show that ves1 genes are transposed between loci routinely, whereas ves2 genes are not. Similarly, analysis of sequence mosaicism shows that recombination drives variation in ves1 sequences, but less so for ves2, indicating the adoption of different mechanisms for variation of the two families. Proteomic analysis of the B. bigemina PR isolate shows that two dominant VESA1 proteins are expressed in the population, whereas numerous VESA2 proteins are co-expressed, consistent with differential transcriptional regulation of each family. Hence, VESA2 proteins are abundant and previously unrecognized elements of Babesia biology, with evolutionary dynamics consistently different to those of VESA1, suggesting that their functions are distinct. PMID:24799432

Hematological shift in goat kids naturally devoid of prion protein.

PubMed

Reiten, Malin R; Bakkebø, Maren K; Brun-Hansen, Hege; Lewandowska-Sabat, Anna M; Olsaker, Ingrid; Tranulis, Michael A; Espenes, Arild; Boysen, Preben

2015-01-01

The physiological role of the cellular prion protein (PrP(C)) is incompletely understood. The expression of PrP(C) in hematopoietic stem cells and immune cells suggests a role in the development of these cells, and in PrP(C) knockout animals altered immune cell proliferation and phagocytic function have been observed. Recently, a spontaneous nonsense mutation at codon 32 in the PRNP gene in goats of the Norwegian Dairy breed was discovered, rendering homozygous animals devoid of PrP(C). Here we report hematological and immunological analyses of homozygous goat kids lacking PrP(C) (PRNP(Ter/Ter) ) compared to heterozygous (PRNP (+/Ter)) and normal (PRNP (+/+)) kids. Levels of cell surface PrP(C) and PRNP mRNA in peripheral blood mononuclear cells (PBMCs) correlated well and were very low in PRNP (Ter/Ter), intermediate in PRNP (+/Ter) and high in PRNP (+/+) kids. The PRNP (Ter/Ter) animals had a shift in blood cell composition with an elevated number of red blood cells (RBCs) and a tendency toward a smaller mean RBC volume (P = 0.08) and an increased number of neutrophils (P = 0.068), all values within the reference ranges. Morphological investigations of blood smears and bone marrow imprints did not reveal irregularities. Studies of relative composition of PBMCs, phagocytic ability of monocytes and T-cell proliferation revealed no significant differences between the genotypes. Our data suggest that PrP(C) has a role in bone marrow physiology and warrant further studies of PrP(C) in erythroid and immune cell progenitors as well as differentiated effector cells also under stressful conditions. Altogether, this genetically unmanipulated PrP(C)-free animal model represents a unique opportunity to unveil the enigmatic physiology and function of PrP(C).

PKCλ/ι signaling promotes triple-negative breast cancer growth and metastasis.

PubMed

Paul, A; Gunewardena, S; Stecklein, S R; Saha, B; Parelkar, N; Danley, M; Rajendran, G; Home, P; Ray, S; Jokar, I; Vielhauer, G A; Jensen, R A; Tawfik, O; Paul, S

2014-09-01

Triple-negative breast cancer (TNBC) is a distinct breast cancer subtype defined by the absence of estrogen receptor (ER), progesterone receptor (PR) and epidermal growth factor receptor 2 (HER2/neu), and the patients with TNBC are often diagnosed with higher rates of recurrence and metastasis. Because of the absence of ER, PR and HER2/neu expressions, TNBC patients are insensitive to HER2-directed and endocrine therapies available for breast cancer treatment. Here, we report that expression of atypical protein kinase C isoform, PKCλ/ι, significantly increased and activated in all invasive breast cancer (invasive ductal carcinoma or IDC) subtypes including the TNBC subtype. Because of the lack of targeted therapies for TNBC, we choose to study PKCλ/ι signaling as a potential therapeutic target for TNBC. Our observations indicated that PKCλ/ι signaling is highly active during breast cancer invasive progression, and metastatic breast cancers, the advanced stages of breast cancer disease that developed more frequently in TNBC patients, are also characterized with high levels of PKCλ/ι expression and activation. Functional analysis in experimental mouse models revealed that depletion of PKCλ/ι significantly reduces TNBC growth as well as lung metastatic colonization. Furthermore, we have identified a PKCλ/ι-regulated gene signature consisting of 110 genes, which are significantly associated with indolent to invasive progression of human breast cancer and poor prognosis. Mechanistically, cytokines such as TGFβ and IL1β could activate PKCλ/ι signaling in TNBC cells and depletion of PKCλ/ι impairs NF-κB p65 (RelA) nuclear localization. We observed that cytokine-PKCλ/ι-RelA signaling axis, at least in part, involved in modulating gene expression to regulate invasion of TNBC cells. Overall, our results indicate that induction and activation of PKCλ/ι promote TNBC growth, invasion and metastasis. Thus, targeting PKCλ/ι signaling could be a therapeutic option for breast cancer, including the TNBC subtype.

PKCλ/ι signaling promotes triple-negative breast cancer growth and metastasis

PubMed Central

Paul, A; Gunewardena, S; Stecklein, S R; Saha, B; Parelkar, N; Danley, M; Rajendran, G; Home, P; Ray, S; Jokar, I; Vielhauer, G A; Jensen, R A; Tawfik, O; Paul, S

2014-01-01

Triple-negative breast cancer (TNBC) is a distinct breast cancer subtype defined by the absence of estrogen receptor (ER), progesterone receptor (PR) and epidermal growth factor receptor 2 (HER2/neu), and the patients with TNBC are often diagnosed with higher rates of recurrence and metastasis. Because of the absence of ER, PR and HER2/neu expressions, TNBC patients are insensitive to HER2-directed and endocrine therapies available for breast cancer treatment. Here, we report that expression of atypical protein kinase C isoform, PKCλ/ι, significantly increased and activated in all invasive breast cancer (invasive ductal carcinoma or IDC) subtypes including the TNBC subtype. Because of the lack of targeted therapies for TNBC, we choose to study PKCλ/ι signaling as a potential therapeutic target for TNBC. Our observations indicated that PKCλ/ι signaling is highly active during breast cancer invasive progression, and metastatic breast cancers, the advanced stages of breast cancer disease that developed more frequently in TNBC patients, are also characterized with high levels of PKCλ/ι expression and activation. Functional analysis in experimental mouse models revealed that depletion of PKCλ/ι significantly reduces TNBC growth as well as lung metastatic colonization. Furthermore, we have identified a PKCλ/ι-regulated gene signature consisting of 110 genes, which are significantly associated with indolent to invasive progression of human breast cancer and poor prognosis. Mechanistically, cytokines such as TGFβ and IL1β could activate PKCλ/ι signaling in TNBC cells and depletion of PKCλ/ι impairs NF-κB p65 (RelA) nuclear localization. We observed that cytokine-PKCλ/ι-RelA signaling axis, at least in part, involved in modulating gene expression to regulate invasion of TNBC cells. Overall, our results indicate that induction and activation of PKCλ/ι promote TNBC growth, invasion and metastasis. Thus, targeting PKCλ/ι signaling could be a therapeutic option for breast cancer, including the TNBC subtype. PMID:24786829

Transcriptomic insight into pathogenicity-associated factors of Conidiobolus obscurus, an obligate aphid-pathogenic fungus belonging to Entomopthoromycota.

PubMed

Wang, Jianghong; Zhou, Xiang; Guo, Kai; Zhang, Xinqi; Lin, Haiping; Montalva, Cristian

2018-01-16

Conidiobolus obscurus is a widespread fungal entomopathogen with aphid biocontrol potential. This study focused on a de novo transcriptomic analysis of C. obscurus. A number of pathogenicity-associated factors were annotated for the first time from the assembled 17 231 fungal unigenes, including those encoding subtilisin-like proteolytic enzymes (Pr1s), trypsin-like proteases, metalloproteases, carboxypeptidases and endochitinases. Many of these genes were transcriptionally up-regulated by at least twofold in mycotized cadavers compared with the in vitro fungal cultures. The resultant transcriptomic database was validated by the transcript levels of three selected pathogenicity-related genes quantified from different in vivo and in vitro material in real-time quantitative polymerase chain reaction (PCR). The involvement of multiple Pr1 proteases in the first stage of fungal infection was also suggested. Interestingly, a unique cytolytic (Cyt)-like δ-endotoxin gene was highly expressed in both mycotized cadavers and fungal cultures, and was more or less distinct from its homologues in bacteria and other fungi. Our findings provide the first global insight into various pathogenicity-related genes in this obligate aphid pathogen and may help to develop novel biocontrol strategy against aphid pests. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

The roles of bile acids and sphingosine-1-phosphate signaling in the hepatobiliary diseases

PubMed Central

Nagahashi, Masayuki; Yuza, Kizuki; Hirose, Yuki; Nakajima, Masato; Ramanathan, Rajesh; Hait, Nitai C.; Hylemon, Phillip B.; Zhou, Huiping; Takabe, Kazuaki; Wakai, Toshifumi

2016-01-01

Based on research carried out over the last decade, it has become increasingly evident that bile acids act not only as detergents, but also as important signaling molecules that exert various biological effects via activation of specific nuclear receptors and cell signaling pathways. Bile acids also regulate the expression of numerous genes encoding enzymes and proteins involved in the synthesis and metabolism of bile acids, glucose, fatty acids, and lipoproteins, as well as energy metabolism. Receptors activated by bile acids include, farnesoid X receptor α, pregnane X receptor, vitamin D receptor, and G protein-coupled receptors, TGR5, muscarinic receptor 2, and sphingosine-1-phosphate receptor (S1PR)2. The ligand of S1PR2, sphingosine-1-phosphate (S1P), is a bioactive lipid mediator that regulates various physiological and pathophysiological cellular processes. We have recently reported that conjugated bile acids, via S1PR2, activate and upregulate nuclear sphingosine kinase 2, increase nuclear S1P, and induce genes encoding enzymes and transporters involved in lipid and sterol metabolism in the liver. Here, we discuss the role of bile acids and S1P signaling in the regulation of hepatic lipid metabolism and in hepatobiliary diseases. PMID:27459945

Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

PubMed

Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

2004-02-01

The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

Interrelation of androgen receptor and miR-30a and miR-30a function in ER-, PR-, AR+ MDA-MB-453 breast cancer cells.

PubMed

Lyu, Shuhua; Liu, Han; Liu, Xia; Liu, Shan; Wang, Yahong; Yu, Qi; Niu, Yun

2017-10-01

The association between androgen-induced androgen receptor (AR) activating signal and microRNA (miR)-30a was investigated, as well as the function of miR-30a in estrogen receptor-negative (ER - ), progesterone receptor-negative (PR - ), and AR-positive (AR + ) MDA-MB-453 breast cancer cells. Androgen-induced AR activating signal upregulated the expression of AR, and downregulated the expression of miR-30a, b and c. Bioinformatics analysis indicated a putative miR-30a, b and c binding site in the 3'-untranslated region of AR mRNA. It was confirmed that the AR gene is a direct target of miR-30a, whereas AR does not target the miR-30a promoter, and AR activating signal may indirectly downregulate miR-30a through other cell signaling pathways. In this positive feedback mechanism AR is then upregulated through miR-30a. Overexpression of miR-30a inhibited cell proliferation, whereas inhibition of miR-30a expression by specific antisense oligonucleotides, increased cell growth. Previously, androgen-induced AR activating signal was demonstrated to inhibit cell proliferation in ER - , PR - and AR + MDA-MB-453 breast cancer cells, but AR activating signal downregulated the expression of miR-30a, relieving the inhibition of MDA-MB-453 cell growth. Therefore, in MDA-MB-453 breast cancer cells, miR-30a has two different functions regarding cell growth: Inhibition of cell proliferation through a positive feedback signaling pathway; and the relative promotion of cell proliferation through downregulation of miR-30a. Thus, the association between AR activating signal and microRNAs is complex, and microRNAs may possess different functions due to different signaling pathways. Although the results of the present study were obtained in one cell line, they contribute to subsequent studies on ER - , PR - and AR + breast cancer.

Functional proteomics outlines the complexity of breast cancer molecular subtypes.

PubMed

Gámez-Pozo, Angelo; Trilla-Fuertes, Lucía; Berges-Soria, Julia; Selevsek, Nathalie; López-Vacas, Rocío; Díaz-Almirón, Mariana; Nanni, Paolo; Arevalillo, Jorge M; Navarro, Hilario; Grossmann, Jonas; Gayá Moreno, Francisco; Gómez Rioja, Rubén; Prado-Vázquez, Guillermo; Zapater-Moros, Andrea; Main, Paloma; Feliú, Jaime; Martínez Del Prado, Purificación; Zamora, Pilar; Ciruelos, Eva; Espinosa, Enrique; Fresno Vara, Juan Ángel

2017-08-30

Breast cancer is a heterogeneous disease comprising a variety of entities with various genetic backgrounds. Estrogen receptor-positive, human epidermal growth factor receptor 2-negative tumors typically have a favorable outcome; however, some patients eventually relapse, which suggests some heterogeneity within this category. In the present study, we used proteomics and miRNA profiling techniques to characterize a set of 102 either estrogen receptor-positive (ER+)/progesterone receptor-positive (PR+) or triple-negative formalin-fixed, paraffin-embedded breast tumors. Protein expression-based probabilistic graphical models and flux balance analyses revealed that some ER+/PR+ samples had a protein expression profile similar to that of triple-negative samples and had a clinical outcome similar to those with triple-negative disease. This probabilistic graphical model-based classification had prognostic value in patients with luminal A breast cancer. This prognostic information was independent of that provided by standard genomic tests for breast cancer, such as MammaPrint, OncoType Dx and the 8-gene Score.

Protection of pigs against pandemic swine origin H1N1 influenza A virus infection by hemagglutinin- or neuraminidase-expressing attenuated pseudorabies virus recombinants.

PubMed

Klingbeil, Katharina; Lange, Elke; Blohm, Ulrike; Teifke, Jens P; Mettenleiter, Thomas C; Fuchs, Walter

2015-03-02

Influenza is an important respiratory disease of pigs, and may lead to novel human pathogens like the 2009 pandemic H1N1 swine-origin influenza virus (SoIV). Therefore, improved influenza vaccines for pigs are required. Recently, we demonstrated that single intranasal immunization with a hemagglutinin (HA)-expressing pseudorabies virus recombinant of vaccine strain Bartha (PrV-Ba) protected pigs from H1N1 SoIV challenge (Klingbeil et al., 2014). Now we investigated enhancement of efficacy by prime-boost vaccination and/or intramuscular administration. Furthermore, a novel PrV-Ba recombinant expressing codon-optimized N1 neuraminidase (NA) was included. In vitro replication of this virus was only slightly affected compared to parental virus. Unlike HA, the abundantly expressed NA was efficiently incorporated into PrV particles. Immunization of pigs with the two PrV recombinants, either singly or in combination, induced B cell proliferation and the expected SoIV-specific antibodies, whose titers increased substantially after boost vaccination. After immunization of animals with either PrV recombinant H1N1 SoIV challenge virus replication was significantly reduced compared to PrV-Ba vaccinated or naïve controls. Protective efficacy of HA-expressing PrV was higher than of NA-expressing PrV, and not significantly enhanced by combination. Despite higher serum antibody titers obtained after intramuscular immunization, transmission of challenge virus to naïve contact animals was only prevented after intranasal prime-boost vaccination with HA-expressing PrV-Ba. Copyright © 2015 Elsevier B.V. All rights reserved.

An analysis of the prognostic value of IDH1 (isocitrate dehydrogenase 1) mutation in Polish glioma patients.

PubMed

Lewandowska, Marzena Anna; Furtak, Jacek; Szylberg, Tadeusz; Roszkowski, Krzysztof; Windorbska, Wiesława; Rytlewska, Joanna; Jóźwicki, Wojciech

2014-02-01

IDH1 (isocitrate dehydrogenase 1) is a potential biomarker and drug target. Genomic and epigenetic data on astrocytoma have demonstrated that the IDH1 mutation is sufficient to establish the glioma hypermethylator phenotype. Furthermore, recent studies have also indicated that a mutant IDH1 inhibitor induced demethylation of histone H3K9me3 and expression of genes associated with gliogenic differentiation. As the presence of the p.R132H mutation in the IDH1 gene seems to be a more powerful prognostic marker than O(6)-methylguanine-DNA methyltransferase promoter status, we evaluated the presence of IDH1 mutation in Polish patients with astrocytoma, glioblastoma, oligoastrocytoma, ganglioglioma, oligodendroglioma, and ependymoma. The IDH1 mutation status at codon 132 was determined using a mouse monoclonal antibody specific for the R132H mutation, direct sequencing, and Co-amplification at Lower Denaturation Temperature (COLD) polymerase chain reaction (PCR) high-resolution melting-curve analysis (HRM). Wild-type (WT) IDH1 was detected in cases with a World Health Organization (WHO) grade I astrocytoma. The IDH1 c.G395A; p.R132H mutation was observed in 56 and 94 % of grade II and grade III astrocytoma cases, respectively. Significant differences in the median overall survival were observed in astrocytoma patients grouped on the basis of the presence of IDH1 mutation: survival was 24 months longer in grade II astrocytoma and 12 months longer in glioblastoma. Overall survival was compared between grade II astrocytoma patients with low or high expression of the mutant protein. Interestingly, lower R132H expression correlated with better overall survival. Our results indicate the usefulness of assessing the R132H IDH1 mutation in glioma patients: the presence or absence of the R132H mutation can help pathologists to distinguish pilocytic astrocytomas (IDH1 WT) from diffuse ones (R132H IDH1/WT). Moreover, low IDH1 p.R132H expression was related to better prognosis. This clinical implication appears to be important for personalization of prognosis and treatment by oncologists.

Frequent germline deleterious mutations in DNA repair genes in familial prostate cancer cases are associated with advanced disease.

PubMed

Leongamornlert, D; Saunders, E; Dadaev, T; Tymrakiewicz, M; Goh, C; Jugurnauth-Little, S; Kozarewa, I; Fenwick, K; Assiotis, I; Barrowdale, D; Govindasami, K; Guy, M; Sawyer, E; Wilkinson, R; Antoniou, A C; Eeles, R; Kote-Jarai, Z

2014-03-18

Prostate cancer (PrCa) is one of the most common diseases to affect men worldwide and among the leading causes of cancer-related death. The purpose of this study was to use second-generation sequencing technology to assess the frequency of deleterious mutations in 22 tumour suppressor genes in familial PrCa and estimate the relative risk of PrCa if these genes are mutated. Germline DNA samples from 191 men with 3 or more cases of PrCa in their family were sequenced for 22 tumour suppressor genes using Agilent target enrichment and Illumina technology. Analysis for genetic variation was carried out by using a pipeline consisting of BWA, Genome Analysis Toolkit (GATK) and ANNOVAR. Clinical features were correlated with mutation status using standard statistical tests. Modified segregation analysis was used to determine the relative risk of PrCa conferred by the putative loss-of-function (LoF) mutations identified. We discovered 14 putative LoF mutations in 191 samples (7.3%) and these mutations were more frequently associated with nodal involvement, metastasis or T4 tumour stage (P=0.00164). Segregation analysis of probands with European ancestry estimated that LoF mutations in any of the studied genes confer a relative risk of PrCa of 1.94 (95% CI: 1.56-2.42). These findings show that LoF mutations in DNA repair pathway genes predispose to familial PrCa and advanced disease and therefore warrants further investigation. The clinical utility of these findings will become increasingly important as targeted screening and therapies become more widespread.

Prognostic value of estrogen receptor and progesterone receptor tumor expression in Danish ovarian cancer patients: from the 'MALOVA' ovarian cancer study.

PubMed

Høgdall, Estrid V S; Christensen, Lise; Høgdall, Claus K; Blaakaer, Jan; Gayther, Simon; Jacobs, Ian J; Christensen, Ib Jarle; Kjaer, Susanne K

2007-11-01

Estrogen and progesterone are important hormones secreted by the ovary acting through specific receptors. Tumor tissue expression profiles of these have demonstrated prognostic value in malignancies such as breast, uterine and prostate cancer. In this study, including tissue samples from 773 Danish patients with an ovarian tumor, we evaluated whether estrogen receptor (ER) and progesterone receptor (PR) expression correlated with clinico-pathological parameters, and a possible prognostic impact on ovarian cancer (OC) patients was investigated. Using tissue array and immunohistochemistry, we analyzed the ER and PR expression levels in tissues from 582 women with OC and 191 women with low malignancy potential (LMP) ovarian tumors. Our results demonstrated that ER was expressed in 30 of the 191 LMP tumors (16%) and in 207 of the 582 OC (36%). PR was expressed in 38 LMP tumors (20%) and in 115 OC (20%). For both tumor types an excess of positive tumors was found in the serous compared to the mucinous subtype (p< or =0.00001). The frequency of ER expression-positive OC increased with increasing FIGO stage (p=0.0003), and the frequency of PR-positive tumors increased with increasing histological grade (p=0.0006). In a Cox survival analysis, a tissue ER and PR expression 10% or higher was found to imply an independent significant advantageous course of patient disease-specific survival (ER: hazard ratio (HR), 0.80; 95% confidence interval (CI), 0.63-0.99; PR: HR, 0.69; 95% CI, 0.51-0.94) together with FIGO stage, residual tumor after primary surgery, age at diagnosis and other histological types vs. serous adenocarcinoma. The histological grade of tumor was found to have no independent prognostic value. The prognostic value of ER and PR was found additive with a HR for patients with high ER and PR expression of 0.48 (95% CI, 0.31-0.74) compared to patients with <10% expression for both receptors. In conclusion, our results predict that an elevated expression of ER and PR, alone and in combination, point to a favorable outcome for patients with OC.

Polysaccharide Peptide-Induced Virus Resistance Depends on Ca2+ Influx by Increasing the Salicylic Acid Content and Upregulating the Leucine-Rich Repeat Gene in Arabidopsis thaliana.

PubMed

Zhao, Lei; Chen, Yujia; Yang, Wen; Zhang, Yuanle; Chen, Wenbao; Feng, Chaohong; Wang, Qaochun; Wu, Yunfeng

2018-05-01

Plant viral diseases cause severe economic losses in agricultural production. The development of biosource-derived antiviral agents provides an alternative strategy to efficiently control plant viral diseases. We previously reported that the exogenous application of polysaccharide peptide (PSP) exerts significant inhibitive effects on Tobacco mosaic virus infection in Nicotiana tabacum. In this study, we studied in additional detail the mechanism by which PSP can induce virus resistance in Arabidopsis thaliana. We found that PSP significantly induced Ca 2+ influx and increased the accumulation of hydrogen peroxide and salicylic acid (SA) in the A. thaliana cells. A gene with a toll interleukin 1 receptor-nucleotide binding site-leucine-rich repeat domain (LRR) was obtained by RNA sequencing in combination with the screening of the gene-deletion mutants of A. thaliana. The LRR gene was deleted, and the inductive response of A. thaliana to PSP was significantly attenuated after mutation. After the heterologous overexpression of the LRR gene in N. benthamiana, the SA content and PR1 gene expression in N. benthamiana were significantly increased. Through analyses of the LRR gene expression and the ability of A. thaliana to resist Cucumber mosaic virus following the treatments of PSP and PSP + ethyleneglycol-bis (beta-aminoethylether)-N,N'-tetraacetic acid, it was shown that PSP enhanced the virus resistance of A. thaliana by inducing Ca 2+ influx and subsequently improving expression of the LRR gene, which further increased the SA content.

Genome-wide identification and characterization of the Populus WRKY transcription factor family and analysis of their expression in response to biotic and abiotic stresses

PubMed Central

Jiang, Yuanzhong; Duan, Yanjiao; Yin, Jia; Ye, Shenglong; Zhu, Jingru; Zhang, Faqi; Lu, Wanxiang; Fan, Di; Luo, Keming

2014-01-01

WRKY proteins are a large family of regulators involved in various developmental and physiological processes, especially in coping with diverse biotic and abiotic stresses. In this study, 100 putative PtrWRKY genes encoded the proteins contained in the complete WRKY domain in Populus. Phylogenetic analysis revealed that the members of this superfamily among poplar, Arabidopsis, and other species were divided into three groups with several subgroups based on the structures of the WRKY protein sequences. Various cis-acting elements related to stress and defence responses were found in the promoter regions of PtrWRKY genes by promoter analysis. High-throughput transcriptomic analyses identified that 61 of the PtrWRKY genes were induced by biotic and abiotic treatments, such as Marssonina brunnea, salicylic acid (SA), methyl jasmonate (MeJA), wounding, cold, and salinity. Among these PtrWRKY genes, transcripts of 46 selected genes were observed in different tissues, including roots, stems, and leaves. Quantitative RT-PCR analysis further confirmed the induced expression of 18 PtrWRKY genes by one or more stress treatments. The overexpression of an SA-inducible gene, PtrWRKY89, accelerated expression of PR protein genes and improved resistance to pathogens in transgenic poplar, suggesting that PtrWRKY89 is a regulator of an SA-dependent defence-signalling pathway in poplar. Taken together, our results provided significant information for improving the resistance and stress tolerance of woody plants. PMID:25249073

Phytophthora megakarya and P. palmivora, Causal Agents of Black Pod Rot, Induce Similar Plant Defense Responses Late during Infection of Susceptible Cacao Pods

PubMed Central

Ali, Shahin S.; Shao, Jonathan; Lary, David J.; Strem, Mary D.; Meinhardt, Lyndel W.; Bailey, Bryan A.

2017-01-01

Phytophthora megakarya (Pmeg) and Phytophthora palmivora (Ppal) cause black pod rot of Theobroma cacao L. (cacao). Of these two clade 4 species, Pmeg is more virulent and is displacing Ppal in many cacao production areas in Africa. Symptoms and species specific sporangia production were compared when the two species were co-inoculated onto pod pieces in staggered 24 h time intervals. Pmeg sporangia were predominantly recovered from pod pieces with unwounded surfaces even when inoculated 24 h after Ppal. On wounded surfaces, sporangia of Ppal were predominantly recovered if the two species were simultaneously applied or Ppal was applied first but not if Pmeg was applied first. Pmeg demonstrated an advantage over Ppal when infecting un-wounded surfaces while Ppal had the advantage when infecting wounded surfaces. RNA-Seq was carried out on RNA isolated from control and Pmeg and Ppal infected pod pieces 3 days post inoculation to assess their abilities to alter/suppress cacao defense. Expression of 4,482 and 5,264 cacao genes was altered after Pmeg and Ppal infection, respectively, with most genes responding to both species. Neural network self-organizing map analyses separated the cacao RNA-Seq gene expression profiles into 24 classes, 6 of which were largely induced in response to infection. Using KEGG analysis, subsets of genes composing interrelated pathways leading to phenylpropanoid biosynthesis, ethylene and jasmonic acid biosynthesis and action, plant defense signal transduction, and endocytosis showed induction in response to infection. A large subset of genes encoding putative Pr-proteins also showed differential expression in response to infection. A subset of 36 cacao genes was used to validate the RNA-Seq expression data and compare infection induced gene expression patterns in leaves and wounded and unwounded pod husks. Expression patterns between RNA-Seq and RT-qPCR were generally reproducible. The level and timing of altered gene expression was influenced by the tissues studied and by wounding. Although, in these susceptible interactions gene expression patterns were similar, some genes did show differential expression in a Phytophthora species dependent manner. The biggest difference was the more intense changes in expression in Ppal inoculated wounded pod pieces further demonstrating its rapid progression when penetrating through wounds. PMID:28261234

Expression of nuclear progesterone receptor and progesterone receptor membrane components 1 and 2 in the oviduct of cyclic and pregnant cows during the post-ovulation period

PubMed Central

2012-01-01

Background Progesterone (P4) may modulate oviductal functions to promote early embryo development in cattle. In addition to its nuclear receptor (PR), P4 may mediate its actions through P4 receptor membrane component 1 (PGRMC1) and its relative, PGRMC2. Two successive experiments were undertaken to characterise the expression of PR, PGRMC1 and PGRMC2 in the bovine oviduct during the post-ovulation period, and to relate their expression to the presence of an embryo, the proximity of the CL and to the region of the oviduct. Methods In the first experiment (Exp. I), whole oviduct sections were collected from Holstein cows at Day 1.5, Day 4 and Day 5 post-ovulation (n = 2 cows per stage). The expression of PR, PGRMC1 and PGRMC2 was studied in the ampulla and isthmus by RT-PCR, western-blot and immunohistochemistry. In Exp. II, oviduct epithelial cells were collected from cyclic and pregnant Charolais cows (n = 4 cows per status) at Day 3.5 post-ovulation and mRNA expression of PR, PGRMC1 and PGRMC2 was examined in the ampulla and isthmus by real-time quantitative PCR. Results In Exp. I, PR, PGRMC1 and PGRMC2 were expressed in all oviduct samples. PGRMC1 was mainly localised in the luminal epithelium whereas PR and PGRMC2 were localised in the epithelium as well as in the muscle and stroma layers of the oviduct. The expression was primarily nuclear for PR, primarily cytoplasmic for PGRMC1 and both nuclear and cytoplasmic for PGRMC2. In Exp. II, mRNA levels for PR, PGRMC1 and PGRMC2 were not affected by either the pregnancy status or the side relative to the CL. However, the expression of PR and PGRMC2 varied significantly with the region of the oviduct: PR was more highly expressed in the isthmus whereas PGRMC2 was more highly expressed in the ampulla. Conclusions This is the first evidence of PGRMC2 expression in the bovine oviduct. Our findings suggest that P4 regulates the functions of the bovine oviduct in a region-specific manner and through both classical and non classical pathways during the post-ovulation period. PMID:22958265

Improved Shoot Regeneration, Salinity Tolerance and Reduced Fungal Susceptibility in Transgenic Tobacco Constitutively Expressing PR-10a Gene.

PubMed

Agarwal, Parinita; Dabi, Mitali; More, Prashant; Patel, Khantika; Jana, Kalyanashis; Agarwal, Pradeep K

2016-01-01

Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to maneuver stress tolerance. The PR-10 protein family is reported to be involved in defense regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of shoot buds in tobacco (Nicotiana tabacum), which could be due to high cytokinin to auxin ratio in the transgenics. The docking analysis shows the binding of three BAP molecules at the active sites of JcPR-10a protein. JcPR-10a transgenics showed enhanced salt tolerance, as was evident by increased germination rate, shoot and root length, relative water content, proline, soluble sugar and amino acid content under salinity. Interestingly, the transgenics also showed enhanced endogenous cytokinin level as compared to WT, which, further increased with salinity. Exposure of gradual salinity resulted in increased stomatal conductance, water use efficiency, photosynthesis rate and reduced transpiration rate. Furthermore, the transgenics also showed enhanced resistance against Macrophomina fungus. Thus, JcPR-10a might be working in co-ordination with cytokinin signaling in mitigating the stress induced damage by regulating different stress signaling pathways, leading to enhanced stress tolerance.

Dynamics and intramolecular ligand binding of DtxR studied by MD simulations and NMR spectroscopy

NASA Astrophysics Data System (ADS)

Yi, Myunggi; Bhattacharya, Nilakshee; Zhou, Huan-Xiang

2005-11-01

Diphtheria toxin repressor (DtxR) regulates the expression of the diphtheria toxin gene through intramolecular ligand binding (Wylie et al., Biochemistry 2005, 44:40-51). Protein dynamics is essential to the binding process of the Pro-rich (Pr) ligand to the C-terminal SH3 domain. We present MD and NMR results on the dynamics and ligand interactions of a Pr-SH3 construct of DtxR. NMR relaxation data (T1, T2, and NOE) showed that the Pr ligand is very flexible, suggesting that it undergoes binding/unbinding transitions. A 50-ns MD trajectory of the protein was used to calculate T1, T2, and NOE, reproducing the NMR results for the SH3 domain but not for the Pr segment. During the MD simulation, the ligand stayed bound to the SH3 domain; thus the simulation represented the bound state. The NMR data for the Pr-segment could be explained by assuming that they represented the average behavior of a fast binding/unbinding exchange. Though unbinding was not observed in the MD simulation, the simulation did show large fluctuations of a loop which forms part of the wall of the binding pocket. The fluctuations led to opening up of the binding pocket, thus weakening the interaction with the Pr segment and perhaps ultimately leading to ligand unbinding.

Distinct functions and regulation of epithelial progesterone receptor in the mouse cervix, vagina, and uterus.

PubMed

Mehta, Fabiola F; Son, Jieun; Hewitt, Sylvia C; Jang, Eunjung; Lydon, John P; Korach, Kenneth S; Chung, Sang-Hyuk

2016-04-05

While the function of progesterone receptor (PR) has been studied in the mouse vagina and uterus, its regulation and function in the cervix has not been described. We selectively deleted epithelial PR in the female reproductive tracts using the Cre/LoxP recombination system. We found that epithelial PR was required for induction of apoptosis and suppression of cell proliferation by progesterone (P4) in the cervical and vaginal epithelium. We also found that epithelial PR was dispensable for P4 to suppress apoptosis and proliferation in the uterine epithelium. PR is encoded by the Pgr gene, which is regulated by estrogen receptor α (ERα) in the female reproductive tracts. Using knock-in mouse models expressing ERα mutants, we determined that the DNA-binding domain (DBD) and AF2 domain of ERα were required for upregulation of Pgr in the cervix and vagina as well as the uterine stroma. The ERα AF1 domain was required for upregulation of Pgr in the vaginal stroma and epithelium and cervical epithelium, but not in the uterine and cervical stroma. ERα DBD, AF1, and AF2 were required for suppression of Pgr in the uterine epithelium, which was mediated by stromal ERα. Epithelial ERα was responsible for upregulation of epithelial Pgr in the cervix and vagina. Our results indicate that regulation and functions of epithelial PR are different in the cervix, vagina, and uterus.

Independent Preharvest Applications of Methyl Jasmonate and Chitosan Elicit Differential Upregulation of Defense-Related Genes with Reduced Incidence of Gray Mold Decay during Postharvest Storage of Fragaria chiloensis Fruit

PubMed Central

Saavedra, Gabriela M.; Sanfuentes, Eugenio; Figueroa, Carlos R.

2017-01-01

The Chilean strawberry (Fragaria chiloensis) fruit has interesting organoleptic properties, but its postharvest life is affected by gray mold decay caused by Botrytis cinerea. The effect of preharvest applications of methyl jasmonate (MeJA) or chitosan on the molecular defense-related responses and protection against gray mold decay were investigated in Chilean strawberry fruit during postharvest storage. Specifically, we inoculated harvested fruit with B. cinerea spores and studied the expression of genes encoding for the pathogenesis-related (PR) proteins β-1,3-glucanases (FcBG2-1, FcBG2-2 and FcBG2-3) and chitinases (FcCHI2-2 and FcCHI3-1), and for polygalacturonase inhibiting proteins (FcPGIP1 and FcPGIP2) at 0, 2, 24, 48, and 72 h post inoculation (hpi). Remarkably, MeJA- and chitosan-treated fruit exhibited a lower incidence of B. cinerea infection than the control-treated at 48 and 72 hpi. At the molecular level, both are efficient elicitors for priming in F. chiloensis fruit since we observed an upregulation of the FcBG2-1, FcBG2-3, FcPGIP1, and FcPGIP2 at 0 hpi. Moreover, a chitosan-mediated upregulation of FcPGIPs at early times post inoculation (2–24 hpi) and MeJA upregulated FcBGs (24–72 hpi) and FcPGIP1 at later times could contribute to reduce B. cinerea incidence by differential upregulation of defense genes. We concluded that preharvest applications of MeJA or chitosan had a long-lasting effect on the reduction of B. cinerea incidence during postharvest as well as an enhancer effect on the induction of PR and PGIP gene expression. PMID:28671619

Independent Preharvest Applications of Methyl Jasmonate and Chitosan Elicit Differential Upregulation of Defense-Related Genes with Reduced Incidence of Gray Mold Decay during Postharvest Storage of Fragaria chiloensis Fruit.

PubMed

Saavedra, Gabriela M; Sanfuentes, Eugenio; Figueroa, Pablo M; Figueroa, Carlos R

2017-07-03

The Chilean strawberry ( Fragaria chiloensis ) fruit has interesting organoleptic properties, but its postharvest life is affected by gray mold decay caused by Botrytis cinerea . The effect of preharvest applications of methyl jasmonate (MeJA) or chitosan on the molecular defense-related responses and protection against gray mold decay were investigated in Chilean strawberry fruit during postharvest storage. Specifically, we inoculated harvested fruit with B. cinerea spores and studied the expression of genes encoding for the pathogenesis-related (PR) proteins β-1,3-glucanases ( FcBG2-1 , FcBG2-2 and FcBG2-3 ) and chitinases ( FcCHI2-2 and FcCHI3-1 ), and for polygalacturonase inhibiting proteins ( FcPGIP1 and FcPGIP2 ) at 0, 2, 24, 48, and 72 h post inoculation (hpi). Remarkably, MeJA- and chitosan-treated fruit exhibited a lower incidence of B. cinerea infection than the control-treated at 48 and 72 hpi. At the molecular level, both are efficient elicitors for priming in F. chiloensis fruit since we observed an upregulation of the FcBG2-1 , FcBG2-3 , FcPGIP1, and FcPGIP2 at 0 hpi. Moreover, a chitosan-mediated upregulation of FcPGIP s at early times post inoculation (2-24 hpi) and MeJA upregulated FcBG s (24-72 hpi) and FcPGIP1 at later times could contribute to reduce B. cinerea incidence by differential upregulation of defense genes. We concluded that preharvest applications of MeJA or chitosan had a long-lasting effect on the reduction of B. cinerea incidence during postharvest as well as an enhancer effect on the induction of PR and PGIP gene expression.

Overexpression of a citrus NDR1 ortholog increases disease resistance in Arabidopsis.

PubMed

Lu, Hua; Zhang, Chong; Albrecht, Ute; Shimizu, Rena; Wang, Guanfeng; Bowman, Kim D

2013-01-01

Emerging devastating diseases, such as Huanglongbing (HLB) and citrus canker, have caused tremendous losses to the citrus industry worldwide. Genetic engineering is a powerful approach that could allow us to increase citrus resistance against these diseases. The key to the success of this approach relies on a thorough understanding of defense mechanisms of citrus. Studies of Arabidopsis and other plants have provided a framework for us to better understand defense mechanisms of citrus. Salicylic acid (SA) is a key signaling molecule involved in basal defense and resistance (R) gene-mediated defense against broad-spectrum pathogens. The Arabidopsis gene NDR1 (NON-RACE-SPECIFIC DISEASE RESISTANCE 1) is a positive regulator of SA accumulation and is specifically required for signaling mediated by a subset of R genes upon recognition of their cognate pathogen effectors. Our bioinformatic analysis identified an ortholog of NDR1 from citrus, CsNDR1. Overexpression of CsNDR1 complemented susceptibility conferred by the Arabidopsis ndr1-1 mutant to Pseudomonas syringae strains and also led to enhanced resistance to an oomycete pathogen Hyaloperonospora arabidopsidis. Such heightened resistance is associated with increased SA production and expression of the defense marker gene PATHOGENESIS RELATED 1 (PR1). In addition, we found that expression of PR1 and accumulation of SA were induced to modest levels in citrus infected with Candidatus Liberibacter asiaticus, the bacterial pathogen associated with HLB disease. Thus, our data suggest that CsNDR1 is a functional ortholog of Arabidopsis NDR1. Since Ca. L. asiaticus infection only activates modest levels of defense responses in citrus, we propose that genetically increasing SA/NDR1-mediated pathways could potentially lead to enhanced resistance against HLB, citrus canker, and other destructive diseases challenging global citrus production.

Overexpression of a citrus NDR1 ortholog increases disease resistance in Arabidopsis

PubMed Central

Lu, Hua; Zhang, Chong; Albrecht, Ute; Shimizu, Rena; Wang, Guanfeng; Bowman, Kim D.

2013-01-01

Emerging devastating diseases, such as Huanglongbing (HLB) and citrus canker, have caused tremendous losses to the citrus industry worldwide. Genetic engineering is a powerful approach that could allow us to increase citrus resistance against these diseases. The key to the success of this approach relies on a thorough understanding of defense mechanisms of citrus. Studies of Arabidopsis and other plants have provided a framework for us to better understand defense mechanisms of citrus. Salicylic acid (SA) is a key signaling molecule involved in basal defense and resistance (R) gene-mediated defense against broad-spectrum pathogens. The Arabidopsis gene NDR1 (NON-RACE-SPECIFIC DISEASE RESISTANCE 1) is a positive regulator of SA accumulation and is specifically required for signaling mediated by a subset of R genes upon recognition of their cognate pathogen effectors. Our bioinformatic analysis identified an ortholog of NDR1 from citrus, CsNDR1. Overexpression of CsNDR1 complemented susceptibility conferred by the Arabidopsis ndr1-1 mutant to Pseudomonas syringae strains and also led to enhanced resistance to an oomycete pathogen Hyaloperonospora arabidopsidis. Such heightened resistance is associated with increased SA production and expression of the defense marker gene PATHOGENESIS RELATED 1 (PR1). In addition, we found that expression of PR1 and accumulation of SA were induced to modest levels in citrus infected with Candidatus Liberibacter asiaticus, the bacterial pathogen associated with HLB disease. Thus, our data suggest that CsNDR1 is a functional ortholog of Arabidopsis NDR1. Since Ca. L. asiaticus infection only activates modest levels of defense responses in citrus, we propose that genetically increasing SA/NDR1-mediated pathways could potentially lead to enhanced resistance against HLB, citrus canker, and other destructive diseases challenging global citrus production. PMID:23761797

Identification of the Pr1 gene product completes the anthocyanin biosynthesis pathway of maize

USDA-ARS?s Scientific Manuscript database

In maize, mutations in the pr1 locus lead to the accumulation of pelargonidin (red) rather than cyanidin (purple) pigments in aleurone cells where the anthocyanin biosynthetic pathway is active. We characterized pr1 mutation and isolated a putative F3'H encoding gene (Zmf3'h1), and showed by segrega...

Nuclear receptor coactivators function in estrogen receptor- and progestin receptor-dependent aspects of sexual behavior in female rats

PubMed Central

Molenda-Figueira, Heather A.; Williams, Casey A.; Griffin, Andreana L.; Rutledge, Eric M.; Blaustein, Jeffrey D.; Tetel, Marc J.

2008-01-01

The ovarian hormones, estradiol (E) and progesterone (P) facilitate the expression of sexual behavior in female rats. E and P mediate many of these behavioral effects by binding to their respective intracellular receptors in specific brain regions. Nuclear receptor coactivators, including Steroid Receptor Coactivator-1 (SRC-1) and CREB Binding Protein (CBP), dramatically enhance ligand-dependent steroid receptor transcriptional activity in vitro. Previously, our lab has shown that SRC-1 and CBP modulate estrogen receptor (ER)-mediated induction of progestin receptor (PR) gene expression in the ventromedial nucleus of the hypothalamus (VMN) and hormone-dependent sexual receptivity in female rats. Female sexual behaviors can be activated by high doses of E alone in ovariectomized rats, and thus are believed to be ER-dependent. However, the full repertoire of female sexual behavior, in particular, proceptive behaviors such as hopping, darting and ear wiggling, are considered to be PR-dependent. In the present experiments, the function of SRC-1 and CBP in distinct ER- (Exp. 1) and PR- (Exp. 2) dependent aspects of female sexual behavior was investigated. In Exp. 1, infusion of antisense oligodeoxynucleotides to SRC-1 and CBP mRNA into the VMN decreased lordosis intensity in rats treated with E alone, suggesting that these coactivators modulate ER-mediated female sexual behavior. In Exp. 2, antisense to SRC-1 and CBP mRNA around the time of P administration reduced PR-dependent ear wiggling and hopping and darting. Taken together, these data suggest that SRC-1 and CBP modulate ER and PR action in brain and influence distinct aspects of hormone-dependent sexual behaviors. These findings support our previous studies and provide further evidence that SRC-1 and CBP function together to regulate ovarian hormone action in behaviorally-relevant brain regions. PMID:16769066

SIZ1 Regulation of Phosphate Starvation-Induced Root Architecture Remodeling Involves the Control of Auxin Accumulation1[C][W][OA

PubMed Central

Miura, Kenji; Lee, Jiyoung; Gong, Qingqiu; Ma, Shisong; Jin, Jing Bo; Yoo, Chan Yul; Miura, Tomoko; Sato, Aiko; Bohnert, Hans J.; Hasegawa, Paul M.

2011-01-01

Phosphate (Pi) limitation causes plants to modulate the architecture of their root systems to facilitate the acquisition of Pi. Previously, we reported that the Arabidopsis (Arabidopsis thaliana) SUMO E3 ligase SIZ1 regulates root architecture remodeling in response to Pi limitation; namely, the siz1 mutations cause the inhibition of primary root (PR) elongation and the promotion of lateral root (LR) formation. Here, we present evidence that SIZ1 is involved in the negative regulation of auxin patterning to modulate root system architecture in response to Pi starvation. The siz1 mutations caused greater PR growth inhibition and LR development of seedlings in response to Pi limitation. Similar root phenotypes occurred if Pi-deficient wild-type seedlings were supplemented with auxin. N-1-Naphthylphthalamic acid, an inhibitor of auxin efflux activity, reduced the Pi starvation-induced LR root formation of siz1 seedlings to a level equivalent to that seen in the wild type. Monitoring of the auxin-responsive reporter DR5::uidA indicated that auxin accumulates in PR tips at early stages of the Pi starvation response. Subsequently, DR5::uidA expression was observed in the LR primordia, which was associated with LR elongation. The time-sequential patterning of DR5::uidA expression occurred earlier in the roots of siz1 as compared with the wild type. In addition, microarray analysis revealed that several other auxin-responsive genes, including genes involved in cell wall loosening and biosynthesis, were up-regulated in siz1 relative to wild-type seedlings in response to Pi starvation. Together, these results suggest that SIZ1 negatively regulates Pi starvation-induced root architecture remodeling through the control of auxin patterning. PMID:21156857

Silencing PRDM14 expression by an innovative RNAi therapy inhibits stemness, tumorigenicity, and metastasis of breast cancer

PubMed Central

Taniguchi, Hiroaki; Hoshino, Daisuke; Moriya, Chiharu; Zembutsu, Hitoshi; Nishiyama, Nobuhiro; Yamamoto, Hiroyuki; Kataoka, Kazunori; Imai, Kohzoh

2017-01-01

PR domain zinc finger protein 14 (PRDM14) maintains stemness in embryonic stem cells via epigenetic mechanisms. Although PRDM14 is elevated in several cancers, it is unclear if and how PRDM14 confers stem cell-like properties and epigenetic changes to cancer cells. Here, we examined the phenotypic characteristics and epigenetic and gene expression profiles of cancer cells that differentially express PRDM14, and assessed the potential of PRDM14-targeted cancer therapy. PRDM14 expression was markedly increased in many different cancer types and correlated with poor survival of breast cancer patients. PRDM14 conferred stem cell-like phenotypes to cancer cells and regulated the expression of genes involved in cancer stemness, metastasis, and chemoresistance. PRDM14 also reduced the methylation of proto-oncogene and stemness gene promoters and PRDM14-binding regions were primarily occupied by histone H3 Lys-4 trimethylation (H3K4me3), both of which are positively correlated with gene expression. Moreover, strong PRDM14 binding sites coincided with promoters containing both H3K4me3 and H3K27me3 histone marks. Using calcium phosphate hybrid micelles as an RNAi delivery system, silencing of PRDM14 expression by chimera RNAi reduced tumor size and metastasis in vivo without causing adverse effects. Conditional loss of PRDM14 function also improved survival of MMTV-Wnt-1 transgenic mice, a spontaneous model of murine breast cancer. Our findings suggest that PRDM14 inhibition may be an effective and novel therapy for cancer stem cells. PMID:28423353

Expression in Escherichia coli, purification, refolding and antifungal activity of an osmotin from Solanum nigrum

PubMed Central

Campos, Magnólia de A; Silva, Marilia S; Magalhães, Cláudio P; Ribeiro, Simone G; Sarto, Rafael PD; Vieira, Eduardo A; Grossi de Sá, Maria F

2008-01-01

Background Heterologous protein expression in microorganisms may contribute to identify and demonstrate antifungal activity of novel proteins. The Solanum nigrum osmotin-like protein (SnOLP) gene encodes a member of pathogenesis-related (PR) proteins, from the PR-5 sub-group, the last comprising several proteins with different functions, including antifungal activity. Based on deduced amino acid sequence of SnOLP, computer modeling produced a tertiary structure which is indicative of antifungal activity. Results To validate the potential antifungal activity of SnOLP, a hexahistidine-tagged mature SnOLP form was overexpressed in Escherichia coli M15 strain carried out by a pQE30 vector construction. The urea solubilized His6-tagged mature SnOLP protein was affinity-purified by immobilized-metal (Ni2+) affinity column chromatography. As SnOLP requires the correct formation of eight disulfide bonds, not correctly formed in bacterial cells, we adapted an in vitro method to refold the E. coli expressed SnOLP by using reduced:oxidized gluthatione redox buffer. This method generated biologically active conformations of the recombinant mature SnOLP, which exerted antifungal action towards plant pathogenic fungi (Fusarium solani f. sp.glycines, Colletotrichum spp., Macrophomina phaseolina) and oomycete (Phytophthora nicotiana var. parasitica) under in vitro conditions. Conclusion Since SnOLP displays activity against economically important plant pathogenic fungi and oomycete, it represents a novel PR-5 protein with promising utility for biotechnological applications. PMID:18334031

Cladosporium fulvum CfHNNI1 induces hypersensitive necrosis, defence gene expression and disease resistance in both host and nonhost plants.

PubMed

Cai, Xin-Zhong; Zhou, Xin; Xu, You-Ping; Joosten, Matthieu H A J; de Wit, Pierre J G M

2007-05-01

Nonhost resistance as a durable and broad-spectrum defence strategy is of great potential for agricultural applications. We have previously isolated a cDNA showing homology with genes encoding bZIP transcription factors from tomato leaf mould pathogen Cladosporium fulvum. Upon expression, the cDNA results in necrosis in C. fulvum host tomato and nonhost tobacco plants and is thus named CfHNNI1 (for C . f ulvum host and nonhost plant necrosis inducer 1). In the present study we report the induction of necrosis in a variety of nonhost plant species belonging to three families by the transient in planta expression of CfHNNI1 using virus-based vectors. Additionally, transient expression of CfHNNI1 also induced expression of the HR marker gene LeHSR203 and greatly reduced the accumulation of recombinant Potato virus X. Stable CfHNNI1 transgenic tobacco plants were generated in which the expression of CfHNNI1 is under the control of the pathogen-inducible hsr203J promoter. When infected with the oomycetes pathogen Phytophthora parasitica var. nicotianae, these transgenic plants manifested enhanced expression of CfHNNI1 and subsequent accumulation of CfHNNI1 protein, resulting in high expression of the HSR203J and PR genes, and strong resistance to the pathogen. The CfHNNI1 transgenic plants also exhibited induced resistance to Pseudomonas syringae pv. tabaci and Tobacco mosaic virus. Furthermore, CfHNNI1 was highly expressed and the protein was translocated into plant cells during the incompatible interactions between C. fulvum and host and nonhost plants. Our results demonstrate that CfHNNI1 is a potential general elicitor of hypersensitive response and nonhost resistance.

Systemic acquired resistance in soybean is regulated by two proteins, Orthologous to Arabidopsis NPR1.

PubMed

Sandhu, Devinder; Tasma, I Made; Frasch, Ryan; Bhattacharyya, Madan K

2009-08-05

Systemic acquired resistance (SAR) is induced in non-inoculated leaves following infection with certain pathogenic strains. SAR is effective against many pathogens. Salicylic acid (SA) is a signaling molecule of the SAR pathway. The development of SAR is associated with the induction of pathogenesis related (PR) genes. Arabidopsis non-expressor of PR1 (NPR1) is a regulatory gene of the SA signal pathway 123. SAR in soybean was first reported following infection with Colletotrichum trancatum that causes anthracnose disease. We investigated if SAR in soybean is regulated by a pathway, similar to the one characterized in Arabidopsis. Pathogenesis-related gene GmPR1 is induced following treatment of soybean plants with the SAR inducer, 2,6-dichloroisonicotinic acid (INA) or infection with the oomycete pathogen, Phytophthora sojae. In P. sojae-infected plants, SAR was induced against the bacterial pathogen, Pseudomonas syringae pv. glycinea. Soybean GmNPR1-1 and GmNPR1-2 genes showed high identities to Arabidopsis NPR1. They showed similar expression patterns among the organs, studied in this investigation. GmNPR1-1 and GmNPR1-2 are the only soybean homologues of NPR1and are located in homoeologous regions. In GmNPR1-1 and GmNPR1-2 transformed Arabidopsis npr1-1 mutant plants, SAR markers: (i) PR-1 was induced following INA treatment and (ii) BGL2 following infection with Pseudomonas syringae pv. tomato (Pst), and SAR was induced following Pst infection. Of the five cysteine residues, Cys82, Cys150, Cys155, Cys160, and Cys216 involved in oligomer-monomer transition in NPR1, Cys216 in GmNPR1-1 and GmNPR1-2 proteins was substituted to Ser and Leu, respectively. Complementation analyses in Arabidopsis npr1-1 mutants revealed that homoeologous GmNPR1-1 and GmNPR1-2 genes are orthologous to Arabidopsis NPR1. Therefore, SAR pathway in soybean is most likely regulated by GmNPR1 genes. Substitution of Cys216 residue, essential for oligomer-monomer transition of Arabidopsis NPR1, with Ser and Leu residues in GmNPR1-1 and GmNPR1-2, respectively, suggested that there may be differences between the regulatory mechanisms of GmNPR1 and Arabidopsis NPR proteins.

The expression of sphingosine-1 phosphate receptor-1 in chronic lymphocytic leukemia cells is impaired by tumor microenvironmental signals and enhanced by piceatannol and R406.

PubMed

Borge, Mercedes; Remes Lenicov, Federico; Nannini, Paula R; de los Ríos Alicandú, María M; Podaza, Enrique; Ceballos, Ana; Fernández Grecco, Horacio; Cabrejo, María; Bezares, Raimundo F; Morande, Pablo E; Oppezzo, Pablo; Giordano, Mirta; Gamberale, Romina

2014-09-15

Chronic lymphocytic leukemia (CLL) is characterized by the progressive accumulation of clonal B lymphocytes. Proliferation occurs in lymphoid tissues upon interaction of leukemic cells with a supportive microenvironment. Therefore, the mobilization of tissue-resident CLL cells into the circulation is a useful therapeutic strategy to minimize the reservoir of tumor cells within survival niches. Because the exit of normal lymphocytes from lymphoid tissues depends on the presence of sphingosine-1 phosphate (S1P) and the regulated expression of S1P receptor-1 (S1PR1), we investigated whether the expression and function of S1PR1 can be modulated by key microenvironment signals. We found that activation of CLL cells with CXCL12, fibroblast CD40L(+), BCR cross-linking, or autologous nurse-like cells reduces their S1PR1 expression and the migratory response toward S1P. Moreover, we found that S1PR1 expression was reduced in the proliferative/activated subset of leukemic cells compared with the quiescent subset from the same patient. Similarly, bone marrow-resident CLL cells expressing high levels of the activation marker CD38 showed a lower expression of S1PR1 compared with CD38(low) counterparts. Finally, given that treatment with BCR-associated kinase inhibitors induces a transient redistribution of leukemic cells from lymphoid tissues to circulation, we studied the effect of the Syk inhibitors piceatannol and R406 on S1PR1 expression and function. We found that they enhance S1PR1 expression in CLL cells and their migratory response toward S1P. Based on our results, we suggest that the regulated expression of S1PR1 might modulate the egress of the leukemic clone from lymphoid tissues. Copyright © 2014 by The American Association of Immunologists, Inc.

Up-regulation of the alligator CYP3A77 gene by toxaphene and dexamethasone and its short term effect on plasma testosterone concentrations.

PubMed

Gunderson, M P; Kohno, S; Blumberg, B; Iguchi, T; Guillette, L J

2006-06-30

In this study we describe an alligator hepatic CYP3A gene, CYP3A77, which is inducible by dexamethasone and toxaphene. CYP3A plays a broad role in biotransforming both exogenous compounds and endogenous hormones such as testosterone and estradiol. Alligators collected from sites in Florida that are contaminated with organochlorine compounds exhibit differences in sex steroid concentrations. Many organochlorine compounds induce CYP3A expression in other vertebrates; hence, CYP3A induction by organochlorine contaminants could increase biotransformation and clearance of sex steroids by CYP3A and provide a plausible mechanism for the lowering of endogenous sex steroid concentrations in alligator plasma. We used real time PCR to examine whether known and suspected CYP3A inducers (dexamethasone, metyrapone, rifampicin, and toxaphene) up-regulate steady state levels of hepatic CYP3A77 transcript to determine if induction patterns in female juvenile alligators are similar to those reported in other vertebrates and whether toxaphene, an organochlorine compound found in high concentrations in Lake Apopka alligators, induces this gene. Estrogen receptor alpha (ERalpha), estrogen receptor beta (ERbeta), androgen receptor (AR), glucocorticoid receptor (GR), progesterone receptor (PR), and steroid-xenobiotic receptor (SXR) transcripts were also measured to determine whether any of these nuclear receptors are also regulated by these compounds in alligators. Dexamethasone (4.2-fold) and toxaphene (3.5-fold) significantly induced CYP3A77 gene transcript, whereas rifampicin (2.8-fold) and metyrapone (2.1-fold) up-regulated ERbeta after 24h. None of the compounds significantly up-regulated AR, ERalpha, GR, PR, or SXR over this time period. Plasma testosterone (T) did not change significantly after 24h in alligators from any of the treatment groups. Dexamethasone treated animals exhibited a strong relationship between the 24h plasma T concentrations and CYP3A77 (R(2)=0.9, positive) and SXR (R(2)=0.77, negative) transcripts, which suggests that the expression of these genes is related to plasma T in alligators. In light of our findings, we hypothesized that higher steady state CYP3A77 (and possibly SXR) gene expression would be observed in alligators collected from Lake Apopka, a polluted lake containing organochlorine compounds known to induce CYP3A isoforms in other taxa. Therefore, we measured basal levels of CYP3A77 and SXR gene transcripts in wild juvenile alligators collected from Orange Lake (reference lake), Lake Woodruff (reference lake), and Lake Apopka (contaminated lake). We found that no differences existed in CYP3A77 or SXR gene expression among animals from the lakes sampled suggesting that exposure to organochlorine compounds at concentrations present in Lake Apopka does not lead to variation in the expression of these genes, although capture stress could be interfering with these results since the glucocorticoid dexamethasone induces CYP3A77 transcript in alligators.

Signal transducer and activator of transcription-3 (Stat3) plays a critical role in implantation via progesterone receptor in uterus

PubMed Central

Lee, Jae Hee; Kim, Tae Hoon; Oh, Seo Jin; Yoo, Jung-Yoon; Akira, Shizuo; Ku, Bon Jeong; Lydon, John P.; Jeong, Jae-Wook

2013-01-01

Recent studies have shown that activation of the signal transducer and activator of transcription-3 (Stat3) is required for decidualization, interacting with progesterone receptor (PR) in uterus. Based on previous reports, we hypothesized that crosstalk between STAT3 and PR signaling is required for successful implantation. To identify the interaction between STAT3 and PR isoforms, we performed immunoprecipitation following transient cotransfection and found that STAT3 physically interacted with PR-A, which is known to be important for uterine development and function, but not with PR-B. To further investigate the role of Stat3 in uterine function, Stat3 was conditionally ablated only in the PR-positive cells (PRcre/+ Stat3f/f; Stat3d/d). Our studies revealed that ovarian function and uterine development of Stat3d/d mice were normal. However, Stat3d/d female mice were infertile due to defective embryo implantation. Unlike Stat3f/f mice, Stat3d/d mice exhibited an unclosed uterine lumen. Furthermore, uteri of Stat3d/d mice were unable to undergo a well-characterized hormonally induced decidual reaction. The expression of stromal PR was decreased during decidualization and preimplantation period in Stat3d/d mice, and PR target genes were significantly down-regulated after progesterone induction. Our results suggest that STAT3 and PR crosstalk is required for successful implantation in the mouse uterus.—Lee, J. H., Kim, T. H., Oh, S. J., Yoo, J.-Y., Akira, S., Ku, B. J., Lydon, J. P., Jeong, J.-W. Signal transducer and activator of transcription-3 (Stat3) plays a critical role in implantation via progesterone receptor in uterus. PMID:23531596

Memory Impairment in Transgenic Alzheimer Mice Requires Cellular Prion Protein

PubMed Central

Gimbel, David A.; Nygaard, Haakon B.; Coffey, Erin E.; Gunther, Erik C.; Laurén, Juha; Gimbel, Zachary A.; Strittmatter, Stephen M.

2012-01-01

Soluble oligomers of the amyloid-β (Aβ) peptide are thought to play a key role in the pathophysiology of Alzheimer’s disease (AD). Recently, we reported that synthetic Aβ oligomers bind to cellular prion protein (PrPC) and that this interaction is required for suppression of synaptic plasticity in hippocampal slices by oligomeric Aβ peptide. We hypothesized that PrPC is essential for the ability of brain-derived Aβ to suppress cognitive function. Here, we crossed familial AD transgenes encoding APPswe and PSen1ΔE9 into Prnp−/− mice to examine the necessity of PrPC for AD-related phenotypes. Neither APP expression nor Aβ level is altered by PrPC absence in this transgenic AD model, and astrogliosis is unchanged. However, deletion of PrPC expression rescues 5-HT axonal degeneration, loss of synaptic markers, and early death in APPswe/PSen1ΔE9 transgenic mice. The AD transgenic mice with intact PrPC expression exhibit deficits in spatial learning and memory. Mice lacking PrPC, but containing Aβ plaque derived from APPswe/PSen1ΔE9 transgenes, show no detectable impairment of spatial learning and memory. Thus, deletion of PrPC expression dissociates Aβ accumulation from behavioral impairment in these AD mice, with the cognitive deficits selectively requiring PrPC. PMID:20445063

Ozone-induced gene expression occurs via ethylene-dependent and -independent signalling.

PubMed

Grimmig, Bernhard; Gonzalez-Perez, Maria N; Leubner-Metzger, Gerhard; Vögeli-Lange, Regina; Meins, Fred; Hain, Rüdiger; Penuelas, Josep; Heidenreich, Bernd; Langebartels, Christian; Ernst, Dieter; Sandermann, Heinrich

2003-03-01

Recent studies suggest that ethylene is involved in signalling ozone-induced gene expression. We show here that application of ozone increased glucuronidase (GUS) expression of chimeric reporter genes regulated by the promoters of the tobacco class I beta-1,3-glucanases (GLB and Gln2) and the grapevine resveratrol synthase (Vst1) genes in transgenic tobacco leaves. 5'-deletion analysis of the class I beta-1,3-glucanase promoter revealed that ozone-induced gene regulation is mainly mediated by the distal enhancer region containing the positively acting ethylene-responsive element (ERE). In addition, application of 1-methylcyclopropene (1-MCP), an inhibitor of ethylene action, blocked ozone-induced class I beta-1,3-glucanase promoter activity. Enhancer activity and ethylene-responsiveness depended on the integrity of the GCC boxes, cis-acting elements present in the ERE of the class I beta-1,3-glucanase and the basic-type pathogenesis-related PR-1 protein (PRB-1b) gene promoters. The minimal PRB-1b promoter containing only the ERE with intact GCC boxes, was sufficient to confer 10-fold ozone inducibility to a GUS-reporter gene, while a substitution mutation in the GCC box abolished ozone responsiveness. The ERE region of the class I beta-1,3-glucanase promoter containing two intact GCC boxes confered strong ozone inducibility to a minimal cauliflower mosaic virus (CaMV) 35S RNA promoter, whereas two single-base substitution in the GCC boxes resulted in a complete loss of ozone inducibility. Taken together, these datastrongly suggest that ethylene is signalling ozone-induced expression of class I beta-l,3-glucanase and PRB-1b genes. Promoter analysis of the stilbene synthase Vst1 gene unravelled different regions for ozone and ethylene-responsiveness. Application of 1-MCP blocked ethylene-induced Vst1 induction, but ozone induction was not affected. This shows that ozone-induced gene expression occurs via at least two different signalling mechanisms and suggests an additional ethylene independent signalling pathway for ozone-induced expression of genes involved in phytoalexin biosynthesis.

Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

PubMed

Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

2006-01-01

Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

PubMed Central

Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

2013-01-01

Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

Interaction of glucocorticoids with FXR/FGF19/FGF21-mediated ileum-liver crosstalk.

PubMed

Al-Aqil, Faten A; Monte, Maria J; Peleteiro-Vigil, Ana; Briz, Oscar; Rosales, Ruben; González, Raquel; Aranda, Carlos J; Ocón, Borja; Uriarte, Iker; de Medina, Fermín Sánchez; Martinez-Augustín, Olga; Avila, Matías A; Marín, José J G; Romero, Marta R

2018-06-06

At high doses, glucocorticoids (GC) have been associated with enhanced serum bile acids and liver injury. We have evaluated the effect of GC, in the absence of hepatotoxicity, on FXR/FGF91(Fgf15)/FGF21-mediated ileum-liver crosstalk. Rats and mice (wild type and Fxr -/- , Fgf15 -/- and int-Gr -/- strains; the latter with GC receptor (Gr) knockout selective for intestinal epithelial cells), were treated (i.p.) with dexamethasone, prednisolone or budesonide. In both species, high doses of GC caused hepatotoxicity. At a non-hepatotoxic dose, GC induced ileal Fgf15 down-regulation and liver Fgf21 up-regulation, without affecting Fxr expression. Fgf21 mRNA levels correlated with those of several genes involved in glucose and bile acid metabolism. Surprisingly, liver Cyp7a1 was not up-regulated. The expression of factors involved in transcriptional modulation by Fxr and Gr (p300, Drip205, CBP and Smrt) was not affected. Pxr target genes Cyp3a11 and Mrp2 were not up-regulated in liver or intestine. In contrast, the expression of some Pparα target genes in liver (Fgf21, Cyp4a14 and Vanin-1) and intestine (Vanin-1 and Cyp3a11) was altered. In mice with experimental colitis, liver Fgf21 was up-regulated (4.4-fold). HepG2 cells transfection with FGF21 inhibited CYP7A1 promoter (prCYP7A1-Luc2). This was mimicked by pure human FGF21 protein or culture in medium previously conditioned by cells over-expressing FGF21. This response was not abolished by deletion of a putative response element for phosphorylated FGF21 effectors present in prCYP7A1. In conclusion, GC interfere with FXR/FGF19-mediated intestinal control of CYP7A1 expression by the liver and stimulate hepatic secretion of FGF21, which inhibits CYP7A1 promoter through an autocrine mechanism. Copyright © 2018 Elsevier B.V. All rights reserved.

FLT3-regulated antigens as targets for leukemia-reactive cytotoxic T lymphocytes

PubMed Central

Brackertz, B; Conrad, H; Daniel, J; Kast, B; Krönig, H; Busch, D H; Adamski, J; Peschel, C; Bernhard, H

2011-01-01

The FMS-like tyrosine kinase 3 (FLT3) is highly expressed in acute myeloid leukemia (AML). Internal tandem duplications (ITD) of the juxtamembrane domain lead to the constitutive activation of the FLT3 kinase inducing the activation of multiple genes, which may result in the expression of leukemia-associated antigens (LAAs). We analyzed the regulation of LAA in FLT3-wild-type (WT)- and FLT3-ITD+ myeloid cells to identify potential targets for antigen-specific immunotherapy for AML patients. Antigens, such as PR-3, RHAMM, Survivin, WT-1 and PRAME, were upregulated by constitutively active FLT3-ITD as well as FLT3-WT activated by FLT3 ligand (FL). Cytotoxic T-cell (CTL) clones against PR-3, RHAMM, Survivin and an AML-directed CTL clone recognized AML cell lines and primary AML blasts expressing FLT3-ITD, as well as FLT3-WT+ myeloid dendritic cells in the presence of FL. Downregulation of FLT3 led to the abolishment of CTL recognition. Comparing our findings concerning LAA upregulation by the FLT3 kinase with those already made for the Bcr-Abl kinase, we found analogies in the LAA expression pattern. Antigens upregulated by both FLT3 and Bcr-Abl may be promising targets for the development of immunotherapeutical approaches against myeloid leukemia of different origin. PMID:22829124

Optimisations and Challenges Involved in the Creation of Various Bioluminescent and Fluorescent Influenza A Virus Strains for In Vitro and In Vivo Applications

PubMed Central

Herfst, Sander; Bestebroer, Theo M.; Vaes, Vincent P.; van der Hoeven, Barbara; Koster, Abraham J.; Kremers, Gert-Jan; Scott, Dana P.; Gultyaev, Alexander P.; Sorell, Erin M.; de Graaf, Miranda; Bárcena, Montserrat; Rimmelzwaan, Guus F.; Fouchier, Ron A.

2015-01-01

Bioluminescent and fluorescent influenza A viruses offer new opportunities to study influenza virus replication, tropism and pathogenesis. To date, several influenza A reporter viruses have been described. These strategies typically focused on a single reporter gene (either bioluminescent or fluorescent) in a single virus backbone. However, whilst bioluminescence is suited to in vivo imaging, fluorescent viruses are more appropriate for microscopy. Therefore, the idea l reporter virus varies depending on the experiment in question, and it is important that any reporter virus strategy can be adapted accordingly. Herein, a strategy was developed to create five different reporter viruses in a single virus backbone. Specifically, enhanced green fluorescent protein (eGFP), far-red fluorescent protein (fRFP), near-infrared fluorescent protein (iRFP), Gaussia luciferase (gLUC) and firefly luciferase (fLUC) were inserted into the PA gene segment of A/PR/8/34 (H1N1). This study provides a comprehensive characterisation of the effects of different reporter genes on influenza virus replication and reporter activity. In vivo reporter gene expression, in lung tissues, was only detected for eGFP, fRFP and gLUC expressing viruses. In vitro, the eGFP-expressing virus displayed the best reporter stability and could be used for correlative light electron microscopy (CLEM). This strategy was then used to create eGFP-expressing viruses consisting entirely of pandemic H1N1, highly pathogenic avian influenza (HPAI) H5N1 and H7N9. The HPAI H5N1 eGFP-expressing virus infected mice and reporter gene expression was detected, in lung tissues, in vivo. Thus, this study provides new tools and insights for the creation of bioluminescent and fluorescent influenza A reporter viruses. PMID:26241861

Estrogenic effects of herbal medicines from Costa Rica used for the management of menopausal symptoms.

PubMed

Doyle, Brian J; Frasor, Jonna; Bellows, Lauren E; Locklear, Tracie D; Perez, Alice; Gomez-Laurito, Jorge; Mahady, Gail B

2009-01-01

Outcomes from the Women's Health Initiative have demonstrated adverse effects associated with hormone therapy and have prioritized the need to develop new alternative treatments for the management of menopause and osteoporosis. To this end, we have been investigating natural herbal medicines used by Costa Rican women to manage menopausal symptoms. Seventeen plant species were collected and extracted in Costa Rica. To establish possible mechanisms of action and to determine their potential future use for menopause or osteoporosis, we investigated the estrogenic activities of the herbal extracts in an estrogen-reporter gene estrogen receptor (ER) beta-Chemically Activated Luciferase Expression assay in U2-OS cells and in reporter and endogenous gene assays in MCF-7 cells. Six of the plant extracts bound to the ERs. Four of the six extracts stimulated reporter gene expression in the ER-beta-Chemically Activated Luciferase Expression assay. All six extracts modulated expression of endogenous genes in MCF-7 cells, with four extracts acting as estrogen agonists and two extracts, Pimenta dioica and Smilax domingensis, acting as partial agonist/antagonists by enhancing estradiol-stimulated pS2 mRNA expression but reducing estradiol-stimulated PR and PTGES mRNA expression. Both P. dioica and S. domingensis induced a 2ERE-luciferase reporter gene in transient transfected MCF-7 cells, which was inhibited by the ER antagonist ICI 182,780. This work presents a plausible mechanism of action for many of the herbal medicines used by Costa Rican women to treat menopausal symptoms. However, it further suggests that studies of safety and efficacy are needed before these herbs should be used as alternative therapies to hormone therapy.

A deletion mutation in the 5' part of the pol gene of Moloney murine leukemia virus blocks proteolytic processing of the gag and pol polyproteins.

PubMed Central

Crawford, S; Goff, S P

1985-01-01

Deletion mutations in the 5' part of the pol gene of Moloney murine leukemia virus were generated by restriction enzyme site-directed mutagenesis of cloned proviral DNA. DNA sequence analysis indicated that one such deletion was localized entirely within the 5' part of the pol gene, did not affect the region encoding reverse transcriptase, and preserved the translational reading frame downstream of the mutation. The major viral precursor polyproteins (Pr65gag, Pr200gag-pol, and gPr80env) were synthesized at wild-type levels in cell lines carrying the mutant genome. These cell lines assembled and released wild-type levels of virion particles into the medium. Cleavage of both Pr65gag and Pr200gag-pol precursors to the mature proteins was completely blocked in the mutant virions. Surprisingly, these virions contained high levels of active reverse transcriptase; examination of the endogenous reverse transcription products synthesized by the mutant virions revealed normal amounts of minus-strand strong-stop DNA, indicating that the RNA genome was packaged and that reverse transcription in detergent-permeabilized virions was not significantly impaired. Processing of gPr80env to gP70env and P15E was not affected by the mutation, but cleavage of P15E to P12E was not observed. The mutant particles were poorly infectious; analysis indicated that infection was blocked at an early stage. The data are consistent with the idea that the 5' part of the pol gene encodes a protease directly responsible for processing Pr65gag, and possibly Pr200gag-pol, to the structural virion proteins. It appears that cleavage of the gag gene product is not required for budding and release of virions and that complete processing of the pol gene product to the mature form of reverse transcriptase is not required for its functional activation. Images PMID:3882995

Ethylene-induced differential gene expression during abscission of citrus leaves

PubMed Central

Merelo, Paz; Cercós, Manuel; Tadeo, Francisco R.; Talón, Manuel

2008-01-01

The main objective of this work was to identify and classify genes involved in the process of leaf abscission in Clementina de Nules (Citrus clementina Hort. Ex Tan.). A 7 K unigene citrus cDNA microarray containing 12 K spots was used to characterize the transcriptome of the ethylene-induced abscission process in laminar abscission zone-enriched tissues and the petiole of debladed leaf explants. In these conditions, ethylene induced 100% leaf explant abscission in 72 h while, in air-treated samples, the abscission period started later and took 240 h. Gene expression monitored during the first 36 h of ethylene treatment showed that out of the 12 672 cDNA microarray probes, ethylene differentially induced 725 probes distributed as follows: 216 (29.8%) probes in the laminar abscission zone and 509 (70.2%) in the petiole. Functional MIPS classification and manual annotation of differentially expressed genes highlighted key processes regulating the activation and progress of the cell separation that brings about abscission. These included cell-wall modification, lipid transport, protein biosynthesis and degradation, and differential activation of signal transduction and transcription control pathways. Expression data associated with the petiole indicated the occurrence of a double defensive strategy mediated by the activation of a biochemical programme including scavenging ROS, defence and PR genes, and a physical response mostly based on lignin biosynthesis and deposition. This work identifies new genes probably involved in the onset and development of the leaf abscission process and suggests a different but co-ordinated and complementary role for the laminar abscission zone and the petiole during the process of abscission. PMID:18515267

Response of Vitis vinifera cell cultures to Eutypa lata and Trichoderma atroviride culture filtrates: expression of defence-related genes and phenotypes.

PubMed

Mutawila, C; Stander, C; Halleen, F; Vivier, M A; Mostert, L

2017-03-01

Cell suspension cultures of Vitis vinifera cv. Dauphine berries were used to study the response to the vascular pathogen, Eutypa lata, in comparison with a biological control agent, Trichoderma atroviride, that was previously shown to be effective in pruning wound protection. The expression of genes coding for enzymes of the phenylpropanoid pathway and pathogenesis-related (PR) proteins was profiled over a 48-h period using quantitative reverse transcriptase PCR. The cell cultures responded to elicitors of both fungi with a hypersensitive-like response that lead to a decrease in cell viability. Similar genes were triggered by both the pathogen and biocontrol agent, but the timing patterns and magnitude of expression was dependent on the specific fungal elicitor. Culture filtrates of both fungi caused upregulation of phenylalanine ammonia-lyase (PAL), 4-coumaroyl Co-A ligase (CCo-A) and stilbene synthase (STS), and a downregulation of chalcone synthase (CHS) genes. The pathogen filtrate caused a biphasic pattern in the upregulation of PAL and STS genes which was not observed in cells treated with filtrates of the biocontrol agent. Analytical assays showed significantly higher total phenolic content and chitinolytic enzyme activity in the cell cultures treated with the T. atroviride filtrate compared to the pathogen filtrate. These results corresponded well to the higher expression of PAL and chitinase class IV genes. The response of the cell cultures to T. atroviride filtrate provides support for the notion that the wound protection by the biocontrol agent at least partially relies on the induction of grapevine resistance mechanisms.

Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

PubMed

Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

2015-06-01

Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by mice expressing only anchorless PrP were more infectious than prions produced in mice expressing anchored PrP. Thus, the lack of the GPI anchor on prions reduced the effect of the mouse-human species barrier. Our results suggest that prion diseases that produce higher levels of anchorless PrP may pose an increased risk for cross-species infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Paromomycin Derived from Streptomyces sp. AG-P 1441 Induces Resistance against Two Major Pathogens of Chili Pepper.

PubMed

Balaraju, Kotnala; Kim, Chang-Jin; Park, Dong-Jin; Nam, Ki-Woong; Zhang, Kecheng; Sang, Mee Kyung; Park, Kyungseok

2016-09-28

This is the first report that paromomycin, an antibiotic derived from Streptomyces sp. AG-P 1441 (AG-P 1441), controlled Phytophthora blight and soft rot diseases caused by Phytophthora capsici and Pectobacterium carotovorum, respectively, in chili pepper (Capsicum annum L.). Chili pepper plants treated with paromomycin by foliar spray or soil drenching 7 days prior to inoculation with P. capsici zoospores showed significant (p < 0.05) reduction in disease severity (%) when compared with untreated control plants. The disease severity of Phytophthora blight was recorded as 8% and 50% for foliar spray and soil drench, respectively, at 1.0 ppm of paromomycin, compared with untreated control, where disease severity was 83% and 100% by foliar spray and soil drench, respectively. A greater reduction of soft rot lesion areas per leaf disk was observed in treated plants using paromomycin (1.0 μg/ml) by infiltration or soil drench in comparison with untreated control plants. Paromomycin treatment did not negatively affect the growth of chili pepper. Furthermore, the treatment slightly promoted growth; this growth was supported by increased chlorophyll content in paromomycin-treated chili pepper plants. Additionally, paromomycin likely induced resistance as confirmed by the expression of pathogenesis-related (PR) genes: PR-1, β-1,3-glucanase, chitinase, PR-4, peroxidase, and PR-10, which enhanced plant defense against P. capsici in chili pepper. This finding indicates that AG-P 1441 plays a role in pathogen resistance upon the activation of defense genes, by secretion of the plant resistance elicitor, paromomycin.

Polymorphism analysis of prion protein gene in 11 Pakistani goat breeds

PubMed Central

Hassan, Mohammad Farooque; Khan, Sher Hayat; Babar, Masroor Ellahi; Yang, Lifeng; Ali, Tariq; Khan, Jamal Muhammad; Shah, Syed Zahid Ali; Zhou, Xiangmei; Hussain, Tanveer; Zhu, Ting; Hussain, Tariq; Zhao, Deming

2016-01-01

ABSTRACT The association between caprine PrP gene polymorphisms and its susceptibility to scrapie has been investigated in current years. As the ORF of the PrP gene is extremely erratic in different breeds of goats, we studied the PrP gene polymorphisms in 80 goats which belong to 11 Pakistani indigenous goat breeds from all provinces of Pakistan. A total of 6 distinct polymorphic sites (one novel) with amino acid substitutions were identified in the PrP gene which includes 126 (A -> G), 304 (G -> T), 379 (A -> G), 414 (C -> T), 428 (A -> G) and 718 (C -> T). The locus c.428 was found highly polymorphic in all breeds as compare to other loci. On the basis of these PrP variants NJ phylogenetic tree was constructed through MEGA6.1 which showed that all goat breeds along with domestic sheep and Mauflon sheep appeared as in one clade and sharing its most recent common ancestors (MRCA) with deer species while Protein analysis has shown that these polymorphisms can lead to varied primary, secondary and tertiary structure of protein. Based on these polymorphic variants, genetic distance, multidimensional scaling plot and principal component analyses revealed the clear picture regarding greater number of substitutions in cattle PrP regions as compared to the small ruminant species. In particular these findings may pinpoint the fundamental control over the scrapie in Capra hircus on genetic basis. PMID:27388702

Transcriptome analysis reveals key roles of AtLBR-2 in LPS-induced defense responses in plants.

PubMed

Iizasa, Sayaka; Iizasa, Ei'ichi; Watanabe, Keiichi; Nagano, Yukio

2017-12-29

Lipopolysaccharide (LPS) from Gram-negative bacteria cause innate immune responses in animals and plants. The molecules involved in LPS signaling in animals are well studied, whereas those in plants are not yet as well documented. Recently, we identified Arabidopsis AtLBR-2, which binds to LPS from Pseudomonas aeruginosa (pLPS) directly and regulates pLPS-induced defense responses, such as pathogenesis-related 1 (PR1) expression and reactive oxygen species (ROS) production. In this study, we investigated the pLPS-induced transcriptomic changes in wild-type (WT) and the atlbr-2 mutant Arabidopsis plants using RNA-Seq technology. RNA-Seq data analysis revealed that pLPS treatment significantly altered the expression of 2139 genes, with 605 up-regulated and 1534 down-regulated genes in WT. Gene ontology (GO) analysis on these genes showed that GO terms, "response to bacterium", "response to salicylic acid (SA) stimulus", and "response to abscisic acid (ABA) stimulus" were enriched amongst only in up-regulated genes, as compared to the genes that were down-regulated. Comparative analysis of differentially expressed genes between WT and the atlbr-2 mutant revealed that 65 genes were up-regulated in WT but not in the atlbr-2 after pLPS treatment. Furthermore, GO analysis on these 65 genes demonstrated their importance for the enrichment of several defense-related GO terms, including "response to bacterium", "response to SA stimulus", and "response to ABA stimulus". We also found reduced levels of pLPS-induced conjugated SA glucoside (SAG) accumulation in atlbr-2 mutants, and no differences were observed in the gene expression levels in SA-treated WT and the atlbr-2 mutants. These 65 AtLBR-2-dependent up-regulated genes appear to be important for the enrichment of some defense-related GO terms. Moreover, AtLBR-2 might be a key molecule that is indispensable for the up-regulation of defense-related genes and for SA signaling pathway, which is involved in defense against pathogens containing LPS.

Silencing and heterologous expression of ppo-2 indicate a specific function of a single polyphenol oxidase isoform in resistance of dandelion (Taraxacum officinale) against Pseudomonas syringae pv. tomato.

PubMed

Richter, Carolin; Dirks, Mareike E; Gronover, Christian Schulze; Prüfer, Dirk; Moerschbacher, Bruno M

2012-02-01

Dandelion (Taraxacum officinale) possesses an unusually high degree of disease resistance. As this plant exhibits high polyphenol oxidase (PPO) activity and PPO have been implicated in resistance against pests and pathogens, we analyzed the potential involvement of five PPO isoenzymes in the resistance of dandelion against Botrytis cinerea and Pseudomonas syringae pv. tomato. Only one PPO (ppo-2) was induced during infection, and ppo-2 promoter and β-glucuronidase marker gene fusions revealed strong induction of the gene surrounding lesions induced by B. cinerea. Specific RNAi silencing reduced ppo-2 expression only, and concomitantly increased plant susceptibility to P. syringae pv. tomato. At 4 days postinoculation, P. syringae pv. tomato populations were strongly increased in the ppo-2 RNAi lines compared with wild-type plants. When the dandelion ppo-2 gene was expressed in Arabidopsis thaliana, a plant having no PPO gene, active protein was formed and protein extracts of the transgenic plants exhibited substrate-dependent antimicrobial activity against P. syringae pv. tomato. These results clearly indicate a strong contribution of a specific, single PPO isoform to disease resistance. Therefore, we propose that specific PPO isoenzymes be included in a new family of pathogenesis-related (PR) proteins.

Glycoform-independent prion conversion by highly efficient, cell-based, protein misfolding cyclic amplification

PubMed Central

Moudjou, Mohammed; Chapuis, Jérôme; Mekrouti, Mériem; Reine, Fabienne; Herzog, Laetitia; Sibille, Pierre; Laude, Hubert; Vilette, Didier; Andréoletti, Olivier; Rezaei, Human; Dron, Michel; Béringue, Vincent

2016-01-01

Prions are formed of misfolded assemblies (PrPSc) of the variably N-glycosylated cellular prion protein (PrPC). In infected species, prions replicate by seeding the conversion and polymerization of host PrPC. Distinct prion strains can be recognized, exhibiting defined PrPSc biochemical properties such as the glycotype and specific biological traits. While strain information is encoded within the conformation of PrPSc assemblies, the storage of the structural information and the molecular requirements for self-perpetuation remain uncertain. Here, we investigated the specific role of PrPC glycosylation status. First, we developed an efficient protein misfolding cyclic amplification method using cells expressing the PrPC species of interest as substrate. Applying the technique to PrPC glycosylation mutants expressing cells revealed that neither PrPC nor PrPSc glycoform stoichiometry was instrumental to PrPSc formation and strainness perpetuation. Our study supports the view that strain properties, including PrPSc glycotype are enciphered within PrPSc structural backbone, not in the attached glycans. PMID:27384922

SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR-Positive Mammary Tumors Connecting Metabolism and Carcinogenesis SIRT3 is a Mitochondrial Tumor Suppressor

DTIC Science & Technology

2012-09-01

well as HIF-1α dependent gene expression, as shown by co-transfection assays using an HRE luciferase reporter (Fig. 4b, bar 1 vs. 2). In addition...MEFs were co-transfected with p3x- HRE -luciferase with or without NAC or stigmatellin and 40 hours afterwards luciferase levels were determined. (c

The evolutionary dynamics of variant antigen genes in Babesia reveal a history of genomic innovation underlying host-parasite interaction.

PubMed

Jackson, Andrew P; Otto, Thomas D; Darby, Alistair; Ramaprasad, Abhinay; Xia, Dong; Echaide, Ignacio Eduardo; Farber, Marisa; Gahlot, Sunayna; Gamble, John; Gupta, Dinesh; Gupta, Yask; Jackson, Louise; Malandrin, Laurence; Malas, Tareq B; Moussa, Ehab; Nair, Mridul; Reid, Adam J; Sanders, Mandy; Sharma, Jyotsna; Tracey, Alan; Quail, Mike A; Weir, William; Wastling, Jonathan M; Hall, Neil; Willadsen, Peter; Lingelbach, Klaus; Shiels, Brian; Tait, Andy; Berriman, Matt; Allred, David R; Pain, Arnab

2014-06-01

Babesia spp. are tick-borne, intraerythrocytic hemoparasites that use antigenic variation to resist host immunity, through sequential modification of the parasite-derived variant erythrocyte surface antigen (VESA) expressed on the infected red blood cell surface. We identified the genomic processes driving antigenic diversity in genes encoding VESA (ves1) through comparative analysis within and between three Babesia species, (B. bigemina, B. divergens and B. bovis). Ves1 structure diverges rapidly after speciation, notably through the evolution of shortened forms (ves2) from 5' ends of canonical ves1 genes. Phylogenetic analyses show that ves1 genes are transposed between loci routinely, whereas ves2 genes are not. Similarly, analysis of sequence mosaicism shows that recombination drives variation in ves1 sequences, but less so for ves2, indicating the adoption of different mechanisms for variation of the two families. Proteomic analysis of the B. bigemina PR isolate shows that two dominant VESA1 proteins are expressed in the population, whereas numerous VESA2 proteins are co-expressed, consistent with differential transcriptional regulation of each family. Hence, VESA2 proteins are abundant and previously unrecognized elements of Babesia biology, with evolutionary dynamics consistently different to those of VESA1, suggesting that their functions are distinct. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Differential Expression and Pathway Analysis in Drug-Resistant Triple-Negative Breast Cancer Cell Lines Using RNASeq Analysis.

PubMed

Shaheen, Safa; Fawaz, Febin; Shah, Shaheen; Büsselberg, Dietrich

2018-06-19

Triple-negative breast cancer (TNBC) is among the most notorious types of breast cancer, the treatment of which does not give consistent results due to the absence of the three receptors (estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) as well as high amount of molecular variability. Drug resistance also contributes to treatment unresponsiveness. We studied differentially expressed genes, their biological roles, as well as pathways from RNA-Seq datasets of two different TNBC drug-resistant cell lines of Basal B subtype SUM159 and MDA-MB-231 treated with drugs JQ1 and Dexamethasone, respectively, to elucidate the mechanism of drug resistance. RNA sequencing(RNA-Seq) data analysis was done using edgeR which is an efficient program for determining the most significant Differentially Expressed Genes (DEGs), Gene Ontology (GO) terms, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. iPathway analysis was further used to obtain validated results using analysis that takes into consideration type, function, and interactions of genes in the pathway. The significant similarities and differences throw light into the molecular heterogeneity of TNBC, giving clues into the aspects that can be focused to overcome drug resistance. From this study, cytokine-cytokine receptor interaction pathway appeared to be a key factor in TNBC drug resistance.

Ethylene emission and PR protein synthesis in ACC deaminase producing Methylobacterium spp. inoculated tomato plants (Lycopersicon esculentum Mill.) challenged with Ralstonia solanacearum under greenhouse conditions.

PubMed

Yim, Woojong; Seshadri, Sundaram; Kim, Kiyoon; Lee, Gillseung; Sa, Tongmin

2013-06-01

Bacteria of genus Methylobacterium have been found to promote plant growth and regulate the level of ethylene in crop plants. This work is aimed to test the induction of defense responses in tomato against bacterial wilt by stress ethylene level reduction mediated by the ACC deaminase activity of Methylobacterium strains. Under greenhouse conditions, the disease index value in Methylobacterium sp. inoculated tomato plants was lower than control plants. Plants treated with Methylobacterium sp. challenge inoculated with Ralstonia solanacearum (RS) showed significantly reduced disease symptoms and lowered ethylene emission under greenhouse condition. The ACC and ACO (1-aminocyclopropane-1-carboxylate oxidase) accumulation in tomato leaves were significantly reduced with Methylobacterium strains inoculation. While ACC oxidase gene expression was found higher in plants treated with R. solanacearum than Methylobacterium sp. treatment, PR proteins related to induced systemic resistance like β-1,3-glucanase, PAL, PO and PPO were increased in Methylobacterium sp. inoculated plants. A significant increase in β-1,3-glucanase and PAL gene expression was found in all the Methylobacterium spp. treatments compared to the R. solanacearum treatment. This study confirms the activity of Methylobacterium sp. in increasing the defense enzymes by modulating the ethylene biosynthesis pathway and suggests the use of methylotrophic bacteria as potential biocontrol agents in tomato cultivation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Studies on the mechanism of functional cooperativity between progesterone and estrogen receptors.

PubMed

Bradshaw, M S; Tsai, S Y; Leng, X H; Dobson, A D; Conneely, O M; O'Malley, B W; Tsai, M J

1991-09-05

Steroid response elements (SREs) cooperate with many different cis-acting elements including NF-1 sites, CACCC boxes, and other SREs to induce target gene expression (Schule, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 332, 87-90; Strahle, U., Schmid, W., and Schutz, G. (1988) EMBO J. 7, 3389-3395). Induction of gene expression can be additive or synergistic with respect to the level of activation by either transactivators. Two mechanisms have been proposed for how synergism occurs: 1) cooperative binding of transcriptional activators to DNA or 2) simultaneous interaction of individually bound activators with a common target protein. We have shown previously that cooperative binding of receptors is important for synergism between two progesterone response elements (PREs). Here we showed that an estrogen response element (ERE) and a PRE can also functionally cooperate and this synergism between an ERE and a PRE is not contributed by cooperative DNA binding. Furthermore, we have demonstrated that the activation domains of the progesterone receptor (PR) (C1Act) are required for synergism between two PREs and sufficient for confirming cooperative binding. However these two activation domains of PR are not sufficient for synergism between an ERE and a PRE. Additional regions within the NH2-terminal and COOH-terminal domains are also required for synergistic interaction between two heterologous SREs.

HOW FUNGI INTERACT WITH NEMATODE TO ACTIVATE THE PLANT DEFENCE RESPONSE TO TOMATO PLANTS.

PubMed

Leonetti, P; Costanza, A; Zonno, M C; Molinari, S; Altomare, C

2014-01-01

Management of plant parasitic nematodes with nematode predators, parasites or antagonists is an eco-friendly approach that may avoid the problems arisen by the use of toxic chemicals. Fungi belonging to Trichoderma spp. are well known in literature for their role in control of plant parasitic nematodes. Root-knot nematodes (RKNs), Meloidogyne spp., are obligate parasites that cause the formation of familiar galls on the roots of many cultivated plants. The interaction between the M. incognita motile second stage juveniles (J2s) and the isolate ITEM 908 of Trichoderma harzianum was examined in its effect on the nematode infestation level of susceptible tomato plants. To gain insight into the mechanisms by which ITEM 908 interacts with nematode-infected tomato plants, the expression patterns of the genes PR1 (marker of Salycilic Acid-depending resistance signalling pathway) and JERF3 (marker of the Jasmonic Acid/Ethylene-depending resistance signalling pathway) were detected over time in: i) untreated roots; ii) roots pre-treated with the fungus; iii) roots inoculated with the nematode; iv) pre-treated and inoculated roots. Infestation parameters were checked in untreated plants and plants treated with the fungus to test the effect of the fungus on nematode infestation level and to compare this effect with the expression of the genes PR1 and JERF3, involved in induced resistance.

Uterine Natural Killer cells regulate endometrial bleeding in women and are suppressed by the progesterone receptor modulator asoprisnil

PubMed Central

Wilkens, Julia; Male, Victoria; Ghazal, Peter; Forster, Thorsten; Gibson, Douglas A.; Williams, Alistair RW; Brito-Mutunayagam, Savita L; Craigon, Marie; Lourenco, Paula; Cameron, Iain T; Chwalisz, Kristof; Moffett, Ashley; Critchley, Hilary OD

2013-01-01

Uterine NK cells (uNK) play a role in the regulation of placentation but their functions in non-pregnant endometrium are not understood. We have previously reported suppression of endometrial bleeding and alteration of spiral artery morphology in women exposed to asoprisnil, a progesterone receptor modulator. We now compare global endometrial gene expression in asoprisnil-treated versus control women, and we demonstrate a statistically significant reduction of genes in the IL-15 pathway, known to play a key role in uNK development and function. Suppression of IL-15 by asoprisnil was also observed at mRNA level (p<0.05), and immunostaining for NK cell marker CD56 revealed a striking reduction of uNK in asoprisnil-treated endometrium (p<0.001). IL-15 levels in normal endometrium are progesterone-responsive. Progesterone receptor (PR) positive stromal cells transcribe both IL-15 and IL-15RA. Thus, the response of stromal cells to progesterone will be to increase IL-15 trans-presentation to uNK, supporting their expansion and differentiation. In asoprisnil-treated endometrium, there is a marked down-regulation of stromal PR expression and virtual absence of uNK. These novel findings indicate that the IL-15 pathway provides a missing link in the complex interplay between endometrial stromal cells, uNK and spiral arteries affecting physiological and pathological endometrial bleeding. PMID:23913972

Gaseous 3-pentanol primes plant immunity against a bacterial speck pathogen, Pseudomonas syringae pv. tomato via salicylic acid and jasmonic acid-dependent signaling pathways in Arabidopsis.

PubMed

Song, Geun C; Choi, Hye K; Ryu, Choong-Min

2015-01-01

3-Pentanol is an active organic compound produced by plants and is a component of emitted insect sex pheromones. A previous study reported that drench application of 3-pentanol elicited plant immunity against microbial pathogens and an insect pest in crop plants. Here, we evaluated whether 3-pentanol and the derivatives 1-pentanol and 2-pentanol induced plant systemic resistance using the in vitro I-plate system. Exposure of Arabidopsis seedlings to 10 μM and 100 nM 3-pentanol evaporate elicited an immune response to Pseudomonas syringae pv. tomato DC3000. We performed quantitative real-time PCR to investigate the 3-pentanol-mediated Arabidopsis immune responses by determining Pathogenesis-Related (PR) gene expression levels associated with defense signaling through salicylic acid (SA), jasmonic acid (JA), and ethylene signaling pathways. The results show that exposure to 3-pentanol and subsequent pathogen challenge upregulated PDF1.2 and PR1 expression. Selected Arabidopsis mutants confirmed that the 3-pentanol-mediated immune response involved SA and JA signaling pathways and the NPR1 gene. Taken together, this study indicates that gaseous 3-pentanol triggers induced resistance in Arabidopsis by priming SA and JA signaling pathways. To our knowledge, this is the first report that a volatile compound of an insect sex pheromone triggers plant systemic resistance against a bacterial pathogen.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

Induction of defence gene expression by oligogalacturonic acid requires increases in both cytosolic calcium and hydrogen peroxide in Arabidopsis thaliana.

PubMed

Hu, Xiang Yang; Neill, Steven J; Cai, Wei Ming; Tang, Zhang Cheng

2004-06-01

Responses to oligogalacturonic acid (OGA) were determined in transgenic Arabidopsis thaliana seedlings expressing the calcium reporter protein aequorin. OGA stimulated a rapid, substantial and transient increase in the concentration of cytosolic calcium ([Ca2+]cyt) that peaked after ca. 15 s. This increase was dose-dependent, saturating at ca. 50 ug Gal equiv/ml of OGA. OGA also stimulated a rapid generation of H2O2. A small, rapid increase in H2O2 content was followed by a much larger oxidative burst, with H2O2 content peaking after ca. 60 min and declining thereafter. Induction of the oxidative burst by OGA was also dose-dependent, with a maximum response again being achieved at ca. 50 ug Gal equiv/mL. Inhibitors of calcium fluxes inhibited both increases in [Ca2+]cyt and [H2O2], whereas inhibitors of NADPH oxidase blocked only the oxidative burst. OGA increased strongly the expression of the defence-related genes CHS, GST, PAL and PR-1. This induction was suppressed by inhibitors of calcium flux or NADPH oxidase, indicating that increases in both cytosolic calcium and H2O2 are required for OGA-induced gene expression.

Memory impairment in transgenic Alzheimer mice requires cellular prion protein.

PubMed

Gimbel, David A; Nygaard, Haakon B; Coffey, Erin E; Gunther, Erik C; Laurén, Juha; Gimbel, Zachary A; Strittmatter, Stephen M

2010-05-05

Soluble oligomers of the amyloid-beta (Abeta) peptide are thought to play a key role in the pathophysiology of Alzheimer's disease (AD). Recently, we reported that synthetic Abeta oligomers bind to cellular prion protein (PrP(C)) and that this interaction is required for suppression of synaptic plasticity in hippocampal slices by oligomeric Abeta peptide. We hypothesized that PrP(C) is essential for the ability of brain-derived Abeta to suppress cognitive function. Here, we crossed familial AD transgenes encoding APPswe and PSen1DeltaE9 into Prnp-/- mice to examine the necessity of PrP(C) for AD-related phenotypes. Neither APP expression nor Abeta level is altered by PrP(C) absence in this transgenic AD model, and astrogliosis is unchanged. However, deletion of PrP(C) expression rescues 5-HT axonal degeneration, loss of synaptic markers, and early death in APPswe/PSen1DeltaE9 transgenic mice. The AD transgenic mice with intact PrP(C) expression exhibit deficits in spatial learning and memory. Mice lacking PrP(C), but containing Abeta plaque derived from APPswe/PSen1DeltaE9 transgenes, show no detectable impairment of spatial learning and memory. Thus, deletion of PrP(C) expression dissociates Abeta accumulation from behavioral impairment in these AD mice, with the cognitive deficits selectively requiring PrP(C).

Enhanced susceptibility of Prnp-deficient mice to kainate-induced seizures, neuronal apoptosis, and death: Role of AMPA/kainate receptors.

PubMed

Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A

2007-09-01

Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.

C-Terminal Helical Domains of Dengue Virus Type 4 E Protein Affect the Expression/Stability of prM Protein and Conformation of prM and E Proteins

PubMed Central

Tsai, Wen-Yang; Hsieh, Szu-Chia; Lai, Chih-Yun; Lin, Hong-En; Nerurkar, Vivek R.; Wang, Wei-Kung

2012-01-01

Background The envelope (E) protein of dengue virus (DENV) is the major immunogen for dengue vaccine development. At the C-terminus are two α-helices (EH1 and EH2) and two transmembrane domains (ET1 and ET2). After synthesis, E protein forms a heterodimer with the precursor membrane (prM) protein, which has been shown as a chaperone for E protein and could prevent premature fusion of E protein during maturation. Recent reports of enhancement of DENV infectivity by anti-prM monoclonal antibodies (mAbs) suggest the presence of prM protein in dengue vaccine is potentially harmful. A better understanding of prM-E interaction and its effect on recognition of E and prM proteins by different antibodies would provide important information for future design of safe and effective subunit dengue vaccines. Methodology/Principal Findings In this study, we examined a series of C-terminal truncation constructs of DENV4 prME, E and prM. In the absence of E protein, prM protein expressed poorly. In the presence of E protein, the expression of prM protein increased in a dose-dependent manner. Radioimmunoprecipitation, sucrose gradient sedimentation and pulse-chase experiments revealed ET1 and EH2 were involved in prM-E interaction and EH2 in maintaining the stability of prM protein. Dot blot assay revealed E protein affected the recognition of prM protein by an anti-prM mAb; truncation of EH2 or EH1 affected the recognition of E protein by several anti-E mAbs, which was further verified by capture ELISA. The E protein ectodomain alone can be recognized well by all anti-E mAbs tested. Conclusions/Significance A C-terminal domain (EH2) of DENV E protein can affect the expression and stability of its chaperone prM protein. These findings not only add to our understanding of the interaction between prM and E proteins, but also suggest the ectodomain of E protein alone could be a potential subunit immunogen without inducing anti-prM response. PMID:23300717

The (PrS/HGF-pDNA) multilayer films for gene-eluting stent coating: Gene-protecting, anticoagulation, antibacterial properties, and in vivo antirestenosis evaluation.

PubMed

Chang, Hao; Ren, Ke-feng; Zhang, He; Wang, Jin-lei; Wang, Bai-liang; Ji, Jian

2015-02-01

Vascular gene-eluting stents (GES) is a promising strategy for treatment of cardiovascular disease. Very recently, we have proved that the (protamine sulfate/plasmid DNA encoding hepatocyte growth factor) (PrS/HGF-pDNA) multilayer can serve as a powerful tool for enhancing competitiveness of endothelial cell over smooth muscle cell, which opens perspectives for the regulation of intercellular competitiveness in the field of interventional therapy. However, before the gene multilayer films could be used in vascular stents for real clinical application, the preservation of gene bioactivity during the industrial sterilization and the hemocompatibility of film should be taken into account. Actually, both are long been ignored issues in the field of gene coating for GES. In this study, we demonstrate that the (PrS/HGF-pDNA) multilayer film exhibits the good gene-protecting abilities, which is confirmed by using the industrial sterilizations (gamma irradiation and ethylene oxide) and a routine storage condition (dry state at 4°C for 30 days). Furthermore, hemocompatible measurements (such as platelet adhesion and whole blood coagulation) and antibacterial assays (bacteria adhesion and growth inhibition) indicate the good anticoagulation and antibacterial properties of the (PrS/HGF-pDNA) multilayer film. The in vivo preliminary data of angiography and histological analysis suggest that the (PrS/HGF-pDNA) multilayer coated stent can reduce the in-stent restenosis. This work reveals that the (PrS/HGF-pDNA) multilayer film could be a promising candidate as coating for GES, which is of great potential in future clinic application. © 2014 Wiley Periodicals, Inc.

Involvement of Prolactin-Releasing Peptide in the Activation of Oxytocin Neurones in Response to Food Intake

PubMed Central

Yamashita, M; Takayanagi, Y; Yoshida, M; Nishimori, K; Kusama, M; Onaka, T

2013-01-01

Food intake activates neurones expressing prolactin-releasing peptide (PrRP) in the medulla oblongata and oxytocin neurones in the hypothalamus. Both PrRP and oxytocin have been shown to have an anorexic action. In the present study, we investigated whether the activation of oxytocin neurones following food intake is mediated by PrRP. We first examined the expression of PrRP receptors (also known as GPR10) in rats. Immunoreactivity of PrRP receptors was observed in oxytocin neurones and in vasopressin neurones in the paraventricular and supraoptic nuclei of the hypothalamus and in the bed nucleus of the stria terminalis. Application of PrRP to isolated supraoptic nuclei facilitated the release of oxytocin and vasopressin. In mice, re-feeding increased the expression of Fos protein in oxytocin neurones of the hypothalamus and bed nucleus of the stria terminalis. The increased expression of Fos protein in oxytocin neurones following re-feeding or i.p. administration of cholecystokinin octapeptide (CCK), a peripheral satiety factor, was impaired in PrRP-deficient mice. CCK-induced oxytocin increase in plasma was also impaired in PrRP-deficient mice. Furthermore, oxytocin receptor-deficient mice showed an increased meal size, as reported in PrRP-deficient mice and in CCKA receptor-deficient mice. These findings suggest that PrRP mediates, at least in part, the activation of oxytocin neurones in response to food intake, and that the CCK–PrRP–oxytocin pathway plays an important role in the control of the termination of each meal. PMID:23363338

Variation of DNA methylation patterns associated with gene expression in rice (Oryza sativa) exposed to cadmium.

PubMed

Feng, Sheng Jun; Liu, Xue Song; Tao, Hua; Tan, Shang Kun; Chu, Shan Shan; Oono, Youko; Zhang, Xian Duo; Chen, Jian; Yang, Zhi Min

2016-12-01

We report genome-wide single-base resolution maps of methylated cytosines and transcriptome change in Cd-exposed rice. Widespread differences were identified in CG and non-CG methylation marks between Cd-exposed and Cd-free rice genomes. There are 2320 non-redundant differentially methylated regions detected in the genome. RNA sequencing revealed 2092 DNA methylation-modified genes differentially expressed under Cd exposure. More genes were found hypermethylated than those hypomethylated in CG, CHH and CHG (where H is A, C or T) contexts in upstream, gene body and downstream regions. Many of the genes were involved in stress response, metal transport and transcription factors. Most of the DNA methylation-modified genes were transcriptionally altered under Cd stress. A subset of loss of function mutants defective in DNA methylation and histone modification activities was used to identify transcript abundance of selected genes. Compared with wide type, mutation of MET1 and DRM2 resulted in general lower transcript levels of the genes under Cd stress. Transcripts of OsIRO2, OsPR1b and Os09g02214 in drm2 were significantly reduced. A commonly used DNA methylation inhibitor 5-azacytidine was employed to investigate whether DNA demethylation affected physiological consequences. 5-azacytidine provision decreased general DNA methylation levels of selected genes, but promoted growth of rice seedlings and Cd accumulation in rice plant. © 2016 John Wiley & Sons Ltd.

Isolation of Novel Synthetic Prion Strains by Amplification in Transgenic Mice Coexpressing Wild-Type and Anchorless Prion Proteins

PubMed Central

Raymond, Gregory J.; Race, Brent; Hollister, Jason R.; Offerdahl, Danielle K.; Moore, Roger A.; Kodali, Ravindra; Raymond, Lynne D.; Hughson, Andrew G.; Rosenke, Rebecca; Long, Dan; Dorward, David W.

2012-01-01

Mammalian prions are thought to consist of misfolded aggregates (protease-resistant isoform of the prion protein [PrPres]) of the cellular prion protein (PrPC). Transmissible spongiform encephalopathy (TSE) can be induced in animals inoculated with recombinant PrP (rPrP) amyloid fibrils lacking mammalian posttranslational modifications, but this induction is inefficient in hamsters or transgenic mice overexpressing glycosylphosphatidylinositol (GPI)-anchored PrPC. Here we show that TSE can be initiated by inoculation of misfolded rPrP into mice that express wild-type (wt) levels of PrPC and that synthetic prion strain propagation and selection can be affected by GPI anchoring of the host's PrPC. To create prions de novo, we fibrillized mouse rPrP in the absence of molecular cofactors, generating fibrils with a PrPres-like protease-resistant banding profile. These fibrils induced the formation of PrPres deposits in transgenic mice coexpressing wt and GPI-anchorless PrPC (wt/GPI−) at a combined level comparable to that of PrPC expression in wt mice. Secondary passage into mice expressing wt, GPI−, or wt plus GPI− PrPC induced TSE disease with novel clinical, histopathological, and biochemical phenotypes. Contrary to laboratory-adapted mouse scrapie strains, the synthetic prion agents exhibited a preference for conversion of GPI− PrPC and, in one case, caused disease only in GPI− mice. Our data show that novel TSE agents can be generated de novo solely from purified mouse rPrP after amplification in mice coexpressing normal levels of wt and anchorless PrPC. These observations provide insight into the minimal elements required to create prions in vitro and suggest that the PrPC GPI anchor can modulate the propagation of synthetic TSE strains. PMID:22915801

Markedly Increased Susceptibility to Natural Sheep Scrapie of Transgenic Mice Expressing Ovine PrP

PubMed Central

Vilotte, Jean-Luc; Soulier, Solange; Essalmani, Rachid; Stinnakre, Marie-George; Vaiman, Daniel; Lepourry, Laurence; Da Silva, Jose Costa; Besnard, Nathalie; Dawson, Mike; Buschmann, Anne; Groschup, Martin; Petit, Stephanie; Madelaine, Marie-Francoise; Rakatobe, Sabine; Le Dur, Annick; Vilette, Didier; Laude, Hubert

2001-01-01

The susceptibility of sheep to scrapie is known to involve, as a major determinant, the nature of the prion protein (PrP) allele, with the VRQ allele conferring the highest susceptibility to the disease. Transgenic mice expressing in their brains three different ovine PrPVRQ-encoding transgenes under an endogenous PrP-deficient genetic background were established. Nine transgenic (tgOv) lines were selected and challenged with two scrapie field isolates derived from VRQ-homozygous affected sheep. All inoculated mice developed neurological signs associated with a transmissible spongiform encephalopathy (TSE) disease and accumulated a protease-resistant form of PrP (PrPres) in their brains. The incubation duration appeared to be inversely related to the PrP steady-state level in the brain, irrespective of the transgene construct. The survival time for animals from the line expressing the highest level of PrP was reduced by at least 1 year compared to those of two groups of conventional mice. With one isolate, the duration of incubation was as short as 2 months, which is comparable to that observed for the rodent TSE models with the briefest survival times. No survival time reduction was observed upon subpassaging of either isolate, suggesting no need for adaptation of the agent to its new host. Overexpression of the transgene was found not to be required for transmission to be accelerated compared to that observed with wild-type mice. Conversely, transgenic mice overexpressing murine PrP were found to be less susceptible than tgOv lines expressing ovine PrP at physiological levels. These data argue that ovine PrPVRQ provided a better substrate for sheep prion replication than did mouse PrP. Altogether, these tgOv mice could be an improved model for experimental studies on natural sheep scrapie. PMID:11390599

Genome-wide identification and characterization of the Populus WRKY transcription factor family and analysis of their expression in response to biotic and abiotic stresses.

PubMed

Jiang, Yuanzhong; Duan, Yanjiao; Yin, Jia; Ye, Shenglong; Zhu, Jingru; Zhang, Faqi; Lu, Wanxiang; Fan, Di; Luo, Keming

2014-12-01

WRKY proteins are a large family of regulators involved in various developmental and physiological processes, especially in coping with diverse biotic and abiotic stresses. In this study, 100 putative PtrWRKY genes encoded the proteins contained in the complete WRKY domain in Populus. Phylogenetic analysis revealed that the members of this superfamily among poplar, Arabidopsis, and other species were divided into three groups with several subgroups based on the structures of the WRKY protein sequences. Various cis-acting elements related to stress and defence responses were found in the promoter regions of PtrWRKY genes by promoter analysis. High-throughput transcriptomic analyses identified that 61 of the PtrWRKY genes were induced by biotic and abiotic treatments, such as Marssonina brunnea, salicylic acid (SA), methyl jasmonate (MeJA), wounding, cold, and salinity. Among these PtrWRKY genes, transcripts of 46 selected genes were observed in different tissues, including roots, stems, and leaves. Quantitative RT-PCR analysis further confirmed the induced expression of 18 PtrWRKY genes by one or more stress treatments. The overexpression of an SA-inducible gene, PtrWRKY89, accelerated expression of PR protein genes and improved resistance to pathogens in transgenic poplar, suggesting that PtrWRKY89 is a regulator of an SA-dependent defence-signalling pathway in poplar. Taken together, our results provided significant information for improving the resistance and stress tolerance of woody plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Close Vicinity of PrP Expressing Cells (FDC) with Noradrenergic Fibers in Healthy Sheep Spleen

PubMed Central

Lezmi, S.; Hunsmann, G.; Baron, T.

2001-01-01

In naturally and experimentally occurring scrapie in sheep, prions invade the immune system and replicate in lymphoid organs. Here we analysed immunohistochemically, in seven spleens of 6-month-old healthy sheep, the nature of the cells expressing prion protein (PrP) potentially supporting prion replication, as well as their relationship with autonomic innervation. PrP was identified using either RB1 rabbit antiserum or 4F2 monoclonal antibody directed against AA 108–123 portion of the bovine and AA 79–92 of human prion protein respectively. Using double labelling analysis, we demonstrated that PrPc is expressed by follicular dendritic cells using a specific monoclonal antibody (CNA42). We also showed the close vicinity of these PrP expressing cells with noradrenergic fibers, using a polyclonal tyrosine hydroxylase antibody. Our results may help the study of the cellular requirements for the possible neuroinvasion from the spleen. PMID:11785673

Prolactin-releasing peptide is a potent mediator of the innate immune response in leukocytes from Salmo salar.

PubMed

Romero, Alex; Manríquez, René; Alvarez, Claudio; Gajardo, Cristina; Vásquez, Jorge; Kausel, Gudrun; Monrás, Mónica; Olavarría, Víctor H; Yáñez, Alejandro; Enríquez, Ricardo; Figueroa, Jaime

2012-06-30

Prolactin (PRL)-releasing peptide (PrRP) is a strong candidate stimulator of pituitary PRL transcription and secretion in teleosts. However, the role in control of extrapituitary PRL expression or its effects on innate immunity are unclear even in mammals. To study the possible presence of PrRP in peripheral organs, PrRP expression patterns and their effect on innate immunity were characterised in SHK-1 cells and head kidney (HK) leukocytes purified from the salmonid, Salmo salar. We detected immunoreactive cells in leukocytes from blood and HK of S. salar and found that PrRP mRNA was abundantly expressed in these cells. We have recently reported that physiological concentrations of native PRL, downstream of neuropeptide PrRP were able to induce expression of pro-inflammatory cytokines and the production of reactive oxygen species (ROS) in HK leukocytes and macrophages from S. salar and Sparus aurata. It is of interest to note that in this work we have revealed that synthetic PrRP was able to induce expression of pro-inflammatory cytokines (interleukins) IL-1β, IL-6, IL-8, IL-12 and PRL. We also show here that PrRP increased both (ROS) production and phagocytosis. Taken together, our results demonstrate for the first time that PrRP may be a local modulator of innate immune responses in leukocytes from S. salar. Copyright © 2012 Elsevier B.V. All rights reserved.

Overexpression of p62/SQSTM1 promotes the degradations of abnormally accumulated PrP mutants in cytoplasm and relieves the associated cytotoxicities via autophagy-lysosome-dependent way.

PubMed

Xu, Yin; Zhang, Jin; Tian, Chan; Ren, Ke; Yan, Yu-E; Wang, Ke; Wang, Hui; Chen, Cao; Wang, Jing; Shi, Qi; Dong, Xiao-Ping

2014-04-01

The protein of p62/sequestosome 1 (SQSTM1), a key cargo adaptor protein involved in autophagy-lysosome degradation, exhibits inclusion bodies structure in cytoplasm and plays a protective role in some models of neurodegenerative diseases. Some PrP mutants, such as PrP-CYTO and PrP-PG14, also form cytosolic inclusion bodies and trigger neuronal apoptosis either in cultured cells or in transgenic mice. Here, we demonstrated that the cellular p62/SQSTM1 incorporated into the inclusion bodies formed by expressing the abnormal PrP mutants, PrP-CYTO and PrP-PG14, in human embryonic kidney 293 cells. Overexpression of p62/SQSTM1 efficiently relieved the cytosolic aggregations and cell apoptosis induced by the abnormal PrPs. Autophagy-lysosome inhibitors instead of proteasome inhibitor sufficiently blocked the p62/SQSTM1-mediated degradations of abnormal PrPs. Overexpression of p62/SQSTM1 did not alter the levels of light chain 3 (LC3) in the cells expressing various PrPs. However, more complexes of p62/SQSTM1 with LC3 were detected in the cells expressing the misfolded PrPs. These data imply that p62/SQSTM1 plays an important role in the homeostasis of abnormal PrPs via autophagy-lysosome-dependent way.

Distinct functions and regulation of epithelial progesterone receptor in the mouse cervix, vagina, and uterus

PubMed Central

Mehta, Fabiola F.; Son, Jieun; Hewitt, Sylvia C.; Jang, Eunjung; Lydon, John P.; Korach, Kenneth S.; Chung, Sang-Hyuk

2016-01-01

While the function of progesterone receptor (PR) has been studied in the mouse vagina and uterus, its regulation and function in the cervix has not been described. We selectively deleted epithelial PR in the female reproductive tracts using the Cre/LoxP recombination system. We found that epithelial PR was required for induction of apoptosis and suppression of cell proliferation by progesterone (P4) in the cervical and vaginal epithelium. We also found that epithelial PR was dispensable for P4 to suppress apoptosis and proliferation in the uterine epithelium. PR is encoded by the Pgr gene, which is regulated by estrogen receptor α (ERα) in the female reproductive tracts. Using knock−in mouse models expressing ERα mutants, we determined that the DNA−binding domain (DBD) and AF2 domain of ERα were required for upregulation of Pgr in the cervix and vagina as well as the uterine stroma. The ERα AF1 domain was required for upregulation of Pgr in the vaginal stroma and epithelium and cervical epithelium, but not in the uterine and cervical stroma. ERα DBD, AF1, and AF2 were required for suppression of Pgr in the uterine epithelium, which was mediated by stromal ERα. Epithelial ERα was responsible for upregulation of epithelial Pgr in the cervix and vagina. Our results indicate that regulation and functions of epithelial PR are different in the cervix, vagina, and uterus. PMID:27007157

Characterization of the human analogue of a Scrapie-responsive gene.

PubMed

Dron, M; Dandoy-Dron, F; Guillo, F; Benboudjema, L; Hauw, J J; Lebon, P; Dormont, D; Tovey, M G

1998-07-17

We have recently described a novel mRNA denominated ScRG-1, the level of which is increased in the brains of Scrapie-infected mice (Dandoy-Dron, F., Guillo, F., Benboudjema, L., Deslys, J.-P., Lasmézas, C., Dormont, D., Tovey, M. G., and Dron, M. (1998) J. Biol. Chem. 273, 7691-7697). The increase in ScRG-1 mRNA in the brain follows the accumulation of PrPSc, the proteinase K-resistant form of the prion protein (PrP), and precedes the widespread neuronal death that occurs in late stage disease. In the present study, we have isolated a cDNA encoding the human counterpart of ScRG-1. Comparison of the human and mouse transcripts firmly established that both sequences encode a highly conserved protein of 98 amino acids that contains a signal peptide, suggesting that the protein may be secreted. Examination of the distribution of human ScRG-1 mRNA in adult and fetal tissues revealed that the gene was expressed primarily in the central nervous system as a 0.7-kilobase message and was under strict developmental control.

Plant immunity induced by COS-OGA elicitor is a cumulative process that involves salicylic acid.

PubMed

van Aubel, Géraldine; Cambier, Pierre; Dieu, Marc; Van Cutsem, Pierre

2016-06-01

Plant innate immunity offers considerable opportunities for plant protection but beside flagellin and chitin, not many molecules and their receptors have been extensively characterized and very few have successfully reached the field. COS-OGA, an elicitor that combines cationic chitosan oligomers (COS) with anionic pectin oligomers (OGA), efficiently protected tomato (Solanum lycopersicum) grown in greenhouse against powdery mildew (Leveillula taurica). Leaf proteomic analysis of plants sprayed with COS-OGA showed accumulation of Pathogenesis-Related proteins (PR), especially subtilisin-like proteases. qRT-PCR confirmed upregulation of PR-proteins and salicylic acid (SA)-related genes while expression of jasmonic acid/ethylene-associated genes was not modified. SA concentration and class III peroxidase activity were increased in leaves and appeared to be a cumulative process dependent on the number of sprayings with the elicitor. These results suggest a systemic acquired resistance (SAR) mechanism of action of the COS-OGA elicitor and highlight the importance of repeated applications to ensure efficient protection against disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Systemic acquired resistance: turning local infection into global defense.

PubMed

Fu, Zheng Qing; Dong, Xinnian

2013-01-01

Systemic acquired resistance (SAR) is an induced immune mechanism in plants. Unlike vertebrate adaptive immunity, SAR is broad spectrum, with no specificity to the initial infection. An avirulent pathogen causing local programmed cell death can induce SAR through generation of mobile signals, accumulation of the defense hormone salicylic acid, and secretion of the antimicrobial PR (pathogenesis-related) proteins. Consequently, the rest of the plant is protected from secondary infection for a period of weeks to months. SAR can even be passed on to progeny through epigenetic regulation. The Arabidopsis NPR1 (nonexpresser of PR genes 1) protein is a master regulator of SAR. Recent study has shown that salicylic acid directly binds to the NPR1 adaptor proteins NPR3 and NPR4, regulates their interactions with NPR1, and controls NPR1 protein stability. However, how NPR1 interacts with TGA transcription factors to activate defense gene expression is still not well understood. In addition, redox regulators, the mediator complex, WRKY transcription factors, endoplasmic reticulum-resident proteins, and DNA repair proteins play critical roles in SAR.

Paranoid potato

PubMed Central

Ali, Ashfaq; Moushib, Laith Ibrahim; Lenman, Marit; Levander, Fredrik; Olsson, Kerstin; Carlson-Nilson, Ulrika; Zoteyeva, Nadezhda; Liljeroth, Erland; Andreasson, Erik

2012-01-01

Phytophthora is the most devastating pathogen of dicot plants. There is a need for resistance sources with different modes of action to counteract the fast evolution of this pathogen. In order to better understand mechanisms of defense against P. infestans, we analyzed several clones of potato. Two of the genotypes tested, Sarpo Mira and SW93-1015, exhibited strong resistance against P. infestans in field trials, whole plant assays and detached leaf assays. The resistant genotypes developed different sizes of hypersensitive response (HR)-related lesions. HR lesions in SW93-1015 were restricted to very small areas, whereas those in Sarpo Mira were similar to those in Solanum demissum, the main source of classical resistance genes. SW93-1015 can be characterized as a cpr (constitutive expressor of PR genes) genotype without spontaneous microscopic or macroscopic HR lesions. This is indicated by constitutive hydrogen peroxide (H2O2) production and PR1 (pathogenesis-related protein 1) secretion. SW93-1015 is one of the first plants identified as having classical protein-based induced defense expressed constitutively without any obvious metabolic costs or spontaneous cell death lesions. PMID:22476463

Expression of Hormone Receptors and HER-2 in Benign and Malignant Salivary Gland Tumors.

PubMed

Can, Nhu Thuy; Lingen, Mark W; Mashek, Heather; McElherne, James; Briese, Renee; Fitzpatrick, Carrie; van Zante, Annemieke; Cipriani, Nicole A

2018-03-01

With the advent of targeted therapies, expression of sex hormone receptors and HER-2 in salivary gland tumors (SGTs) is of clinical interest. Previous reports of estrogen (ER) and progesterone (PR) receptor expression have varied. Androgen receptor (AR) and HER-2 overexpression are frequently reported in salivary duct carcinoma (SDC), but have not been studied systematically in other SGTs. This study examines ER, PR, AR, and HER-2 expression in SGTs. Immunohistochemistry for ER, PR, AR, and HER-2 was performed on 254 SGTs (134 malignant). ER, PR, and AR expression was scored using Allred system. HER-2 expression was scored using Dako HercepTest guidelines. FISH for HER-2 amplification was performed on select cases with HER-2 overexpression (2-3+). No SGT demonstrated strong expression of ER or PR. Combined strong AR and HER-2 expression was seen in 22 carcinomas: 14/25 SDC, 3/16 poorly differentiated, two oncocytic, and one each carcinoma ex pleomorphic adenoma, squamous cell, and intraductal carcinoma. Eighteen additional high grade carcinomas had HER-2 overexpression with absent, weak, or moderate AR expression; eight high grade carcinomas had isolated strong AR expression with 0-1+ HER-2 staining. Of 15 tested cases, six demonstrated HER-2 amplification by FISH, all of which had 3+ immunoreactivity. Neither benign nor malignant SGTs had strong expression of ER or PR. None of the benign SGTs overexpressed AR or HER-2. Coexpression of AR and HER-2 should not define SDC, but immunostaining should be considered in high grade salivary carcinomas, as some show overexpression and may benefit from targeted therapy.

Transcriptional profile of sweet orange in response to chitosan and salicylic acid.

PubMed

Coqueiro, Danila Souza Oliveira; de Souza, Alessandra Alves; Takita, Marco Aurélio; Rodrigues, Carolina Munari; Kishi, Luciano Takeshi; Machado, Marcos Antonio

2015-04-12

Resistance inducers have been used in annual crops as an alternative for disease control. Wood perennial fruit trees, such as those of the citrus species, are candidates for treatment with resistance inducers, such as salicylic acid (SA) and chitosan (CHI). However, the involved mechanisms in resistance induced by elicitors in citrus are currently few known. In the present manuscript, we report information regarding the transcriptional changes observed in sweet orange in response to exogenous applications of SA and CHI using RNA-seq technology. More genes were induced by SA treatment than by CHI treatment. In total, 1,425 differentially expressed genes (DEGs) were identified following treatment with SA, including the important genes WRKY50, PR2, and PR9, which are known to participate in the salicylic acid signaling pathway, and genes involved in ethylene/Jasmonic acid biosynthesis (ACS12, AP2 domain-containing transcription factor, and OPR3). In addition, SA treatment promoted the induction of a subset of genes involved in several metabolic processes, such as redox states and secondary metabolism, which are associated with biotic stress. For CHI treatment, there were 640 DEGs, many of them involved in secondary metabolism. For both SA and CHI treatments, the auxin pathway genes were repressed, but SA treatment promoted induction in the ethylene and jasmonate acid pathway genes, in addition to repressing the abscisic acid pathway genes. Chitosan treatment altered some hormone metabolism pathways. The DEGs were validated by quantitative Real-Time PCR (qRT-PCR), and the results were consistent with the RNA-seq data, with a high correlation between the two analyses. We expanded the available information regarding induced defense by elicitors in a species of Citrus that is susceptible to various diseases and identified the molecular mechanisms by which this defense might be mediated.

The Colletotrichum gloeosporioides species complex

PubMed Central

Weir, B.S.; Johnston, P.R.; Damm, U.

2012-01-01

The limit of the Colletotrichum gloeosporioides species complex is defined genetically, based on a strongly supported clade within the Colletotrichum ITS gene tree. All taxa accepted within this clade are morphologically more or less typical of the broadly defined C. gloeosporioides, as it has been applied in the literature for the past 50 years. We accept 22 species plus one subspecies within the C. gloeosporioides complex. These include C. asianum, C. cordylinicola, C. fructicola, C. gloeosporioides, C. horii, C. kahawae subsp. kahawae, C. musae, C. nupharicola, C. psidii, C. siamense, C. theobromicola, C. tropicale, and C. xanthorrhoeae, along with the taxa described here as new, C. aenigma, C. aeschynomenes, C. alatae, C. alienum, C. aotearoa, C. clidemiae, C. kahawae subsp. ciggaro, C. salsolae, and C. ti, plus the nom. nov. C. queenslandicum (for C. gloeosporioides var. minus). All of the taxa are defined genetically on the basis of multi-gene phylogenies. Brief morphological descriptions are provided for species where no modern description is available. Many of the species are unable to be reliably distinguished using ITS, the official barcoding gene for fungi. Particularly problematic are a set of species genetically close to C. musae and another set of species genetically close to C. kahawae, referred to here as the Musae clade and the Kahawae clade, respectively. Each clade contains several species that are phylogenetically well supported in multi-gene analyses, but within the clades branch lengths are short because of the small number of phylogenetically informative characters, and in a few cases individual gene trees are incongruent. Some single genes or combinations of genes, such as glyceraldehyde-3-phosphate dehydrogenase and glutamine synthetase, can be used to reliably distinguish most taxa and will need to be developed as secondary barcodes for species level identification, which is important because many of these fungi are of biosecurity significance. In addition to the accepted species, notes are provided for names where a possible close relationship with C. gloeosporioides sensu lato has been suggested in the recent literature, along with all subspecific taxa and formae speciales within C. gloeosporioides and its putative teleomorph Glomerella cingulata. Taxonomic novelties: Name replacement - C. queenslandicum B. Weir & P.R. Johnst. New species - C. aenigma B. Weir & P.R. Johnst., C. aeschynomenes B. Weir & P.R. Johnst., C. alatae B. Weir & P.R. Johnst., C. alienum B. Weir & P.R. Johnst, C. aotearoa B. Weir & P.R. Johnst., C. clidemiae B. Weir & P.R. Johnst., C. salsolae B. Weir & P.R. Johnst., C. ti B. Weir & P.R. Johnst. New subspecies - C. kahawae subsp. ciggaro B. Weir & P.R. Johnst. Typification: Epitypification - C. queenslandicum B. Weir & P.R. Johnst. PMID:23136459

Association between BMI-1 expression, acute graft-versus-host disease, and outcome following allogeneic stem cell transplantation from HLA-identical siblings in chronic myeloid leukemia.

PubMed

Mohty, Mohamad; Szydlo, Richard M; Yong, Agnes S M; Apperley, Jane F; Goldman, John M; Melo, Junia V

2008-09-01

Expression of CD7, ELA-2, PR-3, and the polycomb group gene BMI-1 reflects the intrinsic heterogeneity and predicts prognosis of patients with chronic myeloid leukemia (CML) who were not treated with allogeneic stem cell transplantation (allo-SCT). This study investigated whether expression of these genes determined outcome following allo-SCT in a cohort of 84 patients with chronic-phase (CP) CML. We found that patients expressing BMI-1 at a "high" level before allo-SCT had an improved overall survival (P = .005) related to a reduced transplantation-related mortality. In multivariate analysis, when adjusted for the European Group for Blood and Marrow Transplantation (EBMT)-Gratwohl score and other prog-nostic factors, there was an independent association between BMI-1 expression and grades 2 to 4 acute graft-versus-host disease (relative risk [RR] = 2.85; 95% confidence interval [CI], 1.3-6.4; P = .011), suggesting that BMI-1 measured prior to allo-SCT can serve as a biomarker for predicting outcome in patients with CP-CML receiving allo-SCT, and may thus contribute to better therapeutic decisions.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Pseudorabies virus-induced suppression of major histocompatibility complex class I antigen expression.

PubMed Central

Mellencamp, M W; O'Brien, P C; Stevenson, J R

1991-01-01

The ability of pseudorabies virus (PrV) to down-modulate expression of major histocompatibility complex class I antigens in murine and porcine cells was investigated. When quantified by flow cytometry, surface expression of class I Kk and Dk antigens on PrV-infected cells decreased by 60% or more. Down-modulation was associated with a decrease in total cellular class I antigens, indicating regulation at the transcriptional or posttranscriptional level. PrV did not suppress expression of transferrin receptor, suggesting a selective regulatory mechanism. Images PMID:1851884

Proteolytic Processing and Assembly of gag and gag-pol Proteins of TED, a Baculovirus-Associated Retrotransposon of the Gypsy Family

PubMed Central

Hajek, Kathryn L.; Friesen, Paul D.

1998-01-01

TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55gag) is cleaved to produce a single VLP structural protein, p37gag. Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55gag cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195gag-pol. The PR cleavage site within Pr55gag was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55gag truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55gag abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37gag provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging. PMID:9765414

Proteolytic processing and assembly of gag and gag-pol proteins of TED, a baculovirus-associated retrotransposon of the gypsy family.

PubMed

Hajek, K L; Friesen, P D

1998-11-01

TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55(gag)) is cleaved to produce a single VLP structural protein, p37(gag). Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55(gag) cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195(gag-pol). The PR cleavage site within Pr55(gag) was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55(gag) truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55(gag) abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37(gag) provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging.

Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

PubMed

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Expression of progesterone receptor B is associated with G0/G1 arrest of the cell cycle and growth inhibition in NIH3T3 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horiuchi, Shinji; Kato, Kiyoko; Suga, Shin

2005-05-01

Previously, we found a significant reduction of progesterone receptor B (PR-B) expression levels in the Ras-mediated NIH3T3 cell transformation, and re-expression of exogenous PR-B eliminated the tumorigenic potential. We hypothesized that this reduction is of biological significance in cell transformation. In the present study, we determined the correlation between PR-B expression and cell cycle progression. In synchronized NIH3T3 cells, we found an increase in PR-B protein and p27 CDK inhibitor levels in the G0/G1 phase and a reduction due to redistribution in the S and G2/M phases. The MEK inhibitor or cAMP stimulation arrested NIH3T3 cells in the G0/G1 phasemore » of the cell cycle. The expression of PR-B and p27 CDK inhibitors was up-regulated by treatment with both the MEK inhibitor and cAMP. Treatment of synchronized cells with a PKA inhibitor in the presence of 1% calf serum resulted in a significant reduction in both PR-B and p27 levels. The decrease in the PR-B levels caused by anti-sense oligomers or siRNA corresponded to the reduction in p27 levels. PR-B overexpression by adenovirus infection induced p27 and suppressed cell growth. Finally, we showed that PR-B modulation involved in the regulation of NIH3T3 cell proliferation was independent of nuclear estrogen receptor (ER) activity but dependent on non-genomic ER activity.« less

Capsicum annuum transcription factor WRKYa positively regulates defense response upon TMV infection and is a substrate of CaMK1 and CaMK2.

PubMed

Huh, Sung Un; Lee, Gil-Je; Jung, Ji Hoon; Kim, Yunsik; Kim, Young Jin; Paek, Kyung-Hee

2015-01-23

Plants are constantly exposed to pathogens and environmental stresses. To minimize damage caused by these potentially harmful factors, plants respond by massive transcriptional reprogramming of various stress-related genes via major transcription factor families. One of the transcription factor families, WRKY, plays an important role in diverse stress response of plants and is often useful to generate genetically engineered crop plants. In this study, we carried out functional characterization of CaWRKYa encoding group I WRKY member, which is induced during hypersensitive response (HR) in hot pepper (Capsicum annuum) upon Tobacco mosaic virus (TMV) infection. CaWRKYa was involved in L-mediated resistance via transcriptional reprogramming of pathogenesis-related (PR) gene expression and affected HR upon TMV-P0 infection. CaWRKYa acts as a positive regulator of this defense system and could bind to the W-box of diverse PR genes promoters. Furthermore, we found Capsicum annuum mitogen-activated protein kinase 1 (CaMK1) and 2 (CaMK2) interacted with CaWRKYa and phosphorylated the SP clusters but not the MAPK docking (D)-domain of CaWRKYa. Thus, these results demonstrated that CaWRKYa was regulated by CaMK1 and CaMK2 at the posttranslational level in hot pepper.

Segregation of non-p.R132H mutations in IDH1 in distinct molecular subtypes of glioma.

PubMed

Gravendeel, Lonneke A M; Kloosterhof, Nanne K; Bralten, Linda B C; van Marion, Ronald; Dubbink, Hendrikus Jan; Dinjens, Winand; Bleeker, Fonnet E; Hoogenraad, Casper C; Michiels, Erna; Kros, Johan M; van den Bent, Martin; Smitt, Peter A E Sillevis; French, Pim J

2010-03-01

Mutations in the gene encoding the isocitrate dehydrogenase 1 gene (IDH1) occur at a high frequency (up to 80%) in many different subtypes of glioma. In this study, we have screened for IDH1 mutations in a cohort of 496 gliomas. IDH1 mutations were most frequently observed in low grade gliomas with c.395G>A (p.R132H) representing >90% of all IDH1 mutations. Interestingly, non-p.R132H mutations segregate in distinct histological and molecular subtypes of glioma. Histologically, they occur sporadically in classic oligodendrogliomas and at significantly higher frequency in other grade II and III gliomas. Genetically, non-p.R132H mutations occur in tumors with TP53 mutation, are virtually absent in tumors with loss of heterozygosity on 1p and 19q and accumulate in distinct (gene-expression profiling based) intrinsic molecular subtypes. The IDH1 mutation type does not affect patient survival. Our results were validated on an independent sample cohort, indicating that the IDH1 mutation spectrum may aid glioma subtype classification. Functional differences between p.R132H and non-p.R132H mutated IDH1 may explain the segregation in distinct glioma subtypes. (c) 2010 Wiley-Liss, Inc.

Glycoform-independent prion conversion by highly efficient, cell-based, protein misfolding cyclic amplification.

PubMed

Moudjou, Mohammed; Chapuis, Jérôme; Mekrouti, Mériem; Reine, Fabienne; Herzog, Laetitia; Sibille, Pierre; Laude, Hubert; Vilette, Didier; Andréoletti, Olivier; Rezaei, Human; Dron, Michel; Béringue, Vincent

2016-07-07

Prions are formed of misfolded assemblies (PrP(Sc)) of the variably N-glycosylated cellular prion protein (PrP(C)). In infected species, prions replicate by seeding the conversion and polymerization of host PrP(C). Distinct prion strains can be recognized, exhibiting defined PrP(Sc) biochemical properties such as the glycotype and specific biological traits. While strain information is encoded within the conformation of PrP(Sc) assemblies, the storage of the structural information and the molecular requirements for self-perpetuation remain uncertain. Here, we investigated the specific role of PrP(C) glycosylation status. First, we developed an efficient protein misfolding cyclic amplification method using cells expressing the PrP(C) species of interest as substrate. Applying the technique to PrP(C) glycosylation mutants expressing cells revealed that neither PrP(C) nor PrP(Sc) glycoform stoichiometry was instrumental to PrP(Sc) formation and strainness perpetuation. Our study supports the view that strain properties, including PrP(Sc) glycotype are enciphered within PrP(Sc) structural backbone, not in the attached glycans.

Progesterone Receptors: Form and Function in Brain

PubMed Central

Brinton, Roberta Diaz; Thompson, Richard F.; Foy, Michael R.; Baudry, Michel; Wang, JunMing; Finch, Caleb E; Morgan, Todd E.; Stanczyk, Frank Z.; Pike, Christian J.; Nilsen, Jon

2008-01-01

Emerging data indicate that progesterone has multiple non-reproductive functions in the central nervous system to regulate cognition, mood, inflammation, mitochondrial function, neurogenesis and regeneration, myelination and recovery from traumatic brain injury. Progesterone-regulated neural responses are mediated by an array of progesterone receptors (PR) that include the classic nuclear PRA and PRB receptors and splice variants of each, the seven transmembrane domain 7TMPRβ and the membrane-associated 25-Dx PR (PGRMC1). These PRs induce classic regulation of gene expression while also transducing signaling cascades that originate at the cell membrane and ultimately activate transcription factors. Remarkably, PRs are broadly expressed throughout the brain and can be detected in every neural cell type. The distribution of PRs beyond hypothalamic borders, suggests a much broader role of progesterone in regulating neural function. Despite the large body of evidence regarding progesterone regulation of reproductive behaviors and estrogen-inducible responses as well as effects of progesterone metabolite neurosteroids, much remains to be discovered regarding the functional outcomes resulting from activation of the complex array of PRs in brain by gonadally and / or glial derived progesterone. Moreover, the impact of clinically used progestogens and developing selective PR modulators for targeted outcomes in brain is a critical avenue of investigation as the non-reproductive functions of PRs have far-reaching implications for hormone therapy to maintain neurological health and function throughout menopausal aging. PMID:18374402

Transcriptional changes in organoculture of full-thickness human skin following topical application of all-trans retinoic acid

PubMed Central

Gillbro, J M; Al-Bader, T; Westman, M; Olsson, M J; Mavon, A

2014-01-01

Synopsis Objective Retinoids are used as therapeutic agents for numerous skin diseases, for example, psoriasis, acne and keratinization disorders. The same substances have also been recognized in the treatment for hyperpigmentation disorders such as melasma. Other studies on photo-damaged skin have shown that retinoids reduce wrinkles, surface roughness, mottled pigmentation, and visual skin appearance as a whole. We tested the hypothesis that an organoculture of full-thickness human skin could be used as a preclinical model to investigate the retinoid transcriptional profile in human skin in vitro. Methods Full-thickness skin explants were exposed to topically applied all-trans retinoic acid (RA) for 24 h. The gene expression profile was analysed using oligonucleotide microarrays, and data were validated with real-time (RT) PCR. Results We showed that the expression of 93 genes was significantly altered more than twofold. Several of the altered genes, for example, KRT4, CYP26 and LCN2, have previously been shown to be affected by RA in keratinocyte monocultures, reconstructed epidermis and skin biopsies from patients treated topically or orally with RA. In addition, genes, such as SCEL, NRIP1, DGAT2, RDH12 EfnB2, MAPK14, SAMD9 and CEACAM6 not previously reported to be affected by RA in human skin, were identified for the first time in this study. Conclusion The results in the present study show that full-thickness human explants represent a valuable pre-clinical model for studying the effects of retinoids in skin. Résumé Objectif Les rétinoïdes sont utilisés comme agents thérapeutiques pour de nombreuses maladies de la peau, p.ex. le psoriasis, l'acné et les troubles de la kératinisation. Les mêmes substances ont également été reconnues dans le traitement des troubles de l' hyperpigmentation tels que le melasma. D'autres études sur la peau photo-endommagée ont montré que les rétinoïdes réduisent les rides, la rugosité de la surface, la pigmentation tachetée, et l'aspect visuel de la peau dans son ensemble. Nous avons testé l'hypothèse selon laquelle une organoculture de épaisseur intégrale de la peau humaine pourrait être utilisée comme modèle préclinique pour étudier le profil transcriptionnel des rétinoïdes dans la peau humaine in vitro. Méthodes Des explants de peau intégrale ont été exposés à l'application topique de all-trans acide rétinoïque (RA) pendant 24 heures. Le profil d' expression des gènes a été analysé en utilisant des puces DNA array et les données ont été validées par (RT) -PCR. Resultats Nous avons montré que l'expression de 93 gènes a été modifiée de façon significative par plus d'un facteur 2. Plusieurs des gènes modifiés par exemple KRT4, CYP26 et LCN2 ont été montrés précédemment d'être affectés par RA dans les monocultures de kératinocytes, dans l'épiderme reconstruit et dans des biopsies cutanées de patients traités par voie topique ou par voie orale avec RA. En outre, des gènes tels que SCEL, NRIP1, DGAT2, RDH12 EfnB2, MAPK14, SAMD9 et CEACAM6 non signalés précédemment, sont touchés par RA dans la peau humaine, et ont été identifiés pour la première fois dans cette étude. Conclusion Les résultats de la présente étude montrent que les explants humains de pleine épaisseur représentent un modèle préclinique précieux pour l'étude des effets des rétinoïdes dans la peau. PMID:24697191

Gene expression patterns and dynamics of the colonization of common bean (Phaseolus vulgaris L.) by highly virulent and weakly virulent strains of Fusarium oxysporum

PubMed Central

Niño-Sánchez, Jonathan; Tello, Vega; Casado-del Castillo, Virginia; Thon, Michael R.; Benito, Ernesto P.; Díaz-Mínguez, José María

2015-01-01

The dynamics of root and hypocotyl colonization, and the gene expression patterns of several fungal virulence factors and plant defense factors have been analyzed and compared in the interaction of two Fusarium oxysporum f. sp. phaseoli strains displaying clear differences in virulence, with a susceptible common bean cultivar. The growth of the two strains on the root surface and the colonization of the root was quantitatively similar although the highly virulent (HV) strain was more efficient reaching the central root cylinder. The main differences between both strains were found in the temporal and spatial dynamics of crown root and hypocotyl colonization. The increase of fungal biomass in the crown root was considerably larger for the HV strain, which, after an initial stage of global colonization of both the vascular cylinder and the parenchymal cells, restricted its growth to the newly differentiated xylem vessels. The weakly virulent (WV) strain was a much slower and less efficient colonizer of the xylem vessels, showing also growth in the intercellular spaces of the parenchyma. Most of the virulence genes analyzed showed similar expression patterns in both strains, except SIX1, SIX6 and the gene encoding the transcription factor FTF1, which were highly upregulated in root crown and hypocotyl. The response induced in the infected plant showed interesting differences for both strains. The WV strain induced an early and strong transcription of the PR1 gene, involved in SAR response, while the HV strain preferentially induced the early expression of the ethylene responsive factor ERF2. PMID:25883592

Feeding-Related Traits Are Affected by Dosage of the foraging Gene in Drosophila melanogaster

PubMed Central

Allen, Aaron M.; Anreiter, Ina; Neville, Megan C.; Sokolowski, Marla B.

2017-01-01

Nutrient acquisition and energy storage are critical parts of achieving metabolic homeostasis. The foraging gene in Drosophila melanogaster has previously been implicated in multiple feeding-related and metabolic traits. Before foraging’s functions can be further dissected, we need a precise genetic null mutant to definitively map its amorphic phenotypes. We used homologous recombination to precisely delete foraging, generating the for0 null allele, and used recombineering to reintegrate a full copy of the gene, generating the {forBAC} rescue allele. We show that a total loss of foraging expression in larvae results in reduced larval path length and food intake behavior, while conversely showing an increase in triglyceride levels. Furthermore, varying foraging gene dosage demonstrates a linear dose-response on these phenotypes in relation to foraging gene expression levels. These experiments have unequivocally proven a causal, dose-dependent relationship between the foraging gene and its pleiotropic influence on these feeding-related traits. Our analysis of foraging’s transcription start sites, termination sites, and splicing patterns using rapid amplification of cDNA ends (RACE) and full-length cDNA sequencing, revealed four independent promoters, pr1–4, that produce 21 transcripts with nine distinct open reading frames (ORFs). The use of alternative promoters and alternative splicing at the foraging locus creates diversity and flexibility in the regulation of gene expression, and ultimately function. Future studies will exploit these genetic tools to precisely dissect the isoform- and tissue-specific requirements of foraging’s functions and shed light on the genetic control of feeding-related traits involved in energy homeostasis. PMID:28007892

A downy mildew effector attenuates salicylic acid-triggered immunity in Arabidopsis by interacting with the host mediator complex.

PubMed

Caillaud, Marie-Cécile; Asai, Shuta; Rallapalli, Ghanasyam; Piquerez, Sophie; Fabro, Georgina; Jones, Jonathan D G

2013-12-01

Plants are continually exposed to pathogen attack but usually remain healthy because they can activate defences upon perception of microbes. However, pathogens have evolved to overcome plant immunity by delivering effectors into the plant cell to attenuate defence, resulting in disease. Recent studies suggest that some effectors may manipulate host transcription, but the specific mechanisms by which such effectors promote susceptibility remain unclear. We study the oomycete downy mildew pathogen of Arabidopsis, Hyaloperonospora arabidopsidis (Hpa), and show here that the nuclear-localized effector HaRxL44 interacts with Mediator subunit 19a (MED19a), resulting in the degradation of MED19a in a proteasome-dependent manner. The Mediator complex of ∼25 proteins is broadly conserved in eukaryotes and mediates the interaction between transcriptional regulators and RNA polymerase II. We found MED19a to be a positive regulator of immunity against Hpa. Expression profiling experiments reveal transcriptional changes resembling jasmonic acid/ethylene (JA/ET) signalling in the presence of HaRxL44, and also 3 d after infection with Hpa. Elevated JA/ET signalling is associated with a decrease in salicylic acid (SA)-triggered immunity (SATI) in Arabidopsis plants expressing HaRxL44 and in med19a loss-of-function mutants, whereas SATI is elevated in plants overexpressing MED19a. Using a PR1::GUS reporter, we discovered that Hpa suppresses PR1 expression specifically in cells containing haustoria, into which RxLR effectors are delivered, but not in nonhaustoriated adjacent cells, which show high PR1::GUS expression levels. Thus, HaRxL44 interferes with Mediator function by degrading MED19, shifting the balance of defence transcription from SA-responsive defence to JA/ET-signalling, and enhancing susceptibility to biotrophs by attenuating SA-dependent gene expression.

A Downy Mildew Effector Attenuates Salicylic Acid–Triggered Immunity in Arabidopsis by Interacting with the Host Mediator Complex

PubMed Central

Caillaud, Marie-Cécile; Asai, Shuta; Rallapalli, Ghanasyam; Piquerez, Sophie; Fabro, Georgina; Jones, Jonathan D. G.

2013-01-01

Plants are continually exposed to pathogen attack but usually remain healthy because they can activate defences upon perception of microbes. However, pathogens have evolved to overcome plant immunity by delivering effectors into the plant cell to attenuate defence, resulting in disease. Recent studies suggest that some effectors may manipulate host transcription, but the specific mechanisms by which such effectors promote susceptibility remain unclear. We study the oomycete downy mildew pathogen of Arabidopsis, Hyaloperonospora arabidopsidis (Hpa), and show here that the nuclear-localized effector HaRxL44 interacts with Mediator subunit 19a (MED19a), resulting in the degradation of MED19a in a proteasome-dependent manner. The Mediator complex of ∼25 proteins is broadly conserved in eukaryotes and mediates the interaction between transcriptional regulators and RNA polymerase II. We found MED19a to be a positive regulator of immunity against Hpa. Expression profiling experiments reveal transcriptional changes resembling jasmonic acid/ethylene (JA/ET) signalling in the presence of HaRxL44, and also 3 d after infection with Hpa. Elevated JA/ET signalling is associated with a decrease in salicylic acid (SA)–triggered immunity (SATI) in Arabidopsis plants expressing HaRxL44 and in med19a loss-of-function mutants, whereas SATI is elevated in plants overexpressing MED19a. Using a PR1::GUS reporter, we discovered that Hpa suppresses PR1 expression specifically in cells containing haustoria, into which RxLR effectors are delivered, but not in nonhaustoriated adjacent cells, which show high PR1::GUS expression levels. Thus, HaRxL44 interferes with Mediator function by degrading MED19, shifting the balance of defence transcription from SA-responsive defence to JA/ET-signalling, and enhancing susceptibility to biotrophs by attenuating SA-dependent gene expression. PMID:24339748

TaDIR1-2, a Wheat Ortholog of Lipid Transfer Protein AtDIR1 Contributes to Negative Regulation of Wheat Resistance against Puccinia striiformis f. sp. tritici

PubMed Central

Ahmed, Soyed M.; Liu, Peng; Xue, Qinghe; Ji, Changan; Qi, Tuo; Guo, Jia; Guo, Jun; Kang, Zhensheng

2017-01-01

Very few LTPs have been shown to act through plasma membrane receptors or to be involved in the hypersensitive response (HR). DIR1, a new type of plant LTP interacts with lipids in vitro, moves to distant tissues during systemic acquired resistance (SAR) and therefore is thought to be involved in long-distance signaling during SAR. However, the exact functions of DIR1 orthologs in cereal species under biotic and abiotic stresses have not been thoroughly defined. In this study, a novel wheat ortholog of the DIR1 gene, TaDIR1-2, was isolated from Suwon11, a Chinese cultivar of wheat and functionally characterized. Phylogenetic analysis indicated that TaDIR1-2 is clustered within the nsLTP-Type II group and shows a closer relationship with DIR1 orthologs from monocots than from eudicots. TaDIR1-2 was localized in the cytoplasm and the cell membrane of wheat mesophyll protoplast. Transcription of TaDIR1-2 was detected in wheat roots, stems and leaves. TaDIR1-2 transcript was significantly induced during the compatible interaction of wheat with the stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst). Treatments with salicylic acid (SA) and low temperature significantly up-regulated the expression of TaDIR1-2. Transient overexpression of TaDIR1-2 did not induce cell death or suppress Bax-induced cell death in tobacco leaves. Knocking down the expression of TaDIR1-2 through virus-induced gene silencing increased wheat resistance to Pst accompanied by HR, increased accumulation of H2O2 and SA, increased expression of TaPR1, TaPR2, TaPAL, and TaNOX, and decreased expression of two reactive oxygen species (ROS) scavenging genes TaCAT and TaSOD. Our results suggest that TaDIR1-2 acts as a negative regulator in wheat resistance to Pst by modulating ROS and/or SA-induced signaling. PMID:28443114

Comparative Transcriptome Analysis of Resistant and Susceptible Common Bean Genotypes in Response to Soybean Cyst Nematode Infection.

PubMed

Jain, Shalu; Chittem, Kishore; Brueggeman, Robert; Osorno, Juan M; Richards, Jonathan; Nelson, Berlin D

2016-01-01

Soybean cyst nematode (SCN; Heterodera glycines Ichinohe) reproduces on the roots of common bean (Phaseolus vulgaris L.) and can cause reductions in plant growth and seed yield. The molecular changes in common bean roots caused by SCN infection are unknown. Identification of genetic factors associated with SCN resistance could help in development of improved bean varieties with high SCN resistance. Gene expression profiling was conducted on common bean roots infected by SCN HG type 0 using next generation RNA sequencing technology. Two pinto bean genotypes, PI533561 and GTS-900, resistant and susceptible to SCN infection, respectively, were used as RNA sources eight days post inoculation. Total reads generated ranged between ~ 3.2 and 5.7 million per library and were mapped to the common bean reference genome. Approximately 70-90% of filtered RNA-seq reads uniquely mapped to the reference genome. In the inoculated roots of resistant genotype PI533561, a total of 353 genes were differentially expressed with 154 up-regulated genes and 199 down-regulated genes when compared to the transcriptome of non- inoculated roots. On the other hand, 990 genes were differentially expressed in SCN-inoculated roots of susceptible genotype GTS-900 with 406 up-regulated and 584 down-regulated genes when compared to non-inoculated roots. Genes encoding nucleotide-binding site leucine-rich repeat resistance (NLR) proteins, WRKY transcription factors, pathogenesis-related (PR) proteins and heat shock proteins involved in diverse biological processes were differentially expressed in both resistant and susceptible genotypes. Overall, suppression of the photosystem was observed in both the responses. Furthermore, RNA-seq results were validated through quantitative real time PCR. This is the first report describing genes/transcripts involved in SCN-common bean interaction and the results will have important implications for further characterization of SCN resistance genes in common bean.

Comparative Transcriptome Analysis of Resistant and Susceptible Common Bean Genotypes in Response to Soybean Cyst Nematode Infection

PubMed Central

Jain, Shalu; Chittem, Kishore; Brueggeman, Robert; Osorno, Juan M.; Richards, Jonathan; Nelson, Berlin D.

2016-01-01

Soybean cyst nematode (SCN; Heterodera glycines Ichinohe) reproduces on the roots of common bean (Phaseolus vulgaris L.) and can cause reductions in plant growth and seed yield. The molecular changes in common bean roots caused by SCN infection are unknown. Identification of genetic factors associated with SCN resistance could help in development of improved bean varieties with high SCN resistance. Gene expression profiling was conducted on common bean roots infected by SCN HG type 0 using next generation RNA sequencing technology. Two pinto bean genotypes, PI533561 and GTS-900, resistant and susceptible to SCN infection, respectively, were used as RNA sources eight days post inoculation. Total reads generated ranged between ~ 3.2 and 5.7 million per library and were mapped to the common bean reference genome. Approximately 70–90% of filtered RNA-seq reads uniquely mapped to the reference genome. In the inoculated roots of resistant genotype PI533561, a total of 353 genes were differentially expressed with 154 up-regulated genes and 199 down-regulated genes when compared to the transcriptome of non- inoculated roots. On the other hand, 990 genes were differentially expressed in SCN-inoculated roots of susceptible genotype GTS-900 with 406 up-regulated and 584 down-regulated genes when compared to non-inoculated roots. Genes encoding nucleotide-binding site leucine-rich repeat resistance (NLR) proteins, WRKY transcription factors, pathogenesis-related (PR) proteins and heat shock proteins involved in diverse biological processes were differentially expressed in both resistant and susceptible genotypes. Overall, suppression of the photosystem was observed in both the responses. Furthermore, RNA-seq results were validated through quantitative real time PCR. This is the first report describing genes/transcripts involved in SCN-common bean interaction and the results will have important implications for further characterization of SCN resistance genes in common bean. PMID:27441552

Is There a Rationale behind Pharmacotherapy in Idiopathic Gynecomastia?

PubMed

Kasielska-Trojan, Anna; Danilewicz, Marian; Antoszewski, Bogusław

2018-05-17

The aim of this research was to analyze digit ratio in relation to estrogen receptor (ER) and progesterone receptor (PR) expression and to verify digit ratio (2D: 4D) as a marker of ER and PR overexpression in the male breast. This study included 35 patients who underwent breast reduction due to the idiopathic form of gynecomastia. The average age of the studied individuals was 25.7 years (SD = 7.8). ER and PR expression was detected in breasts, and digit ratios were calculated in patients with idiopathic gynecomastia. ER expression did not correlate with the right (p = 0.51) and left 2D: 4D (p = 0.97). Also, there was no correlation between PR expression and 2D: 4D. A lack of correlation between these variables may result from the fact that the analyzed group of men with idiopathic gynecomastia was small in number, but at the same time, it appeared to be homogenous in these aspects (positive ER and/or PR expression and high digit ratio). High digit ratio in men with gynecomastia may tend to be a marker of overexpression of ER and PR. This may justify an early use of tamoxifen in men with gynecomastia and a high digit ratio. © 2018 S. Karger AG, Basel.

Assessment of the potential pathogenicity of missense mutations identified in the GTPase-activating protein (GAP)-related domain of the neurofibromatosis type-1 (NF1) gene.

PubMed

Thomas, Laura; Richards, Mark; Mort, Matthew; Dunlop, Elaine; Cooper, David N; Upadhyaya, Meena

2012-12-01

Neurofibromatosis type-1 (NF1) is caused by constitutional mutations of the NF1 tumor-suppressor gene. Although ∼85% of inherited NF1 microlesions constitute truncating mutations, the remaining ∼15% are missense mutations whose pathological relevance is often unclear. The GTPase-activating protein-related domain (GRD) of the NF1-encoded protein, neurofibromin, serves to define its major function as a negative regulator of the Ras-MAPK (mitogen-activated protein kinase) signaling pathway. We have established a functional assay to assess the potential pathogenicity of 15 constitutional nonsynonymous NF1 missense mutations (11 novel and 4 previously reported but not functionally characterized) identified in the NF1-GRD (p.R1204G, p.R1204W, p.R1276Q, p.L1301R, p.I1307V, p.T1324N, p.E1327G, p.Q1336R, p.E1356G, p.R1391G, p.V1398D, p.K1409E, p.P1412R, p.K1436Q, p.S1463F). Individual mutations were introduced into an NF1-GRD expression vector and activated Ras was assayed by an enzyme-linked immunosorbent assay (ELISA). Ten NF1-GRD variants were deemed to be potentially pathogenic by virtue of significantly elevated levels of activated GTP-bound Ras in comparison to wild-type NF1 protein. The remaining five NF1-GRD variants were deemed less likely to be of pathological significance as they exhibited similar levels of activated Ras to the wild-type protein. These conclusions received broad support from both bioinformatic analysis and molecular modeling and serve to improve our understanding of NF1-GRD structure and function. © 2012 Wiley Periodicals, Inc.

Intrauterine growth restriction and differential patterns of hepatic growth and expression of IGF1, PCK2, and HSDL1 mRNA in the sheep fetus in late gestation.

PubMed

Gentili, Sheridan; Morrison, Janna L; McMillen, I Caroline

2009-06-01

Fetal adaptations to periods of substrate deprivation can result in the programming of glucose intolerance, insulin resistance, and metabolic dysfunction in later life. Placental insufficiency can be associated with either sparing or sacrifice of fetal liver growth, and these different responses may have different metabolic consequences. It is unclear what intrahepatic mechanisms determine the differential responses of the fetal liver to substrate restriction. We investigated the effects of placental restriction (PR) on liver growth and the hepatic expression of SLC2A1, IGF1, IGF2, IGF1R, IGF2R, PPARGC1A, PPARA, PRKAA1, PRKAA2, PCK2, and HSDL1 mRNA in fetal sheep at 140-145 days of gestation. A mean gestational arterial partial pressure of oxygen less than 17 mmHg was defined as hypoxic, and a relative liver of weight more than 2 SD below the mean liver weight of controls was defined as reduced liver growth. Fetuses therefore were defined as control-normoxic (C-N; n = 9), PR-normoxic (PR-N; n = 7), PR-hypoxic (PR-H; n = 8), or PR-hypoxic reduced liver growth (PR-H RLG; n = 4). Hepatic SLC2A1 mRNA expression was highest (P < 0.05) in the PR-H fetuses, in which liver growth was maintained. Expression of IGF1 mRNA was decreased (P < 0.05) only in the PR-H RLG group. Hepatic expression of HSDL1, PPARGC1A, and PCK2 mRNA also were increased (P < 0.05) in the PR-H RLG fetuses. The present study highlights that intrahepatic responses to fetal substrate restriction may exist that protect the liver from decreased growth and, potentially, from a decreased responsiveness to the actions of insulin in postnatal life.

Prion Propagation in Cells Expressing PrP Glycosylation Mutants ▿

PubMed Central

Salamat, Muhammad K.; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert

2011-01-01

Infection by prions involves conversion of a host-encoded cell surface protein (PrPC) to a disease-related isoform (PrPSc). PrPC carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrPC glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrPSc and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrPSc, while PrPC with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrPC, were able to form infectious PrPSc. Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection. PMID:21248032

Wheat transcription factor TaWRKY70 is positively involved in high-temperature seedling plant resistance to Puccinia striiformis f. sp. tritici.

PubMed

Wang, Junjuan; Tao, Fei; An, Fei; Zou, Yiping; Tian, Wei; Chen, Xianming; Xu, Xiangming; Hu, Xiaoping

2017-06-01

Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a devastating disease of wheat (Triticum aestivum) worldwide. Wheat high-temperature seedling plant (HTSP) resistance to Pst is non-race-specific and durable. WRKY transcription factors have been proven to play important roles in plant defence responses to attacks by several pathogens. However, there is no direct evidence as to whether WRKY transcription factors play a role in HTSP resistance to Pst. We isolated a WRKY gene, named TaWRKY70, from wheat cultivar Xiaoyan 6. The expression level of TaWRKY70 was increased significantly when exposed to high temperatures (HTs) during the initial symptom expression stage of Pst infection. The expression of this gene increased in plants treated with ethylene (ET), salicylic acid (SA) and cold (4°C) stresses, but decreased in plants treated with methyl jasmonate (MeJA) and heat (40°C) stresses. Silencing of TaWRKY70 led to greater susceptibility to Pst (in terms of the increase in length of uredinial pustules and the decrease in the number of necrotic cells) compared with non-silenced plants when exposed to HT during the initial symptom expression stage of Pst infection, coinciding with expression changes of the ET- and SA-responsive genes TaPIE1 and TaPR1.1. In contrast, the expression level of the jasmonic acid (JA)-responsive gene TaAOS was not affected by TaWRKY70. These results indicate that TaWRKY70 is positively involved in HTSP resistance, during which SA and ET signalling are probably activated. © 2016 BSPP AND JOHN WILEY & SONS LTD.

RUNX2 correlates with subtype-specific breast cancer in a human tissue microarray, and ectopic expression of Runx2 perturbs differentiation in the mouse mammary gland

PubMed Central

McDonald, Laura; Ferrari, Nicola; Terry, Anne; Bell, Margaret; Mohammed, Zahra M.; Orange, Clare; Jenkins, Alma; Muller, William J.; Gusterson, Barry A.; Neil, James C.; Edwards, Joanne; Morris, Joanna S.; Cameron, Ewan R.; Blyth, Karen

2014-01-01

RUNX2, a master regulator of osteogenesis, is oncogenic in the lymphoid lineage; however, little is known about its role in epithelial cancers. Upregulation of RUNX2 in cell lines correlates with increased invasiveness and the capacity to form osteolytic disease in models of breast and prostate cancer. However, most studies have analysed the effects of this gene in a limited number of cell lines and its role in primary breast cancer has not been resolved. Using a human tumour tissue microarray, we show that high RUNX2 expression is significantly associated with oestrogen receptor (ER)/progesterone receptor (PR)/HER2-negative breast cancers and that patients with high RUNX2 expression have a poorer survival rate than those with negative or low expression. We confirm RUNX2 as a gene that has a potentially important functional role in triple-negative breast cancer. To investigate the role of this gene in breast cancer, we made a transgenic model in which Runx2 is specifically expressed in murine mammary epithelium under the control of the mouse mammary tumour virus (MMTV) promoter. We show that ectopic Runx2 perturbs normal development in pubertal and lactating animals, delaying ductal elongation and inhibiting lobular alveolar differentiation. We also show that the Runx2 transgene elicits age-related, pre-neoplastic changes in the mammary epithelium of older transgenic animals, suggesting that elevated RUNX2 expression renders such tissue more susceptible to oncogenic changes and providing further evidence that this gene might have an important, context-dependent role in breast cancer. PMID:24626992

A Gene Encoding a Hevein-Like Protein from Elderberry Fruits Is Homologous to PR-4 and Class V Chitinase Genes1

PubMed Central

Van Damme, Els J.M.; Charels, Diana; Roy, Soma; Tierens, Koenraad; Barre, Annick; Martins, José C.; Rougé, Pierre; Van Leuven, Fred; Does, Mirjam; Peumans, Willy J.

1999-01-01

We isolated SN-HLPf (Sambucus nigra hevein-like fruit protein), a hevein-like chitin-binding protein, from mature elderberry fruits. Cloning of the corresponding gene demonstrated that SN-HLPf is synthesized as a chimeric precursor consisting of an N-terminal chitin-binding domain corresponding to the mature elderberry protein and an unrelated C-terminal domain. Sequence comparisons indicated that the N-terminal domain of this precursor has high sequence similarity with the N-terminal domain of class I PR-4 (pathogenesis-related) proteins, whereas the C terminus is most closely related to that of class V chitinases. On the basis of these sequence homologies the gene encoding SN-HLPf can be considered a hybrid between a PR-4 and a class V chitinase gene. PMID:10198114

A dynamical systems model of progesterone receptor interactions with inflammation in human parturition.

PubMed

Brubaker, Douglas; Barbaro, Alethea; R Chance, Mark; Mesiano, Sam

2016-08-19

Progesterone promotes uterine relaxation and is essential for the maintenance of pregnancy. Withdrawal of progesterone activity and increased inflammation within the uterine tissues are key triggers for parturition. Progesterone actions in myometrial cells are mediated by two progesterone receptor (PR) isoforms, PR-A and PR-B, that function as ligand-activated transcription factors. PR-B mediates relaxatory actions of progesterone, in part, by decreasing myometrial cell responsiveness to pro-inflammatory stimuli. These same pro-inflammatory stimuli promote the expression of PR-A which inhibits the anti-inflammatory activity of PR-B. Competitive interaction between the progesterone receptors then augments myometrial responsiveness to pro-inflammatory stimuli. The interaction between PR-B transcriptional activity and inflammation in the pregnancy myometrium is examined using a dynamical systems model in which quiescence and labor are represented as phase-space equilibrium points. Our model shows that PR-B transcriptional activity and the inflammatory load determine the stability of the quiescent and laboring phenotypes. The model is tested using published transcriptome datasets describing the mRNA abundances in the myometrium before and after the onset of labor at term. Surrogate transcripts were selected to reflect PR-B transcriptional activity and inflammation status. The model coupling PR-B activity and inflammation predicts contractile status (i.e., laboring or quiescent) with high precision and recall and outperforms uncoupled single and two-gene classifiers. Linear stability analysis shows that phase space bifurcations exist in our model that may reflect the phenotypic states of the pregnancy uterus. The model describes a possible tipping point for the transition of the quiescent to the contractile laboring phenotype. Our model describes the functional interaction between the PR-A:PR-B hypothesis and tissue level inflammation in the pregnancy uterus and is a first step in more sophisticated dynamical systems modeling of human partition. The model explains observed biochemical dynamics and as such will be useful for the development of a range of systems-based models using emerging data to predict preterm birth and identify strategies for its prevention.

Evolutionary divergence of phytochrome protein function in Zea mays PIF3 signaling.

PubMed

Kumar, Indrajit; Swaminathan, Kankshita; Hudson, Karen; Hudson, Matthew E

2016-07-01

Two maize phytochrome-interacting factor (PIF) basic helix-loop-helix (bHLH) family members, ZmPIF3.1 and ZmPIF3.2, were identified, cloned and expressed in vitro to investigate light-signaling interactions. A phylogenetic analysis of sequences of the maize bHLH transcription factor gene family revealed the extent of the PIF family, and a total of seven predicted PIF-encoding genes were identified from genes encoding bHLH family VIIa/b proteins in the maize genome. To investigate the role of maize PIFs in phytochrome signaling, full-length cDNAs for phytochromes PhyA2, PhyB1, PhyB2 and PhyC1 from maize were cloned and expressed in vitro as chromophorylated holophytochromes. We showed that ZmPIF3.1 and ZmPIF3.2 interact specifically with the Pfr form of maize holophytochrome B1 (ZmphyB1), showing no detectable affinity for the Pr form. Maize holophytochrome B2 (ZmphyB2) showed no detectable binding affinity for PIFs in either Pr or Pfr forms, but phyB Pfr from Arabidopsis interacted with ZmPIF3.1 similarly to ZmphyB1 Pfr. We conclude that subfunctionalization at the protein-protein interaction level has altered the role of phyB2 relative to that of phyB1 in maize. Since the phyB2 mutant shows photomorphogenic defects, we conclude that maize phyB2 is an active photoreceptor, without the binding of PIF3 seen in other phyB family proteins. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment.

PubMed

Kong, Wei; Wanda, Soo-Young; Zhang, Xin; Bollen, Wendy; Tinge, Steven A; Roland, Kenneth L; Curtiss, Roy

2008-07-08

We have devised and constructed a biological containment system designed to cause programmed bacterial cell lysis with no survivors. We have validated this system, using Salmonella enterica serovar Typhimurium vaccines for antigen delivery after colonization of host lymphoid tissues. The system is composed of two parts. The first component is Salmonella typhimurium strain chi8937, with deletions of asdA and arabinose-regulated expression of murA, two genes required for peptidoglycan synthesis and additional mutations to enhance complete lysis and antigen delivery. The second component is plasmid pYA3681, which encodes arabinose-regulated murA and asdA expression and C2-regulated synthesis of antisense asdA and murA mRNA transcribed from the P22 P(R) promoter. An arabinose-regulated c2 gene is present in the chromosome. chi8937(pYA3681) exhibits arabinose-dependent growth. Upon invasion of host tissues, an arabinose-free environment, transcription of asdA, murA, and c2 ceases, and concentrations of their gene products decrease because of cell division. The drop in C2 concentration results in activation of P(R), driving synthesis of antisense mRNA to block translation of any residual asdA and murA mRNA. A highly antigenic alpha-helical domain of Streptococcus pneumoniae Rx1 PspA was cloned into pYA3681, resulting in pYA3685 to test antigen delivery. Mice orally immunized with chi8937(pYA3685) developed antibody responses to PspA and Salmonella outer membrane proteins. No viable vaccine strain cells were detected in host tissues after 21 days. This system has potential applications with other Gram-negative bacteria in which biological containment would be desirable.

Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment

PubMed Central

Kong, Wei; Wanda, Soo-Young; Zhang, Xin; Bollen, Wendy; Tinge, Steven A.; Roland, Kenneth L.; Curtiss, Roy

2008-01-01

We have devised and constructed a biological containment system designed to cause programmed bacterial cell lysis with no survivors. We have validated this system, using Salmonella enterica serovar Typhimurium vaccines for antigen delivery after colonization of host lymphoid tissues. The system is composed of two parts. The first component is Salmonella typhimurium strain χ8937, with deletions of asdA and arabinose-regulated expression of murA, two genes required for peptidoglycan synthesis and additional mutations to enhance complete lysis and antigen delivery. The second component is plasmid pYA3681, which encodes arabinose-regulated murA and asdA expression and C2-regulated synthesis of antisense asdA and murA mRNA transcribed from the P22 PR promoter. An arabinose-regulated c2 gene is present in the chromosome. χ8937(pYA3681) exhibits arabinose-dependent growth. Upon invasion of host tissues, an arabinose-free environment, transcription of asdA, murA, and c2 ceases, and concentrations of their gene products decrease because of cell division. The drop in C2 concentration results in activation of PR, driving synthesis of antisense mRNA to block translation of any residual asdA and murA mRNA. A highly antigenic α-helical domain of Streptococcus pneumoniae Rx1 PspA was cloned into pYA3681, resulting in pYA3685 to test antigen delivery. Mice orally immunized with χ8937(pYA3685) developed antibody responses to PspA and Salmonella outer membrane proteins. No viable vaccine strain cells were detected in host tissues after 21 days. This system has potential applications with other Gram-negative bacteria in which biological containment would be desirable. PMID:18607005

Cellular prion protein promotes glucose uptake through the Fyn-HIF-2α-Glut1 pathway to support colorectal cancer cell survival.

PubMed

Li, Qing-Quan; Sun, Yan-Ping; Ruan, Can-Ping; Xu, Xin-Yun; Ge, Jun-Hui; He, Jin; Xu, Zu-De; Wang, Qiang; Gao, Wen-Chao

2011-02-01

Cellular prion protein (PrPc) is a glycosylphosphatidylinositol-anchored membrane protein that has various physical functions, including protection against apoptotic and oxidative stress, cellular uptake of copper ions, transmembrane signaling, and adhesion to the extracellular matrix. In this study, we show that PrPc is highly expressed in colorectal adenocarcinomas. Transcriptome profiling of PrPc-depleted DLD-1 cells revealed downregulation of glucose transporter 1 (Glut1). PrPc is shown to be involved in regulating Glut1 expression through the Fyn-HIF-2α pathway. As Glut1 is the natural transporter of glucose and is required for the high glycolytic rate seen in colorectal tumors, silencing of PrPc reduced the proliferation and survival rate of colorectal cancer cells in vitro. In vivo, knockdown of PrPc by hydrodynamic injection with a cocktail of PrPc-shRNA-encoding plasmids also inhibited tumorigenicity in a xenograft model in nude mice. In summary, our data characterize a novel molecular mechanism that links PrPc expression to the regulation of glycolysis. Targeting PrPc will therefore be a promising strategy to overcome the growth and survival advantage in colorectal tumors. © 2010 Japanese Cancer Association.

Elicitor-induced transcription factors for metabolic reprogramming of secondary metabolism in Medicago truncatula

PubMed Central

Naoumkina, Marina A; He, XianZhi; Dixon, Richard A

2008-01-01

Background Exposure of Medicago truncatula cell suspension cultures to pathogen or wound signals leads to accumulation of various classes of flavonoid and/or triterpene defense molecules, orchestrated via a complex signalling network in which transcription factors (TFs) are essential components. Results In this study, we analyzed TFs responding to yeast elicitor (YE) or methyl jasmonate (MJ). From 502 differentially expressed TFs, WRKY and AP2/EREBP gene families were over-represented among YE-induced genes whereas Basic Helix-Loop-Helix (bHLH) family members were more over-represented among the MJ-induced genes. Jasmonate ZIM-domain (JAZ) transcriptional regulators were highly induced by MJ treatment. To investigate potential involvement of WRKY TFs in signalling, we expressed four Medicago WRKY genes in tobacco. Levels of soluble and wall bound phenolic compounds and lignin were increased in all cases. WRKY W109669 also induced tobacco endo-1,3-β-glucanase (NtPR2) and enhanced the systemic defense response to tobacco mosaic virus in transgenic tobacco plants. Conclusion These results confirm that Medicago WRKY TFs have broad roles in orchestrating metabolic responses to biotic stress, and that they also represent potentially valuable reagents for engineering metabolic changes that impact pathogen resistance. PMID:19102779