Science.gov

Sample records for pre-erythrocytic stage infection

  1. Pre-erythrocytic antibody profiles induced by controlled human malaria infections in healthy volunteers under chloroquine prophylaxis

    PubMed Central

    Felgner, Philip L.; Roestenberg, Meta; Liang, Li; Hung, Christopher; Jain, Aarti; Pablo, Jozelyn; Nakajima-Sasaki, Rie; Molina, Douglas; Teelen, Karina; Hermsen, Cornelus C.; Sauerwein, Robert

    2013-01-01

    Complete sterile protection to Plasmodium falciparum (Pf) infection mediated by pre-erythrocytic immunity can be experimentally induced under chloroquine prophylaxis, through immunization with sporozoites from infected mosquitoes' bites (CPS protocol). To characterize the profile of CPS induced antibody (Ab) responses, we developed a proteome microarray containing 809 Pf antigens showing a distinct Ab profile with recognition of antigens expressed in pre-erythrocytic life-cycle stages. In contrast, plasma from naturally exposed semi-immune individuals from Kenya was skewed toward antibody reactivity against asexual blood stage antigens. CPS-immunized and semi-immune individuals generated antibodies against 192 and 202 Pf antigens, respectively, but only 60 antigens overlapped between the two groups. Although the number of reactive antigens varied between the CPS-immunized individuals, all volunteers reacted strongly against the pre-erythrocytic antigens circumsporozoite protein (CSP) and liver stage antigen 1 (LSA1). Well classified merozoite and erythrocytic antigens were strongly reactive in semi-immune individuals but lacking in the CPS immunized group. These data show that the antibody profile of CPS-immunized and semi-immune groups have quite distinct profiles reflecting their protective immunity; antibodies from CPS immunized individuals react strongly against pre-erythrocytic while semi-immune individuals mainly react against erythrocytic antigens. PMID:24351974

  2. Interferon-γ, a valuable surrogate marker of Plasmodium falciparum pre-erythrocytic stages protective immunity

    PubMed Central

    2011-01-01

    Immunity against the pre-erythrocytic stages of malaria is the most promising, as it is strong and fully sterilizing. Yet, the underlying immune effectors against the human Plasmodium falciparum pre-erythrocytic stages remain surprisingly poorly known and have been little explored, which in turn prevents any rational vaccine progress. Evidence that has been gathered in vitro and in vivo, in higher primates and in humans, is reviewed here, emphasizing the significant role of IFN-γ, either as a critical immune mediator or at least as a valuable surrogate marker of protection. One may hope that these results will trigger investigations in volunteers immunized either by optimally irradiated or over-irradiated sporozoites, to quickly delineate better surrogates of protection, which are essential for the development of a successful malaria vaccine. PMID:21303495

  3. DNA from pre-erythrocytic stage malaria parasites is detectable by PCR in the faeces and blood of hosts.

    PubMed

    Abkallo, Hussein M; Liu, Weimin; Hokama, Sarina; Ferreira, Pedro E; Nakazawa, Shusuke; Maeno, Yoshimasa; Quang, Nguyen T; Kobayashi, Nobuyuki; Kaneko, Osamu; Huffman, Michael A; Kawai, Satoru; Marchand, Ron P; Carter, Richard; Hahn, Beatrice H; Culleton, Richard

    2014-06-01

    Following the bite of an infective mosquito, malaria parasites first invade the liver where they develop and replicate for a number of days before being released into the bloodstream where they invade red blood cells and cause disease. The biology of the liver stages of malaria parasites is relatively poorly understood due to the inaccessibility of the parasites to sampling during this phase of their life cycle. Here we report the detection in blood and faecal samples of malaria parasite DNA throughout their development in the livers of mice and before the parasites begin their growth in the blood circulation. It is shown that parasite DNA derived from pre-erythrocytic stage parasites reaches the faeces via the bile. We then show that different primate malaria species can be detected by PCR in blood and faecal samples from naturally infected captive macaque monkeys. These results demonstrate that pre-erythrocytic parasites can be detected and quantified in experimentally infected animals. Furthermore, these results have important implications for both molecular epidemiology and phylogenetics of malaria parasites. In the former case, individuals who are malaria parasite negative by microscopy, but PCR positive for parasite DNA in their blood, are considered to be "sub-microscopic" blood stage parasite carriers. We now propose that PCR positivity is not necessarily an indicator of the presence of blood stage parasites, as the DNA could derive from pre-erythrocytic parasites. Similarly, in the case of molecular phylogenetics based on DNA sequences alone, we argue that DNA amplified from blood or faeces does not necessarily come from a parasite species that infects the red blood cells of that particular host.

  4. Towards functional antibody-based vaccines to prevent pre-erythrocytic malaria infection.

    PubMed

    Sack, Brandon; Kappe, Stefan H I; Sather, D Noah

    2017-05-01

    An effective malaria vaccine would be considered a milestone of modern medicine, yet has so far eluded research and development efforts. This can be attributed to the extreme complexity of the malaria parasites, presenting with a multi-stage life cycle, high genome complexity and the parasite's sophisticated immune evasion measures, particularly antigenic variation during pathogenic blood stage infection. However, the pre-erythrocytic (PE) early infection forms of the parasite exhibit relatively invariant proteomes, and are attractive vaccine targets as they offer multiple points of immune system attack. Areas covered: We cover the current state of and roadblocks to the development of an effective, antibody-based PE vaccine, including current vaccine candidates, limited biological knowledge, genetic heterogeneity, parasite complexity, and suboptimal preclinical models as well as the power of early stage clinical models. Expert commentary: PE vaccines will need to elicit broad and durable immunity to prevent infection. This could be achievable if recent innovations in studying the parasites' infection biology, rational vaccine selection and design as well as adjuvant formulation are combined in a synergistic and multipronged approach. Improved preclinical assays as well as the iterative testing of vaccine candidates in controlled human malaria infection trials will further accelerate this effort.

  5. Immune Evasion Strategies of Pre-Erythrocytic Malaria Parasites

    PubMed Central

    Zheng, Hong; Tan, Zhangping

    2014-01-01

    Malaria is a mosquito-borne infectious disease of humans. It begins with a bite from an infected female Anopheles mosquito and leads to the development of the pre-erythrocytic and blood stages. Blood-stage infection is the exclusive cause of clinical symptoms of malaria. In contrast, the pre-erythrocytic stage is clinically asymptomatic and could be an excellent target for preventive therapies. Although the robust host immune responses limit the development of the liver stage, malaria parasites have also evolved strategies to suppress host defenses at the pre-erythrocytic stage. This paper reviews the immune evasion strategies of malaria parasites at the pre-erythrocytic stage, which could provide us with potential targets to design prophylactic strategies against malaria. PMID:24891764

  6. Determining liver stage parasite burden by real time quantitative PCR as a method for evaluating pre-erythrocytic malaria vaccine efficacy.

    PubMed

    Witney, A A; Doolan, D L; Anthony, R M; Weiss, W R; Hoffman, S L; Carucci, D J

    2001-12-01

    The detection and quantitation of blood stage parasitaemia is typically used as a surrogate endpoint for estimating the efficacy of vaccines targeted against the hepatic stage, as well as the erythrocytic stage, of the parasite. However, this does not provide an adequate means of evaluating the efficacy of vaccines, which may be only partially effective at the liver-stage. This is a particular concern for effective evaluation of immune enhancement strategies for candidate pre-erythrocytic stage vaccines. Here, we have developed and validated a method for detecting and quantitating liver stage parasites, using the TaqMan fluorescent real-time quantitative PCR system (PE Applied Biosystems). This method uses TaqMan primers designed to the Plasmodium yoelii 18S rRNA gene and rodent GAPDH to amplify products from infected mouse liver cDNA. The technique is highly reproducible as demonstrated with plasmid controls and capable of efficiently quantitating liver-stage parasite burden following a range of sporozoite challenge doses in strains of mice, which differ in their susceptibility to sporozoite infection. We have further demonstrated the capacity of this technique to evaluate the efficacy of a range of pre-erythrocytic stage vaccines. Our data establish this quantitative real-time PCR assay to be a fast and reproducible way of accurately assessing liver stage parasite burden and vaccine efficacy in rodent malaria models.

  7. Effect of Transmission Intensity and Age on Subclass Antibody Responses to Plasmodium falciparum Pre-Erythrocytic and Blood-Stage Antigens

    PubMed Central

    Noland, Gregory S.; Jansen, Paul; Vulule, John M.; Park, Gregory S.; Ondigo, Bartholomew N.; Kazura, James W.; Moormann, Ann M.; John, Chandy C.

    2014-01-01

    Cytophilic immunoglobulin (IgG) subclass responses (IgG1 and IgG3) to Plasmodium falciparum antigens have been associated with protection from malaria, yet the relative importance of transmission intensity and age in generation of subclass responses to pre-erythrocytic and blood-stage antigens have not been clearly defined. We analyzed IgG subclass responses to the pre-erythrocytic antigens CSP, LSA-1, and TRAP and the blood-stage antigens AMA-1, EBA-175, and MSP-1 in asymptomatic residents age 2 years or older in stable (n=116) and unstable (n=96) transmission areas in Western Kenya. In the area of stable malaria transmission, a high prevalence of cytophilic (IgG1 and IgG3) antibodies to each antigen was seen in all age groups. Prevalence and levels of cytophilic antibodies to pre-erythrocytic and blood-stage P. falciparum antigens increased with age in the unstable transmission area, yet IgG1 and IgG3 responses to most antigens for all ages in the unstable transmission area were less prevalent and lower in magnitude than even the youngest age group from the stable transmission area. The dominance of cytophilic responses over non-cytophilic (IgG2 and IgG4) was more pronounced in the stable transmission area, and the ratio of IgG3 over IgG1 generally increased with age. In the unstable transmission area, the ratio of cytophilic to non-cytophilic antibodies did not increase with age, and tended to be IgG3-biased for pre-erythrocytic antigens yet IgG1-biased for blood-stage antigens. The differences between areas could not be attributed to active parasitemia status, as there were minimal differences in antibody responses between those positive and negative for Plasmodium infection by microscopy in the stable transmission area. Individuals in areas of unstable transmission have low cytophilic to non-cytophilic IgG subclass ratios and low IgG3:IgG1 ratios to P. falciparum antigens. These imbalances could contribute to the persistent risk of clinical malaria in these

  8. Malaria vaccine candidate antigen targeting the pre-erythrocytic stage of Plasmodium falciparum produced at high level in plants.

    PubMed

    Voepel, Nadja; Boes, Alexander; Edgue, Güven; Beiss, Veronique; Kapelski, Stephanie; Reimann, Andreas; Schillberg, Stefan; Pradel, Gabriele; Fendel, Rolf; Scheuermayer, Matthias; Spiegel, Holger; Fischer, Rainer

    2014-11-01

    Plants have emerged as low-cost production platforms suitable for vaccines targeting poverty-related diseases. Besides functional efficacy, the stability, yield, and purification process determine the production costs of a vaccine and thereby the feasibility of plant-based production. We describe high-level plant production and functional characterization of a malaria vaccine candidate targeting the pre-erythrocytic stage of Plasmodium falciparum. CCT, a fusion protein composed of three sporozoite antigens (P. falciparum cell traversal protein for ookinetes and sporozoites [PfCelTOS], P. falciparum circumsporozoite protein [PfCSP], and P. falciparum thrombospondin-related adhesive protein [PfTRAP]), was transiently expressed by agroinfiltration in Nicotiana benthamiana leaves, accumulated to levels up to 2 mg/g fresh leaf weight (FLW), was thermostable up to 80°C and could be purified to >95% using a simple two-step procedure. Reactivity of sera from malaria semi-immune donors indicated the immunogenic conformation of the purified fusion protein consisting of PfCelTOS, PfCSP_TSR, PfTRAP_TSR domains (CCT) protein. Total IgG from the CCT-specific mouse immune sera specifically recognized P. falciparum sporozoites in immunofluorescence assays and induced up to 35% inhibition in hepatocyte invasion assays. Featuring domains from three promising sporozoite antigens with different roles (attachment and cell traversal) in the hepatocyte invasion process, CCT has the potential to elicit broader immune responses against the pre-erythrocytic stage of P. falciparum and represents an interesting new candidate, also as a component of multi-stage, multi-subunit malaria vaccine cocktails.

  9. Effect of the pre-erythrocytic candidate malaria vaccine RTS,S/AS01E on blood stage immunity in young children.

    PubMed

    Bejon, Philip; Cook, Jackie; Bergmann-Leitner, Elke; Olotu, Ally; Lusingu, John; Mwacharo, Jedidah; Vekemans, Johan; Njuguna, Patricia; Leach, Amanda; Lievens, Marc; Dutta, Sheetij; von Seidlein, Lorenz; Savarese, Barbara; Villafana, Tonya; Lemnge, Martha M; Cohen, Joe; Marsh, Kevin; Corran, Patrick H; Angov, Evelina; Riley, Eleanor M; Drakeley, Chris J

    2011-07-01

    RTS,S/AS01(E) is the lead candidate malaria vaccine and confers pre-erythrocytic immunity. Vaccination may therefore impact acquired immunity to blood-stage malaria parasites after natural infection. We measured, by enzyme-linked immunosorbent assay, antibodies to 4 Plasmodium falciparum merozoite antigens (AMA-1, MSP-1(42), EBA-175, and MSP-3) and by growth inhibitory activity (GIA) using 2 parasite clones (FV0 and 3D7) at 4 times on 860 children who were randomized to receive with RTS,S/AS01(E) or a control vaccine.  Antibody concentrations to AMA-1, EBA-175, and MSP-1(42) decreased with age during the first year of life, then increased to 32 months of age. Anti-MSP-3 antibody concentrations gradually increased, and GIA gradually decreased up to 32 months. Vaccination with RTS,S/AS01(E) resulted in modest reductions in AMA-1, EBA-175, MSP-1(42), and MSP-3 antibody concentrations and no significant change in GIA. Increasing anti-merozoite antibody concentrations and GIA were prospectively associated with increased risk of clinical malaria. Vaccination with RTS,S/AS01E reduces exposure to blood-stage parasites and, thus, reduces anti-merozoite antigen antibody concentrations. However, in this study, these antibodies were not correlates of clinical immunity to malaria. Instead, heterogeneous exposure led to confounded, positive associations between increasing antibody concentration and increasing risk of clinical malaria.

  10. Identification of Novel Pre-Erythrocytic Malaria Antigen Candidates for Combination Vaccines with Circumsporozoite Protein

    PubMed Central

    Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W.; Garcia, Valentino; Kappe, Stefan H. I.; Krzych, Urszula; Duffy, Patrick E.

    2016-01-01

    Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP. PMID:27434123

  11. An expanding toolkit for preclinical pre-erythrocytic malaria vaccine development: bridging traditional mouse malaria models and human trials.

    PubMed

    Steel, Ryan Wj; Kappe, Stefan Hi; Sack, Brandon K

    2016-12-01

    Malaria remains a significant public health burden with 214 million new infections and over 400,000 deaths in 2015. Elucidating relevant Plasmodium parasite biology can lead to the identification of novel ways to control and ultimately eliminate the parasite within geographic areas. Particularly, the development of an effective vaccine that targets the clinically silent pre-erythrocytic stages of infection would significantly augment existing malaria elimination tools by preventing both the onset of blood-stage infection/disease as well as spread of the parasite through mosquito transmission. In this Perspective, we discuss the role of small animal models in pre-erythrocytic stage vaccine development, highlighting how human liver-chimeric and human immune system mice are emerging as valuable components of these efforts.

  12. Cross-stage immunity for malaria vaccine development.

    PubMed

    Nahrendorf, Wiebke; Scholzen, Anja; Sauerwein, Robert W; Langhorne, Jean

    2015-12-22

    A vaccine against malaria is urgently needed for control and eventual eradication. Different approaches are pursued to induce either sterile immunity directed against pre-erythrocytic parasites or to mimic naturally acquired immunity by controlling blood-stage parasite densities and disease severity. Pre-erythrocytic and blood-stage malaria vaccines are often seen as opposing tactics, but it is likely that they have to be combined into a multi-stage malaria vaccine to be optimally safe and effective. Since many antigenic targets are shared between liver- and blood-stage parasites, malaria vaccines have the potential to elicit cross-stage protection with immune mechanisms against both stages complementing and enhancing each other. Here we discuss evidence from pre-erythrocytic and blood-stage subunit and whole parasite vaccination approaches that show that protection against malaria is not necessarily stage-specific. Parasites arresting at late liver-stages especially, can induce powerful blood-stage immunity, and similarly exposure to blood-stage parasites can afford pre-erythrocytic immunity. The incorporation of a blood-stage component into a multi-stage malaria vaccine would hence not only combat breakthrough infections in the blood should the pre-erythrocytic component fail to induce sterile protection, but would also actively enhance the pre-erythrocytic potency of this vaccine. We therefore advocate that future studies should concentrate on the identification of cross-stage protective malaria antigens, which can empower multi-stage malaria vaccine development.

  13. Stages of HIV Infection

    MedlinePlus

    ... Infection Subscribe Translate Text Size Print Stages of HIV Infection How Does HIV Progress in Your Body? Without treatment, HIV advances ... are the three stages of HIV infection: Acute HIV Infection Stage Within 2-4 weeks after HIV ...

  14. Identification of Two New Protective Pre-erythrocytic Malaria Vaccine Antigen Candidates

    DTIC Science & Technology

    2011-01-01

    Adenovirus-vectored Malaria Vaccines Encoding Plasmodium falciparum Circumsporozoite Protein (CSP) and Apical Membrane Antigen (AMA1) in Malaria -Naïve...Baisor M, Lorry K, Brown G, Pye D, Irving D, Smith T, Beck H, Alpers M: A recombinant blood-stage malaria vaccine reduces Plasmodium falciparum ...study, the efficacy of three pre-erythrocytic stage malaria antigens was evaluated in a Plasmodium yoelii/mouse protection model. Methods: Mice were

  15. Effect of pyrimethamine upon sporogony and pre-erythrocytic schizogony of Laverania falciparum.

    PubMed

    BRAY, R S; BURGESS, R W; FOX, R M; MILLER, M J

    1959-01-01

    Studies have been conducted in Liberia on the effect of pyrimethamine on the sporogony and, for the first time, on the pre-erythrocytic schizogony of Laverania falciparum. From the results reported here it is concluded that it may reasonably be assumed that a mass monthly regimen of pyrimethamine in Liberia could afford protection to the individual and to the mosquito and thus to the population at large, provided that resistance to pyrimethamine does not intervene.Pyrimethamine in single doses of 25 mg or 50 mg administered to gametocyte carriers was able to render gametocytes of L. falciparum uninfective to A. gambiae for periods up to 28 days after administration.Mosquitos feeding upon a malaria-free pyrimethamine-treated subject before or after feeding upon a non-treated gametocyte carrier became infected and sporozoites appeared in the salivary glands.Pyrimethamine administered in 12.5-mg doses 13 days before, 6 days before and 2 days after sporozoite infection or administered in 25-mg doses 35 days and 7 days before sporozoite infection disallowed the development of the pre-erythrocytic schizonts of L. falciparum in the livers of two chimpanzees.

  16. Protective Immunity to Pre-Erythrocytic Stage Malaria

    DTIC Science & Technology

    2011-01-01

    virus; this is coexpressed with free surface Ag to form an hepatitis B surface (HBs) Ag-like particle. RTS,S has been formulated in different...liposome formulation . The RTS,S vaccine con- fers sterile immunity to 40–50% of malaria-naı̈ve subjects against a primary sporozoite challenge, and...present at the time of injection for Abs to confer protection. This implies a need for sustained Ab production by long-lived plasma cells (PC) (Figure

  17. Plasmodium vivax Pre-Erythrocytic–Stage Antigen Discovery: Exploiting Naturally Acquired Humoral Responses

    PubMed Central

    Molina, Douglas M.; Finney, Olivia C.; Arevalo-Herrera, Myriam; Herrera, Socrates; Felgner, Philip L.; Gardner, Malcolm J.; Liang, Xiaowu; Wang, Ruobing

    2012-01-01

    The development of pre-erythrocytic Plasmodium vivax vaccines is hindered by the lack of in vitro culture systems or experimental rodent models. To help bypass these roadblocks, we exploited the fact that naturally exposed Fy− individuals who lack the Duffy blood antigen (Fy) receptor are less likely to develop blood-stage infections; therefore, they preferentially develop immune responses to pre-erythrocytic–stage parasites, whereas Fy+ individuals experience both liver- and blood-stage infections and develop immune responses to both pre-erythrocytic and erythrocytic parasites. We screened 60 endemic sera from P. vivax-exposed Fy+ or Fy− donors against a protein microarray containing 91 P. vivax proteins with P. falciparum orthologs that were up-regulated in sporozoites. Antibodies against 10 P. vivax antigens were identified in sera from P. vivax-exposed individuals but not unexposed controls. This technology has promising implications in the discovery of potential vaccine candidates against P. vivax malaria. PMID:22826492

  18. Immunological memory to blood-stage malaria infection is controlled by the histamine releasing factor (HRF) of the parasite.

    PubMed

    Demarta-Gatsi, Claudia; Peronet, Roger; Smith, Leanna; Thiberge, Sabine; Ménard, Robert; Mécheri, Salaheddine

    2017-08-22

    While most subunit malaria vaccines provide only limited efficacy, pre-erythrocytic and erythrocytic genetically attenuated parasites (GAP) have been shown to confer complete sterilizing immunity. We recently generated a Plasmodium berghei (PbNK65) parasite that lacks a secreted factor, the histamine releasing factor (HRF) (PbNK65 hrfΔ), and induces in infected mice a self-resolving blood stage infection accompanied by a long lasting immunity. Here, we explore the immunological mechanisms underlying the anti-parasite protective properties of the mutant PbNK65 hrfΔ and demonstrate that in addition to an up-regulation of IL-6 production, CD4(+) but not CD8(+) T effector lymphocytes are indispensable for the clearance of malaria infection. Maintenance of T cell-associated protection is associated with the reduction in CD4(+)PD-1(+) and CD8(+)PD-1(+) T cell numbers. A higher number of central and effector memory B cells in mutant-infected mice also plays a pivotal role in protection. Importantly, we also demonstrate that prior infection with WT parasites followed by a drug cure does not prevent the induction of PbNK65 hrfΔ-induced protection, suggesting that such protection in humans may be efficient even in individuals that have been infected and who repeatedly received antimalarial drugs.

  19. Analysis of a Multi-component Multi-stage Malaria Vaccine Candidate--Tackling the Cocktail Challenge.

    PubMed

    Boes, Alexander; Spiegel, Holger; Voepel, Nadja; Edgue, Gueven; Beiss, Veronique; Kapelski, Stephanie; Fendel, Rolf; Scheuermayer, Matthias; Pradel, Gabriele; Bolscher, Judith M; Behet, Marije C; Dechering, Koen J; Hermsen, Cornelus C; Sauerwein, Robert W; Schillberg, Stefan; Reimann, Andreas; Fischer, Rainer

    2015-01-01

    Combining key antigens from the different stages of the P. falciparum life cycle in the context of a multi-stage-specific cocktail offers a promising approach towards the development of a malaria vaccine ideally capable of preventing initial infection, the clinical manifestation as well as the transmission of the disease. To investigate the potential of such an approach we combined proteins and domains (11 in total) from the pre-erythrocytic, blood and sexual stages of P. falciparum into a cocktail of four different components recombinantly produced in plants. After immunization of rabbits we determined the domain-specific antibody titers as well as component-specific antibody concentrations and correlated them with stage specific in vitro efficacy. Using purified rabbit immune IgG we observed strong inhibition in functional in vitro assays addressing the pre-erythrocytic (up to 80%), blood (up to 90%) and sexual parasite stages (100%). Based on the component-specific antibody concentrations we calculated the IC50 values for the pre-erythrocytic stage (17-25 μg/ml), the blood stage (40-60 μg/ml) and the sexual stage (1.75 μg/ml). While the results underline the feasibility of a multi-stage vaccine cocktail, the analysis of component-specific efficacy indicates significant differences in IC50 requirements for stage-specific antibody concentrations providing valuable insights into this complex scenario and will thereby improve future approaches towards malaria vaccine cocktail development regarding the selection of suitable antigens and the ratios of components, to fine tune overall and stage-specific efficacy.

  20. Analysis of a Multi-component Multi-stage Malaria Vaccine Candidate—Tackling the Cocktail Challenge

    PubMed Central

    Voepel, Nadja; Edgue, Gueven; Beiss, Veronique; Kapelski, Stephanie; Fendel, Rolf; Scheuermayer, Matthias; Pradel, Gabriele; Bolscher, Judith M.; Behet, Marije C.; Dechering, Koen J.; Hermsen, Cornelus C.; Sauerwein, Robert W.; Schillberg, Stefan; Reimann, Andreas; Fischer, Rainer

    2015-01-01

    Combining key antigens from the different stages of the P. falciparum life cycle in the context of a multi-stage-specific cocktail offers a promising approach towards the development of a malaria vaccine ideally capable of preventing initial infection, the clinical manifestation as well as the transmission of the disease. To investigate the potential of such an approach we combined proteins and domains (11 in total) from the pre-erythrocytic, blood and sexual stages of P. falciparum into a cocktail of four different components recombinantly produced in plants. After immunization of rabbits we determined the domain-specific antibody titers as well as component-specific antibody concentrations and correlated them with stage specific in vitro efficacy. Using purified rabbit immune IgG we observed strong inhibition in functional in vitro assays addressing the pre-erythrocytic (up to 80%), blood (up to 90%) and sexual parasite stages (100%). Based on the component-specific antibody concentrations we calculated the IC50 values for the pre-erythrocytic stage (17–25 μg/ml), the blood stage (40–60 μg/ml) and the sexual stage (1.75 μg/ml). While the results underline the feasibility of a multi-stage vaccine cocktail, the analysis of component-specific efficacy indicates significant differences in IC50 requirements for stage-specific antibody concentrations providing valuable insights into this complex scenario and will thereby improve future approaches towards malaria vaccine cocktail development regarding the selection of suitable antigens and the ratios of components, to fine tune overall and stage-specific efficacy. PMID:26147206

  1. Late Stage Infection in Sleeping Sickness

    PubMed Central

    Acker, Sven; Frey, Claudia; Meinert, Monika; Schönfeld, Caroline; Lazarus, Michael; Urade, Yoshihiro; Kubata, Bruno Kilunga; Duszenko, Michael

    2012-01-01

    At the turn of the 19th century, trypanosomes were identified as the causative agent of sleeping sickness and their presence within the cerebrospinal fluid of late stage sleeping sickness patients was described. However, no definitive proof of how the parasites reach the brain has been presented so far. Analyzing electron micrographs prepared from rodent brains more than 20 days after infection, we present here conclusive evidence that the parasites first enter the brain via the choroid plexus from where they penetrate the epithelial cell layer to reach the ventricular system. Adversely, no trypanosomes were observed within the parenchyma outside blood vessels. We also show that brain infection depends on the formation of long slender trypanosomes and that the cerebrospinal fluid as well as the stroma of the choroid plexus is a hostile environment for the survival of trypanosomes, which enter the pial space including the Virchow-Robin space via the subarachnoid space to escape degradation. Our data suggest that trypanosomes do not intend to colonize the brain but reside near or within the glia limitans, from where they can re-populate blood vessels and disrupt the sleep wake cycles. PMID:22496723

  2. Late stage infection in sleeping sickness.

    PubMed

    Wolburg, Hartwig; Mogk, Stefan; Acker, Sven; Frey, Claudia; Meinert, Monika; Schönfeld, Caroline; Lazarus, Michael; Urade, Yoshihiro; Kubata, Bruno Kilunga; Duszenko, Michael

    2012-01-01

    At the turn of the 19(th) century, trypanosomes were identified as the causative agent of sleeping sickness and their presence within the cerebrospinal fluid of late stage sleeping sickness patients was described. However, no definitive proof of how the parasites reach the brain has been presented so far. Analyzing electron micrographs prepared from rodent brains more than 20 days after infection, we present here conclusive evidence that the parasites first enter the brain via the choroid plexus from where they penetrate the epithelial cell layer to reach the ventricular system. Adversely, no trypanosomes were observed within the parenchyma outside blood vessels. We also show that brain infection depends on the formation of long slender trypanosomes and that the cerebrospinal fluid as well as the stroma of the choroid plexus is a hostile environment for the survival of trypanosomes, which enter the pial space including the Virchow-Robin space via the subarachnoid space to escape degradation. Our data suggest that trypanosomes do not intend to colonize the brain but reside near or within the glia limitans, from where they can re-populate blood vessels and disrupt the sleep wake cycles.

  3. Progress and prospects for blood-stage malaria vaccines

    PubMed Central

    Miura, Kazutoyo

    2016-01-01

    ABSTRACT There have been significant decreases in malaria mortality and morbidity in the last 10-15 years, and the most advanced pre-erythrocytic malaria vaccine, RTS,S, received a positive opinion from European regulators in July 2015. However, no blood-stage vaccine has reached a phase III trial. The first part of this review summarizes the pros and cons of various assays and models that have been and will be used to predict the efficacy of blood-stage vaccines. In the second part, blood-stage vaccine candidates that showed some efficacy in human clinical trials or controlled human malaria infection models are discussed. Then, candidates under clinical investigation are described in the third part, and other novel candidates and strategies are reviewed in the last part. PMID:26760062

  4. Progress and prospects for blood-stage malaria vaccines.

    PubMed

    Miura, Kazutoyo

    2016-06-01

    There have been significant decreases in malaria mortality and morbidity in the last 10-15 years, and the most advanced pre-erythrocytic malaria vaccine, RTS,S, received a positive opinion from European regulators in July 2015. However, no blood-stage vaccine has reached a phase III trial. The first part of this review summarizes the pros and cons of various assays and models that have been and will be used to predict the efficacy of blood-stage vaccines. In the second part, blood-stage vaccine candidates that showed some efficacy in human clinical trials or controlled human malaria infection models are discussed. Then, candidates under clinical investigation are described in the third part, and other novel candidates and strategies are reviewed in the last part.

  5. ChAd63-MVA–vectored Blood-stage Malaria Vaccines Targeting MSP1 and AMA1: Assessment of Efficacy Against Mosquito Bite Challenge in Humans

    PubMed Central

    Sheehy, Susanne H; Duncan, Christopher JA; Elias, Sean C; Choudhary, Prateek; Biswas, Sumi; Halstead, Fenella D; Collins, Katharine A; Edwards, Nick J; Douglas, Alexander D; Anagnostou, Nicholas A; Ewer, Katie J; Havelock, Tom; Mahungu, Tabitha; Bliss, Carly M; Miura, Kazutoyo; Poulton, Ian D; Lillie, Patrick J; Antrobus, Richard D; Berrie, Eleanor; Moyle, Sarah; Gantlett, Katherine; Colloca, Stefano; Cortese, Riccardo; Long, Carole A; Sinden, Robert E; Gilbert, Sarah C; Lawrie, Alison M; Doherty, Tom; Faust, Saul N; Nicosia, Alfredo; Hill, Adrian VS; Draper, Simon J

    2012-01-01

    The induction of cellular immunity, in conjunction with antibodies, may be essential for vaccines to protect against blood-stage infection with the human malaria parasite Plasmodium falciparum. We have shown that prime-boost delivery of P. falciparum blood-stage antigens by chimpanzee adenovirus 63 (ChAd63) followed by the attenuated orthopoxvirus MVA is safe and immunogenic in healthy adults. Here, we report on vaccine efficacy against controlled human malaria infection delivered by mosquito bites. The blood-stage malaria vaccines were administered alone, or together (MSP1+AMA1), or with a pre-erythrocytic malaria vaccine candidate (MSP1+ME-TRAP). In this first human use of coadministered ChAd63-MVA regimes, we demonstrate immune interference whereby responses against merozoite surface protein 1 (MSP1) are dominant over apical membrane antigen 1 (AMA1) and ME-TRAP. We also show that induction of strong cellular immunity against MSP1 and AMA1 is safe, but does not impact on parasite growth rates in the blood. In a subset of vaccinated volunteers, a delay in time to diagnosis was observed and sterilizing protection was observed in one volunteer coimmunized with MSP1+AMA1—results consistent with vaccine-induced pre-erythrocytic, rather than blood-stage, immunity. These data call into question the utility of T cell-inducing blood-stage malaria vaccines and suggest that the focus should remain on high-titer antibody induction against susceptible antigen targets. PMID:23089736

  6. High infection control rate and function after routine one-stage exchange for chronically infected TKA.

    PubMed

    Jenny, Jean-Yves; Barbe, Bruno; Gaudias, Jeannot; Boeri, Cyril; Argenson, Jean-Noël

    2013-01-01

    Many surgeons consider two-stage exchange the gold standard for treating chronic infection after TKA. One-stage exchange is an alternative for infection control and might provide better knee function, but the rates of infection control and levels of function are unclear. We asked whether a one-stage exchange protocol would lead to infection control rates and knee function similar to those after two-stage exchange. We followed all 47 patients with chronically infected TKAs treated with one-stage exchange between July 2004 and February 2007. We monitored for recurrence of infection and obtained Knee Society Scores. We followed patients a minimum of 3 years or until death or infection recurrence. Three of the 47 patients (6%) experienced a persistence or recurrence of the index infection with the same pathogen isolated. Three patients (6%) had control of the index infection but between 6 and 17 months experienced an infection with another pathogen. The 3-year survival rates were 87% for being free of any infection and 91% for being healed of the index infection. Twenty-five of the 45 patients (56%) had a Knee Society Score of more than 150 points. While routine one-stage exchange was not associated with a higher rate of infection recurrence failure, knee function was not improved compared to that of historical patients having two-stage exchange. One stage-exchange may be a reasonable alternative in chronically infected TKA as a more convenient approach for patients without the risks of two operations and hospitalizations and for reducing costs. The ideal one stage-exchange candidate should be identified in future studies.

  7. The development and fine structure of Lankesterella cf. dicroglossi (Apicomplexa: Lankesterellidae) infecting frogs in Niger, West Africa.

    PubMed

    Paperna, I; Martin, C

    2001-01-01

    One of four Hoplobatrachus occipitalis (Günther, 1859) frogs received from Niger, West Africa was heavily infected with Lankesterella blood and pre-erythrocytic stages. Infected blood and tissues from this frog were force-fed to the remaining three frogs. Two survived to necropsy on days 14 and 27 post-feeding and were found to be infected with gamogonic and oogonic stages, respectively. The source of infection is inconclusive, as a natural origin cannot be excluded. Microgamont, macrogamont, oocyst and sporozoite structure and fine structure are described and found to conform in general, but not in detail, to previous descriptions. Gamonts and oocysts occurred predominantly in the liver and spleen. Walled sporulating oocysts were situated within macrophage centres. Oocysts yielded a progeny of 32 sporozoites. Pre-erythrocytic sporozoites developed within expanded inclusions, within their host cell, from which they massively invaded the liver and spleen, and to a lesser extent the lungs and kidneys. Sporozoites occurred in a parasitophorous vacuole in the erythrocytes. Conspecificity with Lankesterella dicroglossi Paperna et Ogara, 1996 reported from the same host species in Kenya remains uncertain due to several structural and developmental differences.

  8. Broadly distributed T cell reactivity, with no immunodominant loci, to the pre-erythrocytic antigen thrombospondin-related adhesive protein of Plasmodium falciparum in West Africans.

    PubMed

    Flanagan, K L; Plebanski, M; Akinwunmi, P; Lee, E A; Reece, W H; Robson, K J; Hill, A V; Pinder, M

    1999-06-01

    Protective immunity to malaria has been achieved in human volunteers utilizing the pre-erythrocytic Plasmodium falciparum antigen, the circumsporozoite protein (CS). However, T cell reactivity to CS is focused on several highly polymorphic T cell epitope regions, potentially limiting the efficacy of any vaccine to specific malaria strains. Another important pre-erythrocytic malaria antigen, the thrombospondin-related adhesive protein (TRAP), can induce protection in animal models of malaria, but knowledge of human T cell responses is limited to the identification of CD8 T cell epitopes, with no CD4 epitopes identified to date. This comprehensive study assessed reactivity to overlapping peptides spanning almost the whole of P. falciparum TRAP (PfTRAP), as well as peptides selected on the basis of HLA class II-binding motifs. A total of 50 naturally exposed Gambian adults were assessed to define 26 T cell epitopes in PfTRAP capable of inducing rapid IFN-gamma or IL-4 production, as assessed by enzyme-linked immunospot assays. In contrast to the CS protein, this reactivity was broadly distributed along the length of TRAP. Moreover, of the 26 epitopes identified, 10 were found to be conserved in West Africa.

  9. Disruption of the Plasmodium falciparum liver-stage antigen-1 locus causes a differentiation defect in late liver-stage parasites.

    PubMed

    Mikolajczak, Sebastian A; Sacci, John B; De La Vega, Patricia; Camargo, Nelly; VanBuskirk, Kelly; Krzych, Urszula; Cao, Jun; Jacobs-Lorena, Marcelo; Cowman, Alan F; Kappe, Stefan H I

    2011-08-01

    The malaria parasite Plasmodium falciparum infects humans and first targets the liver where liver-stage parasites undergo pre-erythrocytic replication. Liver-stage antigen-1 (LSA-1) is currently the only identified P. falciparum protein for which expression is restricted to liver stages. Yet, the importance of LSA-1 for liver-stage parasite development remains unknown. Here we deleted LSA-1 in the NF54 strain of P. falciparum and analysed the lsa-1(-) parasites throughout their life cycle. lsa-1(-) sporozoites had normal gliding motility and invasion into hepatocytes. Six days after infection of a hepatocytic cell line, lsa-1(-) parasites exhibited a moderate phenotype with an ~50% reduction of late liver-stage forms when compared with wild type. Strikingly, lsa-1(-) parasites growing in SCID/Alb-uPA mice with humanized livers showed a severe defect in late liver-stage differentiation and exo-erythrocytic merozoite formation 7 days after infection, a time point when wild-type parasites develop into mature merozoites. The lsa-1(-) parasites also showed aberrant liver-stage expression of key parasite proteins apical membrane antigen-1 and circumsporozoite protein. Our data show that LSA-1 plays a critical role during late liver-stage schizogony and is thus important in the parasite transition from the liver to blood. LSA-1 is the first P. falciparum protein identified to be required for this transitional stage of the parasite life cycle. © 2011 Blackwell Publishing Ltd.

  10. Blood-stage malaria infection in diabetic mice.

    PubMed

    Elased, K; De Souza, J B; Playfair, J H

    1995-03-01

    Infection of mice with blood-stage Plasmodium yoelii and P. chabaudi malaria induced hypoglycaemia in normal mice and normalized the hyperglycaemia of mice made moderately diabetic with streptozotocin (STZ). Injection of parasite supernatants induced hypoglycaemia accompanied by hyperinsulinaemia in normal mice, and in STZ-diabetic mice induced a profound drop in blood glucose and restored insulin secretion; however, severely diabetic mice (two injections of STZ) remained hyperglycaemic with no change in insulin levels. We conclude that malaria infection and parasite-derived molecules lower blood glucose concentration, but only in the presence of some residual pancreatic function. Diabetic mice were less anaemic, exerted a significant control of parasitaemia, and showed enhanced phagocytic activity compared with normal mice.

  11. Proteomic profiling of the infective trophozoite stage of Acanthamoeba polyphaga.

    PubMed

    Caumo, Karin Silva; Monteiro, Karina Mariante; Ott, Thiely Rodrigues; Maschio, Vinicius José; Wagner, Glauber; Ferreira, Henrique Bunselmeyer; Rott, Marilise Brittes

    2014-12-01

    Acanthamoeba polyphaga is a free-living protozoan pathogen, whose infective trophozoite form is capable of causing a blinding keratitis and fatal granulomatous encephalitis in humans. The damage caused by A. polyphaga trophozoites in human corneal or brain infections is the result of several different pathogenic mechanisms that have not yet been elucidated at the molecular level. We performed a comprehensive analysis of the proteins expressed by A. polyphaga trophozoites, based on complementary 2-DE MS/MS and gel-free LC-MS/MS approaches. Overall, 202 non-redundant proteins were identified. An A. polyphaga proteomic map in the pH range 3-10 was produced, with protein identification for 184 of 370 resolved spots, corresponding to 142 proteins. Additionally, 94 proteins were identified by gel-free LC-MS/MS. Functional classification revealed several proteins with potential importance for pathogen survival and infection of mammalian hosts, including surface proteins and proteins related to defense mechanisms. Our study provided the first comprehensive proteomic survey of the trophozoite infective stage of an Acanthamoeba species, and established foundations for prospective, comparative and functional studies of proteins involved in mechanisms of survival, development, and pathogenicity in A. polyphaga and other pathogenic amoebae.

  12. A case for one-stage revision in infected total knee arthroplasty?

    PubMed

    Parkinson, Richard W; Kay, Peter R; Rawal, Arvind

    2011-01-01

    Infection in total knee replacement is a rare but devastating complication. The current literature tends to support a two-stage revision as definitive treatment of established deep infection. Despite the fact that single stage revision is a well recognised treatment for the infected hip replacement, it has not gained the same level of support in the knee. This article reviews the literature of two-stage and single stage revision and reports the senior author's experience with the latter.

  13. The malarial serine protease SUB1 plays an essential role in parasite liver stage development.

    PubMed

    Suarez, Catherine; Volkmann, Katrin; Gomes, Ana Rita; Billker, Oliver; Blackman, Michael J

    2013-01-01

    Transmission of the malaria parasite to its vertebrate host involves an obligatory exoerythrocytic stage in which extensive asexual replication of the parasite takes place in infected hepatocytes. The resulting liver schizont undergoes segmentation to produce thousands of daughter merozoites. These are released to initiate the blood stage life cycle, which causes all the pathology associated with the disease. Whilst elements of liver stage merozoite biology are similar to those in the much better-studied blood stage merozoites, little is known of the molecular players involved in liver stage merozoite production. To facilitate the study of liver stage biology we developed a strategy for the rapid production of complex conditional alleles by recombinase mediated engineering in Escherichia coli, which we used in combination with existing Plasmodium berghei deleter lines expressing Flp recombinase to study subtilisin-like protease 1 (SUB1), a conserved Plasmodium serine protease previously implicated in blood stage merozoite maturation and egress. We demonstrate that SUB1 is not required for the early stages of intrahepatic growth, but is essential for complete development of the liver stage schizont and for production of hepatic merozoites. Our results indicate that inhibitors of SUB1 could be used in prophylactic approaches to control or block the clinically silent pre-erythrocytic stage of the malaria parasite life cycle.

  14. World Conference on Pre-Erythrocytic Stage Malaria Vaccine Development: Current Status and Future Prospects Held in Bethesda, Maryland on April 12-15, 1989

    DTIC Science & Technology

    1989-12-01

    demonstrated their protective activity . Such antibodies predominantly react with the Inmunodominant repeat region of CS proteins, and MAb’s to CS...differences between naturally-acquired and monoclonal antibodies require Investigation, as MAb-neutralizing activity may define epItopes, probably...hepatocyte recognition and invasion, by facilitating Fc-mediatedmacrophage (Kupffer cell) opsinization , or other mechanisms. The mechanism by which

  15. Parasitic infection in various stages life of cultured Acipenser persicus

    PubMed Central

    Adel, Milad; Safari, Reza; Yaghoubzadeh, Zahra; Fazli, Hassan; Khalili, Elham

    2016-01-01

    The present study was conducted to evaluate the status of the parasite fauna in Acipenser persicus at different development stages, in order to find prevention protocols for parasitic diseases in this valuable species. For this purpose, sampling from each sex breeder, 10 egg samples, 5-day-old larvae (n = 20), 20-day-old larvae (n = 80) and fingerling of A. persicus (n = 60) released in earthen ponds were done. After the bioassay and preparing wet mount from the internal and external organs, identification was done according to the keys. According to the results, no fauna parasites were isolated from egg samples and 5-day-old larvae; but Trichodina spp. was isolated from 20-day-old larvae. Also, the same protozoan was isolated from fingerling released in earthen ponds, the mean intensity, prevalence and range of contamination by fingerling were higher with compared to 20-day-old larvae. Trichodina sp. and Diplostomum spathaceum were isolated from skin and eyes of females, respectively. However, Trichodina sp. and Ichthyophthirius multifiliis were isolated from skin of male breeders. In this study, no parasites were isolated from internal organs of larves and fingerling but four intestinal parasites included: Cucullanus sphaerocephlaus, Anisakis sp., Skyrjabinopsilus semiarmatus, and Lepto-rhynchoides plagicephalu were isolated from internal organs of breeder. Based on a wide range of parasitic infection observed in various life stages of A. persicus, it seems necessary to consider hygienic and management measures. PMID:27226891

  16. Parasitic infection in various stages life of cultured Acipenser persicus.

    PubMed

    Adel, Milad; Safari, Reza; Yaghoubzadeh, Zahra; Fazli, Hassan; Khalili, Elham

    2016-01-01

    The present study was conducted to evaluate the status of the parasite fauna in Acipenser persicus at different development stages, in order to find prevention protocols for parasitic diseases in this valuable species. For this purpose, sampling from each sex breeder, 10 egg samples, 5-day-old larvae (n = 20), 20-day-old larvae (n = 80) and fingerling of A. persicus (n = 60) released in earthen ponds were done. After the bioassay and preparing wet mount from the internal and external organs, identification was done according to the keys. According to the results, no fauna parasites were isolated from egg samples and 5-day-old larvae; but Trichodina spp. was isolated from 20-day-old larvae. Also, the same protozoan was isolated from fingerling released in earthen ponds, the mean intensity, prevalence and range of contamination by fingerling were higher with compared to 20-day-old larvae. Trichodina sp. and Diplostomum spathaceum were isolated from skin and eyes of females, respectively. However, Trichodina sp. and Ichthyophthirius multifiliis were isolated from skin of male breeders. In this study, no parasites were isolated from internal organs of larves and fingerling but four intestinal parasites included: Cucullanus sphaerocephlaus, Anisakis sp., Skyrjabinopsilus semiarmatus, and Lepto-rhynchoides plagicephalu were isolated from internal organs of breeder. Based on a wide range of parasitic infection observed in various life stages of A. persicus, it seems necessary to consider hygienic and management measures.

  17. Does cemented or cementless single-stage exchange arthroplasty of chronic periprosthetic hip infections provide similar infection rates to a two-stage? A systematic review.

    PubMed

    George, D A; Logoluso, N; Castellini, G; Gianola, S; Scarponi, S; Haddad, F S; Drago, L; Romano, C L

    2016-10-10

    The best surgical modality for treating chronic periprosthetic hip infections remains controversial, with a lack of randomised controlled studies. The aim of this systematic review is to compare the infection recurrence rate after a single-stage versus a two-stage exchange arthroplasty, and the rate of cemented versus cementless single-stage exchange arthroplasty for chronic periprosthetic hip infections. We searched for eligible studies published up to December 2015. Full text or abstract in English were reviewed. We included studies reporting the infection recurrence rate as the outcome of interest following single- or two-stage exchange arthroplasty, or both, with a minimum follow-up of 12 months. Two reviewers independently abstracted data and appraised quality assessment. After study selection, 90 observational studies were included. The majority of studies were focused on a two-stage hip exchange arthroplasty (65 %), 18 % on a single-stage exchange, and only a 17 % were comparative studies. There was no statistically significant difference between a single-stage versus a two-stage exchange in terms of recurrence of infection in controlled studies (pooled odds ratio of 1.37 [95 % CI = 0.68-2.74, I(2) = 45.5 %]). Similarly, the recurrence infection rate in cementless versus cemented single-stage hip exchanges failed to demonstrate a significant difference, due to the substantial heterogeneity among the studies. Despite the methodological limitations and the heterogeneity between single cohorts studies, if we considered only the available controlled studies no superiority was demonstrated between a single- and two-stage exchange at a minimum of 12 months follow-up. The overalapping of confidence intervals related to single-stage cementless and cemented hip exchanges, showed no superiority of either technique.

  18. Characteristics of infections in patients undergoing staged implantation for sacral nerve stimulation.

    PubMed

    Guralnick, Michael L; Benouni, Saraleen; O'Connor, R Corey; Edmiston, Charles

    2007-06-01

    To review clinical and surgical factors in patients who have undergone staged sacral nerve stimulator implantation and to determine whether there are any identifiable risk factors for infection. A retrospective chart review was performed on 76 consecutive patients undergoing staged implantation for sacral nerve stimulation for voiding dysfunction. Patients with postprocedural wound infections (after Stage 1 or Stage 2) were compared with those without infections with regard to demographic factors and surgical characteristics, such as operative time and duration of exposed lead wire. Organisms cultured were also documented. Lead infection occurred in 9 of 76 patients (12%). All cultures grew Staphylococcus aureus. Of 9 patients with lead infection, 6 had organisms sensitive to their perioperative antibiotic. Forty-five patients had an implantable pulse generator implanted, and 5 infections occurred (11%). Four cultures grew S. aureus (all sensitive to the perioperative antibiotic given), whereas one grew Pseudomonas. The only significant difference in clinical/surgical characteristics between infected and noninfected patients was a longer operative time for Stage 2 in infected patients. In addition, 3 patients with infection had one or more known risk factors for wound infection (steroid use, severe psoriasis, recurrent skin abscess). Apart from known risk factors for surgical wound infections, the only variable we could identify that might increase the risk for infection is a longer operative time for Stage 2. S. aureus was the organism most commonly cultured. Often it was sensitive to the perioperative antibiotic prophylaxis.

  19. Semen CD4+ T Cells and Macrophages Are Productively Infected at All Stages of SIV infection in Macaques

    PubMed Central

    Bernard-Stoecklin, Sibylle; Gommet, Céline; Corneau, Aurélien B.; Guenounou, Sabrina; Torres, Claire; Dejucq-Rainsford, Nathalie; Cosma, Antonio; Dereuddre-Bosquet, Nathalie; Le Grand, Roger

    2013-01-01

    The mucosal events of HIV transmission have been extensively studied, but the role of infected cells present in the genital and rectal secretions, and in the semen, in particular, remains a matter of debate. As a prerequisite to a thorough in vivo investigation of the early transmission events through infected cells, we characterized in detail by multi-parameter flow cytometry the changes in macaque seminal leukocytes during SIVmac251 infection, focusing on T cells, macrophages and dendritic cells. Using immunocytofluorescence targeting SIV proteins and real-time quantitative PCR targeting SIV DNA, we investigated the nature of the infected cells on sorted semen leukocytes from macaques at different stages of infection. Finally, we cocultured semen CD4+ T cells and macrophages with a cell line permissive to SIV infection to assess their infectivity in vitro. We found that primary infection induced strong local inflammation, which was associated with an increase in the number of leukocytes in semen, both factors having the potential to favor cell-associated virus transmission. Semen CD4+ T cells and macrophages were productively infected at all stages of infection and were infectious in vitro. Lymphocytes had a mucosal phenotype and expressed activation (CD69 & HLA-DR) and migration (CCR5, CXCR4, LFA-1) markers. CD69 expression was increased in semen T cells by SIV infection, at all stages of infection. Macrophages predominated at all stages and expressed CD4, CCR5, MAC-1 and LFA-1. Altogether, we demonstrated that semen contains the two major SIV-target cells (CD4+ T cells and macrophages). Both cell types can be productively infected at all stages of SIV infection and are endowed with markers that may facilitate transmission of infection during sexual exposure. PMID:24348253

  20. A systematic review of the evidence for single stage and two stage revision of infected knee replacement

    PubMed Central

    2013-01-01

    Background Periprosthetic infection about the knee is a devastating complication that may affect between 1% and 5% of knee replacement. With over 79 000 knee replacements being implanted each year in the UK, periprosthetic infection (PJI) is set to become an important burden of disease and cost to the healthcare economy. One of the important controversies in treatment of PJI is whether a single stage revision operation is superior to a two-stage procedure. This study sought to systematically evaluate the published evidence to determine which technique had lowest reinfection rates. Methods A systematic review of the literature was undertaken using the MEDLINE and EMBASE databases with the aim to identify existing studies that present the outcomes of each surgical technique. Reinfection rate was the primary outcome measure. Studies of specific subsets of patients such as resistant organisms were excluded. Results 63 studies were identified that met the inclusion criteria. The majority of which (58) were reports of two-stage revision. Reinfection rated varied between 0% and 41% in two-stage studies, and 0% and 11% in single stage studies. No clinical trials were identified and the majority of studies were observational studies. Conclusions Evidence for both one-stage and two-stage revision is largely of low quality. The evidence basis for two-stage revision is significantly larger, and further work into direct comparison between the two techniques should be undertaken as a priority. PMID:23895421

  1. Toxoplasma gondii: the effects of infection at different stages of pregnancy on the offspring of mice.

    PubMed

    Wang, Tao; Liu, Min; Gao, Xiao-Jie; Zhao, Zhi-Jun; Chen, Xiao-Guang; Lun, Zhao-Rong

    2011-01-01

    Congenital toxoplasmosis can cause fetal damage in humans and domestic animals. This study was focused on the effects of Toxoplasma gondii (Prugniaud strain) infection at different stages of pregnancy on the offspring of mice. Results showed that newborn mice from all infected groups were significantly lower in weight than those from the control group but significant difference was not found among these groups at day 60 after birth. The survival rate of the offspring from the group of mice infected at the earlier stage of pregnancy was significantly lower than those of infected and control groups. The positive offspring (with cysts found in their brain tissues) born from the mice infected at the earlier and intermediate stages of pregnancy showed a shorter latency and greater number of errors in the step-through passive avoidance test than those born from the mice infected at the late stage of pregnancy, the control group and the negative offspring from the infected groups. The number of cysts in the brain tissue was significantly higher in the offspring born from the groups of mice infected at the earlier and intermediate stages of pregnancy than those from the group of mice infected at the late stage of pregnancy. In addition, our results indicated that a high congenital transmission rate (90%) occurred in this NIH mouse model. In conclusion, the earlier and intermediate maternal infection of T. gondii can result in severe congenital toxoplasmosis, exhibiting conditions such as stillbirth or non-viability, and learning or memory capability damage in this mouse model. These results not only provide useful data for better understanding the effects of T. gondii infection on the offspring of mice infected at different stages of pregnancy but also for better consideration of the effect of this infection on other mammalian hosts including humans.

  2. Plasmodium berghei histamine-releasing factor favours liver-stage development via inhibition of IL-6 production and associates with a severe outcome of disease.

    PubMed

    Mathieu, Cédric; Demarta-Gatsi, Claudia; Porcherie, Adeline; Brega, Sara; Thiberge, Sabine; Ronce, Karine; Smith, Leanna; Peronet, Roger; Amino, Rogerio; Ménard, Robert; Mécheri, Salaheddine

    2015-04-01

    Plasmodium spp., which causes malaria, produces a histamine-releasing factor (HRF), an orthologue of mammalian HRF. Histamine-releasing factor produced by erythrocytic stages of the parasite is thought to play a role in the pathogenesis of severe malaria. Here, we show in a rodent model that HRF is not important during the erythrocytic but pre-erythrocytic phase of infection, which mainly consists in the transformation in the liver of the mosquito-injected parasite form into the erythrocyte-infecting form. Development of P. berghei ANKA cl15cy1 liver stages lacking HRF is impaired and associated with an early rise in systemic IL-6, a cytokine that strongly suppresses development of Plasmodium liver stages. The defect is rescued by injection of anti-IL-6 antibodies or infection in IL-6-deficient mice and parasite HRF is sufficient to decrease IL-6 synthesis, indicating a direct role of parasite HRF in reducing host IL-6. The target cells modulated by HRF for IL-6 production at early time points during liver infection are neutrophils. Parasite HRF is thus used to down-regulate a cytokine with anti-parasite activity. Our data also highlight the link between a prolonged transition from liver to blood-stage infection and reduced incidence of experimental cerebral malaria. © 2014 John Wiley & Sons Ltd.

  3. The natural history of HIV-1 infection: staging classifications of disease.

    PubMed

    Royce, R A; Luckmann, R S; Fusaro, R E; Winkelstein, W

    1991-04-01

    We evaluated and compared four staging classification systems for HIV infection in a population-based cohort: (1) a staging based on prodromal clinical criteria; (2) the Walter Reed Staging Classification (WRSC); (3) the immunologic staging system (ISS), and (4) a simple staging based on oral disease and CD4+ T-cell depletion. The staging systems were applied to 386 HIV-infected men in the San Francisco Men's Health Study cohort who did not have AIDS at the baseline examination. After 48-56 months of follow-up the cumulative incidence of AIDS and the cumulative mortality by stage was determined for each staging. Unlike the other systems, the WRSC could not classify a substantial proportion of HIV-infected men (51.9%). The WRSC and ISS include one or more stages which did not appear to be associated with a prognosis substantially different from that of adjacent stages. The simplified staging system based on CD4+ T-cell depletion and oral disease may be the most effective of the systems studied. A more complete understanding of the pathophysiology during the evolution of HIV infection will be required to define a more detailed staging of this disease.

  4. TREM-1 modulation during early stages of dengue virus infection.

    PubMed

    Ruiz-Pacheco, J A; Vivanco-Cid, H; Izaguirre-Hernández, I Y; Estrada-García, I; Arriaga-Pizano, L; Chacón-Salinas, R; Fonseca-Coronado, S; Vaughan, G; Tovar, K Ruiz; Rivera-Osorio, M P; Escobar-Gutiérrez, A

    2014-01-01

    Uncontrolled and intricate production of inflammatory factors is the characteristic feature of dengue infection. The triggering receptor expressed in myeloid cells-1 (TREM-1), expressed on the surface of monocytes and neutrophils, is capable of enhancing and regulating the inflammatory response via the production of different mediators in bacterial and viral infections. Here, both the expression of TREM-1 on human monocytes and neutrophils from peripheral blood of dengue infected individuals, as well as the levels of the soluble form of TREM-1 (sTREM-1) in the sera of these patients were compared against healthy controls. A significant reduction of TREM-1 expression was observed in neutrophils during the first days of infection, followed by a gradual recovery throughout the course of infection. Also, sera from DENV-infected patients exhibited significantly higher sTREM-1 levels than healthy individuals. The difference was more pronounced during the first 5 days after the onset of symptoms. These findings highlight the dynamic process of TREM-1 expression during DENV infection. We hypothesized that increment of free sTREM-1 could be a compensatory mechanism aiming to counteract the inflammatory process elicited during DENV infection. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Progress with viral vectored malaria vaccines: A multi-stage approach involving "unnatural immunity".

    PubMed

    Ewer, Katie J; Sierra-Davidson, Kailan; Salman, Ahmed M; Illingworth, Joseph J; Draper, Simon J; Biswas, Sumi; Hill, Adrian V S

    2015-12-22

    Viral vectors used in heterologous prime-boost regimens are one of very few vaccination approaches that have yielded significant protection against controlled human malaria infections. Recently, protection induced by chimpanzee adenovirus priming and modified vaccinia Ankara boosting using the ME-TRAP insert has been correlated with the induction of potent CD8(+) T cell responses. This regimen has progressed to field studies where efficacy against infection has now been reported. The same vectors have been used pre-clinically to identify preferred protective antigens for use in vaccines against the pre-erythrocytic, blood-stage and mosquito stages of malaria and this work is reviewed here for the first time. Such antigen screening has led to the prioritization of the PfRH5 blood-stage antigen, which showed efficacy against heterologous strain challenge in non-human primates, and vectors encoding this antigen are in clinical trials. This, along with the high transmission-blocking activity of some sexual-stage antigens, illustrates well the capacity of such vectors to induce high titre protective antibodies in addition to potent T cell responses. All of the protective responses induced by these vectors exceed the levels of the same immune responses induced by natural exposure supporting the view that, for subunit vaccines to achieve even partial efficacy in humans, "unnatural immunity" comprising immune responses of very high magnitude will need to be induced.

  6. 1-stage primary arthroplasty of mechanically failed internally fixated of hip fractures with deep wound infection

    PubMed Central

    Klatte, Till O; O’Loughlin, Padraigh F; Citak, Mustafa; Rueger, Johannes M; Gehrke, Thorsten; Kendoff, Daniel

    2013-01-01

    Background and purpose Mechanically failed internal fixation following hip fracture is often treated by salvage arthroplasty. If deep wound infection is present, a 2-stage procedure is often used. We have used a 1-stage procedure in infected cases, and we now report the outcome. Patients and methods We reviewed 16 cases of deep wound infection after mechanically failed hip fracture fixation, treated between 1994 and 2010. In all patients, a joint prosthesis was implanted in a 1-stage procedure. Results After an average follow-up period of 12 (2–18) years, no reinfection was detected. In 4 cases, a hip dislocation occurred and 3 of these needed further surgery. Interpretation A 1-stage procedure for arthroplasty of an infected, mechanically failed hip fracture fixation is feasible and carries a low risk of infection. PMID:23799345

  7. The dynamics of infection of Tribolium confusum by Hymenolepis diminuta: the influence of infective-stage density and spatial distribution.

    PubMed

    Keymer, A E; Anderson, R M

    1979-10-01

    The mean parasite burden of a population of Tribolium confusum is shown to rise to a plateau as the exposure density of infective eggs of Hymenolepis diminuta increases. The level of this plateau is shown to be dependent on the nutritional status of the host population, being depressed from approximately 18 cysticeroids/beetle in hosts which have been starved prior to experimentation, to approximately 2 cysticercoids/beetle in satiated hosts. A simple model is used to describe the shape of this infection functional response in terms of the predator-prey interaction between hosts (T. confusum) and parasite infective stages (H. diminuta eggs). The distribution of successful infections/host is shown to be over-dispersed, even when hosts are exposed to infective stages arranged in a uniform spatial pattern. The over-dispersion of parasite numbers/host is shown to become more severe as the spatial pattern of infective stages changes from under-dispersed, through random, to over-dispersed. Experimental results are discussed in relation to the dynamics of parasite-host interactions, in which infection takes place by host ingestion of a free-living infective stage.

  8. Nitroheterocyclic drugs cure experimental Trypanosoma cruzi infections more effectively in the chronic stage than in the acute stage

    PubMed Central

    Francisco, Amanda Fortes; Jayawardhana, Shiromani; Lewis, Michael D.; White, Karen L.; Shackleford, David M.; Chen, Gong; Saunders, Jessica; Osuna-Cabello, Maria; Read, Kevin D.; Charman, Susan A.; Chatelain, Eric; Kelly, John M.

    2016-01-01

    The insect-transmitted protozoan parasite Trypanosoma cruzi is the causative agent of Chagas disease, and infects 5–8 million people in Latin America. Chagas disease is characterised by an acute phase, which is partially resolved by the immune system, but then develops as a chronic life-long infection. There is a consensus that the front-line drugs benznidazole and nifurtimox are more effective against the acute stage in both clinical and experimental settings. However, confirmative studies have been restricted by difficulties in demonstrating sterile parasitological cure. Here, we describe a systematic study of nitroheterocyclic drug efficacy using highly sensitive bioluminescence imaging of murine infections. Unexpectedly, we find both drugs are more effective at curing chronic infections, judged by treatment duration and therapeutic dose. This was not associated with factors that differentially influence plasma drug concentrations in the two disease stages. We also observed that fexinidazole and fexinidazole sulfone are more effective than benznidazole and nifurtimox as curative treatments, particularly for acute stage infections, most likely as a result of the higher and more prolonged exposure of the sulfone derivative. If these findings are translatable to human patients, they will have important implications for treatment strategies. PMID:27748443

  9. Two-stage Revision for Periprosthetic Hip and Knee Joint Infections

    PubMed Central

    Kini, Sunil Gurpur; Gabr, Ayman; Das, Rishi; Sukeik, Mohamed; Haddad, Fares Sami

    2016-01-01

    Background: Periprosthetic joint infection (PJI) continues to be one of the leading causes of failure following hip and knee surgery. The diagnostic workflow of PJI includes detailed clinical examination, serum markers, imaging and aspiration/biopsy of the affected joint. The goals of treatment are eradication of the infection, alleviation of pain, and restoration of joint function. Surgical management of PJI consists of debridement, antibiotics and implant retention (DAIR) and single or two-stage revision procedures. Two-stage revision remains the gold standard for treatment of PJIs. We aim to discuss the two stage procedure in this article and report the outcomes. Methods: The first stage of the two stages consists of removal of all components and associated cement with aggressive debridement and placement of an antibiotic-loaded cement spacer. Patients are then treated with variable periods of parenteral antibiotics, followed by an antibiotic free period to help ensure the infection has been eradicated. If the clinical evaluation and serum inflammatory markers suggest infection control, then the second stage can be undertaken and this involves removal of the cement spacer, repeat debridement, and placement of a new prosthesis. Results: Common themes around the two-stage revision procedure include timing of the second stage, antibiotics used in the interim period, length of the interim period before consideration of reimplantation and close liaising with microbiologists. Conclusion: Successful eradication of infection and good functional outcome using the two stage procedure is dependent on a multidisciplinary approach and having a standard reproducible startegy. PMID:28144371

  10. Two-stage Revision for Periprosthetic Hip and Knee Joint Infections.

    PubMed

    Kini, Sunil Gurpur; Gabr, Ayman; Das, Rishi; Sukeik, Mohamed; Haddad, Fares Sami

    2016-01-01

    Periprosthetic joint infection (PJI) continues to be one of the leading causes of failure following hip and knee surgery. The diagnostic workflow of PJI includes detailed clinical examination, serum markers, imaging and aspiration/biopsy of the affected joint. The goals of treatment are eradication of the infection, alleviation of pain, and restoration of joint function. Surgical management of PJI consists of debridement, antibiotics and implant retention (DAIR) and single or two-stage revision procedures. Two-stage revision remains the gold standard for treatment of PJIs. We aim to discuss the two stage procedure in this article and report the outcomes. The first stage of the two stages consists of removal of all components and associated cement with aggressive debridement and placement of an antibiotic-loaded cement spacer. Patients are then treated with variable periods of parenteral antibiotics, followed by an antibiotic free period to help ensure the infection has been eradicated. If the clinical evaluation and serum inflammatory markers suggest infection control, then the second stage can be undertaken and this involves removal of the cement spacer, repeat debridement, and placement of a new prosthesis. Common themes around the two-stage revision procedure include timing of the second stage, antibiotics used in the interim period, length of the interim period before consideration of reimplantation and close liaising with microbiologists. Successful eradication of infection and good functional outcome using the two stage procedure is dependent on a multidisciplinary approach and having a standard reproducible startegy.

  11. Infection recurrence factors in one- and two-stage total knee prosthesis exchanges.

    PubMed

    Massin, P; Delory, T; Lhotellier, L; Pasquier, G; Roche, O; Cazenave, A; Estellat, C; Jenny, J Y

    2016-10-01

    Revision of infected total knee replacements (TKR) is usually delayed for a period in which the joint space is filled with an antibiotic-loaded acrylic spacer. In contrast, one-stage re-implantation supposes immediate re-implantation. Formal comparisons between the two methods are scarce. A retrospective multi-centre study was conducted to investigate the effects of surgery type (one-stage vs. two-stage) on cure rates. It was hypothesised that this parameter would not influence the results. All infected TKR, treated consecutively between 2005 and 2010 by senior surgeons working in six referral hospitals, were included retrospectively. Two hundred and eighty-five patients, undergoing one-stage or two-stage TKR, with more than 2-year follow-up (clinical and radiological) were eligible for data collection and analysis. Of them, 108 underwent one-stage and 177 received two-stage TKR. Failure was defined as infection recurrence or persistence of the same or unknown pathogens. Factors linked with infection recurrence were analysed by uni- and multi-variate logistic regression with random intercept. Factors associated with infection recurrence were fistulae (odds ratio (OR) 3.4 [1.2-10.2], p = 0.03), infection by gram-negative bacteria (OR 3.3 [1.0-10.6], p = 0.05), and two-stage surgery with static spacers (OR 4.4 [1.1-17.9], p = 0.04). Gender and type of surgery interacted (p = 0.05). In men (133 patients), type of surgery showed no significant linkage with infection recurrence. In women (152 patients), two-stage surgery with static spacers was associated independently with infection recurrence (OR 5.9 [1.5-23.6], p = 0.01). Among patients without infection recurrence, International Knee Society scores were similar between those undergoing one-stage or two-stage exchanges. Two-stage procedures offered less benefit to female patients. It suggests that one-stage procedures are preferable, because they offer greater comfort without increasing the risk of

  12. Cementless two-stage exchange arthroplasty for infection after total hip arthroplasty.

    PubMed

    Masri, Bassam A; Panagiotopoulos, Kostas P; Greidanus, Nelson V; Garbuz, Donald S; Duncan, Clive P

    2007-01-01

    We retrospectively reviewed all patients at one center with an infected total hip arthroplasty treated with 2-stage revision using cementless components for the second stage and the PROSTALAC articulated spacer at the first stage. Twenty-nine patients were reviewed and followed for at least 2 years postoperatively. An isolated Staphylococcus species was cultured in 76% (22/29) of patients. Three (10.3%) of 29 patients had recurrent infection at the site of the prosthesis. One of the 3 patients ultimately underwent a Girdlestone arthroplasty. Another patient was managed with irrigation and debridement, whereas the final patient was treated with intravenous antibiotics alone. Treatment of infection at the site of a hip arthroplasty with 2-stage revision using cementless components and an articulated spacer yields recurrence rates similar to revisions where at least one of the components at the second stage is fixed with antibiotic-loaded cement.

  13. Cancer stage at diagnosis in patients infected with the human immunodeficiency virus and transplant recipients.

    PubMed

    Shiels, Meredith S; Copeland, Glenn; Goodman, Marc T; Harrell, Janna; Lynch, Charles F; Pawlish, Karen; Pfeiffer, Ruth M; Engels, Eric A

    2015-06-15

    It is unknown whether immunosuppression results in more aggressive, advanced stage cancers. Because cancer stage is influenced both by tumor biology and medical surveillance, the authors assessed cancer stage in individuals infected with the human immunodeficiency virus (HIV) and solid organ transplant recipients, 2 immunosuppressed groups with differences in their health care use. The authors used data on all cases of 15 cancer types diagnosed during 1996 through 2010 in 2 studies that linked US cancer registries with HIV and transplant registries. Odds ratios (ORs) for advanced (vs local) disease were estimated comparing HIV and transplant populations with immunocompetent individuals in polytomous logistic regression models adjusted for age, sex, race, registry, and year. A total of 8411 of 4.5 million cancer cases occurred in HIV-infected individuals and 7322 of 6.4 million cancer cases occurred in transplant recipients. Compared with immunocompetent patients with cancer, those infected with HIV were more likely to be diagnosed with distant stage lung (OR, 1.13), female breast (OR, 1.99), and prostate (OR, 1.57) cancers, whereas transplant recipients had fewer distant stage lung (OR, 0.54), female breast (OR, 0.75), and prostate (OR, 0.72) cancers. Both immunosuppressed populations had a shift toward advanced stage melanoma (ORs of 1.97 for HIV-infected individuals and 1.82 for transplant recipients) and bladder cancer (ORs of 1.42 for HIV-infected individuals and 1.54 for transplant recipients). Bladder cancer and melanoma were more likely to be diagnosed at a nonlocal stage in both HIV-infected individuals and transplant recipients, suggesting a role for immunosuppression in their progression. In addition, we observed a shift for some common cancers toward later stages in HIV-infected individuals and toward earlier stages in transplant recipients, which is consistent with differential access to medical care or surveillance. © 2015 American Cancer Society.

  14. Procalcitonin role in differential diagnosis of infection stages and non infection inflammation.

    PubMed

    Ghorbani, Gholamali

    2009-02-15

    The aim of this study is evaluation of procalcitonin role in the diagnosis of infectious and non infectious inflammation. This cross-sectional study was conducted in one hundred patients in Baqiyatallah Hospital of Iran in 2008. Patients suspected to infection were recruited to study. They were divided to four groups as: systemic inflammatory response syndrome, sepsis, sepsis syndrome and septic shock. Procalcitonin quantitative was assayed by immunoluminometric kit manufactured in Germany. Procalcitonin level was divided to four groups in < 0.5 ng mL(-1) compatible for SIRS, 0.5-2 ng mL(-1) for sepsis and 2-10 ng mL(-1) for sepsis syndrome and > 10 ng mL(-1) for septic shock. Data was analyzed by SPSS 13 for window software; T student test, ANOVA and Chi-square were used. In this study 53(53%) of subjects were men with mean age of 56.16 +/- 19.5 years old. The diagnosis was SIRS in 36%, sepsis in 38%, sepsis syndrome in 14% and septic shock in 12% of cases. Procalcitonin level was less than 0.5 ng mL(-1) in 61% and more than 10 ng mL(-1) in 10% of patients. Procalcitonin level showed significant association with septic shock, positive blood culture and mental dysfunction. Ultimately this study showed that high level of procalcitonin can differentiate septic shock from SIRS and other stages of infection. Dysfunction of mental status and high level of procalcitonin can determine septic shock.

  15. Routine one-stage exchange for chronic infection after total hip replacement.

    PubMed

    Jenny, Jean-Yves; Lengert, Régis; Diesinger, Yann; Gaudias, Jeannot; Boeri, Cyril; Kempf, Jean-François

    2014-12-01

    We hypothesized that a routine one-stage exchange for treatment of chronically infected total hip replacement (THR) will lead to (1) a higher rate of infection recurrence and (2) a poorer hip outcome than the published rates after two-stage exchange. Sixty-five cases have been treated consecutively with one-stage exchange. All patients have been followed for a period of three to six years or until death or infection recurrence. The five-year rate for infection recurrence was 16%. The five-year survival rate for recurrence of the index infection was 8%. Forty-two percent of the hips had a good or excellent PMA score, and 46% a good or excellent OH score. Routine one-stage exchange was not associated with a higher recurrence rate and a poorer hip function than previously published series of two-stage exchange. Therefore, there is little support to choose two-stage exchange as the routine treatment for management of chronically infected THR.

  16. BLOOD-STAGE DYNAMICS AND CLINICAL IMPLICATIONS OF MIXED PLASMODIUM VIVAX–PLASMODIUM FALCIPARUM INFECTIONS

    PubMed Central

    MASON, DANIEL P.; McKENZIE, F. ELLIS

    2008-01-01

    We present a mathematical model of the blood-stage dynamics of mixed Plasmodium vivax–Plasmodium falciparum malaria infections in humans. The model reproduces features of such infections found in nature and suggests several phenomena that may merit clinical attention, including the potential recrudescence of a long-standing, low-level P. falciparum infection following a P. vivax infection or relapse and the capacity of an existing P. vivax infection to reduce the peak parasitemia of a P. falciparum superinfection. We simulate the administration of anti-malarial drugs, and illustrate some potential complications in treating mixed-species malaria infections. Notably, our model indicates that when a mixed-species infection is misdiagnosed as a single-species P. vivax infection, treatment for P. vivax can lead to a surge in P. falciparum parasitemia. PMID:10497972

  17. Prospective Double-Blind Study of Zidovudine (AZT) in Early Stage HIV infection

    DTIC Science & Technology

    1988-05-01

    FRONT COVER FUNDING NO. 87PP7875 S L. TITLE: Prospective Double-Blind Study of Zidovudine (AZT) in Early Stage HIV Infection PRINCIPAL INVESTIGATOR...Prospective Double-Blind Study of Zidovudine (AZT) in Early State HIV Infection 12. PERSONAL AUTHOR(S) Shannon M. Harrison 13a. TYPE OF REPORT 113b...COSATI CODES 18. SUBJECT TERMS (Continue on reverse if necessary and identify by block number) FIELD GROUP SUBGROUP HIV , Zidovudine, Early, Infection 06

  18. Obesity is independently associated with infection in hospitalised patients with end-stage liver disease.

    PubMed

    Sundaram, V; Kaung, A; Rajaram, A; Lu, S C; Tran, T T; Nissen, N N; Klein, A S; Jalan, R; Charlton, M R; Jeon, C Y

    2015-12-01

    Infection is the most common cause of mortality in end-stage liver disease (ESLD). The impact of obesity on infection risk in ESLD is not established. To characterise the impact of obesity on infection risk in ESLD. We evaluated the association between infection and obesity in patients with ESLD. Patients grouped as non-obese, obesity class I-II and obesity class III were studied using the Nationwide Inpatient Sample. Validated diagnostic code based algorithms were utilised to determine weight category and infections, including bacteraemia, skin/soft tissue infection, urinary tract infection (UTI), pneumonia/respiratory infection, Clostridium difficile infection (CDI) and spontaneous bacterial peritonitis (SBP). Risk factors for infection and mortality were assessed using multivariable logistic regression analysis. Of 115 465 patients identified, 100 957 (87.5%) were non-obese and 14 508 (12.5%) were obese, with 9489 (8.2%) as obesity class I-II and 5019 (4.3%) as obesity class III. 37 117 patients (32.1%) had an infection diagnosis. Infection was most prevalent among obesity class III (44.0%), followed by obesity class I-II (38.9%) and then non-obese (31.9%). In multivariable modelling, class III obesity (OR = 1.41; 95% CI 1.32-1.51; P < 0.001), and class I-II obesity (OR = 1.08; 95% CI 1.01-1.15; P = 0.026) were associated with infection. Compared to non-obese patients, obese individuals had greater prevalence of bacteraemia, UTI, and skin/soft tissue infection as compared to non-obese patients. Obesity is newly identified to be independently associated with infection in end-stage liver disease. The distribution of infection sites varies based on weight category. © 2015 John Wiley & Sons Ltd.

  19. One-stage Exchange Arthroplasty for Periprosthetic Hip and Knee Joint Infections

    PubMed Central

    Nguyen, Manny; Sukeik, Mohamed; Zahar, Akos; Nizam, Ikram; Haddad, Fares Sami

    2016-01-01

    Background: Periprosthetic joint infection (PJI) is a devastating complication of joint replacement surgery. In an aging population of the developed world, the increasing numbers of hip and knee replacements will inevitably lead to increasing incidence of PJI, carrying with (it) significant patient morbidity and cost to the health care system. Two-stage exchange arthroplasty is currently the gold standard but it is associated with multiple operations, prolonged hospitalization and impaired functionality. One-stage exchange arthroplasty is similar to the two-stage procedure but the interval between removal of the prosthesis and reimplantation of a new one is only a few minutes. It has the theoretical benefits of a single anesthetic, shorter hospitalization, less cost and improved function. Methods: We reviewed the current literature regarding the outcomes of one-stage exchange arthroplasties focusing on re-infection rates and functional outcomes. Results: Current themes around the one-stage exchange procedure include the indications for the procedure, definition of re-infection, surgical techniques used to provide fixation and differences in approach for hip and knee replacements. Conclusion: The current literature on one-stage exchange procedure is promising, with comparable results to two-stage revisions for hips and knees in selected patients. However, there is a great need for a large multi-centred randomized control trial, focusing on re-infection rates and functional scores postoperatively, to provide concrete guidelines in managing this complex condition. PMID:28144374

  20. Repeat Two-Stage Exchange Arthroplasty for Periprosthetic Knee Infection Is Dependent on Host Grade.

    PubMed

    Fehring, Keith A; Abdel, Matthew P; Ollivier, Matthieu; Mabry, Tad M; Hanssen, Arlen D

    2017-01-04

    Two-stage exchange arthroplasty after a previous, failed 2-stage exchange procedure is fraught with difficulties, and there are no clear guidelines for treatment or prognosis given the heterogeneous group of patients in whom this procedure has been performed. The Musculoskeletal Infection Society (MSIS) staging system was developed in an attempt to stratify patients according to infection type, host status, and local soft-tissue status. The purpose of this study was to report the results of 2-stage exchange arthroplasty following a previous, failed 2-stage exchange protocol for periprosthetic knee infection as well as to identify risk factors for failure. We retrospectively identified 45 patients who had undergone 2 or more 2-stage exchange arthroplasties for periprosthetic knee infection from 2000 to 2013. Patients were stratified according to the MSIS system, and risk factors for failure were analyzed. The minimum follow-up was 2 years (mean, 6 years; range, 24 to 132 months). At the time of follow-up, twenty-two (49%) of the patients had undergone another revision due to infection and 28 (62%) had undergone another revision for any reason. The infection recurred in 6 (75%) of 8 substantially immunocompromised hosts (MSIS type C) and in 3 (30%) of 10 uncompromised hosts (type A) following the second 2-stage exchange arthroplasty (p = 0.06). The infection recurred in 4 (80%) of 5 patients with compromise of the extremity (MSIS type 3) and 3 (33%) of 9 patients with an uncompromised extremity (type 1) (p = 0.27). Both extremely compromised hosts with an extremely compromised extremity (type C3) had recurrence of the infection whereas 3 (30%) of the 10 uncompromised patients with no or less compromise of the extremity (type A1 or A2) did. Five patients in the failure group underwent a third 2-stage exchange arthroplasty following reinfection, and 3 of them were infection-free at the time of the latest follow-up. Uncompromised hosts (MSIS type A) with an acceptable

  1. Cancer Stage at Diagnosis in HIV-infected People and Transplant Recipients

    PubMed Central

    Shiels, Meredith S.; Copeland, Glenn; Goodman, Marc T.; Harrell, Janna; Lynch, Charles F.; Pawlish, Karen; Pfeiffer, Ruth M.; Engels, Eric A.

    2015-01-01

    Background It is unknown whether immunosuppression results in more aggressive, advanced stage cancers. As cancer stage is influenced both by tumor biology and medical surveillance, we assessed cancer stage in HIV-infected individuals and solid organ transplant recipients, two immunosuppressed groups with differences in healthcare utilization. Methods We used data on all cases of 15 cancer types, diagnosed during 1996–2010 in two studies that linked U.S. cancer registries to HIV and transplant registries. Odds ratios (ORs) for advanced (vs. local) disease were estimated comparing HIV and transplant populations to immunocompetent people in polytomous logistic regression models, adjusted for age, sex, race, registry and year. Results A total of 8,411 of 4.5 million cancer cases occurred in HIV-infected people, and 7,322 of 6.4 million cancer cases occurred in transplant recipients. Compared to immunocompetent people with cancer, HIV-infected people were more likely to be diagnosed with distant stage lung (OR=1.13), female breast (OR=1.99), and prostate cancers (OR=1.57), while transplant recipients had fewer distant stage lung (OR=0.54), female breast (OR=0.75) and prostate cancers (OR=0.72). Both immunosuppressed populations had a shift toward advanced stage melanoma (ORs: HIV=1.97; transplant=1.82) and bladder cancer (ORs: HIV=1.42; transplant=1.54). Conclusions Bladder cancer and melanoma were more likely to be diagnosed at non-local stage in both HIV-infected people and transplant recipients, suggesting a role of immunosuppression in their progression. Additionally, we observed a shift for some common cancers toward later stages in HIV-infected individuals and toward earlier stages in transplant recipients, consistent with differential access to medical care or surveillance. PMID:25739496

  2. Durable infection control and function with the PROSTALAC spacer in two-stage revision for infected knee arthroplasty.

    PubMed

    Gooding, Christopher R; Masri, Bassam A; Duncan, Clive P; Greidanus, Nelson V; Garbuz, Donald S

    2011-04-01

    A two-stage revision total knee arthroplasty is recognized as the gold standard in the treatment of infection. However, traditional spacers limit function in the interval between the two stages and may cause instability, scarring, and bone erosion. The PROSTALAC knee spacer is an antibiotic-loaded cement articulating spacer that allows some movement of the knee between stages. Whether motion enhances long-term function is unknown. We therefore identify the rate of control of infection using the PROSTALAC exchange spacer and to assess the clinical outcome after implantation with a definitive implant. We retrospectively reviewed 115 knees that underwent two-stage exchange with the PROSTALAC spacer. Forty-eight of these had a minimum followup of 5 years (mean, 9 years; range, 5-12 years). At last review, 101 of the 115 knees (88%) had no evidence of infection. Of the 14 knees that became reinfected, four were from the same organism and 10 were with a different organism. After further intervention, using the two-stage approach again, the infection was controlled in 12 of the 14 initially reinfected cases, resulting in a failure to cure in only two cases. We observed improvements in mean WOMAC, Oxford, UCLA, and Patient Satisfaction scores at last review. The PROSTALAC functional spacer was associated with a 98% rate of control of infection and improvements in the quality-of-life outcomes in the treatment of chronically infected total knee arthroplasties. Level IV, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

  3. Distinct Cytokine/chemokine Network in Semen and Blood Characterize Different Stages of HIV Infection

    PubMed Central

    Vanpouille, C.; Introini, A.; Morris, S.R.; Margolis, L.; Daar, E.S.; Dube, M.P.; Little, S.J.; Smith, D.M.; Lisco, A.; Gianella, S.

    2016-01-01

    Objective The cytokine/chemokine network is the language used by the innate and adaptive immune system to orchestrate effective immune responses. Here, we describe the cross-sectional association between cytokine levels and stage of HIV infection to gain novel insights into HIV-1 immunopathogenesis and identify novel therapeutic targets. Design Concentrations of 31 cytokine/chemokines were retrospectively measured in blood and semen collected from 252 individuals enrolled in 4 well-characterized cohorts: HIV-uninfected, HIV-infected in early phase of infection, HIV-infected in late phase of infection, and HIV-infected on ART. Methods Cytokine/chemokine levels were measured by multiplex-bead-array. Comparisons between groups were performed by Mann-Whitney U-test and p-values were adjusted for multiple comparisons using the Benjamini-Hochberg method. Results HIV-infection skewed the cytokine/chemokine network towards a pro-inflammatory response in both blood and semen. Such changes emerged within the first weeks of infection and were maintained thereafter: among untreated HIV-infected individuals, none of the 31 measured cytokines were significantly different between early and later stages of infection. Suppression of plasma HIV-1-RNA with ART did not result in normalization of the levels of pro-inflammatory cytokines in blood. In contrast, in semen, several pro-inflammatory cytokines were even further up regulated in ART-treated compared to HIV-uninfected and HIV-untreated individuals. Conclusions The profound disruption in the cytokine network is evident in blood and semen from the earliest stage of HIV-infection shortly after the first detection of systemic viremia. These changes are maintained throughout the chronic phase of the infection and do not normalize despite ART and suppression of plasma HIV-1-RNA. PMID:26558730

  4. The stability analysis of a general viral infection model with distributed delays and multi-staged infected progression

    NASA Astrophysics Data System (ADS)

    Wang, Jinliang; Liu, Shengqiang

    2015-01-01

    We investigate an in-host model with general incidence and removal rate, as well as distributed delays in virus infections and in productions. By employing Lyapunov functionals and LaSalle's invariance principle, we define and prove the basic reproductive number R0 as a threshold quantity for stability of equilibria. It is shown that if R0 > 1 , then the infected equilibrium is globally asymptotically stable, while if R0 ⩽ 1 , then the infection free equilibrium is globally asymptotically stable under some reasonable assumptions. Moreover, n + 1 distributed delays describe (i) the time between viral entry and the transcription of viral RNA, (ii) the n - 1 -stage time needed for activated infected cells between viral RNA transcription and viral release, and (iii) the time necessary for the newly produced viruses to be infectious (maturation), respectively. The model can describe the viral infection dynamics of many viruses such as HIV-1, HCV and HBV.

  5. Hepcidin is regulated during blood-stage malaria and plays a protective role in malaria infection.

    PubMed

    Wang, Hai-Zhen; He, Ying-Xin; Yang, Chun-Ju; Zhou, Wei; Zou, Cheng-Gang

    2011-12-15

    Hepcidin is one of the regulators of iron metabolism. The expression of hepcidin is induced in spleens and livers of mice infected with pathogenic bacteria. Recent studies have indicated that serum hepcidin level is also increased in human subjects infected with Plasmodium falciparum. The mechanism of the regulation of hepcidin expression and its role in the infection of malaria remains unknown. In this study, we determined the expression of hepcidin in livers of mice infected with Plasmodium berghei. The expression of hepcidin in the liver was upregulated and downregulated during the early and late stages of malaria infection, respectively. Inflammation and erythropoietin, rather than the iron-sensing pathway, are involved in the regulation of hepcidin expression in livers of infected mice. Meanwhile, we investigated the effect of hepcidin on the survival of mice infected with P. berghei. Treatment of malaria-infected mice with anti-hepcidin neutralizing Abs promoted the rates of parasitemia and mortality. In contrast, lentiviral vector-mediated overexpression of hepcidin improved the outcome of P. berghei infection in mice. Our data demonstrate an important role of hepcidin in modulating the course and outcome of blood-stage malaria.

  6. Gestational Stage and IFN-λ Signaling Regulate ZIKV Infection In Utero.

    PubMed

    Jagger, Brett W; Miner, Jonathan J; Cao, Bin; Arora, Nitin; Smith, Amber M; Kovacs, Attila; Mysorekar, Indira U; Coyne, Carolyn B; Diamond, Michael S

    2017-09-13

    Although Zika virus (ZIKV)-induced congenital disease occurs more frequently during early stages of pregnancy, its basis remains undefined. Using established type I interferon (IFN)-deficient mouse models of ZIKV transmission in utero, we found that the placenta and fetus were more susceptible to ZIKV infection at earlier gestational stages. Whereas ZIKV infection at embryonic day 6 (E6) resulted in placental insufficiency and fetal demise, infections at midstage (E9) resulted in reduced cranial dimensions, and infection later in pregnancy (E12) caused no apparent fetal disease. In addition, we found that fetuses lacking type III IFN-λ signaling had increased ZIKV replication in the placenta and fetus when infected at E12, and reciprocally, treatment of pregnant mice with IFN-λ2 reduced ZIKV infection. IFN-λ treatment analogously diminished ZIKV infection in human midgestation fetal- and maternal-derived tissue explants. Our data establish a model of gestational stage dependence of ZIKV pathogenesis and IFN-λ-mediated immunity at the maternal-fetal interface. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Susceptibility of some vertebrate hosts to infection with early third-stage larvae of Gnathostoma hispidum.

    PubMed

    Sohn, W M; Lee, S H

    1997-09-01

    Susceptibility of some vertebrates was examined to the early third-stage larvae (EL3) of Gnathostoma hispidum. The larvae collected from the Chinese loaches were infected to 4 silk carps, 3 snake heads, 3 bullfrogs, 5 mice and 9 albino rats. No worms were detected in fish, silk carps and snake heads. In 3 bullfrogs fed 30 larvae, a total of 9 EL3 was recovered in the gastrointestinal tract (8 larvae) and liver (one). In 5 mice infected with 50 larvae, a total of 37 (74.0%) advanced third-stage larvae (AdL3) was recovered from the muscle (31 larvae), liver (5 larvae) and kidney at 4 weeks after infection. In 9 albino rats infected with 115 larvae, a total of 40 (34.8%) AdL3 was found in the muscle. The mammalian hosts were found susceptible to the EL3 of G. hispidum from Chinese loaches.

  8. Patient selection does not improve the success rate of infected TKA one stage exchange.

    PubMed

    Jenny, Jean-Yves; Barbe, Bruno; Cazenave, Alain; Roche, Olivier; Massin, Philippe

    2016-12-01

    One stage exchange of a chronically infected total knee arthroplasty (TKA) is recommended in selected cases only. However, there is little evidence regarding the usefulness of selection criteria. The goal of this retrospective study was to compare the results of two concomitant cohorts of patients with chronically infected TKA: one treated with a routine one-stage exchange (study group) and one treated with one-stage exchange in selected cases only (control group). The hypoyhesis tested was that the failure rate and repeat surgery rate were higher in the study group than in the control group. One hundred and thirty one cases were selected: 54 in the study group and 77 in the control group. There were 63 men and 68 women with a mean age of 70years. All patients were followed up for a minimal period of time of two years or until death or recurrence of infection. Twenty five cases had a recurrence of infection: 9/54 in the study group and 16/77 in the control group (NS). The survival rate for being free of infection after four years was 85% in the study group and 78% in the control group (NS). The repeat surgery rate was significantly higher in the control group. The tested hypothesis was rejected. When one stage exchange is considered, patient selection does not improve outcome. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Tools for the diagnosis of hepatitis C virus infection and hepatic fibrosis staging

    PubMed Central

    Saludes, Verónica; González, Victoria; Planas, Ramon; Matas, Lurdes; Ausina, Vicente; Martró, Elisa

    2014-01-01

    Hepatitis C virus (HCV) infection represents a major public health issue. Hepatitis C can be cured by therapy, but many infected individuals are unaware of their status. Effective HCV screening, fast diagnosis and characterization, and hepatic fibrosis staging are highly relevant for controlling transmission, treating infected patients and, consequently, avoiding end-stage liver disease. Exposure to HCV can be determined with high sensitivity and specificity with currently available third generation serology assays. Additionally, the use of point-of-care tests can increase HCV screening opportunities. However, active HCV infection must be confirmed by direct diagnosis methods. Additionally, HCV genotyping is required prior to starting any treatment. Increasingly, high-volume clinical laboratories use different types of automated platforms, which have simplified sample processing, reduced hands-on-time, minimized contamination risks and human error and ensured full traceability of results. Significant advances have also been made in the field of fibrosis stage assessment with the development of non-invasive methods, such as imaging techniques and serum-based tests. However, no single test is currently available that is able to completely replace liver biopsy. This review focuses on approved commercial tools used to diagnose HCV infection and the recommended hepatic fibrosis staging tests. PMID:24707126

  10. 2-stage revision of 120 deep infected hip and knee prostheses using gentamicin-PMMA beads.

    PubMed

    Janssen, Daniël M C; Geurts, Jan A P; Jütten, Liesbeth M C; Walenkamp, Geert H I M

    2016-08-01

    Background and purpose - A 2-stage revision is the most common treatment for late deep prosthesis-related infections and in all cases of septic loosening. However, there is no consensus about the optimal interval between the 2 stages. Patients and methods - We retrospectively studied 120 deep infections of total hip (n = 95) and knee (n = 25) prostheses that had occurred over a period of 25 years. The mean follow-up time was 5 (2-20) years. All infections had been treated with extraction, 1 or more debridements with systemic antibiotics, and implantation of gentamicin-PMMA beads. There had been different time intervals between extraction and reimplantation: median 14 (11-47) days for short-term treatment with uninterrupted hospital stay, and 7 (3-22) months for long-term treatment with temporary discharge. We analyzed the outcome regarding resolution of the infection and clinical results. Results - 88% (105/120) of the infections healed, with no difference in healing rate between short- and long-term treatment. 82 prostheses were reimplanted. In the most recent decade, we treated patients more often with a long-term treatment but reduced the length of time between the extraction and the reimplantation. More reimplantations were performed in long-term treatments than in short-term treatments, despite more having difficult-to-treat infections with worse soft-tissue condition. Interpretation - Patient, wound, and infection considerations resulted in an individualized treatment with different intervals between stages. The 2-stage revision treatment in combination with local gentamicin-PMMA beads gave good results even with difficult prosthesis infections and gentamicin-resistant bacteria.

  11. Interrogation of infected hepatocyte signaling reveals that suppression of host p53 is critical for Plasmodium liver stage infection

    PubMed Central

    Kaushansky, Alexis; Ye, Albert S.; Austin, Laura S.; Mikolajczak, Sebastian A.; Vaughan, Ashley M.; Camargo, Nelly; Metzger, Peter G.; Douglass, Alyse N.; MacBeath, Gavin; Kappe, Stefan H.I.

    2013-01-01

    Summary Plasmodium parasites infect the liver and replicate inside hepatocytes before they invade erythrocytes and trigger clinical malaria. Analysis of host signaling pathways affected by liver stage infection could provide critical insights into host-pathogen interactions and reveal targets for intervention. Using protein lysate microarrays we found that Plasmodium yoelii rodent malaria parasites perturb hepatocyte regulatory pathways involved in cell survival, proliferation and autophagy. Notably, the pro-death protein p53 was substantially decreased in infected hepatocytes, suggesting it could be targeted by the parasite to foster survival. Indeed, mice that express increased levels of p53 showed reduced liver stage parasite burden whereas p53 knockout mice suffered increased liver stage burden. Furthermore, boosting p53 levels using the small molecule Nutlin-3 dramatically reduced liver stage burden in vitro and in vivo. We conclude that perturbation of the hepatocyte p53 pathway critically impacts parasite survival. Thus, host pathways might constitute potential targets for host-based antimalarial prophylaxis. PMID:23478020

  12. DNA repair systems and the pathogenesis of Mycobacterium tuberculosis: varying activities at different stages of infection.

    PubMed

    Gorna, Alina E; Bowater, Richard P; Dziadek, Jaroslaw

    2010-05-25

    Mycobacteria, including most of all MTB (Mycobacterium tuberculosis), cause pathogenic infections in humans and, during the infectious process, are exposed to a range of environmental insults, including the host's immune response. From the moment MTB is exhaled by infected individuals, through an active and latent phase in the body of the new host, until the time they reach the reactivation stage, MTB is exposed to many types of DNA-damaging agents. Like all cellular organisms, MTB has efficient DNA repair systems, and these are believed to play essential roles in mycobacterial pathogenesis. As different stages of infection have great variation in the conditions in which mycobacteria reside, it is possible that different repair systems are essential for progression to specific phases of infection. MTB possesses homologues of DNA repair systems that are found widely in other species of bacteria, such as nucleotide excision repair, base excision repair and repair by homologous recombination. MTB also possesses a system for non-homologous end-joining of DNA breaks, which appears to be widespread in prokaryotes, although its presence is sporadic within different species within a genus. However, MTB does not possess homologues of the typical mismatch repair system that is found in most bacteria. Recent studies have demonstrated that DNA repair genes are expressed differentially at each stage of infection. In the present review, we focus on different DNA repair systems from mycobacteria and identify questions that remain in our understanding of how these systems have an impact upon the infection processes of these important pathogens.

  13. Susceptibility to Plasmodium liver stage infection is altered by hepatocyte polyploidy

    PubMed Central

    Austin, Laura S.; Kaushansky, Alexis; Kappe, Stefan H.I.

    2014-01-01

    Summary Plasmodium parasites infect hepatocytes of their mammalian hosts and within undergo obligate liver stage development. The specific host cell attributes that are important for liver infection remain largely unknown. Several host signaling pathways are perturbed in infected hepatocytes, some of which are important in the generation of hepatocyte polyploidy. To test the functional consequence of polyploidy in liver infection, we infected hepatocytes with the rodent malaria parasite Plasmodium yoelii both in vitro and in vivo and examined the ploidy of infected and uninfected hepatocytes by flow cytometry. In both hepatoma cell lines and in the mouse liver, the fraction of polyploid cells was higher in the infected cell population than in the uninfected cell population. When the data were reanalyzed by comparing the extent of Plasmodium infection within each ploidy subset, we found that infection rates were elevated in more highly polyploid cells and lower in diploid cells. Furthermore, we found that the parasite’s preference for host cells with high ploidy is conserved among rodent malaria species and the human malaria parasite Plasmodium falciparum. This parasite preference for host cells of high ploidy cannot be explained by differences in hepatocyte size or DNA replication. We conclude that Plasmodium preferentially infects and develops in polyploid hepatocytes. PMID:24612025

  14. Evaluation of a two-stage antibacterial hydrogel dressing for healing in an infected diabetic wound.

    PubMed

    He, Hong; Xia, Dong-Lin; Chen, Yan-Pei; Li, Xiao-Dong; Chen, Chao; Wang, Yu-Fei; Shen, Lingling; Hu, Yu-Lin; Gu, Hai-Ying

    2017-10-01

    Various types of wound dressings have been used to treat complex infections in diabetes mellitus. This study is the first to evaluate the healing effects using a two-stage dressing in infected diabetic wounds. A two-stage antibacterial hydrogel dressing (two-stage dressing) was established with two time phases, an antibacterial phase and a drug release phase. We established each phase by using a swelling and rate of drug release test. These results suggested that the antimicrobial phase is activated as soon as the two-stage dressing attaches to the skin. The drugs in the drug release layer of the dressing were released to a greater extent than expected 20-36 h after attachment to the skin, likely due to extensive water absorption. Histological analysis and measurement of vascular endothelial growth factor expression through in vivo testing suggested that the benefits of a two-stage dressing include rapid antibacterial properties, sustained drug release, and promotion of wound healing through cell proliferation as compared with the traditional composite antibacterial hydrogel dressing. Further in vivo tests confirmed that separation of the antibacterial and drug-releasing properties, along with biocompatibility and rapid wound closure rates made two-stage dressings suitable for healing of infected wounds. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1808-1817, 2017. © 2015 Wiley Periodicals, Inc.

  15. Immunodiagnostic Identification of Dairy Cows Infected with Prototheca zopfii at Various Clinical Stages and Discrimination between Infected and Uninfected Cows

    PubMed Central

    Roesler, Uwe; Scholz, Holger; Hensel, Andreas

    2001-01-01

    Protothecosis is a severe form of mastitis in cattle that is caused by colorless algae of the genus Prototheca. So far, no suitable serological test for the identification of infected animals is available for routine diagnosis. In this study an indirect enzyme-linked immunosorbent assay (ELISA) for the identification of infected cows and for discriminating among infected cows at various clinical stages was developed. Immunoglobulin G (IgG) in serum and IgA and IgG1 in whey were used as antibody isotypes. The ELISA was evaluated using serum and whey from animals at different clinical stages of infection. A total of 12 cows with acute clinical manifestation of protothecal mastitis, 22 cows with clinical signs of chronic mastitis, 40 Prototheca zopfii-negative cows, and 18 cows with chronic clinical signs and earlier cultures positive for P. zopfii but with presently negative culturing results were investigated. A sensitivity of 96% and a specificity of 94% were calculated for the ELISA based on IgA levels. Intra-assay and interassay variations were calculated to be 6.08 and 6.32%, respectively. Based on these data, this ELISA was found to be suitable for discrimination between infected and uninfected animals and might therefore be useful for screening affected herds. PMID:11158103

  16. Immunodiagnostic identification of dairy cows infected with Prototheca zopfii at various clinical stages and discrimination between infected and uninfected cows.

    PubMed

    Roesler, U; Scholz, H; Hensel, A

    2001-02-01

    Protothecosis is a severe form of mastitis in cattle that is caused by colorless algae of the genus Prototheca. So far, no suitable serological test for the identification of infected animals is available for routine diagnosis. In this study an indirect enzyme-linked immunosorbent assay (ELISA) for the identification of infected cows and for discriminating among infected cows at various clinical stages was developed. Immunoglobulin G (IgG) in serum and IgA and IgG1 in whey were used as antibody isotypes. The ELISA was evaluated using serum and whey from animals at different clinical stages of infection. A total of 12 cows with acute clinical manifestation of protothecal mastitis, 22 cows with clinical signs of chronic mastitis, 40 Prototheca zopfii-negative cows, and 18 cows with chronic clinical signs and earlier cultures positive for P. zopfii but with presently negative culturing results were investigated. A sensitivity of 96% and a specificity of 94% were calculated for the ELISA based on IgA levels. Intra-assay and interassay variations were calculated to be 6.08 and 6.32%, respectively. Based on these data, this ELISA was found to be suitable for discrimination between infected and uninfected animals and might therefore be useful for screening affected herds.

  17. Febrile temperatures induce cytoadherence of ring-stage Plasmodium falciparum-infected erythrocytes.

    PubMed

    Udomsangpetch, Rachanee; Pipitaporn, Busaba; Silamut, Kamolrat; Pinches, Robert; Kyes, Sue; Looareesuwan, Sornchai; Newbold, Christopher; White, Nicholas J

    2002-09-03

    In falciparum malaria, the malaria parasite induces changes at the infected red blood cell surface that lead to adherence to vascular endothelium and other red blood cells. As a result, the more mature stages of Plasmodium falciparum are sequestered in the microvasculature and cause vital organ dysfunction, whereas the ring stages circulate in the blood stream. Malaria is characterized by fever. We have studied the effect of febrile temperatures on the cytoadherence in vitro of P. falciparum-infected erythrocytes. Freshly obtained ring-stage-infected red blood cells from 10 patients with acute falciparum malaria did not adhere to the principle vascular adherence receptors CD36 or intercellular adhesion molecule-1 (ICAM-1). However, after a brief period of heating to 40 degrees C, all ring-infected red blood cells adhered to CD36, and some isolates adhered to ICAM-1, whereas controls incubated at 37 degrees C did not. Heating to 40 degrees C accelerated cytoadherence and doubled the maximum cytoadherence observed (P < 0.01). Erythrocytes infected by ring-stages of the ICAM-1 binding clone A4var also did not cytoadhere at 37 degrees C, but after heating to febrile temperatures bound to both CD36 and ICAM-1. Adherence of red blood cells infected with trophozoites was also increased considerably by brief heating. The factor responsible for heat induced adherence was shown to be the parasite derived variant surface protein PfEMP-1. RNA analysis showed that levels of var mRNA did not differ between heated and unheated ring-stage parasites. Thus fever-induced adherence appeared to involve increased trafficking of PfEMP-1 to the erythrocyte membrane. Fever induced cytoadherence is likely to have important pathological consequences and may explain both clinical deterioration with fever in severe malaria and the effects of antipyretics on parasite clearance.

  18. Alzheimer's disease Braak Stage progressions: reexamined and redefined as Borrelia infection transmission through neural circuits.

    PubMed

    MacDonald, Alan B

    2007-01-01

    Brain structure in health is a dynamic energized equation incorporating chemistry, neuronal structure, and circuitry components. The chemistry "piece" is represented by multiple neurotransmitters such as Acetylcholine, Serotonin, and Dopamine. The neuronal structure "piece" incorporates synapses and their connections. And finally circuits of neurons establish "architectural blueprints" of anatomic wiring diagrams of the higher order of brain neuron organizations. In Alzheimer's disease, there are progressive losses in all of these components. Brain structure crumbles. The deterioration in Alzheimer's is ordered, reproducible, and stepwise. Drs. Braak and Braak have described stages in the Alzheimer disease continuum. "Progressions" through Braak Stages benchmark "Regressions" in Cognitive function. Under the microscope, the Stages of Braak commence in brain regions near to the hippocampus, and over time, like a tsunami wave of destruction, overturn healthy brain regions, with neurofibrillary tangle damaged neurons "marching" through the temporal lobe, neocortex and occipital cortex. In effect the destruction ascends from the limbic regions to progressively destroy the higher brain centers. Rabies infection also "begins low and finishes high" in its wave of destruction of brain tissue. Herpes Zoster infections offer the paradigm of clinical latency of infection inside of nerves before the "marching commences". Varicella Zoster virus enters neurons in the pediatric years. Dormant virus remains inside the neurons for 50-80 years, tissue damage late in life (shingles) demonstrates the "march of the infection" down neural pathways (dermatomes) as linear areas of painful blisters loaded with virus from a childhood infection. Amalgamation of Zoster with Rabies models produces a hybrid model to explain all of the Braak Stages of Alzheimer's disease under a new paradigm, namely "Alzheimer's neuroborreliosis" in which latent Borrelia infections ascend neural circuits through

  19. Viral RNA at Two Stages of Reovirus Infection Is Required for the Induction of Necroptosis.

    PubMed

    Berger, Angela K; Hiller, Bradley E; Thete, Deepti; Snyder, Anthony J; Perez, Encarnacion; Upton, Jason W; Danthi, Pranav

    2017-03-15

    Necroptosis, a regulated form of necrotic cell death, requires the activation of the RIP3 kinase. Here, we identify that infection of host cells with reovirus can result in necroptosis. We find that necroptosis requires sensing of the genomic RNA within incoming virus particles via cytoplasmic RNA sensors to produce type I interferon (IFN). While these events that occur prior to the de novo synthesis of viral RNA are required for the induction of necroptosis, they are not sufficient. The induction of necroptosis also requires late stages of reovirus infection. Specifically, efficient synthesis of double-stranded RNA (dsRNA) within infected cells is required for necroptosis. These data indicate that viral RNA interfaces with host components at two different stages of infection to induce necroptosis. This work provides new molecular details about events in the viral replication cycle that contribute to the induction of necroptosis following infection with an RNA virus.IMPORTANCE An appreciation of how cell death pathways are regulated following viral infection may reveal strategies to limit tissue destruction and prevent the onset of disease. Cell death following virus infection can occur by apoptosis or a regulated form of necrosis known as necroptosis. Apoptotic cells are typically disposed of without activating the immune system. In contrast, necroptotic cells alert the immune system, resulting in inflammation and tissue damage. While apoptosis following virus infection has been extensively investigated, how necroptosis is unleashed following virus infection is understood for only a small group of viruses. Here, using mammalian reovirus, we highlight the molecular mechanism by which infection with a dsRNA virus results in necroptosis.

  20. Two-Stage Cementless Revision Total Hip Arthroplasty for Infected Primary Hip Arthroplasties.

    PubMed

    Camurcu, Yalkin; Sofu, Hakan; Buyuk, Abdul Fettah; Gursu, Sarper; Kaygusuz, Mehmet Akif; Sahin, Vedat

    2015-09-01

    The main purpose of the present study was to analyze the clinical features, the most common infective agents, and the results of two-stage total hip revision using a teicoplanin-impregnated spacer. Between January 2005 and July 2011, 41 patients were included. At the clinical status analysis, physical examination was performed, Harris hip score was noted, isolated microorganisms were recorded, and the radiographic evaluation was performed. The mean Harris hip score was improved from 38.9 ± 9.6 points to 81.8 ± 5.8 points (P<0.05). Infection was eradicated in 39 hips. Radiographic evidence of stability was noted in 37 acetabular revision components, and all femoral stems. Two-stage revision of the infected primary hip arthroplasty is a time-consuming but a reliable procedure with high rates of success. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Dynamics of a Class of HIV Infection Models with Cure of Infected Cells in Eclipse Stage.

    PubMed

    Maziane, Mehdi; Lotfi, El Mehdi; Hattaf, Khalid; Yousfi, Noura

    2015-12-01

    In this paper, we propose two HIV infection models with specific nonlinear incidence rate by including a class of infected cells in the eclipse phase. The first model is described by ordinary differential equations (ODEs) and generalizes a set of previously existing models and their results. The second model extends our ODE model by taking into account the diffusion of virus. Furthermore, the global stability of both models is investigated by constructing suitable Lyapunov functionals. Finally, we check our theoretical results with numerical simulations.

  2. ZIPCO, a putative metal ion transporter, is crucial for Plasmodium liver-stage development.

    PubMed

    Sahu, Tejram; Boisson, Bertrand; Lacroix, Céline; Bischoff, Emmanuel; Richier, Quentin; Formaglio, Pauline; Thiberge, Sabine; Dobrescu, Irina; Ménard, Robert; Baldacci, Patricia

    2014-11-01

    The malaria parasite, Plasmodium, requires iron for growth, but how it imports iron remains unknown. We characterize here a protein that belongs to the ZIP (Zrt-, Irt-like Protein) family of metal ion transport proteins and have named ZIP domain-containing protein (ZIPCO). Inactivation of the ZIPCO-encoding gene in Plasmodium berghei, while not affecting the parasite's ability to multiply in mouse blood and to infect mosquitoes, greatly impairs its capacity to develop inside hepatocytes. Iron/zinc supplementation and depletion experiments suggest that ZIPCO is required for parasite utilization of iron and possibly zinc, consistent with its predicted function as a metal transporter. This is the first report of a ZIP protein having a crucial role in Plasmodium liver-stage development, as well as the first metal ion transporter identified in Plasmodium pre-erythrocytic stages. Because of the drastic dependence on iron of Plasmodium growth, ZIPCO and related proteins might constitute attractive drug targets to fight against malaria. © 2014 Institut Pasteur. Published under the terms of the CC BY 4.0 license.

  3. One-stage Revision With Catheter Infusion of Intraarticular Antibiotics Successfully Treats Infected THA.

    PubMed

    Whiteside, Leo A; Roy, M E

    2017-02-01

    Two-stage revision surgery for infected total hip arthroplasty (THA) is commonly advocated, but substantial morbidity and expense are associated with this technique. In certain cases of infected THA, treatment with one-stage revision surgery and intraarticular infusion of antibiotics may offer a reasonable alternative with the distinct advantage of providing a means of delivering the drug in high concentrations. We describe a protocol for intraarticular delivery of antibiotics to the hip through an indwelling catheter combined with one-stage revision surgery and examine (1) the success as judged by eradication of infection at 1 year when treating chronically infected cemented stems; (2) success in treating late-onset acute infections in well-ingrown cementless stems; and (3) what complications were associated with this approach in a small case series. Between January 2002 and July 2013, 30 patients (30 hips) presented to the senior author for treatment of infected THA. Of those, 21 patients (21 hips) with infected cemented THAs underwent débridement and single-stage revision to cementless total hip implants followed by catheter infusion of intraarticular antibiotics. Nine patients (nine hips) with late-onset acute infections in cementless THA had bone-ingrown implants. These patients were all more than 2 years from their original surgery and had acute symptoms of infection for 4 to 9 days. Seven had their original THA elsewhere, and two were the author's patients. All were symptom-free until the onset of their infection, and none had postoperative wound complications, fever, or prolonged pain suggestive of a more chronic process. They were treated with débridement and head and liner exchange, again followed by catheter infusion of intraarticular antibiotics. During this time period, this represented all infected THAs treated by the senior author, and all were treated with this protocol; no patient underwent two-stage exchange during this time, and no patients

  4. Immunization with Pre-Erythrocytic Antigen CelTOS from Plasmodium falciparum Elicits Cross-Species Protection against Heterologous Challenge with Plasmodium berghei

    DTIC Science & Technology

    2010-08-01

    the midgut epithelium by ookinetes [8]. The notion that CelTOS is an important protein for the traversal of the malaria parasite in both, the mammalian...and the insect host, warranted an evaluation of whether targeted immune responses against this antigen could prevent the infection of the liver in...binding on ookinetes and blocking their traversal through the midgut and thus abrogating further development to oocysts in the basal lamina. Although

  5. Fasciola hepatica induces eosinophil apoptosis in the migratory and biliary stages of infection in sheep.

    PubMed

    Escamilla, A; Bautista, M J; Zafra, R; Pacheco, I L; Ruiz, M T; Martínez-Cruz, S; Méndez, A; Martínez-Moreno, A; Molina-Hernández, V; Pérez, J

    2016-01-30

    The aim of the present work was to evaluate the number of apoptotic eosinophils in the livers of sheep experimentally infected with Fasciola hepatica during the migratory and biliary stages of infection. Four groups (n=5) of sheep were used; groups 1-3 were orally infected with 200 metacercariae (mc) and sacrificed at 8 and 28 days post-infection (dpi), and 17 weeks post-infection (wpi), respectively. Group 4 was used as an uninfected control. Apoptosis was detected using immunohistochemistry with a polyclonal antibody against anti-active caspase-3, and transmission electron microscopy (TEM). Eosinophils were identified using the Hansel stain in serial sections for caspase-3, and by ultrastructural features using TEM. At 8 and 28 dpi, numerous caspase-3(+) eosinophils were mainly found at the periphery of acute hepatic necrotic foci. The percentage of caspase -3(+) apoptotic eosinophils in the periphery of necrotic foci was high (46.1-53.9) at 8 and 28 dpi, respectively, and decreased in granulomas found at 28 dpi (6%). Transmission electron microscopy confirmed the presence of apoptotic eosinophils in hepatic lesions at 8 and 28 dpi. At 17 wpi, apoptotic eosinophils were detected in the infiltrate surrounding some enlarged bile ducts containing adult flukes. This is the first report of apoptosis induced by F. hepatica in sheep and the first study reporting apoptosis in eosinophils in hepatic inflammatory infiltrates in vivo. The high number of apoptotic eosinophils in acute necrotic tracts during the migratory and biliary stages of infection suggests that eosinophil apoptosis may play a role in F. hepatica survival during different stages of infection.

  6. Divergent evolution of arrested development in the dauer stage of Caenorhabditis elegans and the infective stage of Heterodera glycines

    PubMed Central

    Elling, Axel A; Mitreva, Makedonka; Recknor, Justin; Gai, Xiaowu; Martin, John; Maier, Thomas R; McDermott, Jeffrey P; Hewezi, Tarek; McK Bird, David; Davis, Eric L; Hussey, Richard S; Nettleton, Dan; McCarter, James P; Baum, Thomas J

    2007-01-01

    Background The soybean cyst nematode Heterodera glycines is the most important parasite in soybean production worldwide. A comprehensive analysis of large-scale gene expression changes throughout the development of plant-parasitic nematodes has been lacking to date. Results We report an extensive genomic analysis of H. glycines, beginning with the generation of 20,100 expressed sequence tags (ESTs). In-depth analysis of these ESTs plus approximately 1,900 previously published sequences predicted 6,860 unique H. glycines genes and allowed a classification by function using InterProScan. Expression profiling of all 6,860 genes throughout the H. glycines life cycle was undertaken using the Affymetrix Soybean Genome Array GeneChip. Our data sets and results represent a comprehensive resource for molecular studies of H. glycines. Demonstrating the power of this resource, we were able to address whether arrested development in the Caenorhabditis elegans dauer larva and the H. glycines infective second-stage juvenile (J2) exhibits shared gene expression profiles. We determined that the gene expression profiles associated with the C. elegans dauer pathway are not uniformly conserved in H. glycines and that the expression profiles of genes for metabolic enzymes of C. elegans dauer larvae and H. glycines infective J2 are dissimilar. Conclusion Our results indicate that hallmark gene expression patterns and metabolism features are not shared in the developmentally arrested life stages of C. elegans and H. glycines, suggesting that developmental arrest in these two nematode species has undergone more divergent evolution than previously thought and pointing to the need for detailed genomic analyses of individual parasite species. PMID:17919324

  7. Blastomycosis infection of the knee treated with staged total knee arthroplasty.

    PubMed

    MacLean, Ian S; Day, Shandra R; Moore, Christopher C; Browne, James A

    2015-12-01

    Blastomycosis is a rare fungal disease that can cause intraarticular infection and joint destruction requiring surgical reconstruction. We describe a patient who presented with destruction of the knee joint of unknown etiology. The patient was initially treated with debridement and spacer placement followed by antifungal therapy after cultures grew blastomycosis. Following adequate treatment of the infection, the patient was taken back to the operating room for reconstruction with a total knee arthroplasty. The patient had a successful outcome with no evidence of infection at two years following surgery. To our knowledge, this case report represents the first documented case in which a blastomycotic infection of a native knee was successfully treated with a two-stage total knee arthroplasty. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Mitochondrial Respiration Is Impaired during Late-Stage Hamster Prion Infection.

    PubMed

    Faris, Robert; Moore, Roger A; Ward, Anne; Sturdevant, Dan E; Priola, Suzette A

    2017-09-15

    Mitochondria are crucial to proper neuronal function and overall brain health. Mitochondrial dysfunction within the brain has been observed in many neurodegenerative diseases, including prion disease. Several markers of decreased mitochondrial activity during prion infection have been reported, yet the bioenergetic respiratory status of mitochondria from prion-infected animals is unknown. Here we show that clinically ill transgenic mice overexpressing hamster prion protein (Tg7) infected with the hamster prion strain 263K suffer from a severe deficit in mitochondrial oxygen consumption in response to the respiratory complex II substrate succinate. Characterization of the mitochondrial proteome of purified brain mitochondria from infected and uninfected Tg7 mice showed significant differences in the relative abundance of key mitochondrial electron transport proteins in 263K-infected animals relative to that in controls. Our results suggest that at clinical stages of prion infection, dysregulation of respiratory chain proteins may lead to impairment of mitochondrial respiration in the brain.IMPORTANCE Mitochondrial dysfunction is present in most major neurodegenerative diseases, and some studies have suggested that mitochondrial processes may be altered during prion disease. Here we show that hamster prion-infected transgenic mice overexpressing the hamster prion protein (Tg7 mice) suffer from mitochondrial respiratory deficits. Tg7 mice infected with the 263K hamster prion strain have little or no signs of mitochondrial dysfunction at the disease midpoint but suffer from a severe deficit in mitochondrial respiration at the clinical phase of disease. A proteomic analysis of the isolated brain mitochondria from clinically affected animals showed that several proteins involved in electron transport, mitochondrial dynamics, and mitochondrial protein synthesis were dysregulated. These results suggest that mitochondrial dysfunction, possibly exacerbated by prion protein

  9. Why Functional Pre-Erythrocytic and Bloodstage Malaria Vaccines Fail: A Meta-Analysis of Fully Protective Immunizations and Novel Immunological Model

    PubMed Central

    Guilbride, D. Lys; Gawlinski, Pawel; Guilbride, Patrick D. L.

    2010-01-01

    Background Clinically protective malaria vaccines consistently fail to protect adults and children in endemic settings, and at best only partially protect infants. Methodology/Principal Findings We identify and evaluate 1916 immunization studies between 1965-February 2010, and exclude partially or nonprotective results to find 177 completely protective immunization experiments. Detailed reexamination reveals an unexpectedly mundane basis for selective vaccine failure: live malaria parasites in the skin inhibit vaccine function. We next show published molecular and cellular data support a testable, novel model where parasite-host interactions in the skin induce malaria-specific regulatory T cells, and subvert early antigen-specific immunity to parasite-specific immunotolerance. This ensures infection and tolerance to reinfection. Exposure to Plasmodium-infected mosquito bites therefore systematically triggers immunosuppression of endemic vaccine-elicited responses. The extensive vaccine trial data solidly substantiate this model experimentally. Conclusions/Significance We conclude skinstage-initiated immunosuppression, unassociated with bloodstage parasites, systematically blocks vaccine function in the field. Our model exposes novel molecular and procedural strategies to significantly and quickly increase protective efficacy in both pipeline and currently ineffective malaria vaccines, and forces fundamental reassessment of central precepts determining vaccine development. This has major implications for accelerated local eliminations of malaria, and significantly increases potential for eradication. PMID:20502667

  10. Dynamics of an HIV Model with Multiple Infection Stages and Treatment with Different Drug Classes.

    PubMed

    Wang, Xia; Song, Xinyu; Tang, Sanyi; Rong, Libin

    2016-02-01

    Highly active antiretroviral therapy can effectively control HIV replication in infected individuals. Some clinical and modeling studies suggested that viral decay dynamics may depend on the inhibited stages of the viral replication cycle. In this paper, we develop a general mathematical model incorporating multiple infection stages and various drug classes that can interfere with specific stages of the viral life cycle. We derive the basic reproductive number and obtain the global stability results of steady states. Using several simple cases of the general model, we study the effect of various drug classes on the dynamics of HIV decay. When drugs are assumed to be 100% effective, drugs acting later in the viral life cycle lead to a faster or more rapid decay in viremia. This is consistent with some patient and experimental data, and also agrees with previous modeling results. When drugs are not 100% effective, the viral decay dynamics are more complicated. Without a second population of long-lived infected cells, the viral load decline can have two phases if drugs act at an intermediate stage of the viral replication cycle. The slopes of viral load decline depend on the drug effectiveness, the death rate of infected cells at different stages, and the transition rate of infected cells from one to the next stage. With a second population of long-lived infected cells, the viral load decline can have three distinct phases, consistent with the observation in patients receiving antiretroviral therapy containing the integrase inhibitor raltegravir. We also fit modeling prediction to patient data under efavirenz (a nonnucleoside reverse-transcriptase inhibitor) and raltegravir treatment. The first-phase viral load decline under raltegravir therapy is longer than that under efavirenz, resulting in a lower viral load at initiation of the second-phase decline in patients taking raltegravir. This explains why patients taking a raltegravir-based therapy were faster to achieve

  11. Hepatitis C virus infection in end-stage renal disease and kidney transplantation.

    PubMed

    Burra, Patrizia; Rodríguez-Castro, Kryssia I; Marchini, Francesco; Bonfante, Luciana; Furian, Lucrezia; Ferrarese, Alberto; Zanetto, Alberto; Germani, Giacomo; Russo, Francesco Paolo; Senzolo, Marco

    2014-09-01

    Liver disease secondary to chronic hepatitis C virus (HCV) infection is an important cause of morbidity and mortality in patients with end-stage renal disease (ESRD) on renal replacement therapy and after kidney transplantation (KT). Hemodialytic treatment (HD) for ESRD constitutes a risk factor for bloodborne infections because of prolonged vascular access and the potential for exposure to infected patients and contaminated equipment. Evaluation of HCV-positive/ESRD and HCV-positive/KT patients is warranted to determine the stage of disease and the appropriateness of antiviral therapy, despite such treatment is challenging especially due to tolerability issues. Antiviral treatment with interferon (IFN) is contraindicated after transplantation due to the risk of rejection, and therefore, treatment is recommended before KT. Newer treatment strategies of direct-acting antiviral agents in combination are revolutionizing HCV therapy, as a result of encouraging outcomes streaming from recent studies which report increased sustained viral response, low or no resistance, and good safety profiles, including preservation of renal function. KT has been demonstrated to yield better outcomes with respect to remaining on HD although survival after KT is penalized by the presence of HCV infection with respect to HCV-negative transplant recipients. Therefore, an appropriate, comprehensive, easily applicable set of clinical practice management guidelines is necessary in both ESRD and KT patients with HCV infection and HCV-related liver disease.

  12. The relationship between cognitive reserve and the clinical stage of HIV infection.

    PubMed

    Alvarez-Tostado, Pablo; Inozemtseva, Olga; Aguiñiga, Miguel A; López, Enrique; Matute, Esmeralda

    2016-01-01

    The objective of this study was to determine whether the effect of cognitive reserve (CR) on neuropsychological functioning differs according to the clinical stage of HIV infection. A sample of 34 HIV-positive individuals aged 23-49, with a minimum of 9 years of formal education, was assessed. Participants were grouped according to the Centers for Disease Control and Prevention's (CDC) clinical stages (A = 10, B = 16, C = 8). CR was calculated for each clinical stage group in accordance with estimates of premorbid IQ, years of education, and occupational attainment. The sum of these three variables was then transformed into z-scores. Individuals above the median were classified as having "High" CR (HCR), those below the median were classified as "Low" CR (LCR). Participants completed an evaluation of cognitive and executive functions based on selected, modified tasks from the HIV University of Miami Annotated Neuropsychological test in Spanish (HUMANS). Assessment included the following domains: attention, memory (visual, verbal, and working memory), executive functions (cognitive flexibility, switching), language (naming), and visual constructive skills (block design). HCR outperformed LCR in all cognitive domains. Comparison of HCR and LCR in each clinical stage revealed that the effect of CR was stronger in stage B than in stages A and C, suggesting that this effect does indeed vary among stages.

  13. Preoperative prediction of failure following two-stage revision for knee prosthetic joint infections.

    PubMed

    Sabry, Fady Youssef; Buller, Leonard; Ahmed, Sarim; Klika, Alison K; Barsoum, Wael K

    2014-01-01

    While two-stage revision is the gold standard for treatment of knee prosthetic joint infection (PJI), it is not without risk. The purpose of this study was to develop a tool to preoperatively predict the probability that a two-stage revision would fail to eradicate knee PJI. 3,809 surgical cases were retrospectively reviewed and data were collected from 314 charts. Overall, 105 (33.4%) cases failed to eradicate PJI using this procedure. Univariate analysis identified multiple variables independently associated with reinfection. Logistic regression was used to generate a model (bootstrap-corrected concordance index of 0.773) predicting failure of infection eradication. Preoperative knowledge of a high probability of failure may improve risk assessment, lead to more aggressive management, and allow for time to consider alternative therapies.

  14. Expression of a hydrophilic surface protein in infective stages of Leishmania major.

    PubMed

    Flinn, H M; Rangarajan, D; Smith, D F

    1994-06-01

    A family of differentially expressed genes from Leishmania major contains one sequence (Gene B) that encodes a novel, hydrophilic protein found on the surface of infective parasite stages. The 177-residue, acidic Gene B protein is characterised by an amino acid repetitive element, comprising 45% of the total molecule, that is related to the cell-wall binding domain of protein A from Staphylococcus aureus. No identifiable signal peptide, membrane-spanning domain or consensus for glycosylphosphatidylinositol anchor attachment to the cell surface is found elsewhere in the deduced protein sequence. In vitro, the Gene B protein fractionates with the parasite cell surface glycoconjugates, lipophosphoglycan and the glycoinositolphospholipids. This protein is the first characterised surface peptide marker for infective stages of the Leishmania life cycle.

  15. Two-stage hierarchical group testing for multiple infections with application to the Infertility Prevention Project

    PubMed Central

    Tebbs, Joshua M.; McMahan, Christopher S.; Bilder, Christopher R.

    2015-01-01

    Summary Screening for sexually transmitted diseases has benefited greatly from the use of group testing (pooled testing) to lower costs. With the development of assays that detect multiple infections, screening practices now involve testing pools of individuals for multiple infections simultaneously. Building on the research for single infection group testing procedures, we examine the performance of group testing for multiple infections. Our work is motivated by chlamydia and gonorrhea testing for the Infertility Prevention Project (IPP), a national program in the United States. We consider a two-stage pooling algorithm currently used to perform testing for the IPP. We first derive the operating characteristics of this algorithm for classification purposes (e.g., expected number of tests, misclassification probabilities, etc.) and identify pool sizes that minimize the expected number of tests. We then develop an expectation-maximization algorithm to estimate probabilities of infection using both group and individual retest responses. Our research shows that group testing can offer large cost savings when classifying individuals for multiple infections and can provide prevalence estimates that are actually more efficient than those from individual testing. PMID:24117173

  16. Two-stage hierarchical group testing for multiple infections with application to the infertility prevention project.

    PubMed

    Tebbs, Joshua M; McMahan, Christopher S; Bilder, Christopher R

    2013-12-01

    Screening for sexually transmitted diseases (STDs) has benefited greatly from the use of group testing (pooled testing) to lower costs. With the development of assays that detect multiple infections, screening practices now involve testing pools of individuals for multiple infections simultaneously. Building on the research for single infection group testing procedures, we examine the performance of group testing for multiple infections. Our work is motivated by chlamydia and gonorrhea testing for the infertility prevention project (IPP), a national program in the United States. We consider a two-stage pooling algorithm currently used to perform testing for the IPP. We first derive the operating characteristics of this algorithm for classification purposes (e.g., expected number of tests, misclassification probabilities, etc.) and identify pool sizes that minimize the expected number of tests. We then develop an expectation-maximization (EM) algorithm to estimate probabilities of infection using both group and individual retest responses. Our research shows that group testing can offer large cost savings when classifying individuals for multiple infections and can provide prevalence estimates that are actually more efficient than those from individual testing. © 2013, The International Biometric Society.

  17. Cucumber Necrosis Virus Recruits Cellular Heat Shock Protein 70 Homologs at Several Stages of Infection

    PubMed Central

    Alam, Syed Benazir

    2015-01-01

    ABSTRACT RNA viruses often depend on host factors for multiplication inside cells due to the constraints of their small genome size and limited coding capacity. One such factor that has been exploited by several plant and animal viruses is heat shock protein 70 (HSP70) family homologs which have been shown to play roles for different viruses in viral RNA replication, viral assembly, disassembly, and cell-to-cell movement. Using next generation sequence analysis, we reveal that several isoforms of Hsp70 and Hsc70 transcripts are induced to very high levels during cucumber necrosis virus (CNV) infection of Nicotiana benthamiana and that HSP70 proteins are also induced by at least 10-fold. We show that HSP70 family protein homologs are co-opted by CNV at several stages of infection. We have found that overexpression of Hsp70 or Hsc70 leads to enhanced CNV genomic RNA, coat protein (CP), and virion accumulation, whereas downregulation leads to a corresponding decrease. Hsc70-2 was found to increase solubility of CNV CP in vitro and to increase accumulation of CNV CP independently of viral RNA replication during coagroinfiltration in N. benthamiana. In addition, virus particle assembly into virus-like particles in CP agroinfiltrated plants was increased in the presence of Hsc70-2. HSP70 was found to increase the targeting of CNV CP to chloroplasts during infection, reinforcing the role of HSP70 in chloroplast targeting of host proteins. Hence, our findings have led to the discovery of a highly induced host factor that has been co-opted to play multiple roles during several stages of the CNV infection cycle. IMPORTANCE Because of the small size of its RNA genome, CNV is dependent on interaction with host cellular components to successfully complete its multiplication cycle. We have found that CNV induces HSP70 family homologs to a high level during infection, possibly as a result of the host response to the high levels of CNV proteins that accumulate during infection

  18. Effects of High Ambient Temperature on Various Stages of Rabies Virus Infection in Mice

    PubMed Central

    Bell, J. F.; Moore, G. J.

    1974-01-01

    Effects of high ambient temperatures on various stages of rabies virus infection have been studied. Ambient temperature increased within the tolerated range was found to have little effect upon body temperature of normal mice, but caused marked elevation of temperature during illness. Temperatures at onset of patent illness in mice were lower than normal. Increased body temperature in the higher thermic ambience during the incubation period was associated with decreased mortality and frequent abortive infections. Exposure to high ambient temperature late in the incubation period delayed onset of illness, decreased mortality, and increased frequency of abortive infections, but exposure to high ambient temperature after onset of patent illness did not affect the course of the disease. PMID:4426698

  19. Transcriptomic Analysis of Calonectria pseudoreteaudii during Various Stages of Eucalyptus Infection.

    PubMed

    Ye, Xiaozhen; Liu, Hongyi; Jin, Yajie; Guo, Mengmeng; Huang, Aizhen; Chen, Quanzhu; Guo, Wenshuo; Zhang, Feiping; Feng, Lizhen

    2017-01-01

    Eucalyptus leaf blight caused by Calonectria spp. is a serious disease in Eucalyptus seedling and plantations. However, the molecular mechanisms of the infection process and pathogenesis of Calonectria to Eucalyptus is not well-studied. In this study, we analyzed the transcriptomes of C. pseudoreteaudii at three stages of Eucalyptus leaf infection, and in mycelium grown in potato dextrose broth using Illumina RNA-Seq technology. We identified 161 differentially expressed genes between C. pseudoreteaudii from leaf and mycelium grown in potato dextrose broth. GO and KEGG enrichment analyses of these genes suggested that they were mainly involved in oxidoreductase activity, hydrolase activity, and transmembrane transporter activity. Most of the differentially expressed genes at the early infection stage were upregulated. These upregulated genes were mainly involved in cell wall hydrolysis and toxin synthesis, suggesting a role for toxin and cell wall hydrolases in the establishment of Calonectria leaf blight. Genes related to detoxification of phytoalexins were continually upregulated during infection. The candidate effectors and putative pathogenicity determinants identified in this study will help in the functional analysis of C. pseudoreteaudii virulence and pathogenicity.

  20. Transcriptomic Analysis of Calonectria pseudoreteaudii during Various Stages of Eucalyptus Infection

    PubMed Central

    Ye, Xiaozhen; Liu, Hongyi; Jin, Yajie; Guo, Mengmeng; Huang, Aizhen; Chen, Quanzhu; Guo, Wenshuo; Zhang, Feiping; Feng, Lizhen

    2017-01-01

    Eucalyptus leaf blight caused by Calonectria spp. is a serious disease in Eucalyptus seedling and plantations. However, the molecular mechanisms of the infection process and pathogenesis of Calonectria to Eucalyptus is not well-studied. In this study, we analyzed the transcriptomes of C. pseudoreteaudii at three stages of Eucalyptus leaf infection, and in mycelium grown in potato dextrose broth using Illumina RNA-Seq technology. We identified 161 differentially expressed genes between C. pseudoreteaudii from leaf and mycelium grown in potato dextrose broth. GO and KEGG enrichment analyses of these genes suggested that they were mainly involved in oxidoreductase activity, hydrolase activity, and transmembrane transporter activity. Most of the differentially expressed genes at the early infection stage were upregulated. These upregulated genes were mainly involved in cell wall hydrolysis and toxin synthesis, suggesting a role for toxin and cell wall hydrolases in the establishment of Calonectria leaf blight. Genes related to detoxification of phytoalexins were continually upregulated during infection. The candidate effectors and putative pathogenicity determinants identified in this study will help in the functional analysis of C. pseudoreteaudii virulence and pathogenicity. PMID:28072879

  1. Two-stage revision of hip prosthesis infection using a hip spacer with stabilising proximal cementation.

    PubMed

    Gil Gonzalez, Sergi; Marqués López, Fernando; Rigol Ramon, Pau; Mestre Cortadellas, Carlos; Cáceres Palou, Enric; León García, Alfonso

    2010-01-01

    Two-stage revision hip arthroplasty for infection using an antibiotic-loaded cement spacer has been used frequently with good results. However, spacer instability is also frequent. Proximal cementation of the spacer could avoid spacer dislocation. We retrospectively assessed 35 patients in whom a 2-stage revision hip arthroplasty for infection was carried out using an antibiotic-loaded cement spacer with gentamicin (Spacer-G) in which the spacer was proximally cemented in 16 patients. The mean follow-up was 32 months. We assessed spacer stability and infection elimination. There were 8 spacer dislocations (22.9%), 5 in hips without proximal cementation and 2 in hips with proximal cementation (p>0.05). There was no fracture in any hip. Reinfection occurred in 5 hips (14.3%), in 3 with the same microorganism, while 2 had a different microorganism. Our results indicate that the proximal cementation of the spacer prevents its dislocation. Infection was eliminated in 86% of the hips.

  2. Infection Staging and Incidence Surveillance Applications of High Dynamic Range Diagnostic Immuno-Assay Platforms.

    PubMed

    Grebe, Eduard; Welte, Alex; Hall, Jake; Keating, Sheila M; Facente, Shelley N; Marson, Kara; Martin, Jeffrey N; Little, Susan J; Price, Matthew A; Kallas, Esper G; Busch, Michael P; Pilcher, Christopher D; Murphy, Gary

    2017-09-07

    Custom HIV staging assays, including the Sedia™ HIV-1 Limiting Antigen Avidity EIA (LAg) and avidity modifications of the Ortho VITROS® anti-HIV-1+2 and Abbott ARCHITECT HIV Ag/Ab Combo assays, are used to identify 'recent' infections in clinical settings and for cross-sectional HIV incidence estimation. However, the high dynamic range of chemiluminescent platforms allows differentiating recent and longstanding infection on signal intensity, and this raises the prospect of using unmodified diagnostic assays for infection timing and surveillance applications. We tested a panel of 2,500 well-characterised specimens with estimable duration of HIV infection with the three assays and the unmodified ARCHITECT. Regression models were used to estimate mean durations of recent infection (MDRI), context-specific false-recent rates (FRR) and correlation between diagnostic signal intensity and LAg measurements. Hypothetical epidemiological scenarios were constructed to evaluate utility in surveillance applications. Over a range of MDRIs (reflecting recency discrimination thresholds), a diluted ARCHITECT-based RITA produced lower FRRs than the VITROS platform (FRR ≈ 0.5% and 1.5% respectively at MDRI ≈ 200 days) and the unmodified diagnostic ARCHITECT produces incidence estimates with comparable precision to LAg (RSE ≈ 17.5% and 15% respectively at MDRI ≈ 200 days). ARCHITECT S/CO measurements were highly correlated with LAg ODn measurements (r = 0.80) and values below 200 are strongly predictive of LAg recency and duration of infection less than one year. Low quantitative measurements from the unmodified ARCHITECT obviate the need for additional recency testing and its use is feasible in clinical staging and incidence surveillance applications.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial License 4.0 (CCBY-NC), where it is permissible to download, share, remix, transform, and buildup the work provided

  3. Antibiotic-Loaded Spacer for Two-Stage Revision of Infected Total Knee Arthroplasty.

    PubMed

    Vecchini, Eugenio; Micheloni, Gian Mario; Perusi, Francesco; Scaglia, Marco; Maluta, Tommaso; Lavini, Franco; Bondi, Manuel; Dall'Oca, Carlo; Magnan, Bruno

    2017-03-01

    Infection of total knee arthroplasty (TKA) is a challenge in orthopedic surgery. In literature TKA infection is classified according to the time after surgery: acute postoperative; late chronic; acute hematogenous; positive intraoperative microbiological growth. The purpose of this study is to present the results of the use of a preformed antibiotic-loaded spacer in TKA infections, treated by a two-stage revision procedure. A series of 19 consecutive patients (20 knees) with a diagnosis of infected TKA were treated from January 2003 to February 2012. Two-stage reimplantation protocols were completed only in 16 patients and these data were included in the study. We lost three patients at follow-up. An antibiotic-loaded preformed articulating polymethylmethacrylate spacer was applied. Patients were observed 1, 3, and 6 months postoperatively and then yearly for clinical and radiographic examination. The mean American Knee Society Score improved from 68.4 preoperatively (range, from 34 to 108) to 112.7 at final follow-up (range, from 49 to 180). The pain was evaluated as part of clinical score. It improved from an average of 19.3 preoperatively (range, from 10 to 30) to 34.3 at final follow-up (range, from 10 to 50). The average range of motion improved from 40.1 degrees (range, from 6 to 90 degrees) to 79.3 degrees (range, from 45 to 125 degrees). The use of the spacer allows obtaining a reduction of pain, an improvement of quality of life in the period of time between the two surgical stages and an easier reimplantation of TKA.

  4. Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

    PubMed Central

    Coronado, Lorena Michelle; Tayler, Nicole Michelle; Correa, Ricardo; Giovani, Rita Marissa; Spadafora, Carmenza

    2013-01-01

    Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ≈40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte. Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite. Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing. PMID:23486405

  5. The Brain NO Levels and NOS Activities Ascended in the Early and Middle Stages and Descended in the Terminal Stage in Scrapie-Infected Animal Models.

    PubMed

    Chen, Li-Na; Sun, Jing; Yang, Xiao-Dong; Xiao, Kang; Lv, Yan; Zhang, Bao-Yun; Zhou, Wei; Chen, Cao; Gao, Chen; Shi, Qi; Dong, Xiao-Ping

    2017-04-01

    The infections of prion agents may cause progressive and fatal neurodegenerative diseases in humans and a serial of animal species. Previous studies have proposed that the levels of nitric oxide (NO) and nitric oxide synthase (NOS) in the brains of some neurodegeneration diseases changed, while S-nitrosylation (SNO) of many brain proteins altered in prion diseases. To elucidate the potential changes of brain NO levels during prion infection, the NO levels and NOS activities in the brain tissues of three scrapie experimental rodents were measured, including scrapie agent 263 K-infected hamsters and 139A- and ME7-infected mice. Both NO levels and NOS activities, including total NOS (TNOS) and inducible NOS (iNOS), were increased at the terminal stages of scrapie-infected animals. Assays of the brain samples collected at different time points during scrapie infection showed that the NO levels and NOS activities started to increase at early stage, reached to the peak in the middle stage, and dropped down at late stage. Western blots for brain iNOS revealed increased firstly and decreased late, especially in the brains of 139A- and ME7-infected mice. In line with those alterations, the levels of the SNO forms of several selected brain proteins such as aquaporin-1 (AQP1), calcium/calmodulin-dependent protein kinase II (CaMKII), neurogranin, and opalin, underwent similar changing trends, while their total protein levels did not change obviously during scrapie infection. Our data here for the first time illustrate the changing profile of brain NO and NOS during prion infection. Time-dependent alterations of brain NO level and the associated protein S-nitrosylation process may contribute greatly to the neuropathological damage in prion diseases.

  6. Characterization of a 14,000 dalton antigen of Dirofilaria immitis infective third stage larvae

    SciTech Connect

    Fuller, S.A.; Cachia, P.J.; Wong, M.M.; Hurrell, J.G.R.

    1986-05-01

    Immunogenic proteins of Dirofilaria immitis (canine heartworm) were identified by probing extracts of adult worms or their excretory-secretory proteins (ESP) blotted to nitrocellulose following SDS-PAGE with control or infected dog sera. A 14,000 dalton antigen (a prominent component of ESP by protein staining) was consistently recognized both in extracts and ESP by dog sera as early as three months post infection. This indicates a larval origin for the antigen since no adult worms are present until approximately five months post infection. Monoclonal antibodies (MAbs) prepared against the 14,000 dalton antigen confirmed by immunoblotting that this antigen is expressed by infective third stage larvae, adults and microfilariae and is present intact in the sera of infected dogs. Surface-labelling of whole adult D. immitis with Na/sup 125/I produced radiolabelled antigens closely corresponding to those of ESP. An anti-14,000 dalton MAb was able to immunoprecipitate radiolabelled antigen which strongly suggest a surface or membrane location in the intact organism. Gel filtration data suggests that the protein is a native monomer. A MAb-affinity column has been used to purify the 14,000 dalton antigen to at least 98% homogeneity in one step from crude worm extracts. Further fractionation by HPLC yields a homogeneous preparation. Amino acid analysis and the N-terminal amino acid sequence data will be presented.

  7. Use of staged molecular analysis to determine causes of unexplained central nervous system infections.

    PubMed

    Hsu, Chien-Chin; Tokarz, Rafal; Briese, Thomas; Tsai, Hung-Chin; Quan, Phenix-Lan; Lipkin, W Ian

    2013-01-01

    No agent is implicated in most central nervous system (CNS) infections. To investigate cerebrospinal fluid samples from patients with CNS infections of unknown cause in 1 hospital in Taiwan, we used a staged molecular approach, incorporating techniques including multiplex MassTag PCR, 16S rRNA PCR, DNA microarray, and high-throughput pyrosequencing. We determined the infectious agent for 31 (24%) of 131 previously negative samples. Candidate pathogens were identified for 25 (27%) of 94 unexplained meningitis cases and 6 (16%) of 37 unexplained encephalitis cases. Epstein-Barr virus (18 infections) accounted for most of the identified agents in unexplained meningitis cases, followed by Escherichia coli (5), enterovirus (2), human herpesvirus 2 (1), and Mycobacterium tuberculosis. Herpesviruses were identified in samples from patients with unexplained encephalitis cases, including varicella-zoster virus (3 infections), human herpesvirus 1 (2), and cytomegalovirus (1). Our study confirms the power of multiplex MassTag PCR as a rapid diagnostic tool for identifying pathogens causing unexplained CNS infections.

  8. Raman spectroscopy based investigation of molecular changes associated with an early stage of dengue virus infection

    NASA Astrophysics Data System (ADS)

    Bilal, Maria; Bilal, Muhammad; Saleem, Muhammad; Khurram, Muhammad; Khan, Saranjam; Ullah, Rahat; Ali, Hina; Ahmed, Mushtaq; Shahzada, Shaista; Ullah Khan, Ehsan

    2017-04-01

    Raman spectroscopy based investigations of the molecular changes associated with an early stage of dengue virus infection (DENV) using a partial least squares (PLS) regression model is presented. This study is based on non-structural protein 1 (NS1) which appears after three days of DENV infection. In total, 39 blood sera samples were collected and divided into two groups. The control group contained samples which were the negative for NS1 and antibodies and the positive group contained those samples in which NS1 is positive and antibodies were negative. Out of 39 samples, 29 Raman spectra were used for the model development while the remaining 10 were kept hidden for blind testing of the model. PLS regression yielded a vector of regression coefficients as a function of Raman shift, which were analyzed. Cytokines in the region 775-875 cm-1, lectins at 1003, 1238, 1340, 1449 and 1672 cm-1, DNA in the region 1040-1140 cm-1 and alpha and beta structures of proteins in the region 933-967 cm-1 have been identified in the regression vector for their role in an early stage of DENV infection. Validity of the model was established by its R-square value of 0.891. Sensitivity, specificity and accuracy were 100% each and the area under the receiver operator characteristic curve was found to be 1.

  9. Usefulness of the recombinant liver stage antigen-3 for an early serodiagnosis of Plasmodium falciparum infection

    PubMed Central

    Lee, Hyeong-Woo; Moon, Sung-Ung; Ryu, Hye-Sun; Kim, Yeon-Joo; Cho, Shin-Hyeong; Chung, Gyung-Tae; Lin, Khin; Na, Byoung-Kuk; Kong, Yoon; Chung, Kyung-Suk

    2006-01-01

    In order to develop tools for an early serodiagnosis of Plasmodium falciparum infection, we evaluated the usefulness of P. falciparum liver stage antigen-3 (LSA-3) as a serodiagnostic antigen. A portion of LSA-3 gene was cloned, and its recombinant protein (rLSA-3) was expressed in Escherichia coli and purified by column chromatography. The purified rLSA-3 and 120 test blood/serum samples collected from inhabitants in malaria-endemic areas of Mandalay, Myanmar were used for this study. In microscopic examinations of blood samples, P. falciparum positive rate was 39.1% (47/120) in thin smear trials, and 33.3% (40/120) in thick smear trials. Although the positive rate associated with the rLSA-3 (30.8%) was lower than that of the blood stage antigens (70.8%), rLSA-3 based enzyme-linked immunosorbent assay could detect 12 seropositive cases (10.0%), in which blood stage antigens were not detected. These results indicate that the LSA-3 is a useful antigen for an early serodiagnosis of P. falciparum infection. PMID:16514282

  10. Usefulness of the recombinant liver stage antigen-3 for an early serodiagnosis of Plasmodium falciparum infection.

    PubMed

    Lee, Hyeong-Woo; Moon, Sung-Ung; Ryu, Hye-Sun; Kim, Yeon-Joo; Cho, Shin-Hyeong; Chung, Gyung-Tae; Lin, Khin; Na, Byoung-Kuk; Kong, Yoon; Chung, Kyung-Suk; Kim, Tong-Soo

    2006-03-01

    In order to develop tools for an early serodiagnosis of Plasmodium falciparum infection, we evaluated the usefulness of P. falciparum liver stage antigen-3 (LSA-3) as a serodiagnostic antigen. A portion of LSA-3 gene was cloned, and its recombinant protein (rLSA-3) was expressed in Escherichia coli and purified by column chromatography. The purified rLSA-3 and 120 test blood/serum samples collected from inhabitants in malaria-endemic areas of Mandalay, Myanmar were used for this study. In microscopic examinations of blood samples, P. falciparum positive rate was 39.1% (47/120) in thin smear trials, and 33.3% (40/120) in thick smear trials. Although the positive rate associated with the rLSA-3 (30.8%) was lower than that of the blood stage antigens (70.8%), rLSA-3 based enzyme-linked immunosorbent assay could detect 12 seropositive cases (10.0%), in which blood stage antigens were not detected. These results indicate that the LSA-3 is a useful antigen for an early serodiagnosis of P. falciparum infection.

  11. Exposure of the snail Potamopyrgus antipodarum to herbicide boosts output and survival of parasite infective stages.

    PubMed

    Hock, Sabrina D; Poulin, Robert

    2012-12-01

    Anthropogenic stressors such as pollutants can modulate levels of parasitic infections in aquatic animals by suppressing host immunity or through some other mechanisms. One such mechanism could involve increases in either the quantity or quality of infective stages produced by parasites. We investigated the effect of exposure of infected snails, Potamopyrgus antipodarum, to different concentrations of the widely-used herbicide glyphosate, on (i) the production of infective cercariae by three trematode species, Coitocaecum parvum, Apatemon sp. and an undescribed renicolid, and (ii) the survival of cercariae of the latter species. For all three trematode species, infected snails exposed over a month to low (0.36 mg a.i. L(-1)) or medium (3.6 mg a.i. L(-1)) formulated glyphosate concentrations released between 1.5 and 3 times more cercariae per day than snails under control conditions. The similar pattern seen in all trematodes suggests a general weakening of the host benefiting any of its parasites rather than some parasite species-specific mechanism. In addition, the survival of renicolid cercariae improved with increasing glyphosate concentrations, with cercariae living about 50% longer in the medium concentration (3.6 mg a.i. L(-1)) than in control conditions. Our results demonstrate a clear interaction between glyphosate pollution and parasitism by trematodes in freshwater systems, occurring at glyphosate concentrations recorded in aquatic habitats, and within the environmental exposure limit allowed in New Zealand freshwaters. Future risk assessments and toxicity tests need to consider indirect impacts resulting from infections to invertebrate and vertebrate species penetrated by cercariae and serving as second intermediate hosts of trematodes.

  12. End-Stage Renal Disease Among HIV-Infected Adults in North America

    PubMed Central

    Abraham, Alison G.; Althoff, Keri N.; Jing, Yuezhou; Estrella, Michelle M.; Kitahata, Mari M.; Wester, C. William; Bosch, Ronald J.; Crane, Heidi; Eron, Joseph; Gill, M. John; Horberg, Michael A.; Justice, Amy C.; Klein, Marina; Mayor, Angel M.; Moore, Richard D.; Palella, Frank J.; Parikh, Chirag R.; Silverberg, Michael J.; Golub, Elizabeth T.; Jacobson, Lisa P.; Napravnik, Sonia; Lucas, Gregory M.; Kirk, Gregory D.; Benson, Constance A.; Bosch, Ronald J.; Collier, Ann C.; Boswell, Stephen; Grasso, Chris; Mayer, Ken; Hogg, Robert S.; Harrigan, Richard; Montaner, Julio; Cescon, Angela; Brooks, John T.; Buchacz, Kate; Gebo, Kelly A.; Moore, Richard D.; Moore, Richard D.; Carey, John T.; Rodriguez, Benigno; Horberg, Michael A.; Silverberg, Michael J.; Thorne, Jennifer E.; Goedert, James J.; Jacobson, Lisa P.; Klein, Marina B.; Rourke, Sean B.; Burchell, Ann; Rachlis, Anita R.; Hunter-Mellado, Robert F.; Mayor, Angel M.; Gill, M. John; Deeks, Steven G.; Martin, Jeffrey N.; Saag, Michael S.; Mugavero, Michael J.; Willig, James; Eron, Joseph J.; Napravnik, Sonia; Kitahata, Mari M.; Crane, Heidi M.; Justice, Amy C.; Dubrow, Robert; Fiellin, David; Sterling, Timothy R.; Haas, David; Bebawy, Sally; Turner, Megan; Gange, Stephen J.; Anastos, Kathryn; Moore, Richard D.; Saag, Michael S.; Gange, Stephen J.; Althoff, Keri N.; Kitahata, Mari M.; McKaig, Rosemary G.; Justice, Amy C.; Freeman, Aimee M.; Moore, Richard D.; Freeman, Aimee M.; Lent, Carol; Kitahata, Mari M.; Van Rompaey, Stephen E.; Crane, Heidi M.; Webster, Eric; Morton, Liz; Simon, Brenda; Gange, Stephen J.; Althoff, Keri N.; Abraham, Alison G.; Lau, Bryan; Zhang, Jinbing; Jing, Jerry; Golub, Elizabeth; Modur, Shari; Hanna, David B.; Rebeiro, Peter; Wong, Cherise; Mendes, Adell

    2015-01-01

    Background. Human immunodeficiency virus (HIV)-infected adults, particularly those of black race, are at high-risk for end-stage renal disease (ESRD), but contributing factors are evolving. We hypothesized that improvements in HIV treatment have led to declines in risk of ESRD, particularly among HIV-infected blacks. Methods. Using data from the North American AIDS Cohort Collaboration for Research and Design from January 2000 to December 2009, we validated 286 incident ESRD cases using abstracted medical evidence of dialysis (lasting >6 months) or renal transplant. A total of 38 354 HIV-infected adults aged 18–80 years contributed 159 825 person-years (PYs). Age- and sex-standardized incidence ratios (SIRs) were estimated by race. Poisson regression was used to identify predictors of ESRD. Results. HIV-infected ESRD cases were more likely to be of black race, have diabetes mellitus or hypertension, inject drugs, and/or have a prior AIDS-defining illness. The overall SIR was 3.2 (95% confidence interval [CI], 2.8–3.6) but was significantly higher among black patients (4.5 [95% CI, 3.9–5.2]). ESRD incidence declined from 532 to 303 per 100 000 PYs and 138 to 34 per 100 000 PYs over the time period for blacks and nonblacks, respectively, coincident with notable increases in both the prevalence of viral suppression and the prevalence of ESRD risk factors including diabetes mellitus, hypertension, and hepatitis C virus coinfection. Conclusions. The risk of ESRD remains high among HIV-infected individuals in care but is declining with improvements in virologic suppression. HIV-infected black persons continue to comprise the majority of cases, as a result of higher viral loads, comorbidities, and genetic susceptibility. PMID:25409471

  13. End-stage renal disease among HIV-infected adults in North America.

    PubMed

    Abraham, Alison G; Althoff, Keri N; Jing, Yuezhou; Estrella, Michelle M; Kitahata, Mari M; Wester, C William; Bosch, Ronald J; Crane, Heidi; Eron, Joseph; Gill, M John; Horberg, Michael A; Justice, Amy C; Klein, Marina; Mayor, Angel M; Moore, Richard D; Palella, Frank J; Parikh, Chirag R; Silverberg, Michael J; Golub, Elizabeth T; Jacobson, Lisa P; Napravnik, Sonia; Lucas, Gregory M

    2015-03-15

    Human immunodeficiency virus (HIV)-infected adults, particularly those of black race, are at high-risk for end-stage renal disease (ESRD), but contributing factors are evolving. We hypothesized that improvements in HIV treatment have led to declines in risk of ESRD, particularly among HIV-infected blacks. Using data from the North American AIDS Cohort Collaboration for Research and Design from January 2000 to December 2009, we validated 286 incident ESRD cases using abstracted medical evidence of dialysis (lasting >6 months) or renal transplant. A total of 38 354 HIV-infected adults aged 18-80 years contributed 159 825 person-years (PYs). Age- and sex-standardized incidence ratios (SIRs) were estimated by race. Poisson regression was used to identify predictors of ESRD. HIV-infected ESRD cases were more likely to be of black race, have diabetes mellitus or hypertension, inject drugs, and/or have a prior AIDS-defining illness. The overall SIR was 3.2 (95% confidence interval [CI], 2.8-3.6) but was significantly higher among black patients (4.5 [95% CI, 3.9-5.2]). ESRD incidence declined from 532 to 303 per 100 000 PYs and 138 to 34 per 100 000 PYs over the time period for blacks and nonblacks, respectively, coincident with notable increases in both the prevalence of viral suppression and the prevalence of ESRD risk factors including diabetes mellitus, hypertension, and hepatitis C virus coinfection. The risk of ESRD remains high among HIV-infected individuals in care but is declining with improvements in virologic suppression. HIV-infected black persons continue to comprise the majority of cases, as a result of higher viral loads, comorbidities, and genetic susceptibility. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. A transgenic animal with antiviral properties that might inhibit multiple stages of infection.

    PubMed

    Jiang, Liang; Zhao, Ping; Cheng, Tingcai; Sun, Qiang; Peng, Zhengwen; Dang, Yinghui; Wu, Xiangwei; Wang, Genhong; Jin, Shengkai; Lin, Ping; Xia, Qingyou

    2013-05-01

    Bombyx mori nucleopolyhedrovirus (BmNPV) is the primary pathogen of silkworms, causing severe economic losses in sericulture. To create antiviral silkworm strains, we constructed a transgenic vector in which the dsRNA for five tandem BmNPV genes was controlled by the BmNPV hr3 enhancer and IE1 promoter. The antivirus gene Bmlipase-1 was driven by B. mori midgut-specific promoter P2. Transgenic strains (SW-H) were generated via embryo microinjection using the practical silkworm strain SW. After infection with a high dose of BmNPV, the survival rates of SW-H and non-transgenic SW were 64% and 13%, respectively. SW-H could be the first transgenic animal that is highly antiviral and that might inhibit the virus at multiple stages of infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Magnetic separation of malaria-infected red blood cells in various developmental stages.

    PubMed

    Nam, Jeonghun; Huang, Hui; Lim, Hyunjung; Lim, Chaeseung; Shin, Sehyun

    2013-08-06

    Malaria is a serious disease that threatens the public health, especially in developing countries. Various methods have been developed to separate malaria-infected red blood cells (i-RBCs) from blood samples for clinical diagnosis and biological and epidemiological research. In this study, we propose a simple and label-free method for separating not only late-stage but also early-stage i-RBCs on the basis of their paramagnetic characteristics due to the malaria byproduct, hemozoin, by using a magnetic field gradient. A polydimethylsiloxane (PDMS) microfluidic channel was fabricated and integrated with a ferromagnetic wire fixed on a glass slide. To evaluate the performance of the microfluidic device containing the ferromagnetic wire, lateral displacement of NaNO2-treated RBCs, which also have paramagnetic characteristics, was observed at various flow rates. The results showed excellent agreement with theoretically predicted values. The same device was applied to separate i-RBCs. Late-stage i-RBCs (trophozoites and schizonts), which contain optically visible black dots, were separated with a recovery rate of approximately 98.3%. In addition, using an optimal flow rate, early-stage (ring-stage) i-RBCs, which had been difficult to separate because of their low paramagnetic characteristics, were successfully separated with a recovery rate of 73%. The present technique, using permanent magnets and ferromagnetic wire in a microchannel, can effectively separate i-RBCs in various developmental stages so that it could provide a potential tool for studying the invasion mechanism of the malarial parasite, as well as performing antimalarial drug assays.

  16. Titanium-copper-nitride coated spacers for two-stage revision of infected total hip endoprostheses.

    PubMed

    Ellenrieder, Martin; Haenle, Maximilian; Lenz, Robert; Bader, Rainer; Mittelmeier, Wolfram

    2011-01-01

    Within the first two years after total hip arthroplasty implant-associated infection has become the second most common reason for a revision surgery. Two-stage implant exchange is frequently conducted using temporary spacers made of antibiotic-loaded cement in order to prevent a bacterial colonization on the spacer. Avoiding several disadvantages of cement spacers, a conventional hemi-endoprosthesis was equipped with a copper-containing implant coating for inhibition of bacterial biofilms. In the present paper details of this novel treatment concept are presented including a case report.

  17. Titanium-copper-nitride coated spacers for two-stage revision of infected total hip endoprostheses

    PubMed Central

    Ellenrieder, Martin; Haenle, Maximilian; Lenz, Robert; Bader, Rainer; Mittelmeier, Wolfram

    2011-01-01

    Within the first two years after total hip arthroplasty implant-associated infection has become the second most common reason for a revision surgery. Two-stage implant exchange is frequently conducted using temporary spacers made of antibiotic-loaded cement in order to prevent a bacterial colonization on the spacer. Avoiding several disadvantages of cement spacers, a conventional hemi-endoprosthesis was equipped with a copper-containing implant coating for inhibition of bacterial biofilms. In the present paper details of this novel treatment concept are presented including a case report. PMID:22242097

  18. Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease.

    PubMed

    Moltó, José; Graterol, Fredzzia; Miranda, Cristina; Khoo, Saye; Bancu, Ioana; Amara, Alieu; Bonjoch, Anna; Clotet, Bonaventura

    2016-04-01

    Data on dolutegravir removal by hemodialysis are lacking. To study this, we measured dolutegravir plasma concentrations in samples of blood entering and leaving the dialyzer and of the resulting dialysate from 5 HIV-infected patients with end-stage renal disease. The median dolutegravir hemodialysis extraction ratio was 7%. The dolutegravir concentrations after the dialysis session remained far above the protein-binding-adjusted inhibitory concentration. Our results show minimal dolutegravir removal by hemodialysis, with no specific dolutegravir dosage adjustments required in this setting. (This study is registered at ClinicalTrials.gov under registration number NCT02487706.). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease

    PubMed Central

    Graterol, Fredzzia; Miranda, Cristina; Khoo, Saye; Bancu, Ioana; Amara, Alieu; Bonjoch, Anna; Clotet, Bonaventura

    2016-01-01

    Data on dolutegravir removal by hemodialysis are lacking. To study this, we measured dolutegravir plasma concentrations in samples of blood entering and leaving the dialyzer and of the resulting dialysate from 5 HIV-infected patients with end-stage renal disease. The median dolutegravir hemodialysis extraction ratio was 7%. The dolutegravir concentrations after the dialysis session remained far above the protein-binding-adjusted inhibitory concentration. Our results show minimal dolutegravir removal by hemodialysis, with no specific dolutegravir dosage adjustments required in this setting. (This study is registered at ClinicalTrials.gov under registration number NCT02487706.) PMID:26856824

  20. Exogenous and endogenous stages of Eimeria perforans naturally infected domestic rabbit (Oryctolagus cuniculus) in Saudi Arabia: Light microscopic study

    PubMed Central

    Al-Quraishy, Saleh

    2011-01-01

    Exogenous and endogenous stages of Eimeria perforans naturally infected rabbits in Saudi Arabia were described. The prevalence of infection was 75%. Oocysts were ovoid to elliptical and measured 16 × 10 μm. The four dizoic sporocysts were ovoid and measured 7 × 5 μm. Endogenous stages were restricted to the duodenum. Meronts, microgamonts, macrogamonts and young oocysts were recorded and described. PMID:23961159

  1. One-stage treatment of deep infection following repair of Achilles tendon rupture with flexor hallucis longus transfer.

    PubMed

    Lee, Kang; Moon, Jeong Seok; Seo, Jeong Gook; Lee, Woo Chun

    2009-03-01

    We present one-stage treatment of deep infection following repair of Achilles tendon rupture using flexor hallucis longus transfer. Flexor hallucis longus was used not only to connect the defect in Achillles tendon, but also to control the soft tissue infection with its abundant blood supply, simultaneously. The clinical results for the two patients in this report were excellent without major complication.

  2. Immunization of broiler chicks by in ovo injection of infective stages of Eimeria.

    PubMed

    Weber, F H; Genteman, K C; LeMay, M A; Lewis, D O; Evans, N A

    2004-03-01

    Immunization of chickens by in ovo injection of infective stages of 5 species of Eimeria was investigated. Fertile Hubbard x Petersen broiler chicken eggs were injected through the air cell on d 18 of incubation with oocysts of E. acervulina, E. maxima, E. mitis, E. praecox, or E. brunetti. Injected doses of all species ranged from 1 x 10(2) to 1 x 10(6) sporulated oocysts per egg. Chicks receiving oocysts in ovo shed oocysts posthatch. After 2 wk in wire-floored cages, birds were given a challenge infection with the homologous Eimeria species. Chicks immunized by in ovo injection of oocysts had significantly reduced lesion scores, improved weight gain, or reduced oocyst output compared with their nonimmunized counterparts. In additional studies, eggs were injected with 1 x 10(5) sporozoites of E. tenella, E. maxima, or E. acervulina per egg. Sporozoites of E. acervulina were not infective for chick embryos when administered in phosphate-buffered saline, but if sporozoites were suspended in tissue culture medium when injected in ovo, hatched chicks shed oocysts with peak output occurring 3 to 4 d posthatch. Sporozoites of E. maxima and E. tenella were infective for 18-d-old embryos regardless of the vehicle. The results demonstrate that immunization of broiler chickens against several species of coccidia by in ovo injection of oocysts is feasible. The infectivity of sporozoites for 18-d-old chick embryos varied depending on the species of Eimeria and the vehicle in which the sporozoites were suspended prior to injection.

  3. The impact of patellar resurfacing in two-stage revision of the infected total knee arthroplasty.

    PubMed

    Glynn, Aaron; Huang, Ronald; Mortazavi, Javad; Parvizi, Javad

    2014-07-01

    Evidence for optimal management of the patellofemoral joint in revision surgery for the infected TKA is limited. We reviewed 69 infected TKAs undergoing two-stage revision. Fifty four patellae were resurfaced, 11 had patelloplasty performed, two were augmented with trabecular metal, one had impaction grafting, and one knee underwent patellectomy. Average follow-up was 4.5 years. The patients that received patellar resurfacing at re-implantation experienced statistically significant improvements in KSS pain score, functional KSS, and patellar score (P < 0.03). One further patient treated with impaction grafting improved significantly in terms of pain and function. Patients treated with patelloplasty, trabecular metal augmentation, or patellectomy did not have significant improvements in clinical or functional outcome. Patient age, use of dynamic vs. static spacer, use of extensor mechanism release, and differences in Charlson index did not seem to statistically affect outcome. We recommend that every effort should be made to minimize patellar bone loss in first stage resection, as inability to resurface the patella at time of reimplantation may adversely affect patient outcome.

  4. Potential gingival crevicular fluid and serum biomarkers by stage of HIV infection.

    PubMed

    Elizondo, Jesús Eduardo; Rocha-Pizaña, María Del Refugio; Treviño, Ana Cecilia; Violant, Deborah; Álvarez, Mario Moisés; Rivas-Estilla, Ana María

    2017-03-01

    This study evaluates the potential of gingival crevicular fluid and serum cytokines as HIV stage biomarkers. Gingival crevicular fluid (GCF) and serum samples from 78 HIV-positive adult male subjects (cases) and 39 HIV-negative male subjects (controls) from Mexico were examined for 17 cytokines using multiplex ELISA. Participants were divided into five subgroups by HIV stage of infection on age-specific CD4+ T-lymphocyte count and antiretroviral therapy (ART), and further correlated to the cytokine levels. GCF concentrations of IL-6, IL-7, IL-10, IL-12, G-CSF and MCP-1, as well as serum concentrations of IL-1β, IL-2 and IL-6 showed a statistically significant difference among subgroups. We found a significant effect size correlation on cytokines expression levels. Subjects who were not in ART showed significantly higher levels of some of the analyzed cytokines compared to the rest. We found that GCF IL-8 was a significant predictor for the Non-ART HIV status (p<0.05). We observed the same result for GCF G-CSF in the ART Short-term group and serum GM-CSF in the ART Long-term subgroup. Results indicate a high variability of GCF and serum cytokines concentrations and low frequency of their detection in different HIV/ART stages. However, within the limits of the present study, some GCF and serum cytokine concentrations correlate positively. Oral and periodontal innate immunity is affected by HIV viremia and ART. GCF IL-8, G-CSF, as well as serum IL-8, MCP-1 and GM-CSF may be useful biomarkers for the detection of disease presence and/or its severity due to HIV infection and ART use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. A cement spacer for two-stage revision of infected implants of the hip joint.

    PubMed

    Leunig, M; Chosa, E; Speck, M; Ganz, R

    1998-01-01

    We report the technical details and clinical results of twelve patients who had deep infections of implants in the hip joint and were treated by two-stage revision, using a gentamicin-loaded, hand-moulded cement spacer inserted for the period between resection and reimplantation arthroplasty. During management with the spacer, usually for 4 months, patients were almost free of pain and mobile with good leg control, spending 2/3 of the treatment period at home. Six of twelve spacers failed locally due to dislocation [5] or cement fracture [1], and more than two further episodes of surgery were required in 3 patients. Problems with dislocation of the spacer were significantly higher when the head to neck offset was lacking (P < 0.05) or when anchorage in the femoral shaft was poor. Nevertheless, infection after reimplantation arthroplasty did not occur by the time of follow-up (2.2 years). Based on these data, we consider that the use of the cement spacer is a promising approach to the treatment of complicated infections of the hip joint.

  6. Lipid droplet dynamics at early stages of Mycobacterium marinum infection in Dictyostelium.

    PubMed

    Barisch, Caroline; Paschke, Peggy; Hagedorn, Monica; Maniak, Markus; Soldati, Thierry

    2015-09-01

    Lipid droplets exist in virtually every cell type, ranging not only from mammals to plants, but also to eukaryotic and prokaryotic unicellular organisms such as Dictyostelium and bacteria. They serve among other roles as energy reservoir that cells consume in times of starvation. Mycobacteria and some other intracellular pathogens hijack these organelles as a nutrient source and to build up their own lipid inclusions. The mechanisms by which host lipid droplets are captured by the pathogenic bacteria are extremely poorly understood. Using the powerful Dictyostelium discoideum/Mycobacterium marinum infection model, we observed that, immediately after their uptake, lipid droplets translocate to the vicinity of the vacuole containing live but not dead mycobacteria. Induction of lipid droplets in Dictyostelium prior to infection resulted in a vast accumulation of neutral lipids and sterols inside the bacterium-containing compartment. Subsequently, under these conditions, mycobacteria accumulated much larger lipid inclusions. Strikingly, the Dictyostelium homologue of perilipin and the murine perilipin 2 surrounded bacteria that had escaped to the cytosol of Dictyostelium or microglial BV-2 cells respectively. Moreover, bacterial growth was inhibited in Dictyostelium plnA knockout cells. In summary, our results provide evidence that mycobacteria actively manipulate the lipid metabolism of the host from very early infection stages.

  7. Tantalum acetabular augments in one-stage exchange of infected total hip arthroplasty: a case-control study.

    PubMed

    Klatte, Till Orla; Kendoff, Daniel; Sabihi, Reza; Kamath, Atul F; Rueger, Johannes M; Gehrke, Thorsten

    2014-07-01

    During the one-stage exchange procedure for periprosthetic joint infection (PJI) after total hip arthroplasty (THA), acetabular defects challenge reconstructive options. Porous tantalum augments are an established tool for addressing acetabular destruction in aseptic cases, but their utility in septic exchange is unknown. This retrospective case-control study presents the initial results of tantalum augmentation during one-stage exchange for PJI. Primary endpoints were rates of re-infection and short-term complications associated with this technique. Study patients had no higher risk of re-infection with equivalent durability at early follow-up with a re-infection rate in both groups of 4%. In conclusion, tantalum augments are a viable option for addressing acetabular defects in one-stage exchange for septic THA. Further study is necessary to assess long-term durability when compared to traditional techniques for acetabular reconstruction. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Epauletted fruit bats display exceptionally high infections with a Hepatocystis species complex in South Sudan.

    PubMed

    Schaer, Juliane; Perkins, Susan L; Ejotre, Imran; Vodzak, Megan E; Matuschewski, Kai; Reeder, DeeAnn M

    2017-07-31

    Hepatocystis parasites are closely related to mammalian Plasmodium species, the causative agents of malaria. Despite the close phylogenetic relationship, Hepatocystis parasites lack the intermittent erythrocytic replication cycles, the signature and exclusive cause of malaria-related morbidity and mortality. Hepatocystis population expansion in the mammalian host is thought to be restricted to the pre-erythrocytic liver phase. Complete differentiation of first generation blood stages into sexual stages for subsequent vector transmission indicates alternative parasite/host co-evolution. In this study, we identified a region of exceptionally high prevalence of Hepatocystis infections in Old World fruit bats in South Sudan. Investigations over the course of five consecutive surveys revealed an average of 93 percent prevalence in four genera of African epauletted fruit bats. We observed a clear seasonal pattern and tolerance of high parasite loads in these bats. Phylogenetic analyses revealed several cryptic Hepatocystis parasite species and, in contrast to mammalian Plasmodium parasites, neither host specificity nor strong geographical patterns were evident. Together, our study provides evidence for Pan-African distribution and local high endemicity of a Hepatocystis species complex in Pteropodidae.

  9. One-stage or two-stage revision surgery for prosthetic hip joint infection--the INFORM trial: a study protocol for a randomised controlled trial.

    PubMed

    Strange, Simon; Whitehouse, Michael R; Beswick, Andrew D; Board, Tim; Burston, Amanda; Burston, Ben; Carroll, Fran E; Dieppe, Paul; Garfield, Kirsty; Gooberman-Hill, Rachael; Jones, Stephen; Kunutsor, Setor; Lane, Athene; Lenguerrand, Erik; MacGowan, Alasdair; Moore, Andrew; Noble, Sian; Simon, Joanne; Stockley, Ian; Taylor, Adrian H; Toms, Andrew; Webb, Jason; Whittaker, John-Paul; Wilson, Matthew; Wylde, Vikki; Blom, Ashley W

    2016-02-17

    Periprosthetic joint infection (PJI) affects approximately 1% of patients following total hip replacement (THR) and often results in severe physical and emotional suffering. Current surgical treatment options are debridement, antibiotics and implant retention; revision THR; excision of the joint and amputation. Revision surgery can be done as either a one-stage or two-stage operation. Both types of surgery are well-established practice in the NHS and result in similar rates of re-infection, but little is known about the impact of these treatments from the patient's perspective. The main aim of this randomised controlled trial is to determine whether there is a difference in patient-reported outcome measures 18 months after randomisation for one-stage or two-stage revision surgery. INFORM (INFection ORthopaedic Management) is an open, two-arm, multi-centre, randomised, superiority trial. We aim to randomise 148 patients with eligible PJI of the hip from approximately seven secondary care NHS orthopaedic units from across England and Wales. Patients will be randomised via a web-based system to receive either a one-stage revision or a two-stage revision THR. Blinding is not possible due to the nature of the intervention. All patients will be followed up for 18 months. The primary outcome is the WOMAC Index, which assesses hip pain, function and stiffness, collected by questionnaire at 18 months. Secondary outcomes include the following: cost-effectiveness, complications, re-infection rates, objective hip function assessment and quality of life. A nested qualitative study will explore patients' and surgeons' experiences, including their views about trial participation and randomisation. INFORM is the first ever randomised trial to compare two widely accepted surgical interventions for the treatment of PJI: one-stage and two-stage revision THR. The results of the trial will benefit patients in the future as the main focus is on patient-reported outcomes: pain, function

  10. Effect of different stages of Schistosoma mansoni infection on the parasite burden and immune response to Strongyloides venezuelensis in co-infected mice.

    PubMed

    de Rezende, Michelle Carvalho; Araújo, Emília Souza; Moreira, João Marcelo Peixoto; Rodrigues, Vanessa Fernandes; Rodrigues, Jailza Lima; Pereira, Cíntia A de Jesus; Negrão-Corrêa, Deborah

    2015-12-01

    Multiple schistosome and soil-transmitted nematode infections are frequently reported in human populations living in tropical areas of developing countries. In addition to exposure factors, the host immune response plays an important role in helminth control and morbidity in hosts with multiple infections; however, these aspects are difficult to evaluate in human populations. In the current study, female Swiss mice were simultaneously co-infected with Strongyloides venezuelensis and Schistosoma mansoni or infected with St. venezuelensis at 2, 4, or 14 weeks after Sc. mansoni infection. The simultaneously infected mice showed a similar parasite burden for St. venezuelensis compared with mono-infected mice. In contrast, there was a significant reduction of St. venezuelensis burden (primarily during the migration of the larvae) in mice that were previously infected with Sc. mansoni at the acute or chronic phase. Independent of the stage of Sc. mansoni infection, the St. venezuelensis co-infection was capable of inducing IL-4 production in the small intestine, increasing the IgE concentration in the serum and increasing eosinophilia in the lungs and intestine. This result suggests that the nematode infection stimulates local type 2 immune responses independently of the schistosomiasis stage. Moreover, previous Sc. mansoni infection stimulated early granulocyte infiltration in the lungs and trematode-specific IgM and IgG1 production that recognized antigens from St. venezuelensis infective larvae; these immune responses would act in the early control of St. venezuelensis larvae. Our data suggest that the effect of multiple helminth infections on host susceptibility and morbidity largely depends on the species of parasite and the immune response.

  11. Identification of regulated proteins in naked barley grains (Hordeum vulgare nudum) after Fusarium graminearum infection at different grain ripening stages.

    PubMed

    Trümper, Christina; Paffenholz, Katrin; Smit, Inga; Kössler, Philip; Karlovsky, Petr; Braun, Hans-Peter; Pawelzik, Elke

    2016-02-05

    We analyzed the effect of Fusarium graminearum infection on field-grown naked barley (Hordeum vulgare nudum). The ears were inoculated with F. graminearum spores during anthesis. In the course of ripening, grains in five phenological growth stages of naked barley from milk ripe to plant death were sampled. The albumin and globulin proteins of inoculated grains and untreated (control) grains were separated by two-dimensional gel electrophoresis. Forty-five spots composing of proteins that were changed in abundance due to F. graminearum infection were subsequently identified by mass spectrometry. Various proteins showing altered expression pattern after Fusarium infection were linked to stress response such as plant signal transduction pathways, fungal defense and oxidative burst. More proteins changed during early grain ripening stages than during later ripening stages. Protease inhibitors occurred at increased abundancy during milk ripe stage. A thaumatin-like protein accumulated at plant death stage. Proteins linked to nitrogen metabolism and protein biosynthesis were mainly reduced, whereas those linked to carbon metabolism were predominantly increased in infected grains. Fusarium graminearum infection can lead to significant contamination of grains with mycotoxins. With this 2D-based proteomics study we give an insight into plant–pathogen interactions between the non-model plant naked barley and the fungus F. graminearum during five stages of grain development. Over the multiple developmental stages we observed specific patterns of changes induced by the fungus: the primary plant metabolism and inhibition of fungal protease were predominantly affected during early grain development stages. During the entire grain development we found an induced accumulation of thaumatin-like proteins due to the fungal infection indicating their fundamental role for naked barley defense.

  12. [Lymphocytic alveolitis in the early stages of HIV infection: correlation with biological and prognostic factors].

    PubMed

    Quint, L; Autran, B; Guillon, J M; Parrot, A; Denis, M; Debre, P; Mayaud, C M; Akoun, G M

    1992-01-01

    Broncho-alveolar lavage was performed to assess the degree of pulmonary lymphocytic alveolitis in 32 asymptomatic patients who were infected with the Human Immunodeficiency Virus (VIH). The patients were stages II and III of the CDC classification and the aim of the study was to determine the frequency, nature and prognostic role of the findings. 62.5% of the subjects (20/32) presented with a lymphocytic alveolitis which consisted predominantly of CD8 lymphocyte (64.3 +/- 3.5%), in the absence of an opportunistic infection or broncho-pulmonary tumours. Two sub-populations of alveolar CD8 were shown at comparable levels, a) sub-population CD8+D44+ (22.1 +/- 5%), in whom we showed the possession of cytotoxic activity in particular specific for VIH; b) sub-population CD8+CD57+ (19.6 +/- 3%) which we have shown to be capable in vitro of inhibiting the effector phase of cytotoxic activity of CD8+D44+ alveolar cells specific for VIH. In this group of 32 patients the occurrence of an alveolitis was not correlated with the usual prognostic factors of infection by VIH measured simultaneously with broncho-alveolar lavage (the level of CD4+ blood lymphocytes, and the beta 2-plasma microglobulins and the presence of p24 antigenaemia). In addition the level of CD4 lymphocytes supperior to 400/mm3 and of beta 2-microglobulins less then 3 mg/l whether a lymphocytic alveolitis was there or not confirmed the relatively poorly developed state of the VIH infection in these asymptomatic patients. Also the occurrence of a lymphocytic alveolitis did not seem to be linked to progression of the disease in the group of patients studied.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Nocardia prosthetic knee infection successfully treated by one-stage exchange: case report and review.

    PubMed

    Laurent, F; Rodriguez-Villalobos, H; Cornu, O; Vandercam, B; Yombi, J C

    2015-08-01

    A 64-year-old man with a history of sarcoidosis on corticosteroids and azathioprine was admitted to our hospital with complaints of worsening left knee pain and swelling for the past 3 weeks. His past medical history is also significant for severe osteoarthritis requiring a cemented total left knee arthroplasty 1 year ago. Diagnostic investigation during his hospital admission eventually led to the diagnosis of Nocardia nova knee prosthetic joint infection in the setting of a disseminated nocardiosis. He was successful treated by one-stage complete hardware exchange in conjunction with an adapted antibiotic therapy regimen (meropenem and doxycycline followed by ceftriaxone and doxycycline). Two years later, his recovery was deemed excellent.

  14. Microbiomes associated with infective stages of root-knot and lesion nematodes in soil.

    PubMed

    Elhady, Ahmed; Giné, Ariadna; Topalovic, Olivera; Jacquiod, Samuel; Sørensen, Søren J; Sorribas, Francisco Javier; Heuer, Holger

    2017-01-01

    Endoparasitic root-knot (Meloidogyne spp.) and lesion (Pratylenchus spp.) nematodes cause considerable damage in agriculture. Before they invade roots to complete their life cycle, soil microbes can attach to their cuticle or surface coat and antagonize the nematode directly or by induction of host plant defenses. We investigated whether the nematode-associated microbiome in soil differs between infective stages of Meloidogyne incognita and Pratylenchus penetrans, and whether it is affected by variation in the composition of microbial communities among soils. Nematodes were incubated in suspensions of five organically and two integrated horticultural production soils, recovered by sieving and analyzed for attached bacteria and fungi after washing off loosely adhering microbes. Significant effects of the soil type and nematode species on nematode-associated fungi and bacteria were revealed as analyzed by community profiling using denaturing gradient gel electrophoresis. Attached microbes represented a small specific subset of the soil microbiome. Two organic soils had very similar bacterial and fungal community profiles, but one of them was strongly suppressive towards root-knot nematodes. They were selected for deep amplicon sequencing of bacterial 16S rRNA genes and fungal ITS. Significant differences among the microbiomes associated with the two species in both soils suggested specific surface epitopes. Among the 28 detected bacterial classes, Betaproteobacteria, Bacilli and Actinobacteria were the most abundant. The most frequently detected fungal genera were Malassezia, Aspergillus and Cladosporium. Attached microbiomes did not statistically differ between these two soils. However, Malassezia globosa and four fungal species of the family Plectosphaerellaceae, and the bacterium Neorhizobium galegae were strongly enriched on M. incognita in the suppressive soil. In conclusion, the highly specific attachment of microbes to infective stages of phytonematodes in

  15. Microbiomes associated with infective stages of root-knot and lesion nematodes in soil

    PubMed Central

    Elhady, Ahmed; Giné, Ariadna; Topalovic, Olivera; Jacquiod, Samuel; Sørensen, Søren J.; Sorribas, Francisco Javier

    2017-01-01

    Endoparasitic root-knot (Meloidogyne spp.) and lesion (Pratylenchus spp.) nematodes cause considerable damage in agriculture. Before they invade roots to complete their life cycle, soil microbes can attach to their cuticle or surface coat and antagonize the nematode directly or by induction of host plant defenses. We investigated whether the nematode-associated microbiome in soil differs between infective stages of Meloidogyne incognita and Pratylenchus penetrans, and whether it is affected by variation in the composition of microbial communities among soils. Nematodes were incubated in suspensions of five organically and two integrated horticultural production soils, recovered by sieving and analyzed for attached bacteria and fungi after washing off loosely adhering microbes. Significant effects of the soil type and nematode species on nematode-associated fungi and bacteria were revealed as analyzed by community profiling using denaturing gradient gel electrophoresis. Attached microbes represented a small specific subset of the soil microbiome. Two organic soils had very similar bacterial and fungal community profiles, but one of them was strongly suppressive towards root-knot nematodes. They were selected for deep amplicon sequencing of bacterial 16S rRNA genes and fungal ITS. Significant differences among the microbiomes associated with the two species in both soils suggested specific surface epitopes. Among the 28 detected bacterial classes, Betaproteobacteria, Bacilli and Actinobacteria were the most abundant. The most frequently detected fungal genera were Malassezia, Aspergillus and Cladosporium. Attached microbiomes did not statistically differ between these two soils. However, Malassezia globosa and four fungal species of the family Plectosphaerellaceae, and the bacterium Neorhizobium galegae were strongly enriched on M. incognita in the suppressive soil. In conclusion, the highly specific attachment of microbes to infective stages of phytonematodes in

  16. Type I Interferons Regulate Immune Responses in Humans with Blood-Stage Plasmodium falciparum Infection

    PubMed Central

    Montes de Oca, Marcela; Kumar, Rajiv; de Labastida Rivera, Fabian; Amante, Fiona H.; Sheel, Meru; Faleiro, Rebecca J.; Bunn, Patrick T.; Best, Shannon E.; Beattie, Lynette; Ng, Susanna S.; Edwards, Chelsea L.; Boyle, Glen M.; Price, Ric N.; Anstey, Nicholas M.; Loughland, Jessica R.; Burel, Julie; Doolan, Denise L.; Haque, Ashraful; McCarthy, James S.; Engwerda, Christian R.

    2016-01-01

    Summary The development of immunoregulatory networks is important to prevent disease. However, these same networks allow pathogens to persist and reduce vaccine efficacy. Here, we identify type I interferons (IFNs) as important regulators in developing anti-parasitic immunity in healthy volunteers infected for the first time with Plasmodium falciparum. Type I IFNs suppressed innate immune cell function and parasitic-specific CD4+ T cell IFNγ production, and they promoted the development of parasitic-specific IL-10-producing Th1 (Tr1) cells. Type I IFN-dependent, parasite-specific IL-10 production was also observed in P. falciparum malaria patients in the field following chemoprophylaxis. Parasite-induced IL-10 suppressed inflammatory cytokine production, and IL-10 levels after drug treatment were positively associated with parasite burdens before anti-parasitic drug administration. These findings have important implications for understanding the development of host immune responses following blood-stage P. falciparum infection, and they identify type I IFNs and related signaling pathways as potential targets for therapies or vaccine efficacy improvement. PMID:27705789

  17. Nonvirion Protein of Novirhabdovirus Suppresses Apoptosis at the Early Stage of Virus Infection

    PubMed Central

    Ammayappan, Arun; Vakharia, Vikram N.

    2011-01-01

    Viral hemorrhagic septicemia virus (VHSV) and infectious hematopoietic necrosis virus (IHNV) are members of the genus Novirhabdovirus within the Rhabdoviridae family, which can cause severe hemorrhagic disease in fresh- and saltwater fish worldwide. These viruses carry an additional nonvirion (NV) gene, which codes for the nonstructural NV protein that has been implicated to play a role in viral pathogenesis. To determine the precise biological function of this NV gene and its gene product, we generated NV-deficient and NV knockout recombinant VHSVs, using reverse genetics. Comparisons of the replication kinetics and markers for virus-induced apoptosis indicated that the NV-deficient and NV knockout mutant viruses induce apoptosis earlier in cell culture than the wild-type recombinant VHSV. These results suggest that the NV protein has an antiapoptotic function at the early stage of virus infection. Furthermore, we created a chimeric VHSV, in which the NV gene of VHSV was replaced by the IHNV NV gene, which was capable of suppressing apoptosis in cell culture. These results show that the NV protein of other members of Novirhabdovirus can restore the NV protein function. In this study, we also investigated the kinetics of VHSV replication during a single round of viral replication and examined the mechanism of VHSV-induced apoptosis. Our results show that VHSV infection induced caspases 3, 8 and 9 in cell culture. PMID:21653667

  18. Transcriptional dynamics of Phytophthora infestans during sequential stages of hemibiotrophic infection of tomato.

    PubMed

    Zuluaga, Andrea P; Vega-Arreguín, Julio C; Fei, Zhangjun; Ponnala, Lalit; Lee, Sang Jik; Matas, Antonio J; Patev, Sean; Fry, William E; Rose, Jocelyn K C

    2016-01-01

    Hemibiotrophic plant pathogens, such as the oomycete Phytophthora infestans, employ a biphasic infection strategy, initially behaving as biotrophs, where minimal symptoms are exhibited by the plant, and subsequently as necrotrophs, feeding on dead plant tissue. The regulation of this transition and the breadth of molecular mechanisms that modulate plant defences are not well understood, although effector proteins secreted by the pathogen are thought to play a key role. We examined the transcriptional dynamics of P. infestans in a compatible interaction with its host tomato (Solanum lycopersicum) at three infection stages: biotrophy; the transition from biotrophy to necrotrophy; and necrotrophy. The expression data suggest a tight temporal regulation of many pathways associated with the suppression of plant defence mechanisms and pathogenicity, including the induction of putative cytoplasmic and apoplastic effectors. Twelve of these were experimentally evaluated to determine their ability to suppress necrosis caused by the P. infestans necrosis-inducing protein PiNPP1.1 in Nicotiana benthamiana. Four effectors suppressed necrosis, suggesting that they might prolong the biotrophic phase. This study suggests that a complex regulation of effector expression modulates the outcome of the interaction.

  19. Coherent Brightfield Microscopy Provides the Spatiotemporal Resolution To Study Early Stage Viral Infection in Live Cells.

    PubMed

    Huang, Yi-Fan; Zhuo, Guan-Yu; Chou, Chun-Yu; Lin, Cheng-Hao; Chang, Wen; Hsieh, Chia-Lung

    2017-03-28

    Viral infection starts with a virus particle landing on a cell surface followed by penetration of the plasma membrane. Due to the difficulty of measuring the rapid motion of small-sized virus particles on the membrane, little is known about how a virus particle reaches an endocytic site after landing at a random location. Here, we use coherent brightfield (COBRI) microscopy to investigate early stage viral infection with ultrahigh spatiotemporal resolution. By detecting intrinsic scattered light via imaging-based interferometry, COBRI microscopy allows us to track the motion of a single vaccinia virus particle with nanometer spatial precision (<3 nm) in 3D and microsecond temporal resolution (up to 100,000 frames per second). We explore the possibility of differentiating the virus signal from cell background based on their distinct spatial and temporal behaviors via digital image processing. Through image postprocessing, relatively stationary background scattering of cellular structures is effectively removed, generating a background-free image of the diffusive virus particle for precise localization. Using our method, we unveil single virus particles exploring cell plasma membranes after attachment. We found that immediately after attaching to the membrane (within a second), the virus particle is locally confined within hundreds of nanometers where the virus particle diffuses laterally with a very high diffusion coefficient (∼1 μm(2)/s) at microsecond time scales. Ultrahigh-speed scattering-based optical imaging may provide opportunities for resolving rapid virus-receptor interactions with nanometer clarity.

  20. Host-cell sensors for Plasmodium activate innate immunity against liver-stage infection.

    PubMed

    Liehl, Peter; Zuzarte-Luís, Vanessa; Chan, Jennie; Zillinger, Thomas; Baptista, Fernanda; Carapau, Daniel; Konert, Madlen; Hanson, Kirsten K; Carret, Céline; Lassnig, Caroline; Müller, Mathias; Kalinke, Ulrich; Saeed, Mohsan; Chora, Angelo Ferreira; Golenbock, Douglas T; Strobl, Birgit; Prudêncio, Miguel; Coelho, Luis P; Kappe, Stefan H; Superti-Furga, Giulio; Pichlmair, Andreas; Vigário, Ana M; Rice, Charles M; Fitzgerald, Katherine A; Barchet, Winfried; Mota, Maria M

    2014-01-01

    Before they infect red blood cells and cause malaria, Plasmodium parasites undergo an obligate and clinically silent expansion phase in the liver that is supposedly undetected by the host. Here, we demonstrate the engagement of a type I interferon (IFN) response during Plasmodium replication in the liver. We identified Plasmodium RNA as a previously unrecognized pathogen-associated molecular pattern (PAMP) capable of activating a type I IFN response via the cytosolic pattern recognition receptor Mda5. This response, initiated by liver-resident cells through the adaptor molecule for cytosolic RNA sensors, Mavs, and the transcription factors Irf3 and Irf7, is propagated by hepatocytes in an interferon-α/β receptor-dependent manner. This signaling pathway is critical for immune cell-mediated host resistance to liver-stage Plasmodium infection, which we find can be primed with other PAMPs, including hepatitis C virus RNA. Together, our results show that the liver has sensor mechanisms for Plasmodium that mediate a functional antiparasite response driven by type I IFN.

  1. Neurocognitive Impairment Associated with Predominantly Early Stage HIV infection in Abuja, Nigeria

    PubMed Central

    Akolo, Christopher; Royal, Walter; Cherner, Mariana; Okwuasaba, Kanayo; Eyzaguirre, Lindsay; Adebiyi, Ruxton; Umlauf, Anya; Hendrix, Terence; Johnson, Joyce; Abimiku, Alashl’e; Blattner, William A.

    2014-01-01

    Detailed neuropsychological testing was performed on 134 HIV seropositive (SP) and 77 HIV seronegative (SN) individuals, 86% with early stage HIV infection in Nigeria, to determine the frequency of HIV-related neurocognitive impairment among the HIV-infected group. Twenty-two tests were administered to assess the following seven ability domains: speed of information processing (SIP); attention/working memory (AWM); executive functioning (EF); learning (LN); memory (MEM); verbal fluency (VF); and motor speed/dexterity (MSD). Demographically corrected individual test scores and scores for each domain or reflecting a global deficit (a global deficit score, or GDS) were compared for the SP and SN groups. SP participants were older, had fewer years of education, were more likely to be married, differed in ethnicity and had higher depression scores than SN individuals. On the testing, SP performed worse than SN on four tests that individually assessed LN, VF and MSD (the timed gait). SP subjects, however, performed better than SN on the finger-tapping test, also a motor task. Within the seven ability domains, SP performed worse than SN with respect to SIP, EF, LN, MEM and VF and also on the global measure. SP were also more frequently impaired on tests of SIP, and there was a borderline increase in the frequency of global impairment. Performance by SP subjects was not associated with CD4 counts. However, there were significant correlations between viral load measurements and individual tests of SIP, EF, LN and VF and with overall EF and a borderline correlation with the GDS. Depression scores for SP were associated with impairment on only a single test of EF. These results demonstrate that the ability of these assessments to identify areas of impairment that may be specifically linked to a history of HIV infection among individuals in Nigeria. Confirmation of these findings awaits analyses using data from a larger number of control subjects. PMID:24927825

  2. Ezrin Interacts with the SARS Coronavirus Spike Protein and Restrains Infection at the Entry Stage

    PubMed Central

    Millet, Jean Kaoru; Kien, François; Cheung, Chung-Yan; Siu, Yu-Lam; Chan, Wing-Lim; Li, Huiying; Leung, Hiu-Lan; Jaume, Martial; Bruzzone, Roberto; Malik Peiris, Joseph S.; Altmeyer, Ralf Marius; Nal, Béatrice

    2012-01-01

    Background Entry of Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and its envelope fusion with host cell membrane are controlled by a series of complex molecular mechanisms, largely dependent on the viral envelope glycoprotein Spike (S). There are still many unknowns on the implication of cellular factors that regulate the entry process. Methodology/Principal Findings We performed a yeast two-hybrid screen using as bait the carboxy-terminal endodomain of S, which faces the cytosol during and after opening of the fusion pore at early stages of the virus life cycle. Here we show that the ezrin membrane-actin linker interacts with S endodomain through the F1 lobe of its FERM domain and that both the eight carboxy-terminal amino-acids and a membrane-proximal cysteine cluster of S endodomain are important for this interaction in vitro. Interestingly, we found that ezrin is present at the site of entry of S-pseudotyped lentiviral particles in Vero E6 cells. Targeting ezrin function by small interfering RNA increased S-mediated entry of pseudotyped particles in epithelial cells. Furthermore, deletion of the eight carboxy-terminal amino acids of S enhanced S-pseudotyped particles infection. Expression of the ezrin dominant negative FERM domain enhanced cell susceptibility to infection by SARS-CoV and S-pseudotyped particles and potentiated S-dependent membrane fusion. Conclusions/Significance Ezrin interacts with SARS-CoV S endodomain and limits virus entry and fusion. Our data present a novel mechanism involving a cellular factor in the regulation of S-dependent early events of infection. PMID:23185364

  3. Screening of early antigen genes of adult-stage Trichinella spiralis using pig serum from different stages of early infection

    USDA-ARS?s Scientific Manuscript database

    The goal of this work was to identify novel, early antigens present in Trichinella spiralis. To this end, a cDNA library generated from 3-day old adult worms (Ad3) was immunologically screened using serum from a pig infected with 20,000 muscle larvae. The serum was obtained from multiple, time cours...

  4. Stage-specific activity in vitro on the Theileria infection process of serum from calves treated prophylactically with buparvaquone.

    PubMed

    Wilkie, G M; Kirvar, E; Thomas, E M; Sparagano, O; Brown, C G

    1998-12-31

    An in vitro method for testing activity of buparvaquone in serum on the infection and development of Theileria in its bovine host mononuclear cells is described and results compared with the effect exhibited in vivo. Serum samples were collected over a time course from calves in a clinical trial of 5 mg kg(-1) buparvaquone prophylaxis on Theileria annulata or T. parva experimental infection. To evaluate drug levels and persistence in each animal for a period of 14 days and its effect on the early infection stages, the sera were tested on established macroschizont infected cell lines and against the in vitro infection and development process of the sporozoite and trophozoite stages of the two Theileria species. Results from the in vitro assays show that buparvaquone in serum can completely prevent the establishment of Theileria infection during the first 48 h after administration at 5 mg kg(-1). After seven days, levels are sufficient to delay the establishment of infection. The drug is more effective in the prevention of the de novo development of the parasite in cells than against established macroschizont infected cell culture. At low concentrations, it is more effective against T. parva than against T. annulata. Drug effect peaks during the first 24 h but residual effect persists for 14 days, particularly against T. parva infection. These novel findings demonstrate how high doses of buparvaquone could over-protect calves if used in the 'infection-and-treatment' method of immunisation when drug is administered prophylactically at the same time as infection with live sporozoites. It is suggested that in certain high Theileria risk situations there may be potential for the immunoprophylactic use of buparvaquone without simultaneous infection. The in vitro assay itself has been shown to be of value as a model for Theileria establishment in cattle.

  5. The rodent malaria liver stage survives in the rapamycin-induced autophagosome of infected Hepa1–6 cells

    PubMed Central

    Zhao, Chenghao; Liu, Taiping; Zhou, Taoli; Fu, Yong; Zheng, Hong; Ding, Yan; Zhang, Kun; Xu, Wenyue

    2016-01-01

    It has been reported that non-selective autophagy of infected hepatocytes could facilitate the development of malaria in the liver stage, but the fate of parasites following selective autophagy of infected hepatocytes is still not very clear. Here, we confirmed that sporozoite infection can induce a selective autophagy-like process targeting EEFs (exo-erythrocytic forms) in Hepa1–6. Rapamycin treatment greatly enhanced this process in EEFs and non-selective autophagy of infected Hepa1-6 cells and enhanced the development of the malaria liver stage in vivo. Although rapamycin promoted the fusion of autophagosomes containing the malaria parasite with lysosomes, some parasites inside the autophagosome survived and replicated normally. Further study showed that the maturation of affected autolysosomes was greatly inhibited. Therefore, in addition to the previously described positive role of rapamycin-induced nonselective autophagy of hepatocytes, we provide evidence that the survival of EEFs in the autophagosome of the infected hepatocytes also contributes to rapamycin-enhanced development of the malaria liver stage, possibly due to the suppression of autolysosome maturation by EEFs. These data suggest that the inhibition of autolysosome maturation might be a novel escape strategy used by the malaria liver stage. PMID:27901110

  6. In vitro alterations do not reflect a requirement for host cell cycle progression during Plasmodium liver stage infection.

    PubMed

    Hanson, Kirsten K; March, Sandra; Ng, Shengyong; Bhatia, Sangeeta N; Mota, Maria M

    2015-01-01

    Prior to invading nonreplicative erythrocytes, Plasmodium parasites undergo their first obligate step in the mammalian host inside hepatocytes, where each sporozoite replicates to generate thousands of merozoites. While normally quiescent, hepatocytes retain proliferative capacity and can readily reenter the cell cycle in response to diverse stimuli. Many intracellular pathogens, including protozoan parasites, manipulate the cell cycle progression of their host cells for their own benefit, but it is not known whether the hepatocyte cell cycle plays a role during Plasmodium liver stage infection. Here, we show that Plasmodium parasites can be observed in mitotic hepatoma cells throughout liver stage development, where they initially reduce the likelihood of mitosis and ultimately lead to significant acquisition of a binucleate phenotype. However, hepatoma cells pharmacologically arrested in S phase still support robust and complete Plasmodium liver stage development, which thus does not require cell cycle progression in the infected cell in vitro. Furthermore, murine hepatocytes remain quiescent throughout in vivo infection with either Plasmodium berghei or Plasmodium yoelii, as do Plasmodium falciparum-infected primary human hepatocytes, demonstrating that the rapid and prodigious growth of liver stage parasites is accomplished independent of host hepatocyte cell cycle progression during natural infection.

  7. NK cells contribute to persistent airway inflammation and AHR during the later stage of RSV infection in mice.

    PubMed

    Long, Xiaoru; Xie, Jun; Zhao, Keting; Li, Wei; Tang, Wei; Chen, Sisi; Zang, Na; Ren, Luo; Deng, Yu; Xie, Xiaohong; Wang, Lijia; Fu, Zhou; Liu, Enmei

    2016-10-01

    RSV can lead to persistent airway inflammation and AHR and is intimately associated with childhood recurrent wheezing and asthma, but the underlying mechanisms remain unclear. There are high numbers of NK cells in the lung, which not only play important roles in the acute stage of RSV infection, but also are pivotal in regulating the pathogenesis of asthma. Therefore, in this study, we assumed that NK cells might contribute to persistent airway disease during the later stage of RSV infection. Mice were killed at serial time points after RSV infection to collect samples. Leukocytes in bronchoalveolar lavage fluid (BALF) were counted, lung histopathology was examined, and airway hyperresponsiveness (AHR) was measured by whole-body plethysmography. Cytokines were detected by ELISA, and NK cells were determined by flow cytometry. Rabbit anti-mouse asialo-GM-1 antibodies and resveratrol were used to deplete or suppress NK cells. Inflammatory cells in BALF, lung tissue damage and AHR were persistent for 60 days post-RSV infection. Type 2 cytokines and NK cells were significantly increased during the later stage of infection. When NK cells were decreased by the antibodies or resveratrol, type 2 cytokines, the persistent airway inflammation and AHR were all markedly reduced. NK cells can contribute to the RSV-associated persistent airway inflammation and AHR at least partially by promoting type 2 cytokines. Therefore, therapeutic targeting of NK cells may provide a novel approach to alleviating the recurrent wheezing subsequent to RSV infection.

  8. Association of Helicobacter pylori infection with chemotherapy-induced thrombocytopenia in patients with stage III colon cancer: a pilot study.

    PubMed

    Tanriverdi, Ozgur

    2014-01-01

    In this study, the effects of the pre-treatment presence of Helicobacter pylori (H. pylori) infection on chemotherapy-induced thrombocytopenia (CIT) were investigated in patients with stage III colon cancer (CC). A cohort of 74 patients with early stage CC was analysed through a review of clinical records and personal interviews. Helicobacter pylori infections were diagnosed in these patients prior to chemotherapy. The subjects were divided into two groups according to H. pylori infection status: Group 1, H. pylori-positive and Group 2, H. pylori-negative. In all patients, bone marrow toxicity and other study variables were compared. Helicobacter pylori infections were detected in 31 of the 74 CC patients. Helicobacter pylori-infected patients (Group 1) showed significantly higher incidences of CIT than did non-infected patients (Group 2; p = 0.029). Helicobacter pylori infection status correlated significantly with tumour location (r = 0.547; p = 0.043) and the most common location of CC in H. pylori-infected patients was the ascending colon (n = 13, 42%) in comparison to non-infected patients (n = 6, 14%; p= 0.042). The relationship between CIT and H. pylori infection status in CC was determined to be independent from the other study variables (p = 0.037; OR = 3.32, CI 95% = 1.16-9.70). In this study, the small number of patients resulted in an inadequate demonstration of the relationship between H. pylori infection and CIT. Therefore, clinical and molecular studies that include more patients are warranted.

  9. Malaria parasite-synthesized heme is essential in the mosquito and liver stages and complements host heme in the blood stages of infection.

    PubMed

    Nagaraj, Viswanathan Arun; Sundaram, Balamurugan; Varadarajan, Nandan Mysore; Subramani, Pradeep Annamalai; Kalappa, Devaiah Monnanda; Ghosh, Susanta Kumar; Padmanaban, Govindarajan

    2013-01-01

    Heme metabolism is central to malaria parasite biology. The parasite acquires heme from host hemoglobin in the intraerythrocytic stages and stores it as hemozoin to prevent free heme toxicity. The parasite can also synthesize heme de novo, and all the enzymes in the pathway are characterized. To study the role of the dual heme sources in malaria parasite growth and development, we knocked out the first enzyme, δ-aminolevulinate synthase (ALAS), and the last enzyme, ferrochelatase (FC), in the heme-biosynthetic pathway of Plasmodium berghei (Pb). The wild-type and knockout (KO) parasites had similar intraerythrocytic growth patterns in mice. We carried out in vitro radiolabeling of heme in Pb-infected mouse reticulocytes and Plasmodium falciparum-infected human RBCs using [4-(14)C] aminolevulinic acid (ALA). We found that the parasites incorporated both host hemoglobin-heme and parasite-synthesized heme into hemozoin and mitochondrial cytochromes. The similar fates of the two heme sources suggest that they may serve as backup mechanisms to provide heme in the intraerythrocytic stages. Nevertheless, the de novo pathway is absolutely essential for parasite development in the mosquito and liver stages. PbKO parasites formed drastically reduced oocysts and did not form sporozoites in the salivary glands. Oocyst production in PbALASKO parasites recovered when mosquitoes received an ALA supplement. PbALASKO sporozoites could infect mice only when the mice received an ALA supplement. Our results indicate the potential for new therapeutic interventions targeting the heme-biosynthetic pathway in the parasite during the mosquito and liver stages.

  10. Prevalence and intensity of infection with third stage larvae of Angiostrongylus cantonensis in mollusks from Northeast Thailand.

    PubMed

    Tesana, Smarn; Srisawangwong, Tuanchai; Sithithaworn, Paiboon; Laha, Thewarach; Andrews, Ross

    2009-06-01

    Prevalences and intensity of infection with Angiostrongylus cantonensis third stage larvae were examined in mollusks to determine whether they are potential intermediate hosts in eight provinces, northeast Thailand. Mollusk samples were collected from 24 reservoirs (3 reservoirs/province) in close to human cases during the previous year. Six out of 24 localities and 9 (3 new record species) out of 27 species were found with the infection. The highest intensity in infected species was found to be only one or two snails, whereas the majority had very low or no infection. The highest density was found in Pila pesmei and the lowest in Pila polita. The edible snails, P. polita, P. pesmei, and Hemiplecta distincta have the potential to transmit A. cantonensis to man. The varying density levels of larvae in infected snails may reflect observed variation in symptoms of people who traditionally eat a raw snail dish.

  11. Neurocognitive impairment associated with predominantly early stage HIV infection in Abuja, Nigeria.

    PubMed

    Akolo, Christopher; Royal, Walter; Cherner, Mariana; Okwuasaba, Kanayo; Eyzaguirre, Lindsay; Adebiyi, Ruxton; Umlauf, Anya; Hendrix, Terence; Johnson, Joyce; Abimiku, Alashl'e; Blattner, William A

    2014-08-01

    Detailed neuropsychological testing was performed on 133 human immunodeficiency virus (HIV) seropositive (SP) and 77 HIV seronegative (SN) individuals, 86 % with early stage HIV infection in Nigeria, to determine the frequency of HIV-related neurocognitive impairment among the HIV-infected group. The tests were administered to assess the following seven ability domains: speed of information processing, attention/working memory, executive functioning, learning, memory, verbal fluency, and motor function motor. Demographically corrected individual test scores and scores for each domain or reflecting a global deficit (a global deficit score, or GDS) were compared for the SP and SN groups. SP participants were older, had fewer years of education, were more likely to be married, differed in ethnicity, and had higher depression scores than SN individuals. Within the seven ability domains, SP performed worse than SN with respect to speed of information processing, executive function, learning, memory, and verbal fluency and also on the global measure. SP were also more frequently impaired on tests of SIP, and there was a borderline increase in the frequency of global impairment. On the individual tests, SP performed worse than SN on four tests that assessed learning, verbal fluency, memory, and motor function (the Timed Gait). SP subjects, however, performed better than SN on the Finger-tapping test, also a motor task. Performance by SP subjects was not associated on the timed gait which showed a borderline statistically significant correlation with CD4 counts. However, there were significant correlations between viral load measurements and individual tests of speed of information processing, executive function, learning, and verbal fluency and with overall executive function and a borderline correlation with the GDS. Depression scores for SP were associated with impairment on only a single test of executive function. These results demonstrate the ability of these

  12. Comparative susceptibility of larval stages of Amblyomma aureolatum, Amblyomma cajennense, and Rhipicephalus sanguineus to infection by Rickettsia rickettsii.

    PubMed

    Labruna, Marcelo B; Ogrzewalska, Maria; Martins, Thiago F; Pinter, Adriano; Horta, Maurício C

    2008-11-01

    The current study compared the susceptibility of larval stages of Amblyomma cajennense (F.), Amblyomma aureolatum (Pallas), and Rhipicephalus sanguineus (Latreille) to infection by a Brazilian strain of Rickettsia rickettsii. Guinea pigs experimentally infected by R. rickettsii were simultaneously infested by larvae of the three tick species. Recovered engorged larvae were allowed to molt to nymphs and held in an incubator at 23 degrees C and 85-90% RH. Subsequent flat nymphs were tested for rickettsial infection by polymerase chain reaction (PCR). Concomitant infestations with sibling ticks on noninfected guinea pigs (control) were done. While 10-60% of the A. cajennense nymphs were shown to be infected by R. rickettsii, both A. aureolatum and R. sanguineus were highly susceptible to R. rickettsii, since 80-100% of their nymphs were shown to be infected in the corresponding trials. Most of the engorged larvae (approximately 70-95%), regardless of being infected or not, successfully molted to nymphs. Mortality rates for engorged larvae tended to be statistically similar (P > 0.05) for ticks recovered from R. rickettsii-infected and noninfected guinea pigs, within each tick species. The only exceptions were the significantly higher mortalities (P < 0.05) for engorged A. cajennense larvae recovered from two infected guinea pigs. Therefore, A. cajennense was less susceptible to R. rickettsii infection than A. aureolatum and R. sanguineus, while feeding on rickettsemic guinea pigs. These two later species were similarly highly susceptible.

  13. Gamma-delta T cell responses in subclinical and clinical stages of Bovine Mycobacterium Avium Paratuberculosis infection

    USDA-ARS?s Scientific Manuscript database

    The early immune response to Mycobacterium avium subsp. paratuberculosis (MAP) in cattle is characterized by a Th1-like immune response effective in controlling bacterial proliferation during the subclinical stage of infection. In young calves nearly 60% of circulating lymphocytes are gamma delta T ...

  14. Revision of Infected Total Knee Arthroplasty: Two-Stage Reimplantation Using an Antibiotic-Impregnated Static Spacer

    PubMed Central

    Almeida, Fernando; Renovell, Pablo; Morante, Elena; López, Raúl

    2013-01-01

    Background A two-stage revision remains as the "gold standard" treatment for chronically infected total knee arthroplasties. Methods Forty-five septic knee prostheses were revised with a minimum follow-up of 5 years. Static antibiotic-impregnated cement spacers were used in all cases. Intravenous antibiotics according to sensitivity test of the culture were applied during patients' hospital stay. Oral antibiotics were given for another 5 weeks. Second-stage surgery was undertaken after control of infection with normal erythrocyte sedimentation rate and C-reactive protein values. Extensile techniques were used if needed and metallic augments were employed for bone loss in 32 femoral and 29 tibial revisions. Results The average interval between the first-stage resection and reimplantation was 4.4 months. Significant improvement was obtained with respect to visual analog scale pain and clinical and functional scores, and infection was eradicated in 95.6% of cases following a two-stage revision total knee arthroplasty. Radiographic evaluation showed suitable alignment without signs of mechanical loosening. Conclusions This technique is a reasonable procedure to eradicate chronic infection in knee arthroplasty and provides proper functional and clinical results. However, it sometimes requires extensile surgical approaches that could imply arduous surgeries. Metallic augments with cementless stems available in most of the knee revision systems are a suitable alternative to handle bone deficiencies, avoiding the use of bone allografts with its complications. PMID:24009903

  15. Radiolabeling of infective third-stage larvae of Strongyloides stercoralis by feeding ( sup 75 Se)selenomethionine-labeled Escherichia coli to first- and second-stage larvae

    SciTech Connect

    Aikens, L.M.; Schad, G.A. )

    1989-10-01

    A technique is described for radiolabeling Strongyloides stercoralis larvae with ({sup 75}Se)selenomethionine. Cultures of an auxotrophic methionine-dependent stain of Escherichia coli were grown in a medium containing Dulbecco's modified Eagle's medium supplemented with 5% nutrient broth, amino acids, and ({sup 75}Se)selenomethionine. When the {sup 75}Se-labeled bacterial populations were in the stationary phase of growth, cultures were harvested and the bacteria dispersed on agar plates to serve as food for S. stercoralis larvae. Use of nondividing bacteria is important for successful labeling because the isotope is not diluted by cell division and death of larvae attributable to overgrowth by bacteria is prevented. First-stage S. stercoralis larvae were recovered from feces of infected dogs and reared in humid air at 30 C on agar plates seeded with bacteria. After 7 days, infective third-stage larvae were harvested. The mean specific activity of 6 different batches of larvae ranged from 75 to 330 counts per min/larva with 91.8 +/- 9.5% of the population labeled sufficiently to produce an autoradiographic focus during a practicable, 6-wk period of exposure. Labeled infective larvae penetrated the skin of 10-day-old puppies and migrated to the small intestine, where the developed to adulthood.

  16. Generating a detailed protein profile of Fasciola hepatica during the chronic stage of infection in cattle.

    PubMed

    Haçarız, Orçun; Baykal, Ahmet Tarık; Akgün, Mete; Kavak, Pınar; Sağıroğlu, Mahmut Şamil; Sayers, Gearóid Patrick

    2014-06-01

    Fasciola hepatica is a trematode helminth causing a damaging disease, fasciolosis, in ruminants and humans. Comprehensive proteomic studies broaden our knowledge of the parasite's protein profile, and provide new insights into the development of more effective strategies to deal with fasciolosis. The objective of this study was to generate a comprehensive profile of F. hepatica proteins expressed during the chronic stage of infection in cattle by building on previous efforts in this area. The approach included an improved sample preparation procedure for surface and internal layers of the parasite, the application of nano-UPLC-ESI-qTOF-MS (nano-ultra-performance LC and ESI quadrupole TOF MS) integrated with different acquisition methods and in silico database search against various protein databases and a transcript database including a new assembly of publically available EST. Of a total of 776 identified proteins, 206 and 332 were specific to the surface and internal layers of the parasite, respectively. Furthermore, 238 proteins were common to both layers, with comparative differences of 172 proteins detected. Specific proteins not previously identified in F. hepatica, but shown to be immunomodulatory or potential drug targets for other parasites, are discussed.

  17. Investigation of sensitivity to microbial infection of diesel fuel at the refinery stage

    SciTech Connect

    Thomsen, E.S.; Petersen, S.

    1995-04-01

    In the practice of a company dealing with microbial problems of contaminated fuels, it was possible to use associations of microorganisms in research. These associations of {open_quotes}wild{close_quotes} microorganisms appeared successful in the environment of ship`s fuel tanks, causing severe problems at the consumer level. Fresh {open_quotes}raw{close_quotes} diesel fuel was treated with the cultures to investigate the sensitivity of the fuel to microbial contamination at the refinery stage. The fuel samples received from Danish refineries were specified as free of any additives or biocides. Before treatment the samples were tested for the presence of inhibiting substances or contamination. Samples of {open_quotes}raw{close_quotes} fuel were added at 1/10, 1/100 and 1/1000 of contaminated fuel, incubated at 27{degrees}C and observed for 14 days. Other samples were incubated at 5{degrees}C and combinations of periods at 5{degrees} and 27{degrees}C. In the absence of water or nutrients the contaminant did not appear to survive and colonize the {open_quotes}raw{close_quotes} fuel, although one sample did produce microbial growth in an order of magnitude corresponding to common definitions of fuel infections. The ability of the two relevant associations of {open_quotes}wild{close_quotes} microorganisms to contaminate the {open_quotes}raw{close_quotes} diesel fuel was not clearly demonstrated at this point.

  18. Inhibition of human coronavirus NL63 infection at early stages of the replication cycle.

    PubMed

    Pyrc, Krzysztof; Bosch, Berend Jan; Berkhout, Ben; Jebbink, Maarten F; Dijkman, Ronald; Rottier, Peter; van der Hoek, Lia

    2006-06-01

    Human coronavirus NL63 (HCoV-NL63), a recently discovered member of the Coronaviridae family, has spread worldwide and is associated with acute respiratory illness in young children and elderly and immunocompromised persons. Further analysis of HCoV-NL63 pathogenicity seems warranted, in particular because the virus uses the same cellular receptor as severe acute respiratory syndrome-associated coronavirus. As there is currently no HCoV-NL63-specific and effective vaccine or drug therapy available, we evaluated several existing antiviral drugs and new synthetic compounds as inhibitors of HCoV-NL63, targeting multiple stages of the replication cycle. Of the 28 compounds that we tested, 6 potently inhibited HCoV-NL63 at early steps of the replication cycle. Intravenous immunoglobulins, heptad repeat 2 peptide, small interfering RNA1 (siRNA1), siRNA2, beta-D-N(4)-hydroxycytidine, and 6-azauridine showed 50% inhibitory concentrations of 125 microg/ml, 2 microM, 5 nM, 3 nM, 400 nM, and 32 nM, respectively, and low 50% cytotoxicity concentrations (>10 mg/ml, >40 microM, >200 nM, >200 nM, >100 microM, and 80 microM, respectively). These agents may be investigated further for the treatment of coronavirus infections.

  19. Variation in infection prevention practices in dialysis facilities: results from the national opportunity to improve infection control in ESRD (End-Stage Renal Disease) project.

    PubMed

    Chenoweth, Carol E; Hines, Stephen C; Hall, Kendall K; Saran, Rajiv; Kalbfleisch, John D; Spencer, Teri; Frank, Kelly M; Carlson, Diane; Deane, Jan; Roys, Erik; Scholz, Natalie; Parrotte, Casey; Messana, Joseph M

    2015-07-01

    OBJECTIVE To observe patient care across hemodialysis facilities enrolled in the National Opportunity to Improve Infection Control in ESRD (end-stage renal disease) (NOTICE) project in order to evaluate adherence to evidence-based practices aimed at prevention of infection. SETTING AND PARTICIPANTS Thirty-four hemodialysis facilities were randomly selected from among 772 facilities in 4 end-stage renal disease participating networks. Facility selection was stratified on dialysis organization affiliation, size, socioeconomic status, and urban/rural status. MEASUREMENTS Trained infection control evaluators used an infection control worksheet to observe 73 distinct infection control practices at the hemodialysis facilities, from October 1, 2011, through January 31, 2012. RESULTS There was considerable variation in infection control practices across enrolled facilities. Overall adherence to recommended practices was 68% (range, 45%-92%) across all facilities. Overall adherence to expected hand hygiene practice was 72% (range, 10%-100%). Compliance to hand hygiene before and after procedures was high; however, during procedures hand hygiene compliance averaged 58%. Use of chlorhexidine as the specific agent for exit site care was 19% overall but varied from 0% to 35% by facility type. The 8 checklists varied in the frequency of perfect performance from 0% for meeting every item on the checklist for disinfection practices to 22% on the arteriovenous access practices at initiation. CONCLUSIONS Our findings suggest that there are many areas for improvement in hand hygiene and other infection prevention practices in end-stage renal disease. These NOTICE project findings will help inform the development of a larger quality improvement initiative at dialysis facilities.

  20. The Modified Static Spacers Using Antibiotic-Impregnated Cement Rod in Two-Stage Revision for Infected Total Knee Arthroplasty

    PubMed Central

    Yoo, Juhyung; Lee, Seungyup; Han, Changdong

    2011-01-01

    The two-stage exchange arthroplasty (one- or two-stage) is believed to be the gold standard for the management of infections following total knee arthroplasty. We herein report a novel two-stage exchange arthroplasty technique using an antibiotic-impregnated cement intramedullary nail, which can be easily prepared during surgery using a straight thoracic tube and a Steinmann pin, and may provide additional stability to the knee to maintain normal mechanical axis. In addition, there is less pain between the period of prosthesis removal and subsequent reimplantation. Less soft tissue contracture, less scar adhesion, easy removal of the cement intramedullary nail, and successful infection control are the advantages of this technique. PMID:21909473

  1. Syphilis Infection Differentially Regulates the Phenotype and Function of γδ T Cells in HIV-1-Infected Patients Depends on the HIV-1 Disease Stage

    PubMed Central

    Li, Zhen; Lu, Xiaofan; Hu, Zhiliang; Luo, Zhenwu; Jiang, Wei; Wu, Hao; Gao, Yanqing; Yan, Junling; Zhang, Qiuyue; Song, Aixin; Huang, Xiaojie; Mou, Danlei; Su, Bin; Zhang, Tong

    2017-01-01

    A rapidly escalating outbreak of syphilis infection has been affected men who have sex with men, particularly those with HIV-1 infection. γδ T cells are unconventional immune cells with two main subsets, Vδ1 T cells and Vδ2 T cells, which possess a combination of innate and adaptive immune features allowing them against HIV-1. However, whether syphilis infection affects the phenotype and function of γδ T cells in HIV-1-infected patients remains unclear, especially in acute HIV-1 infection (AHI). In this study, we enrolled 57 HIV-1-infected patients (24 with HIV-1 infection only and 33 coinfected with syphilis) from an acute HIV-1-infected cohort in Beijing (PRIMO). A comprehensive analysis of γδ T-cell phenotype and function was performed by flow cytometry. We found syphilis coinfection could reverse the imbalance of Vδ1/Vδ2 ratio in AHI. Syphilis infection results in decreased γδ T-cell activation in AHI, but increased γδ T-cell activation in chronic HIV-1 infection (CHI). Moreover, patients with CHI had larger numbers of IL-17-producing γδ T cells than those with AHI, regardless of syphilis status. Thus, syphilis affected the γδ T-cell immune response differently in patients depending on the stages of HIV-1 disease. In addition, the percentage of IL-17-producing γδ T cells was positively correlated with the percentage of neutrophils. These results suggest that the γδ T-cell/IL-17/neutrophil axis is involved in HIV-1 pathogenesis and disease progression. Taken together, our observations provide new insight into the roles of γδ T cells in immunopathogenesis of syphilis and HIV-1 coinfection, particularly during AHI, and our findings may be helpful for the prevention of syphilis and other sexually transmitted infections and highlight the great significance on the remedy of patients coinfected with HIV-1. PMID:28871259

  2. Bilateral One-Stage Revision of Infected Total Hip Arthroplasties: Report of Two Cases and Management of Antibiotic Therapy

    PubMed Central

    Pommepuy, Thomas; Lons, Adrien; Benad, Kevin; Beltrand, Eric; Senneville, Eric; Migaud, Henri

    2016-01-01

    Recommendations for the management of chronic and bilateral total hip arthroplasty (THA) infection are lacking. However, this type of infection involves medical problems concerning the management of the antibiotic therapy. We report two cases of such infections operated as one-stage revision. For each case, both hips were infected with the same bacteria (Staphylococcus caprae for one patient and methicillin-sensitive Staphylococcus aureus for the other). The probabilistic antibiotic treatment started during the first side (after harvesting intraoperative samples) did not prevent the culture of the bacteriologic harvested during the intervention of the second side. Cultures were positive for the same bacteria for both sides in the two cases presented herein. After results of intraoperative cultures, patients received culture-guided antibiotic therapy for three months and were considered cured at the end of a two-year follow-up. Our results suggest one-stage bilateral change of infected THA is a viable option and that early intraoperative antibiotic, started during the first-side exchange, does not jeopardize microbiological documentation of the second side. This work brings indirect arguments, in favor of the use of prophylactic antibiotics during revision of infected THA. PMID:26904335

  3. Influence of Ribeiroia ondatrae (Trematoda: Digenea) infection on limb development and survival of northern leopard frogs (Rana pipiens): effects of host stage and parasite-exposure level

    USGS Publications Warehouse

    Schotthoefer, Anna M.; Koehler, Anson V.; Meteyer, Carol U.; Cole, Rebecca A.

    2003-01-01

    Recent evidence suggests that infection by larvae of the trematode Ribeiroia ondatrae accounts for a significant proportion of limb malformations currently observed in amphibian populations of North America. However, the effects of R. ondatrae infection on northern leopard frogs (Rana pipiens), one of the species most frequently reported with malformations, have not been adequately explored. Moreover, the risk factors associated with R. ondatrae-induced malformations have not been clearly identified. We examined the effects of timing of infection on tadpole survival and limb development. Rana pipiens tadpoles were individually exposed to R. ondatrae cercariae at the pre-limb-bud (Gosner stages 24 and 25), limb-bud (Gosner stages 27 and 28), or paddle (Gosner stages 31–33) stages of development and monitored through metamorphosis. The effects of infection were stage-specific. Infections acquired at the pre-limb-bud stage resulted in a high mortality rate (47.5–97.5%), whereas tadpoles infected at the limb-bud stage displayed a high malformation rate (16% overall), and the magnitude of effects increased with the level of exposure to cercariae. In contrast, infections acquired at the paddle stage had no effect on limb development or tadpole survival, which suggests that the timing of R. ondatrae infection in relation to the stage structure of tadpole populations in the wild is an important determinant of the degree to which populations are affected by R. ondatrae.

  4. Destabilization of the Gut Microbiome Marks the End-Stage of Simian Immunodeficiency Virus Infection in Wild Chimpanzees

    PubMed Central

    BARBIAN, HANNAH J.; LI, YINGYING; RAMIREZ, MIGUEL; KLASE, ZACHARY; LIPENDE, IDDI; MJUNGU, DEUS; MOELLER, ANDREW H.; WILSON, MICHAEL L.; PUSEY, ANNE E.; LONSDORF, ELIZABETH V.; BUSHMAN, FREDERIC D.; HAHN, BEATRICE H.

    2016-01-01

    Enteric dysbiosis is a characteristic feature of progressive human immunodeficiency virus type 1 (HIV-1) infection but has not been observed in simian immunodeficiency virus (SIVmac)-infected macaques, including in animals with end-stage disease. This has raised questions concerning the mechanisms underlying the HIV-1 associated enteropathy, with factors other than virus infection, such as lifestyle and antibiotic use, implicated as playing possible causal roles. Simian immunodeficiency virus of chimpanzees (SIVcpz) is also associated with increased mortality in wild-living communities, and like HIV-1 and SIVmac, can cause CD4+ T cell depletion and immunodeficiency in infected individuals. Given the central role of the intestinal microbiome in mammalian health, we asked whether gut microbial constituents could be identified that are indicative of SIVcpz status and/or disease progression. Here, we characterized the gut microbiome of SIVcpz-infected and -uninfected chimpanzees in Gombe National Park, Tanzania. Subjecting a small number of fecal samples (N = 9) to metagenomic (shotgun) sequencing, we found bacteria of the family Prevotellaceae to be enriched in SIVcpz-infected chimpanzees. However, 16S rRNA gene sequencing of a larger number of samples (N = 123) failed to show significant differences in both the composition and diversity (alpha and beta) of gut bacterial communities between infected (N = 24) and uninfected (N = 26) chimpanzees. Similarly, chimpanzee stool-associated circular virus (Chi-SCV) and chimpanzee adenovirus (ChAdV) identified by metagenomic sequencing were neither more prevalent nor more abundant in SIVcpz-infected individuals. However, fecal samples collected from SIVcpz-infected chimpanzees within 5 months before their AIDS-related death exhibited significant compositional changes in their gut bacteriome. These data indicate that SIVcpz-infected chimpanzees retain a stable gut microbiome throughout much of their natural infection course

  5. Quantitative and qualitative profiles of circulating monocytes may help identifying tuberculosis infection and disease stages

    PubMed Central

    La Manna, Marco Pio; Orlando, Valentina; Dieli, Francesco; Di Carlo, Paola; Cascio, Antonio; Cuzzi, Gilda; Palmieri, Fabrizio; Goletti, Delia

    2017-01-01

    Tuberculosis (TB) is one of the most important cause of morbidity and death among infectious diseases, and continuous efforts are needed to improve diagnostic tools and therapy. Previous published studies showed that the absolute cells number of monocytes or lymphocytes in peripheral blood or yet the ratio of monocytes to lymphocytes displayed the ability to predict the risk of active TB. In the present study we evaluated the ratio of monocytes to lymphocytes variation and we also analyzed the ex-vivo expression of CD64 on monocytes as tools to identify biomarkers for discriminating TB stages. Significant differences were found when the average ratio of monocytes to lymphocytes of active TB patients was compared with latent TB infection (LTBI) subjects, cured TB and healthy donors (HD). By the receiver operator characteristics (ROC) curve analysis the cut-off value of 0.285, allowed the discrimination of active TB from HD, with a sensitivity of 91.04% and a specificity of 93.55% (95% of confidence interval: 0.92–0.99). The ROC curve analysis comparing TB patients and LTBI groups, led to a sensitivity and the specificity of the assay of 85.07% and 85.71%, respectively (95% of confidence interval: 0.85 to 0.96). The upregulation of CD64 expression on circulating monocytes in active TB patients could represent an additional biomarker for diagnosis of active TB. In conclusion, we found that the ML ratio or monocyte absolute count or phenotypic measures show predictive value for active TB. PMID:28208160

  6. Quantitative and qualitative profiles of circulating monocytes may help identifying tuberculosis infection and disease stages.

    PubMed

    La Manna, Marco Pio; Orlando, Valentina; Dieli, Francesco; Di Carlo, Paola; Cascio, Antonio; Cuzzi, Gilda; Palmieri, Fabrizio; Goletti, Delia; Caccamo, Nadia

    2017-01-01

    Tuberculosis (TB) is one of the most important cause of morbidity and death among infectious diseases, and continuous efforts are needed to improve diagnostic tools and therapy. Previous published studies showed that the absolute cells number of monocytes or lymphocytes in peripheral blood or yet the ratio of monocytes to lymphocytes displayed the ability to predict the risk of active TB. In the present study we evaluated the ratio of monocytes to lymphocytes variation and we also analyzed the ex-vivo expression of CD64 on monocytes as tools to identify biomarkers for discriminating TB stages. Significant differences were found when the average ratio of monocytes to lymphocytes of active TB patients was compared with latent TB infection (LTBI) subjects, cured TB and healthy donors (HD). By the receiver operator characteristics (ROC) curve analysis the cut-off value of 0.285, allowed the discrimination of active TB from HD, with a sensitivity of 91.04% and a specificity of 93.55% (95% of confidence interval: 0.92-0.99). The ROC curve analysis comparing TB patients and LTBI groups, led to a sensitivity and the specificity of the assay of 85.07% and 85.71%, respectively (95% of confidence interval: 0.85 to 0.96). The upregulation of CD64 expression on circulating monocytes in active TB patients could represent an additional biomarker for diagnosis of active TB. In conclusion, we found that the ML ratio or monocyte absolute count or phenotypic measures show predictive value for active TB.

  7. Aggregation of Infective Stages of Parasites as an Adaptation and Its Implications for the Study of Parasite-Host Interactions.

    PubMed

    Morrill, André; Forbes, Mark R

    2016-02-01

    The causes and consequences of aggregation among conspecifics have received much attention. For infecting macroparasites, causes include variation among hosts in susceptibility and whether infective stages are aggregated in the environment. Here, we link these two phenomena and explore whether aggregation of infective stages in the environment is adaptive to parasites encountering host condition-linked defenses and what effect such aggregations have for parasite-host interactions. Using simulation models, we show that parasite fitness is increased by aggregates attacking a host, particularly when investment into defenses is high. The fitness benefit of aggregation remains despite inclusion of factors that should curb the benefits of aggregation, namely, mortality of low-condition hosts (those hosts expected to be most susceptible to parasitism) and costs of high coinfection. For sample sizes common in studies, aggregation of infective stages reduces the likelihood of detecting host condition-parasitism relations, even when host condition is the only other factor in models affecting parasitism. Thus, it is not surprising that the expected inverse relations between host condition and parasitism, commonly a premise in studies of parasite-host interactions, are inconsistently found. An understanding of how parasites encounter hosts is thus needed for developing theory for parasite-host ecological and evolutionary interactions.

  8. Dynamics of HIV viremia and antibody seroconversion in plasma donors: implications for diagnosis and staging of primary HIV infection.

    PubMed

    Fiebig, Eberhard W; Wright, David J; Rawal, Bhupat D; Garrett, Patricia E; Schumacher, Richard T; Peddada, Lorraine; Heldebrant, Charles; Smith, Richard; Conrad, Andrew; Kleinman, Steven H; Busch, Michael P

    2003-09-05

    The characterization of primary HIV infection by the analysis of serial plasma samples from newly infected persons using multiple standard viral assays. A retrospective study involving two sets of archived samples from HIV-infected plasma donors. (A) 435 samples from 51 donors detected by anti-HIV enzyme immunoassays donated during 1984-1994; (B) 145 specimens from 44 donors detected by p24 antigen screening donated during 1996-1998. Two US plasma products companies. The timepoints of appearance of HIV-1 markers and viral load concentrations during primary HIV infection. The pattern of sequential emergence of viral markers in the 'A' panels was highly consistent, allowing the definition and estimation of the duration of six sequential stages. From the 'B' panels, the viral load at p24 antigen seroconversion was estimated by regression analysis at 10 000 copies/ml (95% CI 2000-93 000) and the HIV replication rate at 0.35 log copies/ml/day, corresponding to a doubling time in the preseroconversion phase of 20.5 h (95% CI 18.2-23.4 h). Consequently, an RNA test with 50 copies/ml sensitivity would detect HIV infection approximately 7 days before a p24 antigen test, and 12 days before a sensitive anti-HIV test. The sequential emergence of assay reactivity allows the classification of primary HIV-1 infection into distinct laboratory stages, which may facilitate the diagnosis of recent infection and stratification of patients enrolled in clinical trials. Quantitative analysis of preseroconversion replication rates of HIV is useful for projecting the yield and predictive value of assays targeting primary HIV infection.

  9. Transcriptomic analysis of the host response to early stage salmonid alphavirus (SAV-1) infection in Atlantic salmon Salmo salar L.

    PubMed

    Herath, Tharangani K; Bron, James E; Thompson, Kim D; Taggart, John B; Adams, Alexandra; Ireland, Jacqueline H; Richards, Randolph H

    2012-05-01

    Salmon pancreas disease, caused by salmonid alphavirus (SAV) of the family Togaviridae, is an economically important disease affecting farmed Atlantic salmon (Salmo salar L.) in Scotland, Norway, and Ireland. The virus causes characteristic lesions in the pancreas, heart, kidney and skeletal muscle of infected fish. The mechanisms responsible for the pathology and the immune responses elicited in infected Atlantic salmon are not fully understood. A microarray-based study was therefore performed to evaluate the host transcriptomic response during the early stages of an experimentally-induced SAV-1 infection. Atlantic salmon parr were injected intra-peritoneally with viral cell culture supernatant or cell culture supernatant without virus. RNA, extracted from head kidney sampled from infected and control fish at 1, 3 and 5 days post-injection (d.p.i.), was interrogated with the 17 k TRAITS/SGP cDNA microarray. The greatest number of significantly differentially expressed genes was recorded at 3 d.p.i., mainly associated with immune and defence mechanisms, including genes involved in interferon I pathways and Major Histocompatibility Complex Class I and II responses. Genes associated with apoptosis and cellular stress were also found to be differentially expressed between infected and uninfected individuals, as were genes involved in inhibiting viral attachment and replication. The microarray results were validated by follow-on analysis of eight genes by real-time PCR. The findings of the study reflect mechanisms used by the host to protect itself during the early stages of SAV-1 infection. In particular, there was evidence of rapid induction of interferon-mediated responses similar to those seen during mammalian alphavirus infections, and also early involvement of an adaptive immune response. This study provides essential knowledge to assist in the development of effective control and management strategies for SAV-1 infection.

  10. White spot syndrome virus induces metabolic changes resembling the warburg effect in shrimp hemocytes in the early stage of infection.

    PubMed

    Chen, I-Tung; Aoki, Takashi; Huang, Yun-Tzu; Hirono, Ikuo; Chen, Tsan-Chi; Huang, Jiun-Yan; Chang, Geen-Dong; Lo, Chu-Fang; Wang, Han-Ching

    2011-12-01

    The Warburg effect is an abnormal glycolysis response that is associated with cancer cells. Here we present evidence that metabolic changes resembling the Warburg effect are induced by a nonmammalian virus. When shrimp were infected with white spot syndrome virus (WSSV), changes were induced in several metabolic pathways related to the mitochondria. At the viral genome replication stage (12 h postinfection [hpi]), glucose consumption and plasma lactate concentration were both increased in WSSV-infected shrimp, and the key enzyme of the pentose phosphate pathway, glucose-6-phosphate dehydrogenase (G6PDH), showed increased activity. We also found that at 12 hpi there was no alteration in the ADP/ATP ratio and that oxidative stress was lower than that in uninfected controls. All of these results are characteristic of the Warburg effect as it is present in mammals. There was also a significant decrease in triglyceride concentration starting at 12 hpi. At the late stage of the infection cycle (24 hpi), hemocytes of WSSV-infected shrimp showed several changes associated with cell death. These included the induction of mitochondrial membrane permeabilization (MMP), increased oxidative stress, decreased glucose consumption, and disrupted energy production. A previous study showed that WSSV infection led to upregulation of the voltage-dependent anion channel (VDAC), which is known to be involved in both the Warburg effect and MMP. Here we show that double-stranded RNA (dsRNA) silencing of the VDAC reduces WSSV-induced mortality and virion copy number. For these results, we hypothesize a model depicting the metabolic changes in host cells at the early and late stages of WSSV infection.

  11. Contrasting expression of immune genes in scaled and scaleless skin of Atlantic salmon infected with young stages of Lepeophtheirus salmonis.

    PubMed

    Holm, H Jodaa; Skugor, S; Bjelland, A K; Radunovic, S; Wadsworth, S; Koppang, E O; Evensen, Ø

    2017-02-01

    Atlantic salmon skin tissues with and without scales were taken from two preferred sites of salmon louse (Lepeophtheirus salmonis) attachment, behind the dorsal fin (scaled) and from the top of the head (scaleless), respectively. Tissues were profiled by qPCR of 32 genes to study responses to copepodids, 4 days post infection (dpi), and during the moult of copepodids to the chalimus stage, at 8 dpi. Basal/constitutive differences were found for many immune-related genes between the two skin sites; e.g., mannose binding protein C was over 100 fold higher expressed in the scaled skin from the back in comparison to the skin without scales from the head. With lice-infection, at 4 dpi most genes in both tissues showed lower values than in the non-infected control. By 8 dpi, the majority of responses increased towards the control levels, including cytokines of Th1, Th17 and Th2 pathways. Immunohistochemistry of three immune factors revealed an even distribution of MHC class II positive cells throughout epidermis, including the top layer of keratinocytes, marked compartmentalization of Mx(+) and CD8α(+) cells close to stratum basale, and an increase in numbers of CD8α(+) cells in response to infection. In conclusion, suppression of immune genes during the copepodid stage likely sets off a beneficial situation for the parasite. At the moult to chalimus stage 8 dpi, only few genes surpassed the non-infected control levels, including CD8α. The gene expression pattern was reflected in the increased number of CD8α expressing cells, thus revealing a relatively minor activation of skin T-cell defenses in Atlantic salmon in response to L. salmonis infection.

  12. TLR4 and TLR9 signals stimulate protective immunity against blood-stage Plasmodium yoelii infection in mice.

    PubMed

    Zhang, Yanjun; Zhu, Xiaotong; Feng, Yonghui; Pang, Wei; Qi, Zanmei; Cui, Liwang; Cao, Yaming

    2016-11-01

    The mechanisms regulating the induction of protective immunity against blood-stage malaria remain unclear. Resistant DBA/2 mouse develops a higher Th1 response compared with a susceptible BALB/c strain during Plasmodium yoelii (Py) infection. It is known that the T helper cell response is initiated and polarized by dendritic cells (DCs) of the innate immune system, during which TLR4 and TLR9 are important receptors for the innate recognition of the malaria parasite and its products. We hypothesized that TLR4/9 may play critical roles in the induction of protective immunity against Py infection. We used TLR4/9 antagonists and agonists to study their effects on mouse resistance to Py infection. We found that the administration of an antagonist prior to infection aggravated disease outcomes, impaired DC functions and suppressed the pro-inflammatory response to Py infection in resistant DBA/2 mice. Treatment with the TLR4 agonist lipopolysaccharide (LPS) but not TLR9 agonist significantly improved the survival rate of susceptible Py-infected BALB/c mice. LPS administration promoted the activation and expansion of DCs and drove a Th1-biased response. Our data demonstrate the important roles of TLR4/9 signals in inducing resistance to malaria parasites and provide evidence for the rational use of TLR agonists to potentiate protective immunity against Plasmodium infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Single-virus tracking approach to reveal the interaction of Dengue virus with autophagy during the early stage of infection

    NASA Astrophysics Data System (ADS)

    Chu, Li-Wei; Huang, Yi-Lung; Lee, Jin-Hui; Huang, Long-Ying; Chen, Wei-Jun; Lin, Ya-Hsuan; Chen, Jyun-Yu; Xiang, Rui; Lee, Chau-Hwang; Ping, Yueh-Hsin

    2014-01-01

    Dengue virus (DENV) is one of the major infectious pathogens worldwide. DENV infection is a highly dynamic process. Currently, no antiviral drug is available for treating DENV-induced diseases since little is known regarding how the virus interacts with host cells during infection. Advanced molecular imaging technologies are powerful tools to understand the dynamics of intracellular interactions and molecular trafficking. This study exploited a single-virus particle tracking technology to address whether DENV interacts with autophagy machinery during the early stage of infection. Using confocal microscopy and three-dimensional image analysis, we showed that DENV triggered the formation of green fluorescence protein-fused microtubule-associated protein 1A/1B-light chain 3 (GFP-LC3) puncta, and DENV-induced autophagosomes engulfed DENV particles within 15-min postinfection. Moreover, single-virus particle tracking revealed that both DENV particles and autophagosomes traveled together during the viral infection. Finally, in the presence of autophagy suppressor 3-methyladenine, the replication of DENV was inhibited and the location of DENV particles spread in cytoplasma. In contrast, the numbers of newly synthesized DENV were elevated and the co-localization of DENV particles and autophagosomes was detected while the cells were treated with autophagy inducer rapamycin. Taken together, we propose that DENV particles interact with autophagosomes at the early stage of viral infection, which promotes the replication of DENV.

  14. Fungal infection in patients with end-stage liver disease: low frequency or low index of suspicion.

    PubMed

    Hassan, Elham A; Abd El-Rehim, Abeer S; Hassany, Sahar M; Ahmed, Asmaa O; Elsherbiny, Nahla M; Mohammed, Mona H

    2014-06-01

    End-stage liver disease (ESLD) is associated with dysregulation of the immune system and increased susceptibility to infections. Although invasive fungal infection (IFI) is a growing public health problem, studies of IFI in ESLD are lacking. The aims of this study were to screen for IFI in ESLD and to assess risk factors and serum interleukin 17 (IL-17) as a marker of the cellular immune response. Both blood and ascitic fluid samples were collected from 46 patients with ESLD for fungal culture and PCR. Serum IL-17 levels were determined. Seven patients had isolated IFI (four had spontaneous fungal peritonitis, two had fungemia, and one had a disseminated fungal infection) and five cases had combined fungal and bacterial infections. Spontaneous fungal peritonitis was attributed to Candida species, while fungemia was caused by Aspergillus species. Patients with IFI had higher serum IL-17 levels and increased mortality compared to patients without IFI. A history of antibiotic use (p = 0.002), higher model for end-stage liver disease (MELD) scores (p = 0.04), and hepatorenal syndrome (p = 0.006) were risk factors for IFI. Patients with ESLD had a low frequency of IFI; however, in patients with these infections, delayed diagnosis and treatment may contribute to a high fatality rate. Thus, clinicians should have a high index of suspicion for this unusual but lethal entity, as prompt detection and appropriate treatment can improve the outcome. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Can Taenia solium latent post-oncospheral stages be found in muscle tissue of cysticercosis-infected pigs (Sus scrofa)?

    PubMed

    Rodrìguez, Mary L; Rodriguez, Silvia; Gonzalez, Armando E; Verastegui, Manuela; Bernal, Teresa; Jimenez, Juan A; Garcia, Hector H

    2006-02-01

    The existence of latent Taenia solium post-oncospheral stages in the tissues of infected pigs has been postulated. To assess whether such structures exist and can be detected, we examined muscle samples from cysticercosis-infected and uninfected pigs. Pork samples were homogenized, centrifuged, and resuspended in saline solution. Round microscopic structures of approximately 10 microm with variable refringence were found in the pellets of all samples from both infected and uninfected pigs. These became homogeneously red after staining with Sudan IV and disappeared after ether extraction. The only difference between samples from infected and uninfected pigs was the presence of inflammatory cells and tissue necrosis debris in the former group. Taenia solium oncospheres were stained and observed for comparative purposes, before and after inoculation into pork. Control oncospheres were ellipsoidal, had nucleated basophile cells in their interior, and showed red aggregates on their surfaces when stained with 3% Sudan IV. While rounded microscopical structures similar to those previously reported were found, these differed morphologically from oncospheres, were of a lipid nature, and occurred in both infected and uninfected animals. No evidence supporting the presence of latent post-oncospheral stages of Taenia solium was generated in this series of experiments.

  16. Stage-specific immunity to Taenia taeniaeformis infection in mice. A histological study of the course of infection in mice vaccinated with either oncosphere or metacestode antigens.

    PubMed

    Bøgh, H O; Lightowlers, M W; Sullivan, N D; Mitchell, G F; Rickard, M D

    1990-03-01

    The course of Taenia taeniaeformis infection in mice previously vaccinated with antigens prepared from either oncosphere (TtO) or metacestode (TtM) was followed by histological examination of livers from mice killed at various times post-infection (p.i.). Distinctly different immune responses occurred in the two groups. Very few cysts were seen at any stage of infection in TtO-vaccinated mice and most of those which were present appeared histologically similar to cysts in control mice. In TtM-vaccinated mice many cysts were present from early in infection but histologically it was apparent that most were dying from 15 days p.i. because the tegument had lost its integrity, and degranulated polymorphonuclear leucocytes were present inside the parasites. These findings support earlier suggestions that stage-specific antigens are expressed in oncospheres and metacestodes. Parasites developing normally were surrounded by a halo of alcian blue staining amorphous acellular material. This material appeared to act as a barrier to attack by host inflammatory cells, and disappearance of this layer signalled death of the parasite. The possibility that the gut acted as a barrier to delay migration of oncospheres to the liver in vaccinated mice was investigated, but no evidence for this could be found.

  17. Role of Suppressive Oral Antibiotics in Orthopedic Hardware Infections for Those Not Undergoing Two-Stage Replacement Surgery.

    PubMed

    Keller, Sara C; Cosgrove, Sara E; Higgins, Yvonne; Piggott, Damani A; Osgood, Greg; Auwaerter, Paul G

    2016-10-01

    Background.  The use of suppressive antibiotics in treatment of orthopedic hardware infections (OHIs), including spinal hardware infections, prosthetic joint infections, and infections of internal fixation devices, is controversial. Methods.  Over a 4-year period at 2 academic medical centers, patients with OHI who were treated with debridement and retention of hardware components, with single-stage exchange, or without surgery were studied to determine whether use of oral antibiotics for at least 6 months after diagnosis impacts successful treatment of the infection at 1 year after diagnosis. Results.  Of 89 patients in the study, 42 (47.2%) were free of clinical infection 1 year after initial diagnosis. Suppressive antibiotics used for at least 6 months after diagnosis was not associated with being free of clinical infection (adjusted odds ratio [aOR], 5.29; 95% confidence interval [CI], .74-37.80), but being on suppressive antibiotics at least 3 months after diagnosis was associated with being free of clinical infection (OR, 3.50; 95% CI, 1.30-9.43). Causative organisms impacted the likelihood of success; patients with methicillin-resistant Staphylococcus aureus as well as with Gram-negative rods were both less likely to have achieved clinical success at 1 year after surgery (aOR = 0.018, 95% CI = .0017-.19 and aOR = 0.20, 95% CI = .039-.99, respectively). Conclusions.  Oral suppressive antibiotic therapy in treatment of OHI with retention of hardware for 3 months, but not 6 months, postdiagnosis increases the likelihood of treatment success. The organisms implicated in the infection directly impact the likelihood of treatment success.

  18. Role of Suppressive Oral Antibiotics in Orthopedic Hardware Infections for Those Not Undergoing Two-Stage Replacement Surgery

    PubMed Central

    Keller, Sara C.; Cosgrove, Sara E.; Higgins, Yvonne; Piggott, Damani A.; Osgood, Greg; Auwaerter, Paul G.

    2016-01-01

    Background. The use of suppressive antibiotics in treatment of orthopedic hardware infections (OHIs), including spinal hardware infections, prosthetic joint infections, and infections of internal fixation devices, is controversial. Methods. Over a 4-year period at 2 academic medical centers, patients with OHI who were treated with debridement and retention of hardware components, with single-stage exchange, or without surgery were studied to determine whether use of oral antibiotics for at least 6 months after diagnosis impacts successful treatment of the infection at 1 year after diagnosis. Results. Of 89 patients in the study, 42 (47.2%) were free of clinical infection 1 year after initial diagnosis. Suppressive antibiotics used for at least 6 months after diagnosis was not associated with being free of clinical infection (adjusted odds ratio [aOR], 5.29; 95% confidence interval [CI], .74–37.80), but being on suppressive antibiotics at least 3 months after diagnosis was associated with being free of clinical infection (OR, 3.50; 95% CI, 1.30–9.43). Causative organisms impacted the likelihood of success; patients with methicillin-resistant Staphylococcus aureus as well as with Gram-negative rods were both less likely to have achieved clinical success at 1 year after surgery (aOR = 0.018, 95% CI = .0017–.19 and aOR = 0.20, 95% CI = .039–.99, respectively). Conclusions. Oral suppressive antibiotic therapy in treatment of OHI with retention of hardware for 3 months, but not 6 months, postdiagnosis increases the likelihood of treatment success. The organisms implicated in the infection directly impact the likelihood of treatment success. PMID:27747252

  19. MAPK phosphotase 5 deficiency contributes to protection against blood-stage Plasmodium yoelii 17XL infection in mice.

    PubMed

    Cheng, Qianqian; Zhang, Qingfeng; Xu, Xindong; Yin, Lan; Sun, Lin; Lin, Xin; Dong, Chen; Pan, Weiqing

    2014-04-15

    Cell-mediated immunity plays a crucial role in the development of host resistance to asexual blood-stage malaria infection. However, little is known of the regulatory factors involved in this process. In this study, we investigated the impact of MAPK phosphotase 5 (MKP5) on protective immunity against a lethal Plasmodium yoelii 17XL blood-stage infection using MKP5 knockout C57BL/6 mice. Compared with wild-type control mice, MKP5 knockout mice developed significantly lower parasite burdens with prolonged survival times. We found that this phenomenon correlated with a rapid and strong IFN-γ-dependent cellular immune response during the acute phase of infection. Inactivation of IFN-γ by the administration of a neutralizing Ab significantly reduced the protective effects in MKP5 knockout mice. By analyzing IFN-γ production in innate and adaptive lymphocyte subsets, we observed that MKP5 deficiency specifically enhanced the IFN-γ response mediated by CD4+ T cells, which was attributable to the increased stimulatory capacity of splenic CD11c+ dendritic cells. Furthermore, following vaccination with whole blood-stage soluble plasmodial Ag, MKP5 knockout mice acquired strongly enhanced Ag-specific immune responses and a higher level of protection against subsequent P. yoelii 17XL challenge. Finally, we found the enhanced response mediated by MKP5 deficiency resulted in a lethal consequence in mice when infected with nonlethal P. yoelii 17XNL. Thus, our data indicate that MKP5 is a potential regulator of immune resistance against Plasmodium infection in mice, and that an understanding of the role of MKP5 in manipulating anti-malaria immunity may provide valuable information on the development of better control strategies for human malaria.

  20. [Changes of reflectance spectra of pine needles in different stage after being infected by pine wood nematode].

    PubMed

    Xu, Hua-chao; Luo, You-qing; Zhang, Ting-ting; Shi, Yong-jun

    2011-05-01

    In the present study, seedlings of Pinus Thunbergii and Pinus Massoniana were planted and used for reflectance spectrum measurement. In different stage after being infected by pine wood nematode, reflectance spectra were measured by ASD spectrometer and the features of spectral parameters and the change of chlorophyll were analyzed. The results showed that (1) Disease could be estimated in the early stage according to the curve of mid-infrared reflectance; (2) Dynamic parameters such as the position of red edge, green peak height, reflectance of red band, slope of red edge and reflectance of water-stressed wave band were consistent with the disease features of two pine species after being infected by pine wood nematode; (3) To both of two pine species, content of chlorophyll tended to reduce with the development of disease and obvious linear relationship was observed between chlorophyll content and spectral parameters. There results might be able to provide some theoretical basis for the application of remote sensing technology in monitoring of pine wood disease. In addition, it might be also used as theoretical support for the controlling measures in different stage after being infected by pine wood nematode.

  1. Lipocalin 2 bolsters innate and adaptive immune responses to blood-stage malaria infection by reinforcing host iron metabolism.

    PubMed

    Zhao, Hong; Konishi, Aki; Fujita, Yukiko; Yagi, Masanori; Ohata, Keiichi; Aoshi, Taiki; Itagaki, Sawako; Sato, Shintaro; Narita, Hirotaka; Abdelgelil, Noha H; Inoue, Megumi; Culleton, Richard; Kaneko, Osamu; Nakagawa, Atsushi; Horii, Toshihiro; Akira, Shizuo; Ishii, Ken J; Coban, Cevayir

    2012-11-15

    Plasmodium parasites multiply within host erythrocytes, which contain high levels of iron, and parasite egress from these cells results in iron release and host anemia. Although Plasmodium requires host iron for replication, how host iron homeostasis and responses to these fluxes affect Plasmodium infection are incompletely understood. We determined that Lipocalin 2 (Lcn2), a host protein that sequesters iron, is abundantly secreted during human (P. vivax) and mouse (P. yoeliiNL) blood-stage malaria infections and is essential to control P. yoeliiNL parasitemia, anemia, and host survival. During infection, Lcn2 bolsters both host macrophage function and granulocyte recruitment and limits reticulocytosis, or the expansion of immature erythrocytes, which are the preferred target cell of P. yoeliiNL. Additionally, a chronic iron imbalance due to Lcn2 deficiency results in impaired adaptive immune responses against Plasmodium parasites. Thus, Lcn2 exerts antiparasitic effects by maintaining iron homeostasis and promoting innate and adaptive immune responses.

  2. Tibial tubercle osteotomy or quadriceps snip in two-stage revision for prosthetic knee infection? A randomized prospective study.

    PubMed

    Bruni, Danilo; Iacono, Francesco; Sharma, Bharat; Zaffagnini, Stefano; Marcacci, Maurilio

    2013-04-01

    Although 7% to 38% of revision total knee arthroplasties (RTKAs) are attributable to prosthetic knee infections, controversy exists regarding the best surgical approach while reducing the risk of extensor mechanism complications and the reinfection rate. We compared The Knee Society Score(©) (KSS), incidences of complications, maximum knee flexion, residual extension lag, and reinfection rate in patients with prosthetic knee infections treated with two-stage RTKAs using either the tibial tubercle osteotomy (TTO) or the quadriceps snip (QS) for exposure at the time of reimplantation. We prospectively followed 81 patients with chronic prosthetic knee infections treated between 1997 and 2004. Patients were randomized to receive a TTO or QS for exposure at the time of reimplantation. All patients had the same rehabilitation protocol. The minimum followup was 8 years (mean, 12 years; range, 8-15 years). Patients in the TTO group had a higher mean KSS than the QS group (88 versus 70, respectively). Mean maximum knee flexion was greater in the TTO group (113° versus 94°); with a lower incidence of extension lag (45% versus 13%). We observed no differences in reinfection rate between groups. We found the TTO combined with an early rehabilitation protocol associated with superior KSS did not impair extensor mechanism function or increase the reinfection rate. We believe a two-stage RTKA with TTO is a reasonable approach for treating prosthetic knee infections. Level I, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

  3. Apoptosis in Macrophages and Alveolar Epithelial Cells during Early Stages of Infection by Legionella pneumophila and Its Role in Cytopathogenicity

    PubMed Central

    Gao, Lian-Yong; Abu Kwaik, Yousef

    1999-01-01

    The hallmark of Legionnaires’ disease is intracellular replication of Legionella pneumophila within cells in the alveolar spaces. Cytopathogenicity of this bacterium to the host cell has been well demonstrated, but the mechanisms of host cell death due to infection by L. pneumophila are not well understood. In this study, induction of apoptosis in macrophages and alveolar epithelial cells by L. pneumophila during early stages of infection was confirmed by using multiple criteria, including DNA fragmentation by agarose gel electrophoresis, terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling, surface exposure of phosphatidylserine, and cellular morphology by transmission electron microscopy. Induction of nuclear apoptosis in L. pneumophila-infected macrophages is mediated by activation of the caspase cascade death machinery. We provide genetic and biochemical evidence that L. pneumophila-induced apoptosis in macrophages and alveolar epithelial cells does not require intracellular bacterial replication or new protein synthesis. In addition, extracellular L. pneumophila is capable of inducing apoptosis. Furthermore, induction of apoptosis by L. pneumophila correlates with cytopathogenicity. We conclude that L. pneumophila-induced apoptosis in macrophages and alveolar epithelial cells plays an important role in cytopathogenicity to the host cell during early stages of infection. PMID:9916101

  4. Endometrial epithelial cell response to semen from HIV-infected men during different stages of infection is distinct and can drive HIV-1-long terminal repeat.

    PubMed

    Kafka, Jessica K; Sheth, Prameet M; Nazli, Aisha; Osborne, Brendan J; Kovacs, Colin; Kaul, Rupert; Kaushic, Charu

    2012-01-02

    Although more than 60% of HIV transmission occurs via semen, little is known about the immune impact of seminal plasma on HIV susceptibility. Here, we examined the level of selected immunomodulatory factors in seminal plasma from HIV-uninfected and therapy-naive, HIV-infected men in acute and chronic stages; the cytokine response elicited by seminal plasma in genital epithelial cells (GECs); and whether any GEC response to seminal plasma could drive HIV replication in infected T cells. A panel of nine cytokines and chemokines was measured in seminal plasma from HIV-uninfected and HIV-infected men and in primary GEC cultures following seminal plasma exposure. HIV-long terminal repeat (LTR) activation was measured in 1G5 T cells exposed to supernatants from seminal plasma-treated GECs. Pro-inflammatory cytokines and chemokines were present at significantly higher levels in seminal plasma from acute men, whereas transforming growth factor (TGF)-β1 was significantly higher in seminal plasma from chronic men. Pro-inflammatory cytokine production by GECs was significantly decreased following incubation with seminal plasma from chronic men. Blocking the TGF-β1 receptor in GECs prior to seminal plasma exposure enhanced pro-inflammatory cytokine production. Exposure to seminal plasma activated nuclear factor (NF)-κB in GECs and blocking it significantly reduced pro-inflammatory cytokine production. GEC responses to seminal plasma, especially from acute men, significantly activated HIV-LTR activation in 1G5 T cells. Immunomodulatory factors in seminal plasma vary, depending on presence and stage of HIV infection. Exposure to seminal plasma leads to NF-κB activation and pro-inflammatory cytokine production, whereas TGF-β in seminal plasma may suppress pro-inflammatory cytokine production by GECs. GEC responses to seminal plasma can activate HIV-LTR in infected CD4(+) T cells.

  5. Rationale for one stage exchange of infected hip replacement using uncemented implants and antibiotic impregnated bone graft.

    PubMed

    Winkler, Heinz

    2009-09-04

    Infection of a total hip replacement (THR) is considered a devastating complication, necessitating its complete removal and thorough debridement of the site. It is undoubted that one stage exchange, if successful, would provide the best benefit both for the patient and the society. Still the fear of re-infection dominates the surgeons decisions and in the majority of cases directs them to multiple stage protocols. However, there is no scientifically based argument for that practice. Successful eradication of infection with two stage procedures is reported to average 80% to 98%. On the other hand a literature review of Jackson and Schmalzried (CORR 2000) summarizing the results of 1,299 infected hip replacements treated with direct exchange (almost exclusively using antibiotic loaded cement), reports of 1,077 (83%) having been successful. The comparable results suggest, that the major factor for a successful outcome with traditional approaches may be found in the quality of surgical debridement and dead space management. Failures in all protocols seem to be caused by small fragments of bacterial colonies remaining after debridement, whereas neither systemic antibiotics nor antibiotic loaded bone cement (PMMA) have been able to improve the situation significantly. Reasons for failure may be found in the limited sensitivity of traditional bacterial culturing and reduced antibiotic susceptibility of involved pathogens, especially considering biofilm formation. Whenever a new prosthesis is implanted into a previously infected site the surgeon must be aware of increased risk of failure, both in single or two stage revisions. Eventual removal therefore should be easy with low risk of additional damage to the bony substance. On the other hand it should also have potential of a good long term result in case of success. Cemented revisions generally show inferior long term results compared to uncemented techniques; the addition of antibiotics to cement reduces its

  6. Infection-Related Hospitalizations in Older Patients With End-Stage Renal Disease

    PubMed Central

    Dalrymple, Lorien S.; Johansen, Kirsten L.; Chertow, Glenn M.; Cheng, Su-Chun; Grimes, Barbara; Gold, Ellen B.; Kaysen, George A.

    2010-01-01

    Background Infection is an important cause of hospitalization and death in patients receiving dialysis. Few studies have examined the full range of infections experienced by dialysis patients. The purpose of this study was to examine the types, rates and risk factors for infection among older persons starting dialysis. Study Design Retrospective observational cohort study. Setting and Participants The cohort was assembled from the United States Renal Data System and included patients aged 65 to 100 years who initiated dialysis between 1/1/00 and 12/31/02. Exclusions included prior kidney transplant, unknown dialysis modality, or death, loss to follow-up, or transplant during the first 90 days of dialysis. Patients were followed until death, transplant, or study end 12/31/04. Predictors Baseline demographics, co-morbidities, serum albumin and hemoglobin. Outcomes and Measurements Infection-related hospitalizations were ascertained using discharge ICD-9-CM codes. Hospitalization rates were calculated for each type of infection. The Wei-Lin-Weissfeld Model was used to examine risk factors for up to 4 infection-related events. Results 119,858 patients were included, 7,401 of whom were on peritoneal dialysis. During a median follow-up of 1.9 years, infection-related diagnoses were observed in approximately 35% of all hospitalizations. Approximately 50% of patients had at least one infection-related hospitalization. Rates (per 100 person-years) of pulmonary, soft tissue, and genitourinary infections ranged from 8.3 to 10.3 in patients on peritoneal dialysis and 10.2 to 15.3 in patients on hemodialysis. Risk factors for infection included older age, female sex, diabetes, heart failure, pulmonary disease, and low serum albumin. Limitations Use of ICD-9-CM codes, reliance on Medicare claims to capture hospitalizations, use of the Medical Evidence Form to ascertain co-morbidities, absence of data on dialysis access. Conclusion Infection-related hospitalization is frequent in

  7. CD8+ T cells from a novel T cell receptor transgenic mouse induce liver-stage immunity that can be boosted by blood-stage infection in rodent malaria.

    PubMed

    Lau, Lei Shong; Fernandez-Ruiz, Daniel; Mollard, Vanessa; Sturm, Angelika; Neller, Michelle A; Cozijnsen, Anton; Gregory, Julia L; Davey, Gayle M; Jones, Claerwen M; Lin, Yi-Hsuan; Haque, Ashraful; Engwerda, Christian R; Nie, Catherine Q; Hansen, Diana S; Murphy, Kenneth M; Papenfuss, Anthony T; Miles, John J; Burrows, Scott R; de Koning-Ward, Tania; McFadden, Geoffrey I; Carbone, Francis R; Crabb, Brendan S; Heath, William R

    2014-05-01

    To follow the fate of CD8+ T cells responsive to Plasmodium berghei ANKA (PbA) infection, we generated an MHC I-restricted TCR transgenic mouse line against this pathogen. T cells from this line, termed PbT-I T cells, were able to respond to blood-stage infection by PbA and two other rodent malaria species, P. yoelii XNL and P. chabaudi AS. These PbT-I T cells were also able to respond to sporozoites and to protect mice from liver-stage infection. Examination of the requirements for priming after intravenous administration of irradiated sporozoites, an effective vaccination approach, showed that the spleen rather than the liver was the main site of priming and that responses depended on CD8α+ dendritic cells. Importantly, sequential exposure to irradiated sporozoites followed two days later by blood-stage infection led to augmented PbT-I T cell expansion. These findings indicate that PbT-I T cells are a highly versatile tool for studying multiple stages and species of rodent malaria and suggest that cross-stage reactive CD8+ T cells may be utilized in liver-stage vaccine design to enable boosting by blood-stage infections.

  8. CD8+ T Cells from a Novel T Cell Receptor Transgenic Mouse Induce Liver-Stage Immunity That Can Be Boosted by Blood-Stage Infection in Rodent Malaria

    PubMed Central

    Mollard, Vanessa; Sturm, Angelika; Neller, Michelle A.; Cozijnsen, Anton; Gregory, Julia L.; Davey, Gayle M.; Jones, Claerwen M.; Lin, Yi-Hsuan; Haque, Ashraful; Engwerda, Christian R.; Nie, Catherine Q.; Hansen, Diana S.; Murphy, Kenneth M.; Papenfuss, Anthony T.; Miles, John J.; Burrows, Scott R.; de Koning-Ward, Tania; McFadden, Geoffrey I.; Carbone, Francis R.; Crabb, Brendan S.; Heath, William R.

    2014-01-01

    To follow the fate of CD8+ T cells responsive to Plasmodium berghei ANKA (PbA) infection, we generated an MHC I-restricted TCR transgenic mouse line against this pathogen. T cells from this line, termed PbT-I T cells, were able to respond to blood-stage infection by PbA and two other rodent malaria species, P. yoelii XNL and P. chabaudi AS. These PbT-I T cells were also able to respond to sporozoites and to protect mice from liver-stage infection. Examination of the requirements for priming after intravenous administration of irradiated sporozoites, an effective vaccination approach, showed that the spleen rather than the liver was the main site of priming and that responses depended on CD8α+ dendritic cells. Importantly, sequential exposure to irradiated sporozoites followed two days later by blood-stage infection led to augmented PbT-I T cell expansion. These findings indicate that PbT-I T cells are a highly versatile tool for studying multiple stages and species of rodent malaria and suggest that cross-stage reactive CD8+ T cells may be utilized in liver-stage vaccine design to enable boosting by blood-stage infections. PMID:24854165

  9. Contribution of mammary epithelial cells to the immune response during early stages of a bacterial infection to Staphylococcus aureus

    PubMed Central

    2014-01-01

    To differentiate between the contribution of mammary epithelial cells (MEC) and infiltrating immune cells to gene expression profiles of mammary tissue during early stage mastitis, we investigated in goats the in vivo transcriptional response of MEC to an experimental intra mammary infection (IMI) with Staphylococcus aureus, using a non-invasive RNA sampling method from milk fat globules (MFG). Microarrays were used to record gene expression patterns during the first 24 hours post-infection (hpi). This approach was combined with laser capture microdissection of MEC from frozen slides of mammary tissue to analyze some relevant genes at 30 hpi. During the early stages post-inoculation, MEC play an important role in the recruitment and activation of inflammatory cells through the IL-8 signalling pathway and initiate a sharp induction of innate immune genes predominantly associated with the pro-inflammatory response. At 30 hpi, MEC express genes encoding different acute phase proteins, including SAA3, SERPINA1 and PTX3 and factors, such as S100A12, that contribute directly to fighting the infection. No significant change in the expression of genes encoding caseins was observed until 24 hpi, thus validating our experimental model to study early stages of infection before the occurrence of tissue damage, since the milk synthesis function is still operative. This is to our knowledge the first report showing in vivo, in goats, how MEC orchestrate the innate immune response to an IMI challenge with S. aureus. Moreover, the non-invasive sampling method of mammary representative RNA from MFG provides a valuable tool to easily follow the dynamics of gene expression in MEC to search for sensitive biomarkers in milk for early detection of mastitis and therefore, to successfully improve the treatment and thus animal welfare. PMID:24521038

  10. Induction of immune response in macaque monkeys infected with simian-human immunodeficiency virus having the TNF-{alpha} gene at an early stage of infection

    SciTech Connect

    Shimizu, Yuya; Miyazaki, Yasuyuki; Ibuki, Kentaro; Suzuki, Hajime; Kaneyasu, Kentaro; Goto, Yoshitaka; Hayami, Masanori; Miura, Tomoyuki; Haga, Takeshi . E-mail: a0d518u@cc.miyazaki-u.ac.jp

    2005-12-20

    TNF-{alpha} has been implicated in the pathogenesis of, and the immune response against, HIV-1 infection. To clarify the roles of TNF-{alpha} against HIV-1-related virus infection in an SHIV-macaque model, we genetically engineered an SHIV to express the TNF-{alpha} gene (SHIV-TNF) and characterized the virus's properties in vivo. After the acute viremic stage, the plasma viral loads declined earlier in the SHIV-TNF-inoculated monkeys than in the parental SHIV (SHIV-NI)-inoculated monkeys. SHIV-TNF induced cell death in the lymph nodes without depletion of circulating CD4{sup +} T cells. SHIV-TNF provided some immunity in monkeys by increasing the production of the chemokine RANTES and by inducing an antigen-specific proliferation of lymphocytes. The monkeys immunized with SHIV-TNF were partly protected against a pathogenic SHIV (SHIV-C2/1) challenge. These findings suggest that TNF-{alpha} contributes to the induction of an effective immune response against HIV-1 rather than to the progression of disease at the early stage of infection.

  11. HIV Clade-C Infection and Cognitive Impairment, Fatigue, Depression, and Quality of Life in Early-Stage Infection in Northern Indians.

    PubMed

    Cook, R; Jones, D L; Nehra, R; Kumar, A M; Prabhakar, S; Waldrop-Valverde, D; Sharma, S; Kumar, M

    2016-07-01

    HIV disease progression is associated with declining quality of life and overall health status, although most research in this domain has been conducted among Western populations where B is the infecting clade. This study sought to determine the effects of early-stage clade-C HIV infection (CD4 count ≥400 cells/mm(3)) on neurocognitive functioning, cognitive depression, and fatigue by comparing a matched sample of HIV-positive and HIV-negative Northern Indians. This study also examined the impact of these factors on quality of life within the HIV-positive individuals. HIV-positive participants demonstrated reduced cognitive functioning, increased fatigue, and lower quality of life. Fatigue and cognitive impairment interacted to negatively impact quality of life. Results suggest that early-stage HIV clade-C-infected individuals may experience subclinical symptoms, and further research is needed to explore the benefit of therapeutic interventions to ensure optimal clinical outcomes and maintain quality of life in this vulnerable population. © The Author(s) 2013.

  12. Equine Cyathostominae can develop to infective third-stage larvae on straw bedding.

    PubMed

    Love, Sandy; Burden, Faith A; McGirr, Eoghan C; Gordon, Louise; Denwood, Matthew J

    2016-08-31

    Domesticated grazing animals including horses and donkeys are frequently housed using deep litter bedding systems, where it is commonly presumed that there is no risk of infection from the nematodes that are associated with grazing at pasture. We use two different approaches to test whether equids could become infected with cyathostomines from the ingestion of deep litter straw bedding. Two herbage plot studies were performed in horticultural incubators set up to simulate three straw bedding scenarios and one grass turf positive control. Faeces were placed on 16 plots, and larval recoveries performed on samples of straw/grass substrate over 2- to 3-week periods. Within each incubator, a thermostat was set to maintain an environmental temperature of approximately 10 °C to 20 °C. To provide further validation, 24 samples of straw bedding were collected over an 8-week period from six barns in which a large number of donkeys were housed in a deep litter straw bedding system. These samples were collected from the superficial bedding at 16 sites along a "W" route through each barn. No infective larvae were recovered from any of the plots containing dry straw. However, infective cyathostomine larvae were first detected on day 8 from plots containing moist straw. In the straw bedding study, cyathostomine larvae were detected in 18 of the 24 samples. Additionally, in the two barns which were sampled serially, the level of larval infectivity generally increased from week to week, except when the straw bedding was removed and replaced. We have demonstrated that equine cyathostomines can develop to infective larvae on moist straw bedding. It is therefore possible for a horse or donkey bedded in deep litter straw to become infected by ingesting the contaminated straw. This has implications for parasite control in stabled equids and potentially in housed ruminants, and further investigation is required in order to establish the relative infective pressure from pasture versus

  13. The stage-specific in vitro efficacy of a malaria antigen cocktail provides valuable insights into the development of effective multi-stage vaccines.

    PubMed

    Spiegel, Holger; Boes, Alexander; Kastilan, Robin; Kapelski, Stephanie; Edgue, Güven; Beiss, Veronique; Chubodova, Ivana; Scheuermayer, Matthias; Pradel, Gabriele; Schillberg, Stefan; Reimann, Andreas; Fischer, Rainer

    2015-10-01

    Multicomponent vaccines targeting different stages of Plasmodium falciparum represent a promising, holistic concept towards better malaria vaccines. Additionally, an effective vaccine candidate should demonstrate cross-strain specificity because many antigens are polymorphic, which can reduce vaccine efficacy. A cocktail of recombinant fusion proteins (VAMAX-Mix) featuring three diversity-covering variants of the blood-stage antigen PfAMA1, each combined with the conserved sexual-stage antigen Pfs25 and one of the pre-erythrocytic-stage antigens PfCSP_TSR or PfCelTOS, or the additional blood-stage antigen PfMSP1_19, was produced in Pichia pastoris and used to immunize rabbits. The immune sera and purified IgG were used to perform various assays determining antigen specific titers and in vitro efficacy against different parasite stages and strains. In functional in vitro assays we observed robust inhibition of blood-stage (up to 90%), and sexual-stage parasites (up to 100%) and biased inhibition of pre-erythrocytic parasites (0-40%). Cross-strain blood-stage efficacy was observed in erythrocyte invasion assays using four different P. falciparum strains. The quantification of antigen-specific IgGs allowed the determination of specific IC50 values. The significant difference in antigen-specific IC50 requirements, the direct correlation between antigen-specific IgG and the relative quantitative representation of antigens within the cocktail, provide valuable implementations for future multi-stage, multi-component vaccine designs.

  14. The Biting Midge Culicoides sonorensis (Diptera: Ceratopogonidae) Is Capable of Developing Late Stage Infections of Leishmania enriettii

    PubMed Central

    Seblova, Veronika; Sadlova, Jovana; Vojtkova, Barbora; Votypka, Jan; Carpenter, Simon; Bates, Paul Andrew; Volf, Petr

    2015-01-01

    Background Despite their importance in animal and human health, the epidemiology of species of the Leishmania enriettii complex remains poorly understood, including the identity of their biological vectors. Biting midges of the genus Forcipomyia (Lasiohelea) have been implicated in the transmission of a member of the L. enriettii complex in Australia, but the far larger and more widespread genus Culicoides has not been investigated for the potential to include vectors to date. Methodology/Principal Findings Females from colonies of the midges Culicoides nubeculosus Meigen and C. sonorensis Wirth & Jones and the sand fly Lutzomyia longipalpis Lutz & Nevia (Diptera: Psychodidae) were experimentally infected with two different species of Leishmania, originating from Australia (Leishmania sp. AM-2004) and Brazil (Leishmania enriettii). In addition, the infectivity of L. enriettii infections generated in guinea pigs and golden hamsters for Lu. longipalpis and C. sonorensis was tested by xenodiagnosis. Development of L. enriettii in Lu. longipalpis was relatively poor compared to other Leishmania species in this permissive vector. Culicoides nubeculosus was not susceptible to infection by parasites from the L. enriettii complex. In contrast, C. sonorensis developed late stage infections with colonization of the thoracic midgut and the stomodeal valve. In hamsters, experimental infection with L. enriettii led only to mild symptoms, while in guinea pigs L. enriettii grew aggressively, producing large, ulcerated, tumour-like lesions. A high proportion of C. sonorensis (up to 80%) feeding on the ears and nose of these guinea pigs became infected. Conclusions/Significance We demonstrate that L. enriettii can develop late stage infections in the biting midge Culicoides sonorensis. This midge was found to be susceptible to L. enriettii to a similar degree as Lutzomyia longipalpis, the vector of Leishmania infantum in South America. Our results support the hypothesis that some

  15. The effects of benzimidazoles on the larval stage of Toxocara cati in experimentally infected chickens.

    PubMed

    Oryan, A; Sadjjani, S M; Azizi, S

    2009-04-01

    Toxocara cati (T. cati) and Toxocara canis (T. canis), roundworms of cats and dogs, are zoonotic parasites that cause visceral and ocular larval migrans in human beings. Humans and other paratenic hosts are infected by ingesting the infective Toxocara eggs from contaminated soil, unwashed hands, contaminated raw vegetables or ingestion of under-cooked organs and muscle tissues of infected paratenic hosts such as chickens, cattle and sheep. It has been shown that the seroprevalence of toxocariasis in the rural and urban children of southern Iran is high and more than 50% of cats of this area are also infected with T. cati. It is stated that consumption of raw chicken meat resulted in visceral toxocariasis. It is possible that poultry reared outdoors and feeding in open range system, gain Toxocara eggs from soil and or by eating infected earthworms as paratenic host. The aim of the present study was to investigate the effects of albendazole and febendazole in experimentally infected chickens with eggs of T. cati by histopathological and digestive methods. Pathologic lesions were observed only in the untreated group and larvae were detected in brain of 3 chickens of this group by squash method. No larva was observed at histopathological level in liver, lungs, brain, cardiac and skeletal muscles and other examined organs of either treated or untreated animals. No lesion was seen in other tissues of the infected untreated chickens. Treatment resulted in disappearance of the larvae and disappearance of the gross and histopathologic abnormalities from their organs. No detectable difference was observed in chemosusceptibility of the two drugs.

  16. Transcriptional changes of cytokines in rooster testis and epididymis during sexual maturation stages and Salmonella infection.

    PubMed

    Anastasiadou, M; Michailidis, G

    2016-08-01

    Infection of rooster testis and epididymis by pathogens can lead to impaired fertility, resulting in economic losses in the poultry industry. Antimicrobial protection of rooster reproductive organs is, therefore, an important aspect of reproductive physiology. Salmonellosis is one of the most important zoonotic diseases, caused by Salmonella bacteria including Salmonella Enteritidis (SE) and is usually the result of infection of the reproductive organs. Thus, knowledge of the endogenous innate immune mechanisms of the rooster testis and epididymis is an emerging aspect of reproductive physiology. Cytokines are key factors for stimulating the immune response and inflammation in chickens to Salmonella infection. In the present study the expression profile of 11 pro-inflammatory cytokine genes in the rooster testis and epididymis in vivo and transcriptional changes in these organs during sexual maturation and SE infection were investigated. Gene expression analysis data revealed that in both testis and epididymis nine cytokines namely the IL-1β, IL-6, IL-8, IL-10, IL-12, IL-15, IL-16, IL-17 and IL-18 genes were expressed, while no mRNA transcripts were detected in both organs for IL-2 and IL-4. Furthermore, the expression of various cytokine genes during sexual maturation appeared to be developmentally regulated, while SE infection resulted in a significant up-regulation of IL-1β, -6, -12 and -18 genes in the testis and an increase in the mRNA relative abundance of IL-1β, -6, -12, -16 and -18 in the epididymis of SE-infected sexually mature 28-week-old roosters. These results suggest a cytokine-mediated immune response mechanism against Salmonella infection in the rooster reproductive tract. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. An intraoperatively moulded PMMA prostheses like spacer for two-stage revision of infected total knee arthroplasty.

    PubMed

    Kohl, Sandro; Evangelopoulos, Dimitrios S; Kohlhof, Hendrik; Krueger, Andreas; Hartel, Maximilian; Roeder, Christoph; Eggli, Stefan

    2011-12-01

    We report a series of 16 consecutive total knee arthroplasty (TKA) revision procedures for deep infection, treated with a newly developed intraoperatively moulded PMMA cement-prostheses-like spacer (CPLS). The standard treatment consisted of a two-stage protocol with initial explantation of the infected components combined with radical debridement, followed by implantation of a temporary cement spacer and final reimplantation of a new TKA. A sterilizeable Teflon tapered aluminium mould was developed for production of a custom made CPLS during the intervention. Stable implantation of the CPLS was achieved with a second cementation, allowing for correct alignment and ligament balancing. The spacer remained 3.5 months on average until reimplantation of a TKA occurred. At time of reimplantation, patients had an average KSS score of 84.44 points with an average flexion capacity of 102°. There was no recurrent infection during the study period of minimum 2 years. With this new technique, a low friction articulation with good stability, high comfort and a better range of motion compared to handcrafted spacers was achieved. The use of this spacer is a time sparing, cheap and convenient option in 2-stage TKA revision.

  18. Does infection with Human Immunodeficiency Virus affect the antibody responses to Plasmodium falciparum antigenic determinants in asymptomatic pregnant women?

    PubMed

    Ayisi, J G; Branch, OraLee H; Rafi-Janajreh, A; van Eijk, A M; ter Kuile, F O; Rosen, D H; Kager, P A; Lanar, D E; Barbosa, A; Kaslow, D; Nahlen, B L; Lal, A A

    2003-04-01

    HIV-seropositive pregnant women are more susceptible to malaria than HIV-seronegative women. We assessed whether HIV infection alters maternal and cord plasma malarial antibody responses and the mother-to-infant transfer of malaria antibodies. We determined plasma levels of maternal and cord antibodies [Immunoglobulin (IgG)] to recombinant malarial proteins [merozoite surface protein 1 (MSP-1(19kD)), the erythrocyte binding antigen (EBA-175)], the synthetic peptides [MSP-2, MSP-3, rhoptry associated protein 1 (RAP-1), and the pre-erythrocytic stage, circumsporozoite protein (NANP)(5)] antigenic determinants of Plasmodium falciparum; and tetanus toxoid (TT) by ELISA among samples of 99 HIV-seropositive mothers, 69 of their infants, 102 HIV-seronegative mothers and 62 of their infants. The prevalence of maternal antibodies to the malarial antigenic determinants ranged from 18% on MSP3 to 91% on EBA-175; in cord plasma it ranged from 13% to 91%, respectively. More than 97% of maternal and cord samples had antibodies to TT. In multivariate analysis, HIV infection was only associated with reduced antibodies to (NANP)(5) in maternal (P=0.001) and cord plasma (P=0.001); and reduced mother-to-infant antibody transfer to (NANP)(5) (P=0.012). This effect of HIV was independent of maternal age, gravidity and placental malaria. No consistent HIV-associated differences were observed for other antigenic determinants. An effect of HIV infection was only observed on one malarial antigenic determinant, suggesting that the increased susceptibility to malaria among HIV-infected pregnant women may not be explained on the basis of their reduced antibody response to malaria antigens.

  19. Efficacy of albendazole:β-cyclodextrin citrate in the parenteral stage of Trichinella spiralis infection.

    PubMed

    Codina, Ana V; García, Agustina; Leonardi, Darío; Vasconi, María D; Di Masso, Ricardo J; Lamas, María C; Hinrichsen, Lucila I

    2015-01-01

    Albendazole-β-cyclodextrin citrate (ABZ:C-β-CD) inclusion complex in vivo antiparasitic activity was evaluated in the parenteral phase of Trichinella spiralis infection in mice. An equimolar complex of ABZ:C-β-CD was prepared by spray-drying and tested in CBi-IGE male mice orally infected with L1 infective larvae. Infected animals were treated with 50 or 30mg/kg albendazole, (ABZ) equivalent amounts of the ABZ:C-β-CD complex and non treated (controls). Mice received a daily dose on days 28, 29 and 30 post-infection. A week later, larval burden and percentage of encysted dead larvae were assessed in the host by counting viable and non-viable larvae in the tongue. Complexation of ABZ with C-β-CD increased the drug dissolution efficiency nearly eightfold. At 37 days p-i, the reduction percentage in muscle larval load was 35% in mice treated with 50mg/kg/day ABZ and 68% in those given the complex. Treatment with the lower dose showed a similar decrease in parasite burden. Treated animals showed a high percentage of nonviable larvae, the proportion being significantly higher in mice receiving the complex than in control animals (72-88% vs. 11%, P=0.0032). These data indicate that ABZ:C-β-CD increases bioavailability and effectiveness of ABZ against encapsulated Trichinella larvae, thus allowing the use of small doses. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Serologic markers in early stages of African horse sickness virus infection.

    PubMed

    Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I

    1997-02-01

    Fifteen horses were experimentally infected with African horse sickness virus (AHSV) serotype 4. To learn more about the time course of production and specificity of AHSV-specific antibodies, sera were analyzed by immunoblot analysis. Only animals that survived for more than 9 days were able to develop a humoral immune response detectable by immunoblotting. The earliest serological markers corresponded mainly to VP5, VP6, and NS2 and to a lesser extent to VP3, NS1, and NS3. Neutralizing antibodies to VP2 were not detected by immunoblotting, suggesting that they are mostly conformation dependent. VP7-specific antibodies were detected later in infection. These results make NS2 and VP6 the most attractive candidates for the rapid diagnosis of the infection.

  1. Serologic markers in early stages of African horse sickness virus infection.

    PubMed Central

    Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I

    1997-01-01

    Fifteen horses were experimentally infected with African horse sickness virus (AHSV) serotype 4. To learn more about the time course of production and specificity of AHSV-specific antibodies, sera were analyzed by immunoblot analysis. Only animals that survived for more than 9 days were able to develop a humoral immune response detectable by immunoblotting. The earliest serological markers corresponded mainly to VP5, VP6, and NS2 and to a lesser extent to VP3, NS1, and NS3. Neutralizing antibodies to VP2 were not detected by immunoblotting, suggesting that they are mostly conformation dependent. VP7-specific antibodies were detected later in infection. These results make NS2 and VP6 the most attractive candidates for the rapid diagnosis of the infection. PMID:9003637

  2. Rate of detection of human herpesvirus-6 at different stages of HIV infection.

    PubMed

    Gautheret, A; Aubin, J T; Fauveau, V; Rozenbaum, W; Huraux, J M; Agut, H

    1995-09-01

    In a cross-sectional study, human herpesvirus-6 (HHV-6) infection was analysed by means of polymerase chain reaction in peripheral blood mononuclear cells (PBMCs) and saliva from 125 HIV-seropositive subjects and 29 HIV-seronegative controls. HHV-6 was detected in saliva significantly more frequently in HIV-seronegative subjects than in HIV-seropositive subjects (p = 0.023), with no significant difference between HIV-seropositive subgroups. The HIV proviral copy number in PBMCs differed significantly according to HIV subgroup, as expected, but did not differ according to either the presence of HHV-6 or the number of HHV-6 copies in PBMCs. All the HHV-6 identified were variant B except for one variant A strain detected in saliva from a healthy subject. These results do not support the hypothesis that there is synergistic activation of HHV-6 infection in the course of HIV infection.

  3. Multi-Agent Simulations of the Immune Response to Hiv during the Acute Stage of Infection

    NASA Astrophysics Data System (ADS)

    Walshe, R.; Ruskin, H. J.; Callaghan, A.

    Results of multi-agent based simulations of the immune response to HIV during the acute phase of infection are presented here. The model successfully recreates the viral dynamics associated with the acute phase of infection, i.e., a rapid rise in viral load followed by a sharp decline to what is often referred to as a "set point", a result of T-cell response and emergence of HIV neutralizing antibodies. The results indicate that sufficient T Killer cell response is the key factor in controlling viral growth during this phase with antibody levels of critical importance only in the absence of a sufficient T Killer response.

  4. Survival After HIV Infection Stage 3 (AIDS) Diagnosis, by Population Density Areas, United States, 2005-2010.

    PubMed

    Bosh, Karin A; Shi, Jing; Chen, Mi

    We examined the survival rates after diagnosis of HIV infection stage 3 (AIDS) in the United States by population density area of residence at diagnosis. We used data from the National HIV Surveillance System to calculate survival rates among people aged ≥13 with HIV infection stage 3 (AIDS) diagnosed from 2005 through 2010. We determined survival rates for more than 12, 24, and 36 months after diagnosis; overall and by demographic characteristics; and across 3 population density area categories (large metropolitan statistical areas [MSAs, ≥500 000 people], small-to-medium MSAs [50 000 to 499 999 people], and nonmetropolitan areas [<50 000 people]). The survival rates for more than 12, 24, and 36 months after diagnosis were highest among people residing in large MSAs (90.2%, 87.2%, and 84.9%, respectively) and lowest among people residing in nonmetropolitan areas (87.3%, 84.1%, and 81.4%, respectively). With a few exceptions, survival rates were lower in those residing in nonmetropolitan areas than those residing in large MSAs and small-to-medium MSAs across most subgroups by age at diagnosis, race/ethnicity, sex, transmission category, region of residence, and year of diagnosis. Between 2005 and 2010, significant year-to-year increases occurred in the proportion of people surviving more than 36 months after diagnosis across all 3 population density area categories (estimated annual percentage change: large MSAs [0.88; 95% confidence interval (CI), 0.56-1.20]; small-to-medium MSAs [0.94; 95% CI, 0.06-1.83]; and nonmetropolitan areas [1.26; 95% CI, 0.07-2.46]). Although survival rates for those with HIV infection stage 3 (AIDS) improved in all 3 population density area categories, efforts to remove barriers to care and promote treatment adherence in nonmetropolitan areas will be necessary to eliminate survival disparities.

  5. Humoral and Cellular Immunity to Plasmodium falciparum Merozoite Surface Protein 1 and Protection From Infection With Blood-Stage Parasites

    PubMed Central

    Moormann, Ann M.; Sumba, Peter Odada; Chelimo, Kiprotich; Fang, Hua; Tisch, Daniel J.; Dent, Arlene E.; John, Chandy C.; Long, Carole A.; Vulule, John; Kazura, James W.

    2013-01-01

    Background. Acquired immunity to malaria develops with increasing age and repeated infections. Understanding immune correlates of protection from malaria would facilitate vaccine development and identification of biomarkers that reflect changes in susceptibility resulting from ongoing malaria control efforts. Methods. The relationship between immunoglobulin G (IgG) antibody and both interferon γ (IFN-γ) and interleukin 10 (IL-10) responses to the 42-kD C-terminal fragment of Plasmodium falciparum merozoite surface protein 1 (MSP142) and the risk of (re)infection were examined following drug-mediated clearance of parasitemia in 94 adults and 95 children in an area of holoendemicity of western Kenya. Results. Positive IFN-γ enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunosorbent spot assay (ELISPOT) responses to MSP142 3D7 were associated with delayed time to (re)infection, whereas high-titer IgG antibodies to MSP142 3D7 or FVO alleles were not independently predictive of the risk of (re)infection. When IFN-γ and IL-10 responses were both present, the protective effect of IFN-γ was abrogated. A Cox proportional hazard model including IFN-γ, IL-10, MSP142 3D7 IgG antibody responses, hemoglobin S genotype, age, and infection status at baseline showed that the time to blood-stage infection correlated positively with IFN-γ responses and negatively with IL-10 responses, younger age, and asymptomatic parasitemia. Conclusions. Evaluating combined allele-specific cellular and humoral immunity elicited by malaria provides a more informative measure of protection relative to evaluation of either measure alone. PMID:23539744

  6. Humoral and cellular immunity to Plasmodium falciparum merozoite surface protein 1 and protection from infection with blood-stage parasites.

    PubMed

    Moormann, Ann M; Sumba, Peter Odada; Chelimo, Kiprotich; Fang, Hua; Tisch, Daniel J; Dent, Arlene E; John, Chandy C; Long, Carole A; Vulule, John; Kazura, James W

    2013-07-01

     Acquired immunity to malaria develops with increasing age and repeated infections. Understanding immune correlates of protection from malaria would facilitate vaccine development and identification of biomarkers that reflect changes in susceptibility resulting from ongoing malaria control efforts.  The relationship between immunoglobulin G (IgG) antibody and both interferon γ (IFN-γ) and interleukin 10 (IL-10) responses to the 42-kD C-terminal fragment of Plasmodium falciparum merozoite surface protein 1 (MSP142) and the risk of (re)infection were examined following drug-mediated clearance of parasitemia in 94 adults and 95 children in an area of holoendemicity of western Kenya.  Positive IFN-γ enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunosorbent spot assay (ELISPOT) responses to MSP142 3D7 were associated with delayed time to (re)infection, whereas high-titer IgG antibodies to MSP142 3D7 or FVO alleles were not independently predictive of the risk of (re)infection. When IFN-γ and IL-10 responses were both present, the protective effect of IFN-γ was abrogated. A Cox proportional hazard model including IFN-γ, IL-10, MSP142 3D7 IgG antibody responses, hemoglobin S genotype, age, and infection status at baseline showed that the time to blood-stage infection correlated positively with IFN-γ responses and negatively with IL-10 responses, younger age, and asymptomatic parasitemia.  Evaluating combined allele-specific cellular and humoral immunity elicited by malaria provides a more informative measure of protection relative to evaluation of either measure alone.

  7. Supplement of L-Arg improves protective immunity during early-stage Plasmodium yoelii 17XL infection.

    PubMed

    Zhu, X; Pan, Y; Li, Y; Cui, L; Cao, Y

    2012-01-01

    L-arginine (L-Arg), the precursor of nitric oxide (NO), plays multiple important roles in nutrient metabolism and immune regulation. L-Arg supplement serves as a potential adjunctive therapy for severe malaria, because it improves NO bioavailability and reverses endothelial dysfunction in severe malaria patients. In this study, we investigated the effect of dietary L-Arg supplement on host immune responses during subsequent malaria infection using the Plasmodium yoelii 17XL - BALB/c mouse model. We have shown that pretreatment of mice with L-Arg significantly decreased parasitemia and prolonged the survival time of mice after infection. L-Arg supplement led to significant increases in activated CD4(+)T-bet(+)IFN-γ(+) T cells and F4/80(+)CD36(+) macrophages during early-stage infection, which were accompanied by enhanced synthesis of IFN-γ, TNF-α and NO by spleen cells. Moreover, L-Arg-pretreated mice developed more splenic myeloid and plasmacytoid dendritic cells with up-regulated expression of MHC II, CD86 and TLR9. In comparison, L-Arg treatment did not change the number of regulatory T cells and the level of anti-inflammatory cytokine IL-10. Taken together, our results showed that L-Arg pretreatment could improve the protective immune response in experimental malaria infection in mice, which underlines potential importance of L-Arg supplement in malaria-endemic human populations.

  8. Detecting Presymptomatic Infection Is Necessary to Forecast Major Epidemics in the Earliest Stages of Infectious Disease Outbreaks

    PubMed Central

    Thompson, Robin N.; Gilligan, Christopher A.; Cunniffe, Nik J.

    2016-01-01

    We assess how presymptomatic infection affects predictability of infectious disease epidemics. We focus on whether or not a major outbreak (i.e. an epidemic that will go on to infect a large number of individuals) can be predicted reliably soon after initial cases of disease have appeared within a population. For emerging epidemics, significant time and effort is spent recording symptomatic cases. Scientific attention has often focused on improving statistical methodologies to estimate disease transmission parameters from these data. Here we show that, even if symptomatic cases are recorded perfectly, and disease spread parameters are estimated exactly, it is impossible to estimate the probability of a major outbreak without ambiguity. Our results therefore provide an upper bound on the accuracy of forecasts of major outbreaks that are constructed using data on symptomatic cases alone. Accurate prediction of whether or not an epidemic will occur requires records of symptomatic individuals to be supplemented with data concerning the true infection status of apparently uninfected individuals. To forecast likely future behavior in the earliest stages of an emerging outbreak, it is therefore vital to develop and deploy accurate diagnostic tests that can determine whether asymptomatic individuals are actually uninfected, or instead are infected but just do not yet show detectable symptoms. PMID:27046030

  9. Metabolic profiles of soybean roots during early stages of Fusarium tucumaniae infection

    USDA-ARS?s Scientific Manuscript database

    Soybean germplasm exhibits various levels of resistance to Fusarium tucumaniae, the main causal agent of sudden death syndrome (SDS) of soybean in Argentina. In this study, two soybean genotypes, one susceptible (NA 4613) and one partially resistant (DM 4670) to SDS infection, were inoculated with F...

  10. Persistence of Zika Virus in Breast Milk after Infection in Late Stage of Pregnancy

    PubMed Central

    Sotelo, José R.; Sotelo, Andre B.; Sotelo, Fabio J.B.; Pinho, Joao R.R.; Oliveira, Rita de Cassia; Bezerra, Alanna M.P.S.; Deutsch, Alice D.; Villas-Boas, Lucy S.; Felix, Alvina C.; Romano, Camila M.; Machado, Clarisse M.; Mendes-Correa, Maria C.J.; Santana, Rubia A.F.; Menezes, Fernando G.; Mangueira, Cristovao L.P.

    2017-01-01

    We detected Zika virus in breast milk of a woman in Brazil infected with the virus during the 36th week of pregnancy. Virus was detected 33 days after onset of signs and symptoms and 9 days after delivery. No abnormalities were found during fetal assessment or after birth of the infant. PMID:28192072

  11. Persistence of Zika Virus in Breast Milk after Infection in Late Stage of Pregnancy.

    PubMed

    Sotelo, José R; Sotelo, Andre B; Sotelo, Fabio J B; Doi, André M; Pinho, Joao R R; Oliveira, Rita de Cassia; Bezerra, Alanna M P S; Deutsch, Alice D; Villas-Boas, Lucy S; Felix, Alvina C; Romano, Camila M; Machado, Clarisse M; Mendes-Correa, Maria C J; Santana, Rubia A F; Menezes, Fernando G; Mangueira, Cristovao L P

    2017-05-01

    We detected Zika virus in breast milk of a woman in Brazil infected with the virus during the 36th week of pregnancy. Virus was detected 33 days after onset of signs and symptoms and 9 days after delivery. No abnormalities were found during fetal assessment or after birth of the infant.

  12. Longevity of the immune response and memory to blood-stage malaria infection.

    PubMed

    Achtman, A H; Bull, P C; Stephens, R; Langhorne, J

    2005-01-01

    Immunity to malaria develops slowly with protection against the parasite lagging behind protection against disease symptoms. The data on the longevity of protective immune responses are sparse. However, studies of antibody responses associated with protection reveal that they consist of a short- and a long-lived component. Compared with the antibody levels observed in other infection and immunization systems, the levels of the short-lived antibody compartment drop below the detectable threshold with unusual rapidity. The prevalence of long-lived antibodies is comparable to that seen after bacterial and protozoan infections. There is even less available data concerning T cell longevity in malaria infection, but what there is seems to indicate that T cell memory is short in the absence of persistent antigen. In general, the degree and duration of parasite persistence represent a major factor determining how immune response longevity and protection correlate. The predilection for short-lived immune responses in malaria infection could be caused by a number of mechanisms resulting from the interplay of normal regulatory mechanisms of the immune system and immune evasion by the parasite. In conclusion, it appears that the parasite-host relationship has developed to favor some short-lived responses, which allow the host to survive while allowing the parasite to persist. Anti-malarial immune responses present a complex picture, and many aspects of regulation and longevity of the response require further research.

  13. Susceptibility of larvae of Galleria mellonella to infection by Aspergillus fumigatus is dependent upon stage of conidial germination.

    PubMed

    Renwick, Julie; Daly, Paul; Reeves, Emer P; Kavanagh, Kevin

    2006-06-01

    The ability of conidia of the human pathogenic fungus Aspergillus fumigatus to kill larvae of the insect Galleria mellonella was investigated. Conidia at different stages of the germination process displayed variations in their virulence as measured using the Galleria infection model. Non-germinating ('resting') conidia were avirulent except when an inoculation density of 1 x 10(7) conidia per insect was used. Conidia that had been induced to commence the germination process by pre-culturing in growth medium for 3 h were capable of killing larvae at densities of 1 x 10(6) and 1 x 10(7) per insect. An inoculation density of 1 x 10(5) conidia per insect remained avirulent. Conidia in the outgrowth phase of germination (characterised as the formation of a germ tube) were the most virulent and were capable of killing 100% of larvae after 5 or 24 h when 1 x 10(7) or 1 x 10(6) conidia, that had been allowed to germinate for 24 h, were used. Examination of the response of insect haemocytes to conidia at different stages of the germination process established that haemocytes could engulf non-germinating conidia and those in the early stages of the germination process but that conidia, which had reached the outgrowth stages of germination were not phagocytosed. The results presented here indicate that haemocytes of G. mellonella are capable of phagocytosing A. fumigatus conidia less than 3.0 microm in diameter but that conidia greater than this are too large to be engulfed. The virulence of A. fumigatus in G. mellonella larvae can be ascertained within 60-90 h if infection densities of 1 x 10(6) or 1 x 10(7) activated conidia (pre-incubated for 2-3 h) per insect are employed.

  14. Effect of ageing on neurocognitive function by stage of HIV infection: evidence from the Multicenter AIDS Cohort Study.

    PubMed

    Goodkin, Karl; Miller, Eric N; Cox, Christopher; Reynolds, Sandra; Becker, James T; Martin, Eileen; Selnes, Ola A; Ostrow, David G; Sacktor, Ned C

    2017-09-01

    The demographics of the HIV epidemic in the USA have shifted towards older age. We aimed to establish the relationship between the processes of ageing and HIV infection in neurocognitive impairment. With longitudinal data from the Multicenter AIDS Cohort Study, a long-term prospective cohort study of the natural and treated history of HIV infection among men who have sex with men in the USA, we examined the effect of ageing, HIV infection (by disease stage), and their interaction on five neurocognitive domains: information processing speed, executive function, episodic memory, working memory, and motor function. We controlled for duration of serostatus in a subanalysis, as well as comorbidities and other factors that affect cognition. Analyses were by linear mixed models for longitudinal data. 5086 participants (47 886 visits) were included in the analytic sample (2278 HIV-seropositive participants contributed 20 477 visits and 2808 HIV-seronegative control participants contributed 27 409 visits). In an a-priori multivariate analysis with control variables including comorbidities and time since seroconversion, significant, direct negative effects of ageing were noted on all neurocognitive domains (p<0·0001 for all). Similar effects were noted for late-stage HIV disease progression on information processing speed (p=0·002), executive function (p<0·0001), motor function (p<0·0001), and working memory (p=0·001). Deleterious interaction effects were also noted in the domains of episodic memory (p=0·03) and motor function (p=0·02). A greater than expected effect of ageing on episodic memory and motor function with advanced stages of HIV infection suggests that these two domains are most susceptible to the progression of neurocognitive impairment caused by ageing in individuals with HIV. This deficit pattern suggests differential damage to the hippocampus and basal ganglia (specifically nigrostriatal pathways). Older individuals with HIV infection should be

  15. Functional Impairment of Myeloid Dendritic Cells during Advanced Stage of HIV-1 Infection: Role of Factors Regulating Cytokine Signaling.

    PubMed

    Sachdeva, Meenakshi; Sharma, Aman; Arora, Sunil K

    2015-01-01

    Severely immunocompromised state during advanced stage of HIV-1 infection has been linked to functionally defective antigen presentation by dendritic cells (DCs). The molecular mechanisms behind DC impairment are still obscure. We investigated changes in DC function and association of key regulators of cytokine signaling during different stages of HIV-1 infection and following antiretroviral therapy (ART). Phenotypic and functional characteristics of circulating myeloid DCs (mDCs) in 56 ART-naive patients (23 in early and 33 in advanced stage of disease), 36 on ART and 24 healthy controls were evaluated. Sixteen patients were studied longitudinally prior-to and 6 months after the start of ART. For functional studies, monocyte-derived DCs (Mo-DCs) were evaluated for endocytosis, allo-stimulation and cytokine secretion. The expression of suppressor of cytokine signaling (SOCS)-1 and other regulators of cytokine signaling was evaluated by real-time RT-PCR. The ability to respond to an antigenic stimulation was severely impaired in patients in advanced HIV-1 disease which showed partial recovery in the treated group. Mo-DCs from patients with advanced HIV-disease remained immature with low allo-stimulation and reduced cytokine secretion even after TLR-4 mediated stimulation ex-vivo. The cells had an increased expression of negative regulatory factors like SOCS-1, SOCS-3, SH2-containing phosphatase (SHP)-1 and a reduced expression of positive regulators like Janus kinase (JAK)2 and Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB)1. A functional recovery after siRNA mediated silencing of SOCS-1 in these mo-DCs confirms the role of negative regulatory factors in functional impairment of these cells. Functionally defective DCs in advanced stage of HIV-1 infection seems to be due to imbalanced state of negative and positive regulatory gene expression. Whether this is a cause or effect of increased viral replication at this stage of disease, needs

  16. Functional Impairment of Myeloid Dendritic Cells during Advanced Stage of HIV-1 Infection: Role of Factors Regulating Cytokine Signaling

    PubMed Central

    Sachdeva, Meenakshi; Sharma, Aman; Arora, Sunil K.

    2015-01-01

    Introduction Severely immunocompromised state during advanced stage of HIV-1 infection has been linked to functionally defective antigen presentation by dendritic cells (DCs). The molecular mechanisms behind DC impairment are still obscure. We investigated changes in DC function and association of key regulators of cytokine signaling during different stages of HIV-1 infection and following antiretroviral therapy (ART). Methods Phenotypic and functional characteristics of circulating myeloid DCs (mDCs) in 56 ART-naive patients (23 in early and 33 in advanced stage of disease), 36 on ART and 24 healthy controls were evaluated. Sixteen patients were studied longitudinally prior-to and 6 months after the start of ART. For functional studies, monocyte-derived DCs (Mo-DCs) were evaluated for endocytosis, allo-stimulation and cytokine secretion. The expression of suppressor of cytokine signaling (SOCS)-1 and other regulators of cytokine signaling was evaluated by real-time RT-PCR. Results The ability to respond to an antigenic stimulation was severely impaired in patients in advanced HIV-1 disease which showed partial recovery in the treated group. Mo-DCs from patients with advanced HIV-disease remained immature with low allo-stimulation and reduced cytokine secretion even after TLR-4 mediated stimulation ex-vivo. The cells had an increased expression of negative regulatory factors like SOCS-1, SOCS-3, SH2-containing phosphatase(SHP)-1 and a reduced expression of positive regulators like Janus kinase(JAK)2 and Nuclear factor kappa-light-chain-enhancer of activated B cells(NF-κB)1. A functional recovery after siRNA mediated silencing of SOCS-1 in these mo-DCs confirms the role of negative regulatory factors in functional impairment of these cells. Conclusions Functionally defective DCs in advanced stage of HIV-1 infection seems to be due to imbalanced state of negative and positive regulatory gene expression. Whether this is a cause or effect of increased viral

  17. The Role of Nuclear Medicine in the Staging and Management of Human Immune Deficiency Virus Infection and Associated Diseases.

    PubMed

    Ankrah, Alfred O; Glaudemans, Andor W J M; Klein, Hans C; Dierckx, Rudi A J O; Sathekge, Mike

    2017-06-01

    Human immune deficiency virus (HIV) is a leading cause of death. It attacks the immune system, thereby rendering the infected host susceptible to many HIV-associated infections, malignancies and neurocognitive disorders. The altered immune system affects the way the human host responds to disease, resulting in atypical presentation of these disorders. This presents a diagnostic challenge and the clinician must use all diagnostic avenues available to diagnose and manage these conditions. The advent of highly active antiretroviral therapy (HAART) has markedly reduced the mortality associated with HIV infection but has also brought in its wake problems associated with adverse effects or drug interaction and may even modulate some of the HIV-associated disorders to the detriment of the infected human host. Nuclear medicine techniques allow non-invasive visualisation of tissues in the body. By using this principle, pathophysiology in the body can be targeted and the treatment of diseases can be monitored. Being a functional imaging modality, it is able to detect diseases at the molecular level, and thus it has increased our understanding of the immunological changes in the infected host at different stages of the HIV infection. It also detects pathological changes much earlier than conventional imaging based on anatomical changes. This is important in the immunocompromised host as in some of the associated disorders a delay in diagnosis may have dire consequences. Nuclear medicine has played a huge role in the management of many HIV-associated disorders in the past and continues to help in the diagnosis, prognosis, staging, monitoring and assessing the response to treatment of many HIV-associated disorders. As our understanding of the molecular basis of disease increases nuclear medicine is poised to play an even greater role. In this review we highlight the functional basis of the clinicopathological correlation of HIV from a metabolic view and discuss how the use of

  18. Molecular basis of early stages of Clostridium difficile infection: germination and colonization.

    PubMed

    Sarker, Mahfuzur R; Paredes-Sabja, Daniel

    2012-08-01

    Clostridium difficile infections (CDIs) occur when antibiotic therapy disrupts the gastrointestinal flora, favoring infected C. difficile spores to germinate, outgrow, colonize and produce toxins. During CDI, C. difficile vegetative cells initiate the process of sporulation allowing a fraction of the spores to remain adhered to the intestinal surfaces. These spores, which are unaffected by antibiotic therapy commonly used for CDIs, then germinate, outgrow and recolonize the host's GI tract causing relapse of CDI. Consequently, the germination and colonization processes can be considered as the earliest and most essential steps for the development as well as relapse of CDI. The aim of this review is to provide an overview on the molecular basis involved in C. difficile spore germination and colonization.

  19. Iridovirus Bcl-2 protein inhibits apoptosis in the early stage of viral infection.

    PubMed

    Lin, Pei-Wen; Huang, Yi-Jen; John, Joseph Abraham Christopher; Chang, Ya-Nan; Yuan, Chung-Hsiang; Chen, Wen-Ya; Yeh, Chiao-Hwa; Shen, San-Tai; Lin, Fu-Pang; Tsui, Wen-Huei; Chang, Chi-Yao

    2008-01-01

    The grouper iridovirus (GIV) belongs to the family Iridoviridae, whose genome contains an antiapoptotic B-cell lymphoma (Bcl)-2-like gene. This study was carried-out to understand whether GIV blocks apoptosis in its host. UV-irradiated grouper kidney (GK) cells underwent apoptosis. However, a DNA fragmentation assay of UV-exposed GK cells after GIV infection revealed an inhibition of apoptosis. The UV- or heat-inactivated GIV failed to inhibit apoptosis, implying that a gene or protein of the viral particle might contribute to an apoptosis inhibitory function. The DNA ladder assay for GIV-infected GK cells after UV irradiation confirmed that apoptosis inhibition was an early process which occurred as early as 5 min post-infection. A GIV-Bcl sequence comparison showed distant sequence similarities to that of human and four viruses; however, all possessed the putative Bcl-2 homology (BH) domains of BH1, BH2, BH3, and BH4, as well as a transmembrane domain. Northern blot hybridization showed that GIV-Bcl transcription began at 2 h post-infection, and the mRNA level significantly increased in the presence of cycloheximide or aphidicolin, indicating that this GIV-Bcl is an immediate-early gene. This was consistent with the Western blot results, which also revealed that the virion carries the Bcl protein. We observed the localization of GIV-Bcl on the mitochondrial membrane and other defined intracellular areas. By immunostaining, it was proven that GIV-Bcl-expressing cells effectively inhibited apoptosis. Taken together, these results demonstrate that GIV inhibits the promotion of apoptosis by GK cells, which is mediated by the immediate early expressed viral Bcl gene.

  20. Exacerbation of autoimmune neuro-inflammation in mice cured from blood-stage Plasmodium berghei infection.

    PubMed

    Thomé, Rodolfo; Bombeiro, André Luis; Issayama, Luidy Kazuo; Rapôso, Catarina; Lopes, Stefanie Costa Pinto; da Costa, Thiago Alves; Di Gangi, Rosária; Ferreira, Isadora Tassinari; Longhini, Ana Leda Figueiredo; Oliveira, Alexandre Leite Rodrigues; da Cruz Höfling, Maria Alice; Costa, Fábio Trindade Maranhão; Verinaud, Liana

    2014-01-01

    The thymus plays an important role shaping the T cell repertoire in the periphery, partly, through the elimination of inflammatory auto-reactive cells. It has been shown that, during Plasmodium berghei infection, the thymus is rendered atrophic by the premature egress of CD4+CD8+ double-positive (DP) T cells to the periphery. To investigate whether autoimmune diseases are affected after Plasmodium berghei NK65 infection, we immunized C57BL/6 mice, which was previously infected with P. berghei NK65 and treated with chloroquine (CQ), with MOG35-55 peptide and the clinical course of Experimental Autoimmune Encephalomyelitis (EAE) was evaluated. Our results showed that NK65+CQ+EAE mice developed a more severe disease than control EAE mice. The same pattern of disease severity was observed in MOG35-55-immunized mice after adoptive transfer of P. berghei-elicited splenic DP-T cells. The higher frequency of IL-17+- and IFN-γ+-producing DP lymphocytes in the Central Nervous System of these mice suggests that immature lymphocytes contribute to disease worsening. To our knowledge, this is the first study to integrate the possible relationship between malaria and multiple sclerosis through the contribution of the thymus. Notwithstanding, further studies must be conducted to assert the relevance of malaria-induced thymic atrophy in the susceptibility and clinical course of other inflammatory autoimmune diseases.

  1. Batrachochytrium dendrobatidis infection patterns among Panamanian amphibian species, habitats and elevations during epizootic and enzootic stages.

    PubMed

    Brem, Forrest M R; Lips, Karen R

    2008-09-24

    The pathogenic fungus Batrachochytrium dendrobatidis (Bd) has caused declines of many amphibian populations, yet the full course of the epizootic has rarely been observed in wild populations. We determined effects of elevation, habitat, and aquatic index (AI) on prevalence of infection among Panamanian amphibians sampled along 2 elevational transects. Amphibian populations on the Santa Fé transect (SFT) had declined in 2002, while those on the El Copé transect (ECT) were healthy until September 2004. In 2004 we sampled Bd along both transects, surveying the SFT 2 yr after decline, and surveying the ECT 4 mo prior to the arrival of Bd, during the epizootic, and 2 mo later. Overall prevalence of Bd along the ECT increased from 0.0 (95% CI 0.00-0.0003) to 0.51 (95% CI 0.48-0.55) over a 3 mo period, accompanied by significant decreases in amphibian abundance and species richness in all habitats. Prevalence of infection on the ECT was highest along riparian transects and at higher elevations, but not among levels of AI. Prevalence of infection on the SFT was highest in pool transects, and at higher elevations, but not among levels of AI. Riparian amphibian abundance and species richness also declined at SFT following detection of Bd in 2002. Variation among species, microenvironmental conditions, and the length of coexistence with Bd may contribute to observed differences in prevalence of Bd and in population response.

  2. Surface Proteome of “Mycobacterium avium subsp. hominissuis” during the Early Stages of Macrophage Infection

    PubMed Central

    McNamara, Michael; Tzeng, Shin-Cheng; Maier, Claudia; Zhang, Li

    2012-01-01

    “Mycobacterium avium subsp. hominissuis” is a robust and pervasive environmental bacterium that can cause opportunistic infections in humans. The bacterium overcomes the host immune response and is capable of surviving and replicating within host macrophages. Little is known about the bacterial mechanisms that facilitate these processes, but it can be expected that surface-exposed proteins play an important role. In this study, the selective biotinylation of surface-exposed proteins, streptavidin affinity purification, and shotgun mass spectrometry were used to characterize the surface-exposed proteome of M. avium subsp. hominissuis. This analysis detected more than 100 proteins exposed at the bacterial surface of M. avium subsp. hominissuis. Comparisons of surface-exposed proteins between conditions simulating early infection identified several groups of proteins whose presence on the bacterial surface was either constitutive or appeared to be unique to specific culture conditions. This proteomic profile facilitates an improved understanding of M. avium subsp. hominissuis and how it establishes infection. Additionally, surface-exposed proteins are excellent targets for the host adaptive immune system, and their identification can inform the development of novel treatments, diagnostic tools, and vaccines for mycobacterial disease. PMID:22392927

  3. Early stage of Epstein-Barr virus lytic infection leading to the "starry sky" pattern formation in endemic Burkitt lymphoma.

    PubMed

    Fujita, Shuichi; Buziba, Nathan; Kumatori, Atsushi; Senba, Masachika; Yamaguchi, Akira; Toriyama, Kan

    2004-05-01

    Burkitt lymphoma (BL) is histologically characterized by a "starry sky" appearance, representing scattered macrophages that have phagocytosed cell debris among proliferating lymphoma cells. As is well known, almost all the neoplastic cells of endemic BL are infected with Epstein-Barr virus (EBV). Previous studies have indicated that most of the EBV in B cells is latent, and few virus particles enter the lytic cycle. To examine the histologic relationship between EBV infection stages and the formation of the starry sky pattern in African endemic BL tissues. Tissue samples from 44 patients with African endemic BL were examined with immunohistochemistry and in situ hybridization. We used EBV-encoded small RNA (EBER) as a marker of latent infection, and BamHI H left frame 1 (BHLF1) and BamHI Z EBV replication activator (ZEBRA) as lytic cycle markers. In all cases, signals for EBER were found in most neoplastic lymphocytes, and in 73% of cases, signals for BHLF1 and/or ZEBRA were recognized in the lymphoma cells within and around the lacunae in starry sky figures. The mean number of lacunae per unit area in cases positive for lytic cycle markers was significantly higher than that in negative cases (P <.001). Our findings suggest that EBV-infected lymphoma cells in the lytic cycle, which eventually lapse into cell death, are phagocytosed prior to their rupture by macrophages that have migrated into the parenchyma. We emphasize that transition of EBV-infected lymphoma cells to the lytic cycle is one of the histomorphogenetic factors influencing the formation of starry sky pattern in endemic BL.

  4. Filaria-induced immune evasion: suppression by the infective stage of Brugia malayi at the earliest host-parasite interface.

    PubMed

    Semnani, Roshanak Tolouei; Law, Melissa; Kubofcik, Joseph; Nutman, Thomas B

    2004-05-15

    To assess the physiologic interactions between the infective stage of Brugia malayi--one of the extracellular parasites responsible for lymphatic filariasis in humans--and the APC with which they come in contact during their development and routes of travel, we have investigated the interaction between the infective stage (L3) of B. malayi and human Langerhans cells (LC) in the skin. Our data indicate that live L3 result in increased migration of LC from the epidermis without affecting the viability of these cells and up-regulation of the IL-18 cytokine involved in LC migration. Live L3 also result in down-regulation of MHC class I and II on the LC cell surface. Additionally, microarray data indicate that live L3 significantly down-regulated expression of IL-8 as well as of multiple genes involved in Ag presentation, reducing the capacity of LC to induce CD4(+) T cells in allogeneic MLR, and thus resulting in a decreased ability of LC to promote CD4(+) T cell proliferation and production of IFN-gamma and IL-10. These data suggest that L3 exert a down-regulatory response in epidermal LC that leads to a diminished capacity of these cells to activate CD4(+) T cells.

  5. IFNAR1-Signalling Obstructs ICOS-mediated Humoral Immunity during Non-lethal Blood-Stage Plasmodium Infection

    PubMed Central

    Sebina, Ismail; James, Kylie R.; Soon, Megan S. F.; Best, Shannon E.; Montes de Oca, Marcela; Amante, Fiona H.; Thomas, Bryce S.; Beattie, Lynette; Souza-Fonseca-Guimaraes, Fernando; Smyth, Mark J.; Hertzog, Paul J.; Hill, Geoffrey R.; Engwerda, Christian R.

    2016-01-01

    Parasite-specific antibodies protect against blood-stage Plasmodium infection. However, in malaria-endemic regions, it takes many months for naturally-exposed individuals to develop robust humoral immunity. Explanations for this have focused on antigenic variation by Plasmodium, but have considered less whether host production of parasite-specific antibody is sub-optimal. In particular, it is unclear whether host immune factors might limit antibody responses. Here, we explored the effect of Type I Interferon signalling via IFNAR1 on CD4+ T-cell and B-cell responses in two non-lethal murine models of malaria, P. chabaudi chabaudi AS (PcAS) and P. yoelii 17XNL (Py17XNL) infection. Firstly, we demonstrated that CD4+ T-cells and ICOS-signalling were crucial for generating germinal centre (GC) B-cells, plasmablasts and parasite-specific antibodies, and likewise that T follicular helper (Tfh) cell responses relied on B cells. Next, we found that IFNAR1-signalling impeded the resolution of non-lethal blood-stage infection, which was associated with impaired production of parasite-specific IgM and several IgG sub-classes. Consistent with this, GC B-cell formation, Ig-class switching, plasmablast and Tfh differentiation were all impaired by IFNAR1-signalling. IFNAR1-signalling proceeded via conventional dendritic cells, and acted early by limiting activation, proliferation and ICOS expression by CD4+ T-cells, by restricting the localization of activated CD4+ T-cells adjacent to and within B-cell areas of the spleen, and by simultaneously suppressing Th1 and Tfh responses. Finally, IFNAR1-deficiency accelerated humoral immune responses and parasite control by boosting ICOS-signalling. Thus, we provide evidence of a host innate cytokine response that impedes the onset of humoral immunity during experimental malaria. PMID:27812214

  6. Resistance to antibody neutralization in HIV-2 infection occurs in late stage disease and is associated with X4 tropism.

    PubMed

    Marcelino, José M; Borrego, Pedro; Nilsson, Charlotta; Família, Carlos; Barroso, Helena; Maltez, Fernando; Doroana, Manuela; Antunes, Francisco; Quintas, Alexandre; Taveira, Nuno

    2012-11-28

    To characterize the nature and dynamics of the neutralizing antibody (NAb) response and escape in chronically HIV-2 infected patients. Twenty-eight chronically infected adults were studied over a period of 1-4 years. The neutralizing activity of plasma immunoglobulin G (IgG) antibodies against autologous and heterologous primary isolates was analyzed using a standard assay in TZM-bl cells. Coreceptor usage was determined in ghost cells. The sequence and predicted three-dimensional structure of the C2V3C3 Env region were determined for all isolates. Only 50% of the patients consistently produced IgG NAbs to autologous and contemporaneous virus isolates. In contrast, 96% of the patients produced IgG antibodies that neutralized at least two isolates of a panel of six heterologous R5 isolates. Breadth and potency of the neutralizing antibodies were positively associated with the number of CD4(+) T cells and with the titer and avidity of C2V3C3-specific binding IgG antibodies. X4 isolates were obtained only from late stage disease patients and were fully resistant to neutralization. The V3 loop of X4 viruses was longer, had a higher net charge, and differed markedly in secondary structure compared to R5 viruses. Most HIV-2 patients infected with R5 isolates produce C2V3C3-specific neutralizing antibodies whose potency and breadth decreases as the disease progresses. Resistance to antibody neutralization occurs in late stage disease and is usually associated with X4 viral tropism and major changes in V3 sequence and conformation. Our studies support a model of HIV-2 pathogenesis in which the neutralizing antibodies play a central role and have clear implications for the vaccine field.

  7. Molecular characterization of occult hepatitis B virus infection in patients with end-stage liver disease in Colombia.

    PubMed

    Rendon, Julio Cesar; Cortes-Mancera, Fabian; Restrepo-Gutierrez, Juan Carlos; Hoyos, Sergio; Navas, Maria-Cristina

    2017-01-01

    Hepatitis B virus (HBV) occult infection (OBI) is a risk factor to be taken into account in transfusion, hemodialysis and organ transplantation. The aim of this study was to identify and characterize at the molecular level OBI cases in patients with end-stage liver disease. Sixty-six liver samples were obtained from patients with diagnosis of end-stage liver disease submitted to liver transplantation in Medellin (North West, Colombia). Samples obtained from patients who were negative for the surface antigen of HBV (n = 50) were tested for viral DNA detection by nested PCR for ORFs S, C, and X and confirmed by Southern-Blot. OBI cases were analyzed by sequencing the viral genome to determine the genotype and mutations; additionally, viral genome integration events were examined by the Alu-PCR technique. In five cases out of 50 patients (10%) the criteria for OBI was confirmed. HBV genotype F (subgenotypes F1 and F3), genotype A and genotype D were characterized in liver samples. Three integration events in chromosomes 5q14.1, 16p13 and 20q12 affecting Receptor-type tyrosine-protein phosphatase T, Ras Protein Specific Guanine Nucleotide Releasing Factor 2, and the zinc finger 263 genes were identified in two OBI cases. Sequence analysis of the viral genome of the 5 OBI cases showed several punctual missense and nonsense mutations affecting ORFs S, P, Core and X. This is the first characterization of OBI in patients with end-stage liver disease in Colombia. The OBI cases were identified in patients with HCV infection or cryptogenic cirrhosis. The integration events (5q14.1, 16p13 and 20q12) described in this study have not been previously reported. Further studies are required to validate the role of mutations and integration events in OBI pathogenesis.

  8. Molecular characterization of occult hepatitis B virus infection in patients with end-stage liver disease in Colombia

    PubMed Central

    Rendon, Julio Cesar; Cortes-Mancera, Fabian; Restrepo-Gutierrez, Juan Carlos; Hoyos, Sergio

    2017-01-01

    Background Hepatitis B virus (HBV) occult infection (OBI) is a risk factor to be taken into account in transfusion, hemodialysis and organ transplantation. The aim of this study was to identify and characterize at the molecular level OBI cases in patients with end-stage liver disease. Methods Sixty-six liver samples were obtained from patients with diagnosis of end-stage liver disease submitted to liver transplantation in Medellin (North West, Colombia). Samples obtained from patients who were negative for the surface antigen of HBV (n = 50) were tested for viral DNA detection by nested PCR for ORFs S, C, and X and confirmed by Southern-Blot. OBI cases were analyzed by sequencing the viral genome to determine the genotype and mutations; additionally, viral genome integration events were examined by the Alu-PCR technique. Results In five cases out of 50 patients (10%) the criteria for OBI was confirmed. HBV genotype F (subgenotypes F1 and F3), genotype A and genotype D were characterized in liver samples. Three integration events in chromosomes 5q14.1, 16p13 and 20q12 affecting Receptor-type tyrosine-protein phosphatase T, Ras Protein Specific Guanine Nucleotide Releasing Factor 2, and the zinc finger 263 genes were identified in two OBI cases. Sequence analysis of the viral genome of the 5 OBI cases showed several punctual missense and nonsense mutations affecting ORFs S, P, Core and X. Conclusions This is the first characterization of OBI in patients with end-stage liver disease in Colombia. The OBI cases were identified in patients with HCV infection or cryptogenic cirrhosis. The integration events (5q14.1, 16p13 and 20q12) described in this study have not been previously reported. Further studies are required to validate the role of mutations and integration events in OBI pathogenesis. PMID:28686707

  9. Fighting while Parasitized: Can Nematode Infections Affect the Outcome of Staged Combat in Beetles?

    PubMed Central

    Vasquez, David; Willoughby, Anna; Davis, Andrew K.

    2015-01-01

    The effects of non-lethal parasites may be felt most strongly when hosts engage in intense, energy-demanding behaviors. One such behavior is fighting with conspecifics, which is common among territorial animals, including many beetle species. We examined the effects of parasites on the fighting ability of a saproxylic beetle, the horned passalus (Odontotaenius disjunctus, Family: Passalidae), which is host to a non-lethal nematode, Chondronema passali. We pitted pairs of randomly-chosen (but equally-weighted) beetles against each other in a small arena and determined the winner and aggression level of fights. Then we examined beetles for the presence, and severity of nematode infections. There was a non-significant tendency (p = 0.065) for the frequency of wins, losses and draws to differ between beetles with and without C. passali; non-parasitized individuals (n = 104) won 47% of their fights while those with the parasite (n = 88) won 34%, a 13% difference in wins. The number of nematodes in a beetle affected the outcome of fights between infected and uninfected individuals in an unexpected fashion: fighting ability was lowest in beetles with the lowest (p = 0.033), not highest (p = 0.266), nematode burdens. Within-fight aggression was highest when both beetles were uninfected and lowest when both were infected (p = 0.034). Collectively, these results suggest the nematode parasite, C. passali, is associated with a modest reduction in fighting ability in horned passalus beetles, consistent with the idea that parasitized beetles have lower energy available for fighting. This study adds to a small but growing body of evidence showing how parasites negatively influence fighting behavior in animals. PMID:25830367

  10. Ribavirin mitigates wart growth in rabbits at early stages of infection with cottontail rabbit papillomavirus.

    PubMed

    Ostrow, R S; Forslund, K M; McGlennen, R C; Shaw, D P; Schlievert, P M; Ussery, M A; Huggins, J W; Faras, A J

    1992-02-01

    The challenge to develop antiviral agents effective against DNA viruses such as human papillomavirus (HPV) has been dependent on finding an animal model which mimics the human forms of the disease. We have used an existing model system for the purpose of measuring the effect of antiviral drugs on the inhibition of growth of these lesions. This was based upon domestic rabbits which efficiently grow cutaneous papillomas (warts) when infected with cottontail rabbit papillomavirus (CRPV). One agent which had shown significant success in achieving these goals was ribavirin. Ribavirin was administered intradermally shortly prior to infection at multiple sites with CRPV. Following daily injections of this drug for eight weeks, we have shown a dose-dependent response which had markedly reduced the number of warts, the time of first appearance of warts and reduced the tumor mass as compared to placebo-treated control animals. At the highest dose of ribavirin tested, 30 mg/kg/day, compared to controls, the average reduction in the number of warts was 52%, the average time of first appearance of warts was 49% longer, and the average mass of the warts was reduced by 98%. No detectable antibodies to CRPV were observed in any of the animals. The only side effects which were observed was focal alopecia, and a decrease in body growth upon prolonged treatment, both of which were completely reversible. Pharmacokinetic studies established the metabolism of ribavirin over a 24-h period of time. Ribavirin administered beginning 12 or 30 days post-infection, while not reducing the number of warts, slightly retarded the growth of warts as determined by date of first appearance of warts and mass of warts.

  11. Experimental caprine neosporosis: the influence of gestational stage on the outcome of infection.

    PubMed

    Porto, Wagnner José Nascimento; Regidor-Cerrillo, Javier; Kim, Pomy de Cássia Peixoto; Benavides, Julio; Silva, Ana Clécia dos Santos; Horcajo, Pilar; Oliveira, Andrea Alice da Fonseca; Ferre, Ignacio; Mota, Rinaldo Aparecido; Ortega-Mora, Luis Miguel

    2016-02-11

    Here, we assessed outcome of experimental infection by Neospora caninum in goats intravenously inoculated with 10(6) tachyzoites of the Nc-Spain7 isolate at 40 (G1), 90 (G2) and 120 (G3) days of gestation. Infected goats had fever between 5 and 9 days post inoculation (dpi); all were seropositive at the time of abortion/birth. Foetal death occurred in G1 from 10 to 21 dpi (n = 7) and in G2 from 27 to 35 dpi (n = 4). Goats in G2 also had seropositive stillbirth (n = 1) and healthy kids (n = 2). G3 goats (n = 7) had 3 seropositive and 3 seronegative weak kids, and 2 seronegative healthy kids. Parasite DNA detection in placentomes was 100% in G2, 85.7% in G3 and in G1 was detected only in placentomes from the goats with foetal losses from 17 dpi (100%). Parasites were detected in foetal/kid brain (>85.7%) and liver (≥ 50%) of G2 and G3, and in G1 after 17 dpi (100%). The highest parasite loads were detected in the placentomes of G1 from 17 dpi and G2, and in foetal tissues of G1 from 17 dpi and G3. Multifocal necrotic lesions were observed in the placentas of the three groups, but they were larger and more frequent in G1 and G2. Similar lesions were observed in foetal tissues, but they were more frequent in G3. These findings suggest that, as observed in cattle and sheep, the clinical consequences of N. caninum in pregnant goats are dependent in part on the time of gestation when animals were infected.

  12. Depressed Hypoxic and Hypercapnic Ventilatory Responses at Early Stage of Lethal Avian Influenza A Virus Infection in Mice

    PubMed Central

    Pollock, Zemmie; Harrod, Kevin S.; Xu, Fadi

    2016-01-01

    H5N1 virus infection results in ~60% mortality in patients primarily due to respiratory failure, but the underlying causes of mortality are unclear. The goal of this study is to reveal respiratory disorders occurring at the early stage of infection that may be responsible for subsequent respiratory failure and death. BALB/c mice were intranasally infected with one of two H5N1 virus strains: HK483 (lethal) or HK486 (non-lethal) virus. Pulmonary ventilation and the responses to hypoxia (HVR; 7% O2 for 3 min) and hypercapnia (HCVR; 7% CO2 for 5 min) were measured daily at 2 days prior and 1, 2, and 3 days postinfection (dpi) and compared to mortality typically by 8 dpi. At 1, 2, and 3 dpi, immunoreactivities (IR) of substance P (SP-IR) in the nodose ganglion or tyrosine hydroxylase (TH-IR) in the carotid body coupled with the nucleoprotein of influenza A (NP-IR) was examined in some mice, while arterial blood was collected in others. Our results showed that at 2 and 3 dpi: 1) both viral infections failed to alter body temperature and weight, V˙CO2, or induce viremia while producing similarly high lung viral titers; 2) HK483, but not HK486, virus induced tachypnea and depressed HVR and HCVR without changes in arterial blood pH and gases; and 3) only HK483 virus led to NP-IR in vagal SP-IR neurons, but not in the carotid body, and increased density of vagal SP-IR neurons. In addition, all HK483, rather than HK486, mice died at 6 to 8 dpi and the earlier death was correlated with more severe depression of HVR and HCVR. Our data suggest that tachypnea and depressed HVR/HCVR occur at the early stage of lethal H5N1 viral infection associated with viral replication and increased SP-IR density in vagal neurons, which may contribute to the respiratory failure and death. PMID:26808681

  13. In Vivo Analysis of the Viable Microbiota and Helicobacter pylori Transcriptome in Gastric Infection and Early Stages of Carcinogenesis.

    PubMed

    Thorell, Kaisa; Bengtsson-Palme, Johan; Liu, Oscar Hsin-Fu; Palacios Gonzales, Reyna Victoria; Nookaew, Intawat; Rabeneck, Linda; Paszat, Lawrence; Graham, David Y; Nielsen, Jens; Lundin, Samuel B; Sjöling, Åsa

    2017-10-01

    Emerging evidence shows that the human microbiota plays a larger role in disease progression and health than previously anticipated. Helicobacter pylori, the causative agent of gastric cancer and duodenal and gastric ulcers, was early associated with gastric disease, but it has also been proposed that the accompanying microbiota in Helicobacter pylori-infected individuals might affect disease progression and gastric cancer development. In this study, the composition of the transcriptionally active microbial community and H. pylori gene expression were determined using metatranscriptomic RNA sequencing of stomach biopsy specimens from individuals with different H. pylori infection statuses and premalignant tissue changes. The results show that H. pylori completely dominates the microbiota not only in infected individuals but also in most individuals classified as H. pylori uninfected using conventional methods. Furthermore, H. pylori abundance is positively correlated with the presence of Campylobacter, Deinococcus, and Sulfurospirillum Finally, we quantified the expression of a large number of Helicobacter pylori genes and found high expression of genes involved in pH regulation and nickel transport. Our study is the first to dissect the viable microbiota of the human stomach by metatranscriptomic analysis, and it shows that metatranscriptomic analysis of the gastric microbiota is feasible and can provide new insights into how bacteria respond in vivo to variations in the stomach microenvironment and at different stages of disease progression. Copyright © 2017 American Society for Microbiology.

  14. A lethal case of Plasmodium falciparum infection in a young patient with end-stage renal failure who underwent regular hemodialysis.

    PubMed

    Hartopo, Anggoro Budi; Wijisaksono, Doni Priambodo

    2010-01-01

    Acute renal failure associated with Plasmodium falciparum infection is already well recognized. Nevertheless, end-stage chronic renal failure and falciparum malaria comorbidity is a rare condition. We report a case of Plasmodium falciparum infection in a young male Javanese patient with end-stage chronic renal failure who underwent regular hemodialysis. This rare comorbidity led to rapid deterioration of consciousness and metabolic disturbances which had already existed in end-stage renal failure. Because of the immunosuppressive condition due to organ failure, the patient did not survive despite anti-malarial chemotherapy.

  15. Distribution and characteristics of bovine leukemia virus integration sites in the host genome at three different clinical stages of infection.

    PubMed

    Miyasaka, T; Oguma, K; Sentsui, H

    2015-01-01

    Bovine leukemia virus (BLV) is an oncogenic retrovirus closely related to human T-cell lymphotropic virus. BLV-infected cattle are categorized as asymptomatic carriers or as having persistent lymphocytosis or enzootic bovine leukemia, depending on the clinical stage. We investigated the BLV integration site distribution at three BLV clinical stages and examined genome sequence features around the integration sites. In all, 264 BLV integration sites, at various locations on each chromosome, were identified in 28 cattle by inverse PCR and BLAST searches. Approximately one-third of BLV proviruses were independently integrated within transcriptional units, and approximately 10 % were integrated near transcription start sites. Moreover, less than 7 % of BLV integration sites were located near CpG islands. BLV did not preferentially integrate into transcriptionally active regions during any of the clinical stages. At the nucleotide level, regions around BLV integration points were significantly A/T rich with weak sequence consensus. BLV preferentially integrated within long interspersed nuclear repeat elements. Although BLV integration sites may not be associated with disease progression, integration is selective at the nucleotide level.

  16. Pf155/RESA protein influences the dynamic microcirculatory behavior of ring-stage Plasmodium falciparum infected red blood cells

    NASA Astrophysics Data System (ADS)

    Diez-Silva, Monica; Park, Yongkeun; Huang, Sha; Bow, Hansen; Mercereau-Puijalon, Odile; Deplaine, Guillaume; Lavazec, Catherine; Perrot, Sylvie; Bonnefoy, Serge; Feld, Michael S.; Han, Jongyoon; Dao, Ming; Suresh, Subra

    2012-08-01

    Proteins exported by Plasmodium falciparum to the red blood cell (RBC) membrane modify the structural properties of the parasitized RBC (Pf-RBC). Although quasi-static single cell assays show reduced ring-stage Pf-RBCs deformability, the parameters influencing their microcirculatory behavior remain unexplored. Here, we study the dynamic properties of ring-stage Pf-RBCs and the role of the parasite protein Pf155/Ring-Infected Erythrocyte Surface Antigen (RESA). Diffraction phase microscopy revealed RESA-driven decreased Pf-RBCs membrane fluctuations. Microfluidic experiments showed a RESA-dependent reduction in the Pf-RBCs transit velocity, which was potentiated at febrile temperature. In a microspheres filtration system, incubation at febrile temperature impaired traversal of RESA-expressing Pf-RBCs. These results show that RESA influences ring-stage Pf-RBCs microcirculation, an effect that is fever-enhanced. This is the first identification of a parasite factor influencing the dynamic circulation of young asexual Pf-RBCs in physiologically relevant conditions, offering novel possibilities for interventions to reduce parasite survival and pathogenesis in its human host.

  17. Pf155/RESA protein influences the dynamic microcirculatory behavior of ring-stage Plasmodium falciparum infected red blood cells

    PubMed Central

    Diez-Silva, Monica; Park, YongKeun; Huang, Sha; Bow, Hansen; Mercereau-Puijalon, Odile; Deplaine, Guillaume; Lavazec, Catherine; Perrot, Sylvie; Bonnefoy, Serge; Feld, Michael S.; Han, Jongyoon; Dao, Ming; Suresh, Subra

    2012-01-01

    Proteins exported by Plasmodium falciparum to the red blood cell (RBC) membrane modify the structural properties of the parasitized RBC (Pf-RBC). Although quasi-static single cell assays show reduced ring-stage Pf-RBCs deformability, the parameters influencing their microcirculatory behavior remain unexplored. Here, we study the dynamic properties of ring-stage Pf-RBCs and the role of the parasite protein Pf155/Ring-Infected Erythrocyte Surface Antigen (RESA). Diffraction phase microscopy revealed RESA-driven decreased Pf-RBCs membrane fluctuations. Microfluidic experiments showed a RESA-dependent reduction in the Pf-RBCs transit velocity, which was potentiated at febrile temperature. In a microspheres filtration system, incubation at febrile temperature impaired traversal of RESA-expressing Pf-RBCs. These results show that RESA influences ring-stage Pf-RBCs microcirculation, an effect that is fever-enhanced. This is the first identification of a parasite factor influencing the dynamic circulation of young asexual Pf-RBCs in physiologically relevant conditions, offering novel possibilities for interventions to reduce parasite survival and pathogenesis in its human host. PMID:22937223

  18. Infections of Larval Stages of Dicrocoelium dendriticum and Brachylaima sp. in Brown Garden Snail, Helix aspersa, in Turkey.

    PubMed

    Köse, Mustafa; Eser, Mustafa; Kartal, Kürşat; Bozkurt, Mehmet Fatih

    2015-10-01

    The aim of this study was to determine the presence and prevalence of larval stages of Dicrocoelium dendriticum and Brachylaima sp. in the first intermediate host, a species of land snail, Helix aspersa, in Turkey. A total of 211 snails were collected in April-May 2014 from pastures in Mersin District. Larval stages of D. dendriticum were identified under a light microscope. Hepatopancreas from naturally infected H. aspersa snails were examined histologically. The prevalence of larval stages of D. dendriticum and Brachylaima sp. in H. aspersa snails was found to be 2.4% and 1.9%, respectively, in Mersin, Turkey. Cercariae were not matured in sporocysts at the beginning of April; however, it was observed that cercariae matured and started to leave sporocysts by early-May. Thus, it was concluded that H. aspersa acts as an intermediate host to D. dendriticumin and Brachylaima sp. in Mersin, Turkey. A digenean trematode Brachylaima sp. was seen for the first time in Turkey.

  19. Infections of Larval Stages of Dicrocoelium dendriticum and Brachylaima sp. in Brown Garden Snail, Helix aspersa, in Turkey

    PubMed Central

    Köse, Mustafa; Eser, Mustafa; Kartal, Kürşat; Bozkurt, Mehmet Fatih

    2015-01-01

    The aim of this study was to determine the presence and prevalence of larval stages of Dicrocoelium dendriticum and Brachylaima sp. in the first intermediate host, a species of land snail, Helix aspersa, in Turkey. A total of 211 snails were collected in April-May 2014 from pastures in Mersin District. Larval stages of D. dendriticum were identified under a light microscope. Hepatopancreas from naturally infected H. aspersa snails were examined histologically. The prevalence of larval stages of D. dendriticum and Brachylaima sp. in H. aspersa snails was found to be 2.4% and 1.9%, respectively, in Mersin, Turkey. Cercariae were not matured in sporocysts at the beginning of April; however, it was observed that cercariae matured and started to leave sporocysts by early-May. Thus, it was concluded that H. aspersa acts as an intermediate host to D. dendriticumin and Brachylaima sp. in Mersin, Turkey. A digenean trematode Brachylaima sp. was seen for the first time in Turkey. PMID:26537045

  20. Experimental infections of rabbits with proliferative and latent stages of Besnoitia besnoiti.

    PubMed

    Liénard, Emmanuel; Pop, Loredana; Prevot, Françoise; Grisez, Christelle; Mallet, Virginie; Raymond-Letron, Isabelle; Bouhsira, Émilie; Franc, Michel; Jacquiet, Philippe

    2015-10-01

    Cattle besnoitiosis due to Besnoitia besnoiti is spreading across Europe and is responsible for severe economic losses in newly infected herds. Experimentally speaking, rabbits have been found to be susceptible to this parasite. The adaptation of B. besnoiti to rabbits may offer a new, easier and cheaper model of investigation for this disease. This study compared the virulence between tachyzoites and bradyzoites of B. besnoiti in rabbits. Eighteen New Zealand rabbits were allocated into three groups of six animals each. The rabbits from the control (group C), "tachyzoite" (group T) and "bradyzoite" (group B) groups were subcutaneously injected in the right flank with 66 μg of ovalbumin, 6.10(6) tachyzoites (125th passage on Vero cells) and 6.10(6) bradyzoites (collected from a natural infected cow) of B. besnoiti, respectively. Clinical follow-up and blood sampling for serological survey and qPCR were performed during 10 weeks until euthanasia. Molecular and immunohistochemistry examination was achieved on 25 samples of tissue per rabbit. Seroconversion occurred in group T without any clinical signs. Rabbits of group B exhibited a febrile condition (temperature above 40 °C from day 8 to day 11 following injection) with positive qPCR in blood. Cysts of B. besnoiti were found on skin samples and organs of rabbits from group B in tissue explored with threshold cycle (Ct) values below 30. These results suggest a higher virulence of bradyzoites in rabbits than Vero cell-cultivated tachyzoites. The proposed model could be used to assess the in vivo effectiveness of vaccine or drugs against cattle besnoitiosis.

  1. Signaling Strategies of Malaria Parasite for Its Survival, Proliferation, and Infection during Erythrocytic Stage

    PubMed Central

    Soni, Rani; Sharma, Drista; Rai, Praveen; Sharma, Bhaskar; Bhatt, Tarun K.

    2017-01-01

    Irrespective of various efforts, malaria persist the most debilitating effect in terms of morbidity and mortality. Moreover, the existing drugs are also vulnerable to the emergence of drug resistance. To explore the potential targets for designing the most effective antimalarial therapies, it is required to focus on the facts of biochemical mechanism underlying the process of parasite survival and disease pathogenesis. This review is intended to bring out the existing knowledge about the functions and components of the major signaling pathways such as kinase signaling, calcium signaling, and cyclic nucleotide-based signaling, serving the various aspects of the parasitic asexual stage and highlighted the Toll-like receptors, glycosylphosphatidylinositol-mediated signaling, and molecular events in cytoadhesion, which elicit the host immune response. This discussion will facilitate a look over essential components for parasite survival and disease progression to be implemented in discovery of novel antimalarial drugs and vaccines. PMID:28400771

  2. Signaling Strategies of Malaria Parasite for Its Survival, Proliferation, and Infection during Erythrocytic Stage.

    PubMed

    Soni, Rani; Sharma, Drista; Rai, Praveen; Sharma, Bhaskar; Bhatt, Tarun K

    2017-01-01

    Irrespective of various efforts, malaria persist the most debilitating effect in terms of morbidity and mortality. Moreover, the existing drugs are also vulnerable to the emergence of drug resistance. To explore the potential targets for designing the most effective antimalarial therapies, it is required to focus on the facts of biochemical mechanism underlying the process of parasite survival and disease pathogenesis. This review is intended to bring out the existing knowledge about the functions and components of the major signaling pathways such as kinase signaling, calcium signaling, and cyclic nucleotide-based signaling, serving the various aspects of the parasitic asexual stage and highlighted the Toll-like receptors, glycosylphosphatidylinositol-mediated signaling, and molecular events in cytoadhesion, which elicit the host immune response. This discussion will facilitate a look over essential components for parasite survival and disease progression to be implemented in discovery of novel antimalarial drugs and vaccines.

  3. Analysis of the Transcriptome of the Infective Stage of the Beet Cyst Nematode, H. schachtii

    PubMed Central

    Fosu-Nyarko, John; Nicol, Paul; Naz, Fareeha; Gill, Reetinder; Jones, Michael G. K.

    2016-01-01

    The beet cyst nematode, Heterodera schachtii, is a major root pest that significantly impacts the yield of sugar beet, brassicas and related species. There has been limited molecular characterisation of this important plant pathogen: to identify target genes for its control the transcriptome of the pre-parasitic J2 stage of H. schachtii was sequenced using Roche GS FLX. Ninety seven percent of reads (i.e., 387,668) with an average PHRED score > 22 were assembled with CAP3 and CLC Genomics Workbench into 37,345 and 47,263 contigs, respectively. The transcripts were annotated by comparing with gene and genomic sequences of other nematodes and annotated proteins on public databases. The annotated transcripts were much more similar to sequences of Heterodera glycines than to those of Globodera pallida and root knot nematodes (Meloidogyne spp.). Analysis of these transcripts showed that a subset of 2,918 transcripts was common to free-living and plant parasitic nematodes suggesting that this subset is involved in general nematode metabolism and development. A set of 148 contigs and 183 singletons encoding putative homologues of effectors previously characterised for plant parasitic nematodes were also identified: these are known to be important for parasitism of host plants during migration through tissues or feeding from cells or are thought to be involved in evasion or modulation of host defences. In addition, the presence of sequences from a nematode virus is suggested. The sequencing and annotation of this transcriptome significantly adds to the genetic data available for H. schachtii, and identifies genes primed to undertake required roles in the critical pre-parasitic and early post-parasitic J2 stages. These data provide new information for identifying potential gene targets for future protection of susceptible crops against H. schachtii. PMID:26824923

  4. Sensitivity of two in vitro assays for evaluating plant activity against the infective stage of Haemonchus contortus strains.

    PubMed

    Al-Rofaai, A; Rahman, W A; Abdulghani, Mahfoudh

    2013-02-01

    The sensitivity of larval paralysis assay (LPA) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide-formazan (MTT-formazan) assay was compared to evaluate the anthelmintic activity of plant extracts. In this study, the methanolic extract of Azadirachta indica (neem) was evaluated for its activity against the infective-stage larvae (L(3)) of susceptible and resistant Haemonchus contortus strains using the two aforementioned assays. In both in vitro assays, the same serial concentrations of the extract were used, and the median lethal concentrations were determined to compare the sensitivity of both assays. The results revealed a significant difference (P < 0.05) in the sensitivity of the LPA and the MTT-formazan assay. The MTT-formazan assay is more feasible for practical applications because it measured the L(3) mortality more accurately than LPA. This study may help find a suitable assay for investigating the anthelmintic activity of plant extracts against trichostrongylid nematodes.

  5. Simultaneous versus sequential one-stage combined anterior and posterior spinal surgery for spinal infections (outcomes and complications)

    PubMed Central

    Ozturk, Cagatay; Vural, Recep; Sehirlioglu, Ali; Mutlu, Muren

    2006-01-01

    To compare simultaneous with sequential one-stage (same anaesthesia) combined anterior and posterior spinal surgery in the treatment of spinal infections in terms of the operation time, blood loss and complication rate. Fifty-six patients who underwent one-stage (same anaesthesia) simultaneous or sequential anterior decompression and posterior stabilisation of the involved vertebrae for spinal infection from January 1994 to December 2002 were reviewed. In group I (n=29), sequential anterior and posterior surgery was performed. In group II (n=27), simultaneous anterior and posterior spinal surgery was performed. With regard to age and gender, there was no statistical difference between both groups (P=0.05). The analysed and compared data between the two groups included the age, gender, blood loss, operation time and postoperative complications. There was a statistically significant difference between the two groups in terms of the duration of surgery, amount of blood transfusion needed and occurrence of major postoperative complications (P<0.05). The mean correction of the kyphotic deformity was similar in both groups (P>0.05) without a subsequent loss of correction on follow-up radiographic films at a mean follow-up of 6.5 years (range, 3 to 11 years). Simultaneous anterior and posterior surgery is a good alternative procedure. It provides the ability to manipulate both anterior and posterior aspects of the spine at the same time and appears to result in less blood loss, a shorter operative time and fewer complications. However, gaining experience and the availability of two surgical teams are important factors in the success of the procedure. PMID:16736143

  6. Association of caveolin with Chlamydia trachomatis inclusions at early and late stages of infection.

    PubMed

    Norkin, L C; Wolfrom, S A; Stuart, E S

    2001-06-10

    The mechanism by which the intracellular bacterial pathogen Chlamydia trachomatis enters eukaryotic cells is poorly understood. There are conflicting reports of entry occurring by clathrin-dependent and clathrin-independent processes. We report here that C. trachomatis serovar K enters HEp-2 and HeLa 229 epithelial cells and J-774A.1 mouse macrophage/monocyte cells via caveolin-containing sphingolipid and cholesterol-enriched raft microdomains in the host cell plasma membranes. First, filipin and nystatin, drugs that specifically disrupt raft function by cholesterol chelation, each impaired entry of C. trachomatis serovar K. In control experiments, filipin did not impair entry of the same organism by an antibody-mediated opsonic process, nor did it impair entry of BSA-coated microspheres. Second, the chlamydia-containing endocytic vesicles specifically reacted with antisera against the caveolae marker protein caveolin. These vesicles are known to become the inclusions in which parasite replication occurs. They avoid fusion with lysosomes and instead traffic to the Golgi region, where they intercept Golgi-derived vesicles that recycle sphingolipids and cholesterol to the plasma membrane. We also report that late-stage C. trachomatis inclusions continue to display high levels of caveolin, which they likely acquire from the exocytic Golgi vesicles. We suggest that the atypical raft-mediated entry process may have important consequences for the host-pathogen interaction well after entry has occurred. These consequences include enabling the chlamydial vesicle to avoid acidification and fusion with lysosomes, to traffic to the Golgi region, and to intercept sphingolipid-containing vesicles from the Golgi. Copyright 2001 Academic Press.

  7. Lack of flagella disadvantages Salmonella enterica serovar Enteritidis during the early stages of infection in the rat.

    PubMed

    Robertson, Jeanette M C; McKenzie, Norma H; Duncan, Michelle; Allen-Vercoe, Emma; Woodward, Martin J; Flint, Harry J; Grant, George

    2003-01-01

    The roles of flagella and five fimbriae (SEF14, SEF17, SEF21, pef, lpf) in the early stages (up to 3 days) of Salmonella enterica serovar Enteritidis (S. Enteritidis) infection have been investigated in the rat. Wild-type strains LA5 and S1400 (fim+/fla+) and insertionally inactivated mutants unable to express the five fimbriae (fim-/fla+), flagella (fim+/fla-) or fimbriae and flagella (fim-/fla-) were used. All wild-type and mutant strains were able to colonize the gut and spread to the mesenteric lymph nodes, liver and spleen. There appeared to be little or no difference between the fim-/fla+ and wild-type (fim+/fla+) strains. In contrast, the numbers of aflagellate (fim+/fla- or fim-/fla-) salmonella in the liver and spleen were transiently reduced. In addition, fim+/fla- or fim-/fla- strains were less able to persist in the upper gastrointestinal tract and the inflammatory responses they elicited in the gut were less severe. Thus, expression of SEF14, SEF17, SEF21, pef and lpf did not appear to be a prerequisite for induction of S. Enteritidis infection in the rat. Deletion of flagella did, however, disadvantage the bacterium. This may be due to the inability to produce or release the potent immunomodulating protein flagellin.

  8. Host PI(3,5)P2 activity is required for Plasmodium berghei growth during liver stage infection

    PubMed Central

    Thieleke-Matos, Carolina; da Silva, Mafalda Lopes; Cabrita-Santos, Laura; Pires, Cristiana F.; Ramalho, José S.; Ikonomov, Ognian; Seixas, Elsa; Shisheva, Assia; Seabra, Miguel C.; Barral, Duarte C.

    2014-01-01

    Malaria parasites go through an obligatory liver stage before they infect erythrocytes and cause disease symptoms. In the host hepatocytes, the parasite is enclosed by a parasitophorous vacuole membrane (PVM). Here, we dissected the interaction between the Plasmodium parasite and the host cell late endocytic pathway and show that parasite growth is dependent on the phosphoinositide 5-kinase (PIKfyve), which converts phosphatidylinositol 3-phosphate [PI(3)P] into phosphatidylinositol 3,5-bisphosphate [PI(3,5)P2] in the endosomal system. We found that inhibition of PIKfyve either by pharmacological or non-pharmacological means causes a delay in parasite growth. Moreover, we show that the PI(3,5)P2 effector protein TRPML1 that is involved in late endocytic membrane fusion, is present in vesicles closely contacting the PVM and is necessary for parasite growth. Thus, our studies suggest that the parasite PVM is able to fuse with host late endocytic vesicles in a PI(3,5)P2-dependent manner, allowing the exchange of material between the host and the parasite, which is essential for successful infection. PMID:24992508

  9. IFN-gamma treatment at early stages of influenza virus infection protects mice from death in a NK cell-dependent manner.

    PubMed

    Weiss, Ido D; Wald, Ori; Wald, Hanna; Beider, Katia; Abraham, Michal; Galun, Eithan; Nagler, Arnon; Peled, Amnon

    2010-06-01

    Influenza pandemics are imminent and represent a major world health concern. Since vaccinations are expected to be less efficient in the coming years due to newly emerging influenza virus strains, novel antiviral therapies are urgently needed. Here, we show that influenza-infected mice, capable of clearing the virus in the early stages of infection, failed to control inflammation and death. Sequential administration of Interferon-gamma (IFN-gamma) at early stage of the infection protected infected mice from death in a NK cell-dependent manner. IFN-gamma treatment stimulated NK cell proliferation and function and increased their number in the bone marrow, blood, spleen, and infected lungs, keeping viral clearance intact. In parallel, IFN-gamma treatment significantly reduced the number of T cells and NKT cells in the lungs at the inflammatory phase following infection. Thus, rapidly clearing the virus and reducing inflammation by shaping the cellular and cytokine profiles in the early stages of infection may favorably change the fate of influenza pathogenesis.

  10. Infection of Goose with Genotype VIId Newcastle Disease Virus of Goose Origin Elicits Strong Immune Responses at Early Stage

    PubMed Central

    Xu, Qianqian; Chen, Yuqiu; Zhao, Wenjun; Zhang, Tingting; Liu, Chenggang; Qi, Tianming; Han, Zongxi; Shao, Yuhao; Ma, Deying; Liu, Shengwang

    2016-01-01

    Newcastle disease (ND), caused by virulent strains of Newcastle disease virus (NDV), is a highly contagious disease of birds that is responsible for heavy economic losses for the poultry industry worldwide. However, little is known about host-virus interactions in waterfowl, goose. In this study, we aim to characterize the host immune response in goose, based on the previous reports on the host response to NDV in chickens. Here, we evaluated viral replication and mRNA expression of 27 immune-related genes in 10 tissues of geese challenged with a genotype VIId NDV strain of goose origin (go/CH/LHLJ/1/06). The virus showed early replication, especially in digestive and immune tissues. The expression profiles showed up-regulation of Toll-like receptor (TLR)1–3, 5, 7, and 15, avian β-defensin (AvBD) 5–7, 10, 12, and 16, cytokines [interleukin (IL)-8, IL-18, IL-1β, and interferon-γ], inducible NO synthase (iNOS), and MHC class I in some tissues of geese in response to NDV. In contrast, NDV infection suppressed expression of AvBD1 in cecal tonsil of geese. Moreover, we observed a highly positive correlation between viral replication and host mRNA expressions of TLR1-5 and 7, AvBD4-6, 10, and 12, all the cytokines measured, MHC class I, FAS ligand, and iNOS, mainly at 72 h post-infection. Taken together, these results demonstrated that NDV infection induces strong innate immune responses and intense inflammatory responses at early stage in goose which may associate with the viral pathogenesis. PMID:27757109

  11. Circulation of HIV antigen in blood according to stage of infection, risk group, age and geographic origin.

    PubMed

    Goudsmit, J; Paul, D A

    1987-12-01

    Human immunodeficiency virus antigen (HIV-ag) was determined by enzyme immunoassay (EIA) in HIV-antibody (anti-HIV) positive as well as pre-anti-HIV seroconversion sera and the results analysed according to stage of infection, risk group, age and geographic origin. Eleven (19%) of 58 homosexual men tested showed HIV-ag in a serum taken 3-4 months before or one at the time of anti-HIV seroconversion. In another eight (14%) HIV-ag persisted after seroconversion and half of them developed AIDS or AIDS-related complex (ARC) in contrast to none of the other 50 anti-HIV seroconversions. Two (13%) of 16 haemophiliacs tested had HIV-ag only in the first anti-HIV seropositive sample. HIV-ag was present in 86% (30/35) of Dutch homosexual men with AIDS, in 32% (7/22) of men with ARC and in 17% (24/145) of men with persistent generalized lymphadenopathy (PGL) or without symptoms. Three percent (2/60) of sera of asymptomatic i.v. drug users from Amsterdam were HIV-ag positive. Ten percent (1 of 10) of sera from Central Africans with 'Slim Disease' were HIV-ag positive. Among infected children from the USA or Europe 89-100% (8/9 and 2/2) of AIDS cases, 67-100% (6/9 and 3/3) of children with ARC and 75% (3/4) of asymptomatic children were HIV-ag positive. The HIV-ag EIA appears to be able to identify HIV infection earlier than the available anti-HIV assays in a significant number of cases. Since persistence of HIV-ag, except possibly in African cases, is strongly associated with clinical deterioration, HIV-ag appears to be a suitable marker for, independent of their clinical status, selecting individuals for antiviral therapy and also for monitoring the efficiency of such therapy.

  12. Platelets activate a pathogenic response to blood-stage Plasmodium infection but not a protective immune response.

    PubMed

    Gramaglia, Irene; Velez, Joyce; Combes, Valery; Grau, Georges E R; Wree, Melanie; van der Heyde, Henri C

    2017-03-23

    Clinical studies indicate that thrombocytopenia correlates with the development of severe falciparum malaria, suggesting that platelets either contribute to control of parasite replication, possibly as innate parasite killer cells or function in eliciting pathogenesis. Removal of platelets by anti-CD41 mAb treatment, platelet inhibition by aspirin, and adoptive transfer of wild-type (WT) platelets to CD40-KO mice, which do not control parasite replication, resulted in similar parasitemia compared with control mice. Human platelets at a physiologic ratio of 1 platelet to 9 red blood cells (RBCs) did not inhibit the in vitro development or replication of blood-stage Plasmodium falciparum The percentage of Plasmodium-infected (iRBCs) with bound platelets during the ascending parasitemia in Plasmodium chabaudi- and Plasmodium berghei-infected mice and the 48-hour in vitro cycle of P falciparum was <10%. P chabaudi and P berghei iRBCs with apoptotic parasites (TdT(+)) exhibited minimal platelet binding (<5%), which was similar to nonapoptotic iRBCs. These findings collectively indicate platelets do not kill bloodstage Plasmodium at physiologically relevant effector-to-target ratios. P chabaudi primary and secondary parasitemia was similar in mice depleted of platelets by mAb-injection just before infection, indicating that activation of the protective immune response does not require platelets. In contrast to the lack of an effect on parasite replication, adoptive transfer of WT platelets to CD40-KO mice, which are resistant to experimental cerebral malaria, partially restored experimental cerebral malaria mortality and symptoms in CD40-KO recipients, indicating platelets elicit pathogenesis and platelet CD40 is a key molecule. © 2017 by The American Society of Hematology.

  13. Infection of Goose with Genotype VIId Newcastle Disease Virus of Goose Origin Elicits Strong Immune Responses at Early Stage.

    PubMed

    Xu, Qianqian; Chen, Yuqiu; Zhao, Wenjun; Zhang, Tingting; Liu, Chenggang; Qi, Tianming; Han, Zongxi; Shao, Yuhao; Ma, Deying; Liu, Shengwang

    2016-01-01

    Newcastle disease (ND), caused by virulent strains of Newcastle disease virus (NDV), is a highly contagious disease of birds that is responsible for heavy economic losses for the poultry industry worldwide. However, little is known about host-virus interactions in waterfowl, goose. In this study, we aim to characterize the host immune response in goose, based on the previous reports on the host response to NDV in chickens. Here, we evaluated viral replication and mRNA expression of 27 immune-related genes in 10 tissues of geese challenged with a genotype VIId NDV strain of goose origin (go/CH/LHLJ/1/06). The virus showed early replication, especially in digestive and immune tissues. The expression profiles showed up-regulation of Toll-like receptor (TLR)1-3, 5, 7, and 15, avian β-defensin (AvBD) 5-7, 10, 12, and 16, cytokines [interleukin (IL)-8, IL-18, IL-1β, and interferon-γ], inducible NO synthase (iNOS), and MHC class I in some tissues of geese in response to NDV. In contrast, NDV infection suppressed expression of AvBD1 in cecal tonsil of geese. Moreover, we observed a highly positive correlation between viral replication and host mRNA expressions of TLR1-5 and 7, AvBD4-6, 10, and 12, all the cytokines measured, MHC class I, FAS ligand, and iNOS, mainly at 72 h post-infection. Taken together, these results demonstrated that NDV infection induces strong innate immune responses and intense inflammatory responses at early stage in goose which may associate with the viral pathogenesis.

  14. Point prevalence of infection with Mycoplasma bovoculi and Moraxella spp. in cattle at different stages of infectious bovine keratoconjunctivitis.

    PubMed

    Schnee, Christiane; Heller, Martin; Schubert, Evelyn; Sachse, Konrad

    2015-01-01

    Infectious bovine keratoconjunctivitis (IBK) has significant economic consequences and a detrimental impact on animal welfare. Although Moraxella (Mor.) bovis is the primary causative agent, the role of other bacteria, such as Mor. ovis, Mor. bovoculi and Mycoplasma (Myc.) bovoculi, is not well understood. To assess the prevalence of infection with these organisms, and to correlate this with outbreaks of IBK, conjunctival samples from four herds of cattle in Germany of differing IBK status were examined. Herds were selected to represent a hypothetical course of IBK ranging from the pre-outbreak stage (herd 1), to the acute disease stage (herd 2), to a stage where treatment had ceased (herd 3). Unaffected animals were also included (herd 4). To facilitate effective, sensitive sample analysis, a new real-time PCR for Myc. bovoculi was developed and used in concert with established real-time PCR protocols for Myc. bovis and Moraxella spp. Herds 1 and 2 showed similarly high rates of detection for Myc. bovoculi (92.5% and 84.0%, respectively), whereas herds 3 and 4 had a lower prevalence (35.5% and 26.2%, respectively). Mor. bovis and Mor. ovis were more prevalent in herd 1 (32.5% and 87.5%, respectively) and herd 2 (38% and 58%, respectively) than herd 3 (10.4% and 1.3%, respectively) and herd 4 (9.8% and 31.1%, respectively). Mor. bovoculi was the only pathogen that correlated with clinical signs of IBK; at 20% prevalence, it was almost exclusively detected in herd 2. The results indicate that herds with high Myc. bovoculi prevalence are more predisposed to outbreaks of IBK, possibly due to a synergistic interaction with Moraxella spp.

  15. Cellular effector mechanisms against Plasmodium liver stages.

    PubMed

    Frevert, Ute; Nardin, Elizabeth

    2008-10-01

    Advances in our understanding of the molecular and cell biology of the malaria parasite have led to new vaccine development efforts resulting in a pipeline of over 40 candidates undergoing clinical phase I-III trials. Vaccine-induced CD4+ and CD8+ T cells specific for pre-erythrocytic stage antigens have been found to express cytolytic and multi-cytokine effector functions that support a key role for these T cells within the hepatic environment. However, little is known of the cellular interactions that occur during the effector phase in which the intracellular hepatic stage of the parasite is targeted and destroyed. This review focuses on cell biological aspects of the interaction between malaria-specific effector cells and the various antigen-presenting cells that are known to exist within the liver, including hepatocytes, dendritic cells, Kupffer cells, stellate cells and sinusoidal endothelia. Considering the unique immune properties of the liver, it is conceivable that these different hepatic antigen-presenting cells fulfil distinct but complementary roles during the effector phase against Plasmodium liver stages.

  16. Lipoprotein succession in Borrelia burgdorferi: similar but distinct roles for OspC and VlsE at different stages of mammalian infection.

    PubMed

    Tilly, Kit; Bestor, Aaron; Rosa, Patricia A

    2013-07-01

    Borrelia burgdorferi alternates between ticks and mammals, requiring variable gene expression and protein production to adapt to these diverse niches. These adaptations include shifting among the major outer surface lipoproteins OspA, OspC, and VlsE at different stages of the infectious cycle. We hypothesize that these proteins carry out a basic but essential function, and that OspC and VlsE fulfil this requirement during early and persistent stages of mammalian infection respectively. Previous work by other investigators suggested that several B. burgdorferi lipoproteins, including OspA and VlsE, could substitute for OspC at the initial stage of mouse infection, when OspC is transiently but absolutely required. In this study, we assessed whether vlsE and ospA could restore infectivity to an ospC mutant, and found that neither gene product effectively compensated for the absence of OspC during early infection. In contrast, we determined that OspC production was required by B. burgdorferi throughout SCID mouse infection if the vlsE gene were absent. Together, these results indicate that OspC can substitute for VlsE when antigenic variation is unnecessary, but that these two abundant lipoproteins are optimized for their related but specific roles during early and persistent mammalian infection by B. burgdorferi. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  17. An Immediate Innate Immune Response Occurred In the Early Stage of E.granulosus Eggs Infection in Sheep: Evidence from Microarray Analysis

    PubMed Central

    Tang, Jishun; Hou, Hongyan; Chen, Sheng; Jia, Bin; Ban, Qian

    2015-01-01

    Background Cystic Echinococcosis(CE), caused by infection with the larval stage of the cestode Echinococcus granulosus (E. granulosus), is a chronic parasitic zoonosis, with highly susceptible infection in sheep. However, the comprehensive molecular mechanisms that underlie the process of E. granulosus infection in the early stage remain largely unknown. The objective of this present study was to gain a cluster of genes expression profiles in the intestine tissue of sheep infected with CE. Methods Nine healthy sheep were divided into infection group and healthy controls, with six infected perorally 5000 E. granulosus eggs suspended in 1000μl physiological saline and three controls perorally injected 1000μl physiological saline. All animals were sacrificed at 4 hours post-infection, respectively. The intestine tissue was removed and the RNA was extracted. In the infection group, the biology replicates were designed to make sure the accuracy of the data. The ovine microarrays were used to analyze changes of gene expression in the intestine tissue between CE infected sheep and healthy controls. Real-time PCR was used to assess reliability of the microarray data. Results By biology repeats, a total of 195 differentially expressed genes were identified between infected group and controls at 4 hours post-infection, with 105 genes related to immune responses, while 90 genes associated with functions including energy metabolism, fat soluble transport, etc. Among the 105 immunity genes, 72 genes showed up-regulated expression levels while 33 showed down-regulation levels. Function analysis showed that most of up-regulated genes were related to innate immune responses, such as mast cell, NK cell, cytokines, chemokines and complement. In addition, Real-time PCR analysis of a random selection of nine genes confirmed the reliability of the microarray data. Conclusion To our knowledge, this is the first report describing gene expression profiles in the intestine tissue of CE

  18. An Immediate Innate Immune Response Occurred In the Early Stage of E. granulosus Eggs Infection in Sheep: Evidence from Microarray Analysis.

    PubMed

    Hui, Wenqiao; Jiang, Song; Tang, Jishun; Hou, Hongyan; Chen, Sheng; Jia, Bin; Ban, Qian

    2015-01-01

    Cystic Echinococcosis(CE), caused by infection with the larval stage of the cestode Echinococcus granulosus (E. granulosus), is a chronic parasitic zoonosis, with highly susceptible infection in sheep. However, the comprehensive molecular mechanisms that underlie the process of E. granulosus infection in the early stage remain largely unknown. The objective of this present study was to gain a cluster of genes expression profiles in the intestine tissue of sheep infected with CE. Nine healthy sheep were divided into infection group and healthy controls, with six infected perorally 5000 E. granulosus eggs suspended in 1000 μl physiological saline and three controls perorally injected 1000 μl physiological saline. All animals were sacrificed at 4 hours post-infection, respectively. The intestine tissue was removed and the RNA was extracted. In the infection group, the biology replicates were designed to make sure the accuracy of the data. The ovine microarrays were used to analyze changes of gene expression in the intestine tissue between CE infected sheep and healthy controls. Real-time PCR was used to assess reliability of the microarray data. By biology repeats, a total of 195 differentially expressed genes were identified between infected group and controls at 4 hours post-infection, with 105 genes related to immune responses, while 90 genes associated with functions including energy metabolism, fat soluble transport, etc. Among the 105 immunity genes, 72 genes showed up-regulated expression levels while 33 showed down-regulation levels. Function analysis showed that most of up-regulated genes were related to innate immune responses, such as mast cell, NK cell, cytokines, chemokines and complement. In addition, Real-time PCR analysis of a random selection of nine genes confirmed the reliability of the microarray data. To our knowledge, this is the first report describing gene expression profiles in the intestine tissue of CE infection sheep. These results

  19. Infections

    MedlinePlus

    ... Eye Infections Pinkeye (Conjunctivitis) Styes Fungal Infections (Ringworm, Yeast, etc.) Diaper Rash Infections That Pets Carry Oral ... Pneumonia Tinea (Ringworm, Jock Itch, Athlete's Foot) Vaginal Yeast Infections Immunizations Do My Kids Need Vaccines Before ...

  20. Therapeutic efficacy of eprinomectin extended-release injection against induced infections of developing (fourth-stage larvae) and adult nematode parasites of cattle.

    PubMed

    Rehbein, S; Baggott, D G; Royer, G C; Yoon, S; Cramer, L G; Soll, M D

    2013-03-01

    The therapeutic efficacy of eprinomectin in an extended-release injection (ERI) formulation was evaluated against induced infections of developing fourth-stage larval or adult gastrointestinal and pulmonary nematodes of cattle in a series of six studies under two identical protocols (three each for developing fourth-stage larvae or adults) conducted in the USA, Germany or the UK (two studies at each location, one per stage). Each study initially included 16 nematode-free cattle. The cattle were of various breeds or crosses, weighed 109-186.5 kg prior to treatment, and were approximately 4-7 months old. The animals were blocked based on pre-treatment bodyweight and then randomly allocated to treatment: eprinomectin ERI vehicle (control) at 1 mL/50 kg body weight or eprinomectin 5% ERI at 1 mL/50 kg bodyweight (1.0 mg eprinomectin/kg) for a total of eight and eight animals in each group. Treatments were administered once on Day 0 by subcutaneous injection in front of the shoulder. In each study, cattle were infected with a combination of infective third-stage larvae or eggs of gastrointestinal and pulmonary nematodes. Inoculation was scheduled so that the nematodes were expected to be fourth-stage larvae or adults at the time of treatment. For parasite recovery, all study animals were humanely euthanized and necropsied 14-15 (adult infections) or 21-22 days after treatment (developing fourth-stage larval infections). When compared with the vehicle-treated control counts, efficacy of eprinomectin ERI against developing fourth-stage larvae and adults was ≥98% (p<0.05) for the following nematodes: Dictyocaulus viviparus, Bunostomum phlebotomum, Cooperia curticei, C. oncophora, C. surnabada, C. punctata, Haemonchus contortus, H. placei, Nematodirus helvetianus, Oesophagostomum radiatum, Oes. venulosum, Ostertagia leptospicularis, O. ostertagi, O. circumcincta, O. pinnata, O. trifurcata (developing fourth-stage larval infections only), Strongyloides papillosus

  1. EVALUATION OF THE THERAPEUTIC EFFICACY OF LEVAMISOLE HYDROCHLORIDE ON THIRD-STAGE LARVAE OF Lagochilascaris minor IN EXPERIMENTALLY INFECTED MICE

    PubMed Central

    CAMPOS, Dulcinéa Maria Barbosa; BARBOSA, Alverne Passos; OLIVEIRA, Jayrson Araújo; BARBOSA, Carlos Augusto Lopes; LOBO, Tamara Flavia Correa; SILVA, Luana Gabriella; THOMAZ, Douglas Vieira; PEIXOTO, Josana de Castro

    2016-01-01

    Lagochilascariosis, a disease caused by Lagochilascaris minor, affects the neck, sinuses, tonsils, lungs, the sacral region, dental alveoli, eyeballs and the central nervous system of humans. A cycle of autoinfection may occur in human host tissues characterized by the presence of eggs, larvae and adult worms. This peculiarity of the cycle hinders therapy, since there are no drugs that exhibit ovicidal, larvicidal and vermicidal activity. Given these facts, we studied the action of levamisole hydrochloride on third-stage larvae in the migration phase (G1) and on encysted larvae (G3) of L. minor. To this end, 87 inbred mice of the C57BL/6 strain were divided into test groups comprising 67 animals (G1-37; G3-30) and a control group (G2-10; G4-10) with 20 animals. Each animal was inoculated orally with 2,000 infective eggs of the parasite. The animals of the test groups were treated individually with a single oral dose of levamisole hydrochloride at a concentration of 0.075 mg. The drug was administered either 30 minutes prior to the parasite inoculation (G1 animals) or 120 days after the inoculation (G3 animals). The mice in the control groups were not treated with the drug. After the time required for the migration and the encysting of L. minor larvae, all the animals were euthanized and their tissues examined. The data were analyzed using the Student's unpaired t-test and the Levene test. The groups showed no statistically significant difference. Levamisole hydrochloride was ineffective on third-stage larvae of L. minor. These findings explain the massive expulsion of live adult worms, as well as the use of long treatment schemes, owing to the persistence of larvae and eggs in human parasitic lesions. PMID:27253745

  2. HIV Treatments Reduce Malaria Liver Stage Burden in a Non-Human Primate Model of Malaria Infection at Clinically Relevant Concentrations In Vivo

    PubMed Central

    Hobbs, Charlotte V.; Neal, Jillian; Conteh, Solomon; Donnelly, Liam; Chen, Jingyang; Marsh, Kennan; Lambert, Lynn; Orr-Gonzalez, Sachy; Hinderer, Jessica; Healy, Sara; Borkowsky, William; Penzak, Scott R.; Chakravarty, Sumana; Hoffman, Stephen L.; Duffy, Patrick E.

    2014-01-01

    We have previously shown that the HIV protease inhibitor lopinavir-ritonavir (LPV-RTV) and the antibiotic trimethoprim sulfamethoxazole (TMP-SMX) inhibit Plasmodium liver stages in rodent malarias and in vitro in P. falciparum. Since clinically relevant levels are better achieved in the non-human-primate model, and since Plasmodium knowlesi is an accepted animal model for the study of liver stages of malaria as a surrogate for P. falciparum infection, we investigated the antimalarial activity of these drugs on Plasmodium knowlesi liver stages in rhesus macaques. We demonstrate that TMP-SMX and TMP-SMX+LPV-RTV (in combination), but not LPV-RTV alone, inhibit liver stage parasite development. Because drugs that inhibit the clinically silent liver stages target parasites when they are present in lower numbers, these results may have implications for eradication efforts. PMID:24988386

  3. Determinants of late disease-stage presentation at diagnosis of HIV infection in Venezuela: A case-case comparison

    PubMed Central

    Bonjour, Maeva A; Montagne, Morelba; Zambrano, Martha; Molina, Gloria; Lippuner, Catherine; Wadskier, Francis G; Castrillo, Milvida; Incani, Renzo N; Tami, Adriana

    2008-01-01

    Background Although Venezuela has a National Human Immunodeficiency Virus (HIV) Program offering free diagnosis and treatment, 41% of patients present for diagnosis at a later disease-stage, indicating that access to care may still be limited. Our study aimed to identify factors influencing delay in presenting for HIV-diagnosis using a case-case comparison. A cross-sectional survey was performed at the Regional HIV Reference Centre (CAI), Carabobo Region, Venezuela. Between May 2005 and October 2006 225 patients diagnosed with HIV at CAI were included and demographic, behavioural and medical characteristics collected from medical files. Socio-economic and behavioural factors were obtained from 129 eligible subjects through interviews. "Late presentation" at diagnosis was defined as patients classified with disease-stage B or C according to the 1993 Centers for Disease Control and Prevention (Atlanta, USA) classification, and "early presentation" defined as diagnosis in disease-stage A. Results Of 225 subjects, 91 (40%) were defined as late presenters. A similar proportion (51/129) was obtained in the interviewed sub-sample. Older age (>30 years), male heterosexuality, lower socio-economic status, perceiving ones partner to be faithful and living ≥ 25 km from the CAI were positively associated with late diagnosis in a multivariate model. Females were less likely to present late than heterosexual males (odds ratio = 0.23, P = 0.06). The main barriers to HIV testing were low knowledge of HIV/AIDS, lack of awareness of the free HIV program, lack of perceived risk of HIV-infection, fear for HIV-related stigma, fear for lack of confidentiality at testing site and logistic barriers. Conclusion Despite the free Venezuelan HIV Program, poverty and barriers related to lack of knowledge and awareness of both HIV and the Program itself were important determinants in late presentation at HIV diagnosis. This study also indicates that women; heterosexual, bisexual and

  4. Determinants of late disease-stage presentation at diagnosis of HIV infection in Venezuela: a case-case comparison.

    PubMed

    Bonjour, Maeva A; Montagne, Morelba; Zambrano, Martha; Molina, Gloria; Lippuner, Catherine; Wadskier, Francis G; Castrillo, Milvida; Incani, Renzo N; Tami, Adriana

    2008-04-16

    Although Venezuela has a National Human Immunodeficiency Virus (HIV) Program offering free diagnosis and treatment, 41% of patients present for diagnosis at a later disease-stage, indicating that access to care may still be limited. Our study aimed to identify factors influencing delay in presenting for HIV-diagnosis using a case-case comparison. A cross-sectional survey was performed at the Regional HIV Reference Centre (CAI), Carabobo Region, Venezuela. Between May 2005 and October 2006 225 patients diagnosed with HIV at CAI were included and demographic, behavioural and medical characteristics collected from medical files. Socio-economic and behavioural factors were obtained from 129 eligible subjects through interviews. "Late presentation" at diagnosis was defined as patients classified with disease-stage B or C according to the 1993 Centers for Disease Control and Prevention (Atlanta, USA) classification, and "early presentation" defined as diagnosis in disease-stage A. Of 225 subjects, 91 (40%) were defined as late presenters. A similar proportion (51/129) was obtained in the interviewed sub-sample. Older age (>30 years), male heterosexuality, lower socio-economic status, perceiving ones partner to be faithful and living >/= 25 km from the CAI were positively associated with late diagnosis in a multivariate model. Females were less likely to present late than heterosexual males (odds ratio = 0.23, P = 0.06). The main barriers to HIV testing were low knowledge of HIV/AIDS, lack of awareness of the free HIV program, lack of perceived risk of HIV-infection, fear for HIV-related stigma, fear for lack of confidentiality at testing site and logistic barriers. Despite the free Venezuelan HIV Program, poverty and barriers related to lack of knowledge and awareness of both HIV and the Program itself were important determinants in late presentation at HIV diagnosis. This study also indicates that women; heterosexual, bisexual and homosexual men might have different

  5. Vitamin D status does not predict sustained virologic response or fibrosis stage in chronic hepatitis C genotype 1 infection.

    PubMed

    Kitson, Matthew T; Dore, Gregory J; George, Jacob; Button, Peter; McCaughan, Geoffrey W; Crawford, Darrell H G; Sievert, William; Weltman, Martin D; Cheng, Wendy S; Roberts, Stuart K

    2013-03-01

    The relationship between vitamin D status and response to antiviral therapy and liver histology in hepatitis C virus genotype 1 (HCV-1) infection remains unclear, with studies to date yielding inconsistent results and failing to use reference assay methodology. We therefore analyzed pre-treatment 25-hydroxyvitamin D [25(OH)D] level, using reference liquid chromatography-tandem mass spectrometry methodology, in a cohort of treatment-naïve patients with HCV-1 to evaluate the association between vitamin D status, virologic response, and liver histology. 274 patients, with pre-treatment liver biopsy and up to 48 weeks of pegylated interferon alfa-2a plus ribavirin therapy, were tested for serum 25(OH)D level. Predictors of sustained virologic response (SVR), and variables associated with fibrosis stage, activity grade and 25(OH)D status were identified using multivariate analysis. Mean 25(OH)D level was 79.6 nmol/L, with a prevalence of 25(OH)D <75 nmol/L and <50 nmol/L of 48% and 16%, respectively. Season, race and geographic latitude were independent predictors of 25(OH)D status, while vitamin D deficiency was more prevalent in those with high activity grade (21% vs. 11%; p=0.03). Mean 25(OH)D level was lower (76.6 vs. 84.7 nmol/L; p=0.03) and 25(OH)D <75 nmol/L more prevalent (53% vs. 40%; p=0.03) in patients with an SVR, but no association between 25(OH)D status and SVR was found in multivariate analysis. Mean 25(OH)D level did not vary between fibrosis stage or activity grade. Baseline 25(OH)D level is not independently associated with SVR or fibrosis stage in HCV-1, but vitamin D deficiency is associated with high activity grade. Copyright © 2012 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  6. Morphological and morphometric differentiation of dorsal-spined first stage larvae of lungworms, (Nematoda: Protostrongylidae) infecting muskoxen (Ovibos moschatus) in the Central Canadian Arctic

    USDA-ARS?s Scientific Manuscript database

    Umingmakstrongylus pallikuukensis and Varestrongylus eleguneniensis are the two most common protostrongylid nematodes infecting muskoxen in the North American Arctic and Subarctic. First stage larvae (L1) of both these lungworms have a characteristic dorsal spine originating at the level of proxima...

  7. Development of life stages of Leptotrombidium imphalum and Leptotrombidium chiangraiensis (Acari: Trombiculidae) uninfected and infected with the scrub typhus rickettsia, Orientia tsustugamushi

    USDA-ARS?s Scientific Manuscript database

    Leptotrombidium chiangraiensis Tanskul and Linthicum and Leptotrombidium imphalum Vercammen-Grandjean are important vectors of scrub typhus in ricefield habitats in northern Thailand. The developmental biology of all stages of the life cycle of two generations of mites infected with Orientia tsutsug...

  8. Staging of recent HIV-1 infection using Geenius rapid confirmatory assay compared to INNO-LIA, New Lav and Blot 2.2 assays.

    PubMed

    Tuaillon, E; Sanosyan, A; Pisoni, A; Liscouët, J; Makinson, A; Perre, P Van de

    2017-10-01

    Besides confirmation of HIV seropositivity, Western Blot (WB) assays play an important role for identification of recent infection based on incomplete antibody reactivity and lack of p31 band. We evaluated the capacities of the Geenius™ HIV1/2 Confirmatory Assay (Bio-Rad), a new generation rapid confirmatory assay based on immune-chromatography and automated reading, for staging of HIV-1 infection. Sixteen samples collected during early HIV-1 infections (Fiebig stage III-VI) were tested using the Geenius assay, and compared to HIV Blot 2.2 WB assay (MP Diagnostics), New Lav Blot I WB assay (Bio-Rad) and INNO-LIA™ HIV I/II Score Dot Blot assay (Fujirebio). Results obtained with Geenius and INNO LIA in 47 newly diagnosed chronic HIV-1 infections were also compared. The p24 band was less frequently detected in early HIV-1 infections using the Geenius (3/16) compared to the New Lav (15/16, p<0.0001), INNO-LIA (13/16, p=0.0011), and Blot 2.2 (13/16, p=0.0011). Testing samples collected during chronic infection allowed to confirm that p31 band and complete Gag, Pol, Env profiles were less frequently observed using the Geenius assay compared to the INNO LIA assay (p=0.027 for p31, and p=0.0015 for complete profile). The Geenius assay is a simple and rapid test showing a high sensitivity to detect Env bands and to confirm HIV-1 seropositivity during the early phases of infection. However, this test is less suitable for distinguishing between later stages of acute and chronic infections because of a reduced sensitivity to detect the p31 and p24 bands compared to INNO LIA and New Lav assays. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Treatment of third-stage larvae of Toxocara cati with milbemycin oxime plus praziquantel tablets and emodepside plus praziquantel spot-on formulation in experimentally infected cats.

    PubMed

    Wolken, Sonja; Böhm, Claudia; Schaper, Roland; Schnieder, Thomas

    2012-11-01

    Toxocara cati is the most prevalent gastrointestinal helminth in cats worldwide, with cats of all ages at risk of infection. An anthelminthic treatment that not only affects the gut-dwelling stages of this parasite but is also effective against developmental stages in the tissue has the advantage that the pathology caused by migrating larvae is minimized and the need for repeated treatments is reduced. This study was conducted to evaluate the efficacy of milbemycin oxime/praziquantel tablets (Milbemax®, Novartis) against third-stage larvae of T. cati in comparison to a spot-on formulation of emodepside and praziquantel (Profender®, Bayer). Twenty-four kittens were experimentally infected with T. cati and randomly allocated to three study groups. Treatments were performed at the minimum therapeutic dosage 5 days after the experimental infection. The development of patent infections was monitored and all cats were dewormed 50 days post-infection. Efficacies were calculated based on counts of excreted worms in the treated groups compared to a negative control group. Seven of the eight cats in the negative control group developed a patent T. cati infection and all cats were excreting worms at the end of the study (geometric mean worm count 18.1). No efficacy could be observed for the milbemycin oxime-treated animals. All cats developed a patent infection and excreted worms (geometric mean worm count 27.7). The treatment with Profender® was 98.5 % effective against L3 of T. cati. One cat developed a patent infection and was excreting worms at the end of the study (geometric mean worm count 0.3). No adverse reactions were noted in either treatment group.

  10. Ultrastructure of endogenous stages of Eimeria ninakohlyakimovae Yakimoff & Rastegaieff, 1930 Emend. Levine, 1961 in experimentally infected goat.

    PubMed

    Vieira, L S; Lima, J D; Ribeiro, M F; Bozzi, I A; Camargos, E R

    1997-01-01

    The ultrastructure of endogenous stages of Eimeria ninakohlyakimovae was observed in epithelial cells of cecum and colon crypts from a goat experimentally infected with 2.0 x 10(5) oocysts/kg. The secondary meronts developed above the nucleus of the host cell. The nucleus first divides and merozoites then form on the surface of multinucleated meronts. Free merozoites in the parasitophorous vacuole present a conoid, double membrane, one pair of rhoptries, micronemes, micropore, anterior and posterior polar ring, a nucleus with a nucleolus and peripheral chromatin. The microgamonts are located below the nucleus of the host cell and contain several nuclei at the periphery of the parasite. The microgametes consist of a body, a nucleus, three flagella and mitochondria. The macrogamonts develop below the nucleus of the host cell and have a large nucleus with a prominent nucleolus. The macrogametes contain a nucleus, wall-forming bodies of type I and type II. The young oocysts present a wall containing two layers and a sporont.

  11. Liver-Resident Memory CD8(+) T Cells Form a Front-Line Defense against Malaria Liver-Stage Infection.

    PubMed

    Fernandez-Ruiz, Daniel; Ng, Wei Yi; Holz, Lauren E; Ma, Joel Z; Zaid, Ali; Wong, Yik Chun; Lau, Lei Shong; Mollard, Vanessa; Cozijnsen, Anton; Collins, Nicholas; Li, Jessica; Davey, Gayle M; Kato, Yu; Devi, Sapna; Skandari, Roghieh; Pauley, Michael; Manton, Jonathan H; Godfrey, Dale I; Braun, Asolina; Tay, Szun Szun; Tan, Peck Szee; Bowen, David G; Koch-Nolte, Friedrich; Rissiek, Björn; Carbone, Francis R; Crabb, Brendan S; Lahoud, Mireille; Cockburn, Ian A; Mueller, Scott N; Bertolino, Patrick; McFadden, Geoffrey I; Caminschi, Irina; Heath, William R

    2016-10-18

    In recent years, various intervention strategies have reduced malaria morbidity and mortality, but further improvements probably depend upon development of a broadly protective vaccine. To better understand immune requirement for protection, we examined liver-stage immunity after vaccination with irradiated sporozoites, an effective though logistically difficult vaccine. We identified a population of memory CD8(+) T cells that expressed the gene signature of tissue-resident memory T (Trm) cells and remained permanently within the liver, where they patrolled the sinusoids. Exploring the requirements for liver Trm cell induction, we showed that by combining dendritic cell-targeted priming with liver inflammation and antigen recognition on hepatocytes, high frequencies of Trm cells could be induced and these cells were essential for protection against malaria sporozoite challenge. Our study highlights the immune potential of liver Trm cells and provides approaches for their selective transfer, expansion, or depletion, which may be harnessed to control liver infections or autoimmunity. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Colletotrichum orbiculare WHI2, a Yeast Stress-Response Regulator Homolog, Controls the Biotrophic Stage of Hemibiotrophic Infection Through TOR Signaling.

    PubMed

    Harata, Ken; Nishiuchi, Takumi; Kubo, Yasuyuki

    2016-06-01

    The hemibiotrophic fungus Colletotrichum orbiculare first establishes a biotrophic infection stage in cucumber (Cucumber sativus) epidermal cells and subsequently transitions to a necrotrophic stage. Here, we found that C. orbiculare established hemibiotrophic infection via C. orbiculare WHI2, a yeast stress regulator homolog, and TOR (target of rapamycin) signaling. Plant defense responses such as callose deposition, H2O2, and antimicrobial proteins were strongly induced by the C. orbiculare whi2Δ mutant, resulting in defective pathogenesis. Expression analysis of biotrophy-specific genes evaluated by the promoter VENUS fusion gene indicated weaker VENUS signal intensity in the whi2Δ mutant, thereby suggesting that C. orbiculare WHI2 plays a key role in regulating biotrophic infection of C. orbiculare. The involvement of CoWHI2 in biotrophic infection was further explored with a DNA microarray. In the Cowhi2Δ mutant, TOR-dependent ribosomal protein-related genes were strikingly upregulated compared with the wild type. Moreover, callose deposition in the host plant after inoculation with the Cowhi2Δ mutant treated with rapamycin, which inhibits TOR activity, was reduced, and the mutant remained biotrophic in contrast to the untreated mutant. Thus, regulation of TOR by Whi2 is apparently crucial to the biotrophic stage of hemibiotrophic infection in C. orbiculare.

  13. Rapid and Slow Progressors Show Increased IL-6 and IL-10 Levels in the Pre-AIDS Stage of HIV Infection

    PubMed Central

    de Medeiros, Rúbia M.; Valverde-Villegas, Jacqueline M.; Junqueira, Dennis M.; Gräf, Tiago; Lindenau, Juliana D.; de Mello, Marineide G.; Vianna, Priscila; Almeida, Sabrina E. M.; Chies, Jose Artur B.

    2016-01-01

    Cytokines are intrinsically related to disease progression in HIV infection. We evaluated the plasma levels of Th1/Th2/Th17 cytokines in extreme progressors, including slow (SPs) and rapid (RPs) progressors, who were thus classified based on clinical and laboratory follow-up covering a period of time before the initiation of HAART, ranging from 93–136.5 months for SPs and 7.5–16.5 months for RPs. Analyses were also performed based on the different stages of HIV infection (chronic, pre-HAART individuals—subjects sampled before initiating HAART but who initiated therapy from 12 to 24 months—and those receiving HAART). The plasma cytokine levels of 16 HIV-infected rapid progressors and 25 slow progressors were measured using a Human Th1/Th2/Th17 CBA kit. The IL-6 and IL-10 plasma levels differed significantly between the stages of HIV infection. The IL-6 levels were higher in slow progressors pre-HAART than in chronically infected SPs and HIV-seronegative individuals. The IL-10 levels were higher in slow progressors pre-HAART than in slow progressors receiving HAART and HIV-seronegative controls, and in rapid progressors, the IL-10 levels were higher in pre-HAART subjects than in HIV-seronegative controls. The results reflect the changes in the cytokine profile occurring during different clinical stages in HIV+ subjects. Our results suggest an association between increased IL-6 and IL-10 levels and pre-HAART stages independent of the slow or rapid progression status of the subjects. Thus, increased IL-6 and IL-10 levels could indicate a global inflammatory status and could be used as markers of the disease course in HIV-infected individuals. PMID:27214135

  14. Results of single stage exchange arthroplasty with retention of well fixed cement-less femoral component in management of infected total hip arthroplasty

    PubMed Central

    Rahman, Wael A; Kazi, Hussain A; Gollish, Jeffery D

    2017-01-01

    AIM To investigate success of one stage exchange with retention of fixed acetabular cup. METHODS Fifteen patients treated by single stage acetabular component exchange with retention of well-fixed femoral component in infected total hip arthroplasty (THA) were retrospectively reviewed. Inclusion criteria were patients with painful chronic infected total hip. The patient had radiologically well fixed femoral components, absence of major soft tissue or bone defect compromising, and infecting organism was not poly or virulent micro-organism. The organisms were identified preoperatively in 14 patients (93.3%), coagulase negative Staphylococcus was the infecting organism in 8 patients (53.3%). RESULTS Mean age of the patients at surgery was 58.93 (± 10.67) years. Mean follow-up was 102.8 mo (36-217 mo, SD 56.4). Fourteen patients had no recurrence of the infection; one hip (6.7%) was revised for management of infection. Statistical analysis using Kaplan Meier curve showed 93.3% survival rate. One failure in our series; the infection recurred after 14 mo, the patient was treated successfully with surgical intervention by irrigation, and debridement and liner exchange. Two complications: The first patient had recurrent hip dislocation 12 years following the definitive procedure, which was managed by revision THA with abductor reconstruction and constrained acetabular liner; the second complication was aseptic loosening of the acetabular component 2 years following the definitive procedure. CONCLUSION Successful in management of infected THA when following criteria are met; well-fixed stem, no draining sinuses, non-immune compromised patients, and infection with sensitive organisms. PMID:28361019

  15. The shiitake mushroom-derived immuno-stimulant lentinan protects against murine malaria blood-stage infection by evoking adaptive immune-responses.

    PubMed

    Zhou, Lian-di; Zhang, Qi-hui; Zhang, Ying; Liu, Jun; Cao, Ya-ming

    2009-04-01

    Lentinan, a (1-3)-beta glucan from Lentinus edodes, is an effective immunostimulatory drug. We tested the effects of lentinan during blood-stage infection by Plasmodium yoelii 17XL (P.y17XL). Pre-treatment of mice with lentinan significantly decreased the parasitemia and increased their survival after infection. Enhanced IL-12, IFN-gamma and NO production induced by lentinan in spleen cells of infected mice revealed that the Th1 immune response was stimulated against malaria infection. In vitro and in vivo, lentinan can result in enhanced expression of MHC II, CD80/CD86, and Toll-like receptors (TLR2/TLR4), and increased production of IL-12 in spleen dendritic cells (DCs) co-cultured with parasitized red blood cells (pRBCs). Moreover, both the number of CD4(+)CD25(+) regulatory T cells (Tregs) and the levels of IL-10 secreted by Tregs were reduced by pre-treatment with lentinan in the spleen of malaria-infected mice. Meanwhile, apoptosis of CD4(+) T cell in spleens of mice pretreated with lentinan was significantly reduced. In summary, lentinan can induce protective Th1 immune responses to control the proliferation of malaria parasites during the blood-stage of P.y17XL infection by stimulating maturation of DCs to inhibit negative regulation of the Th1 immune response by Tregs. Taken together, our findings suggest that lentinan has prophylactic potential for the treatment of malaria.

  16. Expression of late viral proteins is restricted in nasal mucosal leucocytes but not in epithelial cells during early-stage equine herpes virus-1 infection.

    PubMed

    Gryspeerdt, Annick C; Vandekerckhove, Annelies P; Baghi, Hossein Bannazadeh; Van de Walle, Gerlinde R; Nauwynck, Hans J

    2012-08-01

    Equine herpes virus (EHV)-1 replicates in the epithelial cells of the upper respiratory tract and reaches the lamina propria and bloodstream in infected mononuclear cells. This study evaluated expression of the late viral proteins gB, gC, gD and gM in respiratory epithelial and mononuclear cells using: (1) epithelial-like rabbit kidney cells and peripheral blood mononuclear cells infected with EHV-1 in vitro; (2) an equine ex vivo nasal explant system; and (3) nasal mucosa tissue of ponies infected in vivo. The viral proteins were expressed in all late-infected epithelial cells, whereas expression was not observed in infected leucocytes where proteins gB and gM were expressed in 60-90%, and proteins gC and gD in only 20% of infected cells, respectively. The results indicate that expression of these viral proteins during early-stage EHV-1 infection is highly dependent on the cell type infected.

  17. Amelioration of Citrobacter rodentium proliferation in early stage of infection in mice by pre-treatment with Lactobacillus brevis KB290 and verification using in vivo bioluminescence imaging.

    PubMed

    Waki, Naoko; Kuwabara, Yuki; Yoshikawa, Yuko; Suganuma, Hiroyuki; Koide, Hiroyuki; Oku, Naoto; Ohashi, Norio

    2016-11-10

    Bioluminescent imaging (BLI) has become a useful tool for monitoring bacterial infections in real time. Citrobacter rodentium and its BLI are widely used as a murine model of enteropathogenic and enterohaemorrhagic Escherichia coli infection. In this study, we evaluated the protective effects of the probiotic Lactobacillus brevis KB290 against C. rodentium infection by the BLI approach. First, we examined several solutions for making the suspension of bioluminescent C. rodentium for an oral inoculation to establish a stable intestinal infection. Three percent NaHCO 3 solution was found to be the best. Subsequently, mice were orally administered KB290 once daily for 7 days before inoculation with bioluminescent C. rodentium and for 8 days after infection. The bioluminescence intensity of mice fed with KB290 was significantly lower than that of unfed mice on days 1-3 post-infection . The mRNA levels of tumour necrosis factor-α and interferon-γ in the distal colon from KB290-fed mice were shown to be significantly higher than those from unfed mice on day 3 post-infection. The results suggested that KB290 intake partially inhibited the proliferation of C. rodentium , especially in the early stages of infection, via the moderate enhancement of tumour necrosis factor-α and interferon-γ production in the colon.

  18. Retrospective analysis of hepatitis B virus chronic infection in 247 patients: clinical stages, response to treatment and poor prognostic factors.

    PubMed

    Cunha-Silva, Marlone; Marinho, Fábio R T; Oliveira, Paulo F; Lopes, Tirzah M; Sevá-Pereira, Tiago; Lorena, Sonia L S; Almeida, Jazon R S

    Chronic hepatitis B is a major cause of cirrhosis, and the natural history of the disease has several clinical stages that should be thoroughly understood for the implementation of proper treatment. Nonetheless, curing the disease with antiviral treatment remains a challenge. To describe the clinical course, response to treatment, and poor prognostic factors in 247 hepatitis B virus chronic infection patients treated in a tertiary hospital in Brazil. This was a retrospective and observational study, by analyzing the medical records of HBV infected patients between January 2000 and January 2015. Most patients were male (67.2%) and 74.1% were HBeAg negative. Approximately 41% had cirrhosis and 8.5% were hepatitis C virus coinfected. The viral load was negative after two years on lamivudine, entecavir and tenofovir in 86%, 90.6%, and 92.9% of the patients, respectively. The five-year resistance rates for lamivudine, adefovir, entecavir, and tenofovir were 57.5%, 51.8%, 1.9%, and 0%, respectively. The overall seroconversion rates were 31.2% for HBeAg and 9.4% for HBsAg. Hepatocellular carcinoma was diagnosed in 9.7% of patients, liver transplantation was performed in 9.7%, and overall mortality was 10.5%. Elevations of serum alanine aminotransferase (p=0.0059) and viral load (p<0.0001) were associated with progression to liver cirrhosis. High viral load was associated with progression to hepatocellular carcinoma (p<0.0001). Significant risk factors associated with death were elevated alanine aminotransferase (p=0.0039), liver cirrhosis (p<0.0001), high viral load (p=0.007), and hepatocellular carcinoma (p=0.0008). HBeAg positive status was not associated with worse outcomes, and treatment may have been largely responsible. Elevations of viral load and serum alanine aminotransferase may select patients with worse prognosis, especially progression to cirrhosis and hepatocellular carcinoma, which were strongly association with death. Copyright © 2017 Sociedade Brasileira

  19. Long-Term Relationships: the Complicated Interplay between the Host and the Developmental Stages of Toxoplasma gondii during Acute and Chronic Infections

    PubMed Central

    Pittman, Kelly J.

    2015-01-01

    SUMMARY Toxoplasma gondii represents one of the most common parasitic infections in the world. The asexual cycle can occur within any warm-blooded animal, but the sexual cycle is restricted to the feline intestinal epithelium. T. gondii is acquired through consumption of tissue cysts in undercooked meat as well as food and water contaminated with oocysts. Once ingested, it differentiates into a rapidly replicating asexual form and disseminates throughout the body during acute infection. After stimulation of the host immune response, T. gondii differentiates into a slow-growing, asexual cyst form that is the hallmark of chronic infection. One-third of the human population is chronically infected with T. gondii cysts, which can reactivate and are especially dangerous to individuals with reduced immune surveillance. Serious complications can also occur in healthy individuals if infected with certain T. gondii strains or if infection is acquired congenitally. No drugs are available to clear the cyst form during the chronic stages of infection. This therapeutic gap is due in part to an incomplete understanding of both host and pathogen responses during the progression of T. gondii infection. While many individual aspects of T. gondii infection are well understood, viewing the interconnections between host and parasite during acute and chronic infection may lead to better approaches for future treatment. The aim of this review is to provide an overview of what is known and unknown about the complex relationship between the host and parasite during the progression of T. gondii infection, with the ultimate goal of bridging these events. PMID:26335719

  20. Long-Term Relationships: the Complicated Interplay between the Host and the Developmental Stages of Toxoplasma gondii during Acute and Chronic Infections.

    PubMed

    Pittman, Kelly J; Knoll, Laura J

    2015-12-01

    Toxoplasma gondii represents one of the most common parasitic infections in the world. The asexual cycle can occur within any warm-blooded animal, but the sexual cycle is restricted to the feline intestinal epithelium. T. gondii is acquired through consumption of tissue cysts in undercooked meat as well as food and water contaminated with oocysts. Once ingested, it differentiates into a rapidly replicating asexual form and disseminates throughout the body during acute infection. After stimulation of the host immune response, T. gondii differentiates into a slow-growing, asexual cyst form that is the hallmark of chronic infection. One-third of the human population is chronically infected with T. gondii cysts, which can reactivate and are especially dangerous to individuals with reduced immune surveillance. Serious complications can also occur in healthy individuals if infected with certain T. gondii strains or if infection is acquired congenitally. No drugs are available to clear the cyst form during the chronic stages of infection. This therapeutic gap is due in part to an incomplete understanding of both host and pathogen responses during the progression of T. gondii infection. While many individual aspects of T. gondii infection are well understood, viewing the interconnections between host and parasite during acute and chronic infection may lead to better approaches for future treatment. The aim of this review is to provide an overview of what is known and unknown about the complex relationship between the host and parasite during the progression of T. gondii infection, with the ultimate goal of bridging these events. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Validity of a stage of change instrument in assessing medication adherence in indigent patients with HIV infection.

    PubMed

    Rathbun, R Chris; Farmer, Kevin C; Lockhart, Staci M; Stephens, Johnny R

    2007-02-01

    Adherence to antiretroviral therapy (ART) is vital to achieve durable suppression of viral replication. Effective mechanisms to predict adherence can be difficult to implement in clinical practice settings. Self-administered questionnaires are a practical option for assessing patient adherence but may lack validation with objective measures of adherence. To examine the ability of a 2 item stage of change (SOC) questionnaire to predict medication adherence in indigent patients receiving ART. Patients participating in an ongoing study to examine adherence interventions were administered a 2 item SOC instrument to assess readiness for adherence behavior. The SOC instrument was given to patients prior to beginning ART and readministered after they had received 16 weeks of treatment. Electronic monitoring was used to examine the validity of the SOC instrument to predict patient readiness for adherence behavior. Thirty-one patients completed the SOC questionnaire prior to beginning a new ART regimen. Most (87%) patients were male, had previously received antiretroviral therapy (77%), and had an AIDS diagnosis (77%). The SOC category determined at baseline was a poor predictor of adherence at 4 and 16 weeks; however, the SOC category determined after treatment onset (week 16) was a strong predictor of adherence at both time points (p < 0.001 for 4 and 16 weeks; one way ANOVA). The SOC category determined at baseline correlated poorly with subsequent medication adherence in our indigent, HIV-infected patient population. Prediction of adherence based on SOC after treatment initiation may provide a better estimate of adherence behavior. Recognition of this limitation may help clinicians more accurately interpret predicted adherence behavior from self-report instruments.

  2. Estimation of infection prevalence and sensitivity in a stratified two-stage sampling design employing highly specific diagnostic tests when there is no gold standard.

    PubMed

    Miller, Ezer; Huppert, Amit; Novikov, Ilya; Warburg, Alon; Hailu, Asrat; Abbasi, Ibrahim; Freedman, Laurence S

    2015-11-10

    In this work, we describe a two-stage sampling design to estimate the infection prevalence in a population. In the first stage, an imperfect diagnostic test was performed on a random sample of the population. In the second stage, a different imperfect test was performed in a stratified random sample of the first sample. To estimate infection prevalence, we assumed conditional independence between the diagnostic tests and develop method of moments estimators based on expectations of the proportions of people with positive and negative results on both tests that are functions of the tests' sensitivity, specificity, and the infection prevalence. A closed-form solution of the estimating equations was obtained assuming a specificity of 100% for both tests. We applied our method to estimate the infection prevalence of visceral leishmaniasis according to two quantitative polymerase chain reaction tests performed on blood samples taken from 4756 patients in northern Ethiopia. The sensitivities of the tests were also estimated, as well as the standard errors of all estimates, using a parametric bootstrap. We also examined the impact of departures from our assumptions of 100% specificity and conditional independence on the estimated prevalence. Copyright © 2015 John Wiley & Sons, Ltd.

  3. A multidisciplinary team approach to two-stage revision for the infected hip replacement: a minimum five-year follow-up study.

    PubMed

    Ibrahim, M S; Raja, S; Khan, M A; Haddad, F S

    2014-10-01

    We report the five year outcomes of a two-stage approach for infected total hip replacement. This is a single-surgeon experience at a tertiary centre where the more straightforward cases are treated using single-stage exchange. This study highlights the vital role of the multidisciplinary team in managing these cases. A total of 125 patients (51 male, 74 female) with a mean age of 68 years (42 to 78) were reviewed prospectively. Functional status was assessed using the Harris hip score (HHS). The mean HHS improved from 38 (6 to 78.5) pre-operatively to 81.2 (33 to 98) post-operatively. Staphylococcus species were isolated in 85 patients (68%). The rate of control of infection was 96% at five years. In all, 19 patients died during the period of the study. This represented a one year mortality of 0.8% and an overall mortality of 15.2% at five years. No patients were lost to follow-up. We report excellent control of infection in a series of complex patients and infections using a two-stage revision protocol supported by a multidisciplinary approach. The reason for the high rate of mortality in these patients is not known.

  4. Is caprine arthritis encephalitis virus (CAEV) transmitted vertically to early embryo development stages (morulae or blastocyst) via in vitro infected frozen semen?

    PubMed

    Al Ahmad, M Z Ali; Chebloune, Y; Chatagnon, G; Pellerin, J L; Fieni, F

    2012-05-01

    The aim of this study was to determine, in vivo, whether in vitro infected cryopreserved caprine sperm is capable of transmitting caprine arthritis-encephalitis virus (CAEV) vertically to early embryo development stages via artificial insemination with in vitro infected semen. Sperm was collected from CAEV-free bucks by electroejaculation. Half of each ejaculate was inoculated with CAEV-pBSCA at a viral concentration of 10(4) TCID(50)/mL. The second half of each ejaculate was used as a negative control. The semen was then frozen. On Day 13 of superovulation treatment, 14 CAEV-free does were inseminated directly into the uterus under endoscopic control with thawed infected semen. Six CAEV-free does, used as a negative control, were inseminated intrauterine with thawed CAEV-free sperm, and eight CAEV-free does were mated with naturally infected bucks. Polymerase chain reaction (PCR) was used to detect CAEV proviral-DNA in the embryos at the D7 stage, in the embryo washing media, and in the uterine secretions of recipient does. At Day 7, all the harvested embryos were PCR-negative for CAEV proviral-DNA; however, CAEV proviral-DNA was detected in 8/14 uterine smears, and 9/14 flushing media taken from does inseminated with infected sperm, and in 1/8 uterine swabs taken from the does mated with infected bucks. The results of this study confirm that (i) artificial insemination with infected semen or mating with infected bucks may result in the transmission of CAEV to the does genital tack seven days after insemination, and (ii) irrespective of the medical status of the semen or the recipient doe, it is possible to obtain CAEV-free early embryos usable for embryo transfer.

  5. Disruption of the phagosomal membrane and egress of Legionella pneumophila into the cytoplasm during the last stages of intracellular infection of macrophages and Acanthamoeba polyphaga.

    PubMed

    Molmeret, Maëlle; Bitar, Dina M; Han, Lihui; Kwaik, Yousef Abu

    2004-07-01

    Although the early stages of intracellular infection by Legionella pneumophila are well established at the ultrastructural level, a detailed ultrastructural analysis of late stages of intracellular replication has never been done. Here we show that the membrane of the L. pneumophila-containing phagosome (LCP) is intact for up to 8 h postinfection of macrophages and Acanthamoeba polyphaga. At 12 h, 71 and 74% of the LCPs are disrupted within macrophages and A. polyphaga, respectively, while the plasma membrane remains intact. At 18 and 24 h postinfection, cytoplasmic elements such as mitochondria, lysosomes, vesicles, and amorphous material are dispersed among the bacteria and these bacteria are considered cytoplasmic. At 18 h, 77% of infected macrophages and 32% of infected A. polyphaga amoebae harbor cytoplasmic bacteria. At 24 h, 99 and 78% of infected macrophages and amoebae, respectively, contain cytoplasmic bacteria. On the basis of lysosomal acid phosphatase staining of infected macrophages and A. polyphaga, the lysosomal enzyme is present among the bacteria when host vesicles are dispersed among bacteria. Our data indicate that bacterial replication proceeds despite physical disruption of the phagosomal membrane. We also show that an lspG mutant that is defective in the type II secretion system and therefore does not secrete the hydrolytic enzymes metalloprotease, p-nitrophenol phosphorylcholine hydrolase, lipase, phospholipase A, and lysophospholipase A is as efficient as the wild-type strain in disruption of the LCP. Therefore, L. pneumophila disrupts the phagosomal membrane and becomes cytoplasmic at the last stages of infection in both macrophages and A. polyphaga. Lysosomal elements, mitochondria, cytoplasmic vesicles, and amorphous material are all dispersed among the bacteria, after phagosomal disruption, within both human macrophages and A. polyphaga. The disruption of the LCP is independent of the hydrolytic enzymes exported by the type II secretion

  6. The usefulness of DNA derived from third stage larvae in the detection of Ashworthius sidemi infection in European bison, by a simple polymerase chain reaction

    PubMed Central

    2014-01-01

    Background Ashworthius sidemi, a blood-sucking nematode, is a primary parasite of Asiatic cervides, primarily sika deer (Cervus nippon). As A. sidemi infections are common in bison, red and roe deer, and gastrointestinal nematodes are often exchanged between animals, it is possible that other farm animals such as cows and sheep that may use the same pastures can be infected. Hence, histopathological changes observed in the walls of the abomasa and duodena of infected wildlife caused by a strong parasite presence may become an important health problem also for farm animals. Methods In the present study, a simple PCR test for the detection of A. sidemi infection in European bison based on DNA from third stage infective larvae (L3) has been optimized. Results The species-specific primers generated a 406 bp fragment, and A. sidemi DNA could be detected at concentrations of 0.1 pg/μl. The specificity of PCR was confirmed by the use of the genomic DNA of adult Ostertagia ostertagi, Haemonchus contortus, Cooperiaoncophora as negative controls. Conclusion It is possible to detect A. sidemi infection in European bison using DNA from L3. If this nematode infection is transmitted to cows this method may be effective to diagnose invasion in breeding animals in vivo. PMID:24886355

  7. Altered microRNA expression and pre-mRNA splicing events reveal new mechanisms associated with early stage Mycobacterium avium subspecies paratuberculosis infection.

    PubMed

    Liang, Guanxiang; Malmuthuge, Nilusha; Guan, Yongjuan; Ren, Yuwei; Griebel, Philip J; Guan, Le Luo

    2016-04-22

    The molecular regulatory mechanisms of host responses to Mycobacterium avium subsp. paratuberculosis (MAP) infection during the early subclinical stage are still not clear. In this study, surgically isolated ileal segments in newborn calves (n = 5) were used to establish in vivo MAP infection adjacent to an uninfected control intestinal compartment. RNA-Seq was used to profile the whole transcriptome (mRNAs) and the microRNAome (miRNAs) of ileal tissues collected at one-month post-infection. The most related function of the differentially expressed mRNAs between infected and uninfected tissues was "proliferation of endothelial cells", indicating that MAP infection may lead to the over-proliferation of endothelial cells. In addition, 46.2% of detected mRNAs displayed alternative splicing events. The pre-mRNA of two genes related to macrophage maturation (monocyte to macrophage differentiation-associated) and lysosome function (adenosine deaminase) showed differential alternative splicing events, suggesting that specific changes in the pre-mRNA splicing sites may be a mechanism by which MAP escapes host immune responses. Moreover, 9 miRNAs were differentially expressed after MAP infection. The integrated analysis of microRNAome and transcriptome revealed that these miRNAs might regulate host responses to MAP infection, such as "proliferation of endothelial cells" (bta-miR-196 b), "bacteria recognition" (bta-miR-146 b), and "regulation of the inflammatory response" (bta-miR-146 b).

  8. The potential of positron emission tomography/computerized tomography (PET/CT) scanning as a detector of high-risk patients with oral infection during preoperative staging.

    PubMed

    Yamashiro, Keisuke; Nakano, Makoto; Sawaki, Koichi; Okazaki, Fumihiko; Hirata, Yasuhisa; Takashiba, Shogo

    2016-08-01

    It is sometimes difficult to determine during the preoperative period whether patients have oral infections; these patients need treatment to prevent oral infection-related complications from arising during medical therapies, such as cancer therapy and surgery. One of the reasons for this difficulty is that basic medical tests do not identify oral infections, including periodontitis and periapical periodontitis. In this report, we investigated the potential of positron emission tomography/computerized tomography (PET/CT) as a diagnostic tool in these patients. We evaluated eight patients during the preoperative period. All patients underwent PET/CT scanning and were identified as having the signs of oral infection, as evidenced by (18)F-fludeoxyglucose (FDG) localization in the oral regions. Periodontal examination and orthopantomogram evaluation showed severe infection or bone resorption in the oral regions. (18)F-FDG was localized in oral lesions, such as severe periodontitis, apical periodontitis, and pericoronitis of the third molar. The densities of (18)F-FDG were proportional to the degree of inflammation. PET/CT is a potential diagnostic tool for oral infections. It may be particularly useful in patients during preoperative staging, as they frequently undergo scanning at this time, and those identified as having oral infections at this time require treatment before cancer therapy or surgery. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Infection

    DTIC Science & Technology

    2010-09-01

    standing, diagnosis, and treatment of musculoskeletal infections. Key Words: musculoskeletal infection, biofilm , bacteria, biomaterial (J Orthop Trauma...form a biofilm , or slime layer.1 The recurrence of infections is often the result of microbial biofilm formation on the implant, enabling the persistence...Klebsiella pneumoniae). Staphylococcus species is by far the most studied pathogen in musculoskeletal infections and can produce a multilayered biofilm

  10. Life stage-related differences in density of questing ticks and infection with Borrelia burgdorferi sensu lato within a single cohort of Ixodes pacificus (Acari: Ixodidae).

    PubMed

    Eisen, Rebecca J; Mun, Jeomhee; Eisen, Lars; Lane, Robert S

    2004-07-01

    The primary aims of this study were to quantify the density of Ixodes pacificus Cooley and Kohls nymphs and adults of the same generational cohort collected within a single year in six oak or madrone leaf litter habitats and to compare the prevalence of infection with Borrelia burgdorferi sensu lato (s.l.) in adults originating from nymphal cohorts with a low (<1%) versus high (>10%) infection prevalence. Because adult densities were very low both in and adjacent to several sites, direct comparisons of infection prevalence between nymphs and adults were possible only for two sites. Mean density in these sites decreased from 11.95/100 m2 for nymphs to 0/100 m2 for adults in leaf litter, and infection prevalence with B. burgdorferi s.l. was four-fold higher in nymphs (7.4%) versus adults (1.6%) of the same generational cohort collected in ecotones bordering the leaf litter areas. Assuming a density of adults in leaf litter of 0.04/100 m2 (mean for all six examined sites) and an infection prevalence similar to that found in adults collected from litter ecotones, the risk of encountering infected ticks in leaf litter decreased >1,000-fold from the nymphal to adult stage. Regardless of site-specific infection prevalence in the nymphal stage (n = 2 sites; 0.7 versus 14%), the infection prevalence for the adults of the same generational cohort was similarly low (1.5-1.6%). Peak densities of adult I. pacificus were 0-0.1/100 m2 in leaf litter, 0-6.5/100 m2 in ecotonal grasslands, and 2.0-39.0/100 m2 in ecotonal chaparral. Despite more intensive sampling efforts in leaf litter, the vast majority of the 282 adults collected came from grass or chaparral ecotones (98.9%, n = 279) rather than leaf litter (1.1%, n = 3). The study yielded eight B. burgdorferi s.l.-infected adults; four of these carried B. burgdorferi sensu stricto Johnson, Schmidt, Hyde, Steigerwalt, and Brenner, and the remaining four were infected with currently undescribed B. burgdorferi s.l. spirochetes. This

  11. Controlled human malaria infection.

    PubMed

    Spring, Michele; Polhemus, Mark; Ockenhouse, Christian

    2014-06-15

    Since 1986, investigators at Walter Reed Army Institute of Research (WRAIR) have been using controlled human malaria challenge (CHMI) in malaria-naive adults in order to define the protective efficacy of a malaria vaccine and thus guide programmatic decisions on vaccine candidates. Adapting this model to the dengue field could provide similar evidential support for a vaccine or therapeutic product. After completing a vaccine regimen, volunteers are bitten by 5 malaria-infected female Anopheles mosquitoes in a controlled environment. Volunteers are then monitored daily for peripheral parasitemia in a hotel setting with 24-hour access to a nurse and physician. If a single verified parasite is detected, effective antimalarials are promptly administered. The vast majority of the over 1000 volunteers having participated in CHMI clinical studies have done so at US military research centers. Numerous pre-erythrocytic and erythrocytic vaccine candidates have been evaluated safely and without any related serious adverse events using this model, including the soon-to-be licensed RTS,S malaria vaccine. The lessons learned from over 25 years of experience in consistent, careful preparation and execution of the CHMI model at WRAIR can provide a foundation from which the dengue field can begin to develop a rigorous and safe "CHDI" model. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Stage IV advanced diffuse large B-cell lymphoma in human immunodeficiency virus infection with achieving cure by using highly active antiretroviral therapy alone: a case report.

    PubMed

    Lim, Do Hyoung; Rhee, Ji-Young; Park, Keon Woo

    2017-08-01

    After the introduction of highly active antiretroviral therapy (HAART), there has been a decrease in the incidence of lymphoma among the HIV-infected population and also significantly improved survival rates. We describe a remarkable case of an HIV-infected patient with advanced stage IV diffuse large B-cell lymphoma (DLBCL), completely regressed with the use of HAART alone. He remained disease-free for 6 years and he achieved cure without chemotherapy. Although several cases of low-grade lymphoma with complete regression were reported, we could not find any case of stage IV high-grade malignant lymphoma with HAART alone in complete remission for over 5 years from our review of the literature. This unique case shows the importance of HAART in improving survival and achieving cure in HIV-high-grade malignant lymphoma.

  13. Re-infection outcomes following one- and two-stage surgical revision of infected hip prosthesis in unselected patients: protocol for a systematic review and an individual participant data meta-analysis.

    PubMed

    Kunutsor, Setor K; Whitehouse, Michael R; Webb, Jason; Toms, Andrew; Stockley, Ian; Taylor, Adrian; Jones, Stephen; Wilson, Matthew; Burston, Ben; Board, Tim; Whittaker, John-Paul; Blom, Ashley W; Beswick, Andrew D

    2015-04-25

    Several aggregate published reviews have compared the effectiveness of one- and two-stage surgical revision to prevent re-infection following prosthetic hip infection and have reported inconsistent results. In addition, there were several features of these previous reviews which limited the validity of the findings. In the absence of a well-designed clinical trial, we propose the Global Infection Orthopaedic Management (INFORM) collaboration, a worldwide collaborative systematic review and meta-analysis of individual participant data (IPD) to address the existing uncertainties. Cohort studies (prospective or retrospective) and randomised controlled trials conducted in unselected patients with infection treated exclusively by one- or two-stage revision and reporting re-infection outcomes within 2 years of revision will be retrieved by searching the following databases: MEDLINE, EMBASE, Web of Science, Cochrane Database of Systematic Reviews, Cochrane Central Register of Controlled Trials and the WHO International Clinical Trials Registry Platform. Reference lists of relevant studies will be manually scanned and there will be email contact with investigators of grey literature and conference abstracts. Investigators will be invited to join the Global INFORM collaboration and share their individual level data. The primary outcome of the analyses will be incidence of re-infection within 2 years of commencement of revision surgery. Primary analyses will be conducted comparing the one-stage to the two-stage surgical revision. IPD analyses will be based on Cox proportional hazard (PH) models estimated for each study separately. Study-specific log hazard ratios will be combined using random-effects meta-analysis with fixed-effects meta-analysis in subsidiary analyses. Hazard ratios for re-infection according to different individual level characteristics such as sex, age groups, body mass index and comorbidities will also be assessed. The analyses will enable a consistent

  14. The 11,600-MW protein encoded by region E3 of adenovirus is expressed early but is greatly amplified at late stages of infection.

    PubMed Central

    Tollefson, A E; Scaria, A; Saha, S K; Wold, W S

    1992-01-01

    We have reported that an 11,600-MW (11.6K) protein is coded by region E3 of adenovirus. We have now prepared two new antipeptide antisera that have allowed us to characterize this protein further. The 11.6K protein migrates as multiple diffuse bands having apparent Mws of about 14,000, 21,000, and 31,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Immunoblotting as well as virus mutants with deletions in the 11.6K gene were used to show that the various gel bands represent forms of 11.6K. The 11.6K protein was synthesized in very low amounts during early stages of infection, from the scarce E3 mRNAs d and e which initiate from the E3 promoter. However, 11.6K was synthesized very abundantly at late stages of infection, approximately 400 times the rate at early stages, from new mRNAs termed d' and e'. Reverse transcriptase-polymerase chain reaction and RNA blot experiments indicated that mRNAs d' and e' had the same body (the coding portion) and the same middle exon (the y leader) as early E3 mRNAs d and e, but mRNAs d' and e' were spliced at their 5' termini to the major late tripartite leader which is found in all mRNAs in the major late transcription unit. mRNAs d' and e' and the 11.6K protein were the only E3 mRNAs and protein that were scarce early and were greatly amplified at late stages of infection. This suggests that specific cis- or trans-acting sequences may function to enhance the splicing of mRNAs d' and e' at late stages of infection and perhaps to suppress the splicing of mRNAs d and e at early stages of infection. We propose that the 11.6K gene be considered not only a member of region E3 but also a member of the major late transcription unit. Images PMID:1316473

  15. Kaposi’s Sarcoma-Associated Herpesvirus Genome Programming during the Early Stages of Primary Infection of Peripheral Blood Mononuclear Cells

    PubMed Central

    Jha, Hem C.; Lu, Jie; Verma, Subhash C.; Banerjee, Shuvomoy; Mehta, Devan

    2014-01-01

    ABSTRACT The early period of Kaposi’s sarcoma-associated herpesvirus (KSHV) infection involves the dynamic expression of viral genes, which are temporally and epigenetically regulated. KSHV can effectively infect and persist in endothelial as well as human B cells with different gene expression patterns. To understand the temporal epigenetic changes which occur when KSHV infects the lymphocytic compartment, we infected human peripheral blood mononuclear cells (PBMCs) and comprehensively analyzed the changes which occurred at the binding sites of virally encoded lytic as well as latent proteins along with epigenetic modifications across the KSHV genome during early primary infection. Using chromatin immunoprecipitation (ChIP) assays, we showed that the KSHV genome acquires a uniquely distinct histone modification pattern of methylation (H3K4me3, H3K9me3, and H3K27me3) and acetylation (H3Ac) during de novo infection of human PBMCs. This pattern showed that the epigenetic changes were temporally controlled. The binding profiles of KSHV latent protein LANA and the immediate early proteins RTA and K8 showed specific patterns at different times postinfection, which reflects the gene expression program. Further analysis demonstrated that KSHV can concurrently express lytic and latent genes which were associated with histone modifications at these specific regions on the viral genome. We identified three KSHV genes, K3, ORF49, and ORF64, which exhibited different profiles of histone modifications during the early stages of PBMC infection. These studies established a distinct pattern of epigenetic modification which correlates with viral gene expression temporally regulated during the first 7 days of PBMC infection and provides clues to the regulatory program required for successful infection by KSHV of human PBMCs. PMID:25516617

  16. Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection.

    PubMed

    Raaben, Matthijs; Einerhand, Alexandra W C; Taminiau, Lucas J A; van Houdt, Michel; Bouma, Janneke; Raatgeep, Rolien H; Büller, Hans A; de Haan, Cornelis A M; Rossen, John W A

    2007-06-07

    Cyclooxygenases (COXs) play a significant role in many different viral infections with respect to replication and pathogenesis. Here we investigated the role of COXs in the mouse hepatitis coronavirus (MHV) infection cycle. Blocking COX activity by different inhibitors or by RNA interference affected MHV infection in different cells. The COX inhibitors reduced MHV infection at a post-binding step, but early in the replication cycle. Both viral RNA and viral protein synthesis were affected with subsequent loss of progeny virus production. Thus, COX activity appears to be required for efficient MHV replication, providing a potential target for anti-coronaviral therapy.

  17. Polyfunctional T Cell Responses in Children in Early Stages of Chronic Trypanosoma cruzi Infection Contrast with Monofunctional Responses of Long-term Infected Adults

    PubMed Central

    Albareda, María C.; De Rissio, Ana M.; Tomas, Gonzalo; Serjan, Alicia; Alvarez, María G.; Viotti, Rodolfo; Fichera, Laura E.; Esteva, Mónica I.; Potente, Daniel; Armenti, Alejandro; Tarleton, Rick L.; Laucella, Susana A.

    2013-01-01

    Background Adults with chronic Trypanosoma cruzi exhibit a poorly functional T cell compartment, characterized by monofunctional (IFN-γ-only secreting) parasite-specific T cells and increased levels of terminally differentiated T cells. It is possible that persistent infection and/or sustained exposure to parasites antigens may lead to a progressive loss of function of the immune T cells. Methodology/Principal Findings To test this hypothesis, the quality and magnitude of T. cruzi-specific T cell responses were evaluated in T. cruzi-infected children and compared with long-term T. cruzi-infected adults with no evidence of heart failure. The phenotype of CD4+ T cells was also assessed in T. cruzi-infected children and uninfected controls. Simultaneous secretion of IFN-γ and IL-2 measured by ELISPOT assays in response to T. cruzi antigens was prevalent among T. cruzi-infected children. Flow cytometric analysis of co-expression profiles of CD4+ T cells with the ability to produce IFN-γ, TNF-α, or to express the co-stimulatory molecule CD154 in response to T. cruzi showed polyfunctional T cell responses in most T. cruzi-infected children. Monofunctional T cell responses and an absence of CD4+TNF-α+-secreting T cells were observed in T. cruzi-infected adults. A relatively high degree of activation and differentiation of CD4+ T cells was evident in T. cruzi-infected children. Conclusions/Significance Our observations are compatible with our initial hypothesis that persistent T. cruzi infection promotes eventual exhaustion of immune system, which might contribute to disease progression in long-term infected subjects. PMID:24349591

  18. Effects of commonly used chemical fertilizers on development of free-living stages of Haemonchus contortus in experimentally infected pasture.

    PubMed

    Roul, Tapas Kumar; Panda, Mitra Rajan; Mohanty, Bijayendranath; Sardar, Kautuk Kumar; Dehuri, Manaswini; Hembram, Ananta; Mohapatra, Trilochan

    2017-07-01

    The effects of N-P-K fertilizers in the form of urea, single super phosphate and muriate of potash on development of free-living stages of Haemonchus contortus were studied. Five parasite free experimental plots of 1 m×1 m area, each of paddy leaves (15-day-old) and an equal number of Cynodon dactylon grass were infested with about 10×10(4) eggs/ml phosphate buffer saline along with the application of the calculated amount of fertilizers solution. On the 10(th) day of posttreatment, the pasture was cut, processed, larvae recovered by Baermann method and counted, which was expressed as number of L3 per kg dry matter (DM) of pasture. The average recovered population of L3 of H. contortus per kg DM varied significantly (p<0.05) between the paddy leaves (5933.57±22.718) and Cynodon grass (4861.00±22.718). When different doses of chemical fertilizer and their impact on different pasture were analyzed for control (T-1, 0-0-0 kg/ha N-P-K), the mean L3 recovery per kg DM of paddy (19512.7±50.80) was more than that of Cynodon grass (16540.9±50.80). Larvae recovery per kg DM for different pastures under treatment were in decreasing order as follows: T-2 of paddy (6981.33±50.80, 35.77%), T-2 of Cynodon (5545.38±50.80, 33.52%), T-3 of paddy (317378±50.80, 16.26%), and T-3 of Cynodon (2218.72±50.80, 13.41%) which showed significant difference (p<0.05) among the treatments. In T-4 (paddy) and T-5 (Cynodon), the average number of recovery of larvae was nil implying no significant variation (p>0.05). This study shown that when N-P-K fertilizers administered at recommended level, significantly reduced larval translation of H. contortus minimizing pasture infectivity for the free range grazing animals.

  19. Humoral response to a carboxyl-terminal region of the merozoite surface protein-1 plays a predominant role in controlling blood-stage infection in rodent malaria.

    PubMed

    Daly, T M; Long, C A

    1995-07-01

    The developmental stages of malaria parasites that infect E are responsible for the morbidity and mortality associated with this disease. One of the leading candidates for a blood-stage vaccine against malaria is a surface protein of merozoites, the infectious stages for E, designated merozoite surface protein-1 (MSP-1). The rodent malarial parasite Plasmodium yoelii yoelii (Py) has provided a model system for the study of this Ag, and previous studies from our laboratory had demonstrated that the carboxyl-terminal, cysteine-rich region of MSP-1, when expressed in a native configuration, could immunize mice against a normally lethal challenge infection with Py. We have now prepared a new fusion construct with the glutathione-S-transferase gene of Schistosoma japonicum joined to the carboxyl-terminal 11 kDa of Py MSP-1. This includes only the two epidermal growth factor-like domains of the MSP-1 protein. When expressed in recombinant Escherichia coli, the fusion protein induces a strong protective response in BALB/c mice as judged by the resistance of immunized animals to a virulent challenge infection. Moreover, we demonstrate that this resistance can be transferred passively by immune serum or by purified Ig, establishing a significant role for humoral immunity in protection. No role for CD4+ or CD8+ T cells could be identified in the first 12 days after challenge infection in immune mice selectively depleted of these cells; however, after this time, parasitemias gradually increased in mice depleted of CD4+ T cells, suggesting an active host response is necessary to completely eliminate the infection.

  20. Two-Stage Revision for Infected Total Knee Arthroplasty: Based on Autoclaving the Recycled Femoral Component and Intraoperative Molding Using Antibiotic-Impregnated Cement on the Tibial Side

    PubMed Central

    Lee, Byoung-Joo; Yoon, Seong-Dae

    2015-01-01

    Background The purpose of this study was to determine the degree of infection control and postoperative function for new articulating metal-on-cement spacer. Methods A retrospective study of 19 patients (20 cases), who underwent a two-stage revision arthroplasty using mobile cement prosthesis, were followed for a minimum of 2 years. This series consisted of 16 women and 3 men, having an overall mean age of 71 years. During the first stage of revision, the femoral implant and all the adherent cement was removed, after which it was autoclaved before replacement. The tibial component was removed and a doughy state, antibiotic-impregnated cement was inserted on the tibial side. To achieve joint congruency, intraoperative molding was performed by flexing and extending the knee joint. Each patient was evaluated clinically and radiologically. The clinical assessments included range of motion, and the patients were scored as per the Hospital for Special Surgery (HSS) and Knee Society (KS) criteria. Results The mean range of knee joint motion was 70° prior to the first stage operation and 72° prior to the second stage revision arthroplasty; following revision arthroplasty, it was 113° at the final follow-up. The mean HSS score and KS knee and function scores were 86, 82, and 54, respectively, at the final follow-up. The success rate in terms of infection eradication was 95% (19/20 knees). No patient experienced soft tissue contracture requiring a quadriceps snip. Conclusions This novel technique provides excellent radiological and clinical outcomes. It offers a high surface area of antibiotic-impregnated cement, a good range of motion between first and second stage revision surgery for the treatment of chronic infection after total knee arthroplasty, and is of a reasonable cost. PMID:26330952

  1. Two-Stage Revision Total Hip Arthroplasty for Periprosthetic Infections Using Antibiotic-Impregnated Cement Spacers of Various Types and Materials

    PubMed Central

    Takahira, Naonobu; Moriya, Mitsutoshi; Yamamoto, Takeaki; Minegishi, Yojiro; Sakai, Rina; Itoman, Moritoshi; Takaso, Masashi

    2013-01-01

    Antibiotic-impregnated hip cement spacers of various types and materials have been used in the treatment of periprosthetic hip infections. We developed a handmade spacer by using polymethylmethacrylate (PMMA) and/or α-tricalcium phosphate (α-TCP). In this study, we retrospectively reviewed the surgical outcomes in 36 consecutive patients treated with 2-stage revision total hip arthroplasty by using our antibiotic-impregnated hip cement spacers. We aimed to analyze the infection control and reinfection rates after revision surgery. Moreover, we analyzed the possible predictors of postoperative reinfection. After exclusion of 1 patient who died immediately after the first-stage surgery, infection was controlled in 33 of the 36 hips (success rate, 91.7%). Two of these 33 hips underwent resection arthroplasty. Of the 36 hips that had been treated with the antibiotic-cement spacer, 31 hips (86.1%) were eligible for the second-stage prosthesis re-implantation. The 31 protocol hip joints of patients followed up for >6 months (mean, 48.6 months). Ten of these 31 hips (32.3%) became reinfected. No possible predictor examined differed significantly between the reinfection-positive and reinfection-negative groups. However, spacers consisting of PMMA cement alone were associated with the highest risk of reinfection. Therefore, α-TCP-containing antibiotic-impregnated hip cement spacers might decrease the reinfection rate in patients undergoing re-implantation. PMID:24381509

  2. Comparative Transcriptome Analysis between Broccoli (Brassica oleracea var. italica) and Wild Cabbage (Brassica macrocarpa Guss.) in Response to Plasmodiophora brassicae during Different Infection Stages.

    PubMed

    Zhang, Xiaoli; Liu, Yumei; Fang, Zhiyuan; Li, Zhansheng; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2016-01-01

    Clubroot, one of the most devastating diseases to the Brassicaceae family, is caused by the obligate biotrophic pathogen Plasmodiophora brassicae. However, studies of the molecular basis of disease resistance are still poor especially in quantitative resistance. In the present paper, two previously identified genotypes, a clubroot-resistant genotype (wild cabbage, B2013) and a clubroot-susceptible genotype (broccoli, 90196) were inoculated by P. brassicae for 0 (T0), 7 (T7), and 14 (T14) day after inoculation (DAI). Gene expression pattern analysis suggested that response changes in transcript level of two genotypes under P. brassicae infection were mainly activated at the primary stage (T7). Based on the results of DEGs functional enrichments from two infection stages, genes associated with cell wall biosynthesis, glucosinolate biosynthesis, and plant hormone signal transduction showed down-regulated at T14 compared to T7, indicating that defense responses to P. brassicae were induced earlier, and related pathways were repressed at T14. In addition, the genes related to NBS-LRR proteins, SA signal transduction, cell wall and phytoalexins biosynthesis, chitinase, Ca(2+) signals and RBOH proteins were mainly up-regulated in B2013 by comparing those of 90196, indicating the pathways of response defense to clubroot were activated in the resistant genotype. This is the first report about comparative transcriptome analysis for broccoli and its wild relative during the different stages of P. brassicae infection and the results should be useful for molecular assisted screening and breeding of clubroot-resistant genotypes.

  3. Comparative Transcriptome Analysis between Broccoli (Brassica oleracea var. italica) and Wild Cabbage (Brassica macrocarpa Guss.) in Response to Plasmodiophora brassicae during Different Infection Stages

    PubMed Central

    Zhang, Xiaoli; Liu, Yumei; Fang, Zhiyuan; Li, Zhansheng; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2016-01-01

    Clubroot, one of the most devastating diseases to the Brassicaceae family, is caused by the obligate biotrophic pathogen Plasmodiophora brassicae. However, studies of the molecular basis of disease resistance are still poor especially in quantitative resistance. In the present paper, two previously identified genotypes, a clubroot-resistant genotype (wild cabbage, B2013) and a clubroot-susceptible genotype (broccoli, 90196) were inoculated by P. brassicae for 0 (T0), 7 (T7), and 14 (T14) day after inoculation (DAI). Gene expression pattern analysis suggested that response changes in transcript level of two genotypes under P. brassicae infection were mainly activated at the primary stage (T7). Based on the results of DEGs functional enrichments from two infection stages, genes associated with cell wall biosynthesis, glucosinolate biosynthesis, and plant hormone signal transduction showed down-regulated at T14 compared to T7, indicating that defense responses to P. brassicae were induced earlier, and related pathways were repressed at T14. In addition, the genes related to NBS-LRR proteins, SA signal transduction, cell wall and phytoalexins biosynthesis, chitinase, Ca2+ signals and RBOH proteins were mainly up-regulated in B2013 by comparing those of 90196, indicating the pathways of response defense to clubroot were activated in the resistant genotype. This is the first report about comparative transcriptome analysis for broccoli and its wild relative during the different stages of P. brassicae infection and the results should be useful for molecular assisted screening and breeding of clubroot-resistant genotypes. PMID:28066482

  4. Sustained high level of serum VEGF at convalescent stage contributes to the renal recovery after HTNV infection in patients with hemorrhagic fever with renal syndrome.

    PubMed

    Ma, Ying; Liu, Bei; Yuan, Bin; Wang, Jiuping; Yu, Haitao; Zhang, Yun; Xu, Zhuwei; Zhang, Yusi; Yi, Jing; Zhang, Chunmei; Zhou, Xingchun; Yang, Angang; Zhuang, Ran; Jin, Boquan

    2012-01-01

    To investigate the role of vascular endothelial growth factor (VEGF) in the increased permeability of vascular endothelial cells after Hantaan virus (HTNV) infection in humans, the concentration of VEGF in serum from HTNV infected patients was quantified with sandwich ELISA. Generally, the level of serum VEGF in patients was elevated to 607.0 (542.2-671.9) pg/mL, which was dramatically higher compared with healthy controls (P < 0.001). There was a rapid increase of the serum VEGF level in all patients from the fever onset to oliguric stage, at which the serum creatinine reached the peak level of the disease, indicating that VEGF may be involved in the pathogenesis of renal hyper-permeability. Moreover, the serum VEGF level at convalescent stage was positively correlated with the degree of the disease severity. The sustained high level of serum VEGF at convalescence was observed in critical HFRS patients, suggesting that VEGF would probably contribute to the renal recovery after the virus clearance. Taken together, our results suggested that the VEGF would be involved in the pathogenesis of renal dysfunction at the oliguric stage after HTNV infection, but may function as a recovery factor during the convalescence to help the body self-repair of the renal injury.

  5. Debridement with prosthesis retention and antibiotherapy vs. two-stage revision for periprosthetic knee infection within 3 months after arthroplasty: a case-control study.

    PubMed

    Lizaur-Utrilla, A; Gonzalez-Parreño, S; Gil-Guillen, V; Lopez-Prats, F A

    2015-09-01

    Sixty-four patients with periprosthetic infection within 3 months of index arthroplasty, of whom 39 underwent debridement with prosthesis retention and antibiotherapy (DPRA), and 25 underwent two-stage revision (2SR), were compared regarding control of infection and functional outcomes by use of Knee Society scores. Failure was defined as the need for subsequent surgery to control infection. The failure rate after DPRA was 61.5%, and that after 2SR was 12.0% (p 0.001). The failure risk was not significantly associated with the duration of symptoms (≤4 weeks). The only predictor of failure was isolation of Staphylococcus aureus or Staphylococcus epidermidis. Treatment with 2SR required fewer surgical operations, a shorter duration of hospitalization, and a shorter duration of treatment. All patients who required a second debridement ultimately underwent prosthesis removal. The functional outcome was significantly better for 2SR at the last follow-up.

  6. Extensive complement-dependent enhancement of HIV-1 by autologous non-neutralising antibodies at early stages of infection

    PubMed Central

    2011-01-01

    Background Non-neutralising antibodies to the envelope glycoprotein are elicited during acute HIV-1 infection and are abundant throughout the course of disease progression. Although these antibodies appear to have negligible effects on HIV-1 infection when assayed in standard neutralisation assays, they have the potential to exert either inhibitory or enhancing effects through interactions with complement and/or Fc receptors. Here we report that non-neutralising antibodies produced early in response to HIV-1 infection can enhance viral infectivity. Results We investigated this complement-mediated antibody-dependent enhancement (C'-ADE) of early HIV infection by carrying out longitudinal studies with primary viruses and autologous sera derived sequentially from recently infected individuals, using a T cell line naturally expressing the complement receptor 2 (CR2; CD21). The C'-ADE was consistently observed and in some cases achieved infection-enhancing levels of greater than 350-fold, converting a low-level infection to a highly destructive one. C'-ADE activity declined as a neutralising response to the early virus emerged, but later virus isolates that had escaped the neutralising response demonstrated an increased capacity for enhanced infection by autologous antibodies. Moreover, sera with autologous enhancing activity were capable of C'ADE of heterologous viral isolates, suggesting the targeting of conserved epitopes on the envelope glycoprotein. Ectopic expression of CR2 on cell lines expressing HIV-1 receptors was sufficient to render them sensitive to C'ADE. Conclusions Taken together, these results suggest that non-neutralising antibodies to the HIV-1 envelope that arise during acute infection are not 'passive', but in concert with complement and complement receptors may have consequences for HIV-1 dissemination and pathogenesis. PMID:21401915

  7. C-reactive protein, procalcitonin, interleukin-6, vascular endothelial growth factor and oxidative metabolites in diagnosis of infection and staging in patients with gastric cancer

    PubMed Central

    Ilhan, Nevin; Ilhan, Necip; Ilhan, Yavuz; Akbulut, Handan; Küçüksu, Mehmet

    2004-01-01

    AIM: The current study was to determine the serum/plasma levels of VEGF, IL-6, malondialdehyde (MDA), nitric oxide (NO), PCT and CRP in gastric carcinoma and correlation with the stages of the disease and accompanying infection. METHODS: We examined the levels of serum VEGF, IL-6, PCT, CRP and plasma MDA, NO in 42 preoperative gastric cancer patients and 23 healthy subjects. There were infection anamneses that had no definite origin in 19 cancer patients. RESULTS: The VEGF levels (mean ± SD; pg/mL) were 478.05 ± 178.29 and 473.85 ± 131.24 in gastric cancer patients with and without infection, respectively, and these values were not significantly different (P>0.05). The levels of VEGF, CRP, PCT, IL-6, MDA and NO in cancer patients were significantly higher than those in healthy controls and the levels of CRP, PCT, IL-6, MDA and NO were statistically increased in infection group when compared with non-infection group (P<0.001). CONCLUSION: Although serum VEGF concentrations were increased in gastric cancer, this increase might not be related to infection. CRP, PCT, IL-6, MDA and NO have obvious drawbacks in the diagnosis of infections in cancer patients. These markers may not help to identify infections in the primary evaluation of cancer patients and hence to avoid unnecessary antibiotic treatments as well as hospitalization. According to the results of this study, IL-6, MDA, NO and especially VEGF can be used as useful parameters to diagnose and grade gastric cancer. PMID:15069709

  8. Infection-related hospitalization and risk of end-stage renal disease in patients with systemic lupus erythematosus: a nationwide population-based study.

    PubMed

    Lin, Chien-Hung; Hung, Peir-Haur; Hu, Hsiao-Yun; Chen, Yann-Jang; Guo, How-Ran; Hung, Kuan-Yu

    2017-10-01

    Infections are a major cause of morbidity in patients with systemic lupus erythematosus (SLE), and may lead to death. No nationally representative study of patients with SLE has examined the rates of infection-related hospitalization and the risk of end-stage renal disease (ESRD). We conducted a nationwide cohort study of 7326 patients with newly diagnosed SLE and no history of ESRD. All data were from Taiwan's National Health Insurance claims database for the period 2000-11. Among all SLE patients, 316 (4.3%) developed ESRD (mean follow-up time: 8.1 years). Multivariate Cox regression analysis indicated that the risk of ESRD increased with the number of infection-related hospitalizations. For patients with three or more infection-related admissions, the hazard ratio (HR) for ESRD was 5.08 [95% confidence interval (CI): 3.74-6.90] relative to those with no infection-related admission. Analysis by type of infection indicated that bacteremia patients had the greatest risk for ESRD (HR: 4.82; 95% CI: 3.40-6.85). Analysis of age of SLE onset indicated that patients with juvenile-onset (<18 years) and three or more infection-related hospitalizations had a greatly increased risk for ESRD (HR: 14.49; 95% CI: 5.34-39.33). Infection-related hospitalizations are associated with a significantly increased risk of ESRD in patients with SLE, especially those with juvenile-onset SLE. Among patients with different types of infectious diseases, those with bacteremia were more likely to develop ESRD.

  9. Interleukin-10 production at the early stage of infection with foot-and-mouth disease virus related to the likelihood of persistent infection in cattle.

    PubMed

    Zhang, Zhidong; Doel, Claudia; Bashiruddin, John B

    2015-11-19

    The factors leading to persistent infection of foot-and-mouth disease (FMD) virus in ruminants are not well defined. This paper provides evidence of the presence of interleukin-10 (IL-10) early in the course of infection (1-4 days) as a factor in the development of persistence of FMD virus in cattle. Results showed that serum IL-10 in carrier cattle infected with FMD virus type O (n = 4) was detected and peaked at 1 or 2 days post infection and rapidly declined thereafter. In contract, serum IL-10 levels in non-carrier cattle (n = 21) were very low or undetectable during the same period.

  10. Inefficiency of C3H/HeN Mice to Control Chlamydial Lung Infection Correlates with Downregulation of Neutrophil Activation During the Late Stage of Infection

    PubMed Central

    Tang, Xiaofei; Bu, Xiaokun; Zhang, Naihong; Li, Xiaoxia; Huang, Huanjun; Bai, Hong; Yang, Xi

    2009-01-01

    We previously reported that massive infiltration of neutrophils in C3H/HeN (C3H) mice could not efficiently control Chlamydia muridarum (Cm) infection and might contribute to the high susceptibility of these mice to lung infection. To further define the nature of neutrophil responses in C3H mice during chlamydial infection, we examine the expression of adhesion molecules and CD11b related to neutrophils infiltration and activation, respectively, following intranasal Cm infection. The results showed that the expression of selectins (E-selectin, P-selectin and L-selectin), and intercellular cell adhesion molecule-1 (ICAM-1) in the lung of C3H mice increased more significantly than in C57BL/6 (B6) mice, the more resistant strain. These results correlated well with the massive neutrophils infiltration in C3H mice. In contrast, CD11b expression on peripheral blood and lung neutrophils in C3H mice exhibited a significant reduction compared with B6 mice during the late phage of infection (day 14). These findings suggest that the high-level expression of adhesion molecules in C3H mice may enhance neutrophils recruitment to the lung, but the decline of CD11b expression on neutrophils may attenuate neutrophil function. Therefore, CD11b down-regulation on neutrophils may contribute to the failure of C3H mice to control chlamydial lung infection. PMID:19728926

  11. Pineapple juice for digestion of swamp eel viscera for harvesting infective-stage larva of Gnathostoma spp.

    PubMed

    Soogarun, Suphan; Suwansaksri, Jamsai; Wiwanitkit, Viroj

    2004-06-01

    Third-stage larvae were used as antigen in the diagnosis of gnathostomiasis in Western blot analysis. Normally, the larvae were obtained from digestion of eel's liver (Fluta alba) by the enzyme pepsin. We used pineapple juice (Ananus comosus) instead of enzyme pepsin in harvesting Gnathostoma spinigerum third-stage larvae. The difference in recovered larvae numbers, between pineapple juice and pepsin, were not statistically significantly different (p>0.05). The larvae from pepsin and pineapple juice digestion were cultivated on BME for 7 days; the survival rates were not significantly different (p>0.05). Thus, pineapple juice is another enzyme of choice for recovering Gnathostoma spinigerum third-stage larvae.

  12. In Vivo Antiprotozoal Activity of the Chloroform Extract from Carica papaya Seeds against Amastigote Stage of Trypanosoma cruzi during Indeterminate and Chronic Phase of Infection.

    PubMed

    Jimenez-Coello, Matilde; Acosta-Viana, Karla Y; Ortega-Pacheco, Antonio; Perez-Gutierrez, Salud; Guzman-Marin, Eugenia

    2014-01-01

    In order to evaluate the antiprotozoal activity of the chloroform extract of Carica papaya seeds during the subacute and chronic phase of infection of Trypanosoma cruzi, doses of 50 and 75 mg/kg were evaluated during the subacute phase, including a mixture of their main components (oleic, palmitic, and stearic acids). Subsequently, doses of 50 and 75 mg/kg in mice during the chronic phase of infection (100 dpi) were also evaluated. It was found that chloroform extract was able to reduce the amastigote nests numbers during the subacute phase in 55.5 and 69.7% (P > 0.05) as well as in 56.45% in animals treated with the mixture of fatty acids. Moreover, the experimental groups treated with 50 and 75 mg/kg during the chronic phase of the infection showed a significant reduction of 46.8 and 53.13% respectively (P < 0.05). It is recommended to carry out more studies to determine if higher doses of chloroformic extract or its administration in combination with other antichagasic drugs allows a better response over the intracellular stage of T. cruzi in infected animal models and determine if the chloroform extract of C. papaya could be considered as an alternative for treatment during the indeterminate and chronic phase of the infection.

  13. In Vivo Antiprotozoal Activity of the Chloroform Extract from Carica papaya Seeds against Amastigote Stage of Trypanosoma cruzi during Indeterminate and Chronic Phase of Infection

    PubMed Central

    Ortega-Pacheco, Antonio; Perez-Gutierrez, Salud; Guzman-Marin, Eugenia

    2014-01-01

    In order to evaluate the antiprotozoal activity of the chloroform extract of Carica papaya seeds during the subacute and chronic phase of infection of Trypanosoma cruzi, doses of 50 and 75 mg/kg were evaluated during the subacute phase, including a mixture of their main components (oleic, palmitic, and stearic acids). Subsequently, doses of 50 and 75 mg/kg in mice during the chronic phase of infection (100 dpi) were also evaluated. It was found that chloroform extract was able to reduce the amastigote nests numbers during the subacute phase in 55.5 and 69.7% (P > 0.05) as well as in 56.45% in animals treated with the mixture of fatty acids. Moreover, the experimental groups treated with 50 and 75 mg/kg during the chronic phase of the infection showed a significant reduction of 46.8 and 53.13% respectively (P < 0.05). It is recommended to carry out more studies to determine if higher doses of chloroformic extract or its administration in combination with other antichagasic drugs allows a better response over the intracellular stage of T. cruzi in infected animal models and determine if the chloroform extract of C. papaya could be considered as an alternative for treatment during the indeterminate and chronic phase of the infection. PMID:25276216

  14. Characteristics and stage of the underlying diseases could determine the risk of opportunistic infections in patients receiving alemtuzumab.

    PubMed

    Nosari, A; Tedeschi, A; Ricci, F; Montillo, M

    2008-02-01

    Alemtuzumab is usually associated with opportunistic infections. We have treated 67 patients, 8 non-Hodgkin's lymphoma and 59 chronic lymphocytic leukemia (CLL) with campath. Among CLL patients, 6 used alemtuzumab in first line, alone or with chemotherapy, 41 as consolidation therapy and 11 as salvage therapy, 3 alone and 8 with chemotherapy. In our series opportunistic infections were prevalently found in patients submitted to alemtuzumab salvage therapy (33.3%), with or without chemotherapy; in particular 1 pulmonary nocardiosis, 1 tubercolosis. Also during the first line alemtuzumab therapy one case of lysteriosis and one case of HBV reactivation were found (33.3%). No opportunistic infections were diagnosed to our CLL patients in consolidation therapy, when the underlying hematologic disease was reduced or present only as minimal residual disease. A good response of malignancy, namely CLL, to induction therapy, such as a less aggressive schedule of therapy, determine a lower risk of immunosuppression and therefore a low number of opportunistic infections.

  15. Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle.

    PubMed Central

    Knowles, D; Torioni de Echaide, S; Palmer, G; McGuire, T; Stiller, D; McElwain, T

    1996-01-01

    A protein epitope of major surface protein 5 (MSP5), defined by monoclonal antibody (MAb) ANAF16C1, is conserved among Anaplasma species (E. S. Visser, T. C. McGuire, G. H. Palmer, W. C. Davis, V. Shkap, E. Pipano, and D. P. Knowles, Jr., Infect. Immun. 60:5139-5144, 1992) and is expressed in the salivary glands of infected ticks. A competitive inhibition ELISA (cELISA) for the detection of bovine anti-MSP5 antibodies was developed by using purified recombinant MSP5 fusion protein and MAb ANAF16C1. The specificity of the recombinant-MSP5 cELISA within North America was established by using 261 serum samples from cattle in the regions of Hawaii and Northern Ontario where anaplasmosis is not endemic and from cattle proven by splenectomy or subinoculation of whole blood into susceptible splenectomized recipients to be uninfected. The maximum percent inhibition by these sera was 18%. Sera known to be positive were obtained from 35 cattle either experimentally inoculated with infected erythrocytes or exposed to infected Dermacentor andersoni ticks. Thirty-four of the 35 serum samples inhibited MAb ANAF16C1 binding by > or = 25%. During acute infection, the MSP5 cELISA detected antibodies prior to or concomitantly with the appearance of rickettsiae in erythrocytes. Antibodies were detectable in sera from persistently infected cattle inoculated as long as 6 years previously. PMID:8862589

  16. Altered microRNA expression and pre-mRNA splicing events reveal new mechanisms associated with early stage Mycobacterium avium subspecies paratuberculosis infection

    PubMed Central

    Liang, Guanxiang; Malmuthuge, Nilusha; Guan, Yongjuan; Ren, Yuwei; Griebel, Philip J.; Guan, Le Luo

    2016-01-01

    The molecular regulatory mechanisms of host responses to Mycobacterium avium subsp. paratuberculosis (MAP) infection during the early subclinical stage are still not clear. In this study, surgically isolated ileal segments in newborn calves (n = 5) were used to establish in vivo MAP infection adjacent to an uninfected control intestinal compartment. RNA-Seq was used to profile the whole transcriptome (mRNAs) and the microRNAome (miRNAs) of ileal tissues collected at one-month post-infection. The most related function of the differentially expressed mRNAs between infected and uninfected tissues was “proliferation of endothelial cells”, indicating that MAP infection may lead to the over-proliferation of endothelial cells. In addition, 46.2% of detected mRNAs displayed alternative splicing events. The pre-mRNA of two genes related to macrophage maturation (monocyte to macrophage differentiation-associated) and lysosome function (adenosine deaminase) showed differential alternative splicing events, suggesting that specific changes in the pre-mRNA splicing sites may be a mechanism by which MAP escapes host immune responses. Moreover, 9 miRNAs were differentially expressed after MAP infection. The integrated analysis of microRNAome and transcriptome revealed that these miRNAs might regulate host responses to MAP infection, such as “proliferation of endothelial cells” (bta-miR-196 b), “bacteria recognition” (bta-miR-146 b), and “regulation of the inflammatory response” (bta-miR-146 b). PMID:27102525

  17. High specificity of line-immunoassay based algorithms for recent HIV-1 infection independent of viral subtype and stage of disease

    PubMed Central

    2011-01-01

    Background Serologic testing algorithms for recent HIV seroconversion (STARHS) provide important information for HIV surveillance. We have shown that a patient's antibody reaction in a confirmatory line immunoassay (INNO-LIATM HIV I/II Score, Innogenetics) provides information on the duration of infection. Here, we sought to further investigate the diagnostic specificity of various Inno-Lia algorithms and to identify factors affecting it. Methods Plasma samples of 714 selected patients of the Swiss HIV Cohort Study infected for longer than 12 months and representing all viral clades and stages of chronic HIV-1 infection were tested blindly by Inno-Lia and classified as either incident (up to 12 m) or older infection by 24 different algorithms. Of the total, 524 patients received HAART, 308 had HIV-1 RNA below 50 copies/mL, and 620 were infected by a HIV-1 non-B clade. Using logistic regression analysis we evaluated factors that might affect the specificity of these algorithms. Results HIV-1 RNA <50 copies/mL was associated with significantly lower reactivity to all five HIV-1 antigens of the Inno-Lia and impaired specificity of most algorithms. Among 412 patients either untreated or with HIV-1 RNA ≥50 copies/mL despite HAART, the median specificity of the algorithms was 96.5% (range 92.0-100%). The only factor that significantly promoted false-incident results in this group was age, with false-incident results increasing by a few percent per additional year. HIV-1 clade, HIV-1 RNA, CD4 percentage, sex, disease stage, and testing modalities exhibited no significance. Results were similar among 190 untreated patients. Conclusions The specificity of most Inno-Lia algorithms was high and not affected by HIV-1 variability, advanced disease and other factors promoting false-recent results in other STARHS. Specificity should be good in any group of untreated HIV-1 patients. PMID:21943091

  18. High specificity of line-immunoassay based algorithms for recent HIV-1 infection independent of viral subtype and stage of disease.

    PubMed

    Schüpbach, Jörg; Bisset, Leslie R; Regenass, Stephan; Bürgisser, Philippe; Gorgievski, Meri; Steffen, Ingrid; Andreutti, Corinne; Martinetti, Gladys; Shah, Cyril; Yerly, Sabine; Klimkait, Thomas; Gebhardt, Martin; Schöni-Affolter, Franziska; Rickenbach, Martin; Barth, J; Battegay, M; Bernascon, E; Böni, J; Bucher, H C; Bürgisser, P; Burton-Jeangros, C; Calmy, A; Cavassini, M; Dubs, R; Egger, M; Elzi, L; Fehr, J; Fischer, M; Flepp, M; Francioli, P; Furrer, H; Fux, C A; Gorgievski, M; Günthard, H; Hasse, B; Hirsch, H H; Hirschel, B; Hösli, I; Kahlert, C; Kaiser, L; Keiser, O; Kind, C; Klimkait, T; Kovari, H; Ledergerber, B; Martinetti, G; Martinez de Tejada, B; Müller, N; Nadal, D; Pantaleo, G; Rauch, A; Regenass, S; Rickenbach, M; Rudin, C; Schmid, P; Schultze, D; Schöni-Affolter, F; Schüpbach, J; Speck, R; Taffé, P; Telenti, A; Trkola, A; Vernazza, P; von Wyl, V; Weber, R; Yerly, S

    2011-09-26

    Serologic testing algorithms for recent HIV seroconversion (STARHS) provide important information for HIV surveillance. We have shown that a patient's antibody reaction in a confirmatory line immunoassay (INNO-LIA HIV I/II Score, Innogenetics) provides information on the duration of infection. Here, we sought to further investigate the diagnostic specificity of various Inno-Lia algorithms and to identify factors affecting it. Plasma samples of 714 selected patients of the Swiss HIV Cohort Study infected for longer than 12 months and representing all viral clades and stages of chronic HIV-1 infection were tested blindly by Inno-Lia and classified as either incident (up to 12 m) or older infection by 24 different algorithms. Of the total, 524 patients received HAART, 308 had HIV-1 RNA below 50 copies/mL, and 620 were infected by a HIV-1 non-B clade. Using logistic regression analysis we evaluated factors that might affect the specificity of these algorithms. HIV-1 RNA < 50 copies/mL was associated with significantly lower reactivity to all five HIV-1 antigens of the Inno-Lia and impaired specificity of most algorithms. Among 412 patients either untreated or with HIV-1 RNA ≥ 50 copies/mL despite HAART, the median specificity of the algorithms was 96.5% (range 92.0-100%). The only factor that significantly promoted false-incident results in this group was age, with false-incident results increasing by a few percent per additional year. HIV-1 clade, HIV-1 RNA, CD4 percentage, sex, disease stage, and testing modalities exhibited no significance. Results were similar among 190 untreated patients. The specificity of most Inno-Lia algorithms was high and not affected by HIV-1 variability, advanced disease and other factors promoting false-recent results in other STARHS. Specificity should be good in any group of untreated HIV-1 patients.

  19. Induction of immunomodulatory miR-146a and miR-155 in small intestinal epithelium of Vibrio cholerae infected patients at acute stage of cholera

    PubMed Central

    Melgar, Silvia; Aung, Kyaw Min; Rahman, Arman; Qadri, Firdausi; Wai, Sun Nyunt; Shirin, Tahmina

    2017-01-01

    The potential immunomodulatory role of microRNAs in small intestine of patients with acute watery diarrhea caused by Vibrio cholerae O1 or enterotoxigenic Escherichia coli (ETEC) infection was investigated. Duodenal biopsies were obtained from study-participants at the acute (day 2) and convalescent (day 21) stages of disease, and from healthy individuals. Levels of miR-146a, miR-155 and miR-375 and target gene (IRAK1, TRAF6, CARD10) and 11 cytokine mRNAs were determined by qRT-PCR. The cellular source of microRNAs in biopsies was analyzed by in situ hybridization. The ability of V. cholerae bacteria and their secreted products to cause changes in microRNA- and mRNA levels in polarized tight monolayers of intestinal epithelial cells was investigated. miR-146a and miR-155 were expressed at significantly elevated levels at acute stage of V. cholerae infection and declined to normal at convalescent stage (P<0.009 versus controls; P = 0.03 versus convalescent stage, pairwise). Both microRNAs were mainly expressed in the epithelium. Only marginal down-regulation of target genes IRAK1 and CARD10 was seen and a weak cytokine-profile was identified in the acute infected mucosa. No elevation of microRNA levels was seen in ETEC infection. Challenge of tight monolayers with the wild type V. cholerae O1 strain C6706 and clinical isolates from two study-participants, caused significant increase in miR-155 and miR-146a by the strain C6706 (P<0.01). One clinical isolate caused reduction in IRAK1 levels (P<0.05) and none of the strains induced inflammatory cytokines. In contrast, secreted factors from these strains caused markedly increased levels of IL-8, IL-1β, and CARD10 (P<0.001), without inducing microRNA expression. Thus, miR-146a and miR-155 are expressed in the duodenal epithelium at the acute stage of cholera. The inducer is probably the V. cholerae bacterium. By inducing microRNAs the bacterium can limit the innate immune response of the host, including inflammation

  20. Induction of immunomodulatory miR-146a and miR-155 in small intestinal epithelium of Vibrio cholerae infected patients at acute stage of cholera.

    PubMed

    Bitar, Aziz; De, Rituparna; Melgar, Silvia; Aung, Kyaw Min; Rahman, Arman; Qadri, Firdausi; Wai, Sun Nyunt; Shirin, Tahmina; Hammarström, Marie-Louise

    2017-01-01

    The potential immunomodulatory role of microRNAs in small intestine of patients with acute watery diarrhea caused by Vibrio cholerae O1 or enterotoxigenic Escherichia coli (ETEC) infection was investigated. Duodenal biopsies were obtained from study-participants at the acute (day 2) and convalescent (day 21) stages of disease, and from healthy individuals. Levels of miR-146a, miR-155 and miR-375 and target gene (IRAK1, TRAF6, CARD10) and 11 cytokine mRNAs were determined by qRT-PCR. The cellular source of microRNAs in biopsies was analyzed by in situ hybridization. The ability of V. cholerae bacteria and their secreted products to cause changes in microRNA- and mRNA levels in polarized tight monolayers of intestinal epithelial cells was investigated. miR-146a and miR-155 were expressed at significantly elevated levels at acute stage of V. cholerae infection and declined to normal at convalescent stage (P<0.009 versus controls; P = 0.03 versus convalescent stage, pairwise). Both microRNAs were mainly expressed in the epithelium. Only marginal down-regulation of target genes IRAK1 and CARD10 was seen and a weak cytokine-profile was identified in the acute infected mucosa. No elevation of microRNA levels was seen in ETEC infection. Challenge of tight monolayers with the wild type V. cholerae O1 strain C6706 and clinical isolates from two study-participants, caused significant increase in miR-155 and miR-146a by the strain C6706 (P<0.01). One clinical isolate caused reduction in IRAK1 levels (P<0.05) and none of the strains induced inflammatory cytokines. In contrast, secreted factors from these strains caused markedly increased levels of IL-8, IL-1β, and CARD10 (P<0.001), without inducing microRNA expression. Thus, miR-146a and miR-155 are expressed in the duodenal epithelium at the acute stage of cholera. The inducer is probably the V. cholerae bacterium. By inducing microRNAs the bacterium can limit the innate immune response of the host, including inflammation

  1. In Vivo and In Vitro Studies Suggest a Possible Involvement of HPV Infection in the Early Stage of Breast Carcinogenesis via APOBEC3B Induction

    PubMed Central

    Ohba, Kenji; Ichiyama, Koji; Yajima, Misako; Gemma, Nobuhiro; Nikaido, Masaru; Wu, Qingqing; Chong, PeiPei; Mori, Seiichiro; Yamamoto, Rain; Wong, John Eu Li; Yamamoto, Naoki

    2014-01-01

    High prevalence of infection with high-risk human papilloma virus (HPV) ranging from 25 to 100% (average 31%) was observed in breast cancer (BC) patients in Singapore using novel DNA chip technology. Early stage of BC demonstrated higher HPV positivity, and BC positive for estrogen receptor (ER) showed significantly higher HPV infection rate. This unique association of HPV with BC in vivo prompted us to investigate a possible involvement of HPV in early stages of breast carcinogenesis. Using normal breast epithelial cells stably transfected with HPV-18, we showed apparent upregulation of mRNA for the cytidine deaminase, APOBEC3B (A3B) which is reported to be a source of mutations in BC. HPV-induced A3B overexpression caused significant γH2AX focus formation, and DNA breaks which were cancelled by shRNA to HPV18 E6, E7 and A3B. These results strongly suggest an active involvement of HPV in the early stage of BC carcinogenesis via A3B induction. PMID:24858917

  2. Immune reactivity in early life stages of sea-cage cultured Pacific bluefin tuna naturally infected with blood flukes from genus Cardicola (Trematoda: Aporocotylidae).

    PubMed

    Pennacchi, Ylenia; Shirakashi, Sho; Nowak, Barbara F; Bridle, Andrew R

    2016-11-01

    Pacific bluefin tuna (PBT), Thunnus orientalis, due to its high average price on the market is an economically valuable fish species. Infections by blood flukes from the genus Cardicola (Trematoda: Aporocotylidae) represent a growing concern for the cage culture of bluefin tuna in Japan, Australia and Southern Europe. The accumulation of numerous Cardicola eggs in the fish gills causes severe pathology that has been linked to mortality in PBT juveniles up to one year old. The only effective treatment used to mitigate the infection is the oral administration of the antihelminthic drug praziquantel (PZQ) to the affected fish. However, with the need to minimise therapeutic drug use in aquaculture it is hoped that immunoprophylaxis can provide a future alternative to protect the PBT juveniles against Cardicola infection. Currently, little is known of the host immune response to these parasites and of their infection dynamics. In this study, using real-time qPCR we aimed to quantitatively detect C. orientalis and C. opisthorchis DNA within the gills and heart of cultured PBT juveniles and to investigate the host immune response at the transcriptional level in the gills. The research focused mainly during early stages of infection soon after young PBT were transferred to culture cages (from 14 to 77 days post-transfer). An increase (up to 11-fold) of immune-related genes, namely IgM, MHC-I, TCR-β and IL-1β was observed in the PBT gills infected with Cardicola spp. (28-77 days post-transfer). Furthermore, IgM (19-fold increase) and MHC-I (11.5-fold increase) transcription was strongly up-regulated in gill samples of PBT infected with C. orientalis relative to uninfected fish but not in fish infected with C. opisthorchis. Cardicola-specific DNA was first detected in the host 14 days post-transfer (DPT) to sea-cages which was 55 days earlier than the first detection of parasite eggs and adults by microscopy. Oral administration of PZQ did not have an immediate effect

  3. Safety and comparability of controlled human Plasmodium falciparum infection by mosquito bite in malaria-naïve subjects at a new facility for sporozoite challenge.

    PubMed

    Talley, Angela K; Healy, Sara A; Finney, Olivia C; Murphy, Sean C; Kublin, James; Salas, Carola J; Lundebjerg, Susan; Gilbert, Peter; Van Voorhis, Wesley C; Whisler, John; Wang, Ruobing; Ockenhouse, Chris F; Heppner, D Gray; Kappe, Stefan H; Duffy, Patrick E

    2014-01-01

    Controlled human malaria infection (CHMI) studies which recapitulate mosquito-borne infection are a critical tool to identify protective vaccine and drug candidates for advancement to field trials. In partnership with the Walter Reed Army Institute of Research, the CHMI model was established at the Seattle Biomedical Research Institute's Malaria Clinical Trials Center (MCTC). Activities and reagents at both centers were aligned to ensure comparability and continued safety of the model. To demonstrate successful implementation, CHMI was performed in six healthy malaria-naïve volunteers. All volunteers received NF54 strain Plasmodium falciparum by the bite of five infected Anopheles stephensi mosquitoes under controlled conditions and were monitored for signs and symptoms of malaria and for parasitemia by peripheral blood smear. Subjects were treated upon diagnosis with chloroquine by directly observed therapy. Immunological (T cell and antibody) and molecular diagnostic (real-time quantitative reverse transcriptase polymerase chain reaction [qRT-PCR]) assessments were also performed. All six volunteers developed patent parasitemia and clinical malaria. No serious adverse events occurred during the study period or for six months post-infection. The mean prepatent period was 11.2 days (range 9-14 days), and geometric mean parasitemia upon diagnosis was 10.8 parasites/µL (range 2-69) by microscopy. qRT-PCR detected parasites an average of 3.7 days (range 2-4 days) earlier than blood smears. All volunteers developed antibodies to the blood-stage antigen merozoite surface protein 1 (MSP-1), which persisted up to six months. Humoral and cellular responses to pre-erythrocytic antigens circumsporozoite protein (CSP) and liver-stage antigen 1 (LSA-1) were limited. The CHMI model was safe, well tolerated and characterized by consistent prepatent periods, pre-symptomatic diagnosis in 3/6 subjects and adverse event profiles as reported at established centers. The MCTC can now

  4. Innate Nuclear Sensor IFI16 Translocates into the Cytoplasm during the Early Stage of In Vitro Human Cytomegalovirus Infection and Is Entrapped in the Egressing Virions during the Late Stage

    PubMed Central

    Dell'Oste, Valentina; Gatti, Deborah; Gugliesi, Francesca; De Andrea, Marco; Bawadekar, Mandar; Lo Cigno, Irene; Biolatti, Matteo; Vallino, Marta; Marschall, Manfred; Gariglio, Marisa

    2014-01-01

    defense mechanisms. Our findings describe that during early stages of infection, IFI16 successfully recognizes HCMV DNA. However, in late stages HCMV mislocalizes IFI16 into the cytoplasmic viral assembly complex and finally entraps the protein into mature virions. We clarify here the mechanisms HCMV relies to overcome intracellular viral restriction, which provides new insights about the relevance of DNA sensors during HCMV infection. PMID:24696486

  5. Plasma Metabolomics Biosignature According to HIV Stage of Infection, Pace of Disease Progression, Viremia Level and Immunological Response to Treatment

    PubMed Central

    Scarpelini, Bruno; Zanoni, Michelle; Sucupira, Maria Cecilia Araripe; Truong, Hong-Ha M.; Janini, Luiz Mario Ramos; Segurado, Ismael Dale Cotrin; Diaz, Ricardo Sobhie

    2016-01-01

    Background We evaluated plasma samples HIV-infected individuals with different phenotypic profile among five HIV-infected elite controllers and five rapid progressors after recent HIV infection and one year later and from 10 individuals subjected to antiretroviral therapy, five of whom were immunological non-responders (INR), before and after one year of antiretroviral treatment compared to 175 samples from HIV-negative patients. A targeted quantitative tandem mass spectrometry metabolomics approach was used in order to determine plasma metabolomics biosignature that may relate to HIV infection, pace of HIV disease progression, and immunological response to treatment. Results Twenty-five unique metabolites were identified, including five metabolites that could distinguish rapid progressors and INRs at baseline. Severe deregulation in acylcarnitine and sphingomyelin metabolism compatible with mitochondrial deficiencies was observed. β-oxidation and sphingosine‐1‐phosphate-phosphatase-1 activity were down-regulated, whereas acyl-alkyl-containing phosphatidylcholines and alkylglyceronephosphate synthase levels were elevated in INRs. Evidence that elite controllers harbor an inborn error of metabolism (late-onset multiple acyl-coenzyme A dehydrogenase deficiency [MADD]) was detected. Conclusions Blood-based markers from metabolomics show a very high accuracy of discriminating HIV infection between varieties of controls and have the ability to predict rapid disease progression or poor antiretroviral immunological response. These metabolites can be used as biomarkers of HIV natural evolution or treatment response and provide insight into the mechanisms of the disease. PMID:27941971

  6. A Mechanistic Model of Botrytis cinerea on Grapevines That Includes Weather, Vine Growth Stage, and the Main Infection Pathways

    PubMed Central

    González-Domínguez, Elisa; Caffi, Tito; Ciliberti, Nicola; Rossi, Vittorio

    2015-01-01

    A mechanistic model for Botrytis cinerea on grapevine was developed. The model, which accounts for conidia production on various inoculum sources and for multiple infection pathways, considers two infection periods. During the first period (“inflorescences clearly visible” to “berries groat-sized”), the model calculates: i) infection severity on inflorescences and young clusters caused by conidia (SEV1). During the second period (“majority of berries touching” to “berries ripe for harvest”), the model calculates: ii) infection severity of ripening berries by conidia (SEV2); and iii) severity of berry-to-berry infection caused by mycelium (SEV3). The model was validated in 21 epidemics (vineyard × year combinations) between 2009 and 2014 in Italy and France. A discriminant function analysis (DFA) was used to: i) evaluate the ability of the model to predict mild, intermediate, and severe epidemics; and ii) assess how SEV1, SEV2, and SEV3 contribute to epidemics. The model correctly classified the severity of 17 of 21 epidemics. Results from DFA were also used to calculate the daily probabilities that an ongoing epidemic would be mild, intermediate, or severe. SEV1 was the most influential variable in discriminating between mild and intermediate epidemics, whereas SEV2 and SEV3 were relevant for discriminating between intermediate and severe epidemics. The model represents an improvement of previous B. cinerea models in viticulture and could be useful for making decisions about Botrytis bunch rot control. PMID:26457808

  7. Clinical trial in healthy malaria-naïve adults to evaluate the safety, tolerability, immunogenicity and efficacy of MuStDO5, a five-gene, sporozoite/hepatic stage Plasmodium falciparum DNA vaccine combined with escalating dose human GM-CSF DNA

    PubMed Central

    Richie, Thomas L.; Charoenvit, Yupin; Wang, Ruobing; Epstein, Judith E.; Hedstrom, Richard C.; Kumar, Sanjai; Luke, Thomas C.; Freilich, Daniel A.; Aguiar, Joao C.; Sacci, Jr., John B.; Sedegah, Martha; Nosek, Jr., Ronald A.; De La Vega, Patricia; Berzins, Mara P.; Majam, Victoria F.; Abot, Esteban N.; Ganeshan, Harini; Richie, Nancy O.; Banania, Jo Glenna; Baraceros, Maria Fe B.; Geter, Tanya G.; Mere, Robin; Bebris, Lolita; Limbach, Keith; Hickey, Bradley W.; Lanar, David E.; Ng, Jennifer; Shi, Meng; Hobart, Peter M.; Norman, Jon A.; Soisson, Lorraine A.; Hollingdale, Michael R.; Rogers, William O.; Doolan, Denise L.; Hoffman, Stephen L.

    2012-01-01

    When introduced in the 1990s, immunization with DNA plasmids was considered potentially revolutionary for vaccine development, particularly for vaccines intended to induce protective CD8 T cell responses against multiple antigens. We conducted, in 1997−1998, the first clinical trial in healthy humans of a DNA vaccine, a single plasmid encoding Plasmodium falciparum circumsporozoite protein (PfCSP), as an initial step toward developing a multi-antigen malaria vaccine targeting the liver stages of the parasite. As the next step, we conducted in 2000–2001 a clinical trial of a five-plasmid mixture called MuStDO5 encoding pre-erythrocytic antigens PfCSP, PfSSP2/TRAP, PfEXP1, PfLSA1 and PfLSA3. Thirty-two, malaria-naïve, adult volunteers were enrolled sequentially into four cohorts receiving a mixture of 500 μg of each plasmid plus escalating doses (0, 20, 100 or 500 μg) of a sixth plasmid encoding human granulocyte macrophage-colony stimulating factor (hGM-CSF). Three doses of each formulation were administered intramuscularly by needle-less jet injection at 0, 4 and 8 weeks, and each cohort had controlled human malaria infection administered by five mosquito bites 18 d later. The vaccine was safe and well-tolerated, inducing moderate antigen-specific, MHC-restricted T cell interferon-γ responses but no antibodies. Although no volunteers were protected, T cell responses were boosted post malaria challenge. This trial demonstrated the MuStDO5 DNA and hGM-CSF plasmids to be safe and modestly immunogenic for T cell responses. It also laid the foundation for priming with DNA plasmids and boosting with recombinant viruses, an approach known for nearly 15 y to enhance the immunogenicity and protective efficacy of DNA vaccines. PMID:23151451

  8. 2-Octadecynoic acid as a dual life stage inhibitor of Plasmodium infections and plasmodial FAS-II enzymes.

    PubMed

    Carballeira, Néstor M; Bwalya, Angela Gono; Itoe, Maurice Ayamba; Andricopulo, Adriano D; Cordero-Maldonado, María Lorena; Kaiser, Marcel; Mota, Maria M; Crawford, Alexander D; Guido, Rafael V C; Tasdemir, Deniz

    2014-09-01

    The malaria parasite Plasmodium goes through two life stages in the human host, a non-symptomatic liver stage (LS) followed by a blood stage with all clinical manifestation of the disease. In this study, we investigated a series of 2-alkynoic fatty acids (2-AFAs) with chain lengths between 14 and 18 carbon atoms for dual in vitro activity against both life stages. 2-Octadecynoic acid (2-ODA) was identified as the best inhibitor of Plasmodium berghei parasites with ten times higher potency (IC50=0.34 μg/ml) than the control drug. In target determination studies, the same compound inhibited three Plasmodium falciparum FAS-II (PfFAS-II) elongation enzymes PfFabI, PfFabZ, and PfFabG with the lowest IC50 values (0.28-0.80 μg/ml, respectively). Molecular modeling studies provided insights into the molecular aspects underlying the inhibitory activity of this series of 2-AFAs and a likely explanation for the considerably different inhibition potentials. Blood stages of P. falciparum followed a similar trend where 2-ODA emerged as the most active compound, with 20 times less potency. The general toxicity and hepatotoxicity of 2-AFAs were evaluated by in vitro and in vivo methods in mammalian cell lines and zebrafish models, respectively. This study identifies 2-ODA as the most promising antiparasitic 2-AFA, particularly towards P. berghei parasites.

  9. Sternal reconstruction of deep sternal wound infections following median sternotomy by single-stage muscle flaps transposition.

    PubMed

    Wu, Song; Wan, Feng; Gao, Yong-shun; Zhang, Zhe; Zhao, Hong; Cui, Zhong-qi; Xie, Ji-yan

    2014-12-01

    To assess clinical effectiveness of using bilateral pectoralis major or plus rectus abdominis muscle flaps in treating deep sternal wound infection (DSWI) following median sternotomy. Between January 2009 and December 2013, 19 patients with DSWI after median sternotomy for cardiac surgery were admitted to our hospital, including 14 males (73.7%) and 5 females (26.3%), aged 55±13 (18-78) years. According to the Pairolero classification of infected median sternotomies, 3 (15.8%) patients were type II, and the other 16 (84.2%) were type III. Surgical procedure consisted of adequate debridement of infected sternum, costal cartilage, granulation, steel wires, suture residues and other foreign substances. Sternal reconstruction used the bilateral pectoralis major or plus rectus abdominis muscle flaps to obliterate dead space. The drainage tubes were placed and connected to a negative pressure generator for adequate drainage. There were no intraoperative deaths. In 15 patients (78.9%), bilateral pectoral muscle flaps were mobilized sufficiently to cover and stabilize the defect created by wound debridement. 4 patients (21.0%) needed bilateral pectoral muscle flaps plus rectus abdominis muscle flaps because their pectoralis major muscle flaps could not reach the lowest portion of the wound. 2 patients (10.5%) presented with subcutaneous infection, and 3 patients (15.8%) had hematoma. They recovered following local debridement and medication. 17 patients (89.5%) were examined at follow-up 12 months later, all healed and having stable sternum. No patients showed infection recurrence during the follow-up period over 12 months. DSWI following median sternotomy may be effectively managed with adequate debridement of infected tissues and reconstruction with bilateral pectoralis major muscle or plus rectus abdominis muscle flap transposition.

  10. Efficacy of milbemycin oxime in combination with spinosad in the treatment of larval and immature adult stages of Ancylostoma caninum and Toxocara canis in experimentally infected dogs.

    PubMed

    Bowman, Dwight D; Reinemeyer, Craig R; Wiseman, Scott; Snyder, Daniel E

    2014-09-15

    Ancylostoma caninum and Toxocara canis are two important zoonotic parasites of dogs. The primary objective of these studies were to confirm the oral effectiveness of milbemycin oxime (MO) and spinosad in dogs experimentally infected with immature (L4 and immature adult) stages of T. canis or A. caninum. Both trials were conducted as randomized, blinded, placebo-controlled dose confirmation studies. Treatments using the intended European commercial tablet formulation of Trifexis were administered in a timeframe relative to inoculation so that effectiveness could be assessed against specific immature stages of A. caninum or T. canis. In each study on Day 0, each of 32, 3-4 month old dogs were inoculated with 250 infective eggs of T. canis or 300 infective L3 of the hookworm, A. caninum. All dogs were weighed before their scheduled treatment, randomized to 1 of the 4 treatment groups in each study (8 dogs/group). All dogs were fed just prior to dosing. For T. canis, dogs were treated orally with an MO/spinosad tablet on Day 14 or Day 24. For A. caninum, dogs were treated orally with an MO/spinosad tablet on Day 7 or Day 11. Corresponding control groups in each study received a placebo tablet. Dogs were necropsied 5 or 6 days after their respective treatments. The digestive tract was removed and processed to recover, count, and identify all stages. The GM worm count for the MO/spinosad tablet on Day 14 (L4 T. canis) was 0.0, with efficacy calculated as 100%; however, only 3 of 8 control dogs had adequate infections. The GM worm count for the MO/spinosad tablet on Day 24 (immature adult stage) was 0.30; efficacy calculated at 96.15%. This is based on 5 of the 8 control dogs with adequate infections. In the two A. caninum studies, GM worm counts for the MO/spinosad tablets on Day 7 (L4 efficacy) was 2.37 and 0.8 with efficacy calculated as 98.92% and 99.25%, respectively. The GM count for the group treated with the MO/spinosad combination on Day 11 (immature adult) was 6

  11. Plasmodium vivax but Not Plasmodium falciparum Blood-Stage Infection in Humans Is Associated with the Expansion of a CD8+ T Cell Population with Cytotoxic Potential

    PubMed Central

    Burel, Julie G.; Apte, Simon H.; McCarthy, James S.; Doolan, Denise L.

    2016-01-01

    P. vivax and P. falciparum parasites display different tropism for host cells and induce very different clinical symptoms and pathology, suggesting that the immune responses required for protection may differ between these two species. However, no study has qualitatively compared the immune responses to P. falciparum or P. vivax in humans following primary exposure and infection. Here, we show that the two species differ in terms of the cellular immune responses elicited following primary infection. Specifically, P. vivax induced the expansion of a subset of CD8+ T cells expressing the activation marker CD38, whereas P. falciparum induced the expansion of CD38+ CD4+ T cells. The CD38+ CD8+ T cell population that expanded following P. vivax infection displayed greater cytotoxic potential compared to CD38- CD8+ T cells, and compared to CD38+ CD8+ T cells circulating during P. falciparum infection. We hypothesize that P. vivax infection leads to a stronger CD38+ CD8+ T cell activation because of its preferred tropism for MHC-I-expressing reticulocytes that, unlike mature red blood cells, can present antigen directly to CD8+ T cells. This study provides the first line of evidence to suggest an effector role for CD8+ T cells in P. vivax blood-stage immunity. It is also the first report of species-specific differences in the subset of T cells that are expanded following primary Plasmodium infection, suggesting that malaria vaccine development may require optimization according to the target parasite. Trial Registration anzctr.org.au ACTRN12612000814875; anzctr.org.au ACTRN12613000565741; anzctr.org.au ACTRN12613001040752; ClinicalTrials.gov NCT02281344; anzctr.org.au ACTRN12612001096842; anzctr.org.au ACTRN12613001008718 PMID:27930660

  12. Dimethyl sulfoxide blocks herpes simplex virus-1 productive infection in vitro acting at different stages with positive cooperativity. Application of micro-array analysis

    PubMed Central

    2002-01-01

    Background Dimethyl sulfoxide (DMSO) is frequently used at a concentration of up to 95% in the formulation of antiherpetic agents because of its properties as a skin penetration enhancer. Here, we have analyzed the effect of DMSO on several parameters of Herpes Simplex Virus replication. Methods Productive infection levels of HSV-1 were determined by plaque assay or by reporter gene activity, and its DNA replication was estimated by PCR. Transcript levels were evaluated with HSV-specific DNA micro-arrays. Results DMSO blocks productive infection in vitro in different cell types with a 50% inhibitory concentration (IC50) from 0.7 to 2% depending upon the multiplicity of infection. The concentration dependence exhibits a Hill coefficient greater than 1, indicating that DMSO blocks productive infection by acting at multiple different points (mechanisms of action) with positive cooperativity. Consistently, we identified at least three distinct temporal target mechanisms for inhibition of virus growth by DMSO. At late stages of infection, DMSO reduces virion infectivity, and markedly inhibits viral DNA replication. A third mode of action was revealed using an oligonucleotide-based DNA microarray system for HSV. These experiments showed that DMSO reduced the transcript levels of many HSV-1 genes; including several genes coding for proteins involved in forming and assembling the virion. Also, DMSO markedly inhibited some but not all early transcripts indicating a previously unknown mode for inhibiting the early phase of HSV transcription-replication cycle. Conclusion These observations suggest that DMSO itself may have a role in the anti-herpetic activity of formulations utilizing it as a dispersant. PMID:12052246

  13. Pasteurella multocida non-native joint infection after a dog lick: A case report describing a complicated two-stage revision and a comprehensive review of the literature

    PubMed Central

    Philip W, Lam; Page, Andrea V

    2015-01-01

    Prosthetic joint infections (PJIs) are commonly caused by pathogens such as Staphylococcus aureus and coagulase-negative staphylococci; however, other microbial etiologies and specific risk factors are increasingly recognized. Pasteurella multocida is a Gram-negative coccobacillus that is part of the normal oral flora in many animals, and is particularly common in dogs and cats. PJIs caused by P multocida have been reported only rarely in the literature and typically occur in the context of an animal bite or scratch. The present article describes a P multocida joint infection that occurred after a dog lick and complicated a two-stage revision arthroplasty. A comprehensive review of the literature regarding P multocida PJIs follows. PMID:26361490

  14. Pasteurella multocida non-native joint infection after a dog lick: A case report describing a complicated two-stage revision and a comprehensive review of the literature.

    PubMed

    Lam, Philip W; Page, Andrea V

    2015-01-01

    Prosthetic joint infections (PJIs) are commonly caused by pathogens such as Staphylococcus aureus and coagulase-negative staphylococci; however, other microbial etiologies and specific risk factors are increasingly recognized. Pasteurella multocida is a Gram-negative coccobacillus that is part of the normal oral flora in many animals, and is particularly common in dogs and cats. PJIs caused by P multocida have been reported only rarely in the literature and typically occur in the context of an animal bite or scratch. The present article describes a P multocida joint infection that occurred after a dog lick and complicated a two-stage revision arthroplasty. A comprehensive review of the literature regarding P multocida PJIs follows.

  15. Serum, liver, and lung levels of the major extracellular matrix components at the early stage of BCG-induced granulomatosis depending on the infection route.

    PubMed

    Kim, L B; Shkurupy, V A; Putyatina, A N

    2015-01-01

    Experiments on the model of mouse BCG-induced granulomatous showed that the content of glycosaminoglycans and proteoglycans in the extracellular matrix of the liver and lungs are changed at the early stages of inflammation (days 3 and 30 postinfection) before cell destruction in the organs begins. This is related to degradation of extracellular matrix structures. Their high content in the blood and interstitium probably contributes to the formation of granulomas, fibroblast proliferation and organ fibrosis. These processes depend on the infection route that determines different conditions for generalization of the inflammation process. Intravenous method of vaccine injection is preferable to use when designing the experiments simulating tuberculosis granulomatosis, especially for the analysis of its early stages.

  16. Genome-wide prediction and functional validation of promoter motifs regulating gene expression in spore and infection stages of Phytophthora infestans.

    PubMed

    Roy, Sourav; Kagda, Meenakshi; Judelson, Howard S

    2013-03-01

    Most eukaryotic pathogens have complex life cycles in which gene expression networks orchestrate the formation of cells specialized for dissemination or host colonization. In the oomycete Phytophthora infestans, the potato late blight pathogen, major shifts in mRNA profiles during developmental transitions were identified using microarrays. We used those data with search algorithms to discover about 100 motifs that are over-represented in promoters of genes up-regulated in hyphae, sporangia, sporangia undergoing zoosporogenesis, swimming zoospores, or germinated cysts forming appressoria (infection structures). Most of the putative stage-specific transcription factor binding sites (TFBSs) thus identified had features typical of TFBSs such as position or orientation bias, palindromy, and conservation in related species. Each of six motifs tested in P. infestans transformants using the GUS reporter gene conferred the expected stage-specific expression pattern, and several were shown to bind nuclear proteins in gel-shift assays. Motifs linked to the appressoria-forming stage, including a functionally validated TFBS, were over-represented in promoters of genes encoding effectors and other pathogenesis-related proteins. To understand how promoter and genome architecture influence expression, we also mapped transcription patterns to the P. infestans genome assembly. Adjacent genes were not typically induced in the same stage, including genes transcribed in opposite directions from small intergenic regions, but co-regulated gene pairs occurred more than expected by random chance. These data help illuminate the processes regulating development and pathogenesis, and will enable future attempts to purify the cognate transcription factors.

  17. Cytoskeleton remodling and alterations in smooth muscle contractility in the bovine jejunum during the early stage of Cooperia oncophora infection

    USDA-ARS?s Scientific Manuscript database

    Gastrointestinal nematodes of the genus Cooperia are arguably the most important parasites of cattle. We characterized the bovine jejunal transcriptome in response to C. oncophora infection using RNA-seq technology. Approximately 71% of the 25,670 bovine genes were detected in the jejunal transcript...

  18. The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection.

    PubMed

    Cardinaud, Marion; Dheilly, Nolwenn M; Huchette, Sylvain; Moraga, Dario; Paillard, Christine

    2015-08-01

    Vibrio harveyi is a marine bacterial pathogen responsible for episodic abalone mortalities in France, Japan and Australia. In the European abalone, V. harveyi invades the circulatory system in a few hours after exposure and is lethal after 2 days of infection. In this study, we investigated the responses of European abalone immune cells over the first 24 h of infection. Results revealed an initial induction of immune gene expression including Rel/NF-kB, Mpeg and Clathrin. It is rapidly followed by a significant immuno-suppression characterized by reduced cellular hemocyte parameters, immune response gene expressions and enzymatic activities. Interestingly, Ferritin was overexpressed after 24 h of infection suggesting that abalone attempt to counter V. harveyi infection using soluble effectors. Immune function alteration was positively correlated with V. harveyi concentration. This study provides the evidence that V. harveyi has a hemolytic activity and an immuno-suppressive effect in the European abalone. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Ceftriaxone is an efficient component of antimicrobial regimens in the prevention and initial management of infections in end-stage renal disease.

    PubMed

    Trimarchi, H; Lafuente, P; Suki, W N

    2000-01-01

    Infection is a frequent complication in patients with end-stage renal disease. The most common organisms isolated are gram-positive cocci and gram-negative bacilli. Therefore, the usual initial therapeutic approach in these situations is the simultaneous intravenous administration of vancomycin plus an aminoglycoside. This treatment's adverse effects include ototoxicity, nephrotoxicity, and less than ideal tissue penetrance. We assessed the efficacy of intravenous ceftriaxone in the prevention and in the initial empirical treatment of infections in end-stage renal disease patients, and tested the stability of blood levels of this antibiotic in this population. We studied 104 patients, 65 of them falling into the prevention group (1 g of ceftriaxone i.v. for 5 days) and 39 into the treatment group (1 g of ceftriaxone i.v. or intraperitoneally for 10-14 days). Peak serum ceftriaxone concentrations were well above the minimal inhibitory concentration for 90% of strains. Trough serum concentrations of the drug prior to the next dose were also considerably in excess of the minimal inhibitory concentration. In the prevention group, 8 of 65 developed an infection, which was sensitive to ceftriaxone, whereas in 22 of the 39 patients from the treatment group, cultures showed organisms sensitive to ceftriaxone and in the remaining 17 patients sensitivity was not done. The present study demonstrates the efficacy of a simplified dosing schedule in achieving blood levels of the antibiotic well in excess of minimal inhibitory concentration of any of the organisms encountered. It also shows the usefulness of ceftriaxone in the prevention and/or treatment of bacterial infections and the lack of the side effects vancomycin and/or aminoglycosides possess. Copyright 2000 S. Karger AG, Basel

  20. Stage-dependent fate of Plasmodium falciparum-infected red blood cells in the spleen and sickle-cell trait-related protection against malaria.

    PubMed

    Diakité, Seidina A S; Ndour, Papa Alioune; Brousse, Valentine; Gay, Frederick; Roussel, Camille; Biligui, Sylvestre; Dussiot, Michaël; Prendki, Virginie; Lopera-Mesa, Tatiana M; Traoré, Karim; Konaté, Drissa; Doumbia, Saibou; Cros, Jérôme; Dokmak, Safi; Fairhurst, Rick M; Diakité, Mahamadou; Buffet, Pierre A

    2016-09-21

    Sickle-cell trait (HbAS) reduces falciparum malaria risk and suppresses parasitaemia. Although several candidate mechanisms have been proposed, their epidemiological, clinical and experimental correlates have not been adequately explained. To explore the basis for generally lower parasitaemias and delayed malaria episodes in children with HbAS, it is hypothesized here that their spleen-dependent removal of ring-infected red blood cells (RBCs) is more efficient than in children with normal haemoglobin A (HbAA). The mechanical splenic retention of Plasmodium falciparum-infected RBCs from subjects with HbAS or HbAA was investigated using two physiologically relevant methods: microsphiltration and ex vivo spleen perfusion. P. falciparum-infected RBCs obtained from in vitro cultures and from patients were used in either normoxic or hypoxic conditions. The effect of sickling in ring-infected HbAS RBCs was also investigated. When a laboratory-adapted parasite strain was analysed, ring-infected HbAA RBCs were retained in microsphilters at similar or greater levels than ring-infected HbAS RBCs, under normoxic (retention rate 62.5 vs 43.8 %, P < 0.01) and hypoxic (54.0 vs 38.0 %, P = 0.11) conditions. When parasitized RBCs from Malian children were analysed, retention of ring-infected HbAA and HbAS RBCs was similar when tested either directly ex vivo (32.1 vs 28.7 %, P = 0.52) or after one re-invasion in vitro (55.9 vs 43.7 %, P = 0.30). In hypoxia, sickling of uninfected and ring-infected HbAS RBCs (8.6 vs 5.7 %, P = 0.51), and retention of ring-infected HbAA and HbAS RBCs in microsphilters (72.5 vs 68.8 %, P = 0.38) and spleens (41.2 vs 30.4 %, P = 0.11), also did not differ. Retention of HbAS and HbAA RBCs infected with mature P. falciparum stages was greater than 95 %. Sickle-cell trait is not associated with higher retention or sickling of ring-infected RBCs in experimental systems reflecting the mechanical sensing of RBCs by the human spleen. As

  1. A Phosphorylcholine-Containing Glycolipid-like Antigen Present on the Surface of Infective Stage Larvae of Ascaris spp. Is a Major Antibody Target in Infected Pigs and Humans

    PubMed Central

    Masure, Dries; Wang, Tao; Nejsum, Peter; Hokke, Cornelis H.; Geldhof, Peter

    2016-01-01

    Background The pig parasite Ascaris suum plays and important role in veterinary medicine and represents a suitable model for A. lumbricoides, which infects over 800 million people. In pigs, continued exposure to Ascaris induces immunity at the level of the gut, protecting the host against migrating larvae. The objective of this study was to identify and characterize parasite antigens targeted by this local immune response that may be crucial for parasite invasion and establishment and to evaluate their protective and diagnostic potential. Methodology/Principal Findings Pigs were immunized by trickle infection for 30 weeks, challenged with 2,000 eggs at week 32 and euthanized two weeks after challenge. At necropsy, there was a 100% reduction in worms recovered from the intestine and a 97.2% reduction in liver white spots in comparison with challenged non-immune control animals. Antibodies purified from the intestinal mucus or from the supernatant of cultured antibody secreting cells from mesenteric lymph nodes of immune pigs were used to probe L3 extracts to identify antibody targets. This resulted in the recognition of a 12kDa antigen (As12) that is actively shed from infective Ascaris L3. As12 was characterized as a phosphorylcholine-containing glycolipid-like antigen that is highly resistant to different enzymatic and chemical treatments. Vaccinating pigs with an As12 fraction did not induce protective immunity to challenge infection. However, serological analysis using sera or plasma from experimentally infected pigs or naturally infected humans demonstrated that the As12 ELISA was able to detect long-term exposure to Ascaris with a high diagnostic sensitivity (98.4% and 92%, respectively) and specificity (95.5% and 90.0%) in pigs and humans, respectively. Conclusions/Significance These findings show the presence of a highly stage specific, glycolipid-like component (As12) that is actively secreted by infectious Ascaris larvae and which acts as a major antibody

  2. NOS2 Variants Reveal a Dual Genetic Control of Nitric Oxide Levels, Susceptibility to Plasmodium Infection, and Cerebral Malaria

    PubMed Central

    Trovoada, Maria de Jesus; Martins, Madalena; Ben Mansour, Riadh; Sambo, Maria do Rosário; Fernandes, Ana B.; Antunes Gonçalves, Lígia; Borja, Artur; Moya, Roni; Almeida, Paulo; Costa, João; Marques, Isabel; Macedo, M. Paula; Coutinho, António; Narum, David L.

    2014-01-01

    Nitric oxide (NO) is a proposed component of malaria pathogenesis, and the inducible nitric oxide synthase gene (NOS2) has been associated to malaria susceptibility. We analyzed the role of NOS2 polymorphisms on NO bioavailability and on susceptibility to infection, Plasmodium carrier status and clinical malaria. Two distinct West African sample collections were studied: a population-based collection of 1,168 apparently healthy individuals from the Príncipe Island and a hospital-based cohort of 269 Angolan children. We found that two NOS2 promoter single-nucleotide polymorphism (SNP) alleles associated to low NO plasma levels in noninfected individuals were also associated to reduced risk of pre-erythrocytic infection as measured anti-CSP antibody levels (6.25E–04 < P < 7.57E–04). In contrast, three SNP alleles within the NOS2 cistronic region conferring increased NO plasma levels in asymptomatic carriers were strongly associated to risk of parasite carriage (8.00E–05 < P < 7.90E–04). Notwithstanding, three SNP alleles in this region protected from cerebral malaria (7.90E–4 < P < 4.33E–02). Cohesively, the results revealed a dual regimen in the genetic control of NO bioavailability afforded by NOS2 depending on the infection status. NOS2 promoter variants operate in noninfected individuals to decrease both NO bioavailability and susceptibility to pre-erythrocytic infection. Conversely, NOS2 cistronic variants (namely, rs6505469) operate in infected individuals to increase NO bioavailability and confer increased susceptibility to unapparent infection but protect from cerebral malaria. These findings corroborate the hypothesis that NO anti-inflammatory properties impact on different steps of malaria pathogenesis, explicitly by favoring infection susceptibility and deterring severe malaria syndromes. PMID:24379293

  3. NOS2 variants reveal a dual genetic control of nitric oxide levels, susceptibility to Plasmodium infection, and cerebral malaria.

    PubMed

    Trovoada, Maria de Jesus; Martins, Madalena; Ben Mansour, Riadh; Sambo, Maria do Rosário; Fernandes, Ana B; Antunes Gonçalves, Lígia; Borja, Artur; Moya, Roni; Almeida, Paulo; Costa, João; Marques, Isabel; Macedo, M Paula; Coutinho, António; Narum, David L; Penha-Gonçalves, Carlos

    2014-03-01

    Nitric oxide (NO) is a proposed component of malaria pathogenesis, and the inducible nitric oxide synthase gene (NOS2) has been associated to malaria susceptibility. We analyzed the role of NOS2 polymorphisms on NO bioavailability and on susceptibility to infection, Plasmodium carrier status and clinical malaria. Two distinct West African sample collections were studied: a population-based collection of 1,168 apparently healthy individuals from the Príncipe Island and a hospital-based cohort of 269 Angolan children. We found that two NOS2 promoter single-nucleotide polymorphism (SNP) alleles associated to low NO plasma levels in noninfected individuals were also associated to reduced risk of pre-erythrocytic infection as measured anti-CSP antibody levels (6.25E-04 < P < 7.57E-04). In contrast, three SNP alleles within the NOS2 cistronic region conferring increased NO plasma levels in asymptomatic carriers were strongly associated to risk of parasite carriage (8.00E-05 < P < 7.90E-04). Notwithstanding, three SNP alleles in this region protected from cerebral malaria (7.90E-4 < P < 4.33E-02). Cohesively, the results revealed a dual regimen in the genetic control of NO bioavailability afforded by NOS2 depending on the infection status. NOS2 promoter variants operate in noninfected individuals to decrease both NO bioavailability and susceptibility to pre-erythrocytic infection. Conversely, NOS2 cistronic variants (namely, rs6505469) operate in infected individuals to increase NO bioavailability and confer increased susceptibility to unapparent infection but protect from cerebral malaria. These findings corroborate the hypothesis that NO anti-inflammatory properties impact on different steps of malaria pathogenesis, explicitly by favoring infection susceptibility and deterring severe malaria syndromes.

  4. Host Cell Responses to Persistent Mycoplasmas - Different Stages in Infection of HeLa Cells with Mycoplasma hominis

    PubMed Central

    Hopfe, Miriam; Deenen, René; Degrandi, Daniel; Köhrer, Karl; Henrich, Birgit

    2013-01-01

    Mycoplasma hominis is a facultative human pathogen primarily associated with bacterial vaginosis and pelvic inflammatory disease, but it is also able to spread to other sites, leading to arthritis or, in neonates, meningitis. With a minimal set of 537 annotated genes, M. hominis is the second smallest self-replicating mycoplasma and thus an ideal model organism for studying the effects of an infectious agent on its host more closely. M. hominis adherence, colonisation and invasion of HeLa cells were characterised in a time-course study using scanning electron microscopy, confocal microscopy and microarray-based analysis of the HeLa cell transcriptome. At 4 h post infection, cytoadherence of M. hominis to the HeLa cell surface was accompanied by differential regulation of 723 host genes (>2 fold change in expression). Genes associated with immune responses and signal transduction pathways were mainly affected and components involved in cell-cycle regulation, growth and death were highly upregulated. At 48 h post infection, when mycoplasma invasion started, 1588 host genes were differentially expressed and expression of genes for lysosome-specific proteins associated with bacterial lysis was detected. In a chronically infected HeLa cell line (2 weeks), the proportion of intracellular mycoplasmas reached a maximum of 10% and M. hominis-filled protrusions of the host cell membrane were seen by confocal microscopy, suggesting exocytotic dissemination. Of the 1972 regulated host genes, components of the ECM-receptor interaction pathway and phagosome-related integrins were markedly increased. The immune response was quite different to that at the beginning of infection, with a prominent induction of IL1B gene expression, affecting pathways of MAPK signalling, and genes connected with cytokine-cytokine interactions and apoptosis. These data show for the first time the complex, time-dependent reaction of the host directed at mycoplasmal clearance and the counter measures of

  5. Host cell responses to persistent mycoplasmas--different stages in infection of HeLa cells with Mycoplasma hominis.

    PubMed

    Hopfe, Miriam; Deenen, René; Degrandi, Daniel; Köhrer, Karl; Henrich, Birgit

    2013-01-01

    Mycoplasma hominis is a facultative human pathogen primarily associated with bacterial vaginosis and pelvic inflammatory disease, but it is also able to spread to other sites, leading to arthritis or, in neonates, meningitis. With a minimal set of 537 annotated genes, M. hominis is the second smallest self-replicating mycoplasma and thus an ideal model organism for studying the effects of an infectious agent on its host more closely. M. hominis adherence, colonisation and invasion of HeLa cells were characterised in a time-course study using scanning electron microscopy, confocal microscopy and microarray-based analysis of the HeLa cell transcriptome. At 4 h post infection, cytoadherence of M. hominis to the HeLa cell surface was accompanied by differential regulation of 723 host genes (>2 fold change in expression). Genes associated with immune responses and signal transduction pathways were mainly affected and components involved in cell-cycle regulation, growth and death were highly upregulated. At 48 h post infection, when mycoplasma invasion started, 1588 host genes were differentially expressed and expression of genes for lysosome-specific proteins associated with bacterial lysis was detected. In a chronically infected HeLa cell line (2 weeks), the proportion of intracellular mycoplasmas reached a maximum of 10% and M. hominis-filled protrusions of the host cell membrane were seen by confocal microscopy, suggesting exocytotic dissemination. Of the 1972 regulated host genes, components of the ECM-receptor interaction pathway and phagosome-related integrins were markedly increased. The immune response was quite different to that at the beginning of infection, with a prominent induction of IL1B gene expression, affecting pathways of MAPK signalling, and genes connected with cytokine-cytokine interactions and apoptosis. These data show for the first time the complex, time-dependent reaction of the host directed at mycoplasmal clearance and the counter measures of

  6. Extra-pulmonary tuberculosis infection in the dialysis patients with end stage renal diseases: case reports and literature review.

    PubMed

    Yang, Wen-fang; Han, Fei; Zhang, Xiao-hui; Zhang, Ping; Chen, Jiang-hua

    2013-01-01

    The diagnosis of extra-pulmonary tuberculosis (TB) seems relatively difficult due to the absence of specific symptoms and signs in patients on peritoneal dialysis or hemodialysis. We report four cases of extra-pulmonary tuberculosis on dialysis, with two cases on peritoneal dialysis and two cases on hemodialysis. The presentations, therapy, and outcomes of TB infection in these patients were reviewed. Otherwise, the English literature published in the PubMed database associating extra-pulmonary tuberculosis on dialysis over the last three decades is reviewed. A total of 61 studies containing 70 cases were included. The most common primary disease was diabetic nephropathy (22.86%, 16/70). The peritoneum (31.42%, 22/70), bone (21.42%, 15/70), and lymph node (20%, 14/70) were the most frequently infected. Single organ infection was common (90%, 63/70). Fever (58.57%, 41/70), pain (35.71%, 25/70), and enlarged lymph node (20%, 14/70) were the most common symptoms. Biopsy (67.14%, 47/70) and culture (40%, 28/70) provided most reliable methods for clear diagnosis of tuberculosis. The combined treatment of isoniazid, rifampicin, pyrazinamide, and ethambutol (44.29%, 31/70) was the most common therapy. The majority of patients improved (82.86%, 58/70); however, 12 cases got worse (17.14%), with 10 of them dying (14.29%). Physicians should be aware of the non-specific symptoms and location of infection, and consider tuberculosis in their differential diagnoses in dialysis patients presenting with symptoms such as fever, pain, and weight loss.

  7. The effect of previous cold storage on the subsequent recovery of infective third stage nematode larvae from sheep faeces.

    PubMed

    McKenna, P B

    1998-12-31

    An investigation undertaken to determine the effect of previous cold storage on the recovery of third stage larvae of gastrointestinal nematodes of sheep, showed that increasing periods of exposure of faeces to 4 degrees C resulted in decreasing numbers of larvae subsequently recovered from them. Differences in the abilities of the eggs of the various genera, to survive such treatment, were found to lead to significant changes in the percentage generic compositions of their third stage larvae--in some cases following the prior refrigeration of faecal samples for as little as 24 h. These results suggest that where larval cultures are intended to provide estimates of the proportions of the various worm eggs in the faeces of sheep harboring mixed gastrointestinal nematode burdens, they should be performed only on freshly collected samples.

  8. Species, developmental stage and infection with microbial pathogens of engorged ticks removed from dogs and questing ticks.

    PubMed

    Leschnik, M W; Khanakah, G; Duscher, G; Wille-Piazzai, W; Hörweg, C; Joachim, A; Stanek, G

    2012-12-01

    Research into tick-borne diseases implies vector sampling and the detection and identification of microbial pathogens. Ticks were collected simultaneously from dogs that had been exposed to tick bites and by flagging the ground in the area in which the dogs had been exposed. In total, 200 ticks were sampled, of which 104 came from dogs and 96 were collected by flagging. These ticks were subsequently examined for DNA of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Rickettsia spp. and Babesia canis. A mixed sample of adult ticks and nymphs of Ixodes ricinus (Ixodida: Ixodidae) and Haemaphysalis concinna (Ixodida: Ixodidae) was obtained by flagging. Female I. ricinus and adult Dermacentor reticulatus (Ixodida: Ixodidae) ticks dominated the engorged ticks removed from dogs. Rickettsia spp. were detected in 17.0% of the examined ticks, A. phagocytophilum in 3.5%, B. canis in 1.5%, and B. burgdorferi s.l. in 16.0%. Ticks with multiple infections were found only among the flagging sample. The ticks removed from the dogs included 22 infected ticks, whereas the flagging sample included 44 infected ticks. The results showed that the method for collecting ticks influences the species composition of the sample and enables the detection of a different pattern of pathogens. Sampling strategies should be taken into consideration when interpreting studies on tick-borne pathogens.

  9. [A very up-to-date stage in the fate of infectious diseases: parasitic and fungal opportunistic infections].

    PubMed

    Ambroise-Thomas, P; Grillot, R

    1995-04-01

    Opportunistic parasitosis and mycosis are becoming ever more widespread, mainly under the influence of major immunodeficiencies, either acquired (AIDS) or therapeutic. In this general overview, their main aspects, both clinical and epidemiological, are underlined. In terms of epidemiology, three types of phenomena have been observed: 1) emergence of human parasitosis unknown before (microsporidiosis due to Enterocytozoon bieneusi, Encephalitozoom hellem or Septata intestinalis); 2) among the human parasites already known, identification of very pathogenic strains (Toxoplasma gondii, Aspergillus fumigatus, Cryptococcus neoformans); 3) origin probably or certainly nosocomial of certain infections (pneumocystosis; toxoplasmosis and visceral leishmaniasis transmitted during bone-marrow or organ transplantations). The development of deep mycosis (invasive aspergillosis) is particularly promoted by granulopenia and alterations in the phagocytosis. On the other hand, opportunistic protozoosis (toxoplasmosis and leishmaniasis) and helminthiasis (strongyloidosis due to Strongyloides stercolaris) are related, above all, to disorders in cellular immunity (deficit of CD4+, mainly). Finally, several of these infections may be characterised by a variety of clinical pictures and outcome, depending on the contributory factors (immunodeficit or not) which led to the development of the infection.

  10. Infection

    MedlinePlus

    ... or articles contaminated by them is an important component of infection control and isolation precautions. To help protect exposure to infectious materials, wash your hands: Wear gloves: In addition to ...

  11. [Clinical results of single-stage mobilization of pectoral muscle flaps and omental transposition for infected mediastinitis after open heart surgery].

    PubMed

    Asakura, T; Aoki, K; Tadokoro, M; Nakagawa, T; Furuta, S

    1997-09-01

    The purpose of this study was to retrospectively evaluate the outcome of refractory infected mediastinitis managed primarily with mobilization of pectoral muscle flaps and omental transposition. From January 1992 to December 1995, infected mediastinitis occurred in 11 (2.5%) of 447 consecutive patients. All patients required sternal debridement. The wound was thoroughly irrigated with a solution of 0.5% povidone-iodine in physiological saline after debridement and then the defect was repaired. Reconstruction of the chest wall was attained using pectoral muscle flaps in seven patients and pectoral muscle flaps and omental transposition in four. Antibiotic therapy was provided for 6 weeks or more according to the regimen in North America. No hospital deaths occurred after surgery. Significant early complications occurred in four patients. The reasons for the prolonged hospitalization were a recurrent wound infection, prosthetic valve endocarditis and saphenous vein graft pseudoaneurysm formation caused by Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-resistant Staphylococcus epidermidis (MRSE). Length of stay in ICU after surgical treatment was range 1 to 140 days (an average of 11 +/- 3 days in 9 patients without complications in ICU). Duration between surgical treatment and discharge was range 47 to 300 days (an average of 58 +/- 8 days in 7 patients without significant early complications). At the time of this report, the patients are doing well with no signs of recurrence of infection. The mean follow-up was 28.8 months (range 8 to 48 months). We conclude that single-stage mobilization of pectoral muscle flaps together with omental transposition is very usefull for managing refractory infected mediastinitis. But careful follow-up is needed after this procedure in case of MRSA-caused mediastinitis because of its tendency to recur.

  12. A Pilot Randomised Trial of Induced Blood-Stage Plasmodium falciparum Infections in Healthy Volunteers for Testing Efficacy of New Antimalarial Drugs

    PubMed Central

    McCarthy, James S.; Sekuloski, Silvana; Griffin, Paul M.; Elliott, Suzanne; Douglas, Nanette; Peatey, Chris; Rockett, Rebecca; O'Rourke, Peter; Marquart, Louise; Hermsen, Cornelius; Duparc, Stephan; Möhrle, Jörg; Trenholme, Katharine R.; Humberstone, Andrew J.

    2011-01-01

    Background Critical to the development of new drugs for treatment of malaria is the capacity to safely evaluate their activity in human subjects. The approach that has been most commonly used is testing in subjects with natural malaria infection, a methodology that may expose symptomatic subjects to the risk of ineffective treatment. Here we describe the development and pilot testing of a system to undertake experimental infection using blood stage Plasmodium falciparum parasites (BSP). The objectives of the study were to assess the feasibility and safety of induced BSP infection as a method for assessment of efficacy of new drug candidates for the treatment of P. falciparum infection. Methods and Findings A prospective, unblinded, Phase IIa trial was undertaken in 19 healthy, malaria-naïve, male adult volunteers who were infected with BSP and followed with careful clinical and laboratory observation, including a sensitive, quantitative malaria PCR assay. Volunteers were randomly allocated to treatment with either of two licensed antimalarial drug combinations, artemether–lumefantrine (A/L) or atovaquone-proguanil (A/P). In the first cohort (n = 6) where volunteers received ∼360 BSP, none reached the target parasitemia of 1,000 before the day designated for antimalarial treatment (day 6). In the second and third cohorts, 13 volunteers received 1,800 BSP, with all reaching the target parasitemia before receiving treatment (A/L, n = 6; A/P, n = 7) The study demonstrated safety in the 19 volunteers tested, and a significant difference in the clearance kinetics of parasitemia between the drugs in the 13 evaluable subjects, with mean parasite reduction ratios of 759 for A/L and 17 for A/P (95% CI 120–4786 and 7–40 respectively; p<0.01). Conclusions This system offers a flexible and safe approach to testing the in vivo activity of novel antimalarials. Trial Registration: ClinicalTrials.gov NCT01055002 PMID:21887214

  13. Real-Time Quantitative Reverse Transcription PCR for Monitoring of Blood-Stage Plasmodium falciparum Infections in Malaria Human Challenge Trials

    PubMed Central

    Murphy, Sean C.; Prentice, Jennifer L.; Williamson, Kathryn; Wallis, Carolyn K.; Fang, Ferric C.; Fried, Michal; Pinzon, Cris; Wang, Ruobing; Talley, Angela K.; Kappe, Stefan H. I.; Duffy, Patrick E.; Cookson, Brad T.

    2012-01-01

    To detect pre-patent parasitemia, we developed a real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) for the asexual 18S ribosomal RNA (rRNAs) of Plasmodium falciparum. Total nucleic acids extracted from whole blood were combined with control RNA and tested by qRT-PCR. The assay quantified > 98.7% of parasite-containing samples to ±0.5 log10 parasites/mL of the nominal value without false positives. The analytical sensitivity was ≥ 20 parasites/mL. The coefficient of variation was 0.6% and 1.8% within runs and 1.6% and 4.0% between runs for high and low parasitemia specimens, respectively. Using this assay, we determined that A-type 18S rRNAs are stably expressed at 1×104 copies per ring-stage parasite. When used to monitor experimental P. falciparum infection of human volunteers, the assay detected blood-stage infections 3.7 days earlier on average than thick blood smears. This validated, internally controlled qRT-PCR method also uses a small (50 μL) sample volume requiring minimal pre-analytical handling, making it useful for clinical trials. PMID:22403305

  14. Value of the oral swab for the molecular diagnosis of dogs in different stages of infection with Leishmania infantum.

    PubMed

    Aschar, Mariana; de Oliveira, Eveline Tozzi Braga; Laurenti, Marcia Dalastra; Marcondes, Mary; Tolezano, Jose Eduardo; Hiramoto, Roberto Mitsuyoshi; Corbett, Carlos Eduardo P; da Matta, Vania Lucia Ribeiro

    2016-07-30

    This study was based on the need to employ a sensitive and specific method with samples that could be easily collected for diagnosing dogs infected with Leishmania infantum. To this end, we used real time-PCR (qPCR) to assess the value of the oral swab (OS) in detecting infected sick dogs (SD; n=62), including, for the first time, the analysis of apparently healthy infected dogs (AD; n=30), both from endemic areas for visceral leishmaniasis (VL). For comparison, we also evaluated the performance of the conjunctival swab (CS), blood (BL), lymph node (LN) and serology. We detected the presence of Leishmania DNA in the oral cavity in 62 out of the 92 dogs studied. The OS positivity (67.4%) was equivalent to the CS (68.5%) (p>0.05), higher than BL (52.2%) (p≤0.05), and lower than LN (84.8%) (p≤0.05). OS and CS performed well in SD dogs (82.3% and 83.9%, respectively) but not in AD dogs (36.7% for both samples). BL showed the lowest positivity (52.2%) and provided equivalent results between AD (60.0%) and SD (48.4%) dogs (p>0.05). LN yielded the highest positivity (84.8%), and it was also higher in the SD population (93.5%) compared to the AD population (66.7%) (p≤0.05). Parasite load was high in LN, moderate in OS and CS, and low in BL, showing the relationship between the levels of parasitism and the positivity rates found in these samples. Serology was positive in 82.2% of the SD group and in 70% of the AD dogs (p>0.05). Among the 20 seronegative dogs, seven (35%) were positive in either OS or CS, and 12 (60%) were positive when both noninvasive samples were jointly considered. The OS/CS combination resulted in a significant increase of positivity (p≤0.05) for the AD dogs (from 36.7% to 63.4%), as well as OS/serology (80%) and OS/CS/serology (83.4%). For the SD population, positivity reached up to 95.2% with the same combinations, showing that combination of samples and/or tests is required for the identification of dogs infected with L. infantum and that the

  15. RELEASE OF GENTAMICIN FROM CEMENT SPACERS IN TWO-STAGE PROCEDURES FOR HIP AND KNEE PROSTHETIC INFECTION: AN IN VIVO PHARMACOKINETIC STUDY WITH CLINICAL FOLLOW-UP.

    PubMed

    Balato, G; Ascione, T; Rosa, D; Pagliano, P; Solarino, G; Moretti, B; Mariconda, M

    2015-01-01

    Eighteen patients undergoing two-stage exchange arthroplasty for infected total hip or knee arthroplasty using gentamicin-loaded bone cement spacers (80g bone cement, 2 g gentamicin and 2 g clindamycin) were studied. The concentration of gentamicin eluted from the spacers was assessed on samples of blood, urine, and drainage fluid that were collected from each patient at set intervals during the 48 hours following the first-stage surgery. The hip and knee cement spacers showed similar curve of release over the first postoperative hours (early peak followed by slow release), but the mean gentamicin concentration in the drainage fluid was higher in patients with hip spacers compared to patients with knee spacers (30.61±19.47 mg/L vs 17.43±13,63 mg/L, p less than 0.05). In patients with hip spacers, the mean, maximum, and minimum concentration of gentamicin was higher with respect to the minimum inhibitory concentration (MIC) break point for Staphylococcus spp, Pseudomonas Aeruginosa and Enterobacteriaceae throughout the first postoperative 48 h. Conversely, in 25% of patients with a knee spacer a drug concentration below the MIC break point for Gram negative bacteria was found in the drainage fluid after 12 h. Gentamicin levels in the blood samples were negligible over the entire time interval and were steadily well below the renal toxicity reference. The highest urinary concentration of gentamicin was observed between 4 and 9 h postoperatively. Subsequently, it gradually declined until 48 h. Clinically, the rate of cure was 100% at a mean follow-up of 113 weeks (range 90-182). Gentamicin-loaded cement spacers offer the advantage of achieving early high concentrations of the antibiotic directly at the site of infection but especially in the knee a systemic antibiotic therapy must be given as a complement to the spacer implantation to eradicate periprosthetic joint infection (PJI).

  16. Identification of immunodominant Leishmania major antigenic markers of the early C57BL/6 and BALB/c mice infection stages.

    PubMed

    Sassi, Atfa; Kaak, Olfa; Elgaaied, Amel Benammar

    2015-08-24

    The C57BL/6 mouse strain is resistant to Leishmania (L.) major infection and, unlike susceptible BALB/c, develops small self healing cutaneous lesions. The specific antibody responses of C57BL/6 and BALB/c mice were previously characterized by the predominance of IgG2a ("resistant" isotype associated with Th1) and IgG1 ("pathogenic" isotype associated with Th2) antibodies, respectively. In this study, we looked for the presence of antigens able to elicit an exclusive or predominant IgG1 production during the early stages of C57BL/6 lesion development and checked whether they are recognized or not by BALB/c mice. We demonstrate first that IgG2a predominance in C57BL/6 sera occurs only late after infection whereas in BALB/c, IgG1 antibodies dominate mostly in the early stages. Interestingly, soon after inoculation of live amastigotes, C57BL/6 displayed an exclusive IgG1 reactivity against particular L. major antigens but with MWs different from those identified in BALB/c. Furthermore, mice immunized with killed amastigotes displayed striking differences in their immunodetection profiles, particularly for the IgG1 isotype. Taken together, the observed differences in the specific antibody repertoires between infected mice resulted, at least in part, from immunological events independent from those triggered by the replicating parasite, and bring new insights into the selection of future vaccine candidates. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Efficacy of a milbemycin oxime-praziquantel combination product against adult and immature stages of Toxocara cati in cats and kittens after induced infection.

    PubMed

    Schenker, R; Bowman, D; Epe, C; Cody, R; Seewald, W; Strehlau, G; Junquera, P

    2007-04-10

    Two studies were performed to examine the efficacy of milbemycin oxime against fourth-stage larvae or adults of Toxocara cati. In the study to determine efficacy against fourth-stage larvae, 20 domestic shorthair cats were inoculated with 500 embryonated eggs. Four weeks after inoculation, the animals were allocated to two groups, and cats in one group were treated with medicated tablets containing 4 mg milbemycin oxime and 10mg praziquantel (MILBEMAX) and cats in the other group with placebo tablets. Seven days after treatment the animals were euthanatized and necropsied for worm counting. The number of worms found was significantly (p=0.0002) lower in cats treated with medicated tablets than in cats treated with placebo tablets. The reduction in the number of worms was 96.53%. In the study to determine efficacy against mature adult worms, 13 kittens were inoculated with T. cati embryonated eggs. On day 45 after inoculation and after the infection had been confirmed through faecal examinations for 11 out of the 13 animals, the 11 infected animals were allocated to two groups and treated as in the first study. Seven days after treatment, all animals were euthanatized and necropsied for worm counting. The number of worms found was significantly (p=0.0043) lower in kittens treated with medicated tablets than in kittens treated with placebo tablets. The reduction in the number of worms was 95.90%. No adverse effects were recorded during either study. It is concluded that the milbemycin oxime-praziquantel tablets that were used are efficacious for the control of T. cati infections in cats.

  18. Soft X-ray microscopy analysis of cell volume and hemoglobin content in erythrocytes infected with asexual and sexual stages of Plasmodium falciparum

    PubMed Central

    Hanssen, Eric; Knoechel, Christian; Dearnley, Megan; Dixon, Matthew W.A.; Le Gros, Mark; Larabell, Carolyn; Tilley, Leann

    2012-01-01

    Plasmodium falciparum, the most virulent agent of human malaria, undergoes both asexual cycling and sexual differentiation inside erythrocytes. As the intraerythrocytic parasite develops it increases in size and alters the permeability of the host cell plasma membrane. An intriguing question is: how is the integrity of the host erythrocyte maintained during the intraerythrocytic cycle? We have used water window cryo X-ray tomography to determine cell morphology and hemoglobin content at different stages of asexual and sexual differentiation. The cryo stabilization preserves native structure permitting accurate analyses of parasite and host cell volumes. Absorption of soft X-rays by protein adheres to Beer–Lambert’s law permitting quantitation of the concentration of hemoglobin in the host cell compartment. During asexual development the volume of the parasite reaches about 50% of the uninfected erythrocyte volume but the infected erythrocyte volume remains relatively constant. The total hemoglobin content gradually decreases during the 48 h cycle but its concentration remains constant until early trophozoite stage, decreases by 25%, then remains constant again until just prior to rupture. During early sexual development the gametocyte has a similar morphology to a trophozoite but then undergoes a dramatic shape change. Our cryo X-ray tomography analysis reveals that about 70% of the host cell hemoglobin is taken up and digested during gametocyte development and the parasite eventually occupies about 50% of the uninfected erythrocyte volume. The total volume of the infected erythrocyte remains constant, apart from some reversible shrinkage at stage IV, while the concentration of hemoglobin decreases to about 70% of that in an uninfected erythrocyte. PMID:21945653

  19. Soft X-ray microscopy analysis of cell volume and hemoglobin content in erythrocytes infected with asexual and sexual stages of Plasmodium falciparum.

    PubMed

    Hanssen, Eric; Knoechel, Christian; Dearnley, Megan; Dixon, Matthew W A; Le Gros, Mark; Larabell, Carolyn; Tilley, Leann

    2012-02-01

    Plasmodium falciparum, the most virulent agent of human malaria, undergoes both asexual cycling and sexual differentiation inside erythrocytes. As the intraerythrocytic parasite develops it increases in size and alters the permeability of the host cell plasma membrane. An intriguing question is: how is the integrity of the host erythrocyte maintained during the intraerythrocytic cycle? We have used water window cryo X-ray tomography to determine cell morphology and hemoglobin content at different stages of asexual and sexual differentiation. The cryo stabilization preserves native structure permitting accurate analyses of parasite and host cell volumes. Absorption of soft X-rays by protein adheres to Beer-Lambert's law permitting quantitation of the concentration of hemoglobin in the host cell compartment. During asexual development the volume of the parasite reaches about 50% of the uninfected erythrocyte volume but the infected erythrocyte volume remains relatively constant. The total hemoglobin content gradually decreases during the 48h cycle but its concentration remains constant until early trophozoite stage, decreases by 25%, then remains constant again until just prior to rupture. During early sexual development the gametocyte has a similar morphology to a trophozoite but then undergoes a dramatic shape change. Our cryo X-ray tomography analysis reveals that about 70% of the host cell hemoglobin is taken up and digested during gametocyte development and the parasite eventually occupies about 50% of the uninfected erythrocyte volume. The total volume of the infected erythrocyte remains constant, apart from some reversible shrinkage at stage IV, while the concentration of hemoglobin decreases to about 70% of that in an uninfected erythrocyte.

  20. Detection and treatment of Fiebig stage I HIV-1 infection in young at-risk women in South Africa: a prospective cohort study.

    PubMed

    Dong, Krista L; Moodley, Amber; Kwon, Douglas S; Ghebremichael, Musie S; Dong, Mary; Ismail, Nasreen; Ndhlovu, Zaza M; Mabuka, Jenniffer M; Muema, Daniel M; Pretorius, Karyn; Lin, Nina; Walker, Bruce D; Ndung'u, Thumbi

    2017-09-29

    HIV incidence among young women in sub-Saharan Africa remains high and their inclusion in vaccine and cure efforts is crucial. We aimed to establish a cohort of young women detected during Fiebig stage I acute HIV infection in whom treatment was initiated immediately after diagnosis to advance research in this high-risk group. 945 women aged 18-23 years in KwaZulu-Natal, South Africa, who were HIV uninfected and sexually active consented to HIV-1 RNA testing twice a week and biological sampling and risk assessment every 3 months during participation in a 48-96 week life-skills and job-readiness programme. We analysed the effect of immediate combination antiretroviral therapy (ART) on viraemia and immune responses, sexual risk behaviour, and the effect of the socioeconomic intervention. 42 women were diagnosed with acute HIV infection between Dec 1, 2012, and June 30, 2016, (incidence 8·2 per 100 person-years, 95% CI 5·9-11·1), of whom 36 (86%) were diagnosed in Fiebig stage I infection with a median initial viral load of 2·97 log10 copies per mL (IQR 2·42-3·85). 23 of these 36 women started ART at a median of 1 day (1-1) after detection, which limited the median peak viral load to 4·22 log10 copies per mL (3·27-4·83) and the CD4 nadir to 685 cells per μL (561-802). ART also suppressed viral load (to <20 copies per mL) within a median of 16 days (12-26) and, in 20 (87%) of 23 women, prevented seroconversion, as shown with western blotting. 385 women completed the 48 week socioeconomic intervention, of whom 231 were followed up for 1 year. 202 (87%) of these 231 women were placed in jobs, returned to school, or started a business. Frequent HIV screening combined with a socioeconomic intervention facilitated sampling and risk assessment before and after infection. In addition to detection of acute infection and immediate treatment, we established a cohort optimised for prevention and cure research. Bill & Melinda Gates Foundation, National Institute of

  1. APOBEC3G mRNA expression in exposed seronegative and early stage HIV infected individuals decreases with removal of exposure and with disease progression

    PubMed Central

    Vázquez-Pérez, Joel A; Ormsby, Christopher E; Hernández-Juan, Ramón; Torres, Klintsy J; Reyes-Terán, Gustavo

    2009-01-01

    Background APOBEC3G is an antiretroviral factor that acts by inducing G to A mutations. In this study, we examined the expression of APOBEC3G in uninfected HIV-1 exposed individuals at the time of their partner's diagnosis and one year later. We then compared this expression with that of infected individuals at different disease stages. APOBEC3G mRNA was measured in PBMCs from three groups: healthy controls with no known risk factor to HIV infection (n = 26), exposed uninfected individuals who had unprotected sex with their HIV+ partners for at least 3 months (n = 37), and HIV infected patients at various disease stages (n = 45), including 8 patients with low HIV viral loads < 10,000 copies/mL (LVL) for at least 3 years. Additionally, we obtained sequences from the env, gag, pol, nef, vif and the LTR of the patients' virus. Results Exposed uninfected individuals expressed higher APOBEC3G than healthy controls (3.86 vs. 1.69 relative expression units), and their expression significantly decreased after a year from the HIV diagnosis and subsequent treatment of their partners. Infected individuals showed a positive correlation (Rho = 0.57, p = 0.00006) of APOBEC3G expression with CD4+ T cell count, and a negative correlation with HIV viremia (Rho = -0.54, p = 0.00004). The percentage of G to A mutations had a positive correlation (Rho = 0.43, p = 0.0226) with APOBEC3G expression, and it was higher in LVL individuals than in the other patients (IQR 8.27 to 9.64 vs. 7.06 to 8.1, p = 0.0084). Out of 8 LVLs, 3 had hypermutations, and 4 had premature stop codons only in viral vif. Conclusion The results suggest that exposure to HIV may trigger APOBEC3G expression in PBMCs, in the absence of infection. Additionally, cessation of exposure or advanced disease is associated with decreased APOBEC3G expression. PMID:19254362

  2. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage

    PubMed Central

    Chen, Yang-Er; Cui, Jun-Mei; Su, Yan-Qiu; Yuan, Shu; Yuan, Ming; Zhang, Huai-Yu

    2015-01-01

    Wheat stripe rust (Puccinia striiformis f. sp. tritici, Pst), is one of the most serious diseases of wheat (Triticum aestivum L.) worldwide. To gain a better understanding of the protective mechanism against stripe rust at the adult plant stage, the differences in photosystem II and antioxidant enzymatic systems between susceptible and resistant wheat in response to stripe rust disease (P. striiformis) were investigated. We found that chlorophyll fluorescence and the activities of the antioxidant enzymes were higher in resistant wheat than in susceptible wheat after stripe rust infection. Compared with the susceptible wheat, the resistant wheat accumulated a higher level of D1 protein and a lower level of reactive oxygen species after infection. Furthermore, our results demonstrate that D1 and light-harvesting complex II (LHCII) phosphorylation are involved in the resistance to stripe rust in wheat. The CP29 protein was phosphorylated under stripe rust infection, like its phosphorylation in other monocots under environmental stresses. More extensive damages occur on the thylakoid membranes in the susceptible wheat compared with the resistant wheat. The findings provide evidence that thylakoid protein phosphorylation and antioxidant enzyme systems play important roles in plant responses and defense to biotic stress. PMID:26442087

  3. Efficient monitoring of the blood-stage infection in a malaria rodent model by the rotating-crystal magneto-optical method.

    PubMed

    Orbán, Ágnes; Rebelo, Maria; Molnár, Petra; Albuquerque, Inês S; Butykai, Adam; Kézsmárki, István

    2016-03-17

    Intense research efforts have been focused on the improvement of the efficiency and sensitivity of malaria diagnostics, especially in resource-limited settings for the detection of asymptomatic infections. Our recently developed magneto-optical (MO) method allows the accurate quantification of malaria pigment crystals (hemozoin) in blood by their magnetically induced rotation. First evaluations of the method using β-hematin crystals and in vitro P. falciparum cultures implied its potential for high-sensitivity malaria diagnosis. To further investigate this potential, here we study the performance of the method in monitoring the in vivo onset and progression of the blood-stage infection in a rodent malaria model. Our results show that the MO method can detect the first generation of intraerythrocytic P. berghei parasites 66-76 hours after sporozoite injection, demonstrating similar sensitivity to Giesma-stained light microscopy and exceeding that of flow cytometric techniques. Magneto-optical measurements performed during and after the treatment of P. berghei infections revealed that both the follow up under treatment and the detection of later reinfections are feasible with this new technique. The present study demonstrates that the MO method - besides being label and reagent-free, automated and rapid - has a high in vivo sensitivity and is ready for in-field evaluation.

  4. Immunological signature of the different clinical stages of the HTLV-1 infection: establishing serum biomarkers for HTLV-1-associated disease morbidity.

    PubMed

    Starling, Ana Lúcia Borges; Coelho-Dos-Reis, Jordana Grazziela Alves; Peruhype-Magalhães, Vanessa; Pascoal-Xavier, Marcelo Antônio; Gonçalves, Denise Utsch; Béla, Samantha Ribeiro; Lambertucci, José Roberto; Labanca, Ludimila; Souza Pereira, Silvio Roberto; Teixeira-Carvalho, Andréa; Ribas, João Gabriel; Trindade, Bruno Caetano; Faccioli, Lucia Helena; Carneiro-Proietti, Anna Bárbara Freitas; Martins-Filho, Olindo Assis

    2015-01-01

    This study aimed at establishing the immunological signature and an algorithm for clinical management of the different clinical stages of the HTLV-1-infection based on serum biomarkers. A panel of serum biomarkers was evaluated by four sets of innovative/non-conventional data analysis approaches in samples from 87 HTLV-1 patients: asymptomatic carriers (AC), putative HTLV-1 associated myelopathy/tropical spastic paraparesis (pHAM/TSP) and HAM/TSP. The analysis of cumulative curves and molecular signatures pointed out that HAM/TSP presented a pro-inflammatory profile mediated by CXCL10/LTB-4/IL-6/TNF-α/IFN-γ, counterbalanced by IL-4/IL-10. The analysis of biomarker networks showed that AC presented a strongly intertwined pro-inflammatory/regulatory net with IL-4/IL-10 playing a central role, while HAM/TSP exhibited overall immune response toward a predominant pro-inflammatory profile. At last, the classification and regression trees proposed for clinical practice allowed for the construction of an algorithm to discriminate AC, pHAM and HAM/TSP patients with the elected biomarkers: IFN-γ, TNF-α, IL-10, IL-6, IL-4 and CysLT. These findings reveal a complex interaction among chemokine/leukotriene/cytokine in HTLV-1 infection and suggest the use of the selected but combined biomarkers for the follow-up/diagnosis of disease morbidity of HTLV-1-infected individuals.

  5. Efficient monitoring of the blood-stage infection in a malaria rodent model by the rotating-crystal magneto-optical method

    NASA Astrophysics Data System (ADS)

    Orbán, Ágnes; Rebelo, Maria; Molnár, Petra; Albuquerque, Inês S.; Butykai, Adam; Kézsmárki, István

    2016-03-01

    Intense research efforts have been focused on the improvement of the efficiency and sensitivity of malaria diagnostics, especially in resource-limited settings for the detection of asymptomatic infections. Our recently developed magneto-optical (MO) method allows the accurate quantification of malaria pigment crystals (hemozoin) in blood by their magnetically induced rotation. First evaluations of the method using β-hematin crystals and in vitro P. falciparum cultures implied its potential for high-sensitivity malaria diagnosis. To further investigate this potential, here we study the performance of the method in monitoring the in vivo onset and progression of the blood-stage infection in a rodent malaria model. Our results show that the MO method can detect the first generation of intraerythrocytic P. berghei parasites 66–76 hours after sporozoite injection, demonstrating similar sensitivity to Giesma-stained light microscopy and exceeding that of flow cytometric techniques. Magneto-optical measurements performed during and after the treatment of P. berghei infections revealed that both the follow up under treatment and the detection of later reinfections are feasible with this new technique. The present study demonstrates that the MO method – besides being label and reagent-free, automated and rapid – has a high in vivo sensitivity and is ready for in-field evaluation.

  6. γδ T-cell function is inhibited in end-stage renal disease and impacted by latent tuberculosis infection.

    PubMed

    Juno, Jennifer A; Waruk, Jillian L M; Harris, Angela; Mesa, Christine; Lopez, Carmen; Bueti, Joe; Ball, T Blake; Kiazyk, Sandra A

    2017-10-01

    Patients with end-stage renal disease (ESRD) are at elevated risk of acquiring infectious diseases, including tuberculosis (TB). Inflammation and uremia negatively impact immune function in this population, but specific pathways involved in TB immunity have not been identified. Although γδ T cells are known to contribute to protection from TB, their phenotype and function in patients with ESRD is relatively unknown. To determine this we recruited 20 patients with and 20 without ESRD (controls), with or without latent TB infection to assess γδ T cell frequency, surface phenotype, and cytokine production by flow cytometry in response to stimulation. γδ T cells derived from patients with ESRD exhibited significantly lower expression of CCR5, CXCR3, and CD26 compared to controls. Furthermore, patients with ESRD, particularly the group with latent TB infection, exhibited poor IFNγ, TNFα, and GMCSF responses to stimulation with either phosphoantigen HMB-PP, IL-12/IL-18, E. coli, or phorbol myristate acetate and ionomycin. Similar dysfunctional responses were observed in patients with active TB. Surprisingly, neither the γδ phenotype nor its function was associated with plasma markers of inflammation or microbial translocation. Thus, there is significant perturbation of the γδ T-cell population in patients with ESRD, particularly in those with latent TB infection. Copyright © 2017 International Society of Nephrology. All rights reserved.

  7. Mobile-Based Analysis of Malaria-Infected Thin Blood Smears: Automated Species and Life Cycle Stage Determination.

    PubMed

    Rosado, Luís; da Costa, José M Correia; Elias, Dirk; Cardoso, Jaime S

    2017-09-21

    Microscopy examination has been the pillar of malaria diagnosis, being the recommended procedure when its quality can be maintained. However, the need for trained personnel and adequate equipment limits its availability and accessibility in malaria-endemic areas. Rapid, accurate, accessible diagnostic tools are increasingly required, as malaria control programs extend parasite-based diagnosis and the prevalence decreases. This paper presents an image processing and analysis methodology using supervised classification to assess the presence of malaria parasites and determine the species and life cycle stage in Giemsa-stained thin blood smears. The main differentiation factor is the usage of microscopic images exclusively acquired with low cost and accessible tools such as smartphones, a dataset of 566 images manually annotated by an experienced parasilogist being used. Eight different species-stage combinations were considered in this work, with an automatic detection performance ranging from 73.9% to 96.2% in terms of sensitivity and from 92.6% to 99.3% in terms of specificity. These promising results attest to the potential of using this approach as a valid alternative to conventional microscopy examination, with comparable detection performances and acceptable computational times.

  8. Phagosomal Acidification Prevents Macrophage Inflammatory Cytokine Production to Malaria, and Dendritic Cells Are the Major Source at the Early Stages of Infection

    PubMed Central

    Wu, Xianzhu; Gowda, Nagaraj M.; Gowda, D. Channe

    2015-01-01

    Inflammatory cytokines produced at the early stages of malaria infection contribute to shaping protective immunity and pathophysiology. To gain mechanistic insight into these processes, it is important to understand the cellular origin of cytokines because both cytokine input and cytokine-producing cells play key roles. Here, we determined cytokine responses by monocytes, macrophages, and dendritic cells (DCs) to purified Plasmodium falciparum and Plasmodium berghei ANKA, and by spleen macrophages and DCs from Plasmodium yoelii 17NXL-infected and P. berghei ANKA-infected mice. The results demonstrate that monocytes and macrophages do not produce inflammatory cytokines to malaria parasites and that DCs are the primary source early in infection, and DC subsets differentially produce cytokines. Importantly, blocking of phagosomal acidification by inhibiting vacuolar-type H+-ATPase enabled macrophages to elicit cytokine responses. Because cytokine responses to malaria parasites are mediated primarily through endosomal Toll-like receptors, our data indicate that the inability of macrophages to produce cytokines is due to the phagosomal acidification that disrupts endosomal ligand-receptor engagement. Macrophages efficiently produced cytokines to LPS upon simultaneously internalizing parasites and to heat-killed Escherichia coli, demonstrating that phagosomal acidification affects endosomal receptor-mediated, but not cell surface receptor-mediated, recognition of Toll-like receptor agonists. Enabling monocytes/macrophages to elicit immune responses to parasites by blocking endosomal acidification can be a novel strategy for the effective development of protective immunity to malaria. The results have important implications for enhancing the efficacy of a whole parasite-based malaria vaccine and for designing strategies for the development of protective immunity to pathogens that induce immune responses primarily through endosomal receptors. PMID:26240140

  9. Surgical site infections in liver transplant recipients in the model for end-stage liver disease era: an analysis of the epidemiology, risk factors, and outcomes.

    PubMed

    Freire, Maristela Pinheiro; Soares Oshiro, Isabel C V; Bonazzi, Patricia Rodrigues; Guimarães, Thais; Ramos Figueira, Estela Regina; Bacchella, Telésforo; Costa, Silvia Figueiredo; Carneiro D'Albuquerque, Luiz Augusto; Abdala, Edson

    2013-09-01

    In recipients of liver transplantation (LT), surgical site infection (SSIs) are among the most common types of infection occurring in the first 60 days after LT. In 2007, the Model for End-Stage Liver Disease (MELD) scoring system was adopted as the basis for prioritizing organ allocation. Patients with higher MELD scores are at higher risk for developing SSIs as well as other health care-associated infections. However, there have been no studies comparing the incidence of SSIs in the pre-MELD era with the incidence in the period since its adoption. Therefore, the objectives of this study were to evaluate the incidence, etiology, epidemiology, and outcomes of post-LT SSIs in those 2 periods and to identify risk factors for SSIs. We evaluated all patients who underwent LT over a 10-year period (2002-2011). SSI cases were identified through active surveillance. The primary outcome measure was an SSI during the first 60 days after LT. Risk factors were analyzed via logistic regression, and 60-day survival rates were evaluated via Cox regression. We evaluated 543 patients who underwent LT 597 times. The SSI rates in the 2002-2006 and 2007-2011 periods were 30% and 24%, respectively (P = 0.21). We identified the following risk factors for SSIs: retransplantation, the transfusion of more than 2 U of blood during LT, dialysis, cold ischemia for >400 minutes, and a cytomegalovirus infection. The overall 60-day survival rate was 79%. Risk factors for 60-day mortality were retransplantation, dialysis, and a longer surgical time. The use of the MELD score modified the incidence and epidemiology of SSIs only during the first year after its adoption. Risks for SSIs were related more to intraoperative conditions and intercurrences after LT than to a patient's status before LT.

  10. Phagosomal Acidification Prevents Macrophage Inflammatory Cytokine Production to Malaria, and Dendritic Cells Are the Major Source at the Early Stages of Infection: IMPLICATION FOR MALARIA PROTECTIVE IMMUNITY DEVELOPMENT.

    PubMed

    Wu, Xianzhu; Gowda, Nagaraj M; Gowda, D Channe

    2015-09-18

    Inflammatory cytokines produced at the early stages of malaria infection contribute to shaping protective immunity and pathophysiology. To gain mechanistic insight into these processes, it is important to understand the cellular origin of cytokines because both cytokine input and cytokine-producing cells play key roles. Here, we determined cytokine responses by monocytes, macrophages, and dendritic cells (DCs) to purified Plasmodium falciparum and Plasmodium berghei ANKA, and by spleen macrophages and DCs from Plasmodium yoelii 17NXL-infected and P. berghei ANKA-infected mice. The results demonstrate that monocytes and macrophages do not produce inflammatory cytokines to malaria parasites and that DCs are the primary source early in infection, and DC subsets differentially produce cytokines. Importantly, blocking of phagosomal acidification by inhibiting vacuolar-type H(+)-ATPase enabled macrophages to elicit cytokine responses. Because cytokine responses to malaria parasites are mediated primarily through endosomal Toll-like receptors, our data indicate that the inability of macrophages to produce cytokines is due to the phagosomal acidification that disrupts endosomal ligand-receptor engagement. Macrophages efficiently produced cytokines to LPS upon simultaneously internalizing parasites and to heat-killed Escherichia coli, demonstrating that phagosomal acidification affects endosomal receptor-mediated, but not cell surface receptor-mediated, recognition of Toll-like receptor agonists. Enabling monocytes/macrophages to elicit immune responses to parasites by blocking endosomal acidification can be a novel strategy for the effective development of protective immunity to malaria. The results have important implications for enhancing the efficacy of a whole parasite-based malaria vaccine and for designing strategies for the development of protective immunity to pathogens that induce immune responses primarily through endosomal receptors.

  11. Identification of plant genes regulated in resistant potato Solanum sparsipilum during the early stages of infection by Globodera pallida.

    PubMed

    Jolivet, Katell; Grenier, Eric; Bouchet, Jean-Paul; Esquibet, Magali; Kerlan, Marie-Claire; Caromel, Bernard; Mugniéry, Didier; Lefebvre, Véronique

    2007-04-01

    Using a complementary (c)DNA-amplified fragment length polymorphism (AFLP) approach, we investigated differential gene expression linked to resistance mechanisms during the incompatible potato - Globodera pallida interaction. Expression was compared between a resistant and a susceptible potato clone, inoculated or not inoculated with G. pallida. These clones were issued from a cross between the resistant Solanum sparsipilum spl329.18 accession and the susceptible dihaploid S. tuberosum Caspar H3, and carried, respectively, resistant and susceptible alleles at the resistance quantitative trait loci (QTLs). Analysis was done on root fragments picked up at 4 time points, during a period of 6 days after infection, from penetration of the nematode in the root to degradation of the feeding site in resistant plants. A total of 2560 transcript-derived fragments (TDFs) were analyzed, resulting in the detection of 46 TDFs that were up- or downregulated. The number of TDFs that were up- or downregulated increased with time after inoculation. The majority of TDFs were upregulated at only 1 or 2 time points in response to infection. After isolation and sequencing of the TDFs of interest, a subset of 36 sequences were identified, among which 22 matched plant sequences and 2 matched nematode sequences. Some of the TDFs that matched plant genes showed clear homologies to genes involved in cell-cycle regulation, transcription regulation, resistance downstream signalling pathways, and defense mechanisms. Other sequences with homologies to plant genes of unknown function or without any significant similarity to known proteins were also found. Although not exhaustive, these results represent the most extensive list of genes with altered RNA levels after the incompatible G. pallida-potato interaction that has been published to date. The function of these genes could provide insight into resistance or plant defense mechanisms during incompatible potato-cyst nematode interactions.

  12. Economic Burden of Hepatitis C Virus Infection in Different Stages of Disease: A Report From Southern Iran

    PubMed Central

    Zare, Fatemeh; Fattahi, Mohammad Reza; Sepehrimanesh, Masood; Safarpour, Ali Reza

    2016-01-01

    Background Hepatitis C virus (HCV) infection is a major blood-borne infection which imposes high economic cost on the patients. Objectives The current study aimed to evaluate the total annual cost due to chronic HCV related diseases imposed on each patient and their family in Southern Iran. Patients and Methods Economic burden of chronic hepatitis C-related liver diseases (chronic hepatitis C, cirrhosis and hepatocellular carcinoma) were examined. The current retrospective study evaluated 200 Iranian patients for their socioeconomic status, utilization (direct and indirect costs) and treatment costs and work days lost due to illness by a structured questionnaire in 2015. Costs of hospital admissions were extracted from databases of Nemazee hospital, Shiraz, Iran. The outpatient expenditure per patient was measured through the rate of outpatient visits and average cost per visit reported by the patients; while the inpatient costs were calculated through annual rate of hospital admissions and average expenditure. Self-medication and direct non-medical costs were also reported. The human capital approach was used to measure the work loss cost. Results The total annual cost per patient for chronic hepatitis C, cirrhosis and hepatocellular carcinoma (HCC) based on purchasing power parity (PPP) were USD 1625.50, USD 6117.2, and USD 11047.2 in 2015, respectively. Conclusions Chronic hepatitis C-related liver diseases impose a substantial economic burden on patients, families and the society. The current study provides useful information on cost of treatment and work loss for different disease states, which can be further used in cost-effectiveness evaluations. PMID:27257424

  13. Actively induced antigen-specific CD8+ T cells by epitope-bearing parasite pre-infection but not prime/boost virus vector vaccination could ameliorate the course of Plasmodium yoelii blood-stage infection.

    PubMed

    Ono, Takeshi; Yamaguchi, Yoko; Oguma, Takemi; Takayama, Eiji; Takashima, Yasuhiro; Tadakuma, Takushi; Miyahira, Yasushi

    2012-09-28

    The lack of MHC molecules on red blood cells (RBCs) has led to questions regarding the immunological function of CD8(+) T cells against malarial blood-stage (MBS). However, several recent reports contradicting with this concept have suggested that they play an important role in the course of MBS infection. The present study generated genetically engineered murine malaria, Plasmodium yoelii, which expresses a well-defined Trypanosoma cruzi-derived, H-2K(b)-restricted CD8(+) T cell epitope, ANYNFTLV. Prime/boost vaccination by the use of recombinant adenovirus and recombinant modified vaccinia virus Ankara (MVA), which induced an enhanced number of ANYNFTLV-specific CD8(+) T cells, failed to prevent a pathological outcome to occur upon ANYNFTLV-expressing murine MBS infection. This outcome did not change even with the combination of passive transfer of an appreciable number of in vitro-expanded ANYNFTLV-specific CD8(+) T cells. In contrast, the pre-infection of mice with T. cruzi, which intrinsically bears the same CD8(+) T cell epitope significantly improved the survival of ANYNFTLV-expressing malaria-infected mice but not that of control malaria-infected ones. This protective effect was abrogated by the use of a CD8(+) T cell-depleting monoclonal antibody. Although the protective effect was observed only in certain situations, the actively induced antigen-specific CD8(+) T cells could ameliorate the pathologies caused by the MBS. This is the first study to implicate that the active induction of antigen-specific CD8(+) T cells should be included in the development of a vaccine against MBS. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Opportunistic Infections

    MedlinePlus

    ... Infections Opportunistic Infections and Their Relationship to HIV/AIDS People with healthy immune systems can be exposed ... Disease Dementia Hospitalization & Palliative Care Related Topics on AIDS.gov Signs and Symptoms Immune System 101 Stages ...

  15. Fruit maturity and post-harvest environmental conditions influence the pre-penetration stages of Monilinia infections in peaches.

    PubMed

    Garcia-Benitez, C; Melgarejo, P; De Cal, A

    2017-01-16

    Brown rot caused by the fungi Monilinia laxa (Aderhold and Ruhland) Honey, M. fructicola (Winter) Honey, or M. fructigena (Aderhold and Ruhland) is a serious fungal disease of peaches. The fungal infection process begins when fungal conidia germinate on the fruit surface to produce germ tubes and/or appressoria, and the incidence of brown rot increases as fruit approaches maturity. The interaction between the fungal infection process, peach maturity, and the environmental conditions is not well understood. Accordingly, the objectives of this investigation were to investigate germ tube and appressorial formation by M. laxa and M. fructicola when they were exposed to peach skin from mature and immature fruit at various temperatures and relative humidities (RHs). The greatest number of germ tubes was found when M. laxa or M. fructicola was incubated in culture medium which contained a skin extract of mature peaches. In contrast, the greatest number of appressoria was found when M. laxa or M. fructicola was incubated in culture medium which contained a skin extract of immature peaches. Although M. fructicola produced the same number of germ tubes and appressoria at 4°C, M. fructicola produced more germ tubes than appressoria at temperatures higher than 10°C. M. laxa produced more germ tubes than appressoria at any temperature, except when it was incubated for 48h on culture medium which contained a skin extract of immature peaches at 10°C at 80% or 100% RH, or at 25°C at 60% RH. M. laxa conidia germinated better than M. fructicola conidia at low temperatures. Germ tube and appressorial formation by Monilinia spp. were influenced by fruit postharvest handling. The number of germ tubes that were formed by M. laxa conidia was significantly greater than that for M. fructicola when the conidia were incubated at 100% RH, and this number increased after 3days of refrigeration. The number of appressoria that were formed by both Monilinia spp. also increased after 3

  16. Plum Pox Virus 6K1 Protein Is Required for Viral Replication and Targets the Viral Replication Complex at the Early Stage of Infection.

    PubMed

    Cui, Hongguang; Wang, Aiming

    2016-05-15

    The potyviral RNA genome encodes two polyproteins that are proteolytically processed by three viral protease domains into 11 mature proteins. Extensive molecular studies have identified functions for the majority of the viral proteins. For example, 6K2, one of the two smallest potyviral proteins, is an integral membrane protein and induces the endoplasmic reticulum (ER)-originated replication vesicles that target the chloroplast for robust viral replication. However, the functional role of 6K1, the other smallest protein, remains uncharacterized. In this study, we developed a series of recombinant full-length viral cDNA clones derived from a Canadian Plum pox virus (PPV) isolate. We found that deletion of any of the short motifs of 6K1 (each of which ranged from 5 to 13 amino acids), most of the 6K1 sequence (but with the conserved sequence of the cleavage sites being retained), or all of the 6K1 sequence in the PPV infectious clone abolished viral replication. The trans expression of 6K1 or the cis expression of a dislocated 6K1 failed to rescue the loss-of-replication phenotype, suggesting the temporal and spatial requirement of 6K1 for viral replication. Disruption of the N- or C-terminal cleavage site of 6K1, which prevented the release of 6K1 from the polyprotein, either partially or completely inhibited viral replication, suggesting the functional importance of the mature 6K1. We further found that green fluorescent protein-tagged 6K1 formed punctate inclusions at the viral early infection stage and colocalized with chloroplast-bound viral replicase elements 6K2 and NIb. Taken together, our results suggest that 6K1 is required for viral replication and is an important viral element of the viral replication complex at the early infection stage. Potyviruses account for more than 30% of known plant viruses and consist of many agriculturally important viruses. The genomes of potyviruses encode two polyproteins that are proteolytically processed into 11 mature

  17. Plum Pox Virus 6K1 Protein Is Required for Viral Replication and Targets the Viral Replication Complex at the Early Stage of Infection

    PubMed Central

    Cui, Hongguang

    2016-01-01

    ABSTRACT The potyviral RNA genome encodes two polyproteins that are proteolytically processed by three viral protease domains into 11 mature proteins. Extensive molecular studies have identified functions for the majority of the viral proteins. For example, 6K2, one of the two smallest potyviral proteins, is an integral membrane protein and induces the endoplasmic reticulum (ER)-originated replication vesicles that target the chloroplast for robust viral replication. However, the functional role of 6K1, the other smallest protein, remains uncharacterized. In this study, we developed a series of recombinant full-length viral cDNA clones derived from a Canadian Plum pox virus (PPV) isolate. We found that deletion of any of the short motifs of 6K1 (each of which ranged from 5 to 13 amino acids), most of the 6K1 sequence (but with the conserved sequence of the cleavage sites being retained), or all of the 6K1 sequence in the PPV infectious clone abolished viral replication. The trans expression of 6K1 or the cis expression of a dislocated 6K1 failed to rescue the loss-of-replication phenotype, suggesting the temporal and spatial requirement of 6K1 for viral replication. Disruption of the N- or C-terminal cleavage site of 6K1, which prevented the release of 6K1 from the polyprotein, either partially or completely inhibited viral replication, suggesting the functional importance of the mature 6K1. We further found that green fluorescent protein-tagged 6K1 formed punctate inclusions at the viral early infection stage and colocalized with chloroplast-bound viral replicase elements 6K2 and NIb. Taken together, our results suggest that 6K1 is required for viral replication and is an important viral element of the viral replication complex at the early infection stage. IMPORTANCE Potyviruses account for more than 30% of known plant viruses and consist of many agriculturally important viruses. The genomes of potyviruses encode two polyproteins that are proteolytically

  18. [Antiparasitic effects of peracetic acid (PAA) against infective stages (theronts) of white spot disease, Ichthyophthirius multifiliis in vitro].

    PubMed

    Meinelt, T; Staaks, J; Staaks, G; Stüber, A; Bräunig, I

    2007-10-01

    White spot disease, caused by the protozoan parasite Ichthyophthirius multifiliis (I. multifiliis), invades nearly all fresh water fish species and causes huge economic losses. In Germany no protocide substance is legal for the treatment of I. multifilis. As an alternative substance the peracetic acid (PAA) was tested to treat the free invasive stage (theront) of the parasite. PAA concentrations of 0.3 ppm were able to kill all theronts in 120 min in our investigations. As a result of these investigations we recommend an interval-application of 0.3 to 0.5 ppm PAA for 30 to 150 min. This application should be prolonged for two life cycles of the parasite. Biotic parameters as e. g. fish species, and age as well as abiotic parameters as e. g. temperature, pH and organic load of the water could possibly influence the efficiency of the PAA application and should therefore be taken into account while picking the dosage and length of the PAA exposure.

  19. Expression Analysis of Lily Type Lectin Isotypes in the Rock Bream, Oplegnathus fasciatus: in the Tissue, Developmental Stage and Viral Infection

    PubMed Central

    Lee, Young Mee; Yang, In Jung; Noh, Jae Koo; Kim, Hyun Chul; Park, Choul-Ji; Park, Jong-Won; Noh, Gyeong Eon; Kim, Woo-Jin; Kim, Kyung-Kil

    2016-01-01

    ABSTRACT Lectins belong to the pattern-recognition receptors (PRRs) class and play important roles in the recognition and elimination of pathogens via the innate immune system. Recently, it was reported that lily-type lectin-1 is involved when a pathogen attacks in the early immune response of fish. However, this study is limited to information that the lectin is involved in the innate immune response against viral infection. In the present study, the lily-type lectin-2 and -3 of Oplegnathus fasciatus (OfLTL-2 and 3) have been presented to be included B-lectin domain and two D-mannose binding sites in the amino acid sequence that an important feature for the fundamental structure. To investigate the functional properties of OfLTLs, the tissue distribution in the healthy rock bream and temporal expression during early developmental stage analysis are performed using quantitative real-time PCR. OfLTL-2 and 3 are predominantly expressed in the liver and skin, but rarely expressed in other organ. Also, the transcripts of OfLTLs are not expressed during the early developmental stage but its transcripts are increased after immune-related organs which are fully formed. In the challenge experiment with RBIV (rock bream iridovirus), the expression of OfLTLs was increased much more strongly in the late response than the early, unlike previously known. These results suggest that OfLTLs are specifically expressed in the immune-related tissues when those organs are fully formed and it can be inferred that the more intensively involved in the second half to the virus infection. PMID:28144635

  20. Expression Analysis of Lily Type Lectin Isotypes in the Rock Bream, Oplegnathus fasciatus: in the Tissue, Developmental Stage and Viral Infection.

    PubMed

    Lee, Young Mee; Yang, In Jung; Noh, Jae Koo; Kim, Hyun Chul; Park, Choul-Ji; Park, Jong-Won; Noh, Gyeong Eon; Kim, Woo-Jin; Kim, Kyung-Kil

    2016-12-01

    Lectins belong to the pattern-recognition receptors (PRRs) class and play important roles in the recognition and elimination of pathogens via the innate immune system. Recently, it was reported that lily-type lectin-1 is involved when a pathogen attacks in the early immune response of fish. However, this study is limited to information that the lectin is involved in the innate immune response against viral infection. In the present study, the lily-type lectin-2 and -3 of Oplegnathus fasciatus (OfLTL-2 and 3) have been presented to be included B-lectin domain and two D-mannose binding sites in the amino acid sequence that an important feature for the fundamental structure. To investigate the functional properties of OfLTLs, the tissue distribution in the healthy rock bream and temporal expression during early developmental stage analysis are performed using quantitative real-time PCR. OfLTL-2 and 3 are predominantly expressed in the liver and skin, but rarely expressed in other organ. Also, the transcripts of OfLTLs are not expressed during the early developmental stage but its transcripts are increased after immune-related organs which are fully formed. In the challenge experiment with RBIV (rock bream iridovirus), the expression of OfLTLs was increased much more strongly in the late response than the early, unlike previously known. These results suggest that OfLTLs are specifically expressed in the immune-related tissues when those organs are fully formed and it can be inferred that the more intensively involved in the second half to the virus infection.

  1. Antibodies elicited during natural infection in a predominantly Plasmodium falciparum transmission area cross-react with sexual stage-specific antigen in P. vivax.

    PubMed

    Bansal, Geetha P; Vengesai, Arthur; Cao, Yi; Mduluza, Takafira; Kumar, Nirbhay

    2017-06-01

    Infections caused by Plasmodium falciparum and P. vivax account for more than 90% of global malaria burden. Exposure to malaria parasite elicits immune responses during natural infection and it is generally believed that the immunity is not only stage specific but also species specific. However, partial genomic similarity for various antigens in different Plasmodium spp. raises the possibility of immunological cross-reactivity at the level of specific antigens. Serum samples collected from children who were permanent residents of a P. falciparum transmission area in Zimbabwe were screened for antibody reactivity against Pfs48/45, a P. falciparum gametocyte antigen and Pvs48/45, a P. vivax homolog of Pfs48/45 using ELISA. Western blotting was used to further confirm identity of the specific antibody reactivity to the Pfs48/45 and Pvs48/45 proteins. Pan Plasmodium PCR and nested PCR were used to confirm infection with the Plasmodium species. Twenty-seven percent (49/181) of the participants were found to be sero-positive for Pfs48/45 and 73% (n=36) of these Pfs48/45 positive sera also showed reactivity with Pvs48/45. Immune cross-reactivity revealed by ELISA was also confirmed by Western blot analysis using a panel of randomly selected 23 Pfs48/45 and Pvs48/45 ELISA positive samples. Nested PCR analysis of 27 blood samples randomly selected from the 36 that showed positive ELISA reactivity to both Pfs48/45 and Pvs48/45 antigens confirmed infection with P. falciparum and generalized absence of P. vivax except for a single sample which revealed PCR positivity for both P. vivax and P. falciparum. Our studies with sera samples from a predominantly P. falciparum transmission area in Zimbabwe suggest immunological cross-reactivity with Pvs48/45, thus raising the possibility of partial species cross-reactive immunity and possible cross-boosting of immunity during co-infection with P. falciparum and P. vivax. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Staged treatment of pilon fractures

    PubMed Central

    Deivaraju, Chenthuran; Vlasak, Richard; Sadasivan, Kalia

    2015-01-01

    Aim To evaluate outcomes following staged anterolateral plating of pilon fractures. Methods Over a 5 year period, patients with pilon fractures received four treatment regimens (staged anterolateral plating, staged medial plating, definitive external fixation, early total care). We defined five outcomes (reduction, soft tissue complications, infection, non-union, malunion) and assessed the outcome of fractures treated by these interventions. Results Staged anterolateral plating or staged medial plating achieved comparable reduction and soft tissue complications. Staged medial plating had higher infection rates, malunion and non-union rates. Conclusions Staged anterolateral plating is superior to staged medial plating in the management of pilon fractures. PMID:26719618

  3. [Infect of pingshen decoction on serum HGF, Cys C and TGF-beta1 diabetic nephropathy in early stage].

    PubMed

    Bao, Hui-Lan; Ye, Shang-He; Lou, Shi-Xian; Lu, Xiao-Wen; Zhou, Xiang-Feng

    2014-03-01

    Study the serum level of HGF, Cys C and TGF-beta1 in type 2 diabetic nephropathy (DN), the infect of Pingshen decoction on those index. Selected 69 cases of 2 type DN and randomly divided into therapy group (36 cases) and control group (33 cases). The therapy group were treated with Pingshen decoction 1 dose/d, bid po. The control group were treated with NephritisShu tablet, 6 tablet, tid po. 8 weeks was a course. Before and after treatment, we examine the serum level of HGF, Cys C and TGF-beta1 by ELISA and immunonephelometry, and compare with 30 cases of healthy control group. The study demonstrates that before treatment, the serum level of HGF in both groups were significantly lower than healthy control group (P < 0.01), but Cys C, TGF-beta1 were significantly higher (P < 0.01). After treatment, the serum level of HGF of both groups were increased. The serum level of HGF of therapy group were significantly higher than of control group (P < 0.01), but the serum level of Cys C and TGF-beta1 were significantly lower than control group (P < 0.01). The serum level of HGF was correlated negatively with Cys C,TGF-beta1. In control group, the UAER, urine beta2-MG and quantity of 24-hour urine protein were significantly decreased after treatment (P < 0.01). The index of urine of therapy group were significantly lower than control group (P < 0.01). Results indicate that test of serum level of HGF and Cys C,TGF-beta1 of diabetic nephropathy have important clinical significance. Pingshen decoction can effectively intervene in the serum level of HGF and Cys C, TGF-beta1 and index of urine.

  4. Wound-induced rgs-CaM gets ready for counterresponse to an early stage of viral infection.

    PubMed

    Tadamura, Kazuki; Nakahara, Kenji S; Masuta, Chikara; Uyeda, Ichiro

    2012-12-01

    Plants and animals can recognize the invasion of pathogens through their perception of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs). Plant PRRs identified have been exclusively receptor-like kinases/proteins (RLK/Ps), and no RLK/P that can detect viruses has been identified to date. RNA silencing (RNA interference, RNAi) is regarded as an antiviral basal immunity because the majority of plant viruses has RNA as their genomes and encode RNA silencing suppressor (RSS) proteins to counterattack antiviral RNAi. Many RSSs were reported to bind to double-stranded RNAs (dsRNAs), which are regarded as viral PAMPs. We have recently identified a tobacco calmodulin (CaM)-like protein, rgs-CaM, as a PRR that binds to diverse viral RSSs through its affinity for the dsRNA-binding domains. Because rgs-CaM seems to target RSSs for autophagic degradation with self-sacrifice, the expression level of rgs-CaM is important for antiviral activity. Here, we found that the rgs-CaM expression was induced immediately (within 1 h) after wounding at a wound site on tobacco leaves. Since the invasion of plant viruses is usually associated with wounding, and several hours are required for viruses to replicate to a detectable level in invaded cells, the wound-induced expression of rgs-CaM seems to be linked to its antiviral function, which should be ready before the virus establishes infection. CaMs and CaM-like proteins usually transduce calcium signals through their binding to endogenous targets. Therefore, rgs-CaM is a unique CaM-like protein in terms of binding to exogenous targets and functioning as an antiviral PRR.

  5. Wound-induced rgs-CaM gets ready for counterresponse to an early stage of viral infection

    PubMed Central

    Tadamura, Kazuki; Nakahara, Kenji S.; Masuta, Chikara; Uyeda, Ichiro

    2012-01-01

    Plants and animals can recognize the invasion of pathogens through their perception of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs). Plant PRRs identified have been exclusively receptor-like kinases/proteins (RLK/Ps), and no RLK/P that can detect viruses has been identified to date. RNA silencing (RNA interference, RNAi) is regarded as an antiviral basal immunity because the majority of plant viruses has RNA as their genomes and encode RNA silencing suppressor (RSS) proteins to counterattack antiviral RNAi. Many RSSs were reported to bind to double-stranded RNAs (dsRNAs), which are regarded as viral PAMPs. We have recently identified a tobacco calmodulin (CaM)-like protein, rgs-CaM, as a PRR that binds to diverse viral RSSs through its affinity for the dsRNA-binding domains. Because rgs-CaM seems to target RSSs for autophagic degradation with self-sacrifice, the expression level of rgs-CaM is important for antiviral activity. Here, we found that the rgs-CaM expression was induced immediately (within 1 h) after wounding at a wound site on tobacco leaves. Since the invasion of plant viruses is usually associated with wounding, and several hours are required for viruses to replicate to a detectable level in invaded cells, the wound-induced expression of rgs-CaM seems to be linked to its antiviral function, which should be ready before the virus establishes infection. CaMs and CaM-like proteins usually transduce calcium signals through their binding to endogenous targets. Therefore, rgs-CaM is a unique CaM-like protein in terms of binding to exogenous targets and functioning as an antiviral PRR. PMID:23073002

  6. Drought increases cowpea (Vigna unguiculata [L.] Walp.) susceptibility to cowpea severe mosaic virus (CPSMV) at early stage of infection.

    PubMed

    Silva, Rodolpho G G; Vasconcelos, Ilka M; Martins, Thiago F; Varela, Anna L N; Souza, Pedro F N; Lobo, Ana K M; Silva, Fredy D A; Silveira, Joaquim A G; Oliveira, Jose T A

    2016-12-01

    The physiological and biochemical responses of a drought tolerant, virus-susceptible cowpea genotype exposed to drought stress (D), infected by Cowpea severe mosaic virus (CPSMV) (V), and to these two combined stresses (DV), at 2 and 6 days post viral inoculation (DPI), were evaluated. Gas exchange parameters (net photosynthesis, transpiration rate, stomatal conductance, and internal CO2 partial pressure) were reduced in D and DV at 2 and 6 DPI compared to control plants (C). Photosynthesis was reduced by stomatal and biochemical limitations. Water use efficiency increased at 2 DPI in D, DV, and V, but at 6 DPI only in D and DV compared to C. Photochemical parameters (effective quantum efficiency of photosystem II and electron transport rate) decreased in D and DV compared to C, especially at 6 DPI. The potential quantum efficiency of photosystem II did not change, indicating reversible photoinhibition of photosystem II. In DV, catalase decreased at 2 and 6 DPI, ascorbate peroxidase increased at 2 DPI, but decreased at 6 DPI. Hydrogen peroxide increased at 2 and 6 DPI. Peroxidase increased at 6 DPI and chitinase at 2 and 6 DPI. β-1,3-glucanase decreased in DV at 6 DPI compared to V. Drought increased cowpea susceptibility to CPSMV at 2 DPI, as verified by RT-PCR. However, at 6 DPI, the cowpea plants overcome this effect. Likewise, CPSMV increased the negative effects of drought at 2 DPI, but not at 6 DPI. It was concluded that the responses to combined stresses are not additive and cannot be extrapolated from the study of individual stresses. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  7. Antibody responses and viral load in patients with Crimean-Congo hemorrhagic fever: a comprehensive analysis during the early stages of the infection.

    PubMed

    Ergunay, Koray; Kocak Tufan, Zeliha; Bulut, Cemal; Kinikli, Sami; Demiroz, Ali Pekcan; Ozkul, Aykut

    2014-05-01

    This study was performed to assess viral load, viral nucleocapsid (N), and glycoprotein precursor (GPC) antibodies in consecutive samples obtained from Crimean-Congo hemorrhagic fever patients to reveal viral replication kinetics and antiviral immune responses during the early stages of the infection. Among 116 samples from 20 individuals, 43.9% and 76.7% were positive for viral RNA and IgM/IgG antibodies, respectively, whereas both markers could be detected in 22.4%. Mean duration of viremia was 3 days (range: 1-6 days). N-IgM antibodies were identified as the initial serological marker during the infection, becoming detectable in a median of 2-3 days after disease onset, followed by GPC-IgM (4-6 days) and IgG antibodies (5-6 days). Clearance of viremia followed or coincided N-IgM response. Partial S gene sequences amplified in viremic patients were identical or closely related to previously characterized strains and grouped within European lineage I group II viruses via neighbor-joining analysis without significant amino acid substitutions.

  8. Dynamics and functions of CD4⁺CD25 (high) regulatory T lymphocytes in Chinese rhesus macaques during the early stage of infection with SIVmac239.

    PubMed

    Li, Shao-You; Xia, Hou-Jun; Dai, Zheng-Xi; Zhang, Gao-Hong; Fan, Bo; Li, Ming-Hua; Wang, Rui-Rui; Zheng, Yong-Tang

    2012-05-01

    CD4(+)CD25(high) regulatory T cells (Treg), which are a specialized subset of T cells, play an important role in the prevention of autoimmune diseases, maintenance of immune system homeostasis and tolerance to self-antigens. Chinese rhesus macaques (CRMs) are widely used in preclinical research on potential therapeutic drugs, vaccines and mechanisms of human diseases. However, the basic immunological characterization of Treg cells of CRMs has not been well established. To characterize Treg cells, peripheral blood of 43 adult CRMs was analyzed for CD4+ T lymphocytes by flow cytometry. It was found that Treg cells ranged from 1.52% to 11.1% of CD4+ T cells, and the average value was 5.7%. With our SIV-infected CRM model, through further studies, it was found that Treg cells in peripheral blood increased both in relative and absolute quantities. Moreover, Treg cells maintained their functions by suppressing Th1 cytokine secretion of their target cells. The results show that Treg cells might render cellular immunity against SIV viruses dysfunctional during the early stage after infection.

  9. Preliminary studies by ELISA on the antigen and antibody dynamics in the early stages of experimental infections with Trypanosoma evansi in cattle.

    PubMed

    Thammasart, S; Kanitpun, R; Saithasao, M; Kashiwazaki, Y

    2001-05-01

    Six 6-month-old bulls were experimentally infected with five different isolates of Trypanosoma evansi; two received the same isolate and the other four received different isolates. The parasitaemias and serum antigen levels were monitored regularly by the haematocrit centrifuge technique (HCT) and antigen-detection ELISA (Ag-ELISA), respectively. Trypanosomal antigen was demonstrated by the Ag-ELISA by 10-14 days post inoculation in four cattle, while parasitaemias were first found to be positive in individual cattle over a longer period of time post inoculation (6-28 days). In two cattle, the Ag-ELISA values were also positive when the animals were found to harbour trypanosomes by the HCT and only turned negative 3 days after treatment, while the ELISA values fluctuated during the experiment in another two bulls. The remaining two cattle never produced positive ELISA results despite positive parasitological results. The antibody titres in all six cattle started to rise around 10 days post inoculation and then stayed high throughout the experiment. It was concluded that the Ag-ELISA would produce some false negative results in the early stages of T. evansi infection owing to variations in the balance of parasitaemia and antibody levels in the circulation, and in the pathogenicity of parasite strains.

  10. Human immunodeficiency virus type 1 long terminal repeat variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity.

    PubMed Central

    Estable, M C; Bell, B; Merzouki, A; Montaner, J S; O'Shaughnessy, M V; Sadowski, I J

    1996-01-01

    Despite extensive in vitro studies identifying a myriad of cellular transcription factors that bind the human immunodeficiency virus type 1 5' long terminal repeat (LTR), the relative contribution of these factors to human immunodeficiency virus type 1 replication in infected individuals remains obscure. To address this question, we investigated 478 proviral quasispecies derived from uncultured peripheral blood mononuclear cells of 42 patients representing all stages of infection. In addition to highly conserved TATA box, SP-1, and NF-kappaB sites, the Ets core and an adjacent 5'-ACYGCTGA-3' motif were extremely conserved. Importantly, the most frequent naturally occurring length polymorphism (MFNLP) duplicated 5'-ACYGCTGA-3' motifs in LTRs in which this same motif was disrupted or in LTRs in which a single point mutation to the Ets core ablated binding of c-Ets 1 and another factor distinct from both c-Ets 1 and Elf 1. The MFNLP's location was precise (position -121) and surprisingly frequent (38% of patients) and demarcated LTR Nef-coding sequences from LTR noncoding sequences that appear to be evolving independently. Aside from these features, we found no definitive clinical or transcription phenotype common to all MFNLP LTRs. We also found previously described and novel point polymorphisms, including some conferring TAR-dependent and TAR- independent Tat unresponsiveness, and showed that differential binding of nuclear factor(s) to a TCTAA TATA box variant may be the mechanism for the latter. PMID:8648743

  11. Comparative Genome Analysis of Lactobacillus rhamnosus Clinical Isolates from Initial Stages of Dental Pulp Infection: Identification of a New Exopolysaccharide Cluster

    PubMed Central

    Nadkarni, Mangala A.; Chen, Zhiliang; Wilkins, Marc R.; Hunter, Neil

    2014-01-01

    The human oral microbiome has a major role in oral diseases including dental caries. Our studies on progression of caries infection through dentin and more recently, the invasion of vital dental pulp, detected Lactobacillus rhamnosus in the initial stages of infection of vital pulp tissue. In this study employing current high-throughput next generation sequencing technology we sought to obtain insight into genomic traits of tissue invasive L. rhamnosus, to recognise biomarkers that could provide an understanding of pathogenic potential of lactobacilli, generally regarded as safe. Roche GS FLX+ technology was used to generate whole genome sequences of two clinical isolates of L. rhamnosus infecting vital pulp. Detailed genome-wide comparison of the genetic profiles of tissue invasive L. rhamnosus with probiotic L. rhamnosus was performed to test the hypothesis that specific strains of L. rhamnosus possessing a unique gene complement are selected for the capacity to invade vital pulp tissue. Analysis identified 264 and 258 genes respectively, from dental pulp-invasive L. rhamnosus strains LRHMDP2 and LRHMDP3 isolated from two different subjects that were not present in the reference probiotic L. rhamnosus strain ATCC 53103 (GG). Distinct genome signatures identified included the presence of a modified exopolysaccharide cluster, a characteristic confirmed in a further six clinical isolates. Additional features of LRHMDP2 and LRHMDP3 were altered transcriptional regulators from RpoN, NtrC, MutR, ArsR and zinc-binding Cro/CI families, as well as changes in the two-component sensor kinase response regulator and ABC transporters for ferric iron. Both clinical isolates of L. rhamnosus contained a single SpaFED cluster, as in L. rhamnosus Lc705, instead of the two Spa clusters (SpaCBA and SpaFED) identified in L. rhamnosus ATCC 53103 (GG). Genomic distance analysis and SNP divergence confirmed a close relationship of the clinical isolates but segregation from the reference

  12. The Mannose Receptor (CD206) is an important pattern recognition receptor (PRR) in the detection of the infective stage of the helminth Schistosoma mansoni and modulates IFNγ production.

    PubMed

    Paveley, Ross A; Aynsley, Sarah A; Turner, Joseph D; Bourke, Claire D; Jenkins, Stephen J; Cook, Peter C; Martinez-Pomares, Luisa; Mountford, Adrian P

    2011-11-01

    In this study, infective larvae of the parasitic helminth Schistosoma mansoni were shown to contain a large number of glycosylated components specific for the Mannose Receptor (MR; CD206), which is an important pattern recognition receptor (PRR) of the innate immune system. MR ligands were particularly rich in excretory/secretory (E/S) material released during transformation of cercariae into schistosomula, a process critical for infection of the host. E/S material from carboxyfluorescein diacetate succinimidyl ester (CFDA-SE)-labelled cercariae showed enhanced binding by cells lines that over-express the MR. Conversely, uptake was significantly lower by bone marrow-derived macrophages (MΦ) from MR(-/-) mice, although they were more active as judged by enhanced pro-inflammatory cytokine production and CD40 expression. After natural percutaneous infection of MR(-/-) mice with CFDA-SE-labelled parasites, there were fewer cells in the skin and draining lymph nodes that were CFDA-SE(+) compared with wild-type mice, implying reduced uptake and presentation of larval parasite antigen. However, antigen-specific proliferation of skin draining lymph node cells was significantly enhanced and they secreted markedly elevated levels of IFNγ but decreased levels of IL-4. In conclusion, we show that the MR on mononuclear phagocytic cells, which are plentiful in the skin, plays a significant role in internalising E/S material released by the invasive stages of the parasite which in turn modulates their production of pro-inflammatory cytokines. In the absence of the MR, antigen-specific CD4(+) cells are Th1 biased, suggesting that ligation of the MR by glycosylated E/S material released by schistosome larvae modulates the production of CD4(+) cell specific IFNγ.

  13. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  14. Comparative genome analysis of Lactobacillus rhamnosus clinical isolates from initial stages of dental pulp infection: identification of a new exopolysaccharide cluster.

    PubMed

    Nadkarni, Mangala A; Chen, Zhiliang; Wilkins, Marc R; Hunter, Neil

    2014-01-01

    The human oral microbiome has a major role in oral diseases including dental caries. Our studies on progression of caries infection through dentin and more recently, the invasion of vital dental pulp, detected Lactobacillus rhamnosus in the initial stages of infection of vital pulp tissue. In this study employing current high-throughput next generation sequencing technology we sought to obtain insight into genomic traits of tissue invasive L. rhamnosus, to recognise biomarkers that could provide an understanding of pathogenic potential of lactobacilli, generally regarded as safe. Roche GS FLX+ technology was used to generate whole genome sequences of two clinical isolates of L. rhamnosus infecting vital pulp. Detailed genome-wide comparison of the genetic profiles of tissue invasive L. rhamnosus with probiotic L. rhamnosus was performed to test the hypothesis that specific strains of L. rhamnosus possessing a unique gene complement are selected for the capacity to invade vital pulp tissue. Analysis identified 264 and 258 genes respectively, from dental pulp-invasive L. rhamnosus strains LRHMDP2 and LRHMDP3 isolated from two different subjects that were not present in the reference probiotic L. rhamnosus strain ATCC 53103 (GG). Distinct genome signatures identified included the presence of a modified exopolysaccharide cluster, a characteristic confirmed in a further six clinical isolates. Additional features of LRHMDP2 and LRHMDP3 were altered transcriptional regulators from RpoN, NtrC, MutR, ArsR and zinc-binding Cro/CI families, as well as changes in the two-component sensor kinase response regulator and ABC transporters for ferric iron. Both clinical isolates of L. rhamnosus contained a single SpaFED cluster, as in L. rhamnosus Lc705, instead of the two Spa clusters (SpaCBA and SpaFED) identified in L. rhamnosus ATCC 53103 (GG). Genomic distance analysis and SNP divergence confirmed a close relationship of the clinical isolates but segregation from the reference

  15. Safety and Reproducibility of a Clinical Trial System Using Induced Blood Stage Plasmodium vivax Infection and Its Potential as a Model to Evaluate Malaria Transmission.

    PubMed

    Griffin, Paul; Pasay, Cielo; Elliott, Suzanne; Sekuloski, Silvana; Sikulu, Maggy; Hugo, Leon; Khoury, David; Cromer, Deborah; Davenport, Miles; Sattabongkot, Jetsumon; Ivinson, Karen; Ockenhouse, Christian; McCarthy, James

    2016-12-01

    Interventions to interrupt transmission of malaria from humans to mosquitoes represent an appealing approach to assist malaria elimination. A limitation has been the lack of systems to test the efficacy of such interventions before proceeding to efficacy trials in the field. We have previously demonstrated the feasibility of induced blood stage malaria (IBSM) infection with Plasmodium vivax. In this study, we report further validation of the IBSM model, and its evaluation for assessment of transmission of P. vivax to Anopheles stephensi mosquitoes. Six healthy subjects (three cohorts, n = 2 per cohort) were infected with P. vivax by inoculation with parasitized erythrocytes. Parasite growth was monitored by quantitative PCR, and gametocytemia by quantitative reverse transcriptase PCR (qRT-PCR) for the mRNA pvs25. Parasite multiplication rate (PMR) and size of inoculum were calculated by linear regression. Mosquito transmission studies were undertaken by direct and membrane feeding assays over 3 days prior to commencement of antimalarial treatment, and midguts of blood fed mosquitoes dissected and checked for presence of oocysts after 7-9 days. The clinical course and parasitemia were consistent across cohorts, with all subjects developing mild to moderate symptoms of malaria. No serious adverse events were reported. Asymptomatic elevated liver function tests were detected in four of six subjects; these resolved without treatment. Direct feeding of mosquitoes was well tolerated. The estimated PMR was 9.9 fold per cycle. Low prevalence of mosquito infection was observed (1.8%; n = 32/1801) from both direct (4.5%; n = 20/411) and membrane (0.9%; n = 12/1360) feeds. The P. vivax IBSM model proved safe and reliable. The clinical course and PMR were reproducible when compared with the previous study using this model. The IBSM model presented in this report shows promise as a system to test transmission-blocking interventions. Further work is required to validate

  16. Comparative proteomic analysis reveals that T3SS, Tfp, and xanthan gum are key factors in initial stages of Citrus sinensis infection by Xanthomonas citri subsp. citri.

    PubMed

    Facincani, Agda P; Moreira, Leandro M; Soares, Márcia R; Ferreira, Cristiano B; Ferreira, Rafael M; Ferro, Maria I T; Ferro, Jesus A; Gozzo, Fabio C; de Oliveira, Julio C F

    2014-03-01

    The bacteria Xanthomonas citri subsp. citri (Xac) is the causal agent of citrus canker. The disease symptoms are characterized by localized host cell hyperplasia followed by tissue necrosis at the infected area. An arsenal of bacterial pathogenicity- and virulence-related proteins is expressed to ensure a successful infection process. At the post-genomic stage of Xac, we used a proteomic approach to analyze the proteins that are displayed differentially over time when the pathogen attacks the host plant. Protein extracts were prepared from infectious Xac grown in inducing medium (XAM1) for 24 h or from host citrus plants for 3 or 5 days after infection, detached times to evaluate the adaptation and virulence of the pathogen. The protein extracts were proteolyzed, and the peptides derived from tryptic digestion were investigated using liquid chromatography and tandem mass spectrometry. Changes in the protein expression profile were compared with the Xac genome and the proteome recently described under non-infectious conditions. An analysis of the proteome of Xac under infectious conditions revealed proteins directly involved in virulence such as the type III secretion system (T3SS) and effector proteins (T3SS-e), the type IV pilus (Tfp), and xanthan gum biosynthesis. Moreover, four new mutants related to proteins detected in the proteome and with different functions exhibited reduced virulence relative to the wild-type proteins. The results of the proteome analysis of infectious Xac define the processes of adaptation to the host and demonstrate the induction of the virulence factors of Xac involved in plant-pathogen interactions.

  17. Outcomes of Critical Limb Ischemia in Hemodialysis Patients After Distal Bypass Surgery - Poor Limb Prognosis With Stage 4 Wound, Ischemia, and Foot Infection (WIfI).

    PubMed

    Hoshina, Katsuyuki; Yamamoto, Kota; Miyata, Tetsuro; Watanabe, Toshiaki

    2016-10-25

    Distal bypass is the first-line treatment for patients with critical limb ischemia (CLI). In Japanese high-volume centers, approximately half of these patients are on hemodialysis (HD). We have treated such patients first with bypass using a multidisciplinary perioperative strategy. We reveal the recent characteristics of patients who underwent distal bypass and the surgical outcomes in Japan, especially focusing on the foot conditions by using the wound, ischemia, and foot infection (WIfI) classification.Methods and Results:The 152 patients underwent distal bypass in a tertiary center hospital, and we compared patients on HD (HD group) to those not on HD (non-HD group). There were significant differences between the 2 groups in the overall survival, major adverse cardiac event-free survival and amputation-free survival (AFS) rates (P<0.0001). The procedural outcomes were analyzed via primary and secondary patency, and there was no difference. In the subanalysis of limb status using WIfI stage, the AFS rate of the HD group was significantly worse than that of the non-HD group for WIfI stage 4 patients. The life and limb prognoses of patients with CLI and HD were worse than those of non-HD patients. There was no difference in surgical outcomes suggested by the graft patency rates between the 2 groups. AFS in WIfI stage 4 was significantly worse in the HD group, which indicated the importance of preoperative limb status. (Circ J 2016; 80: 2382-2387).

  18. Impaired maraviroc and raltegravir clearance in a human immunodeficiency virus-infected patient with end-stage liver disease and renal impairment: a management dilemma.

    PubMed

    Pau, Alice K; Penzak, Scott R; Boyd, Sarita D; McLaughlin, Mary; Morse, Caryn G

    2012-01-01

    Current product labels for maraviroc and raltegravir provide no dosing guidance for patients with end-stage liver disease and worsening renal function. We describe a 41-year-old man with human immunodeficiency virus (HIV) infection and rapidly progressive liver failure and vanishing bile duct syndrome at presentation. Despite discontinuation of all potential offending drugs, the patient's liver function continued to deteriorate. To achieve and maintain HIV suppression while awaiting liver transplantation, a regimen consisting of maraviroc, raltegravir, and enfuvirtide was started. These agents were chosen because the patient was not exposed to them before the onset of liver failure. While receiving product label-recommended twice-daily dosing of these drugs, he achieved and maintained HIV suppression. During a complicated and prolonged hospitalization, the patient also developed renal dysfunction. As hepatic metabolism is the primary route of clearance of maraviroc and raltegravir, we predicted that using approved doses of these drugs could result in significant drug accumulation. Since the safety profiles of supratherapeutic concentrations of these agents are not well defined, we chose to use therapeutic drug monitoring to guide further dosing. The reported concentrations showed severely impaired metabolic clearance of both drugs, with markedly prolonged elimination half-lives of 189 hours for maraviroc and 61 hours for raltegravir. Previously reported half-lives for maraviroc and raltegravir in HIV-infected patients with normal hepatic and renal function are 14-18 hours and 9-12 hours, respectively. Based on these results, the dosing intervals were extended from twice/day to twice/week for maraviroc and every 48 hours for raltegravir. Unfortunately, the patient's clinical condition continued to deteriorate, and he eventually died of complications related to end-stage liver disease. This case illustrates the difficulties in managing antiretroviral therapy in

  19. Liver-inherent immune system: its role in blood-stage malaria.

    PubMed

    Wunderlich, Frank; Al-Quraishy, Saleh; Dkhil, Mohamed A

    2014-01-01

    The liver is well known as that organ which is obligately required for the intrahepatocyte development of the pre-erythrocytic stages of the malaria-causative agent Plasmodium. However, largely neglected is the fact that the liver is also a central player of the host defense against the morbidity- and mortality-causing blood stages of the malaria parasites. Indeed, the liver is equipped with a unique immune system that acts locally, however, with systemic impact. Its main "antipodal" functions are to recognize and to generate effective immunoreactivity against pathogens on the one hand, and to generate tolerance to avoid immunoreactivity with "self" and harmless substances as dietary compounds on the other hand. This review provides an introductory survey of the liver-inherent immune system: its pathogen recognition receptors including Toll-like receptors (TLRs) and its major cell constituents with their different facilities to fight and eliminate pathogens. Then, evidence is presented that the liver is also an essential organ to overcome blood-stage malaria. Finally, we discuss effector responses of the liver-inherent immune system directed against blood-stage malaria: activation of TLRs, acute phase response, phagocytic activity, cytokine-mediated pro- and anti-inflammatory responses, generation of "protective" autoimmunity by extrathymic T cells and B-1 cells, and T cell-mediated repair of liver injuries mainly produced by malaria-induced overreactions of the liver-inherent immune system.

  20. Assessment of the prophylactic activity and pharmacokinetic profile of oral tafenoquine compared to primaquine for inhibition of liver stage malaria infections

    PubMed Central

    2014-01-01

    Background As anti-malarial drug resistance escalates, new safe and effective medications are necessary to prevent and treat malaria infections. The US Army is developing tafenoquine (TQ), an analogue of primaquine (PQ), which is expected to be more effective in preventing malaria in deployed military personnel. Methods To compare the prophylactic efficacy of TQ and PQ, a transgenic Plasmodium berghei parasite expressing the bioluminescent reporter protein luciferase was utilized to visualize and quantify parasite development in C57BL/6 albino mice treated with PQ and TQ in single or multiple regimens using a real-time in vivo imaging system (IVIS). As an additional endpoint, blood stage parasitaemia was monitored by flow cytometry. Comparative pharmacokinetic (PK) and liver distribution studies of oral and intravenous PQ and TQ were also performed. Results Mice treated orally with three doses of TQ at 5 mg/kg three doses of PQ at 25 mg/kg demonstrated no bioluminescence liver signal and no blood stage parasitaemia was observed suggesting both drugs showed 100% causal activity at the doses tested. Single dose oral treatment with 5 mg TQ or 25 mg of PQ, however, yielded different results as only TQ treatment resulted in causal prophylaxis in P. berghei sporozoite-infected mice. TQ is highly effective for causal prophylaxis in mice at a minimal curative single oral dose of 5 mg/kg, which is a five-fold improvement in potency versus PQ. PK studies of the two drugs administered orally to mice showed that the absolute bioavailability of oral TQ was 3.5-fold higher than PQ, and the AUC of oral TQ was 94-fold higher than oral PQ. The elimination half-life of oral TQ in mice was 28 times longer than PQ, and the liver tissue distribution of TQ revealed an AUC that was 188-fold higher than PQ. Conclusions The increased drug exposure levels and longer exposure time of oral TQ in the plasma and livers of mice highlight the lead quality attributes that explain the much

  1. Assessment of the prophylactic activity and pharmacokinetic profile of oral tafenoquine compared to primaquine for inhibition of liver stage malaria infections.

    PubMed

    Li, Qigui; O'Neil, Michael; Xie, Lisa; Caridha, Diana; Zeng, Qiang; Zhang, Jing; Pybus, Brandon; Hickman, Mark; Melendez, Victor

    2014-04-14

    As anti-malarial drug resistance escalates, new safe and effective medications are necessary to prevent and treat malaria infections. The US Army is developing tafenoquine (TQ), an analogue of primaquine (PQ), which is expected to be more effective in preventing malaria in deployed military personnel. To compare the prophylactic efficacy of TQ and PQ, a transgenic Plasmodium berghei parasite expressing the bioluminescent reporter protein luciferase was utilized to visualize and quantify parasite development in C57BL/6 albino mice treated with PQ and TQ in single or multiple regimens using a real-time in vivo imaging system (IVIS). As an additional endpoint, blood stage parasitaemia was monitored by flow cytometry. Comparative pharmacokinetic (PK) and liver distribution studies of oral and intravenous PQ and TQ were also performed. Mice treated orally with three doses of TQ at 5 mg/kg three doses of PQ at 25 mg/kg demonstrated no bioluminescence liver signal and no blood stage parasitaemia was observed suggesting both drugs showed 100% causal activity at the doses tested. Single dose oral treatment with 5 mg TQ or 25 mg of PQ, however, yielded different results as only TQ treatment resulted in causal prophylaxis in P. berghei sporozoite-infected mice. TQ is highly effective for causal prophylaxis in mice at a minimal curative single oral dose of 5 mg/kg, which is a five-fold improvement in potency versus PQ. PK studies of the two drugs administered orally to mice showed that the absolute bioavailability of oral TQ was 3.5-fold higher than PQ, and the AUC of oral TQ was 94-fold higher than oral PQ. The elimination half-life of oral TQ in mice was 28 times longer than PQ, and the liver tissue distribution of TQ revealed an AUC that was 188-fold higher than PQ. The increased drug exposure levels and longer exposure time of oral TQ in the plasma and livers of mice highlight the lead quality attributes that explain the much improved efficacy of TQ when compared to PQ.

  2. Cerebrospinal fluid HIV-1 RNA levels in asymptomatic patients with early stage chronic HIV-1 infection: support for the hypothesis of local virus replication.

    PubMed

    García, F; Niebla, G; Romeu, J; Vidal, C; Plana, M; Ortega, M; Ruiz, L; Gallart, T; Clotet, B; Miró, J M; Pumarola, T; Gatell, J M

    1999-08-20

    To assess HIV-1 RNA levels in cerebrospinal fluid (CSF) and their potential correlation with plasma viral load and central nervous system (CNS) HIV-1 infection markers in stable asymptomatic patients with a CD4 T cell count >500x10(6) cells/l. Consecutive patients screened for two trials were eligible for lumbar puncture assessment. At day 0, simultaneous samples of CSF and plasma were obtained and levels of total proteins, albumin, IgG, antibodies against HIV-1 p24 antigen, HIV-1 RNA (using the polymerase chain technique) and white cells were measured. The integrity of the blood-brain barrier was preserved (albumin index > or =7) in 59 out of 70 patients (84%). Intrathecal production of antibodies against HIV-1 p24 antigen was demonstrated in 55 out of 70 individuals (78%). Viral load in CSF was significantly lower than plasma values (3.13+/-0.95 versus 4.53+/-0.53, P = 0.0001). HIV-1 RNA was not detected in CSF in only three of the 70 patients (4%). Overall, there was a significant correlation between plasma and CSF HIV-1 RNA levels (r = 0.43, P = 0.0001); however, in 29 patients (41%) there were significant differences (>1.5 log10 copies/ml) between the viral loads in plasma and CSF. In the multivariate analysis, a high level of protein and white cells in CSF, but not the HIV-1 RNA plasma level, were factors independently associated with a higher level of HIV-1 RNA in CSF (P = 0.0001). HIV-1 RNA can be detected almost always in CSF of asymptomatic patients in early stages of HIV-1 infection including those with a preserved integrity of the blood-brain barrier. The important discrepancies between plasma and CSF viral load, and the independent association between CSF abnormalities and CSF viral load, support the hypothesis of local production of HIV-1.

  3. Modeling the impact of hepatitis C viral clearance on end-stage liver disease in an HIV co-infected cohort with Targeted Maximum Likelihood Estimation

    PubMed Central

    Schnitzer, Mireille E; Moodie, Erica EM; van der Laan, Mark J; Platt, Robert W; Klein, Marina B

    2013-01-01

    Summary Despite modern effective HIV treatment, hepatitis C virus (HCV) co-infection is associated with a high risk of progression to end-stage liver disease (ESLD) which has emerged as the primary cause of death in this population. Clinical interest lies in determining the impact of clearance of HCV on risk for ESLD. In this case study, we examine whether HCV clearance affects risk of ESLD using data from the multicenter Canadian Co-infection Cohort Study. Complications in this survival analysis arise from the time-dependent nature of the data, the presence of baseline confounders, loss to follow-up, and confounders that change over time, all of which can obscure the causal effect of interest. Additional challenges included non-censoring variable missingness and event sparsity. In order to efficiently estimate the ESLD-free survival probabilities under a specific history of HCV clearance, we demonstrate the doubly-robust and semiparametric efficient method of Targeted Maximum Likelihood Estimation (TMLE). Marginal structural models (MSM) can be used to model the effect of viral clearance (expressed as a hazard ratio) on ESLD-free survival and we demonstrate a way to estimate the parameters of a logistic model for the hazard function with TMLE. We show the theoretical derivation of the efficient influence curves for the parameters of two different MSMs and how they can be used to produce variance approximations for parameter estimates. Finally, the data analysis evaluating the impact of HCV on ESLD was undertaken using multiple imputations to account for the non-monotone missing data. PMID:24571372

  4. Protective immune responses elicited by immunization with a chimeric blood-stage malaria vaccine persist but are not boosted by Plasmodium yoelii challenge infection

    PubMed Central

    Alaro, James R.; Lynch, Michele M.; Burns, James M.

    2010-01-01

    An efficacious malaria vaccine remains elusive despite concerted efforts. Using the Plasmodium yoelii murine model, we previously reported that immunization with the C-terminal 19 kDa domain of merozoite surface protein 1 (MSP119) fused to full-length MSP8 protected against lethal P. yoelii 17XL, well beyond that achieved by single or combined immunizations with the component antigens. Here, we continue the evaluation of the chimeric PyMSP1/8 vaccine. We show that immunization with rPyMSP1/8 vaccine elicited an MSP8-restricted T cell response that was sufficient to provide help for both PyMSP119 and PyMSP8 specific B cells to produce high and sustained levels of protective antibodies. The enhanced efficacy of immunization with rPyMSP1/8, in comparison to a combined formulation of rPyMSP142 and rPyMSP8, was not due to improved conformation of protective B cell epitopes in the chimeric molecule. Unexpectedly, rPyMSP1/8 vaccine-induced antibody responses were not boosted by exposure to P. yoelii 17XL infected RBCs. However, rPyMSP1/8 immunized and infected mice mounted robust responses to a diverse set of blood-stage antigens. The data support the further development of an MSP1/8 chimeric vaccine but also suggest that vaccines that prime for responses to a diverse set of parasite proteins will be required to maximize vaccine efficacy. PMID:20709001

  5. A glass fiber-reinforced composite - bioactive glass cranioplasty implant: A case study of an early development stage implant removed due to a late infection.

    PubMed

    Posti, Jussi P; Piitulainen, Jaakko M; Hupa, Leena; Fagerlund, Susanne; Frantzén, Janek; Aitasalo, Kalle M J; Vuorinen, Ville; Serlo, Willy; Syrjänen, Stina; Vallittu, Pekka K

    2015-03-01

    This case study describes the properties of an early development stage bioactive glass containing fiber-reinforced composite calvarial implant with histology that has been in function for two years and three months. The patient is a 33-year old woman with a history of substance abuse, who sustained a severe traumatic brain injury later unsuccessfully treated with an autologous bone flap and a custom-made porous polyethylene implant. She was thereafter treated with developmental stage glass fiber-reinforced composite - bioactive glass implant. After two years and three months, the implant was removed due to an implant site infection. The implant was analyzed histologically, mechanically, and in terms of chemistry and dissolution of bioactive glass. Mechanical integrity of the load bearing fiber-reinforced composite part of the implant was not affected by the in vivo period. Bioactive glass particles demonstrated surface layers of hydroxyapatite like mineral and dissolution, and related increase of pH was considerably less after two and three months period than that for fresh bioactive glass. There was a difference in the histology of the tissues inside the implant areas near to the margin of the implant that absorbed blood during implant installation surgery, showed fibrous tissue with blood vessels, osteoblasts, collagenous fibers with osteoid formation, and tiny clusters of more mature hard tissue. In the center of the implant, where there was less absorbed blood, only fibrous tissue was observed. This finding is in line with the combined positron emission tomography - computed tomography examination with (18F)-fluoride marker, which demonstrated activity of the mineralizing bone by osteoblasts especially at the area near to the margin of the implant 10 months after implantation. Based on these promising reactions found in the bioactive glass containing fiber-reinforced composite implant that has been implanted for two years and three months, calvarial

  6. A whole parasite vaccine to control the blood stages of Plasmodium: the case for lateral thinking.

    PubMed

    Good, Michael F

    2011-08-01

    Now, 27 years following the cloning of malaria antigens with the promise of the rapid development of a malaria vaccine, we face significant obstacles that are belatedly being addressed. Poor immunogenicity of subunit vaccine antigens and significant antigenic diversity of target epitopes represent major hurdles for which there are no clear strategies for a way forward within the current paradigm. Thus, a different paradigm - a vaccine that uses the whole organism - is now being examined. Although most advances in this approach relate to a vaccine for the pre-erythrocytic stages (sporozoites, liver stages), this opinion paper will outline the possibilities of developing a whole parasite vaccine for the blood stage and address some of the challenges for this strategy, which are entirely different to the challenges for a subunit vaccine. It is the view of the author that both vaccine paradigms should be pursued, but that success will come more quickly using the paranormal approach of exposing individuals to ultra-low doses of whole attenuated or killed parasites.

  7. Single or dual experimental infections with Vibrio aestuarianus and OsHV-1 in diploid and triploid Crassostrea gigas at the spat, juvenile and adult stages.

    PubMed

    Azéma, Patrick; Travers, Marie-Agnès; Benabdelmouna, Abdellah; Dégremont, Lionel

    2016-09-01

    French production of the Pacific cupped oyster, Crassostrea gigas, is currently threatened by two pathogens, OsHV-1 and V. aestuarianus. While oysters selected for their higher resistance to OsHV-1 are now available for the industry, the impact of V. aestuarianus on such oysters is unknown, especially for triploids. In addition, experimental infection has used the virus or the bacteria alone, but there have been no investigations of dual exposure to these pathogens. This study is the first report of single or dual exposure in spat (Spat1 and Spat2), juvenile and adult naïve oysters. For each of the two stocks evaluated, unselected oysters and oysters selected for their higher resistance to OsHV-1 infection were tested, as well as their triploid siblings of the selected oysters produced using cytochalasin B. We confirmed that resistance to OsHV-1 infection and susceptibility to V. aestuarianus increased with age and size, although selected oysters were not significantly impacted by OsHV-1 whatever their ploidy, size or age. We found different mortality patterns depending on the pathogen tested. The mortality pattern was similar for oysters exposed to OsHV-1 or to both pathogens in the Spat1 trial (4months old and 1.9g). The mortality pattern was similar for oysters exposed to V. aestuarianus or to both pathogens in the Adult trial (25months old and 63.1g). Surprisingly, mortality was much higher (ranging from 75.9% to 100%), in particular for the selected oysters, for the Spat2 (8months old/3.9g) and Juvenile trials (16months old/18.4g) given a dual exposure, regardless of the level of selection for OsHV-1 and the ploidy state. Our findings highlight an important threat for oyster farmers: oysters exposed to both pathogens could experience dramatic mortality rates, even in oysters selected for their higher resistance to OsHV-1. Finally, our study demonstrated for the first time that triploid oysters were more susceptible to experimental challenges with V

  8. Safety and Reproducibility of a Clinical Trial System Using Induced Blood Stage Plasmodium vivax Infection and Its Potential as a Model to Evaluate Malaria Transmission

    PubMed Central

    Elliott, Suzanne; Sekuloski, Silvana; Sikulu, Maggy; Hugo, Leon; Khoury, David; Cromer, Deborah; Davenport, Miles; Sattabongkot, Jetsumon; Ivinson, Karen; Ockenhouse, Christian; McCarthy, James

    2016-01-01

    Background Interventions to interrupt transmission of malaria from humans to mosquitoes represent an appealing approach to assist malaria elimination. A limitation has been the lack of systems to test the efficacy of such interventions before proceeding to efficacy trials in the field. We have previously demonstrated the feasibility of induced blood stage malaria (IBSM) infection with Plasmodium vivax. In this study, we report further validation of the IBSM model, and its evaluation for assessment of transmission of P. vivax to Anopheles stephensi mosquitoes. Methods Six healthy subjects (three cohorts, n = 2 per cohort) were infected with P. vivax by inoculation with parasitized erythrocytes. Parasite growth was monitored by quantitative PCR, and gametocytemia by quantitative reverse transcriptase PCR (qRT-PCR) for the mRNA pvs25. Parasite multiplication rate (PMR) and size of inoculum were calculated by linear regression. Mosquito transmission studies were undertaken by direct and membrane feeding assays over 3 days prior to commencement of antimalarial treatment, and midguts of blood fed mosquitoes dissected and checked for presence of oocysts after 7–9 days. Results The clinical course and parasitemia were consistent across cohorts, with all subjects developing mild to moderate symptoms of malaria. No serious adverse events were reported. Asymptomatic elevated liver function tests were detected in four of six subjects; these resolved without treatment. Direct feeding of mosquitoes was well tolerated. The estimated PMR was 9.9 fold per cycle. Low prevalence of mosquito infection was observed (1.8%; n = 32/1801) from both direct (4.5%; n = 20/411) and membrane (0.9%; n = 12/1360) feeds. Conclusion The P. vivax IBSM model proved safe and reliable. The clinical course and PMR were reproducible when compared with the previous study using this model. The IBSM model presented in this report shows promise as a system to test transmission-blocking interventions

  9. Breadth of humoral response and antigenic targets of sporozoite-inhibitory antibodies associated with sterile protection induced by controlled human malaria infection

    PubMed Central

    Peng, Kaitian; Goh, Yun Shan; Siau, Anthony; Franetich, Jean-François; Chia, Wan Ni; Ong, Alice Soh Meoy; Malleret, Benoit; Wu, Ying Ying; Snounou, Georges; Hermsen, Cornelus C.; Adams, John H.; Mazier, Dominique; Preiser, Peter R.; Sauerwein, Robert W.; Grüner, Anne-Charlotte; Rénia, Laurent

    2017-01-01

    The development of an effective malaria vaccine has remained elusive even until today. This is due to our incomplete understanding of the immune mechanisms that confer and/or correlate with protection. Human volunteers have been protected experimentally from a subsequent challenge by immunization with Plasmodium falciparum sporozoites under drug cover. Here, we demonstrate that sera from the protected individuals contain neutralizing antibodies against the pre erythrocytic stage. To identify the antigen(s) recognized by these antibodies, a newly developed library of P. falciparum antigens was screened with the neutralizing sera. Antibodies from protected individuals recognized a broad antigenic repertoire of which three antigens, PfMAEBL, PfTRAP and PfSEA1 were recognized by most protected individuals. As a proof of principle, we demonstrated that anti-PfMAEBL antibodies block liver stage development in human hepatocytes. Thus, these antigens identified are promising targets for vaccine development against malaria. PMID:27130708

  10. Evaluation of viral load thresholds for predicting new WHO Stage 3 and 4 events in HIV-infected children receiving highly active antiretroviral therapy

    PubMed Central

    Siberry, George K; Harris, D. Robert; Oliveira, Ricardo Hugo; Krauss, Margot R.; Hofer, Cristina B.; Tiraboschi, Adriana Aparecida; Marques, Heloisa; Succi, Regina C.; Abreu, Thalita; Negra, Marinella Della; Mofenson, Lynne M.; Hazra, Rohan

    2012-01-01

    Background This study evaluated a wide range of viral load (VL) thresholds to identify a cut-point that best predicts new clinical events in children on stable highly-active antiretroviral therapy (HAART). Methods Cox proportional hazards modeling was used to assess the adjusted risk of World Health Organization stage 3 or 4 clinical events (WHO events) as a function of time-varying CD4, VL, and hemoglobin values in a cohort study of Latin American children on HAART ≥ 6 months. Models were fit using different VL cut-points between 400 and 50,000 copies/mL, with model fit evaluated on the basis of the minimum Akaike Information Criterion (AIC) value, a standard model fit statistic. Results Models were based on 67 subjects with WHO events out of 550 subjects on study. The VL cutpoints of > 2600 copies/mL and > 32,000 copies/mL corresponded to the lowest AIC values and were associated with the highest hazard ratios [2.0 (p = 0.015) and 2.1 (p = 0.0058), respectively] for WHO events. Conclusions In HIV-infected Latin American children on stable HAART, two distinct VL thresholds (> 2,600 copies/mL and > 32,000 copies/mL) were identified for predicting children at significantly increased risk of HIV-related clinical illness, after accounting for CD4 level, hemoglobin level, and other significant factors. PMID:22343177

  11. Infection control measures on ships and in ports during the early stage of pandemic influenza A (H1N1) 2009.

    PubMed

    Schlaich, Clara; Gau, Bettina; Cohen, Nicole J; Kojima, Kazunobu; Marano, Nina; Menucci, Daniel

    2012-01-01

    Shipping companies were surveyed to evaluate the effect of public health measures during the influenza A (H1N1) pandemic of 2009 on ship and port operations. Of 31 companies that operated 960 cruise, cargo, and other ships, 32% experienced health-screening measures by port health authorities. Approximately a quarter of ports (26%) performed screening at embarkation and 77% of shipping companies changed procedures during the early stage of the pandemic. Four companies reported outbreaks of pandemic influenza A (H1N1) 2009 on ships, which were ultimately stopped through infection control practices. Public health measures did not interfere substantially with port and ship operations with the exception of some port authorities that delayed embarking and disembarking procedures in a few ships. However, in the shipping companies' experience, measures were inconsistent between port health authorities. Access to antiviral drugs and pandemic vaccine was not provided in all ports. Current guidelines on medical care, hygiene, and emergency procedures on ships need to address pandemic influenza preparedness in future revisions.

  12. Evaluation of viral load thresholds for predicting new World Health Organization stage 3 and 4 events in HIV-infected children receiving highly active antiretroviral therapy.

    PubMed

    Siberry, George K; Harris, D Robert; Oliveira, Ricardo Hugo; Krauss, Margot R; Hofer, Cristina B; Tiraboschi, Adriana Aparecida; Marques, Heloisa; Succi, Regina C; Abreu, Thalita; Della Negra, Marinella; Mofenson, Lynne M; Hazra, Rohan

    2012-06-01

    This study evaluated a wide range of viral load (VL) thresholds to identify a cut-point that best predicts new clinical events in children on stable highly active antiretroviral therapy (HAART). Cox proportional hazards modeling was used to assess the adjusted risk for World Health Organization stage 3 or 4 clinical events (WHO events) as a function of time-varying CD4, VL, and hemoglobin values in a cohort study of Latin American children on HAART ≥6 months. Models were fit using different VL cut-points between 400 and 50,000 copies per milliliter, with model fit evaluated on the basis of the minimum Akaike information criterion value, a standard model fit statistic. Models were based on 67 subjects with WHO events out of 550 subjects on study. The VL cut-points of >2600 and >32,000 copies per milliliter corresponded to the lowest Akaike information criterion values and were associated with the highest hazard ratios (2.0, P = 0.015; and 2.1, P = 0.0058, respectively) for WHO events. In HIV-infected Latin American children on stable HAART, 2 distinct VL thresholds (>2600 and >32,000 copies/mL) were identified for predicting children at significantly increased risk for HIV-related clinical illness, after accounting for CD4 level, hemoglobin level, and other significant factors.

  13. Hierarchical Cluster Analysis of Three-Dimensional Reconstructions of Unbiased Sampled Microglia Shows not Continuous Morphological Changes from Stage 1 to 2 after Multiple Dengue Infections in Callithrix penicillata

    PubMed Central

    Diniz, Daniel G.; Silva, Geane O.; Naves, Thaís B.; Fernandes, Taiany N.; Araújo, Sanderson C.; Diniz, José A. P.; de Farias, Luis H. S.; Sosthenes, Marcia C. K.; Diniz, Cristovam G.; Anthony, Daniel C.; da Costa Vasconcelos, Pedro F.; Picanço Diniz, Cristovam W.

    2016-01-01

    It is known that microglial morphology and function are related, but few studies have explored the subtleties of microglial morphological changes in response to specific pathogens. In the present report we quantitated microglia morphological changes in a monkey model of dengue disease with virus CNS invasion. To mimic multiple infections that usually occur in endemic areas, where higher dengue infection incidence and abundant mosquito vectors carrying different serotypes coexist, subjects received once a week subcutaneous injections of DENV3 (genotype III)-infected culture supernatant followed 24 h later by an injection of anti-DENV2 antibody. Control animals received either weekly anti-DENV2 antibodies, or no injections. Brain sections were immunolabeled for DENV3 antigens and IBA-1. Random and systematic microglial samples were taken from the polymorphic layer of dentate gyrus for 3-D reconstructions, where we found intense immunostaining for TNFα and DENV3 virus antigens. We submitted all bi- or multimodal morphological parameters of microglia to hierarchical cluster analysis and found two major morphological phenotypes designated types I and II. Compared to type I (stage 1), type II microglia were more complex; displaying higher number of nodes, processes and trees and larger surface area and volumes (stage 2). Type II microglia were found only in infected monkeys, whereas type I microglia was found in both control and infected subjects. Hierarchical cluster analysis of morphological parameters of 3-D reconstructions of random and systematic selected samples in control and ADE dengue infected monkeys suggests that microglia morphological changes from stage 1 to stage 2 may not be continuous. PMID:27047345

  14. The Threshold of Protection from Liver-Stage Malaria Relies on a Fine Balance between the Number of Infected Hepatocytes and Effector CD8+ T Cells Present in the Liver

    PubMed Central

    Longley, Rhea J.; Gola, Anita; Ulaszewska, Marta; Lambe, Teresa; Hill, Adrian V. S.

    2017-01-01

    Since the demonstration of sterile protection afforded by injection of irradiated sporozoites, CD8+ T cells have been shown to play a significant role in protection from liver-stage malaria. This is, however, dependent on the presence of an extremely high number of circulating effector cells, thought to be necessary to scan, locate, and kill infected hepatocytes in the short time that parasites are present in the liver. We used an adoptive transfer model to elucidate the kinetics of the effector CD8+ T cell response in the liver following Plasmodium berghei sporozoite challenge. Although effector CD8+ T cells require <24 h to find, locate, and kill infected hepatocytes, active migration of Ag-specific CD8+ T cells into the liver was not observed during the 2-d liver stage of infection, as divided cells were only detected from day 3 postchallenge. However, the percentage of donor cells recruited into division was shown to indicate the level of Ag presentation from infected hepatocytes. By titrating the number of transferred Ag-specific effector CD8+ T cells and sporozoites, we demonstrate that achieving protection toward liver-stage malaria is reliant on CD8+ T cells being able to locate infected hepatocytes, resulting in a protection threshold dependent on a fine balance between the number of infected hepatocytes and CD8+ T cells present in the liver. With such a fine balance determining protection, achieving a high number of CD8+ T cells will be critical to the success of a cell-mediated vaccine against liver-stage malaria. PMID:28087668

  15. Assessment of Humoral Immune Responses to Blood-Stage Malaria Antigens following ChAd63-MVA Immunization, Controlled Human Malaria Infection and Natural Exposure

    PubMed Central

    Elias, Sean C.; Miura, Kazutoyo; Milne, Kathryn H.; de Cassan, Simone C.; Collins, Katharine A.; Halstead, Fenella D.; Bliss, Carly M.; Ewer, Katie J.; Osier, Faith H.; Hodgson, Susanne H.; Duncan, Christopher J. A.; O’Hara, Geraldine A.; Long, Carole A.; Hill, Adrian V. S.; Draper, Simon J.

    2014-01-01

    The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite – MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors – ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI) with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i) ChAd63-MVA immunization, ii) immunization and CHMI, and iii) primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i) total IgG responses before and after CHMI, ii) responses to allelic variants of MSP1 and AMA1, iii) functional growth inhibitory activity (GIA), iv) IgG avidity, and v) isotype responses (IgG1-4, IgA and IgM). These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other

  16. Assessment of humoral immune responses to blood-stage malaria antigens following ChAd63-MVA immunization, controlled human malaria infection and natural exposure.

    PubMed

    Biswas, Sumi; Choudhary, Prateek; Elias, Sean C; Miura, Kazutoyo; Milne, Kathryn H; de Cassan, Simone C; Collins, Katharine A; Halstead, Fenella D; Bliss, Carly M; Ewer, Katie J; Osier, Faith H; Hodgson, Susanne H; Duncan, Christopher J A; O'Hara, Geraldine A; Long, Carole A; Hill, Adrian V S; Draper, Simon J

    2014-01-01

    The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite--MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors--ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI) with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i) ChAd63-MVA immunization, ii) immunization and CHMI, and iii) primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i) total IgG responses before and after CHMI, ii) responses to allelic variants of MSP1 and AMA1, iii) functional growth inhibitory activity (GIA), iv) IgG avidity, and v) isotype responses (IgG1-4, IgA and IgM). These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other diseases

  17. Assessment of immune interference, antagonism, and diversion following human immunization with biallelic blood-stage malaria viral-vectored vaccines and controlled malaria infection.

    PubMed

    Elias, Sean C; Collins, Katharine A; Halstead, Fenella D; Choudhary, Prateek; Bliss, Carly M; Ewer, Katie J; Sheehy, Susanne H; Duncan, Christopher J A; Biswas, Sumi; Hill, Adrian V S; Draper, Simon J

    2013-02-01

    Overcoming antigenic variation is one of the major challenges in the development of an effective vaccine against Plasmodium falciparum, a causative agent of human malaria. Inclusion of multiple Ag variants in subunit vaccine candidates is one strategy that has aimed to overcome this problem for the leading blood-stage malaria vaccine targets, that is, merozoite surface protein 1 (MSP1) and apical membrane Ag 1 (AMA1). However, previous studies, utilizing malaria Ags, have concluded that inclusion of multiple allelic variants, encoding altered peptide ligands, in such a vaccine may be detrimental to both the priming and in vivo restimulation of Ag-experienced T cells. In this study, we analyze the T cell responses to two alleles of MSP1 and AMA1 induced by vaccination of malaria-naive adult volunteers with bivalent viral-vectored vaccine candidates. We show a significant bias to the 3D7/MAD20 allele compared with the Wellcome allele for the 33 kDa region of MSP1, but not for the 19 kDa fragment or the AMA1 Ag. Although this bias could be caused by "immune interference" at priming, the data do not support a significant role for "immune antagonism" during memory T cell restimulation, despite observation of the latter at a minimal epitope level in vitro. A lack of class I HLA epitopes in the Wellcome allele that are recognized by vaccinated volunteers may in fact contribute to the observed bias. We also show that controlled infection with 3D7 strain P. falciparum parasites neither boosts existing 3D7-specific T cell responses nor appears to "immune divert" cellular responses toward the Wellcome allele.

  18. Nitric Oxide is Involved in the Upregulation of IFN-γ and IL-10 mRNA Expression by CD8+ T Cells During the Blood Stages of P. chabaudi AS Infection in CBA/Ca Mice

    PubMed Central

    Legorreta-Herrera, M; Rivas-Contreras, S; Ventura-Gallegos, JL; Zentella-Dehesa, A

    2011-01-01

    Nitric oxide (NO) is involved in the clearance of several types of bacteria, viruses and parasites. Although the roles of NO and CD8+ T cells in the immune response to malaria have been extensively studied, their actual contributions during the blood stages of malaria infection remain unclear. In this work, we corroborate that serum NO levels are not associated with the in vivo elimination of the blood stages of Plasmodium chabaudi AS. In addition, we show that CD8+ T cells exhibit increased apoptosis and up regulate the expression of TNF-α mRNA on day 4 post-infection and IFN-γ and IL-10 mRNA on day 11 post-infection. Interestingly, only the levels of IFN-γ and IL-10 expression are affected when iNOS is inhibited with aminoguanidine (AG), suggesting that NO could be involved in the activation of CD8+ T cells during the blood stages of plasmodium infection. PMID:22110391

  19. Infection and Other Complications

    MedlinePlus

    ... is Lymphedema? What Causes Lymphedema What is the Lymphatic System? Signs and Symptoms Stage 0 Stage 1 Stage ... is Lymphedema? What Causes Lymphedema What is the Lymphatic System? Signs and Symptoms Infection and Other Complications NLN ...

  20. Infection and Other Complications

    MedlinePlus

    ... is Lymphedema? What Causes Lymphedema What is the Lymphatic System? Signs and Symptoms Stage 0 Stage 1 Stage ... is Lymphedema? What Causes Lymphedema What is the Lymphatic System? Signs and Symptoms Infection and Other Complications NLN ...