Sample records for practice guidelines cpg

  1. [Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

    PubMed

    Delessert, D; Pomini, V; Grasset, F; Baumann, P

    2008-01-01

    Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

  2. [Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

    PubMed

    Suárez-Obando, Fernando; Restrepo, Carlos Gómez

    Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  3. Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

    PubMed Central

    Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

    2005-01-01

    Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

  4. Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process

    ERIC Educational Resources Information Center

    Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.

    2007-01-01

    Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…

  5. Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

    PubMed

    Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

    2015-01-01

    Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

  6. Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

    PubMed

    McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

    2018-02-05

    Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

  7. Applying the RE-AIM Framework to Evaluate the Dissemination and Implementation of Clinical Practice Guidelines for Sexually Transmitted Infections.

    PubMed

    Jeong, Heon-Jae; Jo, Heui-Sug; Oh, Moo-Kyung; Oh, Hyung-Won

    2015-07-01

    Clinical practice guidelines (CPG) are one of the most effective ways to translate evidence of medical improvement into everyday practice. This study evaluated the dissemination and implementation of the Sexually Transmitted Infections-Korean Guidelines (STIKG) by applying the reach, effectiveness, adoption, implementation and maintenance (RE-AIM) framework. A survey questionnaire was administered to clinicians via the internet. Among the 332 respondents, 190 (57.2%) stated that they were aware of STIKG and 107 (33.2%) implemented STIKG in their practice. The odds that a physician was exposed to STIKG (dissemination) were 2.61 times greater among physicians with previous training or education for any CPG than those who did not. Clinicians who indicated that STIKG were easy to understand were 4.88 times more likely to implement STIKG in their practice than those who found them not so easy. When a clinician's workplace had a supporting system for CPG use, the odds of implementation was 3.76 times higher. Perceived level of effectiveness of STIKG did not significantly influence their implementation. The findings of this study suggest that, ultimately, knowing how to engage clinicians in CPG implementation is as important as how to disseminate such guidelines; moreover, easy-to-use guidelines and institutional support are key factors.

  8. A systematic review of recent clinical practice guidelines and best practice statements for the evaluation of the infertile male.

    PubMed

    Esteves, Sandro C; Chan, Peter

    2015-09-01

    We systematically identified and reviewed the methods and consistency of recommendations of recently developed clinical practice guidelines (CPG) and best practice statements (BPS) on the evaluation of the infertile male. MEDLINE and related engines as well as guidelines' Web sites were searched for CPG and BPS written in English on the general evaluation of male infertility published between January 2008 and April 2015. Four guidelines were identified, all of which reported to have been recently updated. Systematic review was not consistently used in the BPS despite being reported in the CPG. Only one of them reported having a patient representative in its development team. The CPG issued by the European Association of Urology (EAU) graded some recommendations and related that to levels (but not quality) of evidence. Overall, the BPS issued respectively by the American Urological Association and American Society for Reproductive Medicine concurred with each other, but both differed from the EAU guidelines with regard to methods of collection, extraction and interpretation of data. None of the guidelines incorporated health economics. Important specific limitations of conventional semen analysis results were ignored by all guidelines. Besides variation in the methodological quality, implementation strategies were not reported in two out of four guidelines. While the various panels of experts who contributed to the development of the CPG and BPS reviewed should be commended on their tremendous efforts aiming to establish a clinical standard in both the evaluation and management of male infertility, we recognized inconsistencies in the methodology of their synthesis and in the contents of their final recommendations. These discrepancies pose a barrier in the general implementation of these guidelines and may limit their utility in standardizing clinical practice or improving health-related outcomes. Continuous efforts are needed to generate high-quality evidence to allow further development of these important guidelines for the evaluation and management of males suffering from infertility.

  9. AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY PROTOCOL FOR STANDARDIZED PRODUCTION OF CLINICAL PRACTICE GUIDELINES, ALGORITHMS, AND CHECKLISTS - 2017 UPDATE.

    PubMed

    Mechanick, Jeffrey I; Pessah-Pollack, Rachel; Camacho, Pauline; Correa, Ricardo; Figaro, M Kathleen; Garber, Jeffrey R; Jasim, Sina; Pantalone, Kevin M; Trence, Dace; Upala, Sikarin

    2017-08-01

    Clinical practice guideline (CPG), clinical practice algorithm (CPA), and clinical checklist (CC, collectively CPGAC) development is a high priority of the American Association of Clinical Endocrinologists (AACE) and American College of Endocrinology (ACE). This 2017 update in CPG development consists of (1) a paradigm change wherein first, environmental scans identify important clinical issues and needs, second, CPA construction focuses on these clinical issues and needs, and third, CPG provide CPA node/edge-specific scientific substantiation and appended CC; (2) inclusion of new technical semantic and numerical descriptors for evidence types, subjective factors, and qualifiers; and (3) incorporation of patient-centered care components such as economics and transcultural adaptations, as well as implementation, validation, and evaluation strategies. This third point highlights the dominating factors of personal finances, governmental influences, and third-party payer dictates on CPGAC implementation, which ultimately impact CPGAC development. The AACE/ACE guidelines for the CPGAC program is a successful and ongoing iterative exercise to optimize endocrine care in a changing and challenging healthcare environment. AACE = American Association of Clinical Endocrinologists ACC = American College of Cardiology ACE = American College of Endocrinology ASeRT = ACE Scientific Referencing Team BEL = best evidence level CC = clinical checklist CPA = clinical practice algorithm CPG = clinical practice guideline CPGAC = clinical practice guideline, algorithm, and checklist EBM = evidence-based medicine EHR = electronic health record EL = evidence level G4GAC = Guidelines for Guidelines, Algorithms, and Checklists GAC = guidelines, algorithms, and checklists HCP = healthcare professional(s) POEMS = patient-oriented evidence that matters PRCT = prospective randomized controlled trial.

  10. A systematic review of clinical practice guidelines and best practice statements for the diagnosis and management of varicocele in children and adolescents.

    PubMed

    Roque, Matheus; Esteves, Sandro C

    2016-01-01

    A systematic review was conducted to identify and qualitatively analyze the methods as well as recommendations of Clinical Practice Guidelines (CPG) and Best Practice Statements (BPS) concerning varicocele in the pediatric and adolescent population. An electronic search was performed with the MEDLINE, EMBASE, Science Direct, and Scielo databases, as well as guidelines' Web sites until September 2015. Four guidelines were included in the qualitative synthesis. In general, the recommendations provided by the CPG/BPS were consistent despite the existence of some gaps across the studies. The guidelines issued by the American Urological Association (AUA) and American Society for Reproductive Medicine (ASRM) did not provide evidence-based levels for the recommendations given. Most of the recommendations given by the European Association of Urology (EAU) and European Society of Pediatric Urology (ESPU) were derived from nonrandomized clinical trials, retrospective studies, and expert opinion. Among all CPG/BPS, only one was specifically designed for the pediatric population. The studied guidelines did not undertake independent cost-effectiveness and risk-benefit analysis. The main objectives of these guidelines were to translate the best evidence into practice and provide a framework of standardized care while maintaining clinical autonomy and physician judgment. However, the limitations identified in the CPG/BPS for the diagnosis and management of varicocele in children and adolescents indicate ample opportunities for research and future incorporation of higher quality standards in patient care.

  11. Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

    PubMed

    Sanders, G D; Nease, R F; Owens, D K

    2000-01-01

    Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

  12. Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

    PubMed

    Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

    2016-12-01

    Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Management of convulsive status epilepticus in children: an adapted clinical practice guideline for pediatricians in Saudi Arabia

    PubMed Central

    Bashiri, Fahad A.; Hamad, Muddathir H.; Amer, Yasser S.; Abouelkheir, Manal M.; Mohamed, Sarar; Kentab, Amal Y.; Salih, Mustafa A.; Nasser, Mohammad N. Al; Al-Eyadhy, Ayman A.; Othman, Mohammed A. Al; Al-Ahmadi, Tahani; Iqbal, Shaikh M.; Somily, Ali M.; Wahabi, Hayfaa A.; Hundallah, Khalid J.; Alwadei, Ali H.; Albaradie, Raidah S.; Al-Twaijri, Waleed A.; Jan, Mohammed M.; Al-Otaibi, Faisal; Alnemri, Abdulrahman M.; Al-Ansary, Lubna A.

    2017-01-01

    Objective: To increase the use of evidence-based approaches in the diagnosis, investigations and treatment of Convulsive Status Epilepticus (CSE) in children in relevant care settings. Method: A Clinical Practice Guideline (CPG) adaptation group was formulated at a university hospital in Riyadh. The group utilized 2 CPG validated tools including the ADAPTE method and the AGREE II instrument. Results: The group adapted 3 main categories of recommendations from one Source CPG. The recommendations cover; (i)first-line treatment of CSE in the community; (ii)treatment of CSE in the hospital; and (iii)refractory CSE. Implementation tools were built to enhance knowledge translation of these recommendations including a clinical algorithm, audit criteria, and a computerized provider order entry. Conclusion: A clinical practice guideline for the Saudi healthcare context was formulated using a guideline adaptation process to support relevant clinicians managing CSE in children. PMID:28416791

  14. [Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

    PubMed

    Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

    2017-01-01

    To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

  15. Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

    PubMed

    Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

    2017-06-01

    Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

  16. Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

    PubMed Central

    Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

    2008-01-01

    Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

  17. [General Strategies for Implementation of Clinical Practice Guidelines].

    PubMed

    Valenzuela-Flores, Adriana Abigail; Viniegra-Osorio, Arturo; Torres-Arreola, Laura Laura

    2015-01-01

    The need to use clinical practice guidelines (CPG) arises from the health conditions and problems that public health institutions in the country face. CPG are informative documents that help improve the quality of care processes and patient safety; having among its objectives, to reduce the variability of medical practice. The Instituto Mexicano del Seguro Social designed a strategic plan for the dissemination, implementation, monitoring and control of CPG to establish an applicable model in the medical units in the three levels of care at the Instituto. This paper summarizes some of the strategies of the plan that were made with the knowledge and experience of clinicians and managers, with which they intend to promote the adoption of the key recommendations of the guidelines, to promote a sense of belonging for health personnel, and to encourage changes in organizational culture.

  18. Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

    PubMed

    Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

    2004-07-05

    The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

  19. [Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

    PubMed

    Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

    2014-01-01

    Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

  20. Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.

    PubMed

    Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E

    2016-05-01

    To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.

  1. Comparing Drug-Disease Associations in Clinical Practice Guideline Recommendations and Drug Product Label Indications.

    PubMed

    Leung, Tiffany I; Dumontier, Michel

    2015-01-01

    Clinical practice guidelines (CPGs) and structured product labels (SPLs) are both intended to promote evidence-based medical practices and guide clinicians' prescribing decisions. However, it is unclear how well CPG recommendations about pharmacologic therapies for certain diseases match SPL indications for recommended drugs. In this study, we use publicly available data and text mining methods to examine drug-disease associations in CPG recommendations and SPL treatment indications for 15 common chronic conditions. Preliminary results suggest that there is a mismatch between guideline-recommended pharmacologic therapies and SPL indications. Conflicting or inconsistent recommendations and indications may complicate clinical decision making and implementation or measurement of best practices.

  2. Speech pathologists' experiences with stroke clinical practice guidelines and the barriers and facilitators influencing their use: a national descriptive study.

    PubMed

    Hadely, Kathleen A; Power, Emma; O'Halloran, Robyn

    2014-03-06

    Communication and swallowing disorders are a common consequence of stroke. Clinical practice guidelines (CPGs) have been created to assist health professionals to put research evidence into clinical practice and can improve stroke care outcomes. However, CPGs are often not successfully implemented in clinical practice and research is needed to explore the factors that influence speech pathologists' implementation of stroke CPGs. This study aimed to describe speech pathologists' experiences and current use of guidelines, and to identify what factors influence speech pathologists' implementation of stroke CPGs. Speech pathologists working in stroke rehabilitation who had used a stroke CPG were invited to complete a 39-item online survey. Content analysis and descriptive and inferential statistics were used to analyse the data. 320 participants from all states and territories of Australia were surveyed. Almost all speech pathologists had used a stroke CPG and had found the guideline "somewhat useful" or "very useful". Factors that speech pathologists perceived influenced CPG implementation included the: (a) guideline itself, (b) work environment, (c) aspects related to the speech pathologist themselves, (d) patient characteristics, and (e) types of implementation strategies provided. There are many different factors that can influence speech pathologists' implementation of CPGs. The factors that influenced the implementation of CPGs can be understood in terms of knowledge creation and implementation frameworks. Speech pathologists should continue to adapt the stroke CPG to their local work environment and evaluate their use. To enhance guideline implementation, they may benefit from a combination of educational meetings and resources, outreach visits, support from senior colleagues, and audit and feedback strategies.

  3. Clinical practice guideline for Sjögren's syndrome 2017.

    PubMed

    Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

    2018-05-01

    The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

  4. Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

    PubMed

    Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

    2017-02-01

    We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

  5. Do Clinical Practice Guidelines Improve Quality?

    PubMed

    Baldassari, Cristina M

    2017-07-01

    Controversy exists surrounding how to best define and assess quality in the health care setting. Clinical practice guidelines (CPGs) have been developed to improve the quality of medical care by highlighting key clinical recommendations based on recent evidence. However, data linking CPGs to improvements in outcomes in otolaryngology are lacking. Numerous barriers contribute to difficulties in translating CPGs to improvements in quality. Future initiatives are needed to improve CPG adherence and define the impact of CPG recommendations on the quality of otolaryngologic care provided to our patients.

  6. Developing evidence-based physical therapy clinical practice guidelines.

    PubMed

    Kaplan, Sandra L; Coulter, Colleen; Fetters, Linda

    2013-01-01

    Recommended strategies for developing evidence-based clinical practice guidelines (CPGs) are provided. The intent is that future CPGs developed with the support of the Section on Pediatrics of the American Physical Therapy Association would consistently follow similar developmental processes to yield consistent quality and presentation. Steps in the process of developing CPGs are outlined and resources are provided to assist CPG developers in carrying out their task. These recommended processes may also be useful to CPG developers representing organizations with similar structures, objectives, and resources.

  7. A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

    PubMed

    Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

    2015-01-01

    The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

  8. A UML approach to process modelling of clinical practice guidelines for enactment.

    PubMed

    Knape, T; Hederman, L; Wade, V P; Gargan, M; Harris, C; Rahman, Y

    2003-01-01

    Although clinical practice guidelines (CPGs) have been suggested as a means of encapsulating best practice in evidence-based medical treatment, their usage in clinical environments has been disappointing. Criticisms of guideline representations have been that they are predominantly narrative and are difficult to incorporate into clinical information systems. This paper analyses the use of UML process modelling techniques for guideline representation and proposes the automated generation of executable guidelines using XMI. This hybrid UML-XMI approach provides flexible authoring of guideline decision and control structures whilst integrating appropriate data flow. It also uses an open XMI standard interface to allow the use of authoring tools and process control systems from multiple vendors. The paper first surveys CPG modelling formalisms followed by a brief introduction to process modelling in UMI. Furthermore, the modelling of CPGs in UML is presented leading to a case study of encoding a diabetes mellitus CPG using UML.

  9. A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

    PubMed

    Abidi, Samina

    2017-10-26

    Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

  10. Speech pathologists’ experiences with stroke clinical practice guidelines and the barriers and facilitators influencing their use: a national descriptive study

    PubMed Central

    2014-01-01

    Background Communication and swallowing disorders are a common consequence of stroke. Clinical practice guidelines (CPGs) have been created to assist health professionals to put research evidence into clinical practice and can improve stroke care outcomes. However, CPGs are often not successfully implemented in clinical practice and research is needed to explore the factors that influence speech pathologists’ implementation of stroke CPGs. This study aimed to describe speech pathologists’ experiences and current use of guidelines, and to identify what factors influence speech pathologists’ implementation of stroke CPGs. Methods Speech pathologists working in stroke rehabilitation who had used a stroke CPG were invited to complete a 39-item online survey. Content analysis and descriptive and inferential statistics were used to analyse the data. Results 320 participants from all states and territories of Australia were surveyed. Almost all speech pathologists had used a stroke CPG and had found the guideline “somewhat useful” or “very useful”. Factors that speech pathologists perceived influenced CPG implementation included the: (a) guideline itself, (b) work environment, (c) aspects related to the speech pathologist themselves, (d) patient characteristics, and (e) types of implementation strategies provided. Conclusions There are many different factors that can influence speech pathologists’ implementation of CPGs. The factors that influenced the implementation of CPGs can be understood in terms of knowledge creation and implementation frameworks. Speech pathologists should continue to adapt the stroke CPG to their local work environment and evaluate their use. To enhance guideline implementation, they may benefit from a combination of educational meetings and resources, outreach visits, support from senior colleagues, and audit and feedback strategies. PMID:24602148

  11. How do we know if a clinical practice guideline is good? A response to Djulbegovic and colleagues' use of fast-and-frugal decision trees to improve clinical care strategies.

    PubMed

    Mercuri, Mathew

    2018-04-17

    Clinical practice guidelines (CPGs) and clinical pathways have become important tools for improving the uptake of evidence-based care. Where CPGs are good, adherence to the recommendations within is thought to result in improved patient outcomes. However, the usefulness of such tools for improving patient important outcomes depends both on adherence to the guideline and whether or not the CPG in question is good. This begs the question of what it is that makes a CPG good? In this issue of the Journal, Djulbegovic and colleagues offer a theory to help guide the development of CPGs. The "fast-and-frugal tree" (FFT) heuristic theory is purported to provide the theoretical structure needed to quantitatively assess clinical guidelines in practice, something that the lack of theory to guide CPG development has precluded. In this paper, I examine the role of FFTs in providing an adequate theoretical framework for developing CPGs. In my view, positioning guideline development within the FFT framework may help with problems related to adherence. However, I believe that FTTs fall short in providing panel members with the theoretical basis needed to justify which factors should be considered when developing a CPG, how information on those factors derived from research studies should be interpreted, and how those factors should be integrated into the recommendation. © 2018 John Wiley & Sons, Ltd.

  12. Evidence-based clinical practice guideline for adult Still's disease.

    PubMed

    Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

    2018-05-09

    Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

  13. South African Guidelines Excellence (SAGE): Adopt, adapt, or contextualise?

    PubMed

    Dizon, J M; Grimmer, K; Louw, Q; Kredo, T; Young, T; Machingaidze, S

    2016-12-01

    Clinical practice guideline (CPG) activities must be planned carefully for efficient use of available resources and evidence-based implementation. De novo development of CPGs may sometimes 'recreate the wheel' and delay implementation. Three innovative alternatives to de novo CPG development (adopt, contextualise or adapt) are outlined, which have greater potential than de novo development to best use the limited available resources, personnel and time in settings such as South Africa.

  14. Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

    PubMed Central

    Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

    2017-01-01

    The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

  15. Development of a novel, multilayered presentation format for clinical practice guidelines.

    PubMed

    Kristiansen, Annette; Brandt, Linn; Alonso-Coello, Pablo; Agoritsas, Thomas; Akl, Elie A; Conboy, Tara; Elbarbary, Mahmoud; Ferwana, Mazen; Medani, Wedad; Murad, Mohammad Hassan; Rigau, David; Rosenbaum, Sarah; Spencer, Frederick A; Treweek, Shaun; Guyatt, Gordon; Vandvik, Per Olav

    2015-03-01

    Bridging the gap between clinical research and everyday health-care practice requires effective communication strategies. To address current shortcomings in conveying practice recommendations and supporting evidence, we are creating and testing presentation formats for clinical practice guidelines (CPGs). We carried out multiple cycles of brainstorming and sketching, developing a prototype. Physicians participating in the user testing viewed CPG formats linked to clinical scenarios and engaged in semistructured interviews applying a think-aloud method for exploring important aspects of user experience. We developed a multilayered presentation format that allows clinicians to successively view more in-depth information. Starting with the recommendations, clinicians can, on demand, access a rationale and a key information section containing statements on quality of the evidence, balance between desirable and undesirable consequences, values and preferences, and resource considerations. We collected feedback from 27 stakeholders and performed user testing with 47 practicing physicians from six countries. Advisory group feedback and user testing of the first version revealed problems with conceptual understanding of underlying CPG methodology, as well as difficulties with the complexity of the layout and content. Extensive revisions made before the second round of user testing resulted in most participants expressing overall satisfaction with the final presentation format. We have developed an electronic, multilayered, CPG format that enhances the usability of CPGs for frontline clinicians. We have implemented the format in electronic guideline tools that guideline organizations can now use when authoring and publishing their guidelines.

  16. An XML-based system for the flexible classification and retrieval of clinical practice guidelines.

    PubMed Central

    Ganslandt, T.; Mueller, M. L.; Krieglstein, C. F.; Senninger, N.; Prokosch, H. U.

    2002-01-01

    Beneficial effects of clinical practice guidelines (CPGs) have not yet reached expectations due to limited routine adoption. Electronic distribution and reminder systems have the potential to overcome implementation barriers. Existing electronic CPG repositories like the National Guideline Clearinghouse (NGC) provide individual access but lack standardized computer-readable interfaces necessary for automated guideline retrieval. The aim of this paper was to facilitate automated context-based selection and presentation of CPGs. Using attributes from the NGC classification scheme, an XML-based metadata repository was successfully implemented, providing document storage, classification and retrieval functionality. Semi-automated extraction of attributes was implemented for the import of XML guideline documents using XPath. A hospital information system interface was exemplarily implemented for diagnosis-based guideline invocation. Limitations of the implemented system are discussed and possible future work is outlined. Integration of standardized computer-readable search interfaces into existing CPG repositories is proposed. PMID:12463831

  17. The influence of providing a clinical practice guideline on dental students' decision making.

    PubMed

    van der Sanden, Wil J M; Mettes, Dirk G; Plasschaert, Alphons J M; Mulder, Jan; Verdonschot, Emiel H

    2004-02-01

    The aim of this study was to assess the effect of the provision of a clinical practice guideline (CPG) on dental students' decisions to remove asymptomatic, impacted lower third molars. All dental students, who in 2001 were in the 3rd, 4th or 5th (final) year of their study at the Nijmegen College of Dental Sciences, were invited to participate. A pre-test-post-test control group design was used. Given 36 patient cases, all dental students were asked to assess the need for removal of asymptomatic, impacted lower third molars. All pre-test respondents were randomly allocated to the control or intervention group. After the provision of a CPG to the intervention group, both groups were asked to assess the same cases again. Frequencies of decisions to remove the third molars were calculated. Chi-square tests and anova were used to test the influence of study year and gender on the drop-out rate and on the effect of the provision of a CPG on students' treatment decisions. The decrease in indications to remove third molars by the intervention group was statistically significant (P < 0.05). In the control group, no significant decrease was observed. It was concluded that the provision of a CPG significantly influences dental students' decision making about treatment in a third-molar decision task. Students who used the CPG showed more guideline-conformed decision making.

  18. [SPRINT on clinical practice: It's time to change the management of arterial hypertension in Latin America?

    PubMed

    Galvez-Olortegui, José Kelvin; Condor-Rojas, Yudy; Galvez-Olortegui, Tomas Vladimir; Camacho-Saavedra, Luis

    This paper analyzes the feasibility of the implementation of SPRINT trial results, the need to rethink the clinical practice guidelines(CPG) for the management of arterial hypertension and associated costs with daily practice applicability. SPRINT is a clinical trial comparing systolic blood pressure control <120mmHg and <140mmHg over cardiovascular complications, generating a great worldwide impact followed by publication of several studies that addressed relevance, usefulness, applicability and controversial aspects of SPRINT from different perspectives. Achieving blood pressure goals is one of the most discussed issue in widely used hypertension CPG around the world and in Latin American. SPRINT has generated and will generate a great impact on CPG, being necessary the reassessment of blood pressure goals and inclusion in future CPG, as has been considered in 2016 Canadian guideline and will be considered in NICE guideline update scheduled for June. The SPRINT trial raises new evidence for the management of hypertension, useful in people over 50 years, from urban populations, with defined cardiovascular risk without associated comorbidities. The applicability of SPRINT in Latin America is limited by increased costs associated with hypertensive patients' integrated health care, low care coverage, and lack of integrated care programs. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  19. Developing Guidelines on the Assessment and Treatment of Delirium in Older Adults at the End of Life

    PubMed Central

    Brajtman, Susan; Wright, David; Hogan, David B.; Allard, Pierre; Bruto, Venera; Burne, Deborah; Gage, Laura; Gagnon, Pierre R.; Sadowski, Cheryl A.; Helsdingen, Sherri; Wilson, Kimberley

    2011-01-01

    Background and Purpose Delirium at the end of life is common and can have serious consequences on an older person’s quality of life and death. In spite of the importance of detecting, diagnosing, and managing delirium at the end of life, comprehensive clinical practice guidelines (CPG) are lacking. Our objective was to develop CPG for the assessment and treatment of delirium that would be applicable to seniors receiving end-of-life care in diverse settings. Methods Using as a starting point the 2006 Canadian Coalition for Seniors’ Mental Health CPG on the assessment and treatment of delirium, a team of palliative care researchers and clinicians partnered with members of the original guideline development group to adapt the guidelines for an end-of-life care context. This process was supported by an extensive literature review. The final guidelines were reviewed by external experts. Results Comprehensive CPG on the assessment and treatment of delirium in older adults at the end of life were developed and can be downloaded from http://www.ccsmh.ca. Conclusions Further research is needed on the implementation and evaluation of these adapted delirium guidelines for older patients receiving end-of-life care in various palliative care settings. PMID:23251311

  20. Resource utilization in lung cancer diagnostic procedures: Current use and budget consequences.

    PubMed

    Brinkhof, Sander; Groen, Harry J M; Siesling, Sabine S; IJzerman, Maarten J

    2017-01-01

    The main objective of this study is to determine the current use of lung cancer diagnostic procedures in two large hospitals in the Netherlands, to explore deviations in guideline adherence between the hospitals, and to estimate the budget impact of the diagnostic work-up as well as the over- and underutilization. A state transition model for the diagnostic pathway for lung cancer patients was developed using existing clinical practice guidelines (CPG) combined with a systematic literature. In addition to the CPGs depicting current practice, diagnostic utilization was gathered in two large hospitals representing an academic tertiary care hospital and a large regional teaching hospital for patients, who were selected from the Netherlands cancer registry. The total population consisted of 376 patients with lung cancer. Not in all cases the guideline was followed, for instance in the usage of MR brain with stage III lung cancer patients (n = 70). The state-transition model predicts an average budget impact for the diagnostic pathway per patient estimated of € 2496 in the academic tertiary care hospital and € 2191 in the large regional teaching hospital. The adherence to the CPG's differed between hospitals, which questions the adherence to CPG's in general. Adherence to CPG's could lead to less costs in the diagnostic pathway for lung cancer patients.

  1. [The German program for disease management guidelines: evaluation by use of quality indicators].

    PubMed

    Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter

    2007-08-15

    The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.

  2. Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

    PubMed

    Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

    2018-04-03

    To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

  3. Framework for enhancing clinical practice guidelines through continuous patient engagement.

    PubMed

    Armstrong, Melissa J; Rueda, Juan-David; Gronseth, Gary S; Mullins, C Daniel

    2017-02-01

    Patient engagement in clinical practice guideline (CPG) development is recommended by multiple institutions and instruments measuring guideline quality. Approaches to engaging patients, however, vary between oversight organizations, quality tools and guideline developers. We propose a ten-step framework outlining steps and options for patient engagement in guideline development with the goal of highlighting steps for patient engagement and methods by which this can be achieved. This framework provides a model for continuous patient engagement in CPGs by outlining ten steps of guideline development occurring at the levels of the developer/committee and the individual guideline project. At the developer level, patients can assist in topic nomination (step 1), topic prioritization (step 2) and guideline development group selection (step 3). Within specific guideline projects, patients' opinions may be incorporated when framing the question (step 4), creating an analytic framework and research plan (step 5), conducting the systematic review and conclusion formation (step 6), development of recommendations (step 7) and dissemination and implementation (step 8). At the end of process, patients can again be engaged at the developer level by helping determine when guidelines need updating (step 9) and evaluating the developer's approach to patient engagement (step 10). Patient engagement at each CPG development step has different purposes, mechanisms, advantages and disadvantages, and implications for resource utilization. This framework can serve as a resource for guideline developers desiring to increase patient engagement and reference for researchers investigating engagement methodology at different steps of the CPG lifecycle. © 2016 The Authors. Health Expectations Published by John Wiley & Sons Ltd.

  4. Adherence to Clinical Practice Guidelines during Dementia Work-Up in a Real-World Setting: A Study from the Registry of Dementias of Girona.

    PubMed

    Turró-Garriga, Oriol; Calvó-Perxas, Laia; Vilalta-Franch, Joan; Hernández-Ferrándiz, Marta; Flaqué, Margarita; Linares, Marta; Cullell, Marta; Gich, Jordi; Casas, Isabel; Perkal, Héctor; Garre-Olmo, Josep

    2017-01-01

    There are several position statements and clinical practice guidelines (CPG) for diagnosing dementia. Our aims were to evaluate the adherence to CPG among specialists in the 7 memory clinics included in the Registry of Dementias of Girona (ReDeGi), and to compare the results between 2007-2011 and 2012-2015. We also determined the time and number of visits required to achieve a diagnosis, the supplementary tests ordered, and the drugs prescribed according to dementia subtypes. Medical charts of a stratified random sample of 475 ReDeGi cases were reviewed. Basic dementia work-up was evaluated using as a reference evidence-based CPG. An Index of Adherence (AI) was calculated using the following items in the medical chart: cognitive symptomatology; functional disability evaluation; physical examination; neurological examination; psychiatric examination; brief cognitive examination; activities of daily living performance examination; blood test; structural neuroimaging (CT-scan or MRI). The mean AI to CPG among specialists was of 8.2 points, and it improved from 7.9 points in 2007-2011 to 8.5 points in 2012-2015 (Cohen's d = 0.46). A lower adherence was detected in the most severe cases. A dementia diagnosis required 3.5 visits, regardless of the subtype of dementia, although milder cases required more time, more visits, and more supplementary tests than severe cases. The adherence to CPG in the catchment area of the ReDeGi is high, and an epidemiological surveillance system such as the ReDeGi may help in improving it. Dementia guidelines should establish procedures adapted to clinical practice, with simplified recommendations for most severe cases.

  5. The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study.

    PubMed

    Narayanaswami, Pushpa; Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas S D

    2015-08-13

    Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines "Complementary and alternative medicine in multiple sclerosis" ("CAM in MS") and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians ("physicians"). The primary outcome was the difference in participants' intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination.

  6. The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study

    PubMed Central

    Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever Jr, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas SD

    2015-01-01

    Background Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Objective Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines “Complementary and alternative medicine in multiple sclerosis” (“CAM in MS”) and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Methods Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians (“physicians”). The primary outcome was the difference in participants’ intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Results Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Conclusions Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination. PMID:26272267

  7. Impact of the Canadian Diabetes Association guideline dissemination strategy on clinician knowledge and behaviour change outcomes.

    PubMed

    Yu, Catherine H; Lillie, Erin; Mascarenhas-Johnson, Alekhya; Gall Casey, Carolyn; Straus, Sharon E

    2018-04-04

    Implementation of clinical practice guideline (CPG) into clinical practice remains limited. Using the Knowledge-To-Action framework, a guideline dissemination and implementation strategy for the Canadian Diabetes Association's 2013 CPG was developed and launched to clinicians and people with diabetes. The RE-AIM framework guided evaluation of this strategy clinician; we report here one aspect of the effectiveness dimension using mixed methods. We measured impact of the strategy on clinican knowledge and behaviour change constructs using evaluation forms, national online survey and individual interviews. After attending a lecture, clinician confidence (n = 915) increased (3.7(SD 0.7) to 4.5 (SD 0.6) on a 5-point scale (p < 0.001)), with 55% (n = 505) intending to make a practice change (e.g. clinical management regarding glycemic control). Ninety-four percent of survey respondents (n = 907) were aware of the guidelines, attributed to communications from professional associations, continuing professional development events, and colleagues. Forty to 98% of respondents (total n 462-485) were correct in their interpretation of CPG messages, and 33-65%(total n 351-651) reported that they had made changes to their practice. Interviews with 28 clinicians revealed that organizational credibility, online access to tools, clarity of tool content, and education sessions facilitated uptake; lack of time, team-based consensus, and seamless integration into care and patient complexity were barriers. The complexity of diabetes care requires systemic adoption of organization of care interventions, including interprofessional collaboration and consensus. Augmenting our strategy to include scalable models for professional development, integration of guidelines into electronic medical records, and expansion of our target audience to include health care teams and patients, may optimize guideline uptake. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

    PubMed

    Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

    2013-02-01

    The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

  9. Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

    PubMed

    Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

    2016-01-01

    As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

  10. AGREEing on Canadian cardiovascular clinical practice guidelines.

    PubMed

    Stone, James A; Austford, Leslie; Parker, John H; Gledhill, Norm; Tremblay, Guy; Arthur, Heather M

    2008-10-01

    The use of clinical practice guidelines (CPGs), particularly the routine implementation of evidence-based cardiovascular health maintenance and disease management recommendations, affords both expert and nonexpert practitioners the opportunity to achieve better, and at least theoretically similar, patient outcomes. However, health care practitioners are often stymied in their efforts to follow even well-researched and well-written CPGs as a consequence of contradictory information. The purposeful integration and harmonization of Canadian cardiovascular CPGs, regardless of their specific risk factor or clinical management focus, is critical to their widespread acceptance and implementation. This level of cooperation and coordination among CPG groups and organizations would help to ensure that their clinical practice roadmaps (ie, best practice recommendations) contain clear, concise and complementary, rather than contradictory, patient care information. Similarly, the application of specific tools intended to improve the quality of CPGs, such as the Appraisal of Guidelines for Research and Evaluation (AGREE) assessment tool, may also lead to improvements in CPG quality and potentially enhance their acceptance and implementation.

  11. The Impact of E-Learning on Adherence to Guidelines for Acute Gastroenteritis: A Single-Arm Intervention Study.

    PubMed

    Nicastro, Emanuele; Lo Vecchio, Andrea; Liguoro, Ilaria; Chmielewska, Anna; De Bruyn, Caroline; Dolinsek, Jernej; Doroshina, Elena; Fessatou, Smaragdi; Pop, Tudor Lucian; Prell, Christine; Tabbers, Merit Monique; Tavares, Marta; Urenden-Elicin, Pinar; Bruzzese, Dario; Zakharova, Irina; Sandhu, Bhupinder; Guarino, Alfredo

    2015-01-01

    E-learning is a candidate tool for clinical practice guidelines (CPG) implementation due to its versatility, universal access and low costs. We aimed to assess the impact of a five-module e-learning course about CPG for acute gastroenteritis (AGE) on physicians' knowledge and clinical practice. This work was conceived as a pre/post single-arm intervention study. Physicians from 11 European countries registered for the online course. Personal data, pre- and post-course questionnaires and clinical data about 3 to 5 children with AGE managed by each physician before and after the course were collected. Primary outcome measures included the proportion of participants fully adherent to CPG and number of patients managed with full adherence. Among the 149 physicians who signed up for the e-learning course, 59 took the course and reported on their case management of 519 children <5 years of age who were referred to their practice because of AGE (281 and 264 children seen before and after the course, respectively). The course improved knowledge scores (pre-course 8.6 ± 2.7 versus post-course 12.8 ± 2.1, P < 0.001), average adherence (from 87.0 ± 7.7% to 90.6 ± 7.1%, P = 0.001) and the number of patients managed in full adherence with the guidelines (from 33.6 ± 31.7% to 43.9 ± 36.1%, P = 0.037). E-learning is effective in increasing knowledge and improving clinical practice in paediatric AGE and is an effective tool for implementing clinical practice guidelines.

  12. The development, implementation and evaluation of clinical practice guidelines in Gulf Cooperation Council (GCC) countries: a systematic review of literature.

    PubMed

    Koornneef, Erik; Robben, Paul; Hajat, Cother; Ali, Azhar

    2015-12-01

    Our aim was to examine and describe the current situation in Gulf Cooperation Council (GCC) member countries regarding the development, implementation and evaluation of clinical practice guidelines (CPG). The objectives were to describe from where the studies originated, what the clinical focus was of each study and examine the methodology and the status of each study (i.e. development, dissemination, implementation and evaluation). Review of literature - two stages: stage 1: screening through an abstract review, followed by independent adjudicator; stage 2: detailed assessment and classification. Considering the widespread acceptance that CPG's are useful and effective tools for quality improvement in health care, it is worth noting that relatively few studies have been conducted in the GCC region that examine CPG. Furthermore, the reviewers found that the quality of the research methods used could be improved. The majority of the studies that were conducted evaluated the effects of guidelines and focused on the 'lifestyle diseases', in particular diabetes and cardiovascular diseases. It is also worth noting that there has been a steady increase in the number of publications over the 10 years period. More attention needs to be given to developing, disseminating, implementing and evaluating CPG's in the GCC region in order to improve the quality and safety of health care. © 2015 John Wiley & Sons, Ltd.

  13. Conflict of Interest Policies for Organizations Producing a Large Number of Clinical Practice Guidelines

    PubMed Central

    Norris, Susan L.; Holmer, Haley K.; Burda, Brittany U.; Ogden, Lauren A.; Fu, Rongwei

    2012-01-01

    Background Conflict of interest (COI) of clinical practice guideline (CPG) sponsors and authors is an important potential source of bias in CPG development. The objectives of this study were to describe the COI policies for organizations currently producing a significant number of CPGs, and to determine if these policies meet 2011 Institute of Medicine (IOM) standards. Methodology/Principal Findings We identified organizations with five or more guidelines listed in the National Guideline Clearinghouse between January 1, 2009 and November 5, 2010. We obtained the COI policy for each organization from publicly accessible sources, most often the organization's website, and compared those polices to IOM standards related to COI. 37 organizations fulfilled our inclusion criteria, of which 17 (46%) had a COI policy directly related to CPGs. These COI policies varied widely with respect to types of COI addressed, from whom disclosures were collected, monetary thresholds for disclosure, approaches to management, and updating requirements. Not one organization's policy adhered to all seven of the IOM standards that were examined, and nine organizations did not meet a single one of the standards. Conclusions/Significance COI policies among organizations producing a large number of CPGs currently do not measure up to IOM standards related to COI disclosure and management. CPG developers need to make significant improvements in these policies and their implementation in order to optimize the quality and credibility of their guidelines. PMID:22629391

  14. Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for the treatment of eating disorders.

    PubMed

    Hay, Phillipa; Chinn, David; Forbes, David; Madden, Sloane; Newton, Richard; Sugenor, Lois; Touyz, Stephen; Ward, Warren

    2014-11-01

    This clinical practice guideline for treatment of DSM-5 feeding and eating disorders was conducted as part of the Royal Australian and New Zealand College of Psychiatrists (RANZCP) Clinical Practice Guidelines (CPG) Project 2013-2014. The CPG was developed in accordance with best practice according to the National Health and Medical Research Council of Australia. Literature of evidence for treatments of anorexia nervosa (AN), bulimia nervosa (BN), binge eating disorder (BED), other specified and unspecified eating disorders and avoidant restrictive food intake disorder (ARFID) was sourced from the previous RANZCP CPG reviews (dated to 2009) and updated with a systematic review (dated 2008-2013). A multidisciplinary working group wrote the draft CPG, which then underwent expert, community and stakeholder consultation, during which process additional evidence was identified. In AN the CPG recommends treatment as an outpatient or day patient in most instances (i.e. in the least restrictive environment), with hospital admission for those at risk of medical and/or psychological compromise. A multi-axial and collaborative approach is recommended, including consideration of nutritional, medical and psychological aspects, the use of family based therapies in younger people and specialist therapist-led manualised based psychological therapies in all age groups and that include longer-term follow-up. A harm minimisation approach is recommended in chronic AN. In BN and BED the CPG recommends an individual psychological therapy for which the best evidence is for therapist-led cognitive behavioural therapy (CBT). There is also a role for CBT adapted for internet delivery, or CBT in a non-specialist guided self-help form. Medications that may be helpful either as an adjunctive or alternative treatment option include an antidepressant, topiramate, or orlistat (the last for people with comorbid obesity). No specific treatment is recommended for ARFID as there are no trials to guide practice. Specific evidence based psychological and pharmacological treatments are recommended for most eating disorders but more trials are needed for specific therapies in AN, and research is urgently needed for all aspects of ARFID assessment and management. Associate Professor Susan Byrne, Dr Angelica Claudino, Dr Anthea Fursland, Associate Professor Jennifer Gaudiani, Dr Susan Hart, Ms Gabriella Heruc, Associate Professor Michael Kohn, Dr Rick Kausman, Dr Sarah Maguire, Ms Peta Marks, Professor Janet Treasure and Mr Andrew Wallis. © The Royal Australian and New Zealand College of Psychiatrists 2014.

  15. Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

    PubMed

    Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

    2015-03-01

    To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

  16. Towards symbiosis in knowledge representation and natural language processing for structuring clinical practice guidelines.

    PubMed

    Weng, Chunhua; Payne, Philip R O; Velez, Mark; Johnson, Stephen B; Bakken, Suzanne

    2014-01-01

    The successful adoption by clinicians of evidence-based clinical practice guidelines (CPGs) contained in clinical information systems requires efficient translation of free-text guidelines into computable formats. Natural language processing (NLP) has the potential to improve the efficiency of such translation. However, it is laborious to develop NLP to structure free-text CPGs using existing formal knowledge representations (KR). In response to this challenge, this vision paper discusses the value and feasibility of supporting symbiosis in text-based knowledge acquisition (KA) and KR. We compare two ontologies: (1) an ontology manually created by domain experts for CPG eligibility criteria and (2) an upper-level ontology derived from a semantic pattern-based approach for automatic KA from CPG eligibility criteria text. Then we discuss the strengths and limitations of interweaving KA and NLP for KR purposes and important considerations for achieving the symbiosis of KR and NLP for structuring CPGs to achieve evidence-based clinical practice.

  17. Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

    PubMed

    McKenna, Malachi J; Murray, Barbara F

    2013-06-01

    The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

  18. The Impact of E-Learning on Adherence to Guidelines for Acute Gastroenteritis: A Single-Arm Intervention Study

    PubMed Central

    Nicastro, Emanuele; Lo Vecchio, Andrea; Liguoro, Ilaria; Chmielewska, Anna; De Bruyn, Caroline; Dolinsek, Jernej; Doroshina, Elena; Fessatou, Smaragdi; Pop, Tudor Lucian; Prell, Christine; Tabbers, Merit Monique; Tavares, Marta; Urenden-Elicin, Pinar; Bruzzese, Dario; Zakharova, Irina; Sandhu, Bhupinder; Guarino, Alfredo

    2015-01-01

    Objective E-learning is a candidate tool for clinical practice guidelines (CPG) implementation due to its versatility, universal access and low costs. We aimed to assess the impact of a five-module e-learning course about CPG for acute gastroenteritis (AGE) on physicians’ knowledge and clinical practice. Study design This work was conceived as a pre/post single-arm intervention study. Physicians from 11 European countries registered for the online course. Personal data, pre- and post-course questionnaires and clinical data about 3 to 5 children with AGE managed by each physician before and after the course were collected. Primary outcome measures included the proportion of participants fully adherent to CPG and number of patients managed with full adherence. Results Among the 149 physicians who signed up for the e-learning course, 59 took the course and reported on their case management of 519 children <5 years of age who were referred to their practice because of AGE (281 and 264 children seen before and after the course, respectively). The course improved knowledge scores (pre-course 8.6 ± 2.7 versus post-course 12.8 ± 2.1, P < 0.001), average adherence (from 87.0 ± 7.7% to 90.6 ± 7.1%, P = 0.001) and the number of patients managed in full adherence with the guidelines (from 33.6 ± 31.7% to 43.9 ± 36.1%, P = 0.037). Conclusions E-learning is effective in increasing knowledge and improving clinical practice in paediatric AGE and is an effective tool for implementing clinical practice guidelines. PMID:26148301

  19. Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

    PubMed

    Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

    2017-08-29

    Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

  20. Gaining insight into the Clinical Practice Guideline development processes: qualitative study in a workshop to implement the GRADE proposal in Spain

    PubMed Central

    Calderón, Carlos; Rotaeche, Rafael; Etxebarria, Arritxu; Marzo, Mercé; Rico, Rosa; Barandiaran, Marta

    2006-01-01

    Background The GRADE method represents a new approach to grading the quality of evidence and strength of recommendations in the preparation of Clinical Practice Guidelines (CPG). In the context of a pilot study to assess the implementability of the system in Spain, we considered it relevant to gain an insight into the significance of the perceptions and attitudes expressed by the actual experts participating in the system try-out. Methods Qualitative research with an ethnographic approach, through non-participant observation and focus groups within the context of a consensus workshop in which 19 CPG experts participated to evaluate the GRADE proposal using 12 evidence tables taken from hypertension, asthma and arthritis CPGs. The interventions were recorded, under a guarantee of confidentiality. The transcriptions and field notes were analyzed, based on a sociological discourse analysis model, and the provisional findings were re-sent to participants in order to improve their validity. Results 1) Certain problems over procedure and terminology hindered the acceptance of this new method as a common reference system for the preparation of CPGs. 2). A greater closeness to clinical practice was accompanied by concerns over value judgments and subjectivity, with a demand for greater explicitness in the consensus process. 3). The type of "evidence" on which the guidelines are based, how and by whom the evidence is prepared, and what the role of the different actors should be, all constitute unresolved concerns in the CPG preparation and implementation processes. 4). The grading process is not neutral: professional background, prior experience and the degree of leadership all condition the participants' input and interactions. Conclusion The findings obtained allow the quantitative evaluation to be better interpreted and, in turn, go beyond the particularities of the GRADE method. Adaptation to the complexities of clinical practice, the need for carefully designed multi-disciplinary work and the reflexivity present in the CPG preparation process, all represent lines of debate that are necessary to improve the CPG quality in the Spanish health care sector. PMID:17059600

  1. Compliance with a pediatric clinical practice guideline for intravenous fluid and electrolyte administration.

    PubMed

    Hurdowar, Amanda; Urmson, Lynn; Bohn, Desmond; Geary, Denis; Laxer, Ronald; Stevens, Polly

    2009-01-01

    The occurrence of acute hyponatremia associated with cerebral edema in hospitalized children has been increasingly recognized, with over 50 cases of neurological morbidity and mortality reported in the past decade. This condition most commonly occurs in previously healthy children where maintenance intravenous (IV) fluids have been prescribed in the form of hypotonic saline (e.g., 0.2 or 0.3 NaCl). In response to similar problems at The Hospital for Sick Children (six identified through hospital morbidity and mortality reviews and safety reports prior to fall 2007), an interdisciplinary clinician group from our institution developed a clinical practice guideline (CPG) to guide fluid and electrolyte administration for pediatric patients. This article reviews the evaluation of one patient safety improvement to change the prescribing practice for IV fluids in an acute care pediatric hospital, including the removal of the ability to prescribe hypotonic IV solutions with a sodium concentration of < 75 mmol/L. The evaluation of key components of the CPG included measuring practice and process changes pre- and post-implementation. The evaluation showed that the use of restricted IV fluids was significantly reduced across the organization. Success factors of this safety initiative included the CPG development, forcing functions, reminders, team engagement and support from the hospital leadership. A key learning was that a project leader with considerable dedicated time is required during the implementation to develop change concepts, organize and liaise with stakeholders and measure changes in practice. This project highlights the importance of active implementation for policy and guideline documents.

  2. Leveraging workflow control patterns in the domain of clinical practice guidelines.

    PubMed

    Kaiser, Katharina; Marcos, Mar

    2016-02-10

    Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

  3. Evaluation of all African clinical practice guidelines for hypertension: Quality and opportunities for improvement.

    PubMed

    Okwen, Patrick Mbah; Maweu, Irene; Grimmer, Karen; Margarita Dizon, Janine

    2018-06-14

    Good-quality clinical practice guidelines (CPGs) provide recommendations based on current best-evidence summaries. Hypertension is a prevalent noncommunicable disease in Africa, with disastrous sequelae (stroke, heart, and kidney disease). Its effective management relies on good quality, current, locally relevant evidence. This paper reports on an all African review of the guidance documents currently informing hypertension management. Attempts were made to contact 62 African countries for formal guidance documents used nationally to inform diagnosis and management of hypertension. Their quality was assessed by using Appraisal of Guidelines for Research & Evaluation (AGREE) II, scored by 2 independent reviewers. Differences in domain scores were compared between documents written prior to 2011 and 2011 onward. Findings were compared with earlier African CPG reviews. Guidelines and protocols were provided by 26 countries. Six used country-specific stand-alone hypertension guidelines, and 10 used protocols embedded in Standard Treatment Guidelines for multiple conditions. Six used guidelines developed by the World Health Organization, and 4 indicated ad hoc use of international guidance (US, Portugal, and Brazil). Only 1 guidance document met CPG construction criteria, and none scored well on all AGREE domain scores. The lowest-scoring domain was rigour of development. There was no significant quality difference between pre-2011 and post-2011 guidance documents, and there were variable AGREE II scores for the same CPGs when comparing the African reviews. The quality of hypertension guidance used by African nations could be improved. The need for so many guidance documents is questioned. Adopting a common evidence base from international good-quality CPGs and layering it with local contexts offer 1 way to efficiently improve African hypertension CPG quality and implementation. © 2018 John Wiley & Sons, Ltd.

  4. Overlap in drug-disease associations between clinical practice guidelines and drug structured product label indications.

    PubMed

    Leung, Tiffany I; Dumontier, Michel

    2016-06-08

    Clinical practice guidelines (CPGs) recommend pharmacologic treatments for clinical conditions, and drug structured product labels (SPLs) summarize approved treatment indications. Both resources are intended to promote evidence-based medical practices and guide clinicians' prescribing decisions. However, it is unclear how well CPG recommendations about pharmacologic therapies match SPL indications for recommended drugs. In this study, we perform text mining of CPG summaries to examine drug-disease associations in CPG recommendations and in SPL treatment indications for 15 common chronic conditions. We constructed an initial text corpus of guideline summaries from the National Guideline Clearinghouse (NGC) from a set of manually selected ICD-9 codes for each of the 15 conditions. We obtained 377 relevant guideline summaries and their Major Recommendations section, which excludes guidelines for pediatric patients, pregnant or breastfeeding women, or for medical diagnoses not meeting inclusion criteria. A vocabulary of drug terms was derived from five medical taxonomies. We used named entity recognition, in combination with dictionary-based and ontology-based methods, to identify drug term occurrences in the text corpus and construct drug-disease associations. The ATC (Anatomical Therapeutic Chemical Classification) was utilized to perform drug name and drug class matching to construct the drug-disease associations from CPGs. We then obtained drug-disease associations from SPLs using conditions mentioned in their Indications section in SIDER. The primary outcomes were the frequency of drug-disease associations in CPGs and SPLs, and the frequency of overlap between the two sets of drug-disease associations, with and without using taxonomic information from ATC. Without taxonomic information, we identified 1444 drug-disease associations across CPGs and SPLs for 15 common chronic conditions. Of these, 195 drug-disease associations overlapped between CPGs and SPLs, 917 associations occurred in CPGs only and 332 associations occurred in SPLs only. With taxonomic information, 859 unique drug-disease associations were identified, of which 152 of these drug-disease associations overlapped between CPGs and SPLs, 541 associations occurred in CPGs only, and 166 associations occurred in SPLs only. Our results suggest that CPG-recommended pharmacologic therapies and SPL indications do not overlap frequently when identifying drug-disease associations using named entity recognition, although incorporating taxonomic relationships between drug names and drug classes into the approach improves the overlap. This has important implications in practice because conflicting or inconsistent evidence may complicate clinical decision making and implementation or measurement of best practices.

  5. Clinical practice guidelines in hypertension: a review.

    PubMed

    Álvarez-Vargas, Mayita Lizbeth; Galvez-Olortegui, José Kelvin; Galvez-Olortegui, Tomas Vladimir; Sosa-Rosado, José Manuel; Camacho-Saavedra, Luis Arturo

    2015-10-23

    The aim of this study is the methodological evaluation of Clinical Practice Guidelines (CPG) in hypertension. This is the first in a series of review articles, analysis, assessment in methodology and content of clinical practice guidelines in Cardiology. Of all clinical practice guidelines, three were selected and the Appraisal of Guidelines for Research and Evaluation (AGREE II) instrument was used to assess each guide. The guidelines obtained the lowest score in the domain of applicability (mean 43.8%); while the highest score was for clarity of presentation (mean 81.5%). The lowest percentage was found in the applicability domain (European guideline) and the highest of all scores was found in two domains: scope and purpose, and clarity of presentation (Canadian guideline). Assessing the quality of the clinical practice guidelines analyzed, the Canadian is one with the best scores obtained by applying the AGREE II instrument, and it is advised to be used without modifications.

  6. The Spanish Neurological Society official clinical practice guidelines in epilepsy.

    PubMed

    Mercadé Cerdá, J M; Toledo Argani, M; Mauri Llerda, J A; López Gonzalez, F J; Salas Puig, X; Sancho Rieger, J

    2016-03-01

    Previous Official Clinical Practice Guidelines (CPGs) in Epilepsy were based on expert opinions and developed by the Epilepsy Study Group of the Spanish Neurological Society (GE-SEN). The current CPG in epilepsy is based on the scientific method, which extracts recommendations from published scientific evidence. A reduction in the variability in clinical practice through standardization of medical practice has become its main function. This CPG is focused on comprehensive care for individuals affected by epilepsy as a primary and predominant symptom, regardless of the age of onset and medical policy. 1. Creation of GE-SEN neurologists working group, in collaboration with Neuropediatricians, Neurophysiologists and Neuroradiologists. 2. Identification of clinical areas to be covered: diagnosis, prognosis and treatment. 3. Search and selection of the relevant scientific evidence. 4. Formulation of recommendations based on the classification of the available scientific evidence. It contains 161 recommendations of which 57% are consensus between authors and publishers, due to an important lack of awareness in many fields of this pathology. This Epilepsy CPG formulates recommendations based on explicit scientific evidence as a result of a formal and rigorous methodology, according to the current knowledge in the pre-selected areas. This paper includes the CPG chapter dedicated to emergency situations in seizures and epilepsy, which may present as a first seizure, an unfavorable outcome in a patient with known epilepsy, or status epilepticus as the most severe manifestation. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.

  7. Development of an Enhanced Recovery After Surgery Guideline and Implementation Strategy Based on the Knowledge-to-action Cycle.

    PubMed

    McLeod, Robin S; Aarts, Mary-Anne; Chung, Frances; Eskicioglu, Cagla; Forbes, Shawn S; Conn, Lesley Gotlib; McCluskey, Stuart; McKenzie, Marg; Morningstar, Beverly; Nadler, Ashley; Okrainec, Allan; Pearsall, Emily A; Sawyer, Jason; Siddique, Naveed; Wood, Trevor

    2015-12-01

    Enhanced Recovery After Surgery (ERAS) protocols have been shown to increase recovery, decrease complications, and reduce length of stay. However, they are difficult to implement. To develop and implement an ERAS clinical practice guideline (CPG) at multiple hospitals. A tailored strategy based on the Knowledge-to-action (KTA) cycle was used to develop and implement an ERAS CPG at 15 academic hospitals in Canada. This included an initial audit to identify gaps and interviews to assess barriers and enablers to implementation. Implementation included development of an ERAS guideline by a multidisciplinary group, communities of practice led by multidiscipline champions (surgeons, anesthesiologists, and nurses) both provincially and locally, educational tools, and clinical pathways as well as audit and feedback. The initial audit revealed there was greater than 75% compliance in only 2 of 18 CPG recommendations. Main themes identified by stakeholders were that the CPG must be based on best evidence, there must be increased communication and collaboration among perioperative team members, and patient education is essential. ERAS and Pain Management CPGs were developed by a multidisciplinary team and have been adopted at all hospitals. Preliminary data from more than 1000 patients show that the uptake of recommended interventions varies but despite this, mean length of stay has decreased with low readmission rates and adverse events. On the basis of short-term findings, our results suggest that a tailored implementation strategy based on the KTA cycle can be used to successfully implement an ERAS program at multiple sites.

  8. Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

    PubMed

    Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

    2017-09-01

    There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

  9. Characteristics of Spanish articles of "scientific quality" cited in clinical practice guidelines on mental health.

    PubMed

    Permanyer-Miralda, Gaietà; Adam, Paula; Guillamón, Imma; Solans-Domènech, Maite; Pons, Joan M V

    2013-01-01

    The study aims to illustrate the impact of Spanish research in clinical decision making. To this end, we analysed the characteristics of the most significant Spanish publications cited in clinical practice guidelines (CPG) on mental health. We conducted a descriptive qualitative study on the characteristics of ten articles cited in Spanish CPG on mental health, and selected for their "scientific quality". We analysed the content of the articles on the basis of the following characteristics: topics, study design, research centres, scientific and practical relevance, type of funding, and area or influence of the reference to the content of the guidelines. Among the noteworthy studies, some basic science studies, which have examined the establishment of genetic associations in the pathogenesis of mental illness are included, and others on the effectiveness of educational interventions. The content of those latter had more influence on the GPC, because they were cited in the summary of the scientific evidence or in the recommendations. Some of the outstanding features in the selected articles are the sophisticated designs (experimental or analytical), and the number of study centres, especially in international collaborations. Debate or refutation of previous findings on controversial issues may have also contributed to the extensive citation of work. The inclusion of studies in the CPG is not a sufficient condition of "quality", but their description can be instructive for the design of future research or publications. Copyright © 2012 SEP y SEPB. Published by Elsevier Espana. All rights reserved.

  10. Systematic Review of Clinical Practice Guidelines for Failed Antidepressant Treatment Response in Major Depressive Disorder, Dysthymia, and Subthreshold Depression in Adults.

    PubMed

    MacQueen, Glenda; Santaguida, Pasqualina; Keshavarz, Homa; Jaworska, Natalia; Levine, Mitchell; Beyene, Joseph; Raina, Parminder

    2017-01-01

    This systematic review critically evaluated clinical practice guidelines (CPGs) for treating adults with major depressive disorder, dysthymia, or subthreshold or minor depression for recommendations following inadequate response to first-line treatment with selective serotonin reuptake inhibitors (SSRIs). Searches for CPGs (January 2004 to November 2014) in English included 7 bibliographic databases and grey literature sources using CPG and depression as the keywords. Two raters selected CPGs on depression with a national scope. Data extraction included definitions of adequate response and recommended treatment options. Two raters assessed quality using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) instrument. From 46,908 citations, 3167 were screened at full text. From these 21 CPG were applicable to adults in primary care and outpatient settings. Five CPGs consider patients with dysthymia or subthreshold or minor depression. None provides recommendations for those who do not respond to first-line SSRI treatment. For adults with MDD, most CPGs do not define an "inadequate response" or provide specific suggestions regarding how to choose alternative medications when switching to an alternative antidepressant. There is variability between CPGs in recommending combination strategies. AGREE II ratings for stakeholder involvement in CPG development, editorial independence, and rigor of development are domains in which depression guidelines are often less robust. About half of patients with depression require second-line treatment to achieve remission. Consistency and clarity in guidelines for second-line treatment of depression are therefore important for clinicians but lacking in most current guidelines. This may reflect a paucity of primary studies upon which to base conclusions.

  11. Systematic Review of Clinical Practice Guidelines for Failed Antidepressant Treatment Response in Major Depressive Disorder, Dysthymia, and Subthreshold Depression in Adults

    PubMed Central

    MacQueen, Glenda; Santaguida, Pasqualina; Keshavarz, Homa; Jaworska, Natalia; Levine, Mitchell; Beyene, Joseph

    2016-01-01

    Objective: This systematic review critically evaluated clinical practice guidelines (CPGs) for treating adults with major depressive disorder, dysthymia, or subthreshold or minor depression for recommendations following inadequate response to first-line treatment with selective serotonin reuptake inhibitors (SSRIs). Method: Searches for CPGs (January 2004 to November 2014) in English included 7 bibliographic databases and grey literature sources using CPG and depression as the keywords. Two raters selected CPGs on depression with a national scope. Data extraction included definitions of adequate response and recommended treatment options. Two raters assessed quality using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) instrument. Results: From 46,908 citations, 3167 were screened at full text. From these 21 CPG were applicable to adults in primary care and outpatient settings. Five CPGs consider patients with dysthymia or subthreshold or minor depression. None provides recommendations for those who do not respond to first-line SSRI treatment. For adults with MDD, most CPGs do not define an “inadequate response” or provide specific suggestions regarding how to choose alternative medications when switching to an alternative antidepressant. There is variability between CPGs in recommending combination strategies. AGREE II ratings for stakeholder involvement in CPG development, editorial independence, and rigor of development are domains in which depression guidelines are often less robust. Conclusions: About half of patients with depression require second-line treatment to achieve remission. Consistency and clarity in guidelines for second-line treatment of depression are therefore important for clinicians but lacking in most current guidelines. This may reflect a paucity of primary studies upon which to base conclusions. PMID:27554483

  12. Barriers and enablers for the development and implementation of allied health clinical practice guidelines in South African primary healthcare settings: a qualitative study.

    PubMed

    Dizon, J M; Grimmer, K; Louw, Q; Machingaidze, S; Parker, H; Pillen, H

    2017-09-15

    The South African allied health (AH) primary healthcare (PHC) workforce is challenged with the complex rehabilitation needs of escalating patient numbers. The application of evidence-based care using clinical practice guidelines (CPGs) is one way to make efficient and effective use of resources. Although CPGs are common for AH in high-income countries, there is limited understanding of how to do this in low- to middle-income countries. This paper describes barriers and enablers for AH CPG uptake in South African PHC. Semi-structured individual interviews were undertaken with 25 South African AH managers, policymakers, clinicians and academics to explore perspectives on CPGs. Interviews were conducted by researcher dyads, one being familiar with South African AH PHC practice and the other with CPG expertise. Rigour and transparency of data collection was ensured. Interview transcripts were analysed by structuring content into codes, categories and themes. Exemplar quotations were extracted to support themes. CPGs were generally perceived to be relevant to assist AH providers to address the challenges of consistently providing evidence-based care in South African PHC settings. CPGs were considered to be tools for managing clinical, social and economic complexities of AH PHC practice, particularly if CPG recommendations were contextusalised. CPG uptake was one way to deal with increasing pressures to make efficient use of scarce financial resources, and to demonstrate professional legitimacy. Themes comprised organisational infrastructures and capacities for CPG uptake, interactions between AH actors and interaction with broader political structures, the nature of AH evidence in CPGs, and effectively implementing CPGs into practice. CPGs contextualised to local circumstances offer South African PHC AH services with an efficient vehicle for putting evidence into practice. There are challenges to doing this, related to local barriers such as geography, AH training, workforce availability, scarce resources, an escalating number of patients requiring complex rehabilitation, and local knowledge. Concerted attempts to implement locally relevant CPGs for AH primary care in South Africa are required to improve widespread commitment to evidence-based care, as well as to plan efficient and effective service delivery models.

  13. Ministry of Health Clinical Practice Guidelines: Prevention, Diagnosis and Management of Tuberculosis

    PubMed Central

    Wang, Yee Tang Sonny; Chee, Cynthia Bin Eng; Hsu, Li Yang; Jagadesan, Raghuram; Kaw, Gregory Jon Leng; Kong, Po Marn; Lew, Yii Jen; Lim, Choon Seng; Lim, Ting Ting Jayne; Lu, Kuo Fan Mark; Ooi, Peng Lim; Sng, Li-Hwei; Thoon, Koh Cheng

    2016-01-01

    The Ministry of Health (MOH) has developed the clinical practice guidelines on Prevention, Diagnosis and Management of Tuberculosis to provide doctors and patients in Singapore with evidence-based treatment for tuberculosis. This article reproduces the introduction and executive summary (with recommendations from the guidelines) from the MOH clinical practice guidelines on Prevention, Diagnosis and Management of Tuberculosis, for the information of SMJ readers. The chapters and page numbers mentioned in the reproduced extract refer to the full text of the guidelines, which are available from the Ministry of Health website: http://www.moh.gov.sg/content/moh_web/healthprofessionalsportal/doctors/guidelines/cpg_medical.html. The recommendations should be used with reference to the full text of the guidelines. Following this article are multiple choice questions based on the full text of the guidelines. PMID:26996216

  14. Clinical practice guidelines for the management of patients with endometrial cancer in France: recommendations of the Institut National du Cancer and the Société Française d'Oncologie Gynécologique.

    PubMed

    Querleu, Denis; Planchamp, François; Narducci, Fabrice; Morice, Philippe; Joly, Florence; Genestie, Catherine; Haie-Meder, Christine; Thomas, Laurence; Quénel-Tueux, Nathalie; Daraï, Emile; Dorangeon, Pierre-Hervé; Marret, Henri; Taïeb, Sophie; Mazeau-Woynar, Valérie

    2011-07-01

    Endometrial cancer is the most common gynecological malignancy in France, with more than 6500 new cases in 2010. The French National Cancer Institute has been leading a clinical practice guidelines (CPG) project since 2008. This project involves the development and updating of evidence-based CPG in oncology. To develop CPG for diagnosis, treatment, and follow-up for patients with endometrial cancer. The guideline development process is based on systematic literature review and critical appraisal by experts, with feedback from specialists in cancer care delivery. The recommendations are thus based on the best available evidence and expert agreement. Main recommendations include a routine pelvic magnetic resonance imaging in association with magnetic resonance imaging exploration of the para-aortic lymph nodes for locoregional staging, surgical treatment based on total hysterectomy with bilateral salpingo-oophorectomy with or without lymphadenectomy, and clinical examination for the follow-up. The initial laparoscopic surgical approach is recommended for stage I tumors. Lymphadenectomy and postoperative external radiotherapy are recommended for patients with high risk of recurrence but are restricted for patients with low or intermediate risk. If brachytherapy is indicated, it should be given at a high-dose rate rather than a low-dose rate. Routine imaging, biologic tests, and vaginal smears are not indicated for follow-up.

  15. Methodological quality of systematic reviews referenced in clinical practice guidelines for the treatment of opioid use disorder.

    PubMed

    Ross, Andrew; Rankin, Justin; Beaman, Jason; Murray, Kelly; Sinnett, Philip; Riddle, Ross; Haskins, Jordan; Vassar, Matt

    2017-01-01

    With efforts to combat opioid use disorder, there is an increased interest in clinical practice guidelines (CPGs) for opioid use disorder treatments. No literature exists examining the quality of systematic reviews used in opioid use disorder CPGs. This study aims to describe the methodological quality and reporting clarity of systematic reviews (SRs) used to create CPGs for opioid use disorder. From June to July 2016 guideline clearinghouses and medical literature databases were searched for relevant CPGs used in the treatment of opioid use disorder. Included CPGs must have been recognized by a national organization. SRs from the reference section of each CPG was scored by using AMSTAR (a measurement tool to assess the methodological quality of systematic reviews) tool and PRISMA (preferred reporting items for systematic reviews and meta-analyses) checklist. Seventeen CPGs from 2006-2016 were included in the review. From these, 57 unique SRs were extracted. SRS comprised 0.28% to 17.92% of all references found in the CPGs. All SRs obtained moderate or high methodological quality score on the AMSTAR tool. All reviews met at least 70% of PRISMA criteria. In PRISMA, underperforming areas included accurate title labeling, protocol registration, and risk of bias. Underperforming areas in AMSTAR included conflicts of interest, funding, and publication bias. A positive correlation was found between AMSTAR and PRISMA scores (r = .79). Although the SRs in the CPGs were of good quality, there are still areas for improvement. Systematic reviewers should consult PRISMA and AMSTAR when conducting and reporting reviews. It is important for CPG developers to consider methodological quality as a factor when developing CPG recommendations, recognizing that the quality of systematic reviews underpinning guidelines does not necessarily correspond to the quality of the guideline itself.

  16. Opioid Therapy for Chronic Pain: Overview of the 2017 US Department of Veterans Affairs and US Department of Defense Clinical Practice Guideline.

    PubMed

    Rosenberg, Jack M; Bilka, Brandon M; Wilson, Sara M; Spevak, Christopher

    2018-05-01

    The US Department of Veterans Affairs (VA) and US Department of Defense (DoD) revised the 2010 clinical practice guideline (CPG) for the management of opioid therapy for chronic pain, considering the specific needs of the VA and DoD and new evidence regarding prescribing opioid medication for non-end-of-life-related chronic pain. This paper summarizes the major recommendations and compares them with the US Centers for Disease Control and Prevention (CDC) guideline for prescribing opioids. This Opioid Therapy CPG was developed for VA-DoD service members, veterans, and their families. The VA/DoD Evidence-Based Practice Work Group convened a VA/DoD guideline renewal development effort and conformed to the guidelines established by the VA/DoD Joint Executive Council (JEC) and VA/DoD Health Executive Council (HEC). The panel developed questions, searched and evaluated the literature, developed recommendations using GRADE methodology, and developed algorithms. Passage of the CARA Act by Congress compelled consideration and comparison with the CDC opioid therapy guideline mid-development. There were 18 recommendations made. This article focuses on guideline development and key recommendations with CDC comparisons taken from four major areas, including: initiation and continuation of opioids;type, dose, follow-up, and taper of opioids;risk mitigation;acute pain. Guideline development and recommendations are presented. There was substantial overlap with the CDC opioid guideline. Additionally, there were items particularly relevant to the VA-DoD, including risk mitigation, suicide prevention, and preventing opioid use disorder in young patients. Our guideline highlights avoiding opioid therapy longer than 90 days as a critical juncture.

  17. [The German program for disease management guidelines--implementation with pathways and quality management].

    PubMed

    Ollenschläger, Günter; Lelgemann, Monika; Kopp, Ina

    2007-07-15

    In Germany, physicians enrolled in disease management programs are legally obliged to follow evidence-based clinical practice guidelines. That is why a Program for National Disease Management Guidelines (German DM-CPG Program) was established in 2002 aiming at implementation of best-practice evidence-based recommendations for nationwide as well as regional disease management programs. Against this background the article reviews programs, methods and tools for implementing DM-CPGs via clinical pathways as well as regional guidelines for outpatient care. Special reference is given to the institutionalized program of adapting DM-CPGs for regional use by primary-care physicians in the State of Hesse.

  18. Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

    PubMed

    Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

    2016-01-01

    Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

  19. [Counseling interventions for smoking cessation: systematic review].

    PubMed

    Alba, Luz Helena; Murillo, Raúl; Castillo, Juan Sebastián

    2013-04-01

    A systematic review on efficacy and safety of smoking cessation counseling was developed. The ADAPTE methodology was used with a search of Clinical Practice Guidelines (CPG) in Medline, EMBASE, CINAHL, LILACS, and Cochrane. DELBI was used to select CPG with score over 60 in methodological rigor and applicability to the Colombian health system. Smoking cessation rates at 6 months were assessed according to counseling provider, model, and format. In total 5 CPG out of 925 references were selected comprising 44 systematic reviews and meta-analyses. Physician brief counseling and trained health professionals' intensive counseling (individual, group, proactive telephone) are effective with abstinence rates between 2.1% and 17.4%. Only practical counseling and motivational interview were found effective intensive interventions. The clinical effect of smoking cessation counseling is low and long term cessation rates uncertain. Cost-effectiveness analyses are recommended for the implementation of counseling in public health programs.

  20. A national survey of Chinese medicine doctors and clinical practice guidelines in China.

    PubMed

    Liu, Mengyu; Zhang, Chi; Zha, Qinglin; Yang, Wei; Yuwen, Ya; Zhong, Linda; Bian, Zhaoxiang; Han, Xuejie; Lu, Aiping

    2017-09-06

    Clinical practice guidelines (CPGs) for Chinese medicine (CM) are being developed to assist doctors with appropriate decisions concerning CM care. To date, there has been little investigation on the perspectives of those to whom the guidelines are directed. A self-administered questionnaire was sent to 4503 doctors in 28 provinces of China in the latter half of 2012. Questions were organized around the topics of knowledge, application, practice changes, beliefs and outcomes of implementation. Basic classificatory data on specialties and years of qualification were also collected. Replies were received from 4495 CM doctors (99.82%). Of these, 85.56% of CM doctors reported being familiar with CPG recommendations, but the overall adherence rate was only 50.39%. The length of time practicing CM may influence the rate of adherence, since 709 doctors (51.90%) with less than 5 years of experience reported never having followed CPGs. Doctors in nine specialties showed a modest degree of homogeneity in their attitudes towards CM diagnosis and treatment, which were generally positive. Most doctors regarded CPG-recommended therapies as safe (92%), economic (84%), and effective (76%). Approximately four-fifths of those questioned selected 'acceptable' (60.84%) and 'acceptable after revision' (19.23%) regarding their comprehensive assessment of the CPGs. An encouraging result from this survey is that the majority of CM doctors support the concept of CPGs for the practice of CM. However, the results of this survey also suggest that improving the adherence of CM doctors to the guidelines remains a major challenge to improving the practice standards for CM.

  1. Providers' perceptions of spinal cord injury pressure ulcer guidelines.

    PubMed

    Thomason, Susan S; Evitt, Celinda P; Harrow, Jeffrey J; Love, Linda; Moore, D Helen; Mullins, Maria A; Powell-Cope, Gail; Nelson, Audrey L

    2007-01-01

    Pressure ulcers are a serious complication for people with spinal cord injury (SCI). The Consortium for Spinal Cord Medicine (CSCM) published clinical practice guidelines (CPGs) that provided guidance for pressure ulcer prevention and treatment after SCI. The aim of this study was to assess providers' perceptions for each of the 32 CPG recommendations regarding their agreement with CPGs, degree of CPG implementation, and CPG implementation barriers and facilitators. This descriptive mixed-methods study included both qualitative (focus groups) and quantitative (survey) data collection approaches. The sample (n = 60) included 24 physicians and 36 nurses who attended the 2004 annual national conferences of the American Paraplegia Society or American Association of Spinal Cord Injury Nurses. This sample drew from two sources: a purposive sample from a list of preregistered participants and a convenience sample of conference attendee volunteers. We analyzed quantitative data using descriptive statistics and qualitative data using a coding scheme to capture barriers and facilitators. The focus groups agreed unanimously on the substance of 6 of the 32 recommendations. Nurse and physician focus groups disagreed on the degree of CGP implementation at their sites, with nurses as a group perceiving less progress in implementation of the guideline recommendations. The focus groups identified only one recommendation, complications of surgery, as being fully implemented at their sites. Categories of barriers and facilitators for implementation of CPGs that emerged from the qualitative analysis included (a) characteristics of CPGs: need for research/evidence, (b) characteristics of CPGs: complexity of design and wording, (c) organizational factors, (d) lack of knowledge, and (e) lack of resources. Although generally SCI physicians and nurses agreed with the CPG recommendations as written, they did not feel these recommendations were fully implemented in their respective clinical settings. The focus groups identified multiple barriers to the implementation of the CPGs and suggested several facilitators/solutions to improve implementation of these guidelines in SCI. Participants identified organizational factors and the lack of knowledge as the most substantial systems/issues that created barriers to CPG implementation.

  2. The iSCREEN Electronic Diabetes Dashboard: A Tool to Improve Knowledge and Implementation of Pediatric Clinical Practice Guidelines.

    PubMed

    Zahanova, Stacy; Tsouka, Alexandra; Palmert, Mark R; Mahmud, Farid H

    2017-12-01

    Clinical practice guidelines (CPG) provide evidence-based recommendations for patient care but may not be optimally applied in clinical settings. As a pilot study, we evaluated the impact of a computerized, point-of-care decision support system (CDSS) on guideline knowledge and adherence in our diabetes clinic. iSCREEN, a CDSS, integrated with a province-wide electronic health record, was designed based on the Canadian Diabetes Association 2013 Clinical Practice Guidelines for the Prevention and Management of Diabetes in Canada. Evaluation data were gathered by retrospective chart review and clinician questionnaire prior to and after implementation of iSCREEN. Records of patients with type 1 diabetes, 14 to 18 years of age, were assessed for appropriate screening for complications and comorbidities. To assess guideline adherence, 50 charts were reviewed at 2 time periods (25 before and 25 after launch of iSCREEN). Results revealed improved frequency of appropriate screening for diabetic nephropathy (p=0.03) and retinopathy (p=0.04), accompanied by a decrease in under- and overscreening for these outcomes. To assess guideline knowledge, 58 surveys were collected (31 prior to and 27 after the launch of iSCREEN) from care providers in the field of pediatric diabetes. There was a trend toward improved guideline knowledge in all team members (p=0.06). Implementation of a de novo CDSS was associated with improved rates of appropriate screening for diabetes-related complications. A trend toward improvement in health professionals' knowledge of the guidelines was also observed. Evaluation of this point-of-care computerized decision support tool suggests that it may facilitate diabetes care by optimizing complication screening and CPG knowledge, with the potential for broader implementation. Copyright © 2017 Diabetes Canada. Published by Elsevier Inc. All rights reserved.

  3. Development of clinical practice guidelines.

    PubMed

    Hollon, Steven D; Areán, Patricia A; Craske, Michelle G; Crawford, Kermit A; Kivlahan, Daniel R; Magnavita, Jeffrey J; Ollendick, Thomas H; Sexton, Thomas L; Spring, Bonnie; Bufka, Lynn F; Galper, Daniel I; Kurtzman, Howard

    2014-01-01

    Clinical practice guidelines (CPGs) are intended to improve mental, behavioral, and physical health by promoting clinical practices that are based on the best available evidence. The American Psychological Association (APA) is committed to generating patient-focused CPGs that are scientifically sound, clinically useful, and informative for psychologists, other health professionals, training programs, policy makers, and the public. The Institute of Medicine (IOM) 2011 standards for generating CPGs represent current best practices in the field. These standards involve multidisciplinary guideline development panels charged with generating recommendations based on comprehensive systematic reviews of the evidence. The IOM standards will guide the APA as it generates CPGs that can be used to inform the general public and the practice community regarding the benefits and harms of various treatment options. CPG recommendations are advisory rather than compulsory. When used appropriately, high-quality guidelines can facilitate shared decision making and identify gaps in knowledge.

  4. The quality of laboratory aspects of troponin testing in clinical practice guidelines and consensus documents needs to be improved.

    PubMed

    Aakre, Kristin M; Langlois, Michel R; Barth, Julian H; Misra, Shivani; Watine, Joseph; Oosterhuis, Wytze P

    2014-11-01

    The European Federation of Laboratory Medicine (EFLM) and the Union of European Medical Specialists (UEMS) joint Working Group on guidelines recently proposed a checklist to help standardize the description of laboratory investigations in clinical practice guidelines (CPG). Nine CPGs or consensus documents published from 2011 to 2013 describing the investigation of chest pain, diagnosis of acute coronary syndrome, or myocardial infarction were evaluated against the published checklist. Clinical use of troponin analysis are commonly dealt with but the publications present variable, vague and sometimes conflicting information regarding this laboratory test being very much relied on upon making a diagnosis of acute coronary syndrome. Most of the laboratory related checklist items are not considered or need to be updated e.g. suggested analytical quality goals are not applicable for the high sensitive assays and important interferences that may lead to false positive or negative diagnoses are commonly not mentioned. The current paper sums up important analytical and biological issues related to troponin assays and gives suggestions for analytical quality goals that could be included in CPG's. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. [The National Programme for Disease Management Guidelines. Goals, contents, patient involvement].

    PubMed

    Ollenschläger, G; Kopp, I; Lelgemann, M; Sänger, S; Klakow-Franck, R; Gibis, B; Gramsch, E; Jonitz, G

    2007-03-01

    The Programme for National Disease Management Guidelines (German DM-CPG Programme) aims at the implementation of best practice recommendations for prevention, acute care, rehabilitation and chronic care. The programme, focussing on high priority healthcare topics, has been sponsored since 2003 by the German Medical Association (BAEK), the Association of the Scientific Medical Societies (AWMF), and by the National Association of Statutory Health Insurance Physicians (KBV). It is organised by the German Agency for Quality in Medicine, a founding member of the Guidelines International Network (G-I-N). The main objective of the programme is to establish consensus of the medical professions on evidence-based key recommendations covering all sectors of health care provision and facilitating the coordination of care for the individual patient through time and across disciplines. Within this framework experts from national patient self-help groups have been developing patient guidance based upon the recommendations for healthcare providers. The article describes goals, topics and selected contents of the DM-CPG programme - using asthma as an example.

  6. [Clinical practice guidelines for systemic lupus erythematosus: Recommendations for general clinical management].

    PubMed

    Trujillo-Martín, María M; Rúa-Figueroa Fernández de Larrinoa, Iñigo; Ruíz-Irastorza, Guillermo; Pego-Reigosa, José María; Sabio Sánchez, José Mario; Serrano-Aguilar, Pedro

    2016-05-06

    Systemic lupus erythematosus (SLE) is a complex rheumatic multisystemic disease of autoimmune origin with significant potential morbidity and mortality. It is one of the most common autoimmune diseases with an estimated prevalence of 20-150 cases per 100,000 inhabitants. The clinical spectrum of SLE is wide and variable both in clinical manifestations and severity. This prompted the Spanish Ministry of Health, Social Services and Equality to promote and fund the development of a clinical practice guideline (CPG) for the clinical care of SLE patients within the Programme of CPG in the National Health System which coordinates GuiaSalud. This CPG is is intended as the reference tool in the Spanish National Health System in order to support the comprehensive clinical management of people with SLE by all health professionals involved, regardless of specialty and level of care, helping to standardize and improve the quality of clinical decisions in our context in order to improve the health outcomes of the people affected. The purpose of this document is to present and discuss the rationale of the recommendations on the general management of SLE, specifically, clinical follow-up, general therapeutic approach, healthy lifestyles, photoprotection, and training programmes for patients. These recommendations are based on the best available scientific evidence, on discussion and the consensus of expert groups. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  7. Quality of clinical practice guidelines of lower extremity venous ulcers.

    PubMed

    Rumbo-Prieto, José María; Arantón-Areosa, Luis; Palomar-Llatas, Federico; Romero-Martín, Manuel

    The clinical variability and professional uncertainty in the prevention and treatment of lower extremity venous ulcers (VU) has as a main consequence, the fact that patients can be subjected to diagnostic and therapeutic tests, sometimes of dubious utility, these may even be harmful to the health of the patient and that, at other times, certain procedures or processes that may be appropriate to the patient's situation and needs may be omitted. It is for this reason that a series of specific documents called clinical practice guidelines for the approach of VU (CPG-VU) have been created, with the aim of improving the effectiveness and quality of care, reducing unjustified variability and establishing homogeneous criteria for its handling. Nevertheless, the literature shows that not all CPGs have the same methodological and evidence-drawing criteria. Many of them are of poor scientific quality and editorial rigor. This implies that CPGs should be periodically reviewed and updated based on the most current evidence and their quality contrasted with validated instruments such as AGREE-II. After an analysis of the quality of six CPG-VU available today, it has been possible to identify what guidelines are recommended for its implementation in the practice of care, which should be modified to improve their applicability and development of the evidence. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  8. How equity is addressed in clinical practice guidelines: a content analysis

    PubMed Central

    Shi, Chunhu; Tian, Jinhui; Wang, Quan; Petkovic, Jennifer; Ren, Dan; Yang, Kehu; Yang, Yang

    2014-01-01

    Objectives Considering equity into guidelines presents methodological challenges. This study aims to qualitatively synthesise the methods for incorporating equity in clinical practice guidelines (CPGs). Setting Content analysis of methodological publications. Eligibility criteria for selecting studies Methodological publications were included if they provided checklists/frameworks on when, how and to what extent equity should be incorporated in CPGs. Data sources We electronically searched MEDLINE, retrieved references, and browsed guideline development organisation websites from inception to January 2013. After study selection by two authors, general characteristics and checklists items/framework components from included studies were extracted. Based on the questions or items from checklists/frameworks (unit of analysis), content analysis was conducted to identify themes and questions/items were grouped into these themes. Primary outcomes The primary outcomes were methodological themes and processes on how to address equity issues in guideline development. Results 8 studies with 10 publications were included from 3405 citations. In total, a list of 87 questions/items was generated from 17 checklists/frameworks. After content analysis, questions were grouped into eight themes (‘scoping questions’, ‘searching relevant evidence’, ‘appraising evidence and recommendations’, ‘formulating recommendations’, ‘monitoring implementation’, ‘providing a flow chart to include equity in CPGs’, and ‘others: reporting of guidelines and comments from stakeholders’ for CPG developers and ‘assessing the quality of CPGs’ for CPG users). Four included studies covered more than five of these themes. We also summarised the process of guideline development based on the themes mentioned above. Conclusions For disadvantaged population-specific CPGs, eight important methodological issues identified in this review should be considered when including equity in CPGs under the guidance of a scientific guideline development manual. PMID:25479795

  9. CLINICAL PRACTICE GUIDELINES FOR THE PERIOPERATIVE NUTRITIONAL, METABOLIC, AND NONSURGICAL SUPPORT OF THE BARIATRIC SURGERY PATIENT—2013 UPDATE: COSPONSORED BY AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS, THE OBESITY SOCIETY, AND AMERICAN SOCIETY FOR METABOLIC & BARIATRIC SURGERY★

    PubMed Central

    Mechanick, Jeffrey I.; Youdim, Adrienne; Jones, Daniel B.; Garvey, W. Timothy; Hurley, Daniel L.; McMahon, M. Molly; Heinberg, Leslie J.; Kushner, Robert; Adams, Ted D.; Shikora, Scott; Dixon, John B.; Brethauer, Stacy

    2014-01-01

    The development of these updated guidelines was commissioned by the AACE, TOS, and ASMBS Board of Directors and adheres to the AACE 2010 protocol for standardized production of clinical practice guidelines (CPG). Each recommendation was re-evaluated and updated based on the evidence and subjective factors per protocol. Examples of expanded topics in this update include: the roles of sleeve gastrectomy, bariatric surgery in patients with type-2 diabetes, bariatric surgery for patients with mild obesity, copper deficiency, informed consent, and behavioral issues. There are 74 recommendations (of which 56 are revised and 2 are new) in this 2013 update, compared with 164 original recommendations in 2008. There are 403 citations, of which 33 (8.2%) are EL 1, 131 (32.5%) are EL 2, 170 (42.2%) are EL 3, and 69 (17.1%) are EL 4. There is a relatively high proportion (40.4%) of strong (EL 1 and 2) studies, compared with only 16.5% in the 2008 AACE- TOS-ASMBS CPG. These updated guidelines reflect recent additions to the evidence base. Bariatric surgery remains a safe and effective intervention for select patients with obesity. A team approach to perioperative care is mandatory with special attention to nutritional and metabolic issues. PMID:23529351

  10. Clinical Practice Guidelines for the Perioperative Nutritional, Metabolic, and Nonsurgical Support of the Bariatric Surgery Patient—2013 Update: Cosponsored by American Association of Clinical Endocrinologists, The Obesity Society, and American Society for Metabolic & Bariatric Surgery*

    PubMed Central

    Mechanick, Jeffrey I.; Youdim, Adrienne; Jones, Daniel B.; Garvey, W. Timothy; Hurley, Daniel L.; McMahon, Molly; Heinberg, Leslie J.; Kushner, Robert; Adams, Ted D.; Shikora, Scott; Dixon, John B.; Brethauer, Stacy

    2014-01-01

    The development of these updated guidelines was commissioned by the AACE, TOS, and ASMBS Board of Directors and adheres to the AACE 2010 protocol for standardized production of clinical practice guidelines (CPG). Each recommendation was re-evaluated and updated based on the evidence and subjective factors per protocol. Examples of expanded topics in this update include: the roles of sleeve gastrectomy, bariatric surgery in patients with type-2 diabetes, bariatric surgery for patients with mild obesity, copper deficiency, informed consent, and behavioral issues. There are 74 recommendations (of which 56 are revised and 2 are new) in this 2013 update, compared with 164 original recommendations in 2008. There are 403 citations, of which 33 (8.2%) are EL 1, 131 (32.5%) are EL 2, 170 (42.2%) are EL 3, and 69 (17.1%) are EL 4. There is a relatively high proportion (40.4%) of strong (EL 1 and 2) studies, compared with only 16.5% in the 2008 AACE-TOS-ASMBS CPG. These updated guidelines reflect recent additions to the evidence base. Bariatric surgery remains a safe and effective intervention for select patients with obesity. A team approach to perioperative care is mandatory with special attention to nutritional and metabolic issues. PMID:23529939

  11. Transparency ethics in practice: Revisiting financial conflicts of interest disclosure forms in clinical practice guidelines

    PubMed Central

    Sharara, Nour; Kaltenbach, Tonya; Laine, Loren; McQuaid, Kenneth; Soetikno, Roy; Subramanian, Venkataraman

    2017-01-01

    Background Authors of clinical practice guidelines (CPGs) disclose financial conflicts of interest (FCOIs) to promote transparency ethics. Typically, they do so on standard declaration forms containing generic open-ended questions on FCOIs. Yet, the literature is scant on the format and effect of alternative disclosure forms. Does supplementing a standard form with subsequent detailed disclosure forms tailored to the context of the CPG improve the yield or accuracy of FCOIs declarations? Methods For an international CPG in gastroenterology on the endoscopic surveillance for colorectal neoplasia in inflammatory bowel disease, we compared the use of a standard FCOIs disclosure form with a contextual FCOIs disclosure form that detailed commercial relations related to the CPG topic. This included manufacturers of endoscopes, endoscopy equipment and accessories. Participants completed the generic form early, and the supplementary contextual form six months later. We then compared the FCOI disclosures obtained. Findings 26 participants provided FCOIs disclosures using both disclosure forms. We found discrepancies regarding (1) the disclosure of FCOIs (presence/absence), and (2) the listing of financial entities. While the number of participants who disclosed a FCOI remained the same (30.8%) using the two forms, disclosures were not from the same individuals: two additional participants disclosed a FCOI, whereas two participants withdrew previous disclosures. Among those who reported a FCOI in either form, we noted inconsistencies in disclosures for 70% of the participants. This included changes in FCOIs disclosure status or modifications of "their commercial relations". Discussion Accurate reporting of FCOIs advances the transparency and ethical integrity of CPGs. Our experience suggests that a contextual FCOIs disclosure form tailored to content of the CPG with narrow, detailed questions provides supplementary, more complete FCOIs declarations than generic forms alone. The finding raises challenges on how forms are best written and formatted, optimally timed, and more effectively processed with sensitivity to professional behaviour, so as to heighten transparency. PMID:28841650

  12. [The German program for disease management guidelines. Background, methods, and development process].

    PubMed

    Ollenschläger, Günter; Kopp, Ina; Lelgemann, Monika; Sänger, Sylvia; Heymans, Lothar; Thole, Henning; Trapp, Henrike; Lorenz, Wilfried; Selbmann, Hans-Konrad; Encke, Albrecht

    2006-10-15

    The Program for National Disease Management Guidelines (German DM-CPG Program) was established in 2002 by the German Medical Association (umbrella organization of the German Chambers of Physicians) and joined by the Association of the Scientific Medical Societies (AWMF; umbrella organization of more than 150 professional societies) and by the National Association of Statutory Health Insurance Physicians (NASHIP) in 2003. The program provides a conceptual basis for disease management, focusing on high-priority health-care topics and aiming at the implementation of best practice recommendations for prevention, acute care, rehabilitation and chronic care. It is organized by the German Agency for Quality in Medicine, a founding member of the Guidelines International Network (G-I-N). The main objective of the German DM-CPG Program is to establish consensus of the medical professions on evidence-based key recommendations covering all sectors of health-care provision and facilitating the coordination of care for the individual patient through time and across interfaces. Within the last year, DM-CPGs have been published for asthma, chronic obstructive pulmonary disease, type 2 diabetes, and coronary heart disease. In addition, experts from national patient self-help groups have been developing patient guidance based upon the recommendations for health-care providers. The article describes background, methods, and tools of the DM-CPG Program, and is the first of a publication series dealing with innovative recommendations and aspects of the program.

  13. [After seven years of National Disease Management Guidelines: quo vadis?].

    PubMed

    Weinbrenner, Susanne; Conrad, Susann; Weikert, Beate; Kopp, Ina

    2010-01-01

    After seven years the National Disease Management Guidelines Programme (German DM-CPG Programme) that was established under the auspices of the German Medical Association, the National Association of Statutory Health Insurance Physicians and the Association of the Scientific Medical Societies in Germany has been widely accepted by both health care professionals and patients. DM-CPGs are available as tools for knowledge and quality management for widespread chronic diseases showing need for improvement in treatment pathways and coordination between health care providers. The main objective of the German DM-CPG Programme is to establish consensus among the medical professions on evidence-based key recommendations covering all sectors of health care provision and facilitating the coordination of care for the individual patient over time and across interfaces. German DM-CPGs provide a conceptual basis for disease management and integrative care aiming at the implementation of best practice recommendations for prevention, acute care, rehabilitation, chronic care and management aspects for high priority health care topics. Thus, representatives of all disciplines, professions and patients concerned with the topic of an individual German DM-CPG are involved in the development process. The methodology of guideline development is in accordance with international standards. However, the improvement of strategies for effective implementation and continuous update remain challenging. Future work will also focus on content-related aspects such as co-morbidity, gender and migration background. Copyright © 2010. Published by Elsevier GmbH.

  14. Modeling uncertainty in computerized guidelines using fuzzy logic.

    PubMed Central

    Jaulent, M. C.; Joyaux, C.; Colombet, I.; Gillois, P.; Degoulet, P.; Chatellier, G.

    2001-01-01

    Computerized Clinical Practice Guidelines (CPGs) improve quality of care by assisting physicians in their decision making. A number of problems emerges since patients with close characteristics are given contradictory recommendations. In this article, we propose to use fuzzy logic to model uncertainty due to the use of thresholds in CPGs. A fuzzy classification procedure has been developed that provides for each message of the CPG, a strength of recommendation that rates the appropriateness of the recommendation for the patient under consideration. This work is done in the context of a CPG for the diagnosis and the management of hypertension, published in 1997 by the French agency ANAES. A population of 82 patients with mild to moderate hypertension was selected and the results of the classification system were compared to whose given by a classical decision tree. Observed agreement is 86.6% and the variability of recommendations for patients with close characteristics is reduced. PMID:11825196

  15. Alignment of practice guidelines with targeted-therapy drug funding policies in Ontario.

    PubMed

    Ramjeesingh, R; Meyer, R M; Brouwers, M; Chen, B E; Booth, C M

    2013-02-01

    We evaluated clinical practice guideline (cpg) recommendations from Cancer Care Ontario's Program in Evidence-Based Care (pebc) for molecularly targeted systemic treatments (tts) and subsequent funding decisions from the Ontario Ministry of Health and Long-Term Care. We identified pebc cpgs on tt published before June 1, 2010, and extracted information regarding the key evidence cited in support of cpg recommendations and the effect size associated with each tt. Those variables were compared with mohltc funding decisions as of June 2011. From 23 guidelines related to 17 tts, we identified 43 recommendations, among which 38 (88%) endorsed tt use. Among all the recommendations, 38 (88%) were based on published key evidence, with 82% (31 of 38) being supported by meta-analyses or phase iii trials. For the 38 recommendations endorsing tts, funding was approved in 28 (74%; odds ratio related to cpg recommendation: 29.9; p = 0.003). We were unable to demonstrate that recommendations associated with statistically significant improvements in overall survival [os: 14 of 16 (88%) vs. 8 of 14 (57%); p = 0.10] or disease- (dfs) or progression-free survival [pfs: 16 of 21 (76%) vs. 3 of 5 (60%); p = 0.59] were more likely to be funded than those with no significant difference. Moreover, we did not observe significant associations between funding approvals and absolute improvements of 3 months or more in os [6 of 6 (100%) vs. 3 of 6 (50%), p = 0.18] or pfs [6 of 8 (75%) vs. 10 of 12 (83%), p = 1.00]. For use of tts, most recommendations in pebc cpgs are based on meta-analyses or phase iii data, and funding decisions were strongly associated with those recommendations. Our data suggest a trend toward increased rates of funding for therapies with statistically significant improvements in os.

  16. Improved guideline adherence to pharmacotherapy of chronic systolic heart failure in general practice--results from a cluster-randomized controlled trial of implementation of a clinical practice guideline.

    PubMed

    Peters-Klimm, Frank; Müller-Tasch, Thomas; Remppis, Andrew; Szecsenyi, Joachim; Schellberg, Dieter

    2008-10-01

    Clinical practice guidelines (CPG) reflect the evidence of effective pharmacotherapy of chronic (systolic) heart failure (CHF) which needs to be implemented. This study aimed to evaluate the effect of a new, multifaceted intervention (educational train-the-trainer course plus pharmacotherapy feedback = TTT) compared with standard education on guideline adherence (GA) in general practice. Thirty-seven participating general practitioners (GPs) were randomized (18 vs. 19) and included 168 patients with ascertained symptomatic CHF [New York Heart Association (NYHA) II-IV]. Groups received CPG, the TTT intervention consisted of four interactive educational meetings and a pharmacotherapy feedback, while the control group received a usual lecture (Standard). Outcome measure was GA assessed by prescription rates and target dosing of angiotensin converting enzyme (ACE) inhibitors (ACE-I) or angiotensin receptor blockers (ARB), beta-blockers (BB) and aldosterone antagonists (AA) at baseline and 7-month follow-up. Group comparisons at follow-up were adjusted to GA, sex, age and NYHA stage at baseline. Prescription rates at baseline (n = 168) were high (ACE-I/ARB 90, BB 79 and AA 29%) in both groups. At follow up (n = 146), TTT improved compared with Standard regarding AA (43% vs. 23%, P = 0.04) and the rates of reached target doses of ACE-I/ARB (28% vs. 15%, P = 0.04). TTT group achieved significantly higher mean percentages of daily target dose (52% vs. 42%, mean difference 10.3%, 95% CI 0.84-19.8, P = 0.03). Despite of pre-existing high GA in both groups and an active control group, the multifaceted intervention was effective in quality of care measured by GA. Further research is needed on the choice of interventions in different provider populations.

  17. Effectiveness of a clinical practice guideline implementation strategy for patients with anxiety disorders in primary care: cluster randomized trial.

    PubMed

    Tello-Bernabé, Eugenia; Sanz-Cuesta, Teresa; del Cura-González, Isabel; de Santiago-Hernando, María L; Jurado-Sueiro, Montserrat; Fernández-Girón, Mercedes; García-de Blas, Francisca; Pensado-Freire, Higinio; Góngora-Maldonado, Francisco; de la Puente-Chamorro, María J; Rodríguez-Pasamontes, Carmen; Martín-Iglesias, Susana

    2011-12-01

    Anxiety is a common mental health problem seen in primary care. However, its management in clinical practice varies greatly. Clinical practice guidelines (CPGs) have the potential to reduce variations and improve the care received by patients by promoting interventions of proven benefit. However, uptake and adherence to their recommendations can be low. This study involves a community based on cluster randomized trial in primary healthcare centres in the Madrid Region (Spain). The project aims to determine whether the use of implementation strategy (including training session, information, opinion leader, reminders, audit, and feed-back) of CPG for patients with anxiety disorders in primary care is more effective than usual diffusion. The number of patients required is 296 (148 in each arm), all older than 18 years and diagnosed with generalized anxiety disorder, panic disorder, and panic attacks by the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV). They are chosen by consecutive sampling. The main outcome variable is the change in two or more points into Goldberg anxiety scale at six and twelve months. Secondary outcome variables include quality of life (EuroQol 5D), and degree of compliance with the CPG recommendations on treatment, information, and referrals to mental health services. Main effectiveness will be analyzed by comparing the patients percentage improvement on the Goldberg scale between the intervention group and the control group. Logistic regression with random effects will be used to adjust for prognostic factors. Confounding factors or factors that might alter the effect recorded will be taken into account in this analysis. There is a need to identify effective implementation strategies for CPG for the management of anxiety disorders present in primary care. Ensuring the appropriate uptake of guideline recommendations can reduce clinical variation and improve the care patients receive. ISRCTN: ISRCTN83365316.

  18. Effectiveness of a clinical practice guideline implementation strategy for patients with anxiety disorders in primary care: cluster randomized trial

    PubMed Central

    2011-01-01

    Background Anxiety is a common mental health problem seen in primary care. However, its management in clinical practice varies greatly. Clinical practice guidelines (CPGs) have the potential to reduce variations and improve the care received by patients by promoting interventions of proven benefit. However, uptake and adherence to their recommendations can be low. Method/design This study involves a community based on cluster randomized trial in primary healthcare centres in the Madrid Region (Spain). The project aims to determine whether the use of implementation strategy (including training session, information, opinion leader, reminders, audit, and feed-back) of CPG for patients with anxiety disorders in primary care is more effective than usual diffusion. The number of patients required is 296 (148 in each arm), all older than 18 years and diagnosed with generalized anxiety disorder, panic disorder, and panic attacks by the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV). They are chosen by consecutive sampling. The main outcome variable is the change in two or more points into Goldberg anxiety scale at six and twelve months. Secondary outcome variables include quality of life (EuroQol 5D), and degree of compliance with the CPG recommendations on treatment, information, and referrals to mental health services. Main effectiveness will be analyzed by comparing the patients percentage improvement on the Goldberg scale between the intervention group and the control group. Logistic regression with random effects will be used to adjust for prognostic factors. Confounding factors or factors that might alter the effect recorded will be taken into account in this analysis. Discussion There is a need to identify effective implementation strategies for CPG for the management of anxiety disorders present in primary care. Ensuring the appropriate uptake of guideline recommendations can reduce clinical variation and improve the care patients receive. Trial registration ISRCTN: ISRCTN83365316 PMID:22132861

  19. Impact of the implementation of an evidence-based guideline on diagnostic testing, management, and clinical outcomes for infants with bronchiolitis

    PubMed Central

    Henao-Villada, Ricardo; Sossa-Briceño, Monica P.; Rodríguez-Martínez, Carlos E.

    2016-01-01

    Background: Although bronchiolitis poses a significant health problem in low- and middle-income countries (LMICs), to the best of our knowledge, to date it has not been determined whether evidence-based bronchiolitis clinical practice guidelines (CPGs) complemented by standardized educational strategies reduce the use of unnecessary diagnostic tests and medications and improve clinically important outcomes in LMICs. Methods: In an uncontrolled before and after study, we assessed the impact of the implementation of an evidence-based bronchiolitis CPG on physician behavior and the care of infants with bronchiolitis by comparing pre-guideline (March to August 2014) and post-guideline (March to August 2015) use of diagnostic tests and medications through an electronic medical record review in a children’s hospital in Bogota, Colombia. We also sought to assess the impact of the implementation of the CPG on clinically important outcomes such as lengths of stay, hospital admissions, intensive care admissions, and hospital readmissions. Results: Data from 662 cases of bronchiolitis (pre-guideline period) were compared with the data from 703 cases (post-guideline period). On comparing the pre- and post-guideline periods, it was seen that there was a significant increase in the proportion of patients with an appropriate diagnosis and treatment of bronchiolitis (36.4% versus 44.5%, p = 0.003), and there were statistically significant decreases in the use of a hemogram (33.2% versus 26.6%, p=0.010), procalcitonin (3.9% versus 1.6%, p=0.018), nebulized beta-2 agonists (45.6% versus 3.4%, p < 0.001), nebulized anticholinergics (3.3% versus 1.4%, p= 0.029), and nebulized epinephrine (16.2% versus 7.8%, p < 0.001). Likewise, a significant increase in the use of nebulized hypertonic saline was seen (79.6% versus 91.7%, p < 0.001). However, implementation of the CPG for bronchiolitis was not associated with significant changes in clinically important outcomes. Conclusions: The development and implementation of a good quality bronchiolitis CPG is associated with a significant increase in the proportion of cases with an appropriate diagnosis and treatment of the disease in the context of a university-based hospital located in the capital of an LMIC. However, we could not demonstrate an improvement in clinically important outcomes such as any of the bronchiolitis severity parameters. PMID:27492738

  20. [The German program for disease management guidelines. Results and perspectives].

    PubMed

    Ollenschläger, Günter; Kopp, Ina

    2007-05-15

    The Program for National Disease Management Guidelines (German DM-CPG Program) is a joint initiative of the German Medical Association (umbrella organization of the German Chambers of Physicians), the Association of the Scientific Medical Societies (AWMF), and of the National Association of Statutory Health Insurance Physicians (NASHIP). The program aims at developing, implementing and continuously updating best-practice recommendations for countrywide and regional disease management programs in Germany. Since 2003 twelve national guidelines (topics: asthma, chronic obstructive pulmonary disease, HI (Chronic heart failure), CVD (Chronic coronary heart disease) back pain, depression, several aspects of diabetes) have been produced by use of a standardized procedure in accordance with internationally consented methodologies. For countrywide dissemination and implementation the program uses a wide range of specialist journals, continuous medical education and quality management programs. So far, 36 out of 150 national scientific medical associations, four allied health profession organizations, and twelve national consumer organizations have been participating in the DM-CPG Program. Studies to evaluate the program's effects on health-care providers' behavior and patients' outcomes are under way.

  1. Understanding and treatment of chronic abdominal pain in pediatric primary care.

    PubMed

    Schurman, Jennifer Verrill; Kessler, Emily D; Friesen, Craig A

    2014-10-01

    This study examined the practices used by primary care pediatricians to assess and treat chronic abdominal pain (CAP), as an initial step in guiding clinical practice guideline (CPG) development. A survey was mailed to a random sample of office-based pediatrician members (primary care pediatricians [PCPs]) of the American Medical Association. PCPs (n = 470) provided information about the typical presentation of CAP, assessment/treatment approaches used in their own practice, their definition of a functional gastrointestinal disorder (FGID), and their familiarity with the Rome Criteria for diagnosing FGIDs. Substantial variability among PCPs was noted across all these areas. Results suggest that perceptions and practices of pediatric CAP vary widely among PCPs; no single standard of care emerged to guide development of a CPG for this population. Future research should evaluate the efficacy of specific strategies currently in use to identify potential opportunities for improving assessment and treatment of CAP in pediatric primary care. © The Author(s) 2014.

  2. [ARIA Mexico 2014. Adaptation of the Clinical Practice Guide ARIA 2010 for Mexico. Methodology ADAPTE].

    PubMed

    Larenas-Linnemann, Désirée; Mayorga-Butrón, José Luis; Sánchez-González, Andrés; Ramírez-García, Arturo; Medina-Ávalos, Miguel; Figueroa-Morales, Marco Antonio; Montaño-Velázquez, B Beatriz; Montes-Narváez, Gabriel; Romero-Tapia, Sergio; Stone-Aguilar, Héctor; Xochihua-Díaz, Luis; Salas-Hernández, Jorge; Hernán-Ruiz, Héctor; Betancourt-Suárez, Miguel A; Cano-Salas, María Carmen; Curiel-Aceves, Lorenzo; Dibildox-Martínez, Javier; Fernández-Vega, Margarita; García-Bolaños, Carlos; Iduñate-Palacios, Fernando; Jiménez-Chobillon, M Alejandro; López-Lizárraga, Doris N; Matta-Campos, Juan José; Olvera-Salinas, Jorge; Rivera-Gómez, María Antonia; Virgen-Ortega, César; Sienra-Monge, Juan José; Del Río-Navarro, Blanca; Arias-Cruz, Alfredo; Sacre-Hazouri, Antonio; Aguilar-Aranda, Ambrocio; Vásquez Del Mercado-Cordero, Rodrigo; Barnica, Raúl Humberto; Velasco-Hidalgo, Liliana; Solís-Galicia, Cecilia

    2014-01-01

    The global prevalence of allergic rhinitis is high. International Study of Asthma and Allergies in Childhood (ISAAC) Phase III reports a total estimated prevalence of 4.6% in Mexico. There is evidence based on allergic rhinitis Clinical Practice Guidelines (CPG), but its promotion, acceptance and application is not optimal or adequate in Mexico. To generate a guideline for the treatment of allergic rhinitis and its impact on asthma by adaptating the 2010 ARIA Guideline to Mexican reality, through a transculturation process applying the ADAPTE methodology. Using the ADAPTE Methodology, the original 2010 ARIA CPG recommendations were evaluated by the guideline development group (GDG) into which multiple medical specialities managing patients with allergic rhinitis were incoorporated. The GDG valorated the quality of 2010 ARIA, checked and translated key clinical questions. Moreover, the GDG adjusted recommendations, patient preferences and included comments in the context of the Mexican reality (safety, costs and cultural issues). To accomplish this, we ran Delphi panels with as many rounds as necessary to reach agreement. One extra question, not included in the original 2010 ARIA, on the use of Nasal Lavages for AR was created sustained by a systematic literature review. A total of 45 questions from the original 2010 ARIA were included and divided into six groups covering prevention, medical treatment, immunotherapy and alternative medicine to treat patients with allergic rhinitis with or without asthma. Most of the questions reached agreement in one or two rounds; one question required three rounds. An easy-to-use, adaptated, up-to-date and applicable allergic rhinitis guideline for Mexico is now available.

  3. Critical Appraisal of International Clinical Practice Guidelines in Kidney Transplantation Using the Appraisal of Guidelines for Research and Education (AGREE) II Tool: A Systematic Review.

    PubMed

    OʼDonoghue, Katriona Jane Marie; Reed, Rhiannon D; Knight, Simon R; O'Callaghan, John M; Ayaz-Shah, Anam A; Hassan, Sevda; Weissenbacher, Annemarie; Morris, Peter J; Pengel, Liset H M

    2018-05-22

    Whilst Clinical Practice Guidelines (CPGs) are used for the development of local protocols in kidney transplantation (Ktx), the quality of their methodology is variable. This systematic review aimed to critically appraise international CPGs in all aspects of Ktx using the Appraisal of Guidelines for Research and Evaluation (AGREE) II tool. CPGs in Ktx and donation published between 2010 and 2017 were identified from MEDLINE, Embase, National Guideline Clearinghouse, NHS and NICE Evidence Searches, and the websites of transplant societies. Using AGREE II, 3 appraisers assessed the quality of CPGs. Interrater reliability was measured using the intraclass correlation coefficient (ICC). Searches identified 3,168 records and 115 CPGs were included. The highest scoring AGREE II domain was 'Scope and Purpose' (80%; Range 30-100%), followed by 'Clarity of Presentation' (77%; Range 43-98%), 'Editorial independence' (52%; Range 0-94%), 'Rigour of Development' (47%; Range 6-97%) and 'Stakeholder Involvement' (41%; Range 11-85%). The poorest scoring domain was 'Applicability' (31%; Range 3-74%). Most CPGs were recommended for future use either with (63%) or without modifications (18%). A small number were not recommended for future use (14%) or reviewers did not agree on recommending the CPG (5%). The overall mean CPG quality score was 4 out of 7 (Range 2-7). The mean ICC of 0.74 indicated substantial agreement between reviewers. The quality of international CPGs in Ktx was variable, and most CPGs lacked key aspects of methodological robustness and transparency. Improvements in methodology, patient involvement and strategies for implementation are required.

  4. Effectiveness of implementation strategies in improving physician adherence to guideline recommendations in heart failure: a systematic review protocol.

    PubMed

    Van Spall, Harriette G C; Shanbhag, Deepti; Gabizon, Itzhak; Ibrahim, Quazi; Graham, Ian D; Harlos, Karen; Haynes, R Brian; Connolly, Stuart J

    2016-03-31

    The uptake of Clinical Practice Guideline (CPG) recommendations that improve outcomes in heart failure (HF) remains suboptimal. We will conduct a systematic review to identify implementation strategies that improve physician adherence to class I recommendations, those with clear evidence that benefits outweigh the risks. We will use American, Canadian and European HF guidelines as our reference. We will conduct a literature search in the databases of MEDLINE, EMBASE, HEALTHSTAR, CINAHL, Cochrane Library, Campbell Collaboration, Joanna Briggs Institute Evidence Based Practice, Centre for Reviews and Dissemination and Evidence Based Practice Centres. We will include prospective studies evaluating implementation interventions aimed at improving uptake of class I CPG recommendations in HF. We will extract data in duplicate. We will classify interventions according to their level of application (ie, provider, organisation, systems level) and common underlying characteristics (eg, education, decision-support, financial incentives) using the Cochrane Effective Practice and Organisation of Care Taxonomy. We will assess the impact of the intervention on adherence to the CPGs. Outcomes will include proportion of eligible patients who were: prescribed a CPG-recommended pharmacological treatment; referred for device consideration; provided self-care education at discharge; and provided left ventricular function assessment. We will include clinical outcomes such as hospitalisations, readmissions and mortality, if data is available. We will identify the common elements of successful and failing interventions, and examine the context in which they were applied, using the Process Redesign contextual framework. We will synthesise the results narratively and, if appropriate, will pool results for meta-analysis. In this review, we will assess the impact of implementation strategies and contextual factors on physician adherence to HF CPGs. We will explore why some interventions may succeed in one setting and fail in another. We will disseminate our findings through briefing reports, publications and presentations. CRD42015017155. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  5. To What Extent do Clinical Practice Guidelines Respond to the Needs and Preferences of Patients Diagnosed with Obsessive-Compulsive Disorder?

    PubMed

    Villena-Jimena, Amelia; Gómez-Ocaña, Clara; Amor-Mercado, Gisela; Núñez-Vega, Amanda; Morales-Asencio, José Miguel; Hurtado, María Magdalena

    The number of Clinical Practice Guidelines (CPG) to help in making clinical decisions is increasing. However, there is currently a lack of CPG for Obsessive-Compulsive Disorder that take into account the requirements and expectations of the patients. The aim of the present study was to determine whether recommendations of the NICE guideline, "Obsessive-compulsive disorder: core interventions in the treatment of obsessive-compulsive disorder and body dysmorphic disorder" agrees with the needs and preferences of patients diagnosed with OCD in the mental health service. Two focal groups were formed with a total of 12 participants. They were asked about the impact of the disorder in their lives, their experiences with the mental health services, their satisfaction with treatments, and about their psychological resources. Preferences and needs were compared with the recommendations of the guidelines, and to facilitate their analysis, they were classified into four topics: information, accessibility, treatments, and therapeutic relationship. The results showed a high agreement between recommendations and patients preferences, particularly as regards high-intensity psychological interventions. Some discrepancies included the lack of prior low-intensity psychological interventions in mental health service, and the difficulty of rapid access the professionals. There is significant concordance between recommendations and patients preferences and demands, which are only partially responded to by the health services. Copyright © 2017 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  6. Adapting evidence-based clinical practice guidelines at university teaching hospitals: A model for the Eastern Mediterranean Region.

    PubMed

    Amer, Yasser S; Wahabi, Hayfaa A; Abou Elkheir, Manal M; Bawazeer, Ghada A; Iqbal, Shaikh M; Titi, Maher A; Ekhzaimy, Aishah; Alswat, Khalid A; Alzeidan, Rasmieh A; Al-Ansary, Lubna A

    2018-04-24

    Clinical practice guidelines (CPGs) are significant tools for evidence-based health care quality improvement. The CPG program at King Saud University was launched as a quality improvement program to fulfil the international accreditation standards. This program was a collaboration between the Research Chair for Evidence-Based Healthcare and Knowledge Translation and the Quality Management Department. This study aims to develop a fast-track method for adaptation of evidence-based CPGs and describe results of the program. Twenty-two clinical departments participated in the program. Following a CPGs awareness week directed to all health care professionals (HCPs), 22 teams were trained to set priorities, search, screen, assess, select, and customize the best available CPGs. The teams were technically supported by the program's CPG advisors. To address the local health care context, a modified version of the ADAPTE was used where recommendations were either accepted or rejected but not changed. A strict peer-review process for clinical content and methodology was employed. In addition to raising awareness and building capacity, 35 CPGs were approved for implementation by March 2018. These CPGs were integrated with other existing projects such as accreditation, electronic medical records, performance management, and training and education. Preliminary implementation audits suggest a positive impact on patient outcomes. Leadership commitment was a strength, but the high turnover of the team members required frequent and extensive training for HCPs. This model for CPG adaptation represents a quick, practical, economical method with a sense of ownership by staff. Using this modified version can be replicated in other countries to assess its validity. © 2018 John Wiley & Sons, Ltd.

  7. Evaluation of Industry Relationships Among Authors of Otolaryngology Clinical Practice Guidelines.

    PubMed

    Horn, Jarryd; Checketts, Jake Xavier; Jawhar, Omar; Vassar, Matt

    2018-03-01

    Financial relationships between physicians and industry have influence on patient care. Therefore, organizations producing clinical practice guidelines (CPGs) must have policies limiting financial conflicts during guideline development. To evaluate payments received by physician authors of otolaryngology CPGs, compare disclosure statements for accuracy, and investigate the extent to which the American Academy of Otolaryngology-Head and Neck Surgery complied with standards for guideline development from the Institute of Medicine (IOM). This cross-sectional analysis retrieved CPGs from the American Academy of Otolaryngology-Head and Neck Surgery Foundation that were published or revised from January 1, 2013, through December 31, 2015, by 49 authors. Data were retrieved from December 1 through 31, 2016. Industry payments received by authors were extracted using the Centers for Medicare & Medicaid Services Open Payments database. The values and types of these payments were then evaluated and used to determine whether self-reported disclosure statements were accurate and whether guidelines adhered to applicable IOM standards. The monetary amounts and types of payments received by physicians who author otolaryngology guidelines and the accuracy of disclosure statements. Of the 49 physicians in this sample, 39 (80%) received an industry payment. Twenty-one authors (43%) accepted more than $1000; 12 (24%), more than $10 000; 7 (14%), more than $50 000; and 2 (4%), more than $100 000. Mean (SD) financial payments amounted to $18 431 ($53 459) per physician. Total reimbursement for all authors was $995 282. Disclosure statements disagreed with the Open Payments database for 3 authors, amounting to approximately $20 000 among them. Of the 3 IOM standards assessed, only 1 was consistently enforced. Some CPG authors failed to fully disclose all financial conflicts of interest, and most guideline development panels and chairpersons had conflicts. In addition, adherence to IOM standards for guideline development was lacking. This study is relevant to CPG panels authoring recommendations, physicians implementing CPGs to guide patient care, and the organizations establishing policies for guideline development.

  8. People Getting a Grip on Arthritis: A Knowledge Transfer Strategy to Empower Patients with Rheumatoid Arthritis and Osteoarthritis

    ERIC Educational Resources Information Center

    Brosseau, Lucie; Lineker, Sydney; Bell, Mary; Wells, George; Casimiro, Lynn; Egan, Mary; Cranney, Ann; Tugwell, Peter; Wilson, Keith G.; De Angelis, Gino; Loew, Laurianne

    2012-01-01

    Objective: The purpose of this study was twofold. First, to help people with arthritis become aware of and utilize Rheumatoid Arthritis (RA) and Osteoarthritis (OA) Clinical Practice Guidelines (CPGs) as they relate to self-management strategies. Second, to evaluate the impact of specific Knowledge Translation (KT) activities on CPG uptake. More…

  9. A method for developing standardised interactive education for complex clinical guidelines

    PubMed Central

    2012-01-01

    Background Although systematic use of the Perinatal Society of Australia and New Zealand internationally endorsed Clinical Practice Guideline for Perinatal Mortality (PSANZ-CPG) improves health outcomes, implementation is inadequate. Its complexity is a feature known to be associated with non-compliance. Interactive education is effective as a guideline implementation strategy, but lacks an agreed definition. SCORPIO is an educational framework containing interactive and didactic teaching, but has not previously been used to implement guidelines. Our aim was to transform the PSANZ-CPG into an education workshop to develop quality standardised interactive education acceptable to participants for learning skills in collaborative interprofessional care. Methods The workshop was developed using the construct of an educational framework (SCORPIO), the PSANZ-CPG, a transformation process and tutor training. After a pilot workshop with key target and stakeholder groups, modifications were made to this and subsequent workshops based on multisource written observations from interprofessional participants, tutors and an independent educator. This participatory action research process was used to monitor acceptability and educational standards. Standardised interactive education was defined as the attainment of content and teaching standards. Quantitative analysis of positive expressed as a percentage of total feedback was used to derive a total quality score. Results Eight workshops were held with 181 participants and 15 different tutors. Five versions resulted from the action research methodology. Thematic analysis of multisource observations identified eight recurring education themes or quality domains used for standardisation. The two content domains were curriculum and alignment with the guideline and the six teaching domains; overload, timing, didacticism, relevance, reproducibility and participant engagement. Engagement was the most challenging theme to resolve. Tutors identified all themes for revision whilst participants identified a number of teaching but no content themes. From version 1 to 5, a significant increasing trend in total quality score was obtained; participants: 55%, p=0.0001; educator: 42%, p=0.0004; tutor peers: 57%, p=0.0001. Conclusions Complex clinical guidelines can be developed into a workshop acceptable to interprofessional participants. Eight quality domains provide a framework to standardise interactive teaching for complex clinical guidelines. Tutor peer review is important for content validity. This methodology may be useful for other guideline implementation. PMID:23131137

  10. A method for developing standardised interactive education for complex clinical guidelines.

    PubMed

    Vaughan, Janet I; Jeffery, Heather E; Raynes-Greenow, Camille; Gordon, Adrienne; Hirst, Jane; Hill, David A; Arbuckle, Susan

    2012-11-06

    Although systematic use of the Perinatal Society of Australia and New Zealand internationally endorsed Clinical Practice Guideline for Perinatal Mortality (PSANZ-CPG) improves health outcomes, implementation is inadequate. Its complexity is a feature known to be associated with non-compliance. Interactive education is effective as a guideline implementation strategy, but lacks an agreed definition. SCORPIO is an educational framework containing interactive and didactic teaching, but has not previously been used to implement guidelines. Our aim was to transform the PSANZ-CPG into an education workshop to develop quality standardised interactive education acceptable to participants for learning skills in collaborative interprofessional care. The workshop was developed using the construct of an educational framework (SCORPIO), the PSANZ-CPG, a transformation process and tutor training. After a pilot workshop with key target and stakeholder groups, modifications were made to this and subsequent workshops based on multisource written observations from interprofessional participants, tutors and an independent educator. This participatory action research process was used to monitor acceptability and educational standards. Standardised interactive education was defined as the attainment of content and teaching standards. Quantitative analysis of positive expressed as a percentage of total feedback was used to derive a total quality score. Eight workshops were held with 181 participants and 15 different tutors. Five versions resulted from the action research methodology. Thematic analysis of multisource observations identified eight recurring education themes or quality domains used for standardisation. The two content domains were curriculum and alignment with the guideline and the six teaching domains; overload, timing, didacticism, relevance, reproducibility and participant engagement. Engagement was the most challenging theme to resolve. Tutors identified all themes for revision whilst participants identified a number of teaching but no content themes. From version 1 to 5, a significant increasing trend in total quality score was obtained; participants: 55%, p=0.0001; educator: 42%, p=0.0004; tutor peers: 57%, p=0.0001. Complex clinical guidelines can be developed into a workshop acceptable to interprofessional participants. Eight quality domains provide a framework to standardise interactive teaching for complex clinical guidelines. Tutor peer review is important for content validity. This methodology may be useful for other guideline implementation.

  11. International lessons in new methods for grading and integrating cost effectiveness evidence into clinical practice guidelines.

    PubMed

    Antioch, Kathryn M; Drummond, Michael F; Niessen, Louis W; Vondeling, Hindrik

    2017-01-01

    Economic evidence is influential in health technology assessment world-wide. Clinical Practice Guidelines (CPG) can enable economists to include economic information on health care provision. Application of economic evidence in CPGs, and its integration into clinical practice and national decision making is hampered by objections from professions, paucity of economic evidence or lack of policy commitment. The use of state-of-art economic methodologies will improve this. Economic evidence can be graded by 'checklists' to establish the best evidence for decision making given methodological rigor. New economic evaluation checklists, Multi-Criteria Decision Analyses (MCDA) and other decision criteria enable health economists to impact on decision making world-wide. We analyse the methodologies for integrating economic evidence into CPG agencies globally, including the Agency of Health Research and Quality (AHRQ) in the USA, National Health and Medical Research Council (NHMRC) and Australian political reforms. The Guidelines and Economists Network International (GENI) Board members from Australia, UK, Canada and Denmark presented the findings at the conference of the International Health Economists Association (IHEA) and we report conclusions and developments since. The Consolidated Guidelines for the Reporting of Economic Evaluations (CHEERS) 24 item check list can be used by AHRQ, NHMRC, other CPG and health organisations, in conjunction with the Drummond ten-point check list and a questionnaire that scores that checklist for grading studies, when assessing economic evidence. Cost-effectiveness Analysis (CEA) thresholds, opportunity cost and willingness-to-pay (WTP) are crucial issues for decision rules in CEA generally, including end-of-life therapies. Limitations of inter-rater reliability in checklists can be addressed by including more than one assessor to reach a consensus, especially when impacting on treatment decisions. We identify priority areas to generate economic evidence for CPGs by NHMRC, AHRQ, and other agencies. The evidence may cover demand for care issues such as involved time, logistics, innovation price, price sensitivity, substitutes and complements, WTP, absenteeism and presentism. Supply issues may include economies of scale, efficiency changes, and return on investment. Involved equity and efficiency measures may include cost-of-illness, disease burden, quality-of-life, budget impact, cost-effective ratios, net benefits and disparities in access and outcomes. Priority setting remains essential and trade-off decisions between policy criteria can be based on MCDA, both in evidence based clinical medicine and in health planning.

  12. [Clinical practice guidelines in Peru: evaluation of its quality using the AGREE II instrument].

    PubMed

    Canelo-Aybar, Carlos; Balbin, Graciela; Perez-Gomez, Ángela; Florez, Iván D

    2016-01-01

    To evaluate the methodological quality of clinical practice guidelines (CPGs) put into practice by the Peruvian Ministry of Health (MINSA), 17 CPGs from the ministry, published between 2009 and 2014, were independently evaluated by three methodologic experts using the AGREE II instrument. The score of AGREE II domains was low and very low in all CPGs: scope and purpose (medium, 44%), clarity of presentation (medium, 47%), participation of decision-makers (medium, 8%), methodological rigor (medium, 5%), applicability (medium, 5%), and editorial independence (medium, 8%). In conclusion, the methodological quality of CPGs implemented by the MINSA is low. Consequently, its use could not be recommended. The implementation of the methodology for the development of CPGs described in the recentlypublished CPG methodological preparation manual in Peru is a pressing need.

  13. Developing Leadership in Managers to Facilitate the Implementation of National Guideline Recommendations: A Process Evaluation of Feasibility and Usefulness

    PubMed Central

    Tistad, Malin; Palmcrantz, Susanne; Wallin, Lars; Ehrenberg, Anna; Olsson, Christina B.; Tomson, Göran; Holmqvist, Lotta Widén; Gifford, Wendy; Eldh, Ann Catrine

    2016-01-01

    Background: Previous research supports the claim that managers are vital players in the implementation of clinical practice guidelines (CPGs), yet little is known about interventions aiming to develop managers’ leadership in facilitating implementation. In this pilot study, process evaluation was employed to study the feasibility and usefulness of a leadership intervention by exploring the intervention’s potential to support managers in the implementation of national guideline recommendations for stroke care in outpatient rehabilitation. Methods: Eleven senior and frontline managers from five outpatient stroke rehabilitation centers participated in a four-month leadership intervention that included workshops, seminars, and teleconferences. The focus was on developing knowledge and skills to enhance the implementation of CPG recommendations, with a particular focus on leadership behaviors. Each dyad of managers was assigned to develop a leadership plan with specific goals and leadership behaviors for implementing three rehabilitation recommendations. Feasibility and usefulness were explored through observations and interviews with the managers and staff members prior to the intervention, and then one month and one year after the intervention. Results: Managers considered the intervention beneficial, particularly the participation of both senior and frontline managers and the focus on leadership knowledge and skills for implementing CPG recommendations. All the managers developed a leadership plan, but only two units identified goals specific to implementing the three stroke rehabilitation recommendations. Of these, only one identified leadership behaviors that support implementation. Conclusion: Managers found that the intervention was delivered in a feasible way and appreciated the focus on leadership to facilitate implementation. However, the intervention appeared to have limited impact on managers’ behaviors or clinical practice at the units. Future interventions directed towards managers should have a stronger focus on developing leadership skills and behaviors to tailor implementation plans and support implementation of CPG recommendations. PMID:27694661

  14. Developing Leadership in Managers to Facilitate the Implementation of National Guideline Recommendations: A Process Evaluation of Feasibility and Usefulness.

    PubMed

    Tistad, Malin; Palmcrantz, Susanne; Wallin, Lars; Ehrenberg, Anna; Olsson, Christina B; Tomson, Göran; Holmqvist, Lotta Widén; Gifford, Wendy; Eldh, Ann Catrine

    2016-04-11

    Previous research supports the claim that managers are vital players in the implementation of clinical practice guidelines (CPGs), yet little is known about interventions aiming to develop managers' leadership in facilitating implementation. In this pilot study, process evaluation was employed to study the feasibility and usefulness of a leadership intervention by exploring the intervention's potential to support managers in the implementation of national guideline recommendations for stroke care in outpatient rehabilitation. Eleven senior and frontline managers from five outpatient stroke rehabilitation centers participated in a four-month leadership intervention that included workshops, seminars, and teleconferences. The focus was on developing knowledge and skills to enhance the implementation of CPG recommendations, with a particular focus on leadership behaviors. Each dyad of managers was assigned to develop a leadership plan with specific goals and leadership behaviors for implementing three rehabilitation recommendations. Feasibility and usefulness were explored through observations and interviews with the managers and staff members prior to the intervention, and then one month and one year after the intervention. Managers considered the intervention beneficial, particularly the participation of both senior and frontline managers and the focus on leadership knowledge and skills for implementing CPG recommendations. All the managers developed a leadership plan, but only two units identified goals specific to implementing the three stroke rehabilitation recommendations. Of these, only one identified leadership behaviors that support implementation. Managers found that the intervention was delivered in a feasible way and appreciated the focus on leadership to facilitate implementation. However, the intervention appeared to have limited impact on managers' behaviors or clinical practice at the units. Future interventions directed towards managers should have a stronger focus on developing leadership skills and behaviors to tailor implementation plans and support implementation of CPG recommendations. © 2016 by Kerman University of Medical Sciences

  15. Transforming clinical practice guidelines and clinical pathways into fast-and-frugal decision trees to improve clinical care strategies.

    PubMed

    Djulbegovic, Benjamin; Hozo, Iztok; Dale, William

    2018-02-27

    Contemporary delivery of health care is inappropriate in many ways, largely due to suboptimal Q5 decision-making. A typical approach to improve practitioners' decision-making is to develop evidence-based clinical practice guidelines (CPG) by guidelines panels, who are instructed to use their judgments to derive practice recommendations. However, mechanisms for the formulation of guideline judgments remains a "black-box" operation-a process with defined inputs and outputs but without sufficient knowledge of its internal workings. Increased explicitness and transparency in the process can be achieved by implementing CPG as clinical pathways (CPs) (also known as clinical algorithms or flow-charts). However, clinical recommendations thus derived are typically ad hoc and developed by experts in a theory-free environment. As any recommendation can be right (true positive or negative), or wrong (false positive or negative), the lack of theoretical structure precludes the quantitative assessment of the management strategies recommended by CPGs/CPs. To realize the full potential of CPGs/CPs, they need to be placed on more solid theoretical grounds. We believe this potential can be best realized by converting CPGs/CPs within the heuristic theory of decision-making, often implemented as fast-and-frugal (FFT) decision trees. This is possible because FFT heuristic strategy of decision-making can be linked to signal detection theory, evidence accumulation theory, and a threshold model of decision-making, which, in turn, allows quantitative analysis of the accuracy of clinical management strategies. Fast-and-frugal provides a simple and transparent, yet solid and robust, methodological framework connecting decision science to clinical care, a sorely needed missing link between CPGs/CPs and patient outcomes. We therefore advocate that all guidelines panels express their recommendations as CPs, which in turn should be converted into FFTs to guide clinical care. © 2018 John Wiley & Sons, Ltd.

  16. Quality assessment of osteoporosis clinical practice guidelines for physical activity and safe movement: an AGREE II appraisal.

    PubMed

    Armstrong, James Jacob; Rodrigues, Isabel Braganca; Wasiuta, Tom; MacDermid, Joy C

    2016-01-01

    Many osteoporosis clinical practice guidelines are published, and the extent to which physical activity and safe movement is addressed varies. To better inform clinical decision-making, a quality assessment and structured analysis of recommendations was undertaken. Guideline quality varied substantially, and improvement is necessary in physical activity and safe movement recommendations. The purpose of the present study is to survey available osteoporosis clinical practice guidelines (CPGs) containing physical activity and safe movement recommendations in order to assess the methodological quality with which they were developed. An analysis of the various physical activity and safe movement recommendations was conducted to determine variability between CPGs. An online literature search revealed 19 CPGs meeting our inclusion criteria. Three independent scorers evaluated CPG quality using the Appraisal of Guidelines for Research and Evaluation version II (AGREE II) instrument. Two separate individuals used a standard table to extract relevant recommendations. Intra-reviewer AGREE II score agreement ranged from fair to good (intra-class correlation coefficient (ICC) = 0.34 to 0.65). The quality of the 19 included CPGs was variable (AGREE sub-scores: 14 to 100%). CPGs scored higher in the "scope and purpose" and "clarity of presentation" domains. They scored the lowest in "applicability" and "editorial independence." Four CPGs were classified as high quality, ten average quality, and five low quality. Most CPGs recommended weight-bearing, muscle-strengthening, and resistance exercises. Information on exercise dosage, progression, and contraindications was often absent. Immobility and movements involving spinal flexion and/or torsion were discouraged. There were several high-quality CPGs; however, variability in quality and lack of specific parameters for implementation necessitates caution and critical examination by readers. CPG development groups should pay special attention to the clinical applicability of their CPGs as well as fully disclosing conflicts of interest. CPGs were in general an agreement regarding safe physical activity and safe movement recommendations. However, recommendations were often vague and the more specific recommendations were inconsistent between CPGs.

  17. Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for mood disorders.

    PubMed

    Malhi, Gin S; Bassett, Darryl; Boyce, Philip; Bryant, Richard; Fitzgerald, Paul B; Fritz, Kristina; Hopwood, Malcolm; Lyndon, Bill; Mulder, Roger; Murray, Greg; Porter, Richard; Singh, Ajeet B

    2015-12-01

    To provide guidance for the management of mood disorders, based on scientific evidence supplemented by expert clinical consensus and formulate recommendations to maximise clinical salience and utility. Articles and information sourced from search engines including PubMed and EMBASE, MEDLINE, PsycINFO and Google Scholar were supplemented by literature known to the mood disorders committee (MDC) (e.g., books, book chapters and government reports) and from published depression and bipolar disorder guidelines. Information was reviewed and discussed by members of the MDC and findings were then formulated into consensus-based recommendations and clinical guidance. The guidelines were subjected to rigorous successive consultation and external review involving: expert and clinical advisors, the public, key stakeholders, professional bodies and specialist groups with interest in mood disorders. The Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for mood disorders (Mood Disorders CPG) provide up-to-date guidance and advice regarding the management of mood disorders that is informed by evidence and clinical experience. The Mood Disorders CPG is intended for clinical use by psychiatrists, psychologists, physicians and others with an interest in mental health care. The Mood Disorder CPG is the first Clinical Practice Guideline to address both depressive and bipolar disorders. It provides up-to-date recommendations and guidance within an evidence-based framework, supplemented by expert clinical consensus. Professor Gin Malhi (Chair), Professor Darryl Bassett, Professor Philip Boyce, Professor Richard Bryant, Professor Paul Fitzgerald, Dr Kristina Fritz, Professor Malcolm Hopwood, Dr Bill Lyndon, Professor Roger Mulder, Professor Greg Murray, Professor Richard Porter and Associate Professor Ajeet Singh. Professor Carlo Altamura, Dr Francesco Colom, Professor Mark George, Professor Guy Goodwin, Professor Roger McIntyre, Dr Roger Ng, Professor John O'Brien, Professor Harold Sackeim, Professor Jan Scott, Dr Nobuhiro Sugiyama, Professor Eduard Vieta, Professor Lakshmi Yatham. Professor Marie-Paule Austin, Professor Michael Berk, Dr Yulisha Byrow, Professor Helen Christensen, Dr Nick De Felice, A/Professor Seetal Dodd, A/Professor Megan Galbally, Dr Josh Geffen, Professor Philip Hazell, A/Professor David Horgan, A/Professor Felice Jacka, Professor Gordon Johnson, Professor Anthony Jorm, Dr Jon-Paul Khoo, Professor Jayashri Kulkarni, Dr Cameron Lacey, Dr Noeline Latt, Professor Florence Levy, A/Professor Andrew Lewis, Professor Colleen Loo, Dr Thomas Mayze, Dr Linton Meagher, Professor Philip Mitchell, Professor Daniel O'Connor, Dr Nick O'Connor, Dr Tim Outhred, Dr Mark Rowe, Dr Narelle Shadbolt, Dr Martien Snellen, Professor John Tiller, Dr Bill Watkins, Dr Raymond Wu. © The Royal Australian and New Zealand College of Psychiatrists 2015.

  18. Caries preventive measures in orthodontic practice: the development of a clinical practice guideline.

    PubMed

    Oosterkamp, B C M; van der Sanden, W J M; Frencken, J E F M; Kuijpers-Jagtman, A M

    2016-02-01

    White spot lesions (WSLs) are a side effect of orthodontic treatment, causing esthetic problems and a risk of deeper enamel and dentine lesions. Many strategies have been developed for preventing WSLs, but great variability exists in preventive measures between orthodontists. This study developed statements on which a clinical practice guideline (CPG) can be developed in order to help orthodontists select preventive measures based on the best available evidence. A nominal group technique (RAND-e modified Delphi procedure) was used. A multidisciplinary expert panel rated 264 practice- and evidence-based statements related to the management of WSLs. To provide panel members with the same knowledge, a total of six articles obtained from a systematic review of the literature were read by the panel in preparation of three consensus rounds. According to the technique, a threshold of 75% of all ratings within any 3-point section of the 9-point scale regarding a specific statement was accepted as consensus. After the first and second consensus rounds, consensus was reached on 37.5 and 31.1% of statements, respectively. For the remaining 31.4% of statements, consensus was reached during a 4-h consensus meeting. Statements on the management of WSLs derived from a systematic literature review combined with expert opinion were formally integrated toward consensus through a nominal group technique. These statements formed the basis for developing a CPG on the management of WSLs before and during orthodontic treatment. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. The evolution of Reference Drug Lists and Clinical Practice Guidelines in the public health system of a middle-income country

    PubMed Central

    Rico-Alba, Israel; Figueras, Albert

    2014-01-01

    Aims The aims were to analyze the dynamics of the medicines formulary in a middle-income country and to analyze the concordance of the included medicines with the national Clinical Practices Guidelines (CPG). Methods Medicines and their indications of use included in the Mexican Reference Drug List (Mex-RDL) from 1996 to 2013 were analyzed. The top 10 indications with the highest number of medicines in 2013 were analyzed retrospectively until 1996 in order to identify the increase in the number of medicines to treat each one, as well as the progressive specificity of the indication according to the International statistical Classification of Diseases (ICD-10). The concordance between the CPG and medicines approved for the top 10 indications was studied. Results The number of medicines included in the Mex-RDL kept constantly growing from 454 drugs in 1996 to 811 in 2013. Up to 26.3% of these medicines were approved to treat only 10 indications (1.5% of all possible indications of use). Many of these new medicines had been approved for more and more specific indications, while the oldest ones had been approved for general indications. Up to 27.6% of the medicines approved for these top 10 indications do not appear in the updated recommendations of the specific CPG for those indications. Conclusions During the last 18 years, the new medicines and indications included in the Mex-RDL were redundant and concentrated into few similar clinical conditions. This is a factor that promotes an irrational use of these medicines and, thus, unnecessarily raises the price of health care, undermines the quality of the health system and probably increases the uncertainty of treatments. PMID:25099259

  20. The evolution of Reference Drug Lists and Clinical Practice Guidelines in the public health system of a middle-income country.

    PubMed

    Rico-Alba, Israel; Figueras, Albert

    2014-08-01

    The aims were to analyze the dynamics of the medicines formulary in a middle-income country and to analyze the concordance of the included medicines with the national Clinical Practices Guidelines (CPG). Medicines and their indications of use included in the Mexican Reference Drug List (Mex-RDL) from 1996 to 2013 were analyzed. The top 10 indications with the highest number of medicines in 2013 were analyzed retrospectively until 1996 in order to identify the increase in the number of medicines to treat each one, as well as the progressive specificity of the indication according to the International statistical Classification of Diseases (ICD-10). The concordance between the CPG and medicines approved for the top 10 indications was studied. The number of medicines included in the Mex-RDL kept constantly growing from 454 drugs in 1996 to 811 in 2013. Up to 26.3% of these medicines were approved to treat only 10 indications (1.5% of all possible indications of use). Many of these new medicines had been approved for more and more specific indications, while the oldest ones had been approved for general indications. Up to 27.6% of the medicines approved for these top 10 indications do not appear in the updated recommendations of the specific CPG for those indications. During the last 18 years, the new medicines and indications included in the Mex-RDL were redundant and concentrated into few similar clinical conditions. This is a factor that promotes an irrational use of these medicines and, thus, unnecessarily raises the price of health care, undermines the quality of the health system and probably increases the uncertainty of treatments. © 2014 The British Pharmacological Society.

  1. A Clinician-Centered Evaluation of the Usability of AHLTA and Automated Clinical Practice Guidelines at TAMC

    DTIC Science & Technology

    2011-03-31

    evidence based medicine into clinical practice. It will decrease costs and enable multiple stakeholders to work in an open content/source environment to exchange clinical content, develop and test technology and explore processes in applied CDS. Design: Comparative study between the KMR infrastructure and capabilities developed as an open source, vendor agnostic solution for aCPG execution within AHLTA and the current DoD/MHS standard evaluating: H1: An open source, open standard KMR and Clinical Decision Support Engine can enable organizations to share domain

  2. Quality assessment of recent evidence-based clinical practice guidelines for management of type 2 diabetes mellitus in adults using the AGREE II instrument.

    PubMed

    Anwer, Muhammad A; Al-Fahed, Ousama B; Arif, Samir I; Amer, Yasser S; Titi, Maher A; Al-Rukban, Mohammed O

    2018-02-01

    Type 2 diabetes mellitus (T2DM) is a worldwide and national public health problem that has a great impact on the population in Saudi Arabia. High-quality clinical practice guidelines (CPGs) are cornerstones in improving the health care provided for patients with diabetes. This study evaluated the methodological rigour, transparency, and applicability of recently published CPGs. Our group conducted a systematic search for recently published CPGs for T2DM. The searching and screening for Source CPGs were guided by tools from the ADAPTE methods with specific inclusion/exclusion criteria. Five reviewers using the second version of the Appraisal of Guidelines for Research and Evaluation (AGREE II) Instrument independently assessed the quality of the retrieved Source CPGs. Domains of Scope and purpose and Clarity of presentation received the highest scores in all CPGs. Most of the assessed CPGs (86%) were considered with high overall quality and were recommended for use. Rigour of development and applicability domains were together highest in 3 CPGs (43%). The overall high quality of DM CPGs published in the last 3 years demonstrated the continuous development and improvement in CPG methodologies and standards. Health care professionals should consider the quality of any CPG for T2DM before deciding to use it in their daily clinical practice. Three CPGs have been identified, using the AGREE criteria, as high-quality and trustworthy. Ideally, the resources provided by the AGREE trust including the AGREE II Instrument should be used by a clinician to scan through the large number of published T2DM CPGs to identify the CPGs with high methodological quality and applicability. © 2017 John Wiley & Sons, Ltd.

  3. Systematic and transparent inclusion of ethical issues and recommendations in clinical practice guidelines: a six-step approach.

    PubMed

    Mertz, Marcel; Strech, Daniel

    2014-12-04

    Clinical practice guidelines (CPGs), a core tool to foster medical professionalism, differ widely in whether and how they address disease-specific ethical issues (DSEIs), and current manuals for CPG development are silent on this issue. The implementation of an explicit method faces two core challenges: first, it adds further complexity to CPG development and requires human and financial resources. Second, in contrast to the in-depth treatment of ethical issues that is standard in bioethics, the inclusion of DSEIs in CPGs need to be more pragmatic, reductive, and simplistic, but without rendering the resulting recommendations useless or insufficiently justified. This paper outlines a six-step approach, EthicsGuide, for the systematic and transparent inclusion of ethical issues and recommendations in CPGs. The development of EthicsGuide is based on (a) methodological standards in evidence-based CPG development, (b) principles of bioethics, (c) research findings on how DSEIs are currently addressed in CPGs, and (d) findings from two proof-of-concept analyses of the EthicsGuide approach. The six steps are 1) determine the DSEI spectrum and the need for ethical recommendations; 2) develop statements on which to base ethical recommendations; 3) categorize, classify, condense, and paraphrase the statements; 4) write recommendations in a standard form; 5) validate and justify recommendations, making any necessary modifications; and 6) address consent. All six steps necessarily come into play when including DSEIs in CPGs. If DSEIs are not explicitly addressed, they are unavoidably dealt with implicitly. We believe that as ethicists gain greater involvement in decision-making about health, personal rights, or economic issues, they should make their methods transparent and replicable by other researchers; and as ethical issues become more widely reflected in CPGs, CPG developers have to learn how to address them in a methodologically adequate way. The approach proposed should serve as a basis for further discussion on how to reach these goals. It breaks open the black box of what ethicists implicitly do when they develop recommendations. Further, interdisciplinary discussion and pilot tests are needed to explore the minimal requirements that guarantee a simplified procedure which is still acceptable and does not become mere window dressing.

  4. Curricula for teaching clinical practice guidelines in US psychiatry residency and child and adolescent fellowship programs: a survey study.

    PubMed

    Bannister, Elizabeth; Nakonezny, Paul; Byerly, Matthew

    2014-04-01

    To determine the characteristics of curricula for teaching the content of clinical practice guidelines (CPGs) in psychiatric residency and child and adolescent fellowship programs as well as to determine if and how the learning of CPG content is applied in clinical care settings. We conducted a national online survey of directors of general psychiatry residency and child and adolescent fellowship programs in the USA. The survey questionnaire included 13 brief questions about the characteristics used to teach CPGs in the programs, as well as two demographic questions about each program and director. Descriptive statistics were reported for each questionnaire item by program classification (i.e., child and adolescent vs. general psychiatry). The survey response rate was 49.8% (146 out of 293). Just 23% of programs reported having written goals and objectives related to teaching CPGs. The most frequently taught aspect of CPGs was their content (72% of programs). Didactic sessions were the most frequently employed teaching strategy (79% of programs). Regarding the application of CPG learning in treatment care settings, just 16% of programs applied algorithms in care settings, and 15% performed evaluations to determine consistency between CPG recommendations and care delivery. Only 8% of programs utilized audit and feedback to residents about their adherence to CPGs. Faculty time constraints and insufficient interest were the leading barriers (39% and 33% of programs, respectively) to CPG teaching, although 38% reported no barriers. However, child and adolescent programs less commonly identified insufficient interest among faculty as a barrier to teaching CPGs compared to general programs (20% vs. 43%). Moreover, compared to general programs, child and adolescent fellowship programs taught more aspects of CPGs, used more educational activities to teach the content of specific CPGs, and used more methods to evaluate the teaching of CPGs. Although the majority of programs provided some teaching of CPGs, the rigorousness of the teaching approaches was limited, especially attempts to evaluate the extent and effectiveness of their use in clinical care. Child and adolescent fellowship programs provided more extensive teaching and evaluation related to CPGs.

  5. Influence of organizational culture on provider adherence to the diabetic clinical practice guideline: using the competing values framework in Palestinian Primary Healthcare Centers.

    PubMed

    Radwan, Mahmoud; Akbari Sari, Ali; Rashidian, Arash; Takian, Amirhossein; Abou-Dagga, Sanaa; Elsous, Aymen

    2017-01-01

    Diabetes mellitus (DM) is a serious chronic disease and an important public health issue. This study aimed to identify the predominant culture within the Palestinian Primary Healthcare Centers of the Ministry of Health (PHC-MoH) and the Primary Healthcare Centers of the United Nations Relief and Works Agency for Palestine Refugees (PHC-UNRWA) by using the competing values framework (CVF) and examining its influence on the adherence to the Clinical Practice Guideline (CPG) for DM. A cross-sectional design was employed with a census sample of all the Palestinian family doctors and nurses (n=323) who work within 71 PHC clinic. A cross-cultural adaptation framework was followed to develop the Arabic version of the CVF questionnaire. The overall adherence level to the diabetic guideline was disappointingly suboptimal (51.5%, p <0.001; 47.3% in the PHC-MoH and 55.5% in the PHC-UNRWA). In the PHC-MoH, the clan/group culture was the most predominant (mean =41.13; standard deviation [SD] =8.92), followed by hierarchical (mean =33.14; SD=5.96), while in the PHC-UNRWA, hierarchical was the prevailing culture (mean =48.43; SD =12.51), followed by clan/group (mean =29.73; SD =8.37). Although a positively significant association between the adherence to CPG and the rational culture and a negatively significant association with the developmental archetype were detected in the PHC-MoH, no significant associations were found in the PHC-UNRWA. Our study demonstrates that the organizational culture has a marginal influence on the adherence to the diabetic guideline. Future research should preferably mix quantitative and qualitative approaches and explore the use of more sensitive instruments to measure such a complex construct and its effects on guideline adherence in small-sized clinics.

  6. Inclusion of ethical issues in dementia guidelines: a thematic text analysis.

    PubMed

    Knüppel, Hannes; Mertz, Marcel; Schmidhuber, Martina; Neitzke, Gerald; Strech, Daniel

    2013-08-01

    Clinical practice guidelines (CPGs) aim to improve professionalism in health care. However, current CPG development manuals fail to address how to include ethical issues in a systematic and transparent manner. The objective of this study was to assess the representation of ethical issues in general CPGs on dementia care. To identify national CPGs on dementia care, five databases of guidelines were searched and national psychiatric associations were contacted in August 2011 and in June 2013. A framework for the assessment of the identified CPGs' ethical content was developed on the basis of a prior systematic review of ethical issues in dementia care. Thematic text analysis and a 4-point rating score were employed to assess how ethical issues were addressed in the identified CPGs. Twelve national CPGs were included. Thirty-one ethical issues in dementia care were identified by the prior systematic review. The proportion of these 31 ethical issues that were explicitly addressed by each CPG ranged from 22% to 77%, with a median of 49.5%. National guidelines differed substantially with respect to (a) which ethical issues were represented, (b) whether ethical recommendations were included, (c) whether justifications or citations were provided to support recommendations, and (d) to what extent the ethical issues were explained. Ethical issues were inconsistently addressed in national dementia guidelines, with some guidelines including most and some including few ethical issues. Guidelines should address ethical issues and how to deal with them to help the medical profession understand how to approach care of patients with dementia, and for patients, their relatives, and the general public, all of whom might seek information and advice in national guidelines. There is a need for further research to specify how detailed ethical issues and their respective recommendations can and should be addressed in dementia guidelines. Please see later in the article for the Editors' Summary.

  7. Inclusion of Ethical Issues in Dementia Guidelines: A Thematic Text Analysis

    PubMed Central

    Knüppel, Hannes; Schmidhuber, Martina; Neitzke, Gerald

    2013-01-01

    Background Clinical practice guidelines (CPGs) aim to improve professionalism in health care. However, current CPG development manuals fail to address how to include ethical issues in a systematic and transparent manner. The objective of this study was to assess the representation of ethical issues in general CPGs on dementia care. Methods and Findings To identify national CPGs on dementia care, five databases of guidelines were searched and national psychiatric associations were contacted in August 2011 and in June 2013. A framework for the assessment of the identified CPGs' ethical content was developed on the basis of a prior systematic review of ethical issues in dementia care. Thematic text analysis and a 4-point rating score were employed to assess how ethical issues were addressed in the identified CPGs. Twelve national CPGs were included. Thirty-one ethical issues in dementia care were identified by the prior systematic review. The proportion of these 31 ethical issues that were explicitly addressed by each CPG ranged from 22% to 77%, with a median of 49.5%. National guidelines differed substantially with respect to (a) which ethical issues were represented, (b) whether ethical recommendations were included, (c) whether justifications or citations were provided to support recommendations, and (d) to what extent the ethical issues were explained. Conclusions Ethical issues were inconsistently addressed in national dementia guidelines, with some guidelines including most and some including few ethical issues. Guidelines should address ethical issues and how to deal with them to help the medical profession understand how to approach care of patients with dementia, and for patients, their relatives, and the general public, all of whom might seek information and advice in national guidelines. There is a need for further research to specify how detailed ethical issues and their respective recommendations can and should be addressed in dementia guidelines. Please see later in the article for the Editors' Summary PMID:23966839

  8. Variation in Post-Injury Antibiotic Prophylaxis Patterns over Five Years in a Combat Zone

    PubMed Central

    Lloyd, Col Bradley A; Murray, COL Clinton K.; Bradley, William; Shaikh, Faraz; Aggarwal, Deepak; Carson, M. Leigh; Tribble, David R.

    2016-01-01

    In 2008, a clinical practice guideline (CPG) was developed for the prevention of infections among combat casualties and was later revised in 2011. We evaluated utilization of antimicrobials within 48 hours following injury in the combat zone over a five-year period (June 2009–May 2014) with regard to number of regimens, type of antimicrobial, and adherence to the 2011 CPG. The study population consisted of 5196 wounded military personnel. Open fractures and skin and soft-tissue injuries were the most frequent injuries. Closed injuries had the highest overall compliance (83%), while open fractures and maxillofacial injuries had significant improvement in compliance from 2009–2010 (34% and 50%, respectively) to 2013–2014 (73% and 76%; p<0.05). Part of the improvement with open fractures was a significant reduction of expanded Gram-negative coverage (61% received it in 2009–2010 compared to 7% in 2013–2014; p<0.001). Use of Gram-negative coverage with maxillofacial injuries also significantly declined (37% to 12%; p=0.001). Being injured during 2011–2014 compared to 2009–2010 was associated with CPG compliance (p<0.001), while high injury severity scores (≥10) and admission to the intensive care unit in Germany were associated with noncompliance (p<0.001). Our analysis demonstrates an increasing trend toward CPG compliance with significant reduction of expanded Gram-negative coverage. PMID:28291497

  9. Barriers to implementing the "2008 Mexican Clinical Practice Guideline recommendations for the management of hip and knee osteoarthritis" in primary healthcare practice.

    PubMed

    Loyola-Sanchez, Adalberto; Richardson, Julie; Pelaez-Ballestas, Ingris; Sánchez, José Guadalupe; González, Martha Alicia; Sánchez-Cruz, Juan; Jiménez-Baez, María Valeria; Nolasco-Alonso, Nancy; Alvarado, Idolina; Rodríguez-Amado, Jacqueline; Alvarez-Nemegyei, José; Wilson, Mike G

    2014-01-01

    To evaluate the implementability of the "2008 Mexican Clinical Practice Guideline for the management of hip and knee osteoarthritis at the primary level of care" within primary healthcare of three Mexican regions using the Guideline Implementability Appraisal methodology version 2 (GLIA.v2). Six family physicians, representing the South, North, and Central Mexico, and one Mexican physiatrist evaluated the 45 recommendations stated by the Mexican guideline. The GLIA.v2 methodology includes the execution of qualitative and semi-quantitative techniques. Reviewers' agreement was between moderate to near complete in most cases. Sixty-nine percent of the recommendations were considered difficult to implement within clinical practice. Eight recommendations did not have an appropriate format. Only 6 recommendations were judged as able to be consistently applied to clinical practice. Barriers related to the context of one or more institutions/regions were identified in 25 recommendations. These barriers are related to health providers/patients' beliefs, processes of care within each institution, and availability of some treatments recommended by the guideline. The guideline presented problems of conciseness and clarity that negatively affect its application within the Mexican primary healthcare context. We identified individual, organizational and system characteristics, which are common to the 3 institutions/regions studied and constitute barriers for implementing the guideline to clinical practice. It is recommended that the 2008-Mexican-CPG-OA be thoroughly revised and restructured to improve the clarity of the actions implied by each recommendation. We propose some strategies to accomplish this and to overcome some of the identified regional/institutional barriers. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  10. Exposure-based Interventions for the management of individuals with high levels of needle fear across the lifespan: a clinical practice guideline and call for further research

    PubMed Central

    McMurtry, C. Meghan; Taddio, Anna; Noel, Melanie; Antony, Martin M.; Chambers, Christine T.; Asmundson, Gordon J. G.; Pillai Riddell, Rebecca; Shah, Vibhuti; MacDonald, Noni E.; Rogers, Jess; Bucci, Lucie M.; Mousmanis, Patricia; Lang, Eddy; Halperin, Scott; Bowles, Susan; Halpert, Christine; Ipp, Moshe; Rieder, Michael J.; Robson, Kate; Uleryk, Elizabeth; Votta Bleeker, Elizabeth; Dubey, Vinita; Hanrahan, Anita; Lockett, Donna; Scott, Jeffrey

    2016-01-01

    Abstract Needle fear typically begins in childhood and represents an important health-related issue across the lifespan. Individuals who are highly fearful of needles frequently avoid health care. Although guidance exists for managing needle pain and fear during procedures, the most highly fearful may refuse or abstain from such procedures. The purpose of a clinical practice guideline (CPG) is to provide actionable instruction on the management of a particular health concern; this guidance emerges from a systematic process. Using evidence from a rigorous systematic review interpreted by an expert panel, this CPG provides recommendations on exposure-based interventions for high levels of needle fear in children and adults. The AGREE-II, GRADE, and Cochrane methodologies were used. Exposure-based interventions were included. The included evidence was very low quality on average. Strong recommendations include the following. In vivo (live/in person) exposure-based therapy is recommended (vs. no treatment) for children seven years and older and adults with high levels of needle fear. Non-in vivo (imaginal, computer-based) exposure (vs. no treatment) is recommended for individuals (over seven years of age) who are unwilling to undergo in vivo exposure. Although there were no included trials which examined children < 7 years, exposure-based interventions are discussed as good clinical practice. Implementation considerations are discussed and clinical tools are provided. Utilization of these recommended practices may lead to improved health outcomes due to better health care compliance. Research on the understanding and treatment of high levels of needle fear is urgently needed; specific recommendations are provided. PMID:27007463

  11. Exposure-based Interventions for the management of individuals with high levels of needle fear across the lifespan: a clinical practice guideline and call for further research.

    PubMed

    McMurtry, C Meghan; Taddio, Anna; Noel, Melanie; Antony, Martin M; Chambers, Christine T; Asmundson, Gordon J G; Pillai Riddell, Rebecca; Shah, Vibhuti; MacDonald, Noni E; Rogers, Jess; Bucci, Lucie M; Mousmanis, Patricia; Lang, Eddy; Halperin, Scott; Bowles, Susan; Halpert, Christine; Ipp, Moshe; Rieder, Michael J; Robson, Kate; Uleryk, Elizabeth; Votta Bleeker, Elizabeth; Dubey, Vinita; Hanrahan, Anita; Lockett, Donna; Scott, Jeffrey

    2016-04-01

    Needle fear typically begins in childhood and represents an important health-related issue across the lifespan. Individuals who are highly fearful of needles frequently avoid health care. Although guidance exists for managing needle pain and fear during procedures, the most highly fearful may refuse or abstain from such procedures. The purpose of a clinical practice guideline (CPG) is to provide actionable instruction on the management of a particular health concern; this guidance emerges from a systematic process. Using evidence from a rigorous systematic review interpreted by an expert panel, this CPG provides recommendations on exposure-based interventions for high levels of needle fear in children and adults. The AGREE-II, GRADE, and Cochrane methodologies were used. Exposure-based interventions were included. The included evidence was very low quality on average. Strong recommendations include the following. In vivo (live/in person) exposure-based therapy is recommended (vs. no treatment) for children seven years and older and adults with high levels of needle fear. Non-in vivo (imaginal, computer-based) exposure (vs. no treatment) is recommended for individuals (over seven years of age) who are unwilling to undergo in vivo exposure. Although there were no included trials which examined children < 7 years, exposure-based interventions are discussed as good clinical practice. Implementation considerations are discussed and clinical tools are provided. Utilization of these recommended practices may lead to improved health outcomes due to better health care compliance. Research on the understanding and treatment of high levels of needle fear is urgently needed; specific recommendations are provided.

  12. Development of a theory- and evidence-based intervention to enhance implementation of physical therapy guidelines for the management of low back pain

    PubMed Central

    2014-01-01

    Background Systematic planning could improve the generally moderate effectiveness of interventions to enhance adherence to clinical practice guidelines. The aim of our study was to demonstrate how the process of Intervention Mapping was used to develop an intervention to address the lack of adherence to the national CPG for low back pain by Dutch physical therapists. Methods We systematically developed a program to improve adherence to the Dutch physical therapy guidelines for low back pain. Based on multi-method formative research, we formulated program and change objectives. Selected theory-based methods of change and practical applications were combined into an intervention program. Implementation and evaluation plans were developed. Results Formative research revealed influential determinants for physical therapists and practice quality managers. Self-regulation was appropriate because both the physical therapists and the practice managers needed to monitor current practice and make and implement plans for change. The program stimulated interaction between practice levels by emphasizing collective goal setting. It combined practical applications, such as knowledge transfer and discussion-and-feedback, based on theory-based methods, such as consciousness raising and active learning. The implementation plan incorporated the wider environment. The evaluation plan included an effect and process evaluation. Conclusions Intervention Mapping is a useful framework for formative data in program planning in the field of clinical guideline implementation. However, a decision aid to select determinants of guideline adherence identified in the formative research to analyse the problem may increase the efficiency of the application of the Intervention Mapping process. PMID:24428945

  13. Development of a theory- and evidence-based intervention to enhance implementation of physical therapy guidelines for the management of low back pain.

    PubMed

    Rutten, Geert M; Harting, Janneke; Bartholomew, Leona K; Braspenning, Jozé C; van Dolder, Rob; Heijmans, Marcel Fgj; Hendriks, Erik Jm; Kremers, Stef Pj; van Peppen, Roland Ps; Rutten, Steven Tj; Schlief, Angelique; de Vries, Nanne K; Oostendorp, Rob Ab

    2014-01-15

    Systematic planning could improve the generally moderate effectiveness of interventions to enhance adherence to clinical practice guidelines. The aim of our study was to demonstrate how the process of Intervention Mapping was used to develop an intervention to address the lack of adherence to the national CPG for low back pain by Dutch physical therapists. We systematically developed a program to improve adherence to the Dutch physical therapy guidelines for low back pain. Based on multi-method formative research, we formulated program and change objectives. Selected theory-based methods of change and practical applications were combined into an intervention program. Implementation and evaluation plans were developed. Formative research revealed influential determinants for physical therapists and practice quality managers. Self-regulation was appropriate because both the physical therapists and the practice managers needed to monitor current practice and make and implement plans for change. The program stimulated interaction between practice levels by emphasizing collective goal setting. It combined practical applications, such as knowledge transfer and discussion-and-feedback, based on theory-based methods, such as consciousness raising and active learning. The implementation plan incorporated the wider environment. The evaluation plan included an effect and process evaluation. Intervention Mapping is a useful framework for formative data in program planning in the field of clinical guideline implementation. However, a decision aid to select determinants of guideline adherence identified in the formative research to analyse the problem may increase the efficiency of the application of the Intervention Mapping process.

  14. Traumatic brain injury in modern war

    NASA Astrophysics Data System (ADS)

    Ling, Geoffrey S. F.; Hawley, Jason; Grimes, Jamie; Macedonia, Christian; Hancock, James; Jaffee, Michael; Dombroski, Todd; Ecklund, James M.

    2013-05-01

    Traumatic brain injury (TBI) is common and especially with military service. In Iraq and Afghanistan, explosive blast related TBI has become prominent and is mainly from improvised explosive devices (IED). Civilian standard of care clinical practice guidelines (CPG) were appropriate has been applied to the combat setting. When such CPGs do not exist or are not applicable, new practice standards for the military are created, as for TBI. Thus, CPGs for prehospital care of combat TBI CPG [1] and mild TBI/concussion [2] were introduced as was a DoD system-wide clinical care program, the first large scale system wide effort to address all severities of TBI in a comprehensive organized way. As TBI remains incompletely understood, substantial research is underway. For the DoD, leading this effort are The Defense and Veterans Brain Injury Center, National Intrepid Center of Excellence and the Defense Centers of Excellence for Psychological Health and Traumatic Brain Injury. This program is a beginning, a work in progress ready to leverage advances made scientifically and always with the intent of providing the best care to its military beneficiaries.

  15. Impact of quality of evidence on the strength of recommendations: an empirical study

    PubMed Central

    Djulbegovic, Benjamin; Trikalinos, Thomas A; Roback, John; Chen, Ren; Guyatt, Gordon

    2009-01-01

    Background Evidence is necessary but not sufficient for decision-making, such as making recommendations by clinical practice guideline panels. However, the fundamental premise of evidence-based medicine (EBM) rests on the assumed link between the quality of evidence and "truth" and/or correctness in making guideline recommendations. If this assumption is accurate, then the quality of evidence ought to play a key role in making guideline recommendations. Surprisingly, and despite the widespread penetration of EBM in health care, there has been no empirical research to date investigating the impact of quality of evidence on the strength of recommendations made by guidelines panels. Methods The American Association of Blood Banking (AABB) has recently convened a 12 member panel to develop clinical practice guidelines (CPG) for the use of fresh-frozen plasma (FFP) for 6 different clinical indications. The panel was instructed that 4 factors should play a role in making recommendation: quality of evidence, uncertainty about the balance between desirable (benefits) and undesirable effects (harms), uncertainty or variability in values and preferences, and uncertainty about whether the intervention represents a wise use of resources (costs). Each member of the panel was asked to make his/her final judgments on the strength of recommendation and the overall quality of the body of evidence. "Voting" was anonymous and was based on the use of GRADE (Grading quality of evidence and strength of recommendations) system, which clearly distinguishes between quality of evidence and strength of recommendations. Results Despite the fact that many factors play role in formulating CPG recommendations, we show that when the quality of evidence is higher, the probability of making a strong recommendation for or against an intervention dramatically increases. Probability of making strong recommendation was 62% when evidence is "moderate", while it was only 23% and 13% when evidence was "low" or "very low", respectively. Conclusion We report the first empirical evaluation of the relationship between quality of evidence pertinent to a clinical question and strength of the corresponding guideline recommendations. Understanding the relationship between quality of evidence and probability of making (strong) recommendation has profound implications for the science of quality measurement in health care. PMID:19622148

  16. Korean clinical practice guidelines: otitis media in children.

    PubMed

    Lee, Hyo-Jeong; Park, Su-Kyoung; Choi, Kyu Young; Park, Su Eun; Chun, Young Myung; Kim, Kyu-Sung; Park, Shi-Nae; Cho, Yang-Sun; Kim, Young-Jae; Kim, Hyung-Jong; Korean Otologic Society

    2012-08-01

    Acute otitis media (AOM) and otitis media with effusion (OME) are common infections in children, and their diagnosis and treatment have significant impacts on the health of children and the costs of providing national medical care. In 2009, the Korean Otologic Society organized a committee composed of experts in the field of otolaryngology, pediatrics, and family medicine to develop Korean clinical practice guidelines (CPG) for otitis media in children with the goal of meeting regional medical and social needs in Korea. For this purpose, the committee adapted existing guidelines. A comprehensive literature review was carried out primarily from 2004 to 2009 using medical search engines including data from Korea. A draft was written after a national questionnaire survey and several public audits, and it was editorially supervised by senior advisors before publication of the final report. These evidence-based guidelines for the management of otitis media in children provide recommendations to primary practitioners for the diagnosis and treatment of children younger than 15 yr old with uncomplicated AOM and OME. The guidelines include recommendations regarding diagnosis, treatment options, prevention and parent education, medical records, referral, and complementary/alternative medicine for treating pediatric otitis media.

  17. Clinical practice guidelines in breast cancer

    PubMed Central

    Tyagi, N. Kumar; Dhesy-Thind, S.

    2018-01-01

    Background A number of clinical practice guidelines (cpgs) concerning breast cancer (bca) screening and management are available. Here, we review the strengths and weaknesses of cpgs from various professional organizations and consensus groups with respect to their methodologic quality, recommendations, and implementability. Methods Guidelines from four groups were reviewed with respect to two clinical scenarios: adjuvant ovarian function suppression (ofs) in premenopausal women with early-stage estrogen receptor–positive bca, and use of sentinel lymph node biopsy (slnb) after neoadjuvant chemotherapy (nac) for locally advanced bca. Guidelines from the American Society of Clinical Oncology (asco); Cancer Care Ontario’s Program in Evidence Based Care (cco’s pebc); the U.S. National Comprehensive Cancer Network (nccn); and the St. Gallen International Breast Cancer Consensus Conference were reviewed by two independent assessors. Guideline methodology and applicability were evaluated using the agree ii tool. Results The quality of the cpgs was greatest for the guidelines developed by asco and cco’s pebc. The nccn and St. Gallen guidelines were found to have lower scores for methodologic rigour. All guidelines scored poorly for applicability. The recommendations for ofs were similar in three guidelines. Recommendations by the various organizations for the use of slnb after nac were contradictory. Conclusions Our review demonstrated that cpgs can be heterogeneous in methodologic quality. Low-quality cpg implementation strategies contribute to low uptake of, and adherence to, bca cpgs. Further research examining the barriers to recommendations—such as intrinsic guideline characteristics and the needs of end users—is required. The use of bca cpgs can improve the knowledge-to-practice gap and patient outcomes.

  18. The Consolidated Framework for Implementation Research (CFIR): a useful theoretical framework for guiding and evaluating a guideline implementation process in a hospital-based nursing practice.

    PubMed

    Breimaier, Helga E; Heckemann, Birgit; Halfens, Ruud J G; Lohrmann, Christa

    2015-01-01

    Implementing clinical practice guidelines (CPGs) in healthcare settings is a complex intervention involving both independent and interdependent components. Although the Consolidated Framework for Implementation Research (CFIR) has never been evaluated in a practical context, it appeared to be a suitable theoretical framework to guide an implementation process. The aim of this study was to evaluate the comprehensiveness, applicability and usefulness of the CFIR in the implementation of a fall-prevention CPG in nursing practice to improve patient care in an Austrian university teaching hospital setting. The evaluation of the CFIR was based on (1) team-meeting minutes, (2) the main investigator's research diary, containing a record of a before-and-after, mixed-methods study design embedded in a participatory action research (PAR) approach for guideline implementation, and (3) an analysis of qualitative and quantitative data collected from graduate and assistant nurses in two Austrian university teaching hospital departments. The CFIR was used to organise data per and across time point(s) and assess their influence on the implementation process, resulting in implementation and service outcomes. Overall, the CFIR could be demonstrated to be a comprehensive framework for the implementation of a guideline into a hospital-based nursing practice. However, the CFIR did not account for some crucial factors during the planning phase of an implementation process, such as consideration of stakeholder aims and wishes/needs when implementing an innovation, pre-established measures related to the intended innovation and pre-established strategies for implementing an innovation. For the CFIR constructs reflecting & evaluating and engaging, a more specific definition is recommended. The framework and its supplements could easily be used by researchers, and their scope was appropriate for the complexity of a prospective CPG-implementation project. The CFIR facilitated qualitative data analysis and provided a structure that allowed project results to be organised and viewed in a broader context to explain the main findings. The CFIR was a valuable and helpful framework for (1) the assessment of the baseline, process and final state of the implementation process and influential factors, (2) the content analysis of qualitative data collected throughout the implementation process, and (3) explaining the main findings.

  19. A critical review of recent clinical practice guidelines on the diagnosis and treatment of non-neurogenic male lower urinary tract symptoms

    PubMed Central

    Chua, Michael Erlano; Mendoza, Jonathan; See, Manuel; Esmena, Ednalyn; Aguila, Dean; Silangcruz, Jan Michael; Reyes, Buenaventura Jose; Luna, Saturnino; Morales, Marcelino

    2015-01-01

    Introduction: We provide an overview of the quality of recent clinical clinical practice guidelines (CPGs) for non-neurogenic male lower urinary tract symptoms (LUTS) and summarize the recommendations for their diagnosis, assessment, and treatment. Methods: We systematically searched recent (2008–2013) CPGs for non-neurogenic male LUTS. Eligible CPGs were assessed and appraised using Appraisal of Guidelines, Research and Evaluation II (AGREE II) tool by a CPG-appraisal group. The appraisal scores for each guideline were summarized according to each domain and in total. A recommendation summary was made across the guidelines for diagnostics, conservative management, medical, minimally invasive therapy, and surgical management. Results: A total of 8 guidelines were considered. According to AGREE II appraisal of guidelines, the National Institute for Health and Clinical Excellence (NICE), American Urological Association (AUA) and European Association of Urology (EAU) consistently scored high on the guideline domains assessed. Recommendations on diagnostics, conservative management, medical, and surgical management were consistent among the top 3 guidelines. However, we noted a discrepancy in recommending minimally invasive therapy as an alternative management of moderate to severe or bothersome non-neurogenic male LUTS secondary to benign prostatic enlargement (BPE); the NICE guideline, in particular, does not recommend using minimally invasive therapy. Conclusion: The quality of recent CPGs on non-neurogenic male LUTS was appraised and summarized. The guidelines from NICE, AUA and EAU were considered highly compliant to the AGREE II proposition for guideline formation and development. PMID:26279717

  20. A critical review of recent clinical practice guidelines on the diagnosis and treatment of non-neurogenic male lower urinary tract symptoms.

    PubMed

    Chua, Michael Erlano; Mendoza, Jonathan; See, Manuel; Esmena, Ednalyn; Aguila, Dean; Silangcruz, Jan Michael; Reyes, Buenaventura Jose; Luna, Saturnino; Morales, Marcelino

    2015-01-01

    We provide an overview of the quality of recent clinical clinical practice guidelines (CPGs) for non-neurogenic male lower urinary tract symptoms (LUTS) and summarize the recommendations for their diagnosis, assessment, and treatment. We systematically searched recent (2008-2013) CPGs for non-neurogenic male LUTS. Eligible CPGs were assessed and appraised using Appraisal of Guidelines, Research and Evaluation II (AGREE II) tool by a CPG-appraisal group. The appraisal scores for each guideline were summarized according to each domain and in total. A recommendation summary was made across the guidelines for diagnostics, conservative management, medical, minimally invasive therapy, and surgical management. A total of 8 guidelines were considered. According to AGREE II appraisal of guidelines, the National Institute for Health and Clinical Excellence (NICE), American Urological Association (AUA) and European Association of Urology (EAU) consistently scored high on the guideline domains assessed. Recommendations on diagnostics, conservative management, medical, and surgical management were consistent among the top 3 guidelines. However, we noted a discrepancy in recommending minimally invasive therapy as an alternative management of moderate to severe or bothersome non-neurogenic male LUTS secondary to benign prostatic enlargement (BPE); the NICE guideline, in particular, does not recommend using minimally invasive therapy. The quality of recent CPGs on non-neurogenic male LUTS was appraised and summarized. The guidelines from NICE, AUA and EAU were considered highly compliant to the AGREE II proposition for guideline formation and development.

  1. Efficacy of a strategy for implementing a guideline for the control of cardiovascular risk in a primary healthcare setting: the SIRVA2 study a controlled, blinded community intervention trial randomised by clusters

    PubMed Central

    2011-01-01

    This work describes the methodology used to assess a strategy for implementing clinical practice guidelines (CPG) for cardiovascular risk control in a health area of Madrid. Background The results on clinical practice of introducing CPGs have been little studied in Spain. The strategy used to implement a CPG is known to influence its final use. Strategies based on the involvement of opinion leaders and that are easily executed appear to be among the most successful. Aim The main aim of the present work was to compare the effectiveness of two strategies for implementing a CPG designed to reduce cardiovascular risk in the primary healthcare setting, measured in terms of improvements in the recording of calculated cardiovascular risk or specific risk factors in patients' medical records, the control of cardiovascular risk factors, and the incidence of cardiovascular events. Methods This study involved a controlled, blinded community intervention in which the 21 health centres of the Number 2 Health Area of Madrid were randomly assigned by clusters to be involved in either a proposed CPG implementation strategy to reduce cardiovascular risk, or the normal dissemination strategy. The study subjects were patients ≥ 45 years of age whose health cards showed them to belong to the studied health area. The main variable examined was the proportion of patients whose medical histories included the calculation of their cardiovascular risk or that explicitly mentioned the presence of variables necessary for its calculation. The sample size was calculated for a comparison of proportions with alpha = 0.05 and beta = 0.20, and assuming that the intervention would lead to a 15% increase in the measured variables. Corrections were made for the design effect, assigning a sample size to each cluster proportional to the size of the population served by the corresponding health centre, and assuming losses of 20%. This demanded a final sample size of 620 patients. Data were analysed using summary measures for each cluster, both in making estimates and for hypothesis testing. Analysis of the variables was made on an intention-to-treat basis. Trial Registration ClinicalTrials.gov: NCT01270022 PMID:21504570

  2. Initial evaluation of the training programme for health care professionals on the use of Malaysian clinical practice guidelines for management of dementia.

    PubMed

    Yusoff, S; Koh, C T; Mohd Aminuddin, M Y; Krishnasamy, M; Suhaila, M Z

    2013-09-01

    The Malaysian Clinical Practice Guidelines (CPG) for Management of Dementia (second edition) was launched in April 2010 by the Ministry of Health Malaysia. A training programme for the management of dementia, involving all categories of staff working at primary and secondary centres, was implemented to ensure that care delivery for people with dementia was in accordance with the guidelines. The study aimed to look into improving knowledge and understanding of dementia following training, and to evaluate the effectiveness of the training programme using a clinical audit indicator recommended in the guidelines. The study entailed 2 phases (at national and state levels). The first phase involved the CPG training programme run as a 1.5-day workshop, in which participants filled up pre- and post-workshop questionnaires. A second phase involved analysing all the referral letters to the memory clinic at the Hospital Sultan Ismail, Johor Bahru 1 year before and after the training programme. There was a significant improvement in knowledge about dementia and its management among the health care professionals following training. The mean percentage score for the pre-workshop test was 63% while for the post-workshop test it was 78%, giving a difference of 15%. Although there was an overall improvement in knowledge gain following training in both specialist and non-specialist groups, these differences were not statistically significant (t = 1.32; 95% confidence interval, -2.61 to 9.61; p = 0.25). The proportion of referrals with a possible diagnosis of dementia from primary clinic referrals to the memory clinic also increased from 18% to 44% after training. There was an overall improvement in the knowledge about dementia among the health care professionals following the training, which was reflected in the increase in referrals to the memory clinic. Although the initial results appeared to be promising, a multicentre study is warranted to conclude that the training had been effective.

  3. Mapping South African allied health primary care clinical guideline activity: establishing a stakeholder reference sample.

    PubMed

    Dizon, Janine Margarita; Grimmer, Karen; Machingaidze, Shingai; McLaren, Pam; Louw, Quinette

    2016-10-10

    Little is known about allied health (AH) clinical practice guideline (CPG) activity in South Africa, and particularly in relation to primary health care (PHC). This paper reports on a scoping study undertaken to establish a reference framework, from which a comprehensive maximum variation sample could be selected. This was required to underpin robust sampling for a qualitative study aimed at understanding South African primary care AH therapy CPG activities. This paper builds on findings from the South African Guidelines Evaluation (Project SAGE) Flagship grant. South African government websites were searched for structures of departments and portfolios, and available CPGs. Professional AH association websites were searched for CPGs, purposively-identified key informants were interviewed, and CPGs previously identified for priority South African primary care conditions were critiqued for AH therapy involvement. Key informants described potentially complex relationships between players who may be engaged in South African AH CPGs, in both public and private sectors. There were disability/rehabilitation portfolios at national and provincial governments, but no uniformity in provincial government organisation of, or support for, PHC AH services. There were no AH primary care therapy CPGs on government websites, although there was 'clinical guidance' in various forms on professional association websites. Only two CPGs of priority South African PHC conditions included mention of any AH therapy (physiotherapy for adult asthma and chronic obstructive pulmonary disease). A comprehensive and wide-reaching stakeholder reference framework would be required in order to capture the heterogeneity of AH primary care CPG activity in South Africa. This should involve the voices of national and purposively-selected provincial governments, academic institutions, consultants, public sector managers and clinicians, private practitioners, professional associations, and private sector insurers. Provincial governments should be selected to reflect heterogeneity in local economics, population demographics and availability of university AH training programs. This investigation should aim to determine the areas of PHC in which AH are engaged.

  4. Development of clinical practice guidelines for patients with comorbidity and multiple diseases.

    PubMed

    Bernabeu-Wittel, M; Alonso-Coello, P; Rico-Blázquez, M; Rotaeche Del Campo, R; Sánchez Gómez, S; Casariego Vales, E

    2014-01-01

    The management of patients with comorbidity and polypathology represents a challenge for all healthcare systems. Clinical practice guidelines (CPGs) have limitations when applied to this population. The aim of this study is to propose the terminology and methodology for optimally approach comorbidity and polypathology in the CPGs. Based on a literature review, we suggest a number of proposals for the approach in different phases of CPG preparation, with special attention to the inclusion of clusters of comorbidity in the initial questions the implementation of indirect evidence, the burden of disease management for patients and their environment, when establishing recommendations, as well as the strategies of dissemination and implementation. These proposals should be developed in greater depth with the implication of more agents in order to have valid and useful tools for this population. Copyright © 2014 Elsevier España, S.L. All rights reserved.

  5. [Development of clinical practice guidelines for patients with comorbidity and multiple diseases].

    PubMed

    Bernabeu-Wittel, M; Alonso-Coello, P; Rico-Blázquez, M; Rotaeche del Campo, R; Sánchez Gómez, S; Casariego Vales, E

    2014-01-01

    The management of patients with comorbidity and polypathology represents a challenge for all healthcare systems. Clinical practice guidelines (CPGs) have limitations when applied to this population. The aim of this study is to propose the terminology and methodology for optimally approach comorbidity and polypathology in the CPGs. Based on a literature review, we suggest a number of proposals for the approach in different phases of CPG preparation, with special attention to the inclusion of clusters of comorbidity in the initial questions the implementation of indirect evidence, the burden of disease management for patients and their environment, when establishing recommendations, as well as the strategies of dissemination and implementation. These proposals should be developed in greater depth with the implication of more agents in order to have valid and useful tools for this population. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  6. Assessing the Methodological Quality of Glaucoma Clinical Practice Guidelines and Their Recommendations on Microinvasive Glaucoma Surgery: A Systematic Review.

    PubMed

    Michaelov, Evan; Armstrong, James J; Nguyen, Mary; Instrum, Bridget; Lam, Tracey; Denstedt, James; Hutnik, Cindy M L

    2018-02-01

    Clinical practice guidelines (CPG) are regarded by many as critical communications providing guidance within specific medical fields. Over a decade ago, the first microinvasive glaucoma surgical (MIGS) procedures were introduced. Since then, a number of these novel intraocular pressure controlling surgical options have been approved worldwide. Governing bodies and health care administration often utilize CPGs when considering funding for newer technologies. This highlights the importance of well-written, accurate, and up-to-date CPGs in the rapidly evolving field of MIGS. If CPGs are unable to fill this role, their use in treatment decision-making is doing a disservice to patients, who will be denied currently available and potentially superior care. To determine the overall value of a CPG, the methodological quality with which it was developed, in addition to the current relevance and appropriateness of its recommendations, should be evaluated. The objective of the present study was to assess the methodological quality of currently available international glaucoma CPGs, as well as their coverage of MIGS as a surrogate marker of relevance and appropriateness to policy-makers and ophthalmologists alike. To identify potentially relevant CPGs, a predefined search strategy was used to search the following databases: Medline, EMBASE, BIOSIS, and Web of Science. All CPGs related to adult glaucoma and published in English were included. CPG methodological quality was assessed by 3 individuals using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) tool. Studies were then assessed for coverage of MIGS devices and procedures. Search strategy and subsequent screening identified 11 CPGs for analysis. Eight were of high quality according to the AGREE II criteria. Three included basic information on MIGS, but none provided specific recommendations regarding their indications or which patient populations would benefit most. Many international glaucoma CPGs are of high methodological quality. However, coverage of MIGS is sparse, nonspecific and in many instances, absent. This causes CPGs to be a suboptimal source in guiding physicians and health policy-makers in areas characterized by novel and/or rapidly evolving technologies. Mechanisms to incorporate updated evidence in CPGs would have to be considered before they can be used as a source of contemporary clinical decision-making.

  7. Patients' Experiences With Vehicle Collision to Inform the Development of Clinical Practice Guidelines: A Narrative Inquiry.

    PubMed

    Lindsay, Gail M; Mior, Silvano A; Côté, Pierre; Carroll, Linda J; Shearer, Heather M

    2016-01-01

    The purpose of this narrative inquiry was to explore the experiences of persons who were injured in traffic collisions and seek their recommendations for the development of clinical practice guideline (CPG) for the management of minor traffic injuries. Patients receiving care for traffic injuries were recruited from 4 clinics in Ontario, Canada resulting in 11 adult participants (5 men, 6 women). Eight were injured while driving cars, 1 was injured on a motorcycle, 2 were pedestrians, and none caused the collision. Using narrative inquiry methodology, initial interviews were audiotaped, and follow-up interviews were held within 2 weeks to extend the story of experience created from the first interview. Narrative plotlines across the 11 stories were identified, and a composite story inclusive of all recommendations was developed by the authors. The research findings and composite narrative were used to inform the CPG Expert Panel in the development of new CPGs. Four recommended directions were identified from the narrative inquiry process and applied. First, terminology that caused stigma was a concern. This resulted in modified language ("injured persons") being adopted by the Expert Panel, and a new nomenclature categorizing layers of injury was identified. Second, participants valued being engaged as partners with health care practitioners. This resulted in inclusion of shared decision-making as a foundational recommendation connecting CPGs and care planning. Third, emotional distress was recognized as a factor in recovery. Therefore, the importance of early detection and the ongoing evaluation of risk factors for delayed recovery were included in all CPGs. Fourth, participants shared that they were unfamiliar with the health care system and insurance industry before their accident. Thus, repeatedly orienting injured persons to the system was advised. A narrative inquiry of 11 patients' experiences with traffic collision and their recommendations for clinical guidelines informed the Ontario Protocol for Traffic Injury Management Collaboration in the development of new Minor Injury Guidelines. The values and findings of the qualitative inquiry were interwoven into each clinical pathway and embedded within the final guideline report submitted to government. Copyright © 2016 National University of Health Sciences. Published by Elsevier Inc. All rights reserved.

  8. Systematic review of clinical practice guidelines to identify recommendations for rehabilitation after stroke and other acquired brain injuries

    PubMed Central

    Lannin, Natasha A; Hoffmann, Tammy

    2018-01-01

    Objectives Rehabilitation clinical practice guidelines (CPGs) contain recommendation statements aimed at optimising care for adults with stroke and other brain injury. The aim of this study was to determine the quality, scope and consistency of CPG recommendations for rehabilitation covering the acquired brain injury populations. Design Systematic review. Interventions Included CPGs contained recommendations for inpatient rehabilitation or community rehabilitation for adults with an acquired brain injury diagnosis (stroke, traumatic or other non-progressive acquired brain impairments). Electronic databases (n=2), guideline organisations (n=4) and websites of professional societies (n=17) were searched up to November 2017. Two independent reviewers used the Appraisal of Guidelines for Research and Evaluation (AGREE) II instrument, and textual syntheses were used to appraise and compare recommendations. Results From 427 papers screened, 20 guidelines met the inclusion criteria. Only three guidelines were rated high (>75%) across all domains of AGREE-II; highest rated domains were ‘scope and purpose’ (85.1, SD 18.3) and ‘clarity’ (76.2%, SD 20.5). Recommendations for assessment and for motor therapies were most commonly reported, however, varied in the level of detail across guidelines. Conclusion Rehabilitation CPGs were consistent in scope, suggesting little difference in rehabilitation approaches between vascular and traumatic brain injury. There was, however, variability in included studies and methodological quality. PROSPERO registration number CRD42016026936. PMID:29490958

  9. Failure Mode and Effect Analysis (FMEA) may enhance implementation of clinical practice guidelines: An experience from the Middle East.

    PubMed

    Babiker, Amir; Amer, Yasser S; Osman, Mohamed E; Al-Eyadhy, Ayman; Fatani, Solafa; Mohamed, Sarar; Alnemri, Abdulrahman; Titi, Maher A; Shaikh, Farheen; Alswat, Khalid A; Wahabi, Hayfaa A; Al-Ansary, Lubna A

    2018-02-01

    Implementation of clinical practice guidelines (CPGs) has been shown to reduce variation in practice and improve health care quality and patients' safety. There is a limited experience of CPG implementation (CPGI) in the Middle East. The CPG program in our institution was launched in 2009. The Quality Management department conducted a Failure Mode and Effect Analysis (FMEA) for further improvement of CPGI. This is a prospective study of a qualitative/quantitative design. Our FMEA included (1) process review and recording of the steps and activities of CPGI; (2) hazard analysis by recording activity-related failure modes and their effects, identification of actions required, assigned severity, occurrence, and detection scores for each failure mode and calculated the risk priority number (RPN) by using an online interactive FMEA tool; (3) planning: RPNs were prioritized, recommendations, and further planning for new interventions were identified; and (4) monitoring: after reduction or elimination of the failure mode. The calculated RPN will be compared with subsequent analysis in post-implementation phase. The data were scrutinized from a feedback of quality team members using a FMEA framework to enhance the implementation of 29 adapted CPGs. The identified potential common failure modes with the highest RPN (≥ 80) included awareness/training activities, accessibility of CPGs, fewer advocates from clinical champions, and CPGs auditing. Actions included (1) organizing regular awareness activities, (2) making CPGs printed and electronic copies accessible, (3) encouraging senior practitioners to get involved in CPGI, and (4) enhancing CPGs auditing as part of the quality sustainability plan. In our experience, FMEA could be a useful tool to enhance CPGI. It helped us to identify potential barriers and prepare relevant solutions. © 2017 John Wiley & Sons, Ltd.

  10. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    PubMed

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed commentaries. Overall, participants (87.9%; n=51) were supportive of the recommendations provided by the CPG on the utility of SDF testing based on clinical scenarios. The majority of participants made explicit remarks about both the clinical scenarios and SDF assays' characteristics. Among 'not supportive' and 'supportive with reservation' participants, 75% (n=30/40) and 77.5% (n=31/40) expressed concerns related to technical limitations of SDF testing methods and clinical utility of the test in one or more clinical scenarios discussed in the CPG, respectively. The SWOT analysis revealed that the CPG provides a reasonable evidence-based proposal for integration of SDF testing in the routine daily practice. It also uncovered gaps of knowledge and threats limiting the widespread application of SDF in everyday practice, thus allowing the identification of opportunities to further refine SDF testing and its clinical utility. The understanding of the role of SDF in male infertility requires an in-depth analysis of the multifactorial pathophysiological processes and the theories involved. The SWOT analysis allowed an objective evaluation of CPG on the clinical utility of SDF testing based on clinical scenarios and its accompanying commentaries written by global experts in all possible angles. Implementation of SDF testing in the clinic may not only increase the outcome of ART but more importantly improve the health of both fathers to be and resulting offspring.

  11. AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY COMPREHENSIVE CLINICAL PRACTICE GUIDELINES FOR MEDICAL CARE OF PATIENTS WITH OBESITYEXECUTIVE SUMMARYComplete Guidelines available at https://www.aace.com/publications/guidelines.

    PubMed

    Garvey, W Timothy; Mechanick, Jeffrey I; Brett, Elise M; Garber, Alan J; Hurley, Daniel L; Jastreboff, Ania M; Nadolsky, Karl; Pessah-Pollack, Rachel; Plodkowski, Raymond

    2016-07-01

    Development of these guidelines is mandated by the American Association of Clinical Endocrinologists (AACE) Board of Directors and the American College of Endocrinology (ACE) Board of Trustees and adheres to published AACE protocols for the standardized production of clinical practice guidelines (CPGs). Recommendations are based on diligent review of clinical evidence with transparent incorporation of subjective factors. There are 9 broad clinical questions with 123 recommendation numbers that include 160 specific statements (85 [53.1%] strong [Grade A], 48 [30.0%] intermediate [Grade B], and 11 [6.9%] weak [Grade C], with 16 [10.0%] based on expert opinion [Grade D]) that build a comprehensive medical care plan for obesity. There were 133 (83.1%) statements based on strong (best evidence level [BEL] 1 = 79 [49.4%]) or intermediate (BEL 2 = 54 [33.7%]) levels of scientific substantiation. There were 34 (23.6%) evidence-based recommendation grades (Grades A-C = 144) that were adjusted based on subjective factors. Among the 1,788 reference citations used in this CPG, 524 (29.3%) were based on strong (evidence level [EL] 1), 605 (33.8%) were based on intermediate (EL 2), and 308 (17.2%) were based on weak (EL 3) scientific studies, with 351 (19.6%) based on reviews and opinions (EL 4). The final recommendations recognize that obesity is a complex, adiposity-based chronic disease, where management targets both weight-related complications and adiposity to improve overall health and quality of life. The detailed evidence-based recommendations allow for nuanced clinical decision-making that addresses real-world medical care of patients with obesity, including screening, diagnosis, evaluation, selection of therapy, treatment goals, and individualization of care. The goal is to facilitate high-quality care of patients with obesity and provide a rational, scientific approach to management that optimizes health outcomes and safety. A1C = hemoglobin A1c AACE = American Association of Clinical Endocrinologists ACE = American College of Endocrinology AMA = American Medical Association BEL = best evidence level BMI = body mass index CCO = Consensus Conference on Obesity CPG = clinical practice guideline CSS = cross-sectional study CVD = cardiovascular disease EL = evidence level FDA = Food and Drug Administration GERD = gastroesophageal reflux disease HDL-c = high-density lipoprotein cholesterol IFG = impaired fasting glucose IGT = impaired glucose tolerance LDL-c = low-density lipoprotein cholesterol MNRCT = meta-analysis of non-randomized prospective or case-controlled trials NE = no evidence PCOS = polycystic ovary syndrome RCT = randomized controlled trial SS = surveillance study U.S = United States.

  12. The updating of clinical practice guidelines: insights from an international survey

    PubMed Central

    2011-01-01

    Background Clinical practice guidelines (CPGs) have become increasingly popular, and the methodology to develop guidelines has evolved enormously. However, little attention has been given to the updating process, in contrast to the appraisal of the available literature. We conducted an international survey to identify current practices in CPG updating and explored the need to standardize and improve the methods. Methods We developed a questionnaire (28 items) based on a review of the existing literature about guideline updating and expert comments. We carried out the survey between March and July 2009, and it was sent by email to 106 institutions: 69 members of the Guidelines International Network who declared that they developed CPGs; 30 institutions included in the U.S. National Guideline Clearinghouse database that published more than 20 CPGs; and 7 institutions selected by an expert committee. Results Forty-four institutions answered the questionnaire (42% response rate). In the final analysis, 39 completed questionnaires were included. Thirty-six institutions (92%) reported that they update their guidelines. Thirty-one institutions (86%) have a formal procedure for updating their guidelines, and 19 (53%) have a formal procedure for deciding when a guideline becomes out of date. Institutions describe the process as moderately rigorous (36%) or acknowledge that it could certainly be more rigorous (36%). Twenty-two institutions (61%) alert guideline users on their website when a guideline is older than three to five years or when there is a risk of being outdated. Twenty-five institutions (64%) support the concept of "living guidelines," which are continuously monitored and updated. Eighteen institutions (46%) have plans to design a protocol to improve their guideline-updating process, and 21 (54%) are willing to share resources with other organizations. Conclusions Our study is the first to describe the process of updating CPGs among prominent guideline institutions across the world, providing a comprehensive picture of guideline updating. There is an urgent need to develop rigorous international standards for this process and to minimize duplication of effort internationally. PMID:21914177

  13. Evaluation of the acceptability, feasibility and effectiveness of two methods of involving patients with disability in developing clinical guidelines: study protocol of a randomized pragmatic pilot trial.

    PubMed

    Lamontagne, Marie-Eve; Perreault, Kadija; Gagnon, Marie-Pierre

    2014-04-10

    Despite growing interest in the importance of, and challenges associated with the involvement of patient and population (IPP) in the process of developing and adapting clinical practice guidelines (CPGs), there is a lack of knowledge about the best method to use. This is especially problematic in the field of rehabilitation, where individuals with disabilities might face many barriers to their involvement in the guideline development and adaptation process. The goal of this pilot trial is to document the acceptability, feasibility and effectiveness of two methods of involving patients with a disability (traumatic brain injury) in CPG development. A single-blind, randomized, crossover pragmatic trial will be performed with 20 patients with traumatic brain injury (TBI). They will be randomized into two groups, and each will try two alternative methods of producing recommendations; a discussion group (control intervention) and a Wiki, a webpage that can be modified by those who have access to it (experimental intervention). The participants will rate the acceptability of the two methods, and feasibility will be assessed using indicators such as the number of participants who accessed and completed the two methods, and the number of support interventions required. Twenty experts, blinded to the method of producing the recommendations, will independently rate the recommendations produced by the participants for clarity, accuracy, appropriateness and usefulness. Our trial will allow for the use of optimal IPP methods in a larger project of adapting guidelines for the rehabilitation of individuals with TBI. Ultimately the results will inform the science of CPG development and contribute to the growing knowledge about IPP in rehabilitation settings. Clinical trial KT Canada 87776.

  14. Consensus document. Management of non-alcoholic fatty liver disease (NAFLD). Clinical practice guideline.

    PubMed

    Aller, Rocío; Fernández-Rodríguez, Conrado; Lo Iacono, Oreste; Bañares, Rafael; Abad, Javier; Carrión, José Antonio; García-Monzón, Carmelo; Caballería, Joan; Berenguer, Marina; Rodríguez-Perálvarez, Manuel; Miranda, José López; Vilar-Gómez, Eduardo; Crespo, Javier; García-Cortés, Miren; Reig, María; Navarro, José María; Gallego, Rocío; Genescà, Joan; Arias-Loste, María Teresa; Pareja, María Jesús; Albillos, Agustín; Muntané, Jordi; Jorquera, Francisco; Solà, Elsa; Hernández-Guerra, Manuel; Rojo, Miguel Ángel; Salmerón, Javier; Caballería, Llorenc; Diago, Moisés; Molina, Esther; Bataller, Ramón; Romero-Gómez, Manuel

    2018-05-01

    Non-alcoholic fatty liver disease (NAFLD) is the main cause of liver diseases in Spain and the incidence is raising due to the outbreak of type 2 diabetes and obesity. This CPG suggests recommendation about diagnosis, mainly non-invasive biomarkers, and clinical management of this entity. Life-style modifications to achieve weight loss is the main target in the management of NAFLD. Low caloric Mediterranean diet and 200 minutes/week of aerobic exercise are encouraged. In non-responders patients with morbid obesity, bariatric surgery or metabolic endoscopy could be indicated. Pharmacological therapy is indicated in patients with NASH and fibrosis and non-responders to weight loss measures. NAFLD could influence liver transplantation, as a growing indication, the impact of steatosis in the graft viability, de novo NAFLD rate after OLT and a raised cardiovascular risk that modify the management of this entity. The current CPG was the result of the First Spanish NAFLD meeting in Seville. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.

  15. Emergency department management of gastro-enteritis in Australia and New Zealand.

    PubMed

    Schutz, Jacquie; Babl, Franz E; Sheriff, Nisa; Borland, Meredith

    2008-10-01

    Comparison of clinical practice guideline (CPG) recommendations and reported physician management of gastro-enteritis at Paediatric Research in Emergency Departments International Collaborative (PREDICT) network sites as a baseline for further randomised controlled trials. Two part survey comprising: (i) review of CPGs from PREDICT sites for gastro-enteritis; and (ii) survey of senior emergency department physicians regarding the management of gastro-enteritis. All 11 PREDICT sites participated. Nine CPGs were available with three sites using a common CPG. For moderate dehydration, eight CPGs advocated nasogastric (NG) rehydration in preference to intravenous (IV) rehydration. The IV route was reserved for severe dehydration or failed NG rehydration. In the second component of the survey, 78 of 83 (94%) physicians responded. In moderate dehydration, 82% of respondents used NG rehydration. In severe dehydration, 86% used IV fluids; 12% used NG and 3% an initial IV bolus followed by NG fluid. Serum electrolytes were measured universally with IV fluid use and by 22% using NG rehydration. The IV fluid bolus was with normal saline (86%). Fifty-four per cent used anti-emetics 'rarely' or 'sometimes'. The commonest agents were ondansetron (60%) and metoclopramide (29%). CPG recommendations and physician practice for the management of gastro-enteritis were similar across PREDICT sites with a focus on NG for moderate dehydration and IV for severe dehydration. A variety of fluids and administration rates were used. Anti-emetics were used infrequently. The efficacy and safety of newer anti-emetics should be explored in collaborative studies. Collaborative development of new CPGs should be considered to simplify fluid regimens.

  16. Australian general practitioner attitudes to clinical practice guidelines and some implications for translating osteoarthritis care into practice.

    PubMed

    Basedow, Martin; Runciman, William B; Lipworth, Wendy; Esterman, Adrian

    2016-11-01

    Clinical practice guidelines (CPGs) have been shown to improve processes of care and health outcomes, but there is often a discrepancy between recommendations for care and clinical practice. This study sought to explore general practitioner (GP) attitudes towards CPGs, in general and specifically for osteoarthritis (OA), with the implications for translating OA care into practice. A self-administered questionnaire was conducted in January 2013 with a sample of 228 GPs in New South Wales and South Australia. Seventy-nine GPs returned questionnaires (response rate 35%). Nearly all GPs considered that CPGs support decision-making in practice (94%) and medical education (92%). Very few respondents regarded CPGs as a threat to clinical autonomy, and most recognised that individual patient circumstances must be taken into account. Shorter CPG formats were preferred over longer and more comprehensive formats, with preferences being evenly divided among respondents for short, 2-3-page summaries, flowcharts or algorithms and single page checklists. GPs considered accessibility to CPGs to be important, and electronic formats were popular. Familiarity and use of The Royal Australian College of General Practitioners OA Guideline was poor, with most respondents either not aware of it (30%; 95% confidence interval (CI) 27 - 41%), had never used it (19%; 95% CI 12 - 29%) or rarely used it (34%; 95% CI 25-45%). If CPGs are to assist with the translation of evidence into practice, they must be easily accessible and in a format that encourages use.

  17. Strategies to assess the validity of recommendations: a study protocol

    PubMed Central

    2013-01-01

    Background Clinical practice guidelines (CPGs) become quickly outdated and require a periodic reassessment of evidence research to maintain their validity. However, there is little research about this topic. Our project will provide evidence for some of the most pressing questions in this field: 1) what is the average time for recommendations to become out of date?; 2) what is the comparative performance of two restricted search strategies to evaluate the need to update recommendations?; and 3) what is the feasibility of a more regular monitoring and updating strategy compared to usual practice?. In this protocol we will focus on questions one and two. Methods The CPG Development Programme of the Spanish Ministry of Health developed 14 CPGs between 2008 and 2009. We will stratify guidelines by topic and by publication year, and include one CPG by strata. We will develop a strategy to assess the validity of CPG recommendations, which includes a baseline survey of clinical experts, an update of the original exhaustive literature searches, the identification of key references (reference that trigger a potential recommendation update), and the assessment of the potential changes in each recommendation. We will run two alternative search strategies to efficiently identify important new evidence: 1) PLUS search based in McMaster Premium LiteratUre Service (PLUS) database; and 2) a Restrictive Search (ReSe) based on the least number of MeSH terms and free text words needed to locate all the references of each original recommendation. We will perform a survival analysis of recommendations using the Kaplan-Meier method and we will use the log-rank test to analyse differences between survival curves according to the topic, the purpose, the strength of recommendations and the turnover. We will retrieve key references from the exhaustive search and evaluate their presence in the PLUS and ReSe search results. Discussion Our project, using a highly structured and transparent methodology, will provide guidance of when recommendations are likely to be at risk of being out of date. We will also assess two novel restrictive search strategies which could reduce the workload without compromising rigour when CPGs developers check for the need of updating. PMID:23967896

  18. [Clinical practice guideline on bipolar disorder: drug and psychosocial therapy. Asociación Española de Neuropsiquiatría].

    PubMed

    Bravo, Maria Fe; Lahera, Guillermo; Lalucat, Lluis; Fernández-Liria, Alberto

    2013-10-05

    Bipolar disorder is a chronic and recurrent mood disorder, which may severely impact on the patient's global functioning. It has been estimated that approximately 1.6% of the population is affected. A long delay in diagnosis and an excessive disparity in the treatment of these patients have been detected. Within the Quality Plan of the Spanish National Health System, one of the key strategies is to improve clinical practice through the development and use of clinical practice guidelines (CPGs). In this context, the CPG on bipolar disorder arises from an agreement between the Ministry of Health and the University of Alcalá, involving the Spanish Association of Neuropsychiatry as developer and project manager. Its main objective is to develop recommendations on the diagnostic, therapeutic and rehabilitative care for patients with bipolar disorder, primarily applicable in the public mental health services. In this paper we present the main recommendations on pharmacological and psychosocial interventions in bipolar disorder. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  19. Clinical Practice Guideline Implementation Strategy Patterns in Veterans Affairs Primary Care Clinics

    PubMed Central

    Hysong, Sylvia J; Best, Richard G; Pugh, Jacqueline A

    2007-01-01

    Background The Department of Veterans Affairs (VA) mandated the system-wide implementation of clinical practice guidelines (CPGs) in the mid-1990s, arming all facilities with basic resources to facilitate implementation; despite this resource allocation, significant variability still exists across VA facilities in implementation success. Objective This study compares CPG implementation strategy patterns used by high and low performing primary care clinics in the VA. Research Design Descriptive, cross-sectional study of a purposeful sample of six Veterans Affairs Medical Centers (VAMCs) with high and low performance on six CPGs. Subjects One hundred and two employees (management, quality improvement, clinic personnel) involved with guideline implementation at each VAMC primary care clinic. Measures Participants reported specific strategies used by their facility to implement guidelines in 1-hour semi-structured interviews. Facilities were classified as high or low performers based on their guideline adherence scores calculated through independently conducted chart reviews. Findings High performing facilities (HPFs) (a) invested significantly in the implementation of the electronic medical record and locally adapting it to provider needs, (b) invested dedicated resources to guideline-related initiatives, and (c) exhibited a clear direction in their strategy choices. Low performing facilities exhibited (a) earlier stages of development for their electronic medical record, (b) reliance on preexisting resources for guideline implementation, with little local adaptation, and (c) no clear direction in their strategy choices. Conclusion A multifaceted, yet targeted, strategic approach to guideline implementation emphasizing dedicated resources and local adaptation may result in more successful implementation and higher guideline adherence than relying on standardized resources and taxing preexisting channels. PMID:17355583

  20. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios

    PubMed Central

    Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-01-01

    Background Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. Methods A search of papers published in response to the CPG entitled “Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios” was performed within the Translational Andrology and Urology (TAU) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as “supportive without reservation”, “supportive with reservation”, “not supportive” or “neutral”. We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the ‘Strengths-Weaknesses-Opportunities-Threats’ (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Results Fifty-eight fertility experts from six continents and twenty-two countries contributed commentaries. Overall, participants (87.9%; n=51) were supportive of the recommendations provided by the CPG on the utility of SDF testing based on clinical scenarios. The majority of participants made explicit remarks about both the clinical scenarios and SDF assays’ characteristics. Among ‘not supportive’ and ‘supportive with reservation’ participants, 75% (n=30/40) and 77.5% (n=31/40) expressed concerns related to technical limitations of SDF testing methods and clinical utility of the test in one or more clinical scenarios discussed in the CPG, respectively. The SWOT analysis revealed that the CPG provides a reasonable evidence-based proposal for integration of SDF testing in the routine daily practice. It also uncovered gaps of knowledge and threats limiting the widespread application of SDF in everyday practice, thus allowing the identification of opportunities to further refine SDF testing and its clinical utility. Conclusions The understanding of the role of SDF in male infertility requires an in-depth analysis of the multifactorial pathophysiological processes and the theories involved. The SWOT analysis allowed an objective evaluation of CPG on the clinical utility of SDF testing based on clinical scenarios and its accompanying commentaries written by global experts in all possible angles. Implementation of SDF testing in the clinic may not only increase the outcome of ART but more importantly improve the health of both fathers to be and resulting offspring. PMID:29082207

  1. Systematic Review and Quality Appraisal of Practice Guidelines for Self-Harm in Children and Adolescents.

    PubMed

    Courtney, Darren B; Duda, Stephanie; Szatmari, Peter; Henderson, Joanna; Bennett, Kathryn

    2018-05-02

    This study aimed to systematically identify and appraise clinical practice guidelines (CPGs) relating to the assessment and management of suicide risk and self-harm in children and adolescents. Our research question is as follows: For young people (under 18 years old) presenting to clinical care with suicide ideation or a history of self-harm, what is the quality of up-to-date CPGs? Using the PRISMA format, we systematically identified CPGs meeting our inclusion and exclusion criteria. Subsequently, two independent raters conducted appraisals of the eligible CPGs using the Appraisal of Guidelines for Research and Evaluation II instrument. CPGs were then classified as "poor quality," "minimum quality," and "high quality" using operationally defined criteria developed a priori. We identified 10 eligible CPGs published or renewed between 2005 and May 2017. Only the long-term management of self-harm CPGs produced by the National Institute for Health and Care Excellence met "high-quality" criteria. Despite multiple options of CPGs published to choose from, only one was identified as "high quality," where bias is adequately minimized. Clinicians are advised to direct resources to implementing the "high-quality" CPG. © 2018 The American Association of Suicidology.

  2. The military's approach to traumatic brain injury and post-traumatic stress disorder

    NASA Astrophysics Data System (ADS)

    Ling, Geoffrey S. F.; Grimes, Jamie; Ecklund, James M.

    2014-06-01

    Traumatic brain injury (TBI) and Post Traumatic Stress Disorder (PTSD) are common conditions. In Iraq and Afghanistan, explosive blast related TBI became prominent among US service members but the vast majority of TBI was still due to typical causes such as falls and sporting events. PTS has long been a focus of the US military mental health providers. Combat Stress Teams have been integral to forward deployed units since the beginning of the Global War on Terror. Military medical management of disease and injury follows standard of care clinical practice guidelines (CPG) established by civilian counterparts. However, when civilian CPGs do not exist or are not applicable to the military environment, new practice standards are created. Such is the case for mild TBI. In 2009, the VA-DoD CPG for management of mild TBI/concussion was published and a system-wide clinical care program for mild TBI/concussion was introduced. This was the first large scale effort on an entire medical care system to address all severities of TBI in a comprehensive organized way. In 2010, the VA-DoD CPG for management of PTSD was published. Nevertheless, both TBI and PTS are still incompletely understood. Investment in terms of money and effort has been committed by the DoD to their study. The Defense and Veterans Brain Injury Center, National Intrepid Center of Excellence and the Defense Centers of Excellence for Psychological Health and Traumatic Brain Injury are prominent examples of this effort. These are just beginnings, a work in progress ready to leverage advances made scientifically and always striving to provide the very best care to its military beneficiaries.

  3. Clinical practice guidelines within the Southern African development community: a descriptive study of the quality of guideline development and concordance with best evidence for five priority diseases

    PubMed Central

    2012-01-01

    Background Reducing the burden of disease relies on availability of evidence-based clinical practice guidelines (CPGs). There is limited data on availability, quality and content of guidelines within the Southern African Development Community (SADC). This evaluation aims to address this gap in knowledge and provide recommendations for regional guideline development. Methods We prioritised five diseases: HIV in adults, malaria in children and adults, pre-eclampsia, diarrhoea in children and hypertension in primary care. A comprehensive electronic search to locate guidelines was conducted between June and October 2010 and augmented with email contact with SADC Ministries of Health. Independent reviewers used the AGREE II tool to score six quality domains reporting the guideline development process. Alignment of the evidence-base of the guidelines was evaluated by comparing their content with key recommendations from accepted reference guidelines, identified with a content expert, and percentage scores were calculated. Findings We identified 30 guidelines from 13 countries, publication dates ranging from 2003-2010. Overall the 'scope and purpose' and 'clarity and presentation' domains of the AGREE II instrument scored highest, median 58%(range 19-92) and 83%(range 17-100) respectively. 'Stakeholder involvement' followed with median 39%(range 6-75). 'Applicability', 'rigour of development' and 'editorial independence' scored poorly, all below 25%. Alignment with evidence was variable across member states, the lowest scores occurring in older guidelines or where the guideline being evaluated was part of broader primary healthcare CPG rather than a disease-specific guideline. Conclusion This review identified quality gaps and variable alignment with best evidence in available guidelines within SADC for five priority diseases. Future guideline development processes within SADC should better adhere to global reporting norms requiring broader consultation of stakeholders and transparency of process. A regional guideline support committee could harness local capacity to support context appropriate guideline development. PMID:22221856

  4. Management of acute agitation in Hong Kong and comparisons with Australasia.

    PubMed

    Chan, Esther Wai Yin; Tang, Cedric; Lao, Kim Shi Jian; Ling Pong, Leung; Tsui, Matthew Sik Hon; Ho, Hiu Fai; Wong, Gordon Chi Keung; Kong, David Chee Ming; McD Taylor, David; Knott, Jonathan C; Wong, Ian Chi Kei

    2015-12-01

    Little is known about the use of sedation drugs for the management of acute agitation in Hong Kong's Accident and Emergency Departments (AEDs) and how it compares with Australasian practice. The aim of this study was to determine drug preferences, clinicians' perceived confidence in management, barriers/gaps in training and perceived usefulness of existing clinical practice guidelines (CPGs) in Hong Kong. A validated questionnaire was used, with case vignettes typical of patients presenting to AEDs with acute agitation. The questionnaire was distributed by hand to all trainees and fellows of the Hong Kong College of Emergency Medicine (HKCEM). Two reminders were sent. Of 483 HKCEM members, 280 (58.0% [95% CI 53.5-62.3]) responded. For monotherapy, 46.8% (95% CI 41.0-52.6) of respondents chose haloperidol to manage the undifferentiated patient, followed by midazolam (33.9%, 95% CI 28.6-39.7) and diazepam (13.9%, 95% CI 10.4-18.5). Most respondents (83.6%, 95% CI 78.8-87.5) would not administer combination therapy. Respondents were confident in managing agitation overall. The lack of local/institutional CPGs (55.7%, 95% CI 49.9-61.4) was perceived as an important barrier. Institutional guidelines were considered the most useful CPGs (66.4%, 95% CI 60.7-71.7). Most respondents (72.9%, 95% CI 67.4-77.7) perceived a HKCEM endorsed CPG would be useful. Haloperidol and benzodiazepines are frequently used as monotherapy for the management of acute agitation in Hong Kong's AEDs. Management in Hong Kong differs from Australasian practice in that combination therapy is less common and clinicians' choice of sedation drugs are less variable overall. Results suggest that future work on CPG development and training regarding the safe use of combination therapy would be well received. © 2015 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  5. Effectiveness of guideline dissemination and implementation strategies on health care professionals' behaviour and patient outcomes in the cancer care context: a systematic review protocol.

    PubMed

    Tomasone, Jennifer R; Chaudhary, Rushil; Brouwers, Melissa C

    2015-08-25

    Health care professionals (HCPs) are able to make effective decisions regarding patient care through the use of systematically developed clinical practice guidelines (CPGs). These recommendations are especially important in a cancer health care context as patients are exposed to a multitude of interdisciplinary HCPs offering high-quality care throughout diagnosis, treatment, survivorship and palliative care. Although a large number of CPGs targeted towards cancer are widely disseminated, it is unknown whether implementation strategies targeting the use of these guidelines are effective in effecting HCP behaviour and patient outcomes in the cancer care context. The purpose of this systematic review will be to determine the effectiveness of different CPG dissemination and implementation interventions on HCPs' behaviour and patient outcomes in the cancer health care context. Five electronic databases (CINAHL, the Cochrane Controlled Trials Register, MEDLINE via Ovid, EMBASE via Ovid and PsycINFO via Ovid) will be searched to include all studies examining the dissemination and/or implementation of CPGs in a cancer care setting targeting all HCPs. CPG implementation strategies will be included if the CPGs were systematically developed (e.g. literature review/evidence-informed, expert panel, evidence appraisal). The studies will be limited to randomized controlled trials, controlled clinical trials and quasi-experimental (interrupted time series, controlled before-and-after designs) studies. Two independent reviewers will assess articles for eligibility, data extraction and quality appraisal. The aim of this review is to inform cancer care health care professionals and policymakers about evidence-based implementation strategies that will allow for effective use of CPGs. PROSPERO CRD42015019331.

  6. Is traditional Chinese medicine recommended in Western medicine clinical practice guidelines in China? A systematic analysis

    PubMed Central

    Ren, Jun; Li, Xun; Sun, Jin; Han, Mei; Yang, Guo-Yan; Li, Wen-Yuan; Robinson, Nicola; Lewith, George; Liu, Jian-Ping

    2015-01-01

    Background Evidence-based medicine promotes and relies on the use of evidence in developing clinical practice guidelines (CPGs). The Chinese healthcare system includes both traditional Chinese medicine (TCM) and Western medicine, which are expected to be equally reflected in Chinese CPGs. Objective To evaluate the inclusion of TCM-related information in Western medicine CPGs developed in China and the adoption of high level evidence. Methods All CPGs were identified from the China Guideline Clearinghouse (CGC), which is the main Chinese organisation maintaining the guidelines issued by the Ministry of Health of China, the Chinese Medical Association and the Chinese Medical Doctors’ Association. TCM-related contents were extracted from all the CPGs identified. Extracted information comprised the institution issuing the guideline, date of issue, disease, recommendations relating to TCM, evidence level of the recommended content and references supporting the recommendations. Results A total of 604 CPGs were identified, only a small number of which (74/604; 12%) recommended TCM therapy and only five guidelines (7%) had applied evidence grading. The 74 CPGs involved 13 disease systems according to the International Classification of Diseases 10th edition. TCM was mainly recommended in the treatment part of the guidelines (73/74, 99%), and more than half of the recommendations (43/74, 58%) were related to Chinese herbal medicine (single herbs or herbal treatment based on syndrome differentiation). Conclusions Few Chinese Western medicine CPGs recommend TCM therapies and very few provide evidence grading for the TCM recommendation. We suggest that future guideline development should be based on systematic searches for evidence to support CPG recommendations and involve a multidisciplinary approach including TCM expertise. PMID:26041487

  7. Variable methodological quality and use found in systematic reviews referenced in STEMI clinical practice guidelines.

    PubMed

    Scott, Jared; Howard, Benjamin; Sinnett, Philip; Schiesel, Michael; Baker, Jana; Henderson, Patrick; Vassar, Matt

    2017-12-01

    The objective of this study was to assess the methodological quality and clarity of reporting of the systematic reviews (SRs) supporting clinical practice guideline (CPG) recommendations in the management of ST-elevation myocardial infarction (STEMI) across international CPGs. We searched 13 guideline clearinghouses including the National Guideline Clearinghouse and Guidelines International Network (GIN). To meet inclusion criteria CPGs must be pertinent to the management of STEMI, endorsed by a governing body or national organization, and written in English. We retrieved SRs from the reference sections using a combination of keywords and hand searching. Two investigators scored eligible SRs using AMSTAR and PRISMA. We included four CPGs. We extracted 71 unique SRs. These SRs received AMSTAR scores ranging from 1 (low) to 9 (high) on an 11-point scale. All CPGs consistently underperformed in areas including disclosure of funding sources, risk of bias, and publication bias according to AMSTAR. PRISMA checklist completeness ranged from 44% to 96%. The PRISMA scores indicated that SRs did not provide a full search strategy, study protocol and registration, assessment of publication bias or report funding sources. Only one SR was referenced in all four CPGs. All CPGs omitted a large subset of available SRs cited by other guidelines. Our study demonstrates the variable quality of SRs used to establish recommendations within guidelines included in our sample. Although guideline developers have acknowledged this variability, it remains a significant finding that needs to be addressed further. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Is traditional Chinese medicine recommended in Western medicine clinical practice guidelines in China? A systematic analysis.

    PubMed

    Ren, Jun; Li, Xun; Sun, Jin; Han, Mei; Yang, Guo-Yan; Li, Wen-Yuan; Robinson, Nicola; Lewith, George; Liu, Jian-Ping

    2015-06-03

    Evidence-based medicine promotes and relies on the use of evidence in developing clinical practice guidelines (CPGs). The Chinese healthcare system includes both traditional Chinese medicine (TCM) and Western medicine, which are expected to be equally reflected in Chinese CPGs. To evaluate the inclusion of TCM-related information in Western medicine CPGs developed in China and the adoption of high level evidence. All CPGs were identified from the China Guideline Clearinghouse (CGC), which is the main Chinese organisation maintaining the guidelines issued by the Ministry of Health of China, the Chinese Medical Association and the Chinese Medical Doctors' Association.TCM-related contents were extracted from all the CPGs identified. Extracted information comprised the institution issuing the guideline, date of issue, disease, recommendations relating to TCM, evidence level of the recommended content and references supporting the recommendations. A total of 604 CPGs were identified, only a small number of which (74/604; 12%) recommended TCM therapy and only five guidelines (7%) had applied evidence grading. The 74 CPGs involved 13 disease systems according to the International Classification of Diseases 10th edition. TCM was mainly recommended in the treatment part of the guidelines (73/74, 99%), and more than half of the recommendations (43/74, 58%) were related to Chinese herbal medicine (single herbs or herbal treatment based on syndrome differentiation). Few Chinese Western medicine CPGs recommend TCM therapies and very few provide evidence grading for the TCM recommendation. We suggest that future guideline development should be based on systematic searches for evidence to support CPG recommendations and involve a multidisciplinary approach including TCM expertise. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  9. Guidance for updating clinical practice guidelines: a systematic review of methodological handbooks.

    PubMed

    Vernooij, Robin W M; Sanabria, Andrea Juliana; Solà, Ivan; Alonso-Coello, Pablo; Martínez García, Laura

    2014-01-02

    Updating clinical practice guidelines (CPGs) is a crucial process for maintaining the validity of recommendations. Methodological handbooks should provide guidance on both developing and updating CPGs. However, little is known about the updating guidance provided by these handbooks. We conducted a systematic review to identify and describe the updating guidance provided by CPG methodological handbooks and included handbooks that provide updating guidance for CPGs. We searched in the Guidelines International Network library, US National Guidelines Clearinghouse and MEDLINE (PubMed) from 1966 to September 2013. Two authors independently selected the handbooks and extracted the data. We used descriptive statistics to analyze the extracted data and conducted a narrative synthesis. We included 35 handbooks. Most handbooks (97.1%) focus mainly on developing CPGs, including variable degrees of information about updating. Guidance on identifying new evidence and the methodology of assessing the need for an update is described in 11 (31.4%) and eight handbooks (22.8%), respectively. The period of time between two updates is described in 25 handbooks (71.4%), two to three years being the most frequent (40.0%). The majority of handbooks do not provide guidance for the literature search, evidence selection, assessment, synthesis, and external review of the updating process. Guidance for updating CPGs is poorly described in methodological handbooks. This guidance should be more rigorous and explicit. This could lead to a more optimal updating process, and, ultimately to valid trustworthy guidelines.

  10. Variation in the management of hypothetical cases of acute agitation in Australasian emergency departments.

    PubMed

    Chan, Esther W; Taylor, David McD; Knott, Jonathan C; Kong, David C M

    2011-02-01

    To describe the prescribing practice of emergency medicine clinicians in the management of highly agitated patients and to identify perceived barriers to management and the gaps in training. We undertook an anonymous cross-sectional mail survey of the Australasian College for Emergency Medicine (ACEM) members (fellows and advanced trainees) between June and September 2009. A questionnaire including a case vignette of a hypothetical patient and three clinical scenarios was employed to ascertain prescribing practice and assess perceived barriers to management, confidence and the perceived usefulness of existing and future Clinical Practice Guidelines (CPGs). All 2052 ACEM members were surveyed. However, seven had incorrect postal addresses and could not be reached. Of the remaining 2045, 786/2052 (38.3%, 95% CI 36.2-40.5) responses were received. Of the 786 respondents, 783 were practicing clinicians. If monotherapy was chosen, 622/783 (79.4%, 95% CI 76.4-82.2) of respondents preferred midazolam to manage the common scenario where no history was available, followed by haloperidol 45/783 (5.8%, 95% CI 4.3-7.7) and olanzapine 38/783 (4.9%, 95% CI 3.5-6.7). Most respondents 500/783 (63.9%, 95% CI 60.4-67.2) would also administer another sedative (combination therapy). Important perceived barriers to agitation management included lack of both training (352/783 [45.0%, 95% CI 41.4-48.5]) and a national CPG (313/783 [40.0%, 95% CI 36.5-43.5]). Respondents were generally confident in all aspects of management, although relatively fewer trainees were confident in determining dosing. Institutional CPGs were considered most useful for 415/783 (53.0%, 95% CI 49.4-56.5) respondents. If an ACEM-endorsed CPG were to be developed in the future, 634/783 (81.0%, 95% CI 78.0-83.6) respondents would consider this useful. There is considerable variation in the management of hypothetical cases of acute agitation in Australasian EDs. Benzodiazepines and antipsychotics, either alone or in combination, are commonly used. An ACEM-endorsed, Australasian CPG was perceived as useful. © 2010 The Authors. EMA © 2010 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  11. 'How to know what you need to do': a cross-country comparison of maternal health guidelines in Burkina Faso, Ghana and Tanzania.

    PubMed

    Baker, Ulrika; Tomson, Göran; Somé, Mathias; Kouyaté, Bocar; Williams, John; Mpembeni, Rose; Massawe, Siriel; Blank, Antje; Gustafsson, Lars L; Eriksen, Jaran

    2012-04-13

    Initiatives to raise the quality of care provided to mothers need to be given priority in Sub Saharan Africa (SSA). The promotion of clinical practice guidelines (CPGs) is a common strategy, but their implementation is often challenging, limiting their potential impact. Through a cross-country perspective, this study explored CPGs for maternal health in Burkina Faso, Ghana, and Tanzania. The objectives were to compare factors related to CPG use including their content compared with World Health Organization (WHO) guidelines, their format, and their development processes. Perceptions of their availability and use in practice were also explored. The overall purpose was to further the understanding of how to increase CPGs' potential to improve quality of care for mothers in SSA. The study was a multiple case study design consisting of cross-country comparisons using document review and key informant interviews. A conceptual framework to aid analysis and discussion of results was developed, including selected domains related to guidelines' implementability and use by health workers in practice in terms of usability, applicability, and adaptability. The study revealed few significant differences in content between the national guidelines for maternal health and WHO recommendations. There were, however, marked variations in the format of CPGs between the three countries. Apart from the Ghanaian and one of the Tanzanian CPGs, the levels of both usability and applicability were assessed as low or medium. In all three countries, the use of CPGs by health workers in practice was perceived to be limited. Our cross-country study suggests that it is not poor quality of content or lack of evidence base that constitute the major barrier for CPGs to positively impact on quality improvement in maternal care in SSA. It rather emphasises the need to prioritise the format of guidelines to increase their usability and applicability and to consider these attributes together with implementation strategies as integral to their development processes.

  12. Clinical practice guidelines for prophylaxis of venous thomboembolism in cancer patients.

    PubMed

    Frere, Corinne; Farge, Dominique

    2016-09-27

    Symptomatic venous thromboembolism (VTE) occurs 4-7 times more frequently in cancer patients as compared to non-cancer patients. A significant number of risk factors, which can be subcategorised as patient-, cancer- or treatment-related, have been shown to influence the risk of VTE during malignancy and further incorporated in risk-assessment models. Safe and efficient thromboprophylaxis regimens allow substantial decreased in VTE rates, since VTE is most often a largely preventable disease, but thromboprophylaxis remains underused in cancer compared to non-cancer patients. If thromboprophylaxis is warranted in cancer patients undergoing surgery or hospitalised for acute medical illness or with a lower mobility in the absence of contraindications to anticoagulants, its benefit remains controversial in outpatients and may be limited to locally advanced or metastatic pancreatic or lung cancer treated with chemotherapy. The International Initiative on Thrombosis and Cancer-CME free mobile app (ios and android), based on the International Clinical Practice Guidelines (CPG), facilitates their implementation and dissemination of knowledge worldwide so as to improve VTE treatment and prophylaxis in cancer patients.

  13. Tailoring International Pressure Ulcer Prevention Guidelines for Nigeria: A Knowledge Translation Study Protocol.

    PubMed

    Ilesanmi, Rose Ekama; Gillespie, Brigid M; Adejumo, Prisca Olabisi; Chaboyer, Wendy

    2015-07-28

    The 2014 International Pressure Ulcer Prevention (PUP) Clinical Practice Guidelines (CPG) provides the most current evidence based strategies to prevent Pressure Ulcer (PU). The evidence upon which these guidelines have been developed has predominantly been generated from research conducted in developed countries. Some of these guidelines may not be feasible in developing countries due to structural and resource issues; therefore there is a need to adapt these guidelines to the context thus making it culturally acceptable. To present a protocol detailing the tailoring of international PUPCPG into a care bundle for the Nigerian context. Guided by the Knowledge to Action (KTA) framework, a two phased study will be undertaken. In Phase 1, the Delphi technique with stakeholder leaders will be used to review the current PUPCPG, identifying core strategies that are feasible to be adopted in Nigeria. These core strategies will become components of a PUP care bundle. In Phase 2, key stakeholder interviews will be used to identify the barriers, facilitators and potential implementation strategies to promote uptake of the PUP care bundle. A PUP care bundle, with three to eight components is expected to be developed from Phase 1. Implementation strategies to promote adoption of the PUP care bundle into clinical practice in selected Nigerian hospitals, is expected to result from Phase 2. Engagement of key stakeholders and consumers in the project should promote successful implementation and translate into better patient care. Using KTA, a knowledge translation framework, to guide the implementation of PUPCPG will enhance the likelihood of successful adoption in clinical practice. In implementing a PUP care bundle, developing countries face a number of challenges such as the feasibility of its components and the required resources.

  14. AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY GUIDELINES FOR MANAGEMENT OF DYSLIPIDEMIA AND PREVENTION OF CARDIOVASCULAR DISEASE - EXECUTIVE SUMMARYComplete Appendix to Guidelines available at http://journals.aace.com.

    PubMed

    Jellinger, Paul S; Handelsman, Yehuda; Rosenblit, Paul D; Bloomgarden, Zachary T; Fonseca, Vivian A; Garber, Alan J; Grunberger, George; Guerin, Chris K; Bell, David S H; Mechanick, Jeffrey I; Pessah-Pollack, Rachel; Wyne, Kathleen; Smith, Donald; Brinton, Eliot A; Fazio, Sergio; Davidson, Michael; Zangeneh, Farhad; Bush, Michael A

    2017-04-02

    The development of these guidelines is mandated by the American Association of Clinical Endocrinologists (AACE) Board of Directors and American College of Endocrinology (ACE) Board of Trustees and adheres with published AACE protocols for the standardized production of clinical practice guidelines (CPGs). Each Recommendation is based on a diligent review of the clinical evidence with transparent incorporation of subjective factors. The Executive Summary of this document contains 87 Recommendations of which 45 are Grade A (51.7%), 18 are Grade B (20.7%), 15 are Grade C (17.2%), and 9 (10.3%) are Grade D. These detailed, evidence-based recommendations allow for nuance-based clinical decision making that addresses multiple aspects of real-world medical care. The evidence base presented in the subsequent Appendix provides relevant supporting information for Executive Summary Recommendations. This update contains 695 citations of which 202 (29.1 %) are evidence level (EL) 1 (strong), 137 (19.7%) are EL 2 (intermediate), 119 (17.1%) are EL 3 (weak), and 237 (34.1%) are EL 4 (no clinical evidence). This CPG is a practical tool that endocrinologists, other healthcare professionals, regulatory bodies and health-related organizations can use to reduce the risks and consequences of dyslipidemia. It provides guidance on screening, risk assessment, and treatment recommendations for a range of patients with various lipid disorders. These recommendations emphasize the importance of treating low-density lipoprotein cholesterol (LDL-C) in some individuals to lower goals than previously recommended and support the measurement of coronary artery calcium scores and inflammatory markers to help stratify risk. Special consideration is given to patients with diabetes, familial hypercholesterolemia, women, and pediatric patients with dyslipidemia. Both clinical and cost-effectiveness data are provided to support treatment decisions. A1C = hemoglobin A1C ACE = American College of Endocrinology ACS = acute coronary syndrome AHA = American Heart Association ASCVD = atherosclerotic cardiovascular disease ATP = Adult Treatment Panel apo = apolipoprotein BEL = best evidence level CKD = chronic kidney disease CPG = clinical practice guidelines CVA = cerebrovascular accident EL = evidence level FH = familial hypercholesterolemia HDL-C = high-density lipoprotein cholesterol HeFH = heterozygous familial hypercholesterolemia HIV = human immunodeficiency virus HoFH = homozygous familial hypercholesterolemia hsCRP = high-sensitivity C-reactive protein LDL-C = low-density lipoprotein cholesterol Lp-PLA 2 = lipoprotein-associated phospholipase A 2 MESA = Multi-Ethnic Study of Atherosclerosis MetS = metabolic syndrome MI = myocardial infarction NCEP = National Cholesterol Education Program PCOS = polycystic ovary syndrome PCSK9 = proprotein convertase subtilisin/kexin type 9 T1DM = type 1 diabetes mellitus T2DM = type 2 diabetes mellitus TG = triglycerides VLDL-C = very low-density lipoprotein cholesterol.

  15. Quality and consistency of guidelines for the management of mild traumatic brain injury in the emergency department.

    PubMed

    Tavender, Emma J; Bosch, Marije; Green, Sally; O'Connor, Denise; Pitt, Veronica; Phillips, Kate; Bragge, Peter; Gruen, Russell L

    2011-08-01

    The objective was to provide an overview of the recommendations and quality of evidence-based clinical practice guidelines (CPGs) for the emergency management of mild traumatic brain injury (mTBI), with a view to informing best practice and improving the consistency of recommendations. Electronic searches of health databases (MEDLINE, EMBASE, The Cochrane Library, PsycINFO), CPG clearinghouse websites, CPG developer websites, and Internet search engines up to January 2010 were conducted. CPGs were included if 1) they were published in English and freely accessible, 2) their scope included the management of mTBI in the emergency department (ED), 3) the date of last search was within the past 10 years (2000 onward), 4) systematic methods were used to search for evidence, and 5) there was an explicit link between the recommendations and the supporting evidence. Four authors independently assessed the quality of the included CPGs using the Appraisal of Guidelines, Research and Evaluation (AGREE) Instrument. The authors extracted and categorized recommendations according to initial clinical assessment, imaging, management, observation, discharge planning, and patient information and follow-up. The search identified 18 potential CPGs, of which six met the inclusion criteria. The included CPGs varied in scope, target population, size, and guideline development processes. Four CPGs were assessed as "strongly recommended." The majority of CPGs did not provide information about the level of stakeholder involvement (mean AGREE standardized domain score = 57%, range = 25% to 81%), nor did they address the organizational/cost implications of applying the recommendations or provide criteria for monitoring and review of recommendations in practice (mean AGREE standardized domain score = 46.6%, range = 19% to 94%). Recommendations were mostly consistent in terms of the use of the Glasgow Coma Scale (GCS) score (adult and pediatric) to assess the level of consciousness, initial assessment criteria, the use of computed tomography (CT) scanning as imaging investigation of choice, and the provision of patient information. The CPGs defined mTBI in a variety of ways and described different rules to determine the need for CT scanning and therefore used different criteria to identify high-risk patients. Higher-quality CPGs for mTBI are consistent in their recommendations about assessment, imaging, and provision of patient information. There is not, however, an agreed definition of mTBI, and the quality of future CPGs could be improved with better reporting of stakeholder involvement, procedures for updating, and greater consideration of the applicability of the recommendations (cost implications, monitoring procedures). Nevertheless, guideline developers may benefit from adapting existing CPGs to their local context rather than investing in developing CPGs de novo. © 2011 by the Society for Academic Emergency Medicine.

  16. Creating a multidisciplinary low back pain guideline: anatomy of a guideline adaptation process.

    PubMed

    Harstall, Christa; Taenzer, Paul; Angus, Donna K; Moga, Carmen; Schuller, Tara; Scott, N Ann

    2011-08-01

    A collaborative, multidisciplinary guideline adaptation process was developed to construct a single overarching, evidence-based clinical practice guideline (CPG) for all primary care practitioners responsible for the management of low back pain (LBP) to curb the use of ineffective treatments and improve patient outcomes. The adaptation strategy, which involved multiple committees and partnerships, leveraged existing knowledge transfer connections to recruit guideline development group (GDG) members and ensure that all stakeholders had a voice in the guideline development process. Videoconferencing was used to coordinate the large, geographically dispersed GDG. Information services and health technology assessment experts were used throughout the process to lighten the GDG's workload. The GDG reviewed seven seed guidelines and drafted an Alberta-specific guideline during 10 half-day meetings over a 12-month period. The use of ad hoc subcommittees to resolve uncertainties or disagreements regarding evidence interpretation expedited the process. Challenges were encountered in dealing with subjectivity, guideline appraisal tools, evidence source limitations and inconsistencies, and the lack of sophisticated evidence analysis inherent in guideline adaptation. Strategies for overcoming these difficulties are discussed. Guideline adaptation is useful when resources are limited and good-quality seed CPGs exist. The Ambassador Program successfully utilized existing stakeholder interest to create an overarching guideline that aligned guidance for LBP management across multiple primary care disciplines. Unforeseen challenges in guideline adaptation can be overcome with credible seed guidelines, a consistently applied and transparent methodology, and clear documentation of the subjective contextualization process. Multidisciplinary stakeholder input and an open, trusting relationship among all contributors will ensure that the end product is clinically meaningful. © 2010 Blackwell Publishing Ltd.

  17. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Quality Assessment of Clinical Practice Guidelines Developed by Professional Societies in Turkey.

    PubMed

    Yaşar, Ilknur; Kahveci, Rabia; Baydar Artantaş, Aylin; Ayhan Başer, Duygu; Gökşin Cihan, Fatma; Şencan, Irfan; Koç, Esra Meltem; Özkara, Adem

    2016-01-01

    Clinical practice guidelines (CPGs) are systematically developed statements to assist practitioner and patient decisions about appropriate healthcare for specific clinical circumstances. There is a limited number of studies on guidelines in Turkey. The quality of Ministry of Health guidelines have formerly been assessed whereas there is no information on the other guidelines developed in the country. This study aims to assess the quality of CPGs that are developed by professional societies that work for the health sector in Turkey, and compare the findings with international guidelines. Professional societies that work for the health sector were determined by using the data obtained from the Ministry of Internal Affairs. Inclusion and exclusion criteria were defined for selecting the CPGs. Guidelines containing recommendations about disease management to the doctors, accessible online, developed within the past 5 years, citing references for recommendations, about the diseases over 1% prevalence according to the "Statistical Yearbook of Turkey 2012" were included in the study. The quality of CPGs were assessed with the AGREE II instrument, which is an internationally recognized tool for this purpose. Four independent reviewers, who did not participate in the development of the selected guidelines and were trained in CPG appraisal, used the AGREE instrument for assessment of the selected guidelines. 47 professional societies were defined which provided access to CPGs in their websites; 3 of them were only open to members so these could not be reached. 8 CPGs from 7 societies were selected from a total of 401 CPGs from 44 societies. The mean scores of the domains of the guidelines which were assessed by the AGREE II tool were; 64%, stakeholder involvement: 37.9%, rigour of development: 35.3%, clarity and presentation: 77.9%, applicability: 49.0% and editorial independence: 46.0%. This is the first study in Turkey regarding quality appraisal of guidelines developed by the local professional societies. It adds to the limited amount of information in the literature that comes from Turkey as well as other developing countries.

  19. A Systematic Review and Appraisal of Clinical Practice Guidelines for Musculoskeletal Soft Tissue Injuries and Conditions.

    PubMed

    Pincus, Daniel; Kuhn, John E; Sheth, Ujash; Rizzone, Katie; Colbenson, Kristi; Dwyer, Tim; Karpinos, Ashley; Marks, Paul H; Wasserstein, David

    2017-05-01

    Clinical practice guidelines (CPGs) are published by several sports medicine institutions. A systematic evaluation can help identify the highest quality CPGs for clinical use and identify any deficiencies that remain. To identify and appraise CPGs relevant to clinical sports medicine professionals. Systematic review. Predetermined selection criteria were utilized by 2 reviewers who independently identified published CPGs before January 1, 2014. CPGs were excluded if they focused on injured workers, radiological criteria, medical pathology, or the axial skeleton (back/neck). The remaining guidelines were scored by 6 reviewers with different clinical backgrounds using the Appraisal of Guidelines for Research and Evaluation II (AGREE II). Scores lower than 50% indicated deficiency. Scores were also stratified by the publishing institution and anatomic location and compared using Kruskal-Wallis tests. The Spearman correlation coefficient was used to assess the range of interobserver agreement between the evaluators. Seventeen CPGs met the inclusion criteria. The majority of guidelines pertained to the knee, ankle, or shoulder. Interobserver agreement was strong ( r = 0.548-0.740), and mean total scores between nonsurgical (107.8) and surgical evaluators (109.3) were not statistically different. Overall guideline quality was variable but not deficient for 16 of 17 guidelines (>50%), except regarding clinical "applicability" and "editorial independence." No difference was found between CPGs of the knee, shoulder, foot/ankle, or chronic conditions. However, CPG publishing institutions had significantly different scores; the American Academy of Orthopaedic Surgeons (AAOS) guidelines scored significantly higher (141.4) than the total mean score (108.0). The overall quality of sports medicine CPGs was variable but generally not deficient, except regarding applicability and editorial independence. Bias through poor editorial independence is a concern. To improve future guideline quality, authors should pay particular attention to these areas and use existing highest quality guidelines, or the AGREE II instrument, as templates. CPGs dedicated to anatomic areas other than the knee, ankle, and shoulder are needed.

  20. 76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

  1. The transcultural diabetes nutrition algorithm: a canadian perspective.

    PubMed

    Gougeon, Réjeanne; Sievenpiper, John L; Jenkins, David; Yale, Jean-François; Bell, Rhonda; Després, Jean-Pierre; Ransom, Thomas P P; Camelon, Kathryn; Dupre, John; Kendall, Cyril; Hegazi, Refaat A; Marchetti, Albert; Hamdy, Osama; Mechanick, Jeffrey I

    2014-01-01

    The Transcultural Diabetes Nutrition Algorithm (tDNA) is a clinical tool designed to facilitate implementation of therapeutic lifestyle recommendations for people with or at risk for type 2 diabetes. Cultural adaptation of evidence-based clinical practice guidelines (CPG) recommendations is essential to address varied patient populations within and among diverse regions worldwide. The Canadian version of tDNA supports and targets behavioural changes to improve nutritional quality and to promote regular daily physical activity consistent with Canadian Diabetes Association CPG, as well as channelling the concomitant management of obesity, hypertension, dyslipidemia, and dysglycaemia in primary care. Assessing glycaemic index (GI) (the ranking of foods by effects on postprandial blood glucose levels) and glycaemic load (GL) (the product of mean GI and the total carbohydrate content of a meal) will be a central part of the Canadian tDNA and complement nutrition therapy by facilitating glycaemic control using specific food selections. This component can also enhance other metabolic interventions, such as reducing the need for antihyperglycaemic medication and improving the effectiveness of weight loss programs. This tDNA strategy will be adapted to the cultural specificities of the Canadian population and incorporated into the tDNA validation methodology.

  2. The Transcultural Diabetes Nutrition Algorithm: A Canadian Perspective

    PubMed Central

    Sievenpiper, John L.; Jenkins, David; Yale, Jean-François; Bell, Rhonda; Després, Jean-Pierre; Ransom, Thomas P. P.; Dupre, John; Kendall, Cyril; Hegazi, Refaat A.; Marchetti, Albert; Hamdy, Osama; Mechanick, Jeffrey I.

    2014-01-01

    The Transcultural Diabetes Nutrition Algorithm (tDNA) is a clinical tool designed to facilitate implementation of therapeutic lifestyle recommendations for people with or at risk for type 2 diabetes. Cultural adaptation of evidence-based clinical practice guidelines (CPG) recommendations is essential to address varied patient populations within and among diverse regions worldwide. The Canadian version of tDNA supports and targets behavioural changes to improve nutritional quality and to promote regular daily physical activity consistent with Canadian Diabetes Association CPG, as well as channelling the concomitant management of obesity, hypertension, dyslipidemia, and dysglycaemia in primary care. Assessing glycaemic index (GI) (the ranking of foods by effects on postprandial blood glucose levels) and glycaemic load (GL) (the product of mean GI and the total carbohydrate content of a meal) will be a central part of the Canadian tDNA and complement nutrition therapy by facilitating glycaemic control using specific food selections. This component can also enhance other metabolic interventions, such as reducing the need for antihyperglycaemic medication and improving the effectiveness of weight loss programs. This tDNA strategy will be adapted to the cultural specificities of the Canadian population and incorporated into the tDNA validation methodology. PMID:24550982

  3. The US Public Health Service "treating tobacco use and dependence clinical practice guidelines" as a legal standard of care.

    PubMed

    Torrijos, Randy M; Glantz, Stanton A

    2006-12-01

    The important factors in evaluating the role of clinical practice guidelines (CPGs) in medical malpractice litigation have been discussed for several years, but have focused on broad policy implications rather than on a concrete example of how an actual guideline might be evaluated. There are four items that need to be considered in negligence torts: legal duty, a breach of that duty, causal relationship between breach and injury, and damages. To identify the arguments related to legal duty. The Treating Tobacco Use and Dependence (revised 2000) CPG, sponsored by the US Public Health Service, recommends effective and inexpensive treatments for nicotine addiction, the largest preventable cause of death in the US, and can be used as an example to focus on important considerations about the appropriateness of CPGs in the judicial system. Furthermore, the failure of many doctors and hospitals to deal with tobacco use and dependence raises the question of whether this failure could be considered malpractice, given the Public Health Service guideline's straightforward recommendations, their efficacy in preventing serious disease and cost-effectiveness. Although each case of medical malpractice depends on a multitude of factors unique to individual cases, a court could have sufficient basis to find that the failure to adequately treat the main cause of preventable disease and death in the US qualifies as a violation of the legal duty that doctors and hospitals owe to patients habituated to tobacco use and dependence.

  4. Aligning Documentation With Congenital Muscular Torticollis Clinical Practice Guidelines: Administrative Case Report.

    PubMed

    Gutierrez, Dennis; Kaplan, Sandra L

    2016-01-01

    A hospital-based pediatric outpatient center, wanting to weave evidence into practice, initiated an update of knowledge, skills, and documentation patterns with its staff physical therapists and occupational therapists who treat people with congenital muscular torticollis (CMT). This case report describes 2 cycles of implementation: (1) the facilitators and barriers to implementation and (2) selected quality improvement outcomes aligned with published clinical practice guidelines (CPGs). The Pediatric Therapy Services of St Joseph's Regional Medical Center in New Jersey has 4 full-time, 1 part-time, and 3 per diem staff. Chart audits in 2012 revealed variations in measurement, interventions, and documentation that led to quality improvement initiatives. An iterative process, loosely following the knowledge-to-action cycle, included a series of in-service training sessions to review the basic anatomy, pathokinesiology, and treatment strategies for CMT; reading assignments of the available CPGs; journal review; documentation revisions; and training on the recommended measurements to implement 2 published CPGs and measure outcomes. A previous 1-page generic narrative became a 3-page CMT-specific form aligned with the American Physical Therapy Association Section on Pediatrics CMT CPG recommendations. Staff training on the Face, Legs, Activity, Cry, Consolability (FLACC) pain scale, classification of severity, type of CMT, prognostication, measures of cervical range of motion, and developmental progression improved documentation consistency from 0% to 81.9% to 100%. Clinicians responded positively to using the longer initial evaluation form. Successful implementation of both clinical and documentation practices were facilitated by a multifaceted approach to knowledge translation that included a culture supportive of evidence-based practice, administrative support for training and documentation redesign, commitment by clinicians to embrace changes aimed at improved care, and clinical guidelines that provide implementable recommendations. © 2016 American Physical Therapy Association.

  5. Tools developed and disseminated by guideline producers to promote the uptake of their guidelines.

    PubMed

    Flodgren, Gerd; Hall, Amanda M; Goulding, Lucy; Eccles, Martin P; Grimshaw, Jeremy M; Leng, Gillian C; Shepperd, Sasha

    2016-08-22

    The uptake of clinical practice guidelines (CPGs) is inconsistent, despite their potential to improve the quality of health care and patient outcomes. Some guideline producers have addressed this problem by developing tools to encourage faster adoption of new guidelines. This review focuses on the effectiveness of tools developed and disseminated by guideline producers to improve the uptake of their CPGs. To evaluate the effectiveness of implementation tools developed and disseminated by guideline producers, which accompany or follow the publication of a CPG, to promote uptake. A secondary objective is to determine which approaches to guideline implementation are most effective. We searched the Cochrane Effective Practice and Organisation of Care (EPOC) Group Specialised Register, Cochrane Central Register of Controlled Trials (CENTRAL); NHS Economic Evaluation Database, HTA Database; MEDLINE and MEDLINE In-Process and other non-indexed citations; Embase; PsycINFO; CINAHL; Dissertations and Theses, ProQuest; Index to Theses; Science Citation Index Expanded, ISI Web of Knowledge; Conference Proceedings Citation Index - Science, ISI Web of Knowledge; Health Management Information Consortium (HMIC), and NHS Evidence up to February 2016. We also searched trials registers, reference lists of included studies and relevant websites. We included randomised controlled trials (RCTs) and cluster-RCTs, controlled before-and-after studies (CBAs) and interrupted time series (ITS) studies evaluating the effects of guideline implementation tools developed by recognised guideline producers to improve the uptake of their own guidelines. The guideline could target any clinical area. Two review authors independently extracted data and assessed the risk of bias of each included study using the Cochrane 'Risk of bias' criteria. We graded our confidence in the evidence using the approach recommended by the GRADE working group. The clinical conditions targeted and the implementation tools used were too heterogenous to combine data for meta-analysis. We report the median absolute risk difference (ARD) and interquartile range (IQR) for the main outcome of adherence to guidelines. We included four cluster-RCTs that were conducted in the Netherlands, France, the USA and Canada. These studies evaluated the effects of tools developed by national guideline producers to implement their CPGs. The implementation tools evaluated targeted healthcare professionals; none targeted healthcare organisations or patients.One study used two short educational workshops tailored to barriers. In three studies the intervention consisted of the provision of paper-based educational materials, order forms or reminders, or both. The clinical condition, type of healthcare professional, and behaviour targeted by the CPG varied across studies.Two of the four included studies reported data on healthcare professionals' adherence to guidelines. A guideline tool developed by the producers of a guideline probably leads to increased adherence to the guidelines; median ARD (IQR) was 0.135 (0.115 and 0.159 for the two studies respectively) at an average four-week follow-up (moderate certainty evidence), which indicates a median 13.5% greater adherence to guidelines in the intervention group. Providing healthcare professionals with a tool to improve implementation of a guideline may lead to little or no difference in costs to the health service. Implementation tools developed by recognised guideline producers probably lead to improved healthcare professionals' adherence to guidelines in the management of non-specific low back pain and ordering thyroid-function tests. There are limited data on the relative costs of implementing these interventions.There are no studies evaluating the effectiveness of interventions targeting the organisation of care (e.g. benchmarking tools, costing templates, etc.), or for mass media interventions. We could not draw any conclusions about our second objective, the comparative effectiveness of implementation tools, due to the small number of studies, the heterogeneity between interventions, and the clinical conditions that were targeted.

  6. Integration of clinical practice guidelines into a distributed regional electronic patient record for tumour-patients using XML: a means for standardization of the treatment processes.

    PubMed

    Mludek, V; Wolff, A C; Drings, P; van der Haak, M; Haux, R; Wannenmacher, M; Zierhut, D

    2001-01-01

    With the rising efforts to guarantee a high quality treatment in medicine and to reduce the costs in the health care system, Clinical Practice Guidelines (CPG) have developed into a very important reference in medicine. CPGs are especially useful for the standardization of multi-professional treatment processes like the care for patients with malignant diseases. The Tumour-Centre Heidelberg/Mannheim (Germany) leads a project to build up a regional, virtual distributed Electronic Patient Record (EPR) for patients with malignant diseases in the Rhein-Neckar-Area. Aims of the first stages of the project are the introduction of the distributed EPR to two co-operating pilot-clinics. In this context we intend to provide access for medical professionals not only to the data of the jointly treated patients, but also to relevant existing CPGs and other medical knowledge sources like Medline and Cochrane-Library. Knowledge and Patient data should be interlinked to offer patient-specific views on the CPG-information. As all professions have different information needs, this views should be presented individualized according to the demands of the users. We analysed three relevant CPGs and defined a meta-structure that will be refined to a common meta-structure for CPGs in Oncology. CPGs as well as structured patient-documents will be implemented in the Extensible Markup Language (XML), as this platform-independent technology seems to suit our needs for data exchange and presentation purposes best. The implementation process will be accompanied tightly with evaluations to gain experience for further expansions of the EPR. The vision of the project is, that by integrating CPGs in a shared distributed EPR, the way towards standardized treatment processes in a local, but multi-professional setting, and the efforts to guarantee a high quality treatment in Oncology can sufficiently be supported.

  7. Idiopathic granulomatous lobular mastitis - report of 43 cases from iran; introducing a preliminary clinical practice guideline.

    PubMed

    Omranipour, Ramesh; Mohammadi, S-Farzad; Samimi, Parisa

    2013-12-01

    We aimed to report a large series of idiopathic granulomatous lobular mastitis (IGLM) from Iran and sketch preliminary clinical practice guidelines (CPG) for approaching an inflammatory breast mass. In a retrospective records review, 43 consecutive IGLM cases were studied. Data on baseline, clinical, imaging, and pathologic characteristics were collected. The mean age of the women was 33.5 years. All but 1 were married and had given birth. 16% had a cancer-like presentation. Inflammatory signs, architectural distortion, and a nodular pattern were the most common findings clinically, mammographically and ultrasonographically, respectively. 29.5% of the pathological reports indicated necrosis which was more common in younger subjects (p = 0.016); microabscesses were associated with a shorter lactation course (p = 0.006). Corticosteroids had been used as the initial treatment modality in 51%, immunosuppressive agents had not been administered, and a 16% relapse rate was recorded. We recognized the need for a multidisciplinary approach covering radiology, oncology, and surgery to best handle diagnostic and therapeutic issues and manage relevant infections as well as the major differential diagnosis, i.e. malignancy. We hypothesized that a shorter lactation period may cause more milk stasis and extravasation and be contributory to IGLM. CPGs are needed to incorporate the needed multidisciplinary approach and to standardize IGLM care. We present one such guideline.

  8. Idiopathic Granulomatous Lobular Mastitis – Report of 43 Cases from Iran; Introducing a Preliminary Clinical Practice Guideline

    PubMed Central

    Omranipour, Ramesh; Mohammadi, S-Farzad; Samimi, Parisa

    2013-01-01

    Summary Background We aimed to report a large series of idiopathic granulomatous lobular mastitis (IGLM) from Iran and sketch preliminary clinical practice guidelines (CPG) for approaching an inflammatory breast mass. Patients and Methods In a retrospective records review, 43 consecutive IGLM cases were studied. Data on baseline, clinical, imaging, and pathologic characteristics were collected. Results The mean age of the women was 33.5 years. All but 1 were married and had given birth. 16% had a cancer-like presentation. Inflammatory signs, architectural distortion, and a nodular pattern were the most common findings clinically, mammographically and ultrasonographically, respectively. 29.5% of the pathological reports indicated necrosis which was more common in younger subjects (p = 0.016); microabscesses were associated with a shorter lactation course (p = 0.006). Corticosteroids had been used as the initial treatment modality in 51%, immunosuppressive agents had not been administered, and a 16% relapse rate was recorded. We recognized the need for a multidisciplinary approach covering radiology, oncology, and surgery to best handle diagnostic and therapeutic issues and manage relevant infections as well as the major differential diagnosis, i.e. malignancy. Conclusion We hypothesized that a shorter lactation period may cause more milk stasis and extravasation and be contributory to IGLM. CPGs are needed to incorporate the needed multidisciplinary approach and to standardize IGLM care. We present one such guideline. PMID:24550752

  9. Autoimmune liver diseases in the Asia-Pacific region: Proceedings of APASL symposium on AIH and PBC 2016.

    PubMed

    Tanaka, Atsushi; Ma, Xiong; Yokosuka, Osamu; Weltman, Martin; You, Hong; Amarapurkar, Deepak N; Kim, Yoon Jun; Abbas, Zaigham; Payawal, Diana A; Chang, Ming-Ling; Efe, Cumali; Ozaslan, Ersan; Abe, Masanori; Mitchell-Thain, Robert; Zeniya, Mikio; Han, Kwang Hyub; Vierling, John M; Takikawa, Hajime

    2016-11-01

    During the 25th annual meeting of the Asia-Pacific Association for the Study of the Liver (APASL 2016) in Tokyo, we organized and moderated an inaugural satellite symposium on the autoimmune liver diseases, autoimmune hepatitis (AIH) and primary biliary cholangitis (PBC). Following the keynote lecture by John M. Vierling (USA), speakers from the Asia-Pacific region provided an up-to-date perspective on the epidemiology, clinical practice and research in AIH and PBC in the Asia-Pacific region. Although epidemiology and clinical features of AIH seem to be similar in East Asia compared to those in western countries, the majority of patients with AIH are detected at an advanced stage and have higher mortality rates in South Asia, indicating an unmet need for earlier diagnosis and the initiation of appropriate immunosuppressive treatment. PBC is more commonly seen in Australia and East Asia. As of 2016, clinical practice guidelines (CPG) for PBC have been published in Japan and China. Ursodeoxycholic acid (UDCA) is recommended as a first-line therapy by both CPG. Nevertheless, one of the unmet therapeutic needs in PBC is the treatment of patients refractory to or intolerant of UDCA. It is of interest that the prevalence of chronic hepatitis B (CHB) in PBC patients was low in Taiwan and mainland China where the prevalence of CHB is very high. In this review, we overview this exciting and epoch-making symposium.

  10. The U.K. NICE 2014 Guidelines for Osteoarthritis of the Knee: Lessons Learned in a Narrative Review Addressing Inadvertent Limitations and Bias.

    PubMed

    Birch, Stephen; Lee, Myeong Soo; Robinson, Nicola; Alraek, Terje

    2017-04-01

    Several systematic reviews suggest that acupuncture is effective for knee osteoarthritis (OA), and furthermore a safe and cost-effective treatment for this condition. A recent clinical practice guideline (CPG) from the National Institute for Health and Care Excellence (NICE), in the United Kingdom, recommended against the use of acupuncture on the grounds that the effect size (ES) in comparison with sham acupuncture is too small. Safety data were not considered in the review, in addition the levels of evidence for acupuncture against other recommended therapies were not compared. Consequently, it is argued that this NICE guideline has limitations that lead to several potential biases in its evaluation of acupuncture, which were not addressed correctly: (1) NICE's prior scoping process limited its review. (2) NICE introduced the method of developing recommendations based on the consideration of which interventions make "minimal important differences" of an ES of 0.5 or greater, rather than the statistical significance of the effect of an intervention when compared with an appropriate comparison. (3) Evidence that sham acupuncture is not physiologically inert and has some level of beneficial effect, hence artificially reducing the magnitude of the ES in comparison with sham. (4) The low adverse effects profile of acupuncture. (5) Evidence from trials comparing acupuncture with usual or standard care was not considered, nor was cost-effectiveness data. (6) Lack of the usual CPG "head-to-head" comparisons between interventions. If the same criteria and methods that have been applied to acupuncture were applied to other NICE-recommended therapies for knee OA, including patient centeredness, patient education, self-management and weight loss, nonsteroidal anti-inflammatory drug (NSAIDs), and cyclooxygenase-2 inhibitor (COX-2 inhibitors), these too would no longer be recommended and opiates would become the first line of drug prescription. Given the problems with sham acupuncture, perhaps now is the time to embrace pragmatic studies and employ comparative effectiveness studies instead.

  11. [Therapeutic education didactic techniques].

    PubMed

    Valverde, Maite; Vidal, Mercè; Jansa, Margarida

    2012-10-01

    This article includes an introduction to the role of Therapeutic Education for Diabetes treatment according to the recommendations of the American Diabetes Association (ADA), the Diabetes Education Study Group (DESG) of the "European Association for Study of Diabetes (EASD) and the clinical Practice Guidelines (CPG) of the Spanish Ministry of Health. We analyze theoretical models and the differences between teaching vs. learning as well as current trends (including Internet), that can facilitate meaningful learning of people with diabetes and their families and relatives. We analyze the differences, similarities, advantages and disadvantages of individual and group education. Finally, we describe different educational techniques (metaplan, case method, brainstorming, role playing, games, seminars, autobiography, forums, chats,..) applicable to individual, group or virtual education and its application depending on the learning objective.

  12. Knowledge, attitude and practice of ministry of health primary health care physicians in the management of type 2 diabetes mellitus: a cross-sectional study in the Al Hasa District of Saudi Arabia, 2010.

    PubMed

    Khan, A R; Al Abdul Lateef, Z Nase; Khamseen, Ma B; Al Aithan, M A; Khan, S A; Al Ibrahim, I

    2011-01-01

    To assess the Knowledge Attitude and Practice (KAP) of MOH Primary Health Care Physician in the management of Type 2 Diabetes Mellitus (DM). A cross sectional survey was conduced between April and October 2010 on MOH Primary Health Care physicians working in Al Hasa district of Saudi Arabia by filling up of pre-tested specially designed questionnaires focused on Knowledge, Attitude and practice towards Type 2 DM patients. The answers were scored by assigning marks. A SPSS 18 was used for statistical analysis. The mean of overall KAP score (± SD) for all the respondents were 66.59 ± 8.82 (Maximum 100). Male physicians scored better than the females physicians (66.90, P=.018 Vs 64.67, P=.018) and the same was true with the rural physicians who scored higher (68.65 ± 10.19, P=.003) than the urban physicians (65.34 ± 7.36, P=.003).The main weakness of knowledge was on epidemiology of Diabetes Mellitus (DM). 28.3 % (n=28) of physicians didn't know the correct diagnostic criteria of Type 2 DM and only 34.7% physicians knew the correct angle of insulin injection. 86.8% (n=86) of the physicians did not agree that Diabetic Self Management Education (DSME) is an essential part of diabetic care. The mean overall KAP score was significantly higher for physicians with 1-5 years of experience (70.16, P=<.05)) than those with more than 5 years of practice (P=<.05). This difference was found in all the segments of KAP. Overall KAP score of those GPs who had a copy of Clinical practice guidelines (CPG) in their clinic was 70.90 ± 10.94 which was higher than KAP Score of those GPs who did not have a copy of CPG (65.10 ± 7.01, P=.005). Checking patients' ability to manage their diabetes, checking blood pressure, eye exam, lipids , serum creatinine, baseline ECG, chest X ray and serum electrolyte were the best followed tests while foot exam and urinary protein were performed more often than recommended in the guideline. Serum HbAc1 was the most delayed test. This study explored several aspects of diabetes related KAP of Ministry of Health appointed GPs and identified the need for improvement in their knowledge, attitude and practices for treating Type 2 DM patients.

  13. Analyses of Magnetic Resonance Imaging of Cerebrospinal Fluid Dynamics Pre and Post Short and Long-Duration Space Flights

    NASA Technical Reports Server (NTRS)

    Alperin, Noam; Barr, Yael; Lee, Sang H.; Mason,Sara; Bagci, Ahmet M.

    2015-01-01

    Preliminary results are based on analyses of data from 17 crewmembers. The initial analysis compares pre to post-flight changes in total cerebral blood flow (CBF) and craniospinal CSF flow volume. Total CBF is obtained by summation of the mean flow rates through the 4 blood vessels supplying the brain (right and left internal carotid and vertebral arteries). Volumetric flow rates were obtained using an automated lumen segmentation technique shown to have 3-4-fold improved reproducibility and accuracy over manual lumen segmentation (6). Two cohorts, 5 short-duration and 8 long-duration crewmembers, who were scanned within 3 to 8 days post landing were included (4 short-duration crewmembers with MRI scans occurring beyond 10 days post flight were excluded). The VIIP Clinical Practice Guideline (CPG) classification is being used initially as a measure for VIIP syndrome severity. Median CPG scores of the short and long-duration cohorts were similar, 2. Mean preflight total CBF for the short and long-duration cohorts were similar, 863+/-144 and 747+/-119 mL/min, respectively. Percentage CBF changes for all short duration crewmembers were 11% or lower, within the range of normal physiological fluctuations in healthy individuals. In contrast, in 4 of the 8 long-duration crewmembers, the change in CBF exceeded the range of normal physiological fluctuation. In 3 of the 4 subjects an increase in CBF was measured. Large pre to post-flight changes in the craniospinal CSF flow volume were found in 6 of the 8 long-duration crewmembers. Box-Whisker plots of the CPG and the percent CBF and CSF flow changes for the two cohorts are shown in Figure 4. Examples of CSF flow waveforms for a short and two long-duration (CPG 0 and 3) are shown in Figure 5. Changes in CBF and CSF flow dynamics larger than normal physiological fluctuations were observed in the long-duration crewmembers. Changes in CSF flow were more pronounced than changes in CBF. Decreased CSF flow dynamics were observed in a subject with VIIP signs. Study limitations include a slightly longer landing-to-MRI scan period for the short-duration cohort and limited sensitivity of the subjective discrete ordinal CPG scale. This limitation can be overcome by using imaging based parametric measures of VIIP severity such as globe deformation measures.

  14. Quality Assessment of Clinical Practice Guidelines Developed by Professional Societies in Turkey

    PubMed Central

    Yaşar, Ilknur; Kahveci, Rabia; Baydar Artantaş, Aylin; Ayhan Başer, Duygu; Gökşin Cihan, Fatma; Şencan, Irfan; Koç, Esra Meltem; Özkara, Adem

    2016-01-01

    Background Clinical practice guidelines (CPGs) are systematically developed statements to assist practitioner and patient decisions about appropriate healthcare for specific clinical circumstances. There is a limited number of studies on guidelines in Turkey. The quality of Ministry of Health guidelines have formerly been assessed whereas there is no information on the other guidelines developed in the country. Aim This study aims to assess the quality of CPGs that are developed by professional societies that work for the health sector in Turkey, and compare the findings with international guidelines. Methodology Professional societies that work for the health sector were determined by using the data obtained from the Ministry of Internal Affairs. Inclusion and exclusion criteria were defined for selecting the CPGs. Guidelines containing recommendations about disease management to the doctors, accessible online, developed within the past 5 years, citing references for recommendations, about the diseases over 1% prevalence according to the “Statistical Yearbook of Turkey 2012” were included in the study. The quality of CPGs were assessed with the AGREE II instrument, which is an internationally recognized tool for this purpose. Four independent reviewers, who did not participate in the development of the selected guidelines and were trained in CPG appraisal, used the AGREE instrument for assessment of the selected guidelines. Findings 47 professional societies were defined which provided access to CPGs in their websites; 3 of them were only open to members so these could not be reached. 8 CPGs from 7 societies were selected from a total of 401 CPGs from 44 societies. The mean scores of the domains of the guidelines which were assessed by the AGREE II tool were; Scope and purpose: 64%, stakeholder involvement: 37.9%, rigour of development: 35.3%, clarity and presentation: 77.9%, applicability: 49.0% and editorial independence: 46.0%. Conclusion This is the first study in Turkey regarding quality appraisal of guidelines developed by the local professional societies. It adds to the limited amount of information in the literature that comes from Turkey as well as other developing countries. PMID:27295303

  15. The AAHKS Clinical Research Award: What Are the Costs of Knee Osteoarthritis in the Year Prior to Total Knee Arthroplasty?

    PubMed

    Bedard, Nicholas A; Dowdle, Spencer B; Anthony, Christopher A; DeMik, David E; McHugh, Michael A; Bozic, Kevin J; Callaghan, John J

    2017-09-01

    Despite American Academy of Orthopaedic Surgeons Clinical Practice Guidelines (CPGs) related to the non-arthroplasty management of osteoarthritis (OA) of the knee, non-recommended treatments remain in common use. We sought to determine the costs associated with non-arthroplasty management of knee OA in the year prior to total knee arthroplasty (TKA) and stratify them by CPG recommendation status. The Humana database was reviewed from 2007 to 2015 for primary TKA patients. Costs for hyaluronic acid (HA) and corticosteroid injections, physical therapy, braces, wedge insoles, opioids, non-steroidal anti-inflammatories, and tramadol in the year prior to TKA were calculated. Cost was defined as reimbursement paid by the insurance provider. Costs were analyzed relative to the overall non-inpatient costs for knee OA and categorized based on CPG recommendations. In total 86,081 primary TKA patients were analyzed and 65.8% had at least one treatment in the year prior to TKA. Treatments analyzed made up 57.6% of the total non-inpatient cost of knee OA in the year prior to TKA. Only 3 of the 8 treatments studied have a strong recommendation for their use (physical therapy, non-steroidal anti-inflammatories, tramadol) and costs for these interventions represented 12.2% of non-inpatient knee OA cost. In contrast, 29.3% of the costs are due to HA injections alone, which are not supported by CPGs. In the year prior to TKA, over half of the non-inpatient costs associated with knee OA are from injections, therapy, prosthetics, and prescriptions. Approximately 30% of this is due to HA injections alone. If only interventions recommend by the CPG are utilized then costs associated with knee OA could be decreased by 45%. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. [Using routine data for quality of care assessments: a critical review, taking quality indicators for the "National Disease Management Guideline for Chronic Heart Failure" as an example].

    PubMed

    Laux, Gunter; Nothacker, Monika; Weinbrenner, Susanne; Störk, Stefan; Blozik, Eva; Peters-Klimm, Frank; Szecsenyi, Jürgen; Scherer, Martin

    2011-01-01

    In December 2009, the first version of the German Disease Management Guideline (DM-CPG) for chronic heart failure was completed, including a set of proposed quality indicators for heart failure. This article explores whether proposed indicators can be derived from data collected routinely in general practices. For this purpose, previous experiences and data from the research project CONTENT (CONTinuous morbidity registration Epidemiologic NeTwork) conducted under guidance of the Department of General Medicine and Health Services Research at the University of Heidelberg, Germany, were applied. The availability of numerators and denominators needed for calculating the four quality indicators for diagnosis and pharmacotherapy proposed in the DM-CPG was checked within so-called "routine data" from the existing dataset of the CONTENT project. Within the given context, routine data are defined as data that are periodically transmitted from health care providers to cost units within the health care system. A thorough assessment has revealed that within the given context only one indicator could be deduced from routine data collection. This was the indicator measuring the proportion of patients receiving beta receptor antagonists, compared to all patients with heart failure NYHA class II to IV. Indeed, this single indicator will only be computable if the NYHA grade of heart failure severity and the presence or absence of contraindications to beta receptor antagonist therapy are routinely collected and the data merged into a central database. Against the background of these results it is obvious that a fully developed, transsectoral concept for data collection and data transfer needs to be implemented.

  17. First-order logic theory for manipulating clinical practice guidelines applied to comorbid patients: a case study.

    PubMed

    Michalowski, Martin; Wilk, Szymon; Tan, Xing; Michalowski, Wojtek

    2014-01-01

    Clinical practice guidelines (CPGs) implement evidence-based medicine designed to help generate a therapy for a patient suffering from a single disease. When applied to a comorbid patient, the concurrent combination of treatment steps from multiple CPGs is susceptible to adverse interactions in the resulting combined therapy (i.e., a therapy established according to all considered CPGs). This inability to concurrently apply CPGs has been shown to be one of the key shortcomings of CPG uptake in a clinical setting1. Several research efforts are underway to address this issue such as the K4CARE2 and GuideLine INteraction Detection Assistant (GLINDA)3 projects and our previous research on applying constraint logic programming to developing a consistent combined therapy for a comorbid patient4. However, there is no generalized framework for mitigation that effectively captures general characteristics of the problem while handling nuances such as time and ordering requirements imposed by specific CPGs. In this paper we propose a first-order logic-based (FOL) approach for developing a generalized framework of mitigation. This approach uses a meta-algorithm and entailment properties to mitigate (i.e., identify and address) adverse interactions introduced by concurrently applied CPGs. We use an illustrative case study of a patient suffering from type 2 diabetes being treated for an onset of severe rheumatoid arthritis to show the expressiveness and robustness of our proposed FOL-based approach, and we discuss its appropriateness as the basis for the generalized theory.

  18. The US Public Health Service “treating tobacco use and dependence clinical practice guidelines” as a legal standard of care

    PubMed Central

    Torrijos, Randy M; Glantz, Stanton A

    2006-01-01

    Background The important factors in evaluating the role of clinical practice guidelines (CPGs) in medical malpractice litigation have been discussed for several years, but have focused on broad policy implications rather than on a concrete example of how an actual guideline might be evaluated. There are four items that need to be considered in negligence torts: legal duty, a breach of that duty, causal relationship between breach and injury, and damages. Objective To identify the arguments related to legal duty. Results The Treating Tobacco Use and Dependence (revised 2000) CPG, sponsored by the US Public Health Service, recommends effective and inexpensive treatments for nicotine addiction, the largest preventable cause of death in the US, and can be used as an example to focus on important considerations about the appropriateness of CPGs in the judicial system. Furthermore, the failure of many doctors and hospitals to deal with tobacco use and dependence raises the question of whether this failure could be considered malpractice, given the Public Health Service guideline's straightforward recommendations, their efficacy in preventing serious disease and cost‐effectiveness. Conclusion Although each case of medical malpractice depends on a multitude of factors unique to individual cases, a court could have sufficient basis to find that the failure to adequately treat the main cause of preventable disease and death in the US qualifies as a violation of the legal duty that doctors and hospitals owe to patients habituated to tobacco use and dependence. PMID:17130373

  19. 76 FR 24493 - Statement of Organization, Functions, and Delegations of Authority

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-02

    ... reorganization of the Laboratory Science, Policy, and Practice Program Office, Office of Surveillance... Laboratory Policy and Practice (CPGB), Laboratory Science, Policy, and Practice Program Office (CPG), and...

  20. Prevention of venous thromboembolism in long term care: results of a multicenter educational intervention using clinical practice guidelines: part 2 of 2 (an AMDA Foundation project).

    PubMed

    Dharmarajan, T S; Nanda, Aman; Agarwal, Bikash; Agnihotri, Parag; Doxsie, G L; Gokula, Murthy; Javaheri, Ashkan; Kanagala, M; Lebelt, Anna S; Madireddy, Prasuna; Mahapatra, Sourya; Murakonda, P; Muthavarapu, S Ram Rao; Patel, Mennakshi; Patterson, Christopher; Soch, Kathleen; Troncales, Anna; Yaokim, Kamal; Kroft, Robin; Norkus, Edward P

    2012-03-01

    Implementation of prophylaxis for venous thomboembolism (VTE) through risk assessment based on clinical practice guidelines (CPGs) is variably adopted in long term care facilities (LTCF). Current guidelines recommend venous thromboembolism prophylaxis (VTE-P) following risk assessment, individualized to patient status. In LTCF, differing comorbidity, life-expectancy, ethical, and quality-of-life issues may warrant a unique approach. This article examines VTE-P practices in LTCF before and after educational intervention to bring practice patterns consistent with CPGs. Phase 1 (preceding article in this issue) identified current practice to assess risk and implement VTE-P (17 geographically diverse LTCFs, 3260 total beds). Phase 2 (educational intervention using CPGs) and Phase 3 (outcomes) reexamined VTE-P at the same 17 centers. The frequency of indications for VTE-P and contraindications to anticoagulation were similar during Phases 1 and 3 (all P > .05). In Phase 3, use of aspirin alone decreased more than 50% (P < .0005), whereas use of compression devices increased (P < .0005). Regression models predicted no relationship between any indication or contraindication and VTE-P in Phase 1 (all P > .05) but identified significant relationships between indication and contraindications and VTE-P in Phase 3 (P = .022 to P < .0005), suggesting adequate understanding of current CPGs following education as the basis for improved VTE-P. The study confirms the presence of significant comorbidity in LTC residents, many with indications for VTE-P, some with contraindications for anticoagulation. Following educational intervention, more residents received VTE-P, influenced by risk-benefit ratio favoring treatment. These findings suggest that even a modest educational intervention significantly improves provider knowledge pertinent to risk assessment consistent with CPG and more appropriate VTE-P. Copyright © 2012 American Medical Directors Association, Inc. Published by Elsevier Inc. All rights reserved.

  1. Implementation strategies for guidelines at ICUs: a systematic review.

    PubMed

    Jordan, Portia; Mpasa, Ferestas; Ten Ham-Baloyi, Wilma; Bowers, Candice

    2017-05-08

    Purpose The purpose of this paper is to critically analyze empirical studies related to the implementation strategies for clinical practice guidelines (CPGs) in intensive care units (ICUs). Design/methodology/approach A systematic review with a narrative synthesis adapted from Popay et al.'s method for a narrative synthesis was conducted. A search using CINAHL, Google Scholar, Academic search complete, Cochrane Register for Randomized Controlled Trials, MEDLINE via PUBMED and grey literature was conducted in 2014 and updated in 2016 (August). After reading the abstracts, titles and full-text articles, 11 ( n=11) research studies met the inclusion criteria. Findings After critical appraisal, using the Joanna Briggs Critical Appraisal Tools, eight randomized controlled trials conducted in adult and neonatal ICUs using implementation strategies remained. Popay et al.'s method for narrative synthesis was adapted and used to analyze and synthesize the data and formulate concluding statements. Included studies found that multi-faceted strategies appear to be more effective than single strategies. Strategies mostly used were printed educational materials, information/ sessions, audit, feedback, use of champion leaders, educational outreach visits, and computer or internet usage. Practical training, monitoring visits and grand rounds were less used. Practical implications Findings can be used by clinicians to implement the best combination of multi-faceted implementation strategies in the ICUs in order to enhance the optimal use of CPGs. Originality/value No systematic review was previously done on the implementation strategies that should be used best for optimal CPG implementation in the ICU.

  2. Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

    PubMed Central

    Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

    2016-01-01

    We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

  3. Multi-Targeted Antithrombotic Therapy for Total Artificial Heart Device Patients.

    PubMed

    Ramirez, Angeleah; Riley, Jeffrey B; Joyce, Lyle D

    2016-03-01

    To prevent thrombotic or bleeding events in patients receiving a total artificial heart (TAH), agents have been used to avoid adverse events. The purpose of this article is to outline the adoption and results of a multi-targeted antithrombotic clinical procedure guideline (CPG) for TAH patients. Based on literature review of TAH anticoagulation and multiple case series, a CPG was designed to prescribe the use of multiple pharmacological agents. Total blood loss, Thromboelastograph(®) (TEG), and platelet light-transmission aggregometry (LTA) measurements were conducted on 13 TAH patients during the first 2 weeks of support in our institution. Target values and actual medians for postimplant days 1, 3, 7, and 14 were calculated for kaolinheparinase TEG, kaolin TEG, LTA, and estimated blood loss. Protocol guidelines were followed and anticoagulation management reduced bleeding and prevented thrombus formation as well as thromboembolic events in TAH patients postimplantation. The patients in this study were susceptible to a variety of possible complications such as mechanical device issues, thrombotic events, infection, and bleeding. Among them all it was clear that patients were at most risk for bleeding, particularly on postoperative days 1 through 3. However, bleeding was reduced into postoperative days 3 and 7, indicating that acceptable hemostasis was achieved with the anticoagulation protocol. The multidisciplinary, multi-targeted anticoagulation clinical procedure guideline was successful to maintain adequate antithrombotic therapy for TAH patients.

  4. [In-hospital stroke care in Catalonia [Spain]. Results of the "First Clinical Audit of Stroke. Catalonia, 2005/2006"].

    PubMed

    Abilleira, Sònia; Ribera, Aida; Sánchez, Emília; Roquer, Jaume; Duarte, Esther; Tresserras, Ricard; Gallofré, Miquel

    2008-01-01

    To determine the quality of in-hospital stroke care in public acute care hospitals in Catalonia before the implementation of a clinical practice guideline (CPG) on stroke by determining adherence to specific recommendations of the CPG. We retrospectively reviewed the case notes of consecutive patients with stroke (defined with ICD-9 codes: 431, 433.x1, 434.x1, and 436) admitted to 48 Catalan hospitals within the first half of 2005. Data were collected on indicators of the healthcare process selected on the basis of their scientific evidence and/or clinical relevance. The participating hospitals included 20, 40 or 60 stroke cases according to their annual stroke caseload. After random selection, up to 9.3% of all cases recruited at each study center were externally monitored to assess the quality of the data gathered. Indicators were grouped into six different dimensions related to distinct aspects of clinical practice. We analyzed data from 1,791 stroke cases (53.9% men, mean age: 75.6 [12.4] years). Overall inter-observer agreement was 0.7. Compliance with the six dimensions was as follows (mean percentage [95%CI]): quality of medical records, 78.5% (77.5-79.4); initial interventions, 92.4% (91.5-93.2); neurological assessment, 38.3% (37.3-39.3); assessment of rehabilitation needs, 44.9% (43.2-46.7); prevention and management of medical complications, 68.4% (66.9-70), and initial preventive measures, 78.9% (77.3-80.4). In the first half of 2005, in-hospital stroke care in Catalonia showed room for improvement particularly in aspects related to the neurological assessment and follow-up of patients and their rehabilitation process.

  5. A systematic review and quality appraisal of international guidelines for early breast cancer systemic therapy: Are recommendations sensitive to different global resources?

    PubMed

    Gandhi, S; Verma, S; Ethier, J-L; Simmons, C; Burnett, H; Alibhai, S M H

    2015-08-01

    The breast cancer incidence in low and middle income countries (LMCs) is increasing globally, and patient outcomes are generally worse in these nations compared to high income countries (HICs). This is partly due to resource constraints associated with implementing recommended breast cancer therapies. Clinical practice guideline (CPG) adherence can improve breast cancer outcomes, however, many CPGs are created in HICs, and include costly recommendations that may not be feasible in LMCs. In addition, the quality of CPGs can be variable. The aim of this study was to perform a systematic review of CPGs on early breast cancer systemic therapy with potential international impact, to evaluate their content, quality, and resource sensitivity. A MEDLINE and gray literature search was completed for English language CPGs published between 2005 and 2010, and then updated to July 2014. Extracted guidelines were evaluated using the AGREE 2 instrument. Guidelines were specifically analyzed for resource sensitivity. Most of the extracted CPGs had similar recommendations with regards to systemic therapy. However, only one, the Breast Health Global Initiative, made recommendations with consideration of different global resources. Overall, the CPGs were of variable quality, and most scored poorly in the quality domain evaluating implementation barriers such as resources. Published CPGs for early breast cancer are created in HICs, have similar recommendations, and are generally resource-insensitive. Given the visibility and influence of these CPGs on LMCs, efforts to create higher quality, resource-sensitive guidelines with less redundancy are needed. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. An audit of referral and treatment patterns of high-risk prostate cancer patients in Alberta.

    PubMed

    Alghamdi, Majed; Taggar, Amandeep; Tilley, Derek; Kerba, Marc; Kostaras, Xanthoula; Gotto, Geoffrey; Sia, Michael

    2016-01-01

    We aimed to determine the impact of clinical practice guidelines (CPG) on rates of radiation oncologist (RO) referral, androgen-deprivation therapy (ADT), radiation therapy (RT), and radical prostatectomy (RP) in patients with high-risk prostate cancer (HR-PCa). All men >18 years, diagnosed with PCa in 2005 and 2012 were identified from the Alberta Cancer Registry. Patient age, aggregated clinical risk group (ACRG) score, Gleason score (GS), pre-treatment prostate-specific antigen (PSA), RO referral, and treatment received were extracted from electronic medical records. Logistic regression modelling was used to examine associations between RO referral rates and relevant factors. HR-PCa was diagnosed in 261 of 1792 patients in 2005 and 435 of 2148 in 2012. Median age and ACRG scores were similar in both years (p>0.05). The rate of patients with PSA >20 were 67% and 57% in 2005 and 2012, respectively (p=0.004). GS ≤6 was found in 13% vs. 5% of patients, GS 7 in 27% vs. 24%, and GS ≥8 in 59% vs. 71% in 2005 and 2012, respectively (p<0.001). In 2005, RO referral rate was 68% compared to 56% in 2012 (p=0.001), use of RT + ADT was 53% compared to 32% (p<0.001), and RP rate was 9% vs. 17% (p=0.002). On regression analysis, older age, 2012 year of diagnosis and higher PSA were associated with decreased RO referral rates (odds ratios [OR] 0.49, 95% confidence interval [CI] 0.39-0.61; OR 0.51, 95% CI 0.34-0.76; and OR 0.64, 95% CI 0.39-0.61), respectively [p<0.001]). Since CPG creation in 2005, RO referral rates and ADT + RT use declined and RP rates increased, which demonstrates a need to improve adherence to CPG in the HR-PCa population.

  7. Risk Factors Associated with Invasive Fungal Infections in Combat Trauma

    PubMed Central

    Rodriguez, Carlos J.; Weintrob, Amy C.; Shah, Jinesh; Malone, Debra; Dunne, James R.; Weisbrod, Allison B.; Lloyd, Bradley A.; Warkentien, Tyler E.; Murray, Clinton K.; Wilkins, Kenneth; Shaikh, Faraz; Carson, M. Leigh; Aggarwal, Deepak

    2014-01-01

    Abstract Background: In recent years, invasive fungal infections (IFI) have complicated the clinical course of patients with combat-related injuries. Commonalities in injury patterns and characteristics among patients with IFI led to the development of a Joint Trauma System (JTS) clinical practice guideline (CPG) for IFI management. We performed a case-control study to confirm and further delineate risk factors associated with IFI development in combat casualties with the objective of generating data to refine the CPG and promote timelier initiation of treatment. Methods: Data were collected retrospectively for United States (U.S.) military personnel injured during deployment in Afghanistan from June 2009 through August 2011. Cases were identified as IFI based upon wound cultures with fungal growth and/or fungal elements seen on histology, in addition to the presence of recurrent wound necrosis. Controls were matched using date of injury (±3 mo) and injury severity score (±10). Risk factor parameters analyzed included injury circumstances, blood transfusion requirements, amputations after first operative intervention, and associated injuries. Data are expressed as multivariate odds ratios (OR; 95% confidence interval [CI]). Results: Seventy-six IFI cases were identified from 1,133 U.S. military personnel wounded in Afghanistan and matched to 150 controls. Parameters associated significantly with the development of IFI multivariate analysis were blast injuries (OR: 5.7; CI: 1.1–29.6), dismounted at time of injury (OR: 8.5; CI: 1.2–59.8); above the knee amputations (OR: 4.1; CI: 1.3-12.7), and large-volume packed red blood cell (PRBC; >20 U) transfusions within first 24 h (OR: 7.0; CI: 2.5-19.7). Conclusions: Our analysis indicates that dismounted blast injuries, resulting in above the knee amputations, and requirement of large volume PRBC transfusions are independent predictors of IFI development. These data confirm all the preliminary risk factors, except for genitalia/perineal injuries, utilized by JTS in their IFI CPG. Model validation is necessary for further risk factor specification. PMID:24821267

  8. Before the Emergency: A Framework for Evaluating Emergency Preparedness Alternatives at Higher Education Institutions

    DTIC Science & Technology

    2010-09-01

    Operations and Procedures • Logistics and Facilities • Training • Exercises, Evaluation and Corrective Actions • Crisis Communications ...Assessment Team BCA Benefit-cost analysis CEO Chief Executive Officer CERT Community Emergency Response Team CFR Code of Federal Regulations...CHDS Center for Homeland Defense and Security CPG 101 Comprehensive Preparedness Guidelines 101 CPP Community Preparedness and Participation CPW

  9. Gait Planning and Stability Control of a Quadruped Robot

    PubMed Central

    Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

  10. Gait Planning and Stability Control of a Quadruped Robot.

    PubMed

    Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

  11. B-cell activation with CD40L or CpG measures the function of B-cell subsets and identifies specific defects in immunodeficient patients.

    PubMed

    Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita

    2017-01-01

    Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The tools of an evidence-based culture: implementing clinical-practice guidelines in an Israeli HMO.

    PubMed

    Kahan, Natan R; Kahan, Ernesto; Waitman, Dan-Andrei; Kitai, Eliezer; Chintz, David P

    2009-09-01

    Although clinical-practice guidelines (CPGs) are implemented on the assumption that they will improve the quality, efficiency, and consistency of health care, they generally have limited effect in changing physicians' behavior. The purpose of this study was to design and implement an effective program for formulating, promulgating, and implementing CPGs to foster the development of an evidence-based culture in an Israeli HMO. The authors implemented a four-stage program of stepwise collaborative efforts with academic institutions composed of developing quantitative tools to evaluate prescribing patterns, updating CPGs, collecting MDs' input via focus groups and quantitative surveys, and conducting a randomized controlled trial of a two-stage, multipronged intervention. The test case for this study was the development, dissemination, and implementation of CPG for the treatment of acute uncomplicated cystitis in adult women. Interventions in the form of a lecture at a conference and a letter with personalized feedback were implemented, both individually and combined, to improve physicians' rates of prescribing the first-line drug, nitrofurantoin, and, in the absence of nitrofurantoin, adhering to the recommended duration of three days of treatment with ofloxacin. The tools and data-generating capabilities designed and constructed in Stage I of the project were integral components of all subsequent stages of the program. Personalized feedback alone was sufficient to improve the rate of adherence to the guidelines by 19.4% (95% CI = 16.7, 22.1). This study provides a template for introducing the component of experimentation essential for cultivating an evidence-based culture. This process, composed of collaborative efforts between academic institutions and a managed care organization, may be beneficial to other health care systems.

  13. How current Clinical Practice Guidelines for low back pain reflect Traditional Medicine in East Asian Countries: a systematic review of Clinical Practice Guidelines and systematic reviews.

    PubMed

    Cho, Hyun-Woo; Hwang, Eui-Hyoung; Lim, Byungmook; Heo, Kwang-Ho; Liu, Jian-Ping; Tsutani, Kiichiro; Lee, Myeong Soo; Shin, Byung-Cheul

    2014-01-01

    The aims of this study were to investigate whether there is a gap between evidence of traditional medicine (TM) interventions in East-Asian countries from the current Clinical Practice Guidelines (CPGs) and evidence from current systematic reviews and meta-analyses (SR-MAs) and to analyze the impact of this gap on present CPGs. We examined 5 representative TM interventions in the health care systems of East-Asian countries. We searched seven relevant databases for CPGs to identify whether core CPGs included evidence of TM interventions, and we searched 11 databases for SR-MAs to re-evaluate current evidence on TM interventions. We then compared the gap between the evidence from CPGs and SR-MAs. Thirteen CPGs and 22 SR-MAs met our inclusion criteria. Of the 13 CPGs, 7 CPGs (54%) mentioned TM interventions, and all were for acupuncture (only one was for both acupuncture and acupressure). However, the CPGs did not recommend acupuncture (or acupressure). Of 22 SR-MAs, 16 were for acupuncture, 5 for manual therapy, 1 for cupping, and none for moxibustion and herbal medicine. Comparing the evidence from CPGs and SR-MAs, an underestimation or omission of evidence for acupuncture, cupping, and manual therapy in current CPGs was detected. Thus, applying the results from the SR-MAs, we moderately recommend acupuncture for chronic LBP, but we inconclusively recommend acupuncture for (sub)acute LBP due to the limited current evidence. Furthermore, we weakly recommend cupping and manual therapy for both (sub)acute and chronic LBP. We cannot provide recommendations for moxibustion and herbal medicine due to a lack of evidence. The current CPGs did not fully reflect the evidence for TM interventions. As relevant studies such as SR-MAs are conducted and evidence increases, the current evidence on acupuncture, cupping, and manual therapy should be rigorously considered in the process of developing or updating the CPG system.

  14. CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

    PubMed Central

    Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

    2009-01-01

    Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

  15. Unanswered clinical questions in the management of cardiometabolic risk in the elderly: a statement of the Spanish Society of Internal Medicine.

    PubMed

    Gómez-Huelgas, Ricardo; Giner-Galvañ, Vicente; Mostaza, José M; Cuende, José I; de Miguel-Yanes, Jose M; Rovira, Eduardo; Sánchez-Fuentes, Demetrio; Suárez Fernández, Carmen; Román Sánchez, Pilar

    2014-12-18

    Despite the progressive increase in life expectancy and the relationship between aging with multi-morbidities and the increased use of healthcare resources, current clinical practice guidelines (CPG) on cardiometabolic risk cannot be adequately applied to elderly subjects with multiple chronic conditions. Its management frequently becomes complicated by both, an excessive use of medications that may lead to overtreatment, drug interactions and increased toxicity, and errors in dosage and non-compliance. Concerned by this gap, the Spanish Society of Internal Medicine created a group of independent experts on cardiometabolic risk who discussed what they considered to be unanswered questions in the management of elderly patients. Current guidelines do not specifically address the problem of elderly with multiple chronic conditions. For this reason, the combined use of the limited available evidence, clinical experience and common sense, could all help us to address this unmet need. In very old people, life expectancy and functionality are the most important factors for guiding potential treatments. Their higher propensity to develop serious adverse events and their shorter lifespan could prevent them from obtaining the potential benefits of the interventions administered. In this document, experts on cardiometabolic risk factors have established a number of consensual recommendations that have taken into account international guidelines and clinical experience, and have also considered the more effective use of healthcare resources. This document is intended to provide general recommendations for clinicians and to promote the effective use of procedures and medications.

  16. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  17. Engaging Patients and Clinicians in Establishing Research Priorities for Gestational Diabetes Mellitus.

    PubMed

    Rees, Sandra E; Chadha, Rati; Donovan, Lois E; Guitard, Adrienne L T; Koppula, Sudha; Laupacis, Andreas; Simpson, Sara; Johnson, Jeffrey A

    2017-04-01

    We involved patients and clinicians in Alberta, Canada, to establish research priorities in gestational diabetes mellitus (GDM), using an approach based on a model proposed by the James Lind Alliance (JLA). We adapted the 4-step JLA process to engage women with GDM and clinicians to identify uncertainties about the management of GDM. Uncertainties were identified through a survey and a review of the clinical practice guidelines (CPG). Uncertainties were short-listed by a steering committee, followed by a 1-day facilitated workshop using a nominal group format and involving a similar number of patients and clinicians, who identified the top 10 research priorities. Across the various survey formats, 75 individuals submitted 389 uncertainties, the majority (44; 59%) coming from patients. We removed 9 questions as being out of scope or unclear, and 41 were identified on a review of CPG, resulting in a total of 421 uncertainties. After the priority setting process, the final top 10 research priorities included questions about a simpler, more accurate and convenient screening test; risk factors for GDM; improving postpartum diabetes screening; the impact of GDM on the future health of the children; lifestyle challenges and mental health issues; safety, effectiveness and/or impact of diet and/or medication treatments; appropriate timing for delivery; and how care is provided, organized or communicated. These top 10 research priorities were informed through a comprehensive and transparent process involving women who have experienced GDM as well as clinicians, and they may be regarded as research priorities for GDM. Copyright © 2016 Canadian Diabetes Association. Published by Elsevier Inc. All rights reserved.

  18. A 2015 Survey of Clinical Practice Patterns in the Management of Thyroid Nodules.

    PubMed

    Burch, Henry B; Burman, Kenneth D; Cooper, David S; Hennessey, James V; Vietor, Nicole O

    2016-07-01

    The management of thyroid nodules has changed dramatically over the past two decades. In the interim, technological advances including high-resolution ultrasound and molecular testing of thyroid nodules have been introduced. We sought to document current practices in the management thyroid nodules and assess the extent to which technological advances have been incorporated into current practice. We further sought to compare current practice to recommendations made in a recently updated American Thyroid Association (ATA) clinical practice guideline (CPG) and examine differences in thyroid nodule management among international members of U.S.-based endocrine societies. Members of The Endocrine Society, ATA, and American Association of Clinical Endocrinologists were invited to participate in a Web-based survey dealing with testing, treatment preference, and modulating factors in patients with thyroid nodules. A total of 897 respondents participated in the survey, including 661 members of The Endocrine Society, 454 American Association of Clinical Endocrinologists members, and 365 ATA members. Thyroid fine-needle aspiration (FNA) in 2015 is generally performed by endocrinologists (56.6%) and radiologists (31.9%), most frequently using ultrasound guidance (83.3%). Respondents in general have a lower threshold for FNA of thyroid nodules than that recommended in the updated ATA CPG. Management depends on the FNA result, with follicular lesion of undetermined significance/atypia of undetermined significance resulting in molecular testing (38.8% of respondents), repeat FNA cytology (31.5%), or immediate referral for thyroid surgery (24.4%). Nodules showing follicular neoplasm by FNA are referred for thyroid surgery by 61.2% of respondents (46.6 % lobectomy, 14.6 % total thyroidectomy) or molecular testing (29.0 %). Nodules found suspicious but not conclusive for malignancy (Bethesda category V), are referred for thyroid surgery (86.0%) and rarely undergo molecular testing (9.5%). During pregnancy, only 47.6% of respondents would perform FNA in the absence of nodular growth, with most respondents deferring FNA until after pregnancy. Endocrinologists are 64.2% less likely to perform FNA in an octogenarian than a younger patient with a comparable thyroid nodule. Striking international differences were identified in the routine measurement of calcitonin and in the use of molecular testing of thyroid nodules. In summary, our survey of clinical endocrinologists on the management of thyroid nodules documents current practice patterns and demonstrates both concordance and focal discordance with recently updated CPGs. Both international differences and a change in practice patterns during the past two decades are demonstrated.

  19. Evaluation of a combined strategy directed towards health-care professionals and patients with chronic obstructive pulmonary disease (COPD): information and health education feedback for improving clinical monitoring and quality-of-life.

    PubMed

    Valero, Carles; Monteagudo, Mònica; Llagostera, Maria; Bayona, Xavier; Granollers, Sílvia; Acedo, Mateo; Ferro, Juan J; Rodríguez-Latre, Lluïsa; Almeda, Jesús; Muñoz, Laura

    2009-12-01

    Chronic obstructive pulmonary disease (COPD) is a health problem that is becoming increasingly attended-to in Primary Care (PC). However, there is a scarcity of health-care programs and studies exploring the implementation of Clinical Practice Guidelines (CPG). The principal objective of the present study is to evaluate the effectiveness of a combined strategy directed towards health-care professionals and patients to improve the grade of clinical control and the quality-of-life (QoL) of the patients via a feedback on their state-of-health. A training plan for the health-care professionals is based on CPG and health education. Multi-centred, before-after, quasi experimental, prospective study involving an intervention group and a control group of individuals followed-up for 12 months. The patients receive attention from urban and semi-urban Primary Care Centres (PCC) within the administrative area of the Costa de Ponent (near Barcelona). All the pacients corresponding to the PCC of one sub-area were assigned to the intervention group and patients from the rest of sub-areas to the group control. The intervention includes providing data to the health-care professionals (clinician/nurse) derived from a clinical history and an interview. A course of training focused on aspects of CPG, motivational interview and health education (tobacco, inhalers, diet, physical exercise, physiotherapy). The sample random includes a total of 801 patients (> or = 40 years of age), recorded as having COPD, receiving attention in the PCC or at home, who have had at least one clinical visit, and who provided written informed consent to participation in the study. Data collected include socio-demographic characteristics, drug treatment, exacerbations and hospital admissions, evaluation of inhaler use, tobacco consumption and life-style and health-care resources consumed. The main endpoints are dyspnoea, according to the modified scale of the Medical Research Council (MRC) and the QoL, evaluated with the St George's Respiratory Questionnaire (SGRQ). The variables are obtained at the start and the end of the intervention. Information from follow-up visits focuses on the changes in life-style activities of the patient. This study is conducted with the objective of generating evidence that shows that implementation of awareness programs directed towards health-care professionals as well as patients in the context of PC can produce an increase in the QoL and a decrease in the disease exacerbation, compared to standard clinical practice. Clinical Trials.gov Identifier: NCT00922545;

  20. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  1. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  2. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Support of personalized medicine through risk-stratified treatment recommendations - an environmental scan of clinical practice guidelines

    PubMed Central

    2013-01-01

    Background Risk-stratified treatment recommendations facilitate treatment decision-making that balances patient-specific risks and preferences. It is unclear if and how such recommendations are developed in clinical practice guidelines (CPGs). Our aim was to assess if and how CPGs develop risk-stratified treatment recommendations for the prevention or treatment of common chronic diseases. Methods We searched the United States National Guideline Clearinghouse for US, Canadian and National Institute for Health and Clinical Excellence (United Kingdom) CPGs for heart disease, stroke, cancer, chronic obstructive pulmonary disease and diabetes that make risk-stratified treatment recommendations. We included only those CPGs that made risk-stratified treatment recommendations based on risk assessment tools. Two reviewers independently identified CPGs and extracted information on recommended risk assessment tools; type of evidence about treatment benefits and harms; methods for linking risk estimates to treatment evidence and for developing treatment thresholds; and consideration of patient preferences. Results We identified 20 CPGs that made risk-stratified treatment recommendations out of 133 CPGs that made any type of treatment recommendations for the chronic diseases considered in this study. Of the included 20 CPGs, 16 (80%) used evidence about treatment benefits from randomized controlled trials, meta-analyses or other guidelines, and the source of evidence was unclear in the remaining four (20%) CPGs. Nine CPGs (45%) used evidence on harms from randomized controlled trials or observational studies, while 11 CPGs (55%) did not clearly refer to harms. Nine CPGs (45%) explained how risk prediction and evidence about treatments effects were linked (for example, applying estimates of relative risk reductions to absolute risks), but only one CPG (5%) assessed benefit and harm quantitatively and three CPGs (15%) explicitly reported consideration of patient preferences. Conclusions Only a small proportion of CPGs for chronic diseases make risk-stratified treatment recommendations with a focus on heart disease and stroke prevention, diabetes and breast cancer. For most CPGs it is unclear how risk-stratified treatment recommendations were developed. As a consequence, it is uncertain if CPGs support patients and physicians in finding an acceptable benefit- harm balance that reflects both profile-specific outcome risks and preferences. PMID:23302096

  4. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  5. DNA methylation analysis of phenotype specific stratified Indian population.

    PubMed

    Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

    2015-05-08

    DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

  6. Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

    PubMed

    Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

    2016-08-01

    Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

  7. Sudden Sensorineural Hearing Loss in the Department of Defense.

    PubMed

    Hughes, Charlotte K; Fischer, Jakob; Esquivel, Carlos R; Laury, Adrienne M

    2018-04-01

    Objective The American Academy of Otolaryngology-Head and Neck Surgery Foundation clinical practice guideline (CPG) proposes recommendations regarding sudden sensorineural hearing loss (SSNHL). SSNHL is managed by primary care, emergency medicine, and otolaryngology providers in the Department of Defense (DoD). However, their adherence to this CPG is unknown. We sought to determine provider compliance and identify areas for improvement. Study Design Case series with chart review. Setting DoD's electronic medical record. Subjects and Methods Patients with SSNHL (N = 204) were treated between March 1, 2012, and September 30, 2015. Time from onset of symptoms to evaluation by primary care, emergency department, audiology, and otolaryngology providers and treatments were analyzed. Results The average interval from onset of symptoms to evaluation by a primary care or emergency department provider was 4.86 days (95% CI, 3.46-6.26). Time from presentation to ear, nose, and throat and audiologic evaluation was 15.26 days (95% CI, 12.34-18.20) and 14.16 days (95% CI, 11.31-17.01), respectively. Diagnostic workup included magnetic resonance imaging (n = 150, 73.5%), computed tomography (n = 28, 13.7%), and laboratory testing (n = 50, 24.5%). Oral steroids were used in 137 (67.2%) patients, with 78.8% treated with the recommended dose. Intratympanic steroids were utilized in 65 (31.9%) patients, with variable dosing. Conclusion The DoD is uniquely positioned to evaluate adherence to CPGs on national and international levels given the robust and standardized electronic medical record. Areas of improvement include timely identification of SSNHL with rapid referral to ear, nose, and throat and audiology providers; minimizing unnecessary imaging, laboratory testing, and medications; and correct dosing of oral and intratympanic steroids.

  8. Predicting suicides after outpatient mental health visits in the Army Study to Assess Risk and Resilience in Servicemembers (Army STARRS)

    PubMed Central

    Kessler, Ronald C.; Stein, Murray B.; Petukhova, Maria V.; Bliese, Paul; Bossarte, Robert M.; Bromet, Evelyn J.; Fullerton, Carol S.; Gilman, Stephen E.; Ivany, Christopher; Lewandowski-Romps, Lisa; Bell, Amy Millikan; Naifeh, James A.; Nock, Matthew K.; Reis, Benjamin Y.; Rosellini, Anthony J.; Sampson, Nancy A.; Zaslavsky, Alan M.; Ursano, Robert J.

    2016-01-01

    The 2013 U.S. Veterans Administration/Department of Defense Clinical Practice Guidelines (VA/DoD CPG) require comprehensive suicide risk assessments for VA/DoD patients with mental disorders but provide minimal guidance on how to carry out these assessments. Given that clinician-based assessments are known not to be strong predictors of suicide, we investigated whether a precision medicine model using administrative data after outpatient mental health specialty visits could be developed to predict suicides among outpatients. We focused on male non-deployed Regular U.S. Army soldiers because they account for the vast majority of such suicides. Four machine learning classifiers (naïve Bayes, random forests, support vector regression, elastic net penalized regression) were explored. 41.5% of Army suicides in 2004-2009 occurred among the 12.0% of soldiers seen as outpatient by mental health specialists, with risk especially high within 26 weeks of visits. An elastic net classifier with 10-14 predictors optimized sensitivity (45.6% of suicide deaths occurring after the 15% of visits with highest predicted risk). Good model stability was found for a model using 2004-2007 data to predict 2008-2009 suicides, although stability decreased in a model using 2008-2009 data to predict 2010-2012 suicides. The 5% of visits with highest risk included only 0.1% of soldiers (1047.1 suicides/100,000 person-years in the 5 weeks after the visit). This is a high enough concentration of risk to have implications for targeting preventive interventions. An even better model might be developed in the future by including the enriched information on clinician-evaluated suicide risk mandated by the VA/DoD CPG to be recorded. PMID:27431294

  9. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  10. The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

    PubMed Central

    Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

    2014-01-01

    One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

  11. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  12. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

  13. Relationship Between Using Clinical Practice Guidelines for Pain Treatment and Physicians' Training and Attitudes Toward Patients and the Effects on Patient Care.

    PubMed

    Dueñas, María; Salazar, Alejandro; Sánchez, Modesto; De Sola, Helena; Ojeda, Begoña; Failde, Inmaculada

    2018-01-01

    To determine the use of clinical practice guidelines (CPGs) for chronic pain (CP) management; analyze the effects of training in pain and the attitudes of physicians toward pain and CP patients on the adherence to these CPGs; and assess the impact of adherence to CPGs on patient care. This was a cross-sectional study in a sample of physicians involved in CP patient management. Information on the use of CPGs for CP management, their training in pain, and their attitudes toward pain, patients, and patient care was collected. Descriptive and bivariate analyses were performed, and a multinomial logistic regression model was constructed to analyze factors associated with the use of CPGs. Of the 257 physicians surveyed, 46.6% were physiatrists, 26.7% were general practitioners, and 26.7% were medical oncologists. Although 96.5% claimed to have received training in pain, only 10.1% had received college training, and 76.3% expressed having gaps in their knowledge; 53.9% stated they applied CPGs often/always, and 12.5% rarely/never. Limited knowledge on pain, reduced involvement in training activities, more negative attitudes toward patients, and having experienced CP were the factors related to reduced adherence to CPGs, especially among the youngest respondents. The greater the use of CPGs, the better the patient care was. Access to scientific information and specialized training are factors related to the use of CPGs for pain treatment. Therefore, the inclusion of CP training in university and during medical specialty training will be essential measures to improve adherence to CPG, thereby improving patient care and pain control. © 2017 World Institute of Pain.

  14. Management of Falls in Community-Dwelling Older Adults: Clinical Guidance Statement From the Academy of Geriatric Physical Therapy of the American Physical Therapy Association

    PubMed Central

    Avin, Keith G.; Hanke, Timothy A.; Kirk-Sanchez, Neva; McDonough, Christine M.; Shubert, Tiffany E.; Hartley, Greg

    2015-01-01

    Background Falls in older adults are a major public health concern due to high prevalence, impact on health outcomes and quality of life, and treatment costs. Physical therapists can play a major role in reducing fall risk for older adults; however, existing clinical practice guidelines (CPGs) related to fall prevention and management are not targeted to physical therapists. Objective The purpose of this clinical guidance statement (CGS) is to provide recommendations to physical therapists to help improve outcomes in the identification and management of fall risk in community-dwelling older adults. Design and Methods The Subcommittee on Evidence-Based Documents of the Practice Committee of the Academy of Geriatric Physical Therapy developed this CGS. Existing CPGs were identified by systematic search and critically appraised using the Appraisal of Guidelines, Research, and Evaluation in Europe II (AGREE II) tool. Through this process, 3 CPGs were recommended for inclusion in the CGS and were synthesized and summarized. Results Screening recommendations include asking all older adults in contact with a health care provider whether they have fallen in the previous year or have concerns about balance or walking. Follow-up should include screening for balance and mobility impairments. Older adults who screen positive should have a targeted multifactorial assessment and targeted intervention. The components of this assessment and intervention are reviewed in this CGS, and barriers and issues related to implementation are discussed. Limitations A gap analysis supports the need for the development of a physical therapy–specific CPG to provide more precise recommendations for screening and assessment measures, exercise parameters, and delivery models. Conclusion This CGS provides recommendations to assist physical therapists in the identification and management of fall risk in older community-dwelling adults. PMID:25573760

  15. Management of falls in community-dwelling older adults: clinical guidance statement from the Academy of Geriatric Physical Therapy of the American Physical Therapy Association.

    PubMed

    Avin, Keith G; Hanke, Timothy A; Kirk-Sanchez, Neva; McDonough, Christine M; Shubert, Tiffany E; Hardage, Jason; Hartley, Greg

    2015-06-01

    Falls in older adults are a major public health concern due to high prevalence, impact on health outcomes and quality of life, and treatment costs. Physical therapists can play a major role in reducing fall risk for older adults; however, existing clinical practice guidelines (CPGs) related to fall prevention and management are not targeted to physical therapists. The purpose of this clinical guidance statement (CGS) is to provide recommendations to physical therapists to help improve outcomes in the identification and management of fall risk in community-dwelling older adults. The Subcommittee on Evidence-Based Documents of the Practice Committee of the Academy of Geriatric Physical Therapy developed this CGS. Existing CPGs were identified by systematic search and critically appraised using the Appraisal of Guidelines, Research, and Evaluation in Europe II (AGREE II) tool. Through this process, 3 CPGs were recommended for inclusion in the CGS and were synthesized and summarized. Screening recommendations include asking all older adults in contact with a health care provider whether they have fallen in the previous year or have concerns about balance or walking. Follow-up should include screening for balance and mobility impairments. Older adults who screen positive should have a targeted multifactorial assessment and targeted intervention. The components of this assessment and intervention are reviewed in this CGS, and barriers and issues related to implementation are discussed. A gap analysis supports the need for the development of a physical therapy-specific CPG to provide more precise recommendations for screening and assessment measures, exercise parameters, and delivery models. This CGS provides recommendations to assist physical therapists in the identification and management of fall risk in older community-dwelling adults. © 2015 American Physical Therapy Association.

  16. Evaluation of a combined strategy directed towards health-care professionals and patients with chronic obstructive pulmonary disease (COPD): Information and health education feedback for improving clinical monitoring and quality-of-life

    PubMed Central

    2009-01-01

    Background Chronic obstructive pulmonary disease (COPD) is a health problem that is becoming increasingly attended-to in Primary Care (PC). However, there is a scarcity of health-care programs and studies exploring the implementation of Clinical Practice Guidelines (CPG). The principal objective of the present study is to evaluate the effectiveness of a combined strategy directed towards health-care professionals and patients to improve the grade of clinical control and the quality-of-life (QoL) of the patients via a feedback on their state-of-health. A training plan for the health-care professionals is based on CPG and health education. Method/Design Multi-centred, before-after, quasi experimental, prospective study involving an intervention group and a control group of individuals followed-up for 12 months. The patients receive attention from urban and semi-urban Primary Care Centres (PCC) within the administrative area of the Costa de Ponent (near Barcelona). All the pacients corresponding to the PCC of one sub-area were assigned to the intervention group and patients from the rest of sub-areas to the group control. The intervention includes providing data to the health-care professionals (clinician/nurse) derived from a clinical history and an interview. A course of training focused on aspects of CPG, motivational interview and health education (tobacco, inhalers, diet, physical exercise, physiotherapy). The sample random includes a total of 801 patients (≥ 40 years of age), recorded as having COPD, receiving attention in the PCC or at home, who have had at least one clinical visit, and who provided written informed consent to participation in the study. Data collected include socio-demographic characteristics, drug treatment, exacerbations and hospital admissions, evaluation of inhaler use, tobacco consumption and life-style and health-care resources consumed. The main endpoints are dyspnoea, according to the modified scale of the Medical Research Council (MRC) and the QoL, evaluated with the St George's Respiratory Questionnaire (SGRQ). The variables are obtained at the start and the end of the intervention. Information from follow-up visits focuses on the changes in life-style activities of the patient. Discussion This study is conducted with the objective of generating evidence that shows that implementation of awareness programs directed towards health-care professionals as well as patients in the context of PC can produce an increase in the QoL and a decrease in the disease exacerbation, compared to standard clinical practice. Trial Registration Clinical Trials.gov Identifier: NCT00922545; PMID:20128887

  17. ADIPOSITY-BASED CHRONIC DISEASE AS A NEW DIAGNOSTIC TERM: THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY POSITION STATEMENT.

    PubMed

    Mechanick, Jeffrey I; Hurley, Daniel L; Garvey, W Timothy

    2017-03-01

    The American Association of Clinical Endocrinologists (AACE) and American College of Endocrinology (ACE) have created a chronic care model, advanced diagnostic framework, clinical practice guidelines, and clinical practice algorithm for the comprehensive management of obesity. This coordinated effort is not solely based on body mass index as in previous models, but emphasizes a complications-centric approach that primarily determines therapeutic decisions and desired outcomes. Adiposity-Based Chronic Disease (ABCD) is a new diagnostic term for obesity that explicitly identifies a chronic disease, alludes to a precise pathophysiologic basis, and avoids the stigmata and confusion related to the differential use and multiple meanings of the term "obesity." Key elements to further the care of patients using this new ABCD term are: (1) positioning lifestyle medicine in the promotion of overall health, not only as the first algorithmic step, but as the central, pervasive action; (2) standardizing protocols that comprehensively and durably address weight loss and management of adiposity-based complications; (3) approaching patient care through contextualization (e.g., primordial prevention to decrease obesogenic environmental risk factors and transculturalization to adapt evidence-based recommendations for different ethnicities, cultures, and socio-economics); and lastly, (4) developing evidence-based strategies for successful implementation, monitoring, and optimization of patient care over time. This AACE/ACE blueprint extends current work and aspires to meaningfully improve both individual and population health by presenting a new ABCD term for medical diagnostic purposes, use in a complications-centric management and staging strategy, and precise reference to the obesity chronic disease state, divested from counterproductive stigmata and ambiguities found in the general public sphere. AACE = American Association of Clinical Endocrinologists ABCD = Adiposity-Based Chronic Disease ACE = American College of Endocrinology BMI = body mass index CPG = clinical practice guidelines HCP = health care professionals.

  18. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  19. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

  20. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  1. AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY GUIDELINES FOR MANAGEMENT OF DYSLIPIDEMIA AND PREVENTION OF CARDIOVASCULAR DISEASE.

    PubMed

    Jellinger, Paul S; Handelsman, Yehuda; Rosenblit, Paul D; Bloomgarden, Zachary T; Fonseca, Vivian A; Garber, Alan J; Grunberger, George; Guerin, Chris K; Bell, David S H; Mechanick, Jeffrey I; Pessah-Pollack, Rachel; Wyne, Kathleen; Smith, Donald; Brinton, Eliot A; Fazio, Sergio; Davidson, Michael

    2017-04-01

    The development of these guidelines is mandated by the American Association of Clinical Endocrinologists (AACE) Board of Directors and American College of Endocrinology (ACE) Board of Trustees and adheres with published AACE protocols for the standardized production of clinical practice guidelines (CPGs). Recommendations are based on diligent reviews of the clinical evidence with transparent incorporation of subjective factors, according to established AACE/ACE guidelines for guidelines protocols. The Executive Summary of this document contains 87 recommendations of which 45 are Grade A (51.7%), 18 are Grade B (20.7%), 15 are Grade C (17.2%), and 9 (10.3%) are Grade D. These detailed, evidence-based recommendations allow for nuance-based clinical decision-making that addresses multiple aspects of real-world medical care. The evidence base presented in the subsequent Appendix provides relevant supporting information for Executive Summary Recommendations. This update contains 695 citations of which 203 (29.2 %) are EL 1 (strong), 137 (19.7%) are EL 2 (intermediate), 119 (17.1%) are EL 3 (weak), and 236 (34.0%) are EL 4 (no clinical evidence). This CPG is a practical tool that endocrinologists, other health care professionals, health-related organizations, and regulatory bodies can use to reduce the risks and consequences of dyslipidemia. It provides guidance on screening, risk assessment, and treatment recommendations for a range of individuals with various lipid disorders. The recommendations emphasize the importance of treating low-density lipoprotein cholesterol (LDL-C) in some individuals to lower goals than previously endorsed and support the measurement of coronary artery calcium scores and inflammatory markers to help stratify risk. Special consideration is given to individuals with diabetes, familial hypercholesterolemia, women, and youth with dyslipidemia. Both clinical and cost-effectiveness data are provided to support treatment decisions. 4S = Scandinavian Simvastatin Survival Study A1C = glycated hemoglobin AACE = American Association of Clinical Endocrinologists AAP = American Academy of Pediatrics ACC = American College of Cardiology ACE = American College of Endocrinology ACS = acute coronary syndrome ADMIT = Arterial Disease Multiple Intervention Trial ADVENT = Assessment of Diabetes Control and Evaluation of the Efficacy of Niaspan Trial AFCAPS/TexCAPS = Air Force/Texas Coronary Atherosclerosis Prevention Study AHA = American Heart Association AHRQ = Agency for Healthcare Research and Quality AIM-HIGH = Atherothrombosis Intervention in Metabolic Syndrome With Low HDL/High Triglycerides trial ASCVD = atherosclerotic cardiovascular disease ATP = Adult Treatment Panel apo = apolipoprotein BEL = best evidence level BIP = Bezafibrate Infarction Prevention trial BMI = body mass index CABG = coronary artery bypass graft CAC = coronary artery calcification CARDS = Collaborative Atorvastatin Diabetes Study CDP = Coronary Drug Project trial CI = confidence interval CIMT = carotid intimal media thickness CKD = chronic kidney disease CPG(s) = clinical practice guideline(s) CRP = C-reactive protein CTT = Cholesterol Treatment Trialists CV = cerebrovascular CVA = cerebrovascular accident EL = evidence level FH = familial hypercholesterolemia FIELD = Secondary Endpoints from the Fenofibrate Intervention and Event Lowering in Diabetes trial FOURIER = Further Cardiovascular Outcomes Research with PCSK9 Inhibition in Subjects With Elevated Risk trial HATS = HDL-Atherosclerosis Treatment Study HDL-C = high-density lipoprotein cholesterol HeFH = heterozygous familial hypercholesterolemia HHS = Helsinki Heart Study HIV = human immunodeficiency virus HoFH = homozygous familial hypercholesterolemia HPS = Heart Protection Study HPS2-THRIVE = Treatment of HDL to Reduce the Incidence of Vascular Events trial HR = hazard ratio HRT = hormone replacement therapy hsCRP = high-sensitivity CRP IMPROVE-IT = Improved Reduction of Outcomes: Vytorin Efficacy International Trial IRAS = Insulin Resistance Atherosclerosis Study JUPITER = Justification for the Use of Statins in Primary Prevention: An Intervention Trial Evaluating Rosuvastatin LDL-C = low-density lipoprotein cholesterol Lp-PLA2 = lipoprotein-associated phospholipase A2 MACE = major cardiovascular events MESA = Multi-Ethnic Study of Atherosclerosis MetS = metabolic syndrome MI = myocardial infarction MRFIT = Multiple Risk Factor Intervention Trial NCEP = National Cholesterol Education Program NHLBI = National Heart, Lung, and Blood Institute PCOS = polycystic ovary syndrome PCSK9 = proprotein convertase subtilisin/kexin type 9 Post CABG = Post Coronary Artery Bypass Graft trial PROSPER = Prospective Study of Pravastatin in the Elderly at Risk trial QALY = quality-adjusted life-year ROC = receiver-operator characteristic SOC = standard of care SHARP = Study of Heart and Renal Protection T1DM = type 1 diabetes mellitus T2DM = type 2 diabetes mellitus TG = triglycerides TNT = Treating to New Targets trial VA-HIT = Veterans Affairs High-Density Lipoprotein Cholesterol Intervention Trial VLDL-C = very low-density lipoprotein cholesterol WHI = Women's Health Initiative.

  2. DNA Methylation Suppresses Expression of the Urea Cycle Enzyme Carbamoyl Phosphate Synthetase 1 (CPS1) in Human Hepatocellular Carcinoma

    PubMed Central

    Liu, Hongyan; Dong, Huijia; Robertson, Keith; Liu, Chen

    2011-01-01

    Carbamoyl phosphate synthetase 1 (CPS1) is a liver-specific, intramitochondrial, rate-limiting enzyme in the urea cycle. A previous study showed that CPS1 is the antigen for hepatocyte paraffin 1 antibody, a commonly used antibody in surgical pathology practice; and CPS1 expression appears to be down-regulated in liver cancer tissue and cell lines. The aim of this study is to understand how the CPS1 gene is regulated in liver carcinogenesis. In this report, we show that human hepatocellular carcinoma (HCC) cells do not express CPS1, whereas cultured human primary hepatocytes express abundant levels. In addition, CPS1 was silenced or down-regulated in liver tumor tissues compared with the matched noncancerous tissues. The expression of CPS1 in HCC cells was restored with a demethylation agent, 5-azacytidine. We show that two CpG dinucleotides, located near the transcription start site, and a CpG-rich region in the first intron were hypermethylated in HCC cells. The hypermethylation of the two CpG dinucleotides was also detected in HCC tumor tissues compared with noncancerous tissues. Further molecular analysis with mutagenesis indicated that the two CpG dinucleotides play a role in promoter activity of the CPS1 gene. In conclusion, our study demonstrates that DNA methylation is a key mechanism of silencing CPS1 expression in human HCC cells, and CPS1 gene hypermethylation of the two CpG dinucleotides is a potential biomarker for HCC. PMID:21281797

  3. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  4. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  5. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  6. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

  7. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  8. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

  9. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  10. Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

    NASA Astrophysics Data System (ADS)

    Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

    2018-02-01

    This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

  11. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  12. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  13. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  14. GRASP/Ada 95: Reverse Engineering Tools for Ada

    NASA Technical Reports Server (NTRS)

    Cross, James H., II

    1996-01-01

    The GRASP/Ada project (Graphical Representations of Algorithms, Structures, and Processes for Ada) has successfully created and prototyped an algorithmic level graphical representation for Ada software, the Control Structure Diagram (CSD), and a new visualization for a fine-grained complexity metric called the Complexity Profile Graph (CPG). By synchronizing the CSD and the CPG, the CSD view of control structure, nesting, and source code is directly linked to the corresponding visualization of statement level complexity in the CPG. GRASP has been integrated with GNAT, the GNU Ada 95 Translator to provide a comprehensive graphical user interface and development environment for Ada 95. The user may view, edit, print, and compile source code as a CSD with no discernible addition to storage or computational overhead. The primary impetus for creation of the CSD was to improve the comprehension efficiency of Ada software and, as a result, improve reliability and reduce costs. The emphasis has been on the automatic generation of the CSD from Ada 95 source code to support reverse engineering and maintenance. The CSD has the potential to replace traditional prettyprinted Ada source code. The current update has focused on the design and implementation of a new Motif compliant user interface, and a new CSD generator consisting of a tagger and renderer. The Complexity Profile Graph (CPG) is based on a set of functions that describes the context, content, and the scaling for complexity on a statement by statement basis. When combined graphicafly, the result is a composite profile of complexity for the program unit. Ongoing research includes the development and refinement of the associated functions, and the development of the CPG generator prototype. The current Version 5.0 prototype provides the capability for the user to generate CSDs and CPGs from Ada 95 source code in a reverse engineering as well as forward engineering mode with a level of flexibility suitable for practical application. This report provides an overview of the GRASP/Ada project with an emphasis on the current update.

  15. Maternal BMI as a predictor of methylation of obesity-related genes in saliva samples from preschool-age Hispanic children at-risk for obesity.

    PubMed

    Oelsner, Kathryn Tully; Guo, Yan; To, Sophie Bao-Chieu; Non, Amy L; Barkin, Shari L

    2017-01-09

    The study of epigenetic processes and mechanisms present a dynamic approach to assess complex individual variation in obesity susceptibility. However, few studies have examined epigenetic patterns in preschool-age children at-risk for obesity despite the relevance of this developmental stage to trajectories of weight gain. We hypothesized that salivary DNA methylation patterns of key obesogenic genes in Hispanic children would 1) correlate with maternal BMI and 2) allow for identification of pathways associated with children at-risk for obesity. Genome-wide DNA methylation was conducted on 92 saliva samples collected from Hispanic preschool children using the Infinium Illumina HumanMethylation 450 K BeadChip (Illumina, San Diego, CA, USA), which interrogates >484,000 CpG sites associated with ~24,000 genes. The analysis was limited to 936 genes that have been associated with obesity in a prior GWAS Study. Child DNA methylation at 17 CpG sites was found to be significantly associated with maternal BMI, with increased methylation at 12 CpG sites and decreased methylation at 5 CpG sites. Pathway analysis revealed methylation at these sites related to homocysteine and methionine degradation as well as cysteine biosynthesis and circadian rhythm. Furthermore, eight of the 17 CpG sites reside in genes (FSTL1, SORCS2, NRF1, DLC1, PPARGC1B, CHN2, NXPH1) that have prior known associations with obesity, diabetes, and the insulin pathway. Our study confirms that saliva is a practical human tissue to obtain in community settings and in pediatric populations. These salivary findings indicate potential epigenetic differences in Hispanic preschool children at risk for pediatric obesity. Identifying early biomarkers and understanding pathways that are epigenetically regulated during this critical stage of child development may present an opportunity for prevention or early intervention for addressing childhood obesity. The clinical trial protocol is available at ClinicalTrials.gov ( NCT01316653 ). Registered 3 March 2011.

  16. Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

    PubMed

    Katz, P S

    1998-11-16

    Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

  17. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  19. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  20. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  1. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  2. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  3. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  4. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  5. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  6. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  7. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  8. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  9. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

  10. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

    PubMed Central

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-01-01

    Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

  11. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  12. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

  13. Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

    PubMed

    Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

    2016-01-01

    Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

  14. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  15. DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

    PubMed

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-28

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

  16. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  17. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  18. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  20. Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

    PubMed

    Kalveram, K T

    1991-01-01

    A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

  1. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  2. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  3. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

    PubMed

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-12-01

    Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  4. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  5. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  6. Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

    PubMed Central

    Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

    2017-01-01

    Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

  7. DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

    PubMed

    Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

    2016-09-01

    The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  9. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  10. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  11. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  12. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  13. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  14. Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

    PubMed

    Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

    2008-12-20

    The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

  15. Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-05-01

    We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

  16. Analysis of RET promoter CpG island methylation using methylation-specific PCR (MSP), pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM): impact on stage II colon cancer patient outcome.

    PubMed

    Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle

    2016-01-01

    Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested-MSP, pyrosequencing, and MS-HRM varied, the prognostic effect seemed similar (HR 1.74, 95 % CI 0.97-3.15; HR 1.85, 95 % CI 0.93-3.86; HR 1.83, 95 % CI 0.92-3.65, respectively). Our results show that upon optimizing and aligning four RET methylation assays with regard to primer location and sensitivity, differences in methylation frequencies and clinical sensitivities are observed; however, the effect on the marker's prognostic outcome is minimal.

  17. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  18. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  19. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    PubMed Central

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

  20. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

    PubMed

    Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-08-01

    The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

  1. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

    2010-01-01

    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  2. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  3. Assessing Clinical Microbiology Practice Guidelines: American Society for Microbiology Ad Hoc Committee on Evidence-Based Laboratory Medicine Practice Guidelines Assessment

    PubMed Central

    Kirn, Thomas J.; Westblade, Lars F.; Humphries, Romney

    2017-01-01

    ABSTRACT As part of the American Society for Microbiology (ASM) Evidence-Based Laboratory Medicine Practice Guidelines Committee of the Professional Practice Committee, an ad hoc committee was formed in 2014 to assess guidelines published by the committee using an assessment tool, Appraisal of Guidelines for Research Evaluation II (AGREE II). The AGREE II assessment helps reviewers determine whether published guidelines are robust, transparent, and clear in presenting practice recommendations in a standardized manner. Identifying strengths and weaknesses of practice guidelines by ad hoc assessments helps with improving future guidelines through the participation of key stakeholders. This minireview describes the development of the ad hoc committee and results from their review of several ASM best practices guidelines and a non-ASM practice guideline from the Emergency Nurses Association. PMID:28835476

  4. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

  5. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  6. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  7. Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

    PubMed Central

    Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

    2005-01-01

    Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

  8. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  9. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  10. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  11. Assessing Clinical Microbiology Practice Guidelines: American Society for Microbiology Ad Hoc Committee on Evidence-Based Laboratory Medicine Practice Guidelines Assessment.

    PubMed

    Nachamkin, Irving; Kirn, Thomas J; Westblade, Lars F; Humphries, Romney

    2017-11-01

    As part of the American Society for Microbiology (ASM) Evidence-Based Laboratory Medicine Practice Guidelines Committee of the Professional Practice Committee, an ad hoc committee was formed in 2014 to assess guidelines published by the committee using an assessment tool, Appraisal of Guidelines for Research Evaluation II (AGREE II). The AGREE II assessment helps reviewers determine whether published guidelines are robust, transparent, and clear in presenting practice recommendations in a standardized manner. Identifying strengths and weaknesses of practice guidelines by ad hoc assessments helps with improving future guidelines through the participation of key stakeholders. This minireview describes the development of the ad hoc committee and results from their review of several ASM best practices guidelines and a non-ASM practice guideline from the Emergency Nurses Association. Copyright © 2017 American Society for Microbiology.

  12. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  13. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  14. Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

    PubMed

    Ragone, M I; Torres, N S; Consolini, A E

    2013-02-01

    To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  15. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  16. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  17. Promoter methylation assay of SASH1 gene in breast cancer.

    PubMed

    Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

    2013-01-01

    To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

  18. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  19. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  20. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  1. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  2. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  3. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  4. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  5. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  6. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  7. Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

    PubMed

    Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

    2018-02-01

    Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

  8. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  9. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

    PubMed

    Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

    2017-10-20

    We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

  10. Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

    PubMed Central

    Lee, Wei-Chung Allen; Nedivi, Elly

    2011-01-01

    cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

  11. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  12. Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

    PubMed

    Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

    2013-11-07

    We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

  13. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  14. A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

    NASA Astrophysics Data System (ADS)

    Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

    2017-05-01

    The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

  15. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

    PubMed Central

    2010-01-01

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

  16. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

    PubMed

    Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

    2010-02-05

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

  17. Are nutrition messages lost in transmission? Assessing the quality and consistency of diabetes guideline recommendations on the delivery of nutrition therapy.

    PubMed

    Hale, Kelli; Capra, Sandra; Bauer, Judy

    2016-12-01

    To provide an overview of (1) the consistency of Type 2 Diabetes Clinical Practice Guidelines recommendations on the delivery of nutrition therapy and (2) Clinical Practice Guideline quality. Large international clinical practice guideline repositories, diabetes organisation websites, and electronic databases (Pubmed, Scopus), were searched to identify Clinical Practice Guidelines for adults with type 2 diabetes published 2005 to August 2014. Recommendations on the delivery of nutrition therapy were extracted and inductive content analysis was used to analyse consistency. Two researchers independently assessed guideline quality using the AGREE II tool. Nine topics were identified from the recommendations. Overall the consistency of the recommendations was related to guideline type. Compared with nutrition-specific guidelines, the broad ones had a broader focus and included more patient-focused recommendations. The ten Clinical Practice Guidelines assessed included six broad guidelines and four nutrition specific guidelines. Based on AGREE II analysis, the broad guidelines were higher quality than nutrition-specific ones. Broad Clinical Practice Guidelines were higher quality and included more patient-focused recommendations than nutrition-specific ones. Our findings suggest a need for nutrition-specific guidelines to be modified to include greater patient-focus, or for practitioners delivering nutrition therapy to adopt broad Clinical Practice Guidelines. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Quality in the pharmaceutical industry - A literature review.

    PubMed

    Haleem, Reham M; Salem, Maissa Y; Fatahallah, Faten A; Abdelfattah, Laila E

    2015-10-01

    The aim of this study is to:a.Highlight the most important guidelines and practices of quality in the pharmaceutical industry.b.Organize such guidelines and practices to create a guide to pave the way for other researchers who would like to dig deeper into these guidelines and practices. A review was conducted of 102 publications; 56 publications were concerned with the pharmaceutical quality directly while 46 publications were concerned with the general quality practices. The content of those sources was analyzed and the following themes were identified:a.Research theme 1: Guidelines of the pharmaceutical quality.b.Research theme 2: General practices recently applied in the pharmaceutical industry. The following guidelines were identified and reviewed: WHO guidelines, FDA guidelines, EU guidelines and ICH guidelines in the research theme I. In research theme II; the following topics were identified and reviewed: quality risk management, quality by design, corrective actions and preventive actions, process capability analysis, Six Sigma, process analytical technology, lean manufacturing, total quality management, ISO series and HACCP. Upon reviewing the previously highlighted guidelines and the practices that are widely applied in the pharmaceutical industry, it was noticed that there is an abundant number of papers and articles that explain the general guidelines and practices but the literature lack those describing application; case studies of the pharmaceutical factories applying those guidelines and significance of those guidelines and practices. It is recommended that the literature would invest more in the area of application and significance of guidelines and practices. New case studies should be done to prove the feasibility of such practices.

  19. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    PubMed Central

    2010-01-01

    Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

  20. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  1. Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

    PubMed

    Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

    2013-10-01

    Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

  2. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  3. Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

    PubMed

    Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

    2017-04-04

    Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

  4. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  5. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    PubMed Central

    Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

    2004-01-01

    Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

  7. 42 CFR 438.236 - Practice guidelines.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Practice guidelines. 438.236 Section 438.236 Public... Improvement Standards § 438.236 Practice guidelines. (a) Basic rule: The State must ensure, through its...) Adoption of practice guidelines. Each MCO and, when applicable, each PIHP and PAHP adopts practice...

  8. Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

    PubMed Central

    Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

    2018-01-01

    Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

  9. Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

    PubMed

    Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

    2018-03-01

    Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

  10. CpG Distribution and Methylation Pattern in Porcine Parvovirus

    PubMed Central

    Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

    2013-01-01

    Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

  11. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  12. [Progress in methodological characteristics of clinical practice guideline for osteoarthritis].

    PubMed

    Xing, D; Wang, B; Lin, J H

    2017-06-01

    At present, several clinical practice guidelines for the treatment of osteoarthritis have been developed by institutes or societies. The ultimate purpose of developing clinical practice guidelines is to formulate the process in the treatment of osteoarthritis effectively. However, the methodologies used in developing clinical practice guidelines may place an influence on the transformation and application of that in treating osteoarthritis. The present study summarized the methodological features of individual clinical practice guideline and presented the tools for quality evaluation of clinical practice guideline. The limitations of current osteoarthritis guidelines of China are also indicated. The review article might help relevant institutions improve the quality in developing guide and clinical transformation.

  13. Crafting practice guidelines in the world of evidence-based medicine.

    PubMed

    Chung, Kevin C; Shauver, Melissa J

    2009-10-01

    In the era of exponential increase in the medical literature, physicians and health policy-makers are relying on well-constructed, evidence-based practice guidelines to help ensure that the care given to patients is based on valid, scientific data. The construction of practice guidelines, however, may not always adhere to accepted research protocol. In this article, the authors detail the steps required to produce effective, evidence-based practice guidelines. The seven essential steps in crafting a practice guideline are presented: (1) defining a topic, (2) selecting a work group, (3) performing a literature review, (4) writing the guideline, (5) peer review, (6) making plans for review and revision, and (7) dissemination. Given the importance of practice guidelines in supporting everyday practice, this article strives to provide a practical guide in the development of this key component of evidence-based medicine.

  14. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Quality in the pharmaceutical industry – A literature review

    PubMed Central

    Haleem, Reham M.; Salem, Maissa Y.; Fatahallah, Faten A.; Abdelfattah, Laila E.

    2013-01-01

    Objectives The aim of this study is to:a.Highlight the most important guidelines and practices of quality in the pharmaceutical industry.b.Organize such guidelines and practices to create a guide to pave the way for other researchers who would like to dig deeper into these guidelines and practices. Design A review was conducted of 102 publications; 56 publications were concerned with the pharmaceutical quality directly while 46 publications were concerned with the general quality practices. The content of those sources was analyzed and the following themes were identified:a.Research theme 1: Guidelines of the pharmaceutical quality.b.Research theme 2: General practices recently applied in the pharmaceutical industry. Main outcome measures The following guidelines were identified and reviewed: WHO guidelines, FDA guidelines, EU guidelines and ICH guidelines in the research theme I. In research theme II; the following topics were identified and reviewed: quality risk management, quality by design, corrective actions and preventive actions, process capability analysis, Six Sigma, process analytical technology, lean manufacturing, total quality management, ISO series and HACCP. Results Upon reviewing the previously highlighted guidelines and the practices that are widely applied in the pharmaceutical industry, it was noticed that there is an abundant number of papers and articles that explain the general guidelines and practices but the literature lack those describing application; case studies of the pharmaceutical factories applying those guidelines and significance of those guidelines and practices. Conclusions It is recommended that the literature would invest more in the area of application and significance of guidelines and practices. New case studies should be done to prove the feasibility of such practices. PMID:26594110

  17. Implementation of national comprehensive cancer network evidence-based guidelines to prevent and treat cancer-related infections.

    PubMed

    Wood, Sylvia K; Payne, Judith K

    2012-06-01

    Clinical practice guidelines are an important result of evidence-based research. However, current clinical practice remains out of step with the rapid pace of research advancements. Often, decades pass before research is translated into clinical practice. The National Comprehensive Cancer Network (NCCN) has created evidence-based clinical guidelines to promote effective clinical practice. Formerly, the NCCN established guidelines to reduce cancer-related infections only for neutropenic patients; however, they have expanded their guidelines beyond neutropenia to prevent and treat cancer-related infections. Implementing scientific evidence into clinical practice is challenging and complex, and healthcare professionals should understand barriers to implementing clinical practice guidelines to ensure successful translation into practice. This article provides a brief review of NCCN guidelines and describes common barriers encountered during implementation. In addition, a conceptual framework is offered to help identify and address potential concerns before and after adoption of guidelines.

  18. Critical factors influencing physicians' intention to use computerized clinical practice guidelines: an integrative model of activity theory and the technology acceptance model.

    PubMed

    Hsiao, Ju-Ling; Chen, Rai-Fu

    2016-01-16

    With the widespread use of information communication technologies, computerized clinical practice guidelines are developed and considered as effective decision supporting tools in assisting the processes of clinical activities. However, the development of computerized clinical practice guidelines in Taiwan is still at the early stage and acceptance level among major users (physicians) of computerized clinical practice guidelines is not satisfactory. This study aims to investigate critical factors influencing physicians' intention to computerized clinical practice guideline use through an integrative model of activity theory and the technology acceptance model. The survey methodology was employed to collect data from physicians of the investigated hospitals that have implemented computerized clinical practice guidelines. A total of 505 questionnaires were sent out, with 238 completed copies returned, indicating a valid response rate of 47.1 %. The collected data was then analyzed by structural equation modeling technique. The results showed that attitudes toward using computerized clinical practice guidelines (γ = 0.451, p < 0.001), organizational support (γ = 0.285, p < 0.001), perceived usefulness of computerized clinical practice guidelines (γ = 0.219, p < 0.05), and social influence (γ = 0.213, p < 0.05) were critical factors influencing physicians' intention to use computerized clinical practice guidelines, and these factors can explain 68.6 % of the variance in intention to use computerized clinical practice guidelines. This study confirmed that some subject (human) factors, environment (organization) factors, tool (technology) factors mentioned in the activity theory should be carefully considered when introducing computerized clinical practice guidelines. Managers should pay much attention on those identified factors and provide adequate resources and incentives to help the promotion and use of computerized clinical practice guidelines. Through the appropriate use of computerized clinical practice guidelines, the clinical benefits, particularly in improving quality of care and facilitating the clinical processes, will be realized.

  19. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  20. A pan-Canadian practice guideline and algorithm: screening, assessment, and supportive care of adults with cancer-related fatigue

    PubMed Central

    Howell, D.; Keller–Olaman, S.; Oliver, T.K.; Hack, T.F.; Broadfield, L.; Biggs, K.; Chung, J.; Gravelle, D.; Green, E.; Hamel, M.; Harth, T.; Johnston, P.; McLeod, D.; Swinton, N.; Syme, A.; Olson, K.

    2013-01-01

    Purpose The purpose of the present systematic review was to develop a practice guideline to inform health care providers about screening, assessment, and effective management of cancer-related fatigue (crf) in adults. Methods The internationally endorsed adapte methodology was used to develop a practice guideline for pan-Canadian use. A systematic search of the literature identified a broad range of evidence: clinical practice guidelines, systematic reviews, and other guidance documents on the screening, assessment, and management of crf. The search included medline, embase, cinahl, the Cochrane Library, and other guideline and data sources to December 2009. Results Two clinical practice guidelines were identified for adaptation. Seven guidance documents and four systematic reviews also provided supplementary evidence to inform guideline recommendations. Health professionals across Canada provided expert feedback on the adapted recommendations in the practice guideline and algorithm through a participatory external review process. Conclusions Practice guidelines can facilitate the adoption of evidence-based assessment and interventions for adult cancer patients experiencing fatigue. Development of an algorithm to guide decision-making in practice may also foster the uptake of a guideline into routine care. PMID:23737693

  1. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

    PubMed

    Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

    2003-09-01

    In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

  2. On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

    PubMed Central

    Amrollah, Elmira; Henaff, Patrick

    2010-01-01

    This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

  3. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  4. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  5. Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

    PubMed

    Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

    2016-12-01

    For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  7. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  8. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  10. Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

    PubMed

    Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

    2011-08-26

    Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

  12. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  13. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  14. Pressure Ulcers in Adults: Prediction and Prevention. Clinical Practice Guideline Number 3.

    ERIC Educational Resources Information Center

    Agency for Health Care Policy and Research (DHHS/PHS), Rockville, MD.

    This package includes a clinical practice guideline, quick reference guide for clinicians, and patient's guide to predicting and preventing pressure ulcers in adults. The clinical practice guideline includes the following: overview of the incidence and prevalence of pressure ulcers; clinical practice guideline (introduction, risk assessment tools…

  15. Evaluating Evidence-Based Intervention to Prevent Fall and Pressure Ulcers

    DTIC Science & Technology

    2011-12-20

    Group 1 and 2 attended EBP ED. Out of this group , 205 completed a pretest and 213 completed a posttest for CPG knowledge uptake. In group 1, ninety...various times and locations while supporting the staffing needs of the nursing care unit. This adjustment extended the timeline by one month. Group ...structured EBP education focusing on translation of research into practice for all nurses involved in this initiative to include clinicians, managers, and

  16. Clinical practice guidelines and consensus statements in oncology--an assessment of their methodological quality.

    PubMed

    Jacobs, Carmel; Graham, Ian D; Makarski, Julie; Chassé, Michaël; Fergusson, Dean; Hutton, Brian; Clemons, Mark

    2014-01-01

    Consensus statements and clinical practice guidelines are widely available for enhancing the care of cancer patients. Despite subtle differences in their definition and purpose, these terms are often used interchangeably. We systematically assessed the methodological quality of consensus statements and clinical practice guidelines published in three commonly read, geographically diverse, cancer-specific journals. Methods Consensus statements and clinical practice guidelines published between January 2005 and September 2013 in Current Oncology, European Journal of Cancer and Journal of Clinical Oncology were evaluated. Each publication was assessed using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) rigour of development and editorial independence domains. For assessment of transparency of document development, 7 additional items were taken from the Institute of Medicine's standards for practice guidelines and the Journal of Clinical Oncology guidelines for authors of guidance documents. Consensus statements and clinical practice guidelines published between January 2005 and September 2013 in Current Oncology, European Journal of Cancer and Journal of Clinical Oncology were evaluated. Each publication was assessed using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) rigour of development and editorial independence domains. For assessment of transparency of document development, 7 additional items were taken from the Institute of Medicine's standards for practice guidelines and the Journal of Clinical Oncology guidelines for authors of guidance documents. Thirty-four consensus statements and 67 clinical practice guidelines were evaluated. The rigour of development score for consensus statements over the three journals was 32% lower than that of clinical practice guidelines. The editorial independence score was 15% lower for consensus statements than clinical practice guidelines. One journal scored consistently lower than the others over both domains. No journals adhered to all the items related to the transparency of document development. One journal's consensus statements endorsed a product made by the sponsoring pharmaceutical company in 64% of cases. Guidance documents are an essential part of oncology care and should be subjected to a rigorous and validated development process. Consensus statements had lower methodological quality than clinical practice guidelines using AGREE II. At a minimum, journals should ensure that that all consensus statements and clinical practice guidelines adhere to AGREE II criteria. Journals should consider explicitly requiring guidelines to declare pharmaceutical company sponsorship and to identify the sponsor's product to enhance transparency.

  17. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  18. [Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

    PubMed

    Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

    2012-01-01

    The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

  19. CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

    PubMed

    Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

    2010-11-23

    Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. Translating knowledge into best practice care bundles: a pragmatic strategy for EBP implementation via moving postprocedural pain management nursing guidelines into clinical practice.

    PubMed

    Saunders, Hannele

    2015-07-01

    To describe quantitative and qualitative best evidence as sources for practical interventions usable in daily care delivery in order to integrate best evidence into clinical decision-making at local practice settings. To illustrate the development, implementation and evaluation of a pain management nursing care bundle based on a clinical practice guideline via a real-world clinical exemplar. Successful implementation of evidence-based practice requires consistent integration of best evidence into daily clinical decision-making. Best evidence comprises high-quality knowledge summarised in systematic reviews and translated into guidelines. However, consistent integration of guidelines into care delivery remains challenging, partly due to guidelines not being in a usable form for daily practice or relevant for the local context. A position paper with a clinical exemplar of a nurse-led, evidence-based quality improvement project to design, implement and evaluate a pain management care bundle translated from a national nursing guideline. A pragmatic approach to integrating guidelines into daily practice is presented. Best evidence from a national nursing guideline was translated into a pain management care bundle and integrated into daily practice in 15 medical-surgical (med-surg) units of nine hospitals of a large university hospital system in Finland. Translation of best evidence from guidelines into usable form as care bundles adapted to the local setting may increase implementation and uptake of guidelines and improve quality and consistency of care delivery. A pragmatic approach to translating a nursing guideline into a pain management care bundle to incorporate best evidence into daily practice may help achieve more consistent and equitable integration of guidelines into care delivery, and better quality of pain management and patient outcomes. © 2015 John Wiley & Sons Ltd.

  1. Use of clinical practice guidelines by dentists: findings from the Japanese dental practice-based research network.

    PubMed

    Kakudate, Naoki; Yokoyama, Yoko; Sumida, Futoshi; Matsumoto, Yuki; Gordan, Valeria V; Gilbert, Gregg H

    2017-02-01

    The objectives of this study were to: (1) examine differences in the use of dental clinical practice guidelines among Japanese dentists, and (2) identify characteristics associated with the number of guidelines used by participating dentists. We conducted a cross-sectional study consisting of a questionnaire survey in Japan between July 2014 and May 2015. The study queried dentists working in outpatient dental practices who are affiliated with the Dental Practice-Based Research Network Japan (n = 148). They were asked whether they have used each of 15 Japanese dental clinical guidelines. Associations between the number of guidelines used by participants and specific characteristics were analysed via negative binomial regression analysis. The mean number of guidelines used by participating dentists was 2.5 ± 2.9 [standard deviation (SD)]. Rate of use of guidelines showed substantial variation, from 5% to 34% among dentists. The proportion of dentists that used guidelines was the highest among oral medicine specialists, who had the highest proportion for 10 of 15 guidelines. Negative binomial regression analysis identified three factors significantly associated with the number of guidelines used: 'years since graduation from dental school', 'specialty practice' and 'practice busyness'. These results suggest that the use of clinical practice guidelines by Japanese dentists may still be inadequate. Training in the use of the guidelines could be given to dental students as undergraduate education and to young clinicians as continuing education. © 2016 John Wiley & Sons, Ltd.

  2. Practice guidelines need to address the 'how' and the 'what' of implementation.

    PubMed

    McKillop, Ann; Crisp, Jackie; Walsh, Kenneth

    2012-01-01

    The aim of this study was to explore the realities of everyday nursing practice associated with the implementation of a guideline for the assessment and management of cardiovascular risk. The use of clinical practice guidelines is pivotal to improving health outcomes. However, the implementation of guidelines into practice is complex, unpredictable and, in spite of much investigation, remains resistant to explanation of what works and why. Exploration of the nature of guideline implementation has the potential to illuminate the complexities of guideline implementation by focussing on the nature of practice. Nurses are well placed at the front line of primary health care to contribute to an understanding of how guideline implementation plays out in their everyday practice. Qualitative description was used, involving focus groups and interviews with 32 participants (20 nurses, four doctors, five managers and three funder/planners), to explore the use of a guideline in everyday primary health-care practice. Thematic analysis of data was managed through an inductive process of familiarisation, coding, categorising and generation of themes. Four themes were generated from the data portraying the realities of guideline implementation for primary health-care nurses: self-managing patient, everyday nursing practice, developing new relationships in the health team and impact on health-care delivery. The findings reveal that, even with the best of intentions to implement the guideline, health professionals were frustrated and at a loss as to how to achieve that in practice. Consequently, cardiovascular risk assessment and management was uneven and fragmented. Primary health-care practice environments vary so much that solutions to the difficulties of implementing evidence into practice requires context-specific solution-finding through collaborative teamwork. Furthermore, the attention of guideline developers, health-care policymakers, funders and researchers requires direct focus on the 'how' and the 'what' of evidence implementation.

  3. Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

    PubMed Central

    Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

    2017-01-01

    Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

  4. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    PubMed

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  5. Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

    PubMed

    Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

    2018-02-01

    In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

  6. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  7. [Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

    PubMed

    Fu, J; Su, Y; Liu, Y; Zhang, X Y

    2018-04-09

    Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

  8. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

    PubMed Central

    Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

    2006-01-01

    In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

  9. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  10. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  11. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  12. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  13. Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

    PubMed

    Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

    2018-05-16

    Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

  14. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

    PubMed

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-07-25

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

  15. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

    PubMed Central

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-01-01

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

  16. DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

    PubMed

    Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

    2018-05-02

    Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

  17. A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

    PubMed Central

    Shen, Hong; Iwasaki, Akiko

    2006-01-01

    Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

  18. The contribution of a central pattern generator in a reflex-based neuromuscular model

    PubMed Central

    Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

    2014-01-01

    Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

  19. Best practice guidelines for stroke in Cameroon: An innovative and participatory knowledge translation project.

    PubMed

    Cockburn, Lynn; Fanfon, Timothy N; Bramall, Alexa; Ngole, Eta M; Kuwoh, Pius; Anjonga, Emmanuel; Difang, Brenda M E; Kiani, Shirin; Muso, Petra S; Trivedi, Navjyot; Sama, Julius; Teboh, Sylvian

    2014-01-01

    Although the adherence to stroke guidelines in high-income countries has been shown to be associated with improved patient outcomes, the research, development and implementation of rehabilitation related guidelines in African countries is lacking. The purpose of this article is to describe how a group of front-line practitioners collaborated with academics and students to develop best practice guidelines (BPG) for the management and rehabilitation of stroke in adult patients in Cameroon. A working group was established and adapted internationally recognised processes for the development of best practice guidelines. The group determined the scope of the guidelines, documented current practices, and critically appraised evidence to develop guidelines relevant to the Cameroon context. The primary result of this project is best practice guidelines which provided an overview of the provision of stroke rehabilitation services in the region, and made 83 practice recommendations to improve these services. We also report on the successes and challenges encountered during the process, and the working group's recommendations aimed at encouraging others to consider similar projects. This project demonstrated that there is interest and capacity for improving stroke rehabilitation practices and for stroke guideline development in Africa.

  20. Developmental procedures for the clinical practice guidelines for conscious sedation in dentistry for the Korean Academy of Dental Sciences.

    PubMed

    An, So-Youn; Seo, Kwang-Suk; Kim, Seungoh; Kim, Jongbin; Lee, Deok-Won; Hwang, Kyung-Gyun; Kim, Hyun Jeong

    2016-12-01

    Evidence-based clinical practice guidelines (CPGs) are defined as "statements that are scientifically reviewed about evidence and systematically developed to assist in the doctors' and patients' decision making in certain clinical situations." This recommendation aims to promote good clinical practice for the provision of safe and effective practices of conscious sedation in dentistry. The development of this clinical practice guideline was conducted by performing a systematic search of the literature for evidence-based CPGs. Existing guidelines, relevant systematic reviews, policy documents, legislation, or other recommendations were reviewed and appraised. To supplement this information, key questions were formulated by the Guideline Development Group and used as the basis for designing systematic literature search strategies to identify literature that may address these questions. Guideline documents were evaluated through a review of domestic and international databases for the development of a renewing of existing conscious sedation guidelines for dentistry. Clinical practice guidelines were critically appraised for their methodologies using Appraisal of guidelines for research and evaluation (AGREE) II. A total of 12 existing CPGs were included and 13 recommendations were made in a range of general, adult, and pediatric areas. The clinical practice guidelines for conscious sedation will be reviewed in 5 years' time for further updates to reflect significant changes in the field.

  1. [Clinical practice guidelines (II): searching and critical evaluation].

    PubMed

    Alonso, P; Bonfill, X

    2007-01-01

    Clinical practice guidelines have unique characteristics of the Internet era in which they are starting to be increasingly popular. The fact that they are often elaborated by governmental agencies and are not published in conventional journals means that they may not be accessible using the usual search methods employed for other types of scientific studies and documents (clinical trials, reviews, etc.). The Internet has become an essential tool for locating clinical practice guidelines, and meta-search engines, specific databases, directories, and elaborating institutions are of special importance. The relative lack of indexing of clinical practice guides means that Medline and Embase are not as useful in this context as in searching for original studies. With the aim of evaluating the validity, reproducibility, and reliability of clinical practice guidelines, a series of European institutions designed a tool to evaluate clinical practice guidelines at the end of the 1990s. This instrument, named AGREE, aims to offer a framework for the evaluation of the quality of clinical practice guidelines. It can also be useful in the design of new clinical practice guidelines as well as in the evaluation of the validity of guidelines to be updated or adapted. The AGREE instrument has become the reference for those that use guidelines, those that elaborate them, and for healthcare providers.

  2. [How to assess clinical practice guidelines with AGREE II: The example of neonatal jaundice].

    PubMed

    Renesme, L; Bedu, A; Tourneux, P; Truffert, P

    2016-03-01

    Neonatal jaundice is a very frequent condition that occurs in approximately 50-70% of term or near-term (>35 GA) babies in the 1st week of life. In some cases, a high bilirubin blood level can lead to kernicterus. There is no consensus for the management of neonatal jaundice and few countries have published national clinical practice guidelines for the management of neonatal jaundice. The aim of this study was to assess the quality of these guidelines. We conducted a systematic review of the literature for national clinical practice guidelines for the management of neonatal jaundice in term or near-term babies. Four independent reviewers assessed the quality of each guideline using the AGREE II evaluation. For each of the clinical practice guidelines, the management modalities were analyzed (screening, treatment, follow-up, etc.). Seven national clinical practice guidelines were found (South Africa, USA AAP, UK NICE, Canada, Norway, Switzerland, and Israel). The AGREE II score showed widespread variation regarding the quality of these national guidelines. There was no major difference between the guidelines concerning the clinical management of these babies. The NICE guideline is the most valuable guideline regarding the AGREE II score. NICE showed that, despite a strong and rigorous methodology, there is no evidenced-based recommended code of practice (RCP). Comparing RCPs, we found no major differences. The NICE guideline showed the best quality. The AGREE II instrument should be used as a framework when developing clinical practice guidelines to improve the quality of the future guideline. In France, a national guideline is needed for a more standardized management of neonatal jaundice. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. Attitudes, knowledge and behavior of Japanese physical therapists with regard to evidence-based practice and clinical practice guidelines: a cross-sectional mail survey

    PubMed Central

    Fujimoto, Shuhei; Kon, Noriko; Takasugi, Jun; Nakayama, Takeo

    2017-01-01

    [Purpose] This study aimed to investigate Japanese physical therapists’ attitudes of evidence-based practice and clinical practice guidelines. [Subjects and Methods] In 2014, a cross-sectional postal mail survey using a self-administered questionnaire was conducted. Of 2,982 physical therapists belonging to the Chiba Prefecture Physical Therapist Association, 1,000 were randomly selected. The questionnaire comprised 42 items pertaining to the attitudes of and behavior toward evidence-based practice and clinical practice guidelines. It was investigated to reveal the relationship between clinical practice guidelines/evidence-based practice and therapist characteristics. [Results] The response rate was 39.6%, and 384 questionnaires were available. The main results were as follows: 83.3% participants agreed to the importance of evidence-based practice, 77.1% agree to that evidence-based practice supports clinical decision of physical therapists, and about 11% agreed to have been educated about evidence-based practice. Then, 29.2% used, 54.9% agreed to the importance of, and 13.3% agreed to the utility of clinical practice guidelines. An important factor related mostly to a positive attitude, knowledge and behavior of evidence-based practice and clinical practice guidelines was participating in research activities. [Conclusion] Many of physical therapists do not use and understand the importance of clinical practice guidelines. Participating in research activities may partially contribute to improving these conditions. PMID:28265139

  4. Guidelines to the Practice of Anesthesia - Revised Edition 2018.

    PubMed

    Dobson, Gregory; Chong, Matthew; Chow, Lorraine; Flexman, Alana; Kurrek, Matthew; Laflamme, Claude; Lagacé, Annie; Stacey, Shean; Thiessen, Barton

    2018-01-01

    The Guidelines to the Practice of Anesthesia Revised Edition 2018 (the Guidelines) were prepared by the Canadian Anesthesiologists' Society (CAS), which reserves the right to determine their publication and distribution. The Guidelines are subject to revision and updated versions are published annually. The Guidelines to the Practice of Anesthesia Revised Edition 2018 supersedes all previously published versions of this document. Although the CAS encourages Canadian anesthesiologists to adhere to its practice guidelines to ensure high-quality patient care, the CAS cannot guarantee any specific patient outcome. Anesthesiologists should exercise their own professional judgement in determining the proper course of action for any patient's circumstances. The CAS assumes no responsibility or liability for any error or omission arising from the use of any information contained in its Guidelines to the Practice of Anesthesia.

  5. Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

    DTIC Science & Technology

    2012-09-01

    tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

  6. WHO Expert Committee on specifications for pharmaceutical preparations.

    PubMed

    2010-01-01

    The Expert Committee on Specifications for Pharmaceutical Preparations works towards clear, independent and practical standards and guidelines for the quality assurance of medicines. Standards are developed by the Committee through worldwide consultation and an international consensus-building process. The following new guidelines were adopted and recommended for use: good practices for pharmaceutical quality control laboratories; supplementary guidelines for active pharmaceutical ingredients; good manufacturing practices for pharmaceutical products containing hazardous substances; good manufacturing practices for sterile pharmaceutical products; good distribution practices for pharmaceutical products; guidelines on the requalification of prequalified dossiers: and guidelines for the preparation of a contract research organization master file.

  7. DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

    PubMed

    Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

    2014-12-01

    Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

  8. Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

    PubMed Central

    Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

    2012-01-01

    Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

  9. Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

    NASA Astrophysics Data System (ADS)

    Frederickson, Lee Thomas

    Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

  10. Critical appraisal of clinical practice guidelines in pediatric infectious diseases.

    PubMed

    Wilby, Kyle John; Black, Emily Kathleen; MacLeod, Claire; Wiens, Matthew; Lau, Tim T Y; Paiva, Maria A; Gorman, Sean

    2015-10-01

    There is a need to critically appraise clinical practice guidelines in order to ensure safe and effective practices are being implemented to optimize patient care. Appraising guidelines within one therapeutic area enable recommendations for improvement during guideline creation and dissemination. Study objectives were to systematically appraise selected published guidelines used in the treatment of pediatric infectious diseases and to make recommendations for improvement throughout the development and dissemination processes. The study occurred between collaborative academic and practice-based institutions located in Canada and Qatar. A literature search identified guidelines for management of pediatric infectious diseases from 1997 to 2013. Each guideline was appraised by four independent assessors, according to the appraisal of guidelines for research and evaluation II (AGREE II) instrument. Standardized domain scores were calculated for each guideline and pooled. Final endorsements for use in clinical practice were also determined. Inter-rater reliability was assessed using intraclass correlation coefficients. Standardized domain scores according to the AGREE II instrument. Twenty guidelines met inclusion criteria and were appraised. Pooled domain scores were: scope and purpose (69.9), stakeholder involvement (40.1), rigour of development (47.1), clarity of presentation (73.4), applicability (23.7), editorial independence (46.7), and overall assessment (55.8). Two (10%) guidelines were recommended for use without revision, 13 (65%) guidelines were recommended with modifications, and 5 (25%) guidelines were not recommended for implementation into practice. Inter-rater reliability was moderate to good with intra-class correlations of 0.65-0.93 per guideline. The majority of appraised guidelines were moderately rated, with a 25% of guidelines not recommended for use. Strategies for improvement require the involvement of all key stakeholders (caregivers, patients, and allied health professionals), and consideration of facilitators, barriers and resource implications during implementation. Additionally, critical appraisal of guidelines should become standard practice prior to adoption into clinical settings.

  11. Financial Relationships between Organizations That Produce Clinical Practice Guidelines and the Biomedical Industry: A Cross-Sectional Study.

    PubMed

    Campsall, Paul; Colizza, Kate; Straus, Sharon; Stelfox, Henry T

    2016-05-01

    Financial relationships between organizations that produce clinical practice guidelines and biomedical companies are vulnerable to conflicts of interest. We sought to determine whether organizations that produce clinical practice guidelines have financial relationships with biomedical companies and whether there are associations between organizations' conflict of interest policies and recommendations and disclosures provided in guidelines. We conducted a cross-sectional survey and review of websites of 95 national/international medical organizations that produced 290 clinical practice guidelines published on the National Guideline Clearinghouse website from January 1 to December 31, 2012. Survey responses were available for 68% (65/95) of organizations (167/290 guidelines, 58%), and websites were reviewed for 100% (95/95) of organizations (290/290 guidelines, 100%). In all, 63% (60/95) of organizations producing clinical practice guidelines reported receiving funds from a biomedical company; 80% (76/95) of organizations reported having a policy for managing conflicts of interest. Disclosure statements (disclosing presence or absence of financial relationships with biomedical companies) were available in 65% (188/290) of clinical practice guidelines for direct funding sources to produce the guideline, 51% (147/290) for financial relationships of the guideline committee members, and 1% (4/290) for financial relationships of the organizations producing the guidelines. Among all guidelines, 6% (18/290) disclosed direct funding by biomedical companies, 40% (117/290) disclosed financial relationships between committee members and biomedical companies (38% of guideline committee members, 773/2,043), and 1% (4/290) disclosed financial relationships between the organizations producing the guidelines and biomedical companies. In the survey responses, 60 organizations reported the procedures that they included in their conflict of interest policies (158 guidelines): guidelines produced by organizations reporting more comprehensive conflict of interest policies (per additional procedure, range 5-17) included fewer positive (rate ratio [RR] 0.91, 95% CI 0.86-0.95) and more negative (RR 1.32, 95% CI 1.09-1.60) recommendations regarding patented biomedical products. The clinical practice guidelines produced by organizations reporting more comprehensive conflict of interest policies were also more likely to include disclosure statements for direct funding sources (odds ratio [OR] 1.31, 95% CI 1.10-1.56) and financial relationships of guideline committee members (OR 1.36, 95% CI 1.09-1.79), but not financial relationships of the organizations (0 disclosures). Limitations of the study include the use of the National Guideline Clearinghouse as the single source of clinical practice guidelines and the self-report of survey responses and organizations' website postings. Financial relationships between organizations that produce clinical practice guidelines and biomedical companies are common and infrequently disclosed in guidelines. Our study highlights the need for an effective policy to manage organizational conflicts of interest and disclosure of financial relationships.

  12. Meeting patient needs trumps adherence. A cross-sectional study of adherence and adaptations when national guidelines are used in practice.

    PubMed

    Kakeeto, Mikael; Lundmark, Robert; Hasson, Henna; von Thiele Schwarz, Ulrica

    2017-08-01

    In the evidence-to-practice pathway, guidelines are developed to provide a practical summary of evidence and stimulate change. However, when guidelines are used in practice, adherence to the recommendations in guidelines is limited, and adaptations are common. Thus, we need more detailed knowledge about adherence and adaptations when guidelines are used in practice to understand the end of the evidence-to-practice pathway. Subsequently, the aim is to examine adherence to and adaptations of recommendations in the Swedish National Guidelines for Methods of Preventing Disease. A questionnaire was sent to healthcare professionals and managers in Stockholm between January and March 2014. Adherence to the recommendations was compared between practice settings, and the frequency of different adaptations and reasons for adaptations was analysed. Partial adherence to the guidelines was found. The adherence was significantly greater within primary care than at the hospitals (P < .001). Modifications formed the most common category of adaptations (55%) and included mainly prioritization of specific patient groups and increased patient customization. The most common reason for adaptations (25%) was to meet the patients' specific needs and capabilities. This study provides insight into adherence and adaptation when guidelines are used in practice. Work with lifestyle habits was partially done in accordance with the guidelines. Lack of time and lack of resources were not the most common reasons for adaptations. Rather, the findings suggest that when patient needs and capabilities contrast with guideline recommendations, patient needs trump adherence to guidelines. © 2017 John Wiley & Sons, Ltd.

  13. The development of clinical practice guidelines and guidance statements of the American College of Physicians: summary of methods.

    PubMed

    Qaseem, Amir; Snow, Vincenza; Owens, Douglas K; Shekelle, Paul

    2010-08-03

    The American College of Physicians (ACP) established its evidence-based clinical practice guidelines program in 1981. The ACP's Guidelines Committee and the staff of the Clinical Programs and Quality of Care Department develop the clinical recommendations. The ACP develops 2 different types of clinical recommendations: clinical practice guidelines and clinical guidance statements. The ACP clinical practice guidelines and guidance statements follow a multistep development process that includes a systematic review of the evidence, deliberation of the evidence by the committee, summary recommendations, and evidence and recommendation grading. All ACP clinical practice guidelines and clinical guidance statements, if not updated, are considered automatically withdrawn or invalid 5 years after publication or once an update has been issued.

  14. Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

    PubMed

    1999-05-14

    The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

  15. CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

    PubMed

    Liu, Chengju; Chen, Qijun; Wang, Danwei

    2011-06-01

    This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

  16. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    PubMed Central

    Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

    2017-01-01

    In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

  18. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  19. The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

    PubMed

    Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

    2017-09-01

    The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Medical Physics Practice Guideline 4.a: Development, implementation, use and maintenance of safety checklists

    PubMed Central

    de los Santos, E. Fong; Evans, Suzanne; Ford, Eric C.; Gaiser, James E.; Hayden, Sandra E.; Huffman, Kristina E.; Johnson, Jennifer L.; Mechalakos, James G.; Stern, Robin L.; Terezakis, Stephanie; Thomadsen, Bruce R.; Pronovost, Peter J.; Fairobent, Lynne A.

    2015-01-01

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States. The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for the purpose of revision or renewal, as appropriate, on their fifth anniversary or sooner. Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized. The following terms are used in the AAPM practice guidelines: Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline.Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances. PMID:26103502

  1. Medical Physics Practice Guideline 4.a: Development, implementation, use and maintenance of safety checklists.

    PubMed

    Fong de Los Santos, Luis E; Evans, Suzanne; Ford, Eric C; Gaiser, James E; Hayden, Sandra E; Huffman, Kristina E; Johnson, Jennifer L; Mechalakos, James G; Stern, Robin L; Terezakis, Stephanie; Thomadsen, Bruce R; Pronovost, Peter J; Fairobent, Lynne A

    2015-05-08

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States.The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for the purpose of revision or renewal, as appropriate, on their fifth anniversary or sooner.Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized.The following terms are used in the AAPM practice guidelines:Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline.Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances.

  2. AAPM Medical Physics Practice Guideline 5.a.: Commissioning and QA of Treatment Planning Dose Calculations — Megavoltage Photon and Electron Beams

    PubMed Central

    Das, Indra J.; Feygelman, Vladimir; Fraass, Benedick A.; Kry, Stephen F.; Marshall, Ingrid R.; Mihailidis, Dimitris N.; Ouhib, Zoubir; Ritter, Timothy; Snyder, Michael G.; Fairobent, Lynne

    2015-01-01

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States. The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for the purpose of revision or renewal, as appropriate, on their fifth anniversary or sooner. Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized. The following terms are used in the AAPM practice guidelines: Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline.Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances. PMID:26699330

  3. AAPM Medical Physics Practice Guideline 5.a.: Commissioning and QA of Treatment Planning Dose Calculations - Megavoltage Photon and Electron Beams.

    PubMed

    Smilowitz, Jennifer B; Das, Indra J; Feygelman, Vladimir; Fraass, Benedick A; Kry, Stephen F; Marshall, Ingrid R; Mihailidis, Dimitris N; Ouhib, Zoubir; Ritter, Timothy; Snyder, Michael G; Fairobent, Lynne

    2015-09-08

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States. The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for the purpose of revision or renewal, as appropriate, on their fifth anniversary or sooner. Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized. The following terms are used in the AAPM practice guidelines:• Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline.• Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances.

  4. AAPM Medical Physics Practice Guideline 3.a: Levels of supervision for medical physicists in clinical training.

    PubMed

    Seibert, J Anthony; Clements, Jessica B; Halvorsen, Per H; Herman, Michael G; Martin, Melissa C; Palta, Jatinder; Pfeiffer, Douglas E; Pizzutiello, Robert J; Schueler, Beth A; Shepard, S Jeff; Fairobrent, Lynne A

    2015-05-08

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States.The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for the purpose of revision or renewal, as appropriate, on their fifth anniversary or sooner.Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized.The following terms are used in the AAPM practice guidelines:Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline.Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances.

  5. The Role of Health Services Research in Developing Practice Policy: Development of Practice Guidelines.

    ERIC Educational Resources Information Center

    Crall, James J.

    1990-01-01

    The paper offers guidance for the incorporation of treatment effectiveness research into clinical dental practice guidelines. Recommended is inclusion of patients' preferences for different outcomes as well as of clinical outcomes in development of valid practice guidelines. (DB)

  6. Concussion Care Practices and Utilization of Evidence-Based Guidelines in the Evaluation and Management of Concussion: A Survey of New England Emergency Departments.

    PubMed

    Stern, Robert A; Seichepine, Daniel; Tschoe, Christine; Fritts, Nathan G; Alosco, Michael L; Berkowitz, Oren; Burke, Peter; Howland, Jonathan; Olshaker, Jonathan; Cantu, Robert C; Baugh, Christine M; Holsapple, James W

    2017-02-15

    Evidence-based clinical practice guidelines can facilitate proper evaluation and management of concussions in the emergency department (ED), often the initial and primary point of contact for concussion care. There is no universally adopted set of guidelines for concussion management, and extant evidence suggests that there may be variability in concussion care practices and limited application of clinical practice guidelines in the ED. This study surveyed EDs throughout New England to examine current practices of concussion care and utilization of evidence-based clinical practice guidelines in the evaluation and management of concussions. In 2013, a 32-item online survey was e-mailed to 149/168 EDs throughout New England (Connecticut, Rhode Island, Massachusetts, Vermont, New Hampshire, Maine). Respondents included senior administrators asked to report on their EDs use of clinical practice guidelines, neuroimaging decision-making, and discharge instructions for concussion management. Of the 72/78 respondents included, 35% reported absence of clinical practice guidelines, and 57% reported inconsistency in the type of guidelines used. Practitioner preference guided neuroimaging decision-making for 57%. Although 94% provided written discharge instructions, there was inconsistency in the recommended time frame for follow-up care (13% provided no specific time frame), the referral specialist to be seen (25% did not recommend any specialist), and return to activity instructions were inconsistent. There is much variability in concussion care practices and application of evidence-based clinical practice guidelines in the evaluation and management of concussions in New England EDs. Knowledge translational efforts will be critical to improve concussion management in the ED setting.

  7. Librarian contributions to clinical practice guidelines.

    PubMed

    Cruse, Peggy; Protzko, Shandra

    2014-01-01

    Librarians have become more involved in developing high quality systematic reviews. Evidence-based practice guidelines are an extension of systematic reviews and offer another significant area for librarian involvement. This column highlights opportunities and challenges for the librarian working on guideline panels and provides practical considerations for meaningful contributions to the guideline creation process.

  8. Health care delivery for head-and-neck cancer patients in Alberta: a practice guideline

    PubMed Central

    Harris, J.R.; Lau, H.; Surgeoner, B.V.; Chua, N.; Dobrovolsky, W.; Dort, J.C.; Kalaydjian, E.; Nesbitt, M.; Scrimger, R.A.; Seikaly, H.; Skarsgard, D.; Webster, M.A.

    2014-01-01

    Background The treatment of head-and-neck cancer is complex and requires the involvement of various health care professionals with a wide range of expertise. We describe the process of developing a practice guideline with recommendations about the organization and delivery of health care services for head-and-neck cancer patients in Alberta. Methods Outcomes of interest included composition of the health care team, qualification requirements for team members, cancer centre and team member volumes, infrastructure needs, and wait times. A search for existing practice guidelines and a systematic review of the literature addressing the organization and delivery of health care services for head-and-neck cancer patients were conducted. The search included the Standards and Guidelines Evidence (sage) directory of cancer guidelines and PubMed. Results One practice guideline was identified for adaptation. Three additional practice guidelines provided supplementary evidence to inform guideline recommendations. Members of the Alberta Provincial Head and Neck Tumour Team (consisting of various health professionals from across the province) provided expert feedback on the adapted recommendations through an online and in-person review process. Selected experts in head-and-neck cancer from outside the province participated in an external online review. SUMMARY The recommendations outlined in this practice guideline are based on existing guidelines that have been modified to fit the Alberta context. Although specific to Alberta, the recommendations lend credence to similar published guidelines and could be considered for use by groups lacking the resources of appointed guideline panels. The recommendations are meant to be a guide rather than a fixed protocol. The implementation of this practice guideline will depend on many factors, including but not limited to availability of trained personnel, adequate funding of infrastructure, and collaboration with other associations of health care professionals in the province. PMID:25302041

  9. The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

    PubMed

    Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

    2018-02-28

    The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

  10. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

    NASA Astrophysics Data System (ADS)

    Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

    2017-11-01

    In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

  12. Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

    PubMed Central

    Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

    2016-01-01

    To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

  13. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  14. Bridging the gap between guidelines and practice in the management of emerging infectious diseases: a qualitative study of emergency nurses.

    PubMed

    Lam, Stanley Kk; Kwong, Enid Wy; Hung, Maria Sy; Pang, Samantha Mc

    2016-10-01

    To explore the difficulties and strategies regarding guideline implementation among emergency nurses. Emerging infectious diseases remain an underlying source of global health concern. Guidelines for accident and emergency departments would require adjustments for infectious disease management. However, disparities between guidelines and nurses' practice are frequently reported, which undermines the implementation of these guidelines into practice. This article explores the experience of frontline emergency nurses regarding guideline implementation and provides an in-depth account of their strategies in bridging guideline-practice gaps. A qualitative descriptive design was used. Semi-structured, face-to-face, individual interviews were conducted between November 2013-May 2014. A purposive sample of 12 frontline emergency nurses from five accident and emergency departments in Hong Kong were recruited. The audio-recorded interviews were transcribed verbatim and analysed with a qualitative content analysis approach. Four key categories associated with guideline-practice gaps emerged, including getting work done, adapting to accelerated infection control measures, compromising care standards and resolving competing clinical judgments across collaborating departments. The results illustrate that the guideline-practice gaps could be associated with inadequate provision of corresponding organisational supports after guidelines are established. The nurses' experiences have uncovered the difficulties in the implementation of guidelines in emergency care settings and the corresponding strategies used to address these problems. The nurses' experiences reflect their endeavour in adjusting accordingly and adapting themselves to their circumstances in the face of unfeasible guidelines. It is important to customise guidelines to the needs of frontline nurses. Maintaining cross-departmental consensus on guideline interpretation and operation is also indicated as an important component for effective guideline implementation. © 2016 John Wiley & Sons Ltd.

  15. Financial Relationships between Organizations That Produce Clinical Practice Guidelines and the Biomedical Industry: A Cross-Sectional Study

    PubMed Central

    Campsall, Paul; Colizza, Kate; Straus, Sharon; Stelfox, Henry T.

    2016-01-01

    Background Financial relationships between organizations that produce clinical practice guidelines and biomedical companies are vulnerable to conflicts of interest. We sought to determine whether organizations that produce clinical practice guidelines have financial relationships with biomedical companies and whether there are associations between organizations’ conflict of interest policies and recommendations and disclosures provided in guidelines. Methods and Findings We conducted a cross-sectional survey and review of websites of 95 national/international medical organizations that produced 290 clinical practice guidelines published on the National Guideline Clearinghouse website from January 1 to December 31, 2012. Survey responses were available for 68% (65/95) of organizations (167/290 guidelines, 58%), and websites were reviewed for 100% (95/95) of organizations (290/290 guidelines, 100%). In all, 63% (60/95) of organizations producing clinical practice guidelines reported receiving funds from a biomedical company; 80% (76/95) of organizations reported having a policy for managing conflicts of interest. Disclosure statements (disclosing presence or absence of financial relationships with biomedical companies) were available in 65% (188/290) of clinical practice guidelines for direct funding sources to produce the guideline, 51% (147/290) for financial relationships of the guideline committee members, and 1% (4/290) for financial relationships of the organizations producing the guidelines. Among all guidelines, 6% (18/290) disclosed direct funding by biomedical companies, 40% (117/290) disclosed financial relationships between committee members and biomedical companies (38% of guideline committee members, 773/2,043), and 1% (4/290) disclosed financial relationships between the organizations producing the guidelines and biomedical companies. In the survey responses, 60 organizations reported the procedures that they included in their conflict of interest policies (158 guidelines): guidelines produced by organizations reporting more comprehensive conflict of interest policies (per additional procedure, range 5–17) included fewer positive (rate ratio [RR] 0.91, 95% CI 0.86–0.95) and more negative (RR 1.32, 95% CI 1.09–1.60) recommendations regarding patented biomedical products. The clinical practice guidelines produced by organizations reporting more comprehensive conflict of interest policies were also more likely to include disclosure statements for direct funding sources (odds ratio [OR] 1.31, 95% CI 1.10–1.56) and financial relationships of guideline committee members (OR 1.36, 95% CI 1.09–1.79), but not financial relationships of the organizations (0 disclosures). Limitations of the study include the use of the National Guideline Clearinghouse as the single source of clinical practice guidelines and the self-report of survey responses and organizations’ website postings. Conclusions Financial relationships between organizations that produce clinical practice guidelines and biomedical companies are common and infrequently disclosed in guidelines. Our study highlights the need for an effective policy to manage organizational conflicts of interest and disclosure of financial relationships. PMID:27244653

  16. Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

    PubMed

    Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

    2015-01-01

    Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

  17. Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

    PubMed Central

    Endo, Toshiaki; Kiehn, Ole

    2008-01-01

    The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

  18. DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

    PubMed

    Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

    2017-01-01

    The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

  19. Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

    PubMed Central

    Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

    2014-01-01

    While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

  20. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  1. How GPs implement clinical guidelines in everyday clinical practice--a qualitative interview study.

    PubMed

    Le, Jette V; Hansen, Helle P; Riisgaard, Helle; Lykkegaard, Jesper; Nexøe, Jørgen; Bro, Flemming; Søndergaard, Jens

    2015-12-01

    Clinical guidelines are considered to be essential for improving quality and safety of health care. However, interventions to promote implementation of guidelines have demonstrated only partial effectiveness and the reasons for this apparent failure are not yet fully understood. To investigate how GPs implement clinical guidelines in everyday clinical practice and how implementation approaches differ between practices. Individual semi-structured open-ended interviews with seven GPs who were purposefully sampled with regard to gender, age and practice form. Interviews were recorded, transcribed verbatim and then analysed using systematic text condensation. Analysis of the interviews revealed three different approaches to the implementation of guidelines in clinical practice. In some practices the GPs prioritized time and resources on collective implementation activities and organized their everyday practice to support these activities. In other practices GPs discussed guidelines collectively but left the application up to the individual GP whilst others again saw no need for discussion or collective activities depending entirely on the individual GP's decision on whether and how to manage implementation. Approaches to implementation of clinical guidelines vary substantially between practices. Supporting activities should take this into account. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Practice Guidelines for Nutrition in Critically Ill Patients: A Relook for Indian Scenario.

    PubMed

    Mehta, Yatin; Sunavala, J D; Zirpe, Kapil; Tyagi, Niraj; Garg, Sunil; Sinha, Saswati; Shankar, Bhuvaneshwari; Chakravarti, Sanghamitra; Sivakumar, M N; Sahu, Sambit; Rangappa, Pradeep; Banerjee, Tanmay; Joshi, Anshu; Kadhe, Ganesh

    2018-04-01

    Intensive-care practices and settings may differ for India in comparison to other countries. While international guidelines are available to direct the use of enteral nutrition (EN), there are no recommendations specific to Indian settings. Advisory board meetings were arranged to develop the practice guidelines specific to Indian context, for the use of EN in critically ill patients and to overcome challenges in this field. Various existing guidelines, meta-analyses, randomized controlled trials, controlled trials, and review articles were reviewed for their contextual relevance and strength. A systematic grading of practice guidelines by advisory board was done based on strength of the supporting evidence. Wherever Indian studies were not available, references were taken from the international guidelines. Based on the literature review, the recommendations for developing the practice guidelines were made as per the grading criteria agreed upon by the advisory board. The recommendations were to address challenges regarding EN versus parenteral nutrition; nutrition screening and assessment; nutrition in hemodynamically unstable; route of nutrition; tube feeding and challenges; tolerance; optimum calorie-protein requirements; selection of appropriate enteral feeding formula; micronutrients and immune-nutrients; standard nutrition in hepatic, renal, and respiratory diseases and documentation of nutrition practices. This paper summarizes the optimum nutrition practices for critically ill patients. The possible solutions to overcome the challenges in this field are presented as practice guidelines at the end of each section. These guidelines are expected to provide guidance in critical care settings regarding appropriate critical-care nutrition practices and to set up Intensive Care Unit nutrition protocols.

  3. Practice Guidelines for Nutrition in Critically Ill Patients: A Relook for Indian Scenario

    PubMed Central

    Mehta, Yatin; Sunavala, J. D.; Zirpe, Kapil; Tyagi, Niraj; Garg, Sunil; Sinha, Saswati; Shankar, Bhuvaneshwari; Chakravarti, Sanghamitra; Sivakumar, M. N.; Sahu, Sambit; Rangappa, Pradeep; Banerjee, Tanmay; Joshi, Anshu; Kadhe, Ganesh

    2018-01-01

    Background and Aim: Intensive-care practices and settings may differ for India in comparison to other countries. While international guidelines are available to direct the use of enteral nutrition (EN), there are no recommendations specific to Indian settings. Advisory board meetings were arranged to develop the practice guidelines specific to Indian context, for the use of EN in critically ill patients and to overcome challenges in this field. Methods: Various existing guidelines, meta-analyses, randomized controlled trials, controlled trials, and review articles were reviewed for their contextual relevance and strength. A systematic grading of practice guidelines by advisory board was done based on strength of the supporting evidence. Wherever Indian studies were not available, references were taken from the international guidelines. Results: Based on the literature review, the recommendations for developing the practice guidelines were made as per the grading criteria agreed upon by the advisory board. The recommendations were to address challenges regarding EN versus parenteral nutrition; nutrition screening and assessment; nutrition in hemodynamically unstable; route of nutrition; tube feeding and challenges; tolerance; optimum calorie-protein requirements; selection of appropriate enteral feeding formula; micronutrients and immune-nutrients; standard nutrition in hepatic, renal, and respiratory diseases and documentation of nutrition practices. Conclusion: This paper summarizes the optimum nutrition practices for critically ill patients. The possible solutions to overcome the challenges in this field are presented as practice guidelines at the end of each section. These guidelines are expected to provide guidance in critical care settings regarding appropriate critical-care nutrition practices and to set up Intensive Care Unit nutrition protocols. PMID:29743765

  4. Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

    NASA Astrophysics Data System (ADS)

    Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

    2014-02-01

    The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

  5. Output variability across animals and levels in a motor system

    PubMed Central

    Norris, Brian J; Günay, Cengiz; Kueh, Daniel

    2018-01-01

    Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

  6. Attitudes Toward Practice Guidelines Among ICU Personnel: A Cross-Sectional Anonymous Survey

    PubMed Central

    Quiros, Dave; Lin, Susan; Larson, Elaine L

    2007-01-01

    Objectives To assess attitudes of ICU staff members toward practice guidelines in general and toward a specific guideline, CDC's Guideline for Hand Hygiene in Healthcare Settings; to correlate these attitudes with staff and hospital characteristics; and to examine the impact of staff attitudes toward the Hand Hygiene Guideline on self reported implementation of the Guideline. Methods A cross-sectional survey of staff in 70 ICUs in 39 U.S. hospitals, members of The National Nosocomial Infection Surveillance (NNIS) System. A survey, “Attitudes Regarding Practice Guidelines”, was administered anonymously to all willing staff during a site visit at each hospital; 1,359 ICU personnel: 1,003 nurses (74%), 228 physicians (17%), and 128 others (10%) responded. Results Significantly more positive attitudes toward practice guidelines were found among staff in pediatric as compared with adult ICUs (p<0.001). Nurses and other staff when compared with physicians had more positive attitudes toward guidelines in general but not toward the specific Hand Hygiene Guideline. Those with more positive attitudes were significantly more likely to report that they had implemented recommendations of the Guideline (p<0.001) and used an alcohol product for hand hygiene (p=0.002). Conclusions The majority of staff members were familiar with the CDC Hand Hygiene Guideline. Staff attitudes toward practice guidelines varied by type of ICU and by profession, and more positive attitudes were associated with significantly better self-reported guideline implementation. Because differences in staff attitudes might hinder or facilitate their acceptance and adoption of evidence-based practice guidelines, these results may have important implications for the education and/or socialization of ICU staff. PMID:17628198

  7. Concussion Care Practices and Utilization of Evidence-Based Guidelines in the Evaluation and Management of Concussion: A Survey of New England Emergency Departments

    PubMed Central

    Seichepine, Daniel; Tschoe, Christine; Fritts, Nathan G.; Alosco, Michael L.; Berkowitz, Oren; Burke, Peter; Howland, Jonathan; Olshaker, Jonathan; Cantu, Robert C.; Baugh, Christine M.; Holsapple, James W.

    2017-01-01

    Abstract Evidence-based clinical practice guidelines can facilitate proper evaluation and management of concussions in the emergency department (ED), often the initial and primary point of contact for concussion care. There is no universally adopted set of guidelines for concussion management, and extant evidence suggests that there may be variability in concussion care practices and limited application of clinical practice guidelines in the ED. This study surveyed EDs throughout New England to examine current practices of concussion care and utilization of evidence-based clinical practice guidelines in the evaluation and management of concussions. In 2013, a 32-item online survey was e-mailed to 149/168 EDs throughout New England (Connecticut, Rhode Island, Massachusetts, Vermont, New Hampshire, Maine). Respondents included senior administrators asked to report on their EDs use of clinical practice guidelines, neuroimaging decision-making, and discharge instructions for concussion management. Of the 72/78 respondents included, 35% reported absence of clinical practice guidelines, and 57% reported inconsistency in the type of guidelines used. Practitioner preference guided neuroimaging decision-making for 57%. Although 94% provided written discharge instructions, there was inconsistency in the recommended time frame for follow-up care (13% provided no specific time frame), the referral specialist to be seen (25% did not recommend any specialist), and return to activity instructions were inconsistent. There is much variability in concussion care practices and application of evidence-based clinical practice guidelines in the evaluation and management of concussions in New England EDs. Knowledge translational efforts will be critical to improve concussion management in the ED setting. PMID:27112592

  8. Standards and Guidelines in Telemedicine and Telehealth

    PubMed Central

    Krupinski, Elizabeth A.; Bernard, Jordana

    2014-01-01

    The development of guidelines and standards for telemedicine is an important and valuable process to help insure effective and safe delivery of quality healthcare. Some organizations, such as the American Telemedicine Association (ATA), have made the development of standards and guidelines a priority. The practice guidelines developed so far have been well received by the telemedicine community and are being adopted in numerous practices, as well as being used in research to support the practice and growth of telemedicine. Studies that utilize published guidelines not only help bring them into greater public awareness, but they also provide evidence needed to validate existing guidelines and guide the revision of future versions. Telemedicine will continue to grow and be adopted by more healthcare practitioners and patients in a wide variety of forms not just in the traditional clinical environments, and practice guidelines will be a key factor in fostering this growth. Creation of guidelines is important to payers and regulators as well as increasingly they are adopting and integrating them into regulations and policies. This paper will review some of the recent ATA efforts in developing telemedicine practice guidelines, review the role of research in guidelines development, review data regarding their use, and discuss some of areas where guidelines are still needed. PMID:27429261

  9. The rural health care workforce implications of practice guideline implementation.

    PubMed

    Yawn, B P; Casey, M; Hebert, P

    1999-03-01

    Rural health care workforce forecasting has not included adjustments for predictable changes in practice patterns, such as the introduction of practice guidelines. To estimate the impact of a practice guideline for a single health condition on the needs of a rural health professional workforce. The current care of a cohort of rural Medicare recipients with diabetes mellitus was compared with the care recommended by a diabetes practice guideline. The additional tests and visits that were needed to comply with the guideline were translated into additional hours of physician services and total physician full-time equivalents. The implementation of a practice guideline for Medicare recipients with diabetes in rural Minnesota would require over 30,000 additional hours of primary care physician services and over 5,000 additional hours of eye care professionals' time per year. This additional need represents a 1.3% to 2.4% increase in the number of primary care physicians and a 1.0% to 6.6% increase in the number of eye-care clinicians in a state in which the rural medical provider to population ratios already meet some recommended workforce projections. The implementation of practice guidelines could result in an increased need for rural health care physicians or other providers. That increase, caused by guideline implementation, should be accounted for in future rural health care workforce predictions.

  10. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

    2014-01-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

  11. Impact of Clinical Practice Guidelines on Use of Intra-Articular Hyaluronic Acid and Corticosteroid Injections for Knee Osteoarthritis.

    PubMed

    Bedard, Nicholas A; DeMik, David E; Glass, Natalie A; Burnett, Robert A; Bozic, Kevin J; Callaghan, John J

    2018-05-16

    The efficacy of corticosteroid and hyaluronic acid injections for knee osteoarthritis has been questioned. The purpose of this study was to determine the impact of the American Academy of Orthopaedic Surgeons (AAOS) clinical practice guidelines on the use of these injections in the United States and determine if utilization differed by provider specialty. Patients with knee osteoarthritis were identified within the Humana database from 2007 to 2015, and the percentage of patients receiving a knee injection relative to the number of patients having an encounter for knee osteoarthritis was calculated and was trended for the study period. The impact of each edition of the AAOS clinical practice guidelines on injection use was evaluated with segmented regression analysis. Injection trends were also analyzed relative to the specialty of the provider performing the injection. Of 1,065,175 patients with knee osteoarthritis, 405,101 (38.0%) received a corticosteroid injection and 137,005 (12.9%) received a hyaluronic acid injection. The rate of increase in hyaluronic acid use, per 100 patients with knee osteoarthritis, decreased from 0.15 to 0.07 injection per quarter year (p = 0.02) after the first clinical practice guideline, and the increase changed to a decrease at a rate of -0.12 injection per quarter (p < 0.001) after the second clinical practice guideline. After the first clinical practice guideline, the rate of increase in utilization of corticosteroids, per 100 patients with knee osteoarthritis, significantly lessened to 0.12 injection per quarter (p < 0.001), and after the second clinical practice guideline, corticosteroid injection use plateaued (p = 0.72). The trend in use of hyaluronic acid injections by orthopaedic surgeons and pain specialists decreased with time following the second-edition clinical practice guideline but did not change for primary care physicians or nonoperative musculoskeletal providers. Subtle but significant changes in hyaluronic acid and corticosteroid injections occurred following the publication of both clinical practice guidelines. Although the clinical practice guidelines did impact injection use, given the high costs of these injections and their questionable clinical efficacy, further interventions beyond publishing clinical practice guidelines are needed to encourage higher-value care for patients with knee osteoarthritis.

  12. A Systematic Critical Appraisal for Non-Pharmacological Management of Osteoarthritis Using the Appraisal of Guidelines Research and Evaluation II Instrument

    PubMed Central

    Brosseau, Lucie; Rahman, Prinon; Toupin-April, Karine; Poitras, Stéphane; King, Judy; De Angelis, Gino; Loew, Laurianne; Casimiro, Lynn; Paterson, Gail; McEwan, Jessica

    2014-01-01

    Clinical practice CPGs (CPGs) have been developed to summarize evidence related to the management of osteoarthritis (OA). CPGs facilitate uptake of evidence-based knowledge by consumers, health professionals, health administrators and policy makers. The objectives of the present review were: 1) to assess the quality of the CPGs on non-pharmacological management of OA; using a standardized and validated instrument - the Appraisal of Guidelines Research and Evaluation (AGREE II) tool - by three pairs of trained appraisers; and 2) to summarize the recommendations based on only high-quality existing CPGs. Scientific literature databases from 2001 to 2013 were systematically searched for the state of evidence, with 17 CPGs for OA being identified. Most CPGs effectively addressed only a minority of AGREE II domains. Scope and purpose was effectively addressed in 10 CPGs on the management of OA, stakeholder involvement in 12 CPGs, rigour of development in 10 CPGs, clarity/presentation in 17 CPGs, editorial independence in 2 CPGs, and applicability in none of the OA CPGs. The overall quality of the included CPGs, according to the 7-point AGREE II scoring system, is 4.8±0.41 for OA. Therapeutic exercises, patient education, transcutaneous electrical nerve stimulation, acupuncture, orthoses and insoles, heat and cryotherapy, patellar tapping, and weight control are commonly recommended for the non-pharmacological management of OA by the high-quality CPGs. The general clinical management recommendations tended to be similar among high-quality CPGs, although interventions addressed varied. Non-pharmacological management interventions were superficially addressed in more than half of the selected CPGs. For CPGs to be standardized uniform creators should use the AGREE II criteria when developing CPGs. Innovative and effective methods of CPG implementation to users are needed to ultimately enhance the quality of life of arthritic individuals. PMID:24427268

  13. A systematic critical appraisal for non-pharmacological management of osteoarthritis using the appraisal of guidelines research and evaluation II instrument.

    PubMed

    Brosseau, Lucie; Rahman, Prinon; Toupin-April, Karine; Poitras, Stéphane; King, Judy; De Angelis, Gino; Loew, Laurianne; Casimiro, Lynn; Paterson, Gail; McEwan, Jessica

    2014-01-01

    Clinical practice CPGs (CPGs) have been developed to summarize evidence related to the management of osteoarthritis (OA). CPGs facilitate uptake of evidence-based knowledge by consumers, health professionals, health administrators and policy makers. The objectives of the present review were: 1) to assess the quality of the CPGs on non-pharmacological management of OA; using a standardized and validated instrument--the Appraisal of Guidelines Research and Evaluation (AGREE II) tool--by three pairs of trained appraisers; and 2) to summarize the recommendations based on only high-quality existing CPGs. Scientific literature databases from 2001 to 2013 were systematically searched for the state of evidence, with 17 CPGs for OA being identified. Most CPGs effectively addressed only a minority of AGREE II domains. Scope and purpose was effectively addressed in 10 CPGs on the management of OA, stakeholder involvement in 12 CPGs, rigour of development in 10 CPGs, clarity/presentation in 17 CPGs, editorial independence in 2 CPGs, and applicability in none of the OA CPGs. The overall quality of the included CPGs, according to the 7-point AGREE II scoring system, is 4.8 ± 0.41 for OA. Therapeutic exercises, patient education, transcutaneous electrical nerve stimulation, acupuncture, orthoses and insoles, heat and cryotherapy, patellar tapping, and weight control are commonly recommended for the non-pharmacological management of OA by the high-quality CPGs. The general clinical management recommendations tended to be similar among high-quality CPGs, although interventions addressed varied. Non-pharmacological management interventions were superficially addressed in more than half of the selected CPGs. For CPGs to be standardized uniform creators should use the AGREE II criteria when developing CPGs. Innovative and effective methods of CPG implementation to users are needed to ultimately enhance the quality of life of arthritic individuals.

  14. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Guidelines on treatment of perinatal depression with antidepressants: An international review

    PubMed Central

    Kamperman, Astrid M; Boyce, Philip; Bergink, Veerle

    2018-01-01

    Objective: Several countries have developed Clinical Practice Guidelines regarding treatment of perinatal depressive symptoms and perinatal use of antidepressant. We aimed to compare guidelines to guide clinicians in best clinical practice. Methods: An extensive search in guideline databases, MEDLINE and PsycINFO was performed. When no guidelines were (publicly) available online, we contacted psychiatric-, obstetric-, perinatal- and mood disorder societies of all first world countries and the five largest second world countries. Only Clinical Practice Guidelines adhering to quality criteria of the Appraisal of Guidelines for Research and Evaluation instrument and including a systematic review of evidence were included. Data extraction focussed on recommendations regarding continuation or withdrawal of antidepressants and preferred treatment in newly depressed patients. Results: Our initial search resulted in 1094 articles. After first screening, 40 full-text articles were screened. Of these, 24 were excluded for not being an official Clinical Practice Guidelines. In total, 16 Clinical Practice Guidelines were included originating from 12 countries. Eight guidelines were perinatal specific and eight were general guidelines. Conclusion: During pregnancy, four guidelines advise to continue antidepressants, while there is a lack of evidence supporting this recommendation. Five guidelines do not specifically advise or discourage continuation. For new episodes, guidelines agree on psychotherapy (especially cognitive behavioural therapy) as initial treatment for mild to moderate depression and antidepressants for severe depression, with a preference for sertraline. Paroxetine is not preferred treatment for new episodes but switching antidepressants for ongoing treatment is discouraged (three guidelines). If mothers use antidepressants, observation of the neonate is generally recommended and breastfeeding encouraged. PMID:29506399

  16. Guidelines on treatment of perinatal depression with antidepressants: An international review.

    PubMed

    Molenaar, Nina M; Kamperman, Astrid M; Boyce, Philip; Bergink, Veerle

    2018-04-01

    Several countries have developed Clinical Practice Guidelines regarding treatment of perinatal depressive symptoms and perinatal use of antidepressant. We aimed to compare guidelines to guide clinicians in best clinical practice. An extensive search in guideline databases, MEDLINE and PsycINFO was performed. When no guidelines were (publicly) available online, we contacted psychiatric-, obstetric-, perinatal- and mood disorder societies of all first world countries and the five largest second world countries. Only Clinical Practice Guidelines adhering to quality criteria of the Appraisal of Guidelines for Research and Evaluation instrument and including a systematic review of evidence were included. Data extraction focussed on recommendations regarding continuation or withdrawal of antidepressants and preferred treatment in newly depressed patients. Our initial search resulted in 1094 articles. After first screening, 40 full-text articles were screened. Of these, 24 were excluded for not being an official Clinical Practice Guidelines. In total, 16 Clinical Practice Guidelines were included originating from 12 countries. Eight guidelines were perinatal specific and eight were general guidelines. During pregnancy, four guidelines advise to continue antidepressants, while there is a lack of evidence supporting this recommendation. Five guidelines do not specifically advise or discourage continuation. For new episodes, guidelines agree on psychotherapy (especially cognitive behavioural therapy) as initial treatment for mild to moderate depression and antidepressants for severe depression, with a preference for sertraline. Paroxetine is not preferred treatment for new episodes but switching antidepressants for ongoing treatment is discouraged (three guidelines). If mothers use antidepressants, observation of the neonate is generally recommended and breastfeeding encouraged.

  17. Specialty Guidelines for Forensic Psychology

    ERIC Educational Resources Information Center

    American Psychologist, 2013

    2013-01-01

    In the past 50 years forensic psychological practice has expanded dramatically. Because the practice of forensic psychology differs in important ways from more traditional practice areas (Monahan, 1980) the "Specialty Guidelines for Forensic Psychologists" were developed and published in 1991 (Committee on Ethical Guidelines for Forensic…

  18. Applying clinical guidelines in general practice: a qualitative study of potential complications.

    PubMed

    Austad, Bjarne; Hetlevik, Irene; Mjølstad, Bente Prytz; Helvik, Anne-Sofie

    2016-07-22

    Clinical guidelines for single diseases often pose problems in general practice work with multimorbid patients. However, little research focuses on how general practice is affected by the demand to follow multiple guidelines. This study explored Norwegian general practitioners' (GPs') experiences with and reflections upon the consequences for general practice of applying multiple guidelines. Qualitative focus group study carried out in Mid-Norway. The study involved a purposeful sample of 25 Norwegian GPs from four pre-existing groups. Interviews were audio-recorded, transcribed and analyzed using systematic text condensation, i.e. applying a phenomenological approach. The GPs' responses clustered around two major topics: 1) Complications for the GPs of applying multiple guidelines; and, 2) Complications for their patients when GPs apply multiple guidelines. For the GPs, applying multiple guidelines created a highly problematic situation as they felt obliged to implement guidelines that were not suited to their patients: too often, the map and the terrain did not match. They also experienced greater insecurity regarding their own practice which, they admitted, resulted in an increased tendency to practice 'defensive medicine'. For their patients, the GPs experienced that applying multiple guidelines increased the risk of polypharmacy, excessive non-pharmacological recommendations, a tendency toward medicalization and, for some, a reduction in quality of life. The GPs experienced negative consequences when obliged to apply a variety of single disease guidelines to multimorbid patients, including increased risk of polypharmacy and overtreatment. We believe patient-centered care and the GPs' courage to non-comply when necessary may aid in reducing these risks. Health care authorities and guideline developers need to be aware of the potential negative effects of applying a single disease focus in general practice, where multimorbidity is highly prevalent.

  19. Medical Malpractice Implications of Clinical Practice Guidelines.

    PubMed

    Ruhl, Douglas S; Siegal, Gil

    2017-08-01

    Clinical practice guidelines aim to improve medical care by clarifying and making useful recommendations to providers. Although providers should account for patients' unique characteristics when determining a treatment plan, it is generally perceived as good practice to follow guidelines when applicable. This is of interest in malpractice litigation, where it is essential to establish a standard of care to evaluate the performances of providers. Although the opinions of expert witnesses are used to determine standards of care, guidelines are expected to play a leading role. Guidelines alone should not establish a legal standard but may help inform this discussion in the courtroom. Therefore, it is incumbent that excellent, practical, and timely guidelines are continually created and updated in a transparent way. These guidelines must be very clear and underscore the various strengths of recommendation based on the quality of available evidence.

  20. [Practical guideline of Parkinson's disease in Japan: evaluation and mission of future].

    PubMed

    Yamamoto, Mitsutoshi

    2013-01-01

    Japanese Society of Neurology (JSN) published Practical guideline for Parkinson's Disease (PD) in 2002 and revised version in 2012. This guideline was prepared according to the method of evidence-based medicine. We surveyed the daily practice of PD to expert neurologists for PD nationwide in Japan. Many specialists for PD reported that patients with PD had poor treatment by neurologists and neurosurgeons that was out of PD practical guideline. Some patients were treated with small dose levodopa despite of Hoehn-Yahr 3 stage. Another disabled patients were treated with dopamine agonists alone despite of over aged of 80. Many neurologists treated PD patients out of guideline. It is important to educate guideline to neurologists and general practioner.

  1. Implementing clinical guidelines for chronic obstructive pulmonary disease: barriers and solutions

    PubMed Central

    Overington, Jeff D.; Huang, Yao C.; Abramson, Michael J.; Brown, Juliet L.; Goddard, John R.; Bowman, Rayleen V.; Fong, Kwun M.

    2014-01-01

    Chronic obstructive pulmonary disease (COPD) is a complex chronic lung disease characterised by progressive fixed airflow limitation and acute exacerbations that frequently require hospitalisation. Evidence-based clinical guidelines for the diagnosis and management of COPD are now widely available. However, the uptake of these COPD guidelines in clinical practice is highly variable, as is the case for many other chronic disease guidelines. Studies have identified many barriers to implementation of COPD and other guidelines, including factors such as lack of familiarity with guidelines amongst clinicians and inadequate implementation programs. Several methods for enhancing adherence to clinical practice guidelines have been evaluated, including distribution methods, professional education sessions, electronic health records (EHR), point of care reminders and computer decision support systems (CDSS). Results of these studies are mixed to date, and the most effective ways to implement clinical practice guidelines remain unclear. Given the significant resources dedicated to evidence-based medicine, effective dissemination and implementation of best practice at the patient level is an important final step in the process of guideline development. Future efforts should focus on identifying optimal methods for translating the evidence into everyday clinical practice to ensure that patients receive the best care. PMID:25478199

  2. AAPM-RSS Medical Physics Practice Guideline 9.a. for SRS-SBRT.

    PubMed

    Halvorsen, Per H; Cirino, Eileen; Das, Indra J; Garrett, Jeffrey A; Yang, Jun; Yin, Fang-Fang; Fairobent, Lynne A

    2017-09-01

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education, and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States. The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for revision or renewal, as appropriate, on their fifth anniversary or sooner. Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized. The following terms are used in the AAPM practice guidelines: Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline. Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances. Approved by AAPM Professional Council 3-31-2017 and Executive Committee 4-4-2017. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  3. AAPM medical physics practice guideline 6.a.: Performance characteristics of radiation dose index monitoring systems.

    PubMed

    Gress, Dustin A; Dickinson, Renee L; Erwin, William D; Jordan, David W; Kobistek, Robert J; Stevens, Donna M; Supanich, Mark P; Wang, Jia; Fairobent, Lynne A

    2017-07-01

    The American Association of Physicists in Medicine (AAPM) is a nonprofit professional society whose primary purposes are to advance the science, education and professional practice of medical physics. The AAPM has more than 8,000 members and is the principal organization of medical physicists in the United States. The AAPM will periodically define new practice guidelines for medical physics practice to help advance the science of medical physics and to improve the quality of service to patients throughout the United States. Existing medical physics practice guidelines will be reviewed for the purpose of revision or renewal, as appropriate, on their fifth anniversary or sooner. Each medical physics practice guideline represents a policy statement by the AAPM, has undergone a thorough consensus process in which it has been subjected to extensive review, and requires the approval of the Professional Council. The medical physics practice guidelines recognize that the safe and effective use of diagnostic and therapeutic radiology requires specific training, skills, and techniques, as described in each document. Reproduction or modification of the published practice guidelines and technical standards by those entities not providing these services is not authorized. The following terms are used in the AAPM practice guidelines: •Must and Must Not: Used to indicate that adherence to the recommendation is considered necessary to conform to this practice guideline. •Should and Should Not: Used to indicate a prudent practice to which exceptions may occasionally be made in appropriate circumstances. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  4. Supportive Care Treatment Guidelines: Value, Limitations, and Opportunities

    PubMed Central

    Peterson, Douglas E.; Bensadoun, Rene-Jean; Lalla, Rajesh V.; McGuire, Deborah B.

    2013-01-01

    Evidence-based guidelines in clinical oncology practice are now prominent, with emphasis on clinical, health outcome and economic perspectives. Given the complexity of cancer management, a multidisciplinary approach is essential. Evidence-based guidelines to address supportive cancer care have merged expert opinion, systematic evaluation of clinical and research data, and meta-analyses of clinical trials. Production of supportive care guidelines by the interdisciplinary team is dependent on sufficient high-quality research studies. Once published, it is essential they be customized at institutional and national levels. Implementation in clinical practice is perhaps the greatest challenge. Optimal management occurs through integration of country-specific issues, including care access, healthcare resources, information technology, and national coordination of healthcare practices. The purpose of this article is to: (1) provide an overview of interdisciplinary cancer management using evidence-based guidelines; (2) delineate the theory and practice of guideline dissemination, utilization and outcome assessment; and (3) recommend future research strategies to maximize guidelines use in clinical practice. PMID:21600365

  5. Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

    PubMed

    Nam, Jutaek; Son, Sejin; Moon, James J

    2017-10-01

    Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

  6. Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

    PubMed Central

    Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-01-01

    The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

  7. Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

    PubMed

    Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

    2017-01-01

    There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

  8. Canadian physicians' attitudes about and preferences regarding clinical practice guidelines.

    PubMed

    Hayward, R S; Guyatt, G H; Moore, K A; McKibbon, K A; Carter, A O

    1997-06-15

    To assess Canadian physicians' confidence in, attitudes about and preferences regarding clinical practice guidelines. Cross-sectional, self-administered mailed survey. Stratified random sample of 3000 Canadian physicians; 1878 (62.6%) responded. Canada. Physicians' use of various information sources; familiarity with and confidence in guidelines; attitudes about guidelines and their effect on medical care; rating of importance of guidelines and other sources of information in clinical decision-making; rating of importance of various considerations in deciding whether to adopt a set of guidelines; and rating of usefulness of different formats for presenting guidelines. In all, 52% of the respondents reported using guidelines at least monthly, substantially less frequently than traditional information sources. Most of the respondents expressed confidence in guidelines issued by various physician organizations, but 51% to 77% were not confident in guidelines issued by federal or provincial health ministries or by health insurance plans. The respondents were generally positive about guidelines (e.g., over 50% strongly agreed that they are a convenient source of advice and good educational tools); however, 22% to 26% had concerns about loss of autonomy, the rigidity of guidelines and decreased satisfaction with medical practice. Endorsement by respected colleagues or major organizations was identified as very important by 78% and 62% of the respondents respectively in deciding whether to adopt a set of guidelines in their practice. User friendliness of the guidelines format was thought to be very important by 62%; short pamphlets, manuals summarizing a number of guidelines, journal articles and pocket cards summarizing guidelines were the preferred formats (identified as most useful by 50% to 62% of the respondents). Canadian physicians, although generally positive about guidelines and confident in those developed by clinicians, have not yet integrated the use of guidelines into their practices to a large extent. Our results suggest that respected organizations and opinion leaders should be involved in the development of guidelines and that the acceptability of any proposed format and medium for guidelines presentation should be pretested.

  9. Influence of Institutional Guidelines on Oral Hygiene Practices in Intensive Care Units.

    PubMed

    Kiyoshi-Teo, Hiroko; Blegen, Mary

    2015-07-01

    Maintaining oral hygiene is a key component of preventing ventilator-associated pneumonia; however, practices are inconsistent. To explore how characteristics of institutional guidelines for oral hygiene influence nurses' oral hygiene practices and perceptions of that practice. Oral hygiene section of a larger survey study on prevention of ventilator-associated pneumonia. Critical care nurses at 8 hospitals in Northern California that had more than 1000 ventilator days in 2009 were recruited to participate in the survey. Twenty-one questions addressed oral hygiene practices and practice perceptions. Descriptive statistics, analysis of variance, and Spearman correlations were used for analyses. A total of 576 critical care nurses (45% response rate) responded to the survey. Three types of institutional oral hygiene guidelines existed: nursing policy, order set, and information bulletin. Nursing policy provided the most detail about the oral hygiene care; however, adherence, awareness, and priority level were higher with order sets (P < .05). The content and method of disseminating these guidelines varied, and nursing practices were affected by these differences. Nurses assessed the oral cavity and used oral swabs more often when those practices were included in institutional guidelines. The content and dissemination method of institutional guidelines on oral hygiene do influence the oral hygiene practices of critical care nurses. Future studies examining how institutional guidelines could best be incorporated into routine workflow are needed. ©2015 American Association of Critical-Care Nurses.

  10. Developing Practice Guidelines for Psychoanalysis

    PubMed Central

    GRAY, SHEILA HAFTER

    1996-01-01

    Consensus-based practice guidelines codify clinical intelligence and the rich oral tradition in medicine. Because they reflect actual practice, they are readily accepted by clinicians as a basis for external review. This article illustrates the development of guidelines for a psychoanalytic approach to the large pool of patients who present with a depression. It suggests an integrated biopsychosocial approach to these individuals that is useful in current practice, and it offers propositions that may be tested in future research undertakings. Eventually, practice guidelines such as these may form the basis of economical systems of health care that avoid arbitrary, clinically untenable limitations on services. PMID:22700290

  11. A Review of Best Practices for Intravenous Push Medication Administration.

    PubMed

    Lenz, Janelle R; Degnan, Daniel D; Hertig, John B; Stevenson, James G

    In 2015, the Institute for Safe Medication Practices (ISMP) released safe practice guidelines for adult intravenous (IV) push medications. ISMP's most recent set of guidelines has added to a growing list of recommendations from professional groups on the safe use of IV medications. These recommendations and guidelines vary with regard to their audience, scope, and terminology. In some ways, these variations may contribute to confusion and delayed adoption of the standards. This report attempts to provide clarity about the rationale and background regarding the need for practice improvement, discussion of various guidelines, and practice mitigation strategies to improve patient safety.

  12. Closing the gap between science and practice: the need for professional leadership.

    PubMed

    Eagle, Kim A; Garson, Arthur J; Beller, George A; Sennett, Cary

    2003-01-01

    Major opportunity exists to better align clinical science and clinical practice. To do so will require efforts not only to develop clinical practice guidelines, but to facilitate their application in practice. The American College of Cardiology operates a program to develop and assess the effectiveness of tools that facilitate the application of guidelines in practice. Here we review what we have learned about the process of guideline implementation, lay out the major research questions that need to be addressed, and argue that professional societies play a critical role in moving from guideline development to application.

  13. Adherence To Diabetes Mellitus Treatment Guidelines From Theory To Practice: The Missing Link.

    PubMed

    Hashmi, Noreen Rahat; Khan, Shahzad Ali

    2016-01-01

    Diabetes mellitus is a complex multisystem disease that requires high quality care. Clinical practice guidelines help physicians and patients make the best possible health care decisions and improve health care management of diabetic patients. These guidelines provide the norms for clinical management as well as monitoring of diabetes care. They are not simple algorithms but are based on structured evidence based diabetic management protocols developed from randomized controlled trials. Despite the widespread availability of this diabetic guideline, their use is suboptimal at best. There are several factors blamed for contributing to this missing link from available theoretical guideline recommendations to practical applications of these guidelines. We present a brief review based on available literature review for an ongoing interventional study being done by authors in two tertiary care hospital in Lahore Pakistan for improving adherence to diabetes guidelines. We will discuss guideline implementation cycle and also present a framework encompassing various factors involved in adherence to guidelines. Until recently the emphasis to improve the guideline adherence targeted the factors relating to individual health care professionals in reference to their knowledge, attitude practice of the guidelines. However, we will discuss that broader range of health care systems, organizational factors, and factors relating to patients which may also significantly impact the adherence to the guidelines. The framework emphasises that it is important to understand the factors that act as barriers and contribute to the missing link between theory and practice of diabetic guidelines. This will help plan appropriate strategies in the pre-implementation stage for effective and improved diabetes guidelines adherence and management.

  14. Quality appraisal of clinical practice guidelines on the use of physiotherapy in rheumatoid arthritis: a systematic review.

    PubMed

    Hurkmans, Emalie J; Jones, Anamaria; Li, Linda C; Vliet Vlieland, Theodora P M

    2011-10-01

    To assess the quality of guidelines published in peer-reviewed literature concerning the role of physiotherapy in the management of patients with RA. A systematic literature search for clinical practice guidelines that included physiotherapy interventions was performed in four electronic databases. We assessed the quality of the selected guidelines using the appraisal of guidelines for research and evaluation (AGREE) instrument. In addition, the recommendations of guidelines with the highest quality scores were summarized. Eight clinical practice guidelines fulfilled the inclusion criteria. Scope/purpose was the most often adequately addressed AGREE domain (in seven of the eight guidelines) and applicability the least (in two of the eight guidelines). Based on the AGREE domain scores, six guidelines could be recommended or strongly recommended for clinical use. Five out of these six (strongly) recommended guidelines included a recommendation on exercise therapy and/or patient education, with these interventions being recommended in every case. Transcutaneous electrical nerve stimulation and thermotherapy were recommended in four of these six guidelines. US, thermotherapy, low-level laser therapy, massage, passive mobilization and balneotherapy were addressed in one or two of these six guidelines. Six of eight clinical practice guidelines addressing physiotherapy interventions were recommended or strongly recommended according to the AGREE instrument. In general, guideline recommendations on physiotherapy intervention, from both the recommended guidelines as well as from the not recommended guidelines, lacked detail concerning mode of delivery, intensity, frequency and duration.

  15. The impact of qualitative research on gynaecologic oncology guidelines.

    PubMed

    How, Jeffrey Andrew; Abitbol, Jeremie; Lau, Susie; Gotlieb, Walter Henri; Abenhaim, Haim Arie

    2015-02-01

    Inherent in the care provided to patients with cancer is an important psychosocial element which has been explored scientifically through qualitative research. The purpose of our study was to evaluate the availability of qualitative research in gynaecologic oncology and to measure its integration in gynaecologic oncology practice guidelines. We searched Medline, CINHAL, Scopus, and Web of Science databases to identify the availability of qualitative research conducted in the past 20 years on the three most prevalent gynaecologic cancers: endometrial, ovarian, and cervical cancer. National and international practice guidelines on management of gynaecologic cancers were selected using the National Guideline Clearinghouse website, the Society of Obstetricians and Gynaecologists of Canada website, and the Standards and Guidelines Evidence directory of cancer guidelines. Bibliometric analysis was used to determine the frequency of qualitative references cited in these guidelines. One hundred thirteen qualitative research papers on gynaecologic cancers were identified focusing on psychological impacts, social dynamics, and doctor-patient interactions during cancer treatment and recovery. Among the 15 national and international clinical practice guidelines identified on management of gynaecologic cancer, there were a total of 2272 references, and of these only three references citing qualitative research were identified (0.1%) in only one of the 15 practice guidelines. Although qualitative research is being carried out in gynaecologic oncology, its integration into clinical practice guidelines is essentially absent. Efforts to narrow the gap between qualitative research and clinical practice are essential in ensuring a comprehensive approach to the treatment of patients with gynaecologic cancer.

  16. Reporting potential conflicts of interest among authors of professional medical societies' guidelines.

    PubMed

    Khalil, Bassem; Aung, KoKo; Mansi, Ishak A

    2012-08-01

    Limited attention is directed to the potential conflicts of interest (COI) of the authors of practice guidelines writing groups of professional medical societies (PMS) and industry. The objective of this study was to report the proportion of authors with potential COI among guidelines writing groups of PMS. A systematic search in PubMed to identify practice guidelines of a convenience sample of 12 publicly known PMS for a period of 3 years. The authors' disclosures of COI were reviewed for the identified guidelines. We identified 126 guidelines, of which 107 (85%) reported authors' disclosures of COI and 19 (15%) did not. With the exception of the US Preventive Services Task Force, all of the reviewed guidelines writing groups of PMS had potential COI to some extent. The maximum percentage of authors with potential COI varied among PMS from 25% to 100%. A substantial variation of percentage of authors with potential COI exists among guidelines writing groups of different PMS. Several practice guidelines of PMS fail to include the disclosures of potential COI in their published guidelines. We made several suggestions to promote the transparency of potential COI in clinical practice guidelines.

  17. Development of practice guidelines for psychological interventions in the rehabilitation of patients with oncological disease (breast, prostate, or colorectal cancer): Methods and results.

    PubMed

    Reese, Christina; Weis, Joachim; Schmucker, Dieter; Mittag, Oskar

    2017-10-01

    The goal of this project was to develop evidence- and consensus-based practice guidelines for psychological interventions in the rehabilitation of patients with oncological disease (breast, prostate, or colorectal cancer). First of all, we conducted a literature search and survey of all oncological rehabilitation centers in Germany (N = 145) to obtain a thorough perspective of the recent evidence, guidelines, the structural framework, and practice of psychological services in oncological rehabilitation. Next, an expert workshop was held with national experts from scientific departments, clinicians from rehabilitation centers, and patients. In this workshop, we drafted and agreed upon an initial version of the practice guidelines. Afterwards, the practice guidelines were sent to all head physicians and senior psychologists at oncological rehabilitation centers in Germany for approval (N = 280 questionnaires). In addition, key recommendations were discussed with a group of rehabilitation patients. Finally, the practice guidelines were revised by the expert panel and made available online to the public. The practice guidelines have been widely accepted by both the expert panel and the surveyed clinicians and patients. They include recommendations for psycho-oncological interventions that should be offered to all rehabilitation patients with breast, prostate, or colorectal cancer. They also comprise recommendations for specific problem areas concerning psychological functions, body functions, and environmental and personal factors. The practice guidelines provide detailed recommendations for high-quality psychosocial care in an oncological rehabilitation context. It is their aim to guide the multidisciplinary team, especially psychologists and physicians, in their daily practice. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Systematic review of recent dementia practice guidelines.

    PubMed

    Ngo, Jennifer; Holroyd-Leduc, Jayna M

    2015-01-01

    dementia is a highly prevalent acquired cognitive disorder that interferes with activities of daily living, relationships and quality of life. Recognition and effective management strategies are necessary to provide comprehensive care for these patients and their families. High-quality clinical practice guidelines can improve the quality and consistency of care in all aspects of dementia diagnosis and management by clarifying interventions supported by sound evidence and by alerting clinicians to interventions without proven benefit. we aimed to offer a synthesis of existing practice recommendations for the diagnosis and management of dementia, based upon moderate-to-high quality dementia guidelines. we performed a systematic search in EMBASE and MEDLINE as well as the grey literature for guidelines produced between 2008 and 2013. thirty-nine retrieved practice guidelines were included for quality appraisal by the Appraisal of Guidelines Research and Evaluation II (AGREE-II) tool, performed by two independent reviewers. From the 12 moderate-to-high quality guidelines included, specific practice recommendations for the diagnosis and/or management of any aspect of dementia were extracted for comparison based upon the level of evidence and strength of recommendation. there was a general agreement between guidelines for many practice recommendations. However, direct comparisons between guidelines were challenging due to variations in grading schemes. © The Author 2014. Published by Oxford University Press on behalf of the British Geriatrics Society. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Developing a practice guideline for the occupational health services by using a community of practice approach: a process evaluation of the development process.

    PubMed

    Kwak, Lydia; Wåhlin, Charlotte; Stigmar, Kjerstin; Jensen, Irene

    2017-01-18

    One way to facilitate the translation of research into the occupational health service practice is through clinical practice guidelines. To increase the implementability of guidelines it is important to include the end-users in the development, for example by a community of practice approach. This paper describes the development of an occupational health practice guideline aimed at the management of non-specific low back pain (LBP) by using a community of practice approach. The paper also includes a process evaluation of the development providing insight into the feasibility of the process. A multidisciplinary community of practice group (n = 16) consisting of occupational nurses, occupational physicians, ergonomists/physical therapists, health and safety engineers, health educators, psychologists and researchers from different types of occupational health services and geographical regions within Sweden met eleven times (June 2012-December 2013) to develop the practice guideline following recommendations of guideline development handbooks. Process-outcomes recruitment, reach, context, satisfaction, feasibility and fidelity were assessed by questionnaire, observations and administrative data. Group members attended on average 7.5 out of 11 meetings. Half experienced support from their workplace for their involvement. Feasibility was rated as good, except for time-scheduling. Most group members were satisfied with the structure of the process (e.g. presentations, multidisciplinary group). Fidelity was rated as fairly high. The described development process is a feasible process for guideline development. For future guideline development expectations of the work involved should be more clearly communicated, as well as the purpose and tasks of the CoP-group. Moreover, possibilities to improve support from managers and colleagues should be explored. This paper has important implications for future guideline development; it provides valuable information on how practitioners can be included in the development process, with the aim of increasing the implementability of the developed guidelines.

  20. Dissemination of the CDC's Hand Hygiene Guideline and impact on infection rates

    PubMed Central

    Larson, Elaine L.; Quiros, Dave; Lin, Susan X.

    2007-01-01

    Background The diffusion of national evidence-based practice guidelines and their impact on patient outcomes often go unmeasured. Methods Our objectives were to (1) evaluate implementation and compliance with clinical practices recommended in the new Centers for Disease Control and Prevention (CDC) Hand Hygiene Guideline, (2) compare rates of health care-associated infections (HAI) before and after implementation of the Guideline recommendations, and (3) examine the patterns and correlates of changes in rates of HAI. We used pre- and post-Guideline implementation site visits and surveys in the setting of 40 US hospitals—members of the National Nosocomial Infections Surveillance System—and measured HAI rates 1 year before and after publication of the CDC Guideline and used direct observation of hand hygiene compliance and Guideline implementation scores. Results All study hospitals had changed their policies and procedures and provided products in compliance with Guideline recommendations; 89.8% of 1359 staff members surveyed anonymously reported that they were familiar with the Guideline. However, in 44.2% of the hospitals (19/40), there was no evidence of a multidisciplinary program to improve compliance. Hand hygiene rates remained low (mean, 56.6%). Rates of central line-associated bloodstream infections were significantly lower in hospitals with higher rates of hand hygiene (P < .001). No impact of Guideline implementation or hand hygiene compliance on other HAI rates was identified. Other factors occurring over time could affect rates of HAI. Observed hand hygiene compliance rates were likely to overestimate rates in actual practice. The study may have been of too short duration to detect the impact of a practice guideline. Conclusion Wide dissemination of this Guideline was not sufficient to change practice. Only some hospitals had initiated multidisciplinary programs; practice change is unlikely without such multidisciplinary efforts and explicit administrative support. PMID:18063132

  1. Dissemination of the CDC's Hand Hygiene Guideline and impact on infection rates.

    PubMed

    Larson, Elaine L; Quiros, Dave; Lin, Susan X

    2007-12-01

    The diffusion of national evidence-based practice guidelines and their impact on patient outcomes often go unmeasured. Our objectives were to (1) evaluate implementation and compliance with clinical practices recommended in the new Centers for Disease Control and Prevention (CDC) Hand Hygiene Guideline, (2) compare rates of health care-associated infections (HAI) before and after implementation of the Guideline recommendations, and (3) examine the patterns and correlates of changes in rates of HAI. We used pre- and post-Guideline implementation site visits and surveys in the setting of 40 US hospitals--members of the National Nosocomial Infections Surveillance System--and measured HAI rates 1 year before and after publication of the CDC Guideline and used direct observation of hand hygiene compliance and Guideline implementation scores. All study hospitals had changed their policies and procedures and provided products in compliance with Guideline recommendations; 89.8% of 1359 staff members surveyed anonymously reported that they were familiar with the Guideline. However, in 44.2% of the hospitals (19/40), there was no evidence of a multidisciplinary program to improve compliance. Hand hygiene rates remained low (mean, 56.6%). Rates of central line-associated bloodstream infections were significantly lower in hospitals with higher rates of hand hygiene (P < .001). No impact of Guideline implementation or hand hygiene compliance on other HAI rates was identified. Other factors occurring over time could affect rates of HAI. Observed hand hygiene compliance rates were likely to overestimate rates in actual practice. The study may have been of too short duration to detect the impact of a practice guideline. Wide dissemination of this Guideline was not sufficient to change practice. Only some hospitals had initiated multidisciplinary programs; practice change is unlikely without such multidisciplinary efforts and explicit administrative support.

  2. Cancer related fatigue: implementing guidelines for optimal management.

    PubMed

    Pearson, Elizabeth J M; Morris, Meg E; McKinstry, Carol E

    2017-07-18

    Cancer-related fatigue (CRF) is a key concern for people living with cancer and can impair physical functioning and activities of daily living. Evidence-based guidelines for CRF are available, yet inconsistently implemented globally. This study aimed to identify barriers and enablers to applying a cancer fatigue guideline and to derive implementation strategies. A mixed-method study explored the feasibility of implementing the CRF guideline developed by the Canadian Association for Psychosocial Oncology (CAPO). Health professionals, managers and consumers from different practice settings participated in a modified Delphi study with two survey rounds. A reference group informed the design of the study including the surveys. The first round focused on guideline characteristics, compatibility with current practice and experience, and behaviour change. The second survey built upon and triangulated the first round. Forty-five health practitioners and managers, and 68 cancer survivors completed the surveys. More than 75% of participants endorsed the CAPO cancer related fatigue guidelines. Some respondents perceived a lack of resources for accessible and expert fatigue management services. Further barriers to guideline implementation included complexity, limited practical details for some elements, and lack of clinical tools such as assessment tools or patient education materials. Recommendations to enhance guideline applicability centred around four main themes: (1) balancing the level of detail in the CAPO guideline with ease of use, (2) defining roles of different professional disciplines in CRF management, (3) how best to integrate CRF management into policy and practice, (4) how best to ensure a consumer-focused approach to CRF management. Translating current knowledge on optimal management of CRF into clinical practice can be enhanced by the adoption of valid guidelines. This study indicates that it is feasible to adopt the CAPO guidelines. Clinical application may be further enhanced with guideline adaptation, professional education and integration with existing practices.

  3. From evidence to action

    PubMed Central

    Verheyen, Cees CPM; Kerkhoffs, Gino M; Bhandari, Mohit; Schünemann, Holger J

    2009-01-01

    ABSTRACT Good guidelines will help us to take evidence into practice. In a survey among Dutch orthopedic surgeons, development and use of evidence-based guidelines was perceived as one of the best ways of moving from opinion-based to evidence-based orthopedic practice. The increasing number of guidelines means that knowing how to make a critical appraisal of guidelines is now a key part of every surgeon’s life. This is particularly true because guidelines use varying systems to judge the quality of evidence and the strength of recommendations. In this manuscript we discuss what a guideline is, where we can find guidelines, how to evaluate the quality of guidelines, and finally provide an example on the different steps of guideline development. Thus, we show that good guidelines are a summary of the best available evidence and that they provide a graded recommendation to help surgeons in evidence-based practice. PMID:19234892

  4. Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

    PubMed

    Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

    2011-02-28

    To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

  5. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  6. Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

    PubMed Central

    Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

    2016-01-01

    Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

  7. Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

    PubMed

    Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

    2014-03-20

    Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  9. Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

    PubMed

    Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

    2017-03-09

    It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

  10. Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

    2002-04-01

    Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

  11. The Healthy Weight Commitment Foundation pledge: calories sold from U.S. consumer packaged goods, 2007-2012.

    PubMed

    Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M

    2014-10-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  12. Blood fatty acid composition of pregnant and nonpregnant Korean women: red cells may act as a reservoir of arachidonic acid and docosahexaenoic acid for utilization by the developing fetus.

    PubMed

    Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H

    2000-05-01

    Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.

  13. [Factors influencing the quality of clinical practice guidelines in ovarian cancer].

    PubMed

    Castillo-Londoño, J S; Medina-Torres, Y A; Sandoval-Salinas, C; Buitrago-Gutierrez, G; Torres-Ibargüen, M Z; Gonzalez-Rangel, A L

    To identify the characteristics of the published clinical practice guidelines for the management of epithelial ovarian cancer that suggest a good methodological quality. A literature review was performed on 25 clinical practice guidelines for epithelial ovarian cancer that were identified in different databases (MEDLINE, Guidelines International Network, National Guidelines Clearing house) published between 2007 and 2014. The quality of the guidelines was evaluated using the Appraisal of Guidelines Research and Evaluation II tool. Descriptive and bivariate analyses were performed to assess the association between the quality of the guidelines and of some of their features and their developers. Just under half (48%) of the guidelines were rated as low quality. Scientific societies or independent centres and private funding, or under-reporting the source of funding, were statistically associated with lower quality of clinical practice guidelines (P<.01). The guidelines developed by National Program Guidelines had a median of consistently higher scores in all domains of the Appraisal of Guidelines Research and Evaluation II, with significant differences in the definition of scope and objectives, the participation of stakeholders, the methodological rigour of development, and applicability to the context. Features such as the nature of the developer and funding of the guidelines are predictors of quality that should be taken into account prior to the use of the recommendations of a document. Copyright © 2016 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. A Reporting Tool for Practice Guidelines in Health Care: The RIGHT Statement.

    PubMed

    Chen, Yaolong; Yang, Kehu; Marušic, Ana; Qaseem, Amir; Meerpohl, Joerg J; Flottorp, Signe; Akl, Elie A; Schünemann, Holger J; Chan, Edwin S Y; Falck-Ytter, Yngve; Ahmed, Faruque; Barber, Sarah; Chen, Chiehfeng; Zhang, Mingming; Xu, Bin; Tian, Jinhui; Song, Fujian; Shang, Hongcai; Tang, Kun; Wang, Qi; Norris, Susan L

    2017-01-17

    The quality of reporting practice guidelines is often poor, and there is no widely accepted guidance or standards for such reporting in health care. The international RIGHT (Reporting Items for practice Guidelines in HealThcare) Working Group was established to address this gap. The group followed an existing framework for developing guidelines for health research reporting and the EQUATOR (Enhancing the QUAlity and Transparency Of health Research) Network approach. It developed a checklist and an explanation and elaboration statement. The RIGHT checklist includes 22 items that are considered essential for good reporting of practice guidelines: basic information (items 1 to 4), background (items 5 to 9), evidence (items 10 to 12), recommendations (items 13 to 15), review and quality assurance (items 16 and 17), funding and declaration and management of interests (items 18 and 19), and other information (items 20 to 22). The RIGHT checklist can assist developers in reporting guidelines, support journal editors and peer reviewers when considering guideline reports, and help health care practitioners understand and implement a guideline.

  15. [Evidence-based clinical oral healthcare guidelines 4. Adherence requires an implementation strategy].

    PubMed

    Braspenning, J C C; Mettes, T G P H; van der Sanden, W J M; Wensing, M J P

    2015-03-01

    Adherence to clinical guidelines requires support in practice. However, systematic implementation of evidence-based guidelines is not common practice in oral healthcare. The Knowledge Institute Oral Care (KiMo) offers the opportunity to take into account potential barriers and facilitators during the development of evidence-based clinical practice guidelines. These factors which are relevant to the guideline and the oral healthcare practice provide the ingredients for a tailor-made programme of implementation that has a scientific basis. Elements of any implementation programme are the quality indicators derived from the oral healthcare guidelines. These indicators should fit, on the one hand, the specific goals of the guidelines (patient safety, effectiveness, efficiency, patient-centred, timeliness, accessibility) and, onthe other hand, the various perspectives of the different stakeholders, such as patients, caregivers, health insurers and inspectorate. These quality indicators provide information on adherence to the guidelines, the results of a certain treatment and the success of the implementation strategy, all with the aim to improve the quality of oral healthcare.

  16. Assessment of clinical practice guideline methodology for the treatment of knee osteoarthritis with intra-articular hyaluronic acid.

    PubMed

    Altman, Roy D; Schemitsch, Emil; Bedi, Asheesh

    2015-10-01

    Clinical practice guidelines are of increasing importance in the decision making for the treatment of knee osteoarthritis. Inconsistent recommendations regarding the use of intra-articular hyaluronic acid for the treatment of knee osteoarthritis have led to confusion among treating physicians. Literature search to identify clinical practice guidelines that provide recommendations regarding the use of intra-articular hyaluronic acid treatment for knee osteoarthritis was conducted. Included guidelines were appraised using the AGREE II instrument. Guideline development methodologies, how the results were assessed, the recommendation formation, and work group composition were summarized. Overall, 10 clinical practice guidelines were identified that met our inclusion criteria. AGREE II domain scores were variable across the included guidelines. The methodology utilized across the guidelines was heterogeneous regarding the evidence inclusion criteria, analysis of evidence results, formulation of clinical practice recommendations, and work group composition. The recommendations provided by the guidelines for intra-articular hyaluronic acid treatment for knee osteoarthritis are highly inconsistent as a result of the variability in guideline methodology. Overall, 30% of the included guidelines recommended against the use of intra-articular hyaluronic acid in the treatment of knee osteoarthritis, while 30% deemed the treatment an appropriate intervention under certain scenarios. The remaining 40% of the guidelines provided either an uncertain recommendation or no recommendation at all, based on the high variability in reviewed evidence regarding efficacy and trial quality. There is a need for a standard "appropriate methodology" that is agreed upon for osteoarthritis clinical practice guidelines in order to prevent the development of conflicting recommendations for intra-articular hyaluronic acid treatment for knee osteoarthritis, and to assure that treating physicians who are utilizing these guidelines are making their clinical decisions on the best available evidence. At present, the inconsistent recommendations provided for intra-articular hyaluronic acid treatment make it difficult for clinical professionals to determine its appropriateness when treating patients with knee osteoarthritis. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Adherence of healthcare professionals to evidence-based clinical practice guidelines in the management of hemodialysis patients, Khartoum State, Sudan.

    PubMed

    Abdelwahab, Hisham; Shigidi, Mazin; El-Tohami, Alyaa; Ibrahim, Lamees

    2013-05-01

    Hemodialysis (HD) is a complex procedure with many specifications and requires adherence to a set of particular clinical practice guidelines. These guidelines had already been established by globally acclaimed renal authorities and their implementation was shown to correlate with patients' morbidity and mortality. This study was conducted to evaluate the adherence of healthcare professionals to the evidence-based clinical practice patterns in Khartoum State HD units. A cross-sectional study was conducted in Khartoum State HD units during the period from September 2010 to January of 2011. Data was collected from the healthcare professionals using a specially designed checklist. The checklist included the evidence-based clinical practice guidelines for the HD vascular access, HD adequacy, anemia of chronic kidney disease (CKD), nutrition, cardiovascular risk assessment, and hepatitis B and C virus infection control. Implementation of these guidelines was evaluated, and further graded using a Likert-type scale. Four randomly selected HD units were included in the study. The rate of implementation of the HD vascular access guidelines was 54.8%, adequacy guidelines 57%, anemia of CKD 68.8%, nutrition 58.4%, cardiovascular risk assessment 57%, and hepatitis B and C infection control guidelines was 79.2%. Overall, the four HD units assessed showed moderate deviations from the practice guidelines of anemia of CKD and hepatitis B and C infection control. Extreme deviations from the clinical practice guidelines were seen in HD vascular access practices, adequacy assessments, nutrition and cardiovascular risk assessment. Hemodialysis services in Khartoum State are in need of great improvements regarding adherence to protocols and the standards of care.

  18. Perinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: the Triple B study

    PubMed Central

    Fransquet, Peter D.; Hutchinson, Delyse; Olsson, Craig A.; Wilson, Judy; Allsop, Steve; Najman, Jake; Elliott, Elizabeth; Mattick, Richard P.; Saffery, Richard; Ryan, Joanne

    2016-01-01

    Maternal alcohol use during the perinatal period is a major public health issue, the higher ends of which are associated with foetal alcohol spectrum disorder and a range of adverse health outcomes in the progeny. The underlying molecular mechanisms remain largely unknown but may include the epigenetic disruption of gene activity during development. Alcohol directly activates the neurotransmitter dopamine, which plays an essential role in neurodevelopment. To investigate whether antenatal and early postnatal alcohol consumption were associated with differential dopamine receptor DRD4 promoter methylation in infants (n = 844). Data were drawn from the large population based Triple B pregnancy cohort study, with detailed information on maternal alcohol consumption in each trimester of pregnancy and early postpartum. DNA was extracted from infant buccal swabs collected at 8-weeks. DRD4 promoter DNA methylation was analysed by Sequenom MassARRAY. No strong evidence was found for an association between alcohol consumption during pregnancy and infant DRD4 methylation at 8-weeks postpartum. However, maternal alcohol consumption assessed contemporaneously at 8-weeks postpartum was associated with increased methylation at 13 of 19 CpG units examined (largest Δ + 3.20%, 95%Confidence Interval:1.66,4.75%, P = 0.0001 at CpG.6). This association was strongest in women who breastfeed, suggesting the possibility of a direct effect of alcohol exposure via breast milk. The findings of this study could influence public health guidelines around alcohol consumption for breastfeeding mothers; however, further research is required to confirm these novel findings. PMID:29492300

  19. 78 FR 42526 - Salmonella

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-16

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...

  20. CpG islands: algorithms and applications in methylation studies.

    PubMed

    Zhao, Zhongming; Han, Leng

    2009-05-15

    Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

Top